Yeast promoter and use thereof

- Rhone-Poulenc Rorer S.A.

The present invention concerns DNA sequences from the K. lactis PGK gene having transcriptional promoter activity, to expression vectors comprising these sequences and to their use for the production of proteins.

Skip to: Description  ·  Claims  ·  References Cited  · Patent History  ·  Patent History
Description

The present invention relates to the field of molecular biology. More particularly, it relates to a novel DNA sequence having a transcriptional promoter activity, to expression vectors containing this sequence and to the use thereof for the production of proteins, for example heterologous proteins. The invention also relates to recombinant cells containing this DNA sequence.

The progress accomplished in the field of molecular biology has enabled microorganisms to be modified in order to make them produce heterologous proteins. In particular, many genetic studies have been carried out on the bacterium E. coli. However, the industrial application of these novel modes of production is still limited, in particular by problems of efficiency of gene expression in these recombinant microorganisms. Accordingly, research studies have been carried out with the aim of increasing the efficiency of these production systems in order to isolate strong promoters enabling high levels of expression of heterologous proteins to be obtained. In E. coli, the tryptophan operon and the lactose operon promoters may be mentioned in particular.

More recently, in the yeast S. cerevisiae, studies have been carried out on promoters derived from genes involved in glycolysis. There may be mentioned in particular the work on the promoter of the 3-phosphoglycerate kinase PGK gene (Dobson et al., Nucleic Acids Res. 10:2625, 1982; Hitzeman et al., Nucleic Acids Research 10:7791, 1982), the glyceraldehyde-3-phosphate dehydrogenase GAPDH gene (Holland et al., J. Biol. Chem. 254:9839, 1979; Musti et al., Gene 25:133, 1983), the alcohol dehydrogenase 1 ADH1 gene (Bennentzen et al., J. Biol. Chem. 257:3018, 1982; Denis et al., J. Biol. Chem. 25:1165, 1983), and the enolase 1 ENO1 gene (Uemura et al., Gene 45:65, 1986).

Recently, genetic tools have been developed in order to make use of the yeast Kluyveromyces as a host cell for the production of recombinant proteins. The discovery of a 2-micron type plasmid derived from K. drosophilarum (plasmid pKD1; described in European Patent No. 241,435) has enabled a very efficient host/vector system for the production of recombinant proteins (EP 361,991) to be established. However, the promoters used in this system have never been optimized. In particular, the promoters involved are essentially heterologous promoters, that is to say derived from other microorganisms, such as S. cerevisiae. This situation may lead to various disadvantages. The activity of the promoter may be limited because of the absence of certain elements of the transcriptional machinery (for example, trans-activators). A certain toxicity to the host cell may occur due to an absence of regulation, or the stability of the vector may be affected.

Under these conditions, the lack of strong homologous promoters in Kluyveromyces constitutes a limiting factor in the industrial exploitation of this expression system.

The Applicant has now identified, cloned and sequenced a region of the Kluyveromyces lactis genome having transcriptional promoter activity (see FIG. 1 [SEQ ID NO: 1]). More specifically, this region corresponds to the promoter of the K. lactis PGK gene. This region, or derivatives or fragments thereof, may be used for the efficient production of recombinant proteins in yeasts of the Kluyveromyces genus. It is understood that this sequence may also be used in other host organisms.

Moreover, an analysis of the region of the Kluyveromyces genome obtained has identified two reading frames in the two opposite directions (see FIG. 2). This observation shows that the complementary strand of the region presented in FIG. 1 also possesses a promoter activity acting in the other direction.

One subject of the present invention therefore lies in a DNA sequence comprising all or part of the sequence presented in FIG. 1 [SEQ ID NO: 1], or a sequence of its complementary strand, or of a derivative of these, and possessing promoter activity.

Within the context of the present invention, derivative is understood to mean any sequence obtained from the sequence given in FIG. 1 [SEQ ID NO: 1], by structural modifications (mutations, deletions, substitutions, additions, restrictions and the like) which conserve promoter activity. In particular, the mutations may involve one or more nucleotides, and the additions and/or substitutions may involve regulatory elements or activator regions such as UASs.

When a derivative is produced, its transcriptional promoter activity may be demonstrated in several ways and in particular by placing a resistance gene or a complementation marker under the control of the sequence studied. Other techniques known to a person skilled in the art may obviously be used to this effect.

A more specific subject of the invention relates to a DNA sequence corresponding to the region between the 2 open reading frames ORF PGK and ORF X, as presented in FIG. 6 [SEQ ID NO: 2].

Another subject of the invention relates to a recombinant DNA comprising a DNA sequence as defined above.

This recombinant DNA may contain, for example, the promoter sequence presented in FIG. 1 [SEQ ID NO: 1] or a derivative thereof, in which a restriction site is inserted, facilitating the use of this sequence as "portable" promoter.

Preferably, this recombinant DNA contains, in addition, one or more structural genes.

Still more preferably, the recombinant DNA also contains signals permitting the secretion of the expression product of said structural gene(s).

In a specific embodiment of the invention, the recombinant DNA is part of an expression plasmid which may be autonomously replicating or integrative in nature.

In particular, autonomously replicating vectors may be obtained by using autonomously replicating sequences (ARS) in the host selected. In yeast in particular, replication origins derived from known plasmids (pKD1, 2.mu., and the like) may be involved.

Integrative vectors may be obtained in particular by using homologous sequences at certain regions of the host genome which permit integration of the vector by homologous recombination.

The sequence presented in FIG. 1 was obtained by screening a total genomic DNA library from Kluyveromyces lactis by means of a heterologous probe derived from the S. cerevisiae PGK gene. The Applicant has indeed shown that it is possible to clone a promoter region in Kluyveromyces, by hybridization using heterologous probes corresponding to a S. cerevisiae gene. Details of the cloning of the sequence are given in the examples. The intergenic region may then be isolated from this sequence, in particular by restriction site insertion using the PCR amplification technique, as indicated in the examples.

Another subject of the invention relates to the recombinant cells which contain a DNA sequence as defined above.

Advantageously, cells are chosen from yeasts, and still more preferably from yeasts of the Kluyveromyces genus. It is understood, however, that the invention covers all the recombinant cells in which the promoter regions of the invention are active.

These cells may be obtained by any method enabling a foreign DNA to be introduced into a cell. The methods involved may be in particular transformation, electroporation or any other technique known to a person skilled in the art.

Another subject of the invention relates to the use of a sequence as defined above, for the expression of recombinant genes.

As illustrated by the examples, the DNA sequences according to the invention indeed permit high levels of production of recombinant proteins.

Moreover, the bi-directional promoter activity of the sequences of the invention permits a particularly advantageous use. In particular, it is possible to use these sequences in the 2 directions possible, for the simultaneous expression of several structural genes.

Advantageously, the invention relates to the use of a sequence as defined above for the simultaneous expression of recombinant genes in the 2 opposite directions.

Advantageously, the sequences of the invention may be used for the expression of genes encoding proteins of interest in the pharmaceutical or foodstuffs sectors. By way of example, there may be mentioned enzymes (such as in particular superoxide dismutase, catalase, amylases, lipases, amidases, chymosin and the like), blood derivatives (such as serum albumin, alpha- or beta-globin, factor VIII, factor IX, von Willebrand factor, fibronectin, alpha-1-antitrypsin and the like), insulin and its variants, lymphokines (such as interleukins, interferons, colony stimulating factors (G--CSF, GM--CSF, M--CSF and the like), TNF, TRF and the like), growth factors (such as growth hormones, erythropoietin, FGF, EGF, PDGF, TGF and the like), apolipoproteins, antigenic polypeptides for the production of vaccines (hepatitis, cytomegalovirus, Epstein-Barr, herpes and the like) or alternatively polypeptide fusions such as in particular fusions comprising an active part fused with a stabilizing part (for example fusions between albumin or fragments of albumin and the virus receptor or part of a virus receptor (CD4, and the like)).

The invention will be more completely described by means of the examples which should be considered as illustrative and nonlimiting. Other and further objects, features, and advantages will be apparent from the following description of the preferred embodiments of the invention given for the purpose of disclosure when taken in conjunction with the following drawings.

BRIEF DESCRIPTION OF THE FIGURES

FIG. 1: Nucleotide sequence of the 2.2 kb region of the chromosomal fragment situated upstream of the initiation codon for translation of the K. lactis PGK gene having the promoter activity [SEQ ID NO: 1].

FIG. 2: Analysis of the open reading frames. The 6 possible reading frames are shown ad -3, -2, -1, 1, 2, 3. The vertical half-lines represent translation initiation codons. The full vertical lines represent stop codons. The clear regions show the open reading frames (ORF X and ORF PGK).

FIG. 3: Restriction map of the plasmid pYG610. The black region corresponds to the region isolated from the K. lactis genome.

FIG. 4: Strategy for sequencing the 2.5 kb XbaI fragment.

FIG. 5: Sequence and location of the oligodeoxynucleotides used in the PCR reaction for inserting a HindIII site at position -6 with respect to the ATG of the sequence in FIG. 1. The oligodeoxynucleotides are represented in italics [SEQ ID NOS: 3 and 4]. ATG corresponds to the initiation codon for translation of the PGK gene.

FIG. 6: Nucleotide sequence of the intergenic region of the 2.2 kb fragment. 6(a): oligodeoxynucleotides used in the PCR reactions [SEQ ID NOS: 5-8]. 6(b): SaII--HindIII fragment corresponding to the nucleotides 1343 to 2246 on the sequence in FIG. 1 [SEQ ID NO: 2].

FIG. 7: Strategy for the construction of the plasmid pYG45.

FIG. 8: Strategy for the construction of human serum albumin expression cassettes.

FIG. 9: Strategy for the construction of the plasmid pYG65.

FIG. 10: Strategy for the construction of the plasmid pYG70.

FIG. 11: Strategy for the construction of the plasmid pYG72.

FIG. 12: Strategy for the construction of the vector pYG621.

FIG. 13: Visualization, by Northern blotting, of the expression of the human albumin gene under the control of the K. lactis PGK promoter. The samples correspond to 10 .mu.g of total RNA. 18S and 28S are the positions of the 18S and 28S ribosomal RNAs. ALB=fragments recognized by the probe corresponding to the albumin gene; URA=fragments recognized by the probe corresponding to the K. lactis URA A gene serving as loading reference.

FIG. 14: Visualization of albumin production in strains transformed by the expression vector pYG621 containing the K. lactis PGK promoter. The samples correspond to 30 .mu.l of culture supernatant; the bands at the position of the 66 kd marker correspond to albumin. M=molecular weight markers: bovine carbonic anhydrase (31 kd), ovalbumin (45 kd), BSA (66 kd), rabbit phosphorylase b (92 kd).

EXAMPLES

The following examples describe the isolation and use of the promoter of the present invention and are not intended to be limiting unless so expressly stated.

Example 1 Isolation of the Promoter Region of the K. lactis PGK Gene

The sequence presented in FIG. 1 was obtained by screening a total genomic DNA library from Kluyveromyces lactis CBS2359 using a heterologous probe derived from the S. Cerevisiae PGK gene (Dobson et al., Nucleic Acids Res. 10:2625, 1982). More specifically, the probe used corresponds to the 1.3 kb N-terminal PvuI-EcoRI fragment of the S. Cerevisiae PGK gene.

In Southern blotting (Southern et al., J. Biol. Chem. 98:503, 1975), the probe used hybridizes to two different fragments when the genomic DNA is digested with XbaI. One fragment, of about 2.5 kb, was isolated by screening a small genomic library from K. lactis CBS2359 consisting of XbaI-cut DNA fragments of between 2 and 3 kb in size, which were introduced inside the plasmid pUC18 at the XbaI site. A library with 500 clones was thus produced and then screened with the heterologous probe described above.

A clone was identified by colony hybridization and its plasmid DNA was prepared. This plasmid (pYG610) contains a 2.5 kb genomic DNA fragment whose restriction map is presented in FIG. 3. The plasmid pYG611 contains the same insert in the opposite direction (see FIG. 8).

In a second stage, the 2.5 kb fragment thus isolated was sequenced using the Sanger method (Sanger et al., Proc. Nat. Acad. Sci USA 74:5463, 1977). For that, the fragment derived from pYG611 was first subcloned in the bacteriophages M13tg130 and M13tg131. The strategy for the sequencing of the fragment is schematically represented in FIG. 4.

Analysis of the sequence obtained showed that the fragment isolated contains a part encoding the N-terminal region of the protein PGK from Kluyveromyces lactis (0.3 kb), and 2.2 kb corresponding to the promoter region situated upstream of the site of initiation of translation. It shows furthermore that a second reading frame, situated about 0.9 kb upstream of the ATG of the PGK gene, is situated in the opposite direction relative to the PGK gene (FIG. 2).

Comparison of this sequence with that of the promoter of the S. Cerevisiae PGK gene reveals the absence of specific homology, especially with its regulatory element. This sequence therefore corresponds to a completely novel promoter region, which is very distinct from those previously described, from the point of view of its structure and consequently from the point of view of its regulation.

Example 2 Construction of Expression Vectors for the Production of Heterologous Proteins

This example illustrates the use of the promoter capabilities of the 2.2 kb sequence of the sequence in FIG. 1 [SEQ ID NO: 1] and of derived sequences.

a) Insertion of a restriction site at position -6 relative to the ATG

The insertion of this site subsequently enables any gene which is to be expressed to be introduced downstream of the promoter. For reasons of compatibility with existing expression vectors (EP 361,991 ), "portable" promoters were constructed in the form of SaII--HindIII fragments.

A HindIII site was introduced at position -6 relative to the site of initiation of translation (ATG) of the PGK gene using the PCR amplification technique (Mullis et al., Meth. Enzymol. 155:335, 1987), Two oligodeoxynucleotides, which are presented in FIG. 5 [SEQ ID NOS: 3 and 4], were used for this purpose.

The oligodeoxynucleotide A [SEQ ID NO: 3] corresponds to the sequence situated at 467 bp upstream of the ATG codon, at a HindIII site which is replaced by a SaII site during the amplification. The oligodeoxynucleotide B [SEQ ID NO: 4] corresponds to the sequence upstream of the initiation site, and enables a HindIII site to be introduced at position -6.

The fragment obtained by PCR was inserted between the SaII and HindIII sites of the bacteriophage M13tg130 in order to verify, by sequencing, that mutations did not occur during the amplification.

b) Construction of human serum albumin expression cassettes: FIG. 8

The 474 bp recombinant DNA obtained above was introduced into the SaII and HindIII sites of the plasmid pYG45 (FIG. 7), in order to obtain the vector pYG614 (FIG. 8). The plasmid pYG45 contains an expression cassette consisting of the promoter and the terminator of the S. cerevisiae PGK gene between which the prepro-human serum albumin encoding gene (prepro-HSA sequence) is inserted into a HindIII site. pYG45 is derived from pYG18 (see Patent EP 361,991) by subcloning the SaII--BamHI fragment containing the HSA expression cassette into the corresponding sites of the vector pIC-20RDH (FIG. 7). pIC-2ORDH is obtained by digesting the plasmid pIC-20R (March et al., Gene 32:481, 1984) with the enzyme HindIII, filling the ends using the Klenow fragment of E. Coli polymerase I and recircularization with T4 DNA ligase.

The SaII--SacI fragment may be isolated from the plasmid pYG614 by digestion. It contains: a promoter region derived from the sequence in FIG. 1, the albumin gene and the terminator of the S. cerevisiae PGK gene. It constitutes an expression cassette which may be inserted inside a plasmid so as to constitute an expression vector.

Another expression cassette may be obtained from the plasmid pYG614 by cloning the AfIII--SacI fragment containing part of the PGK promoter of the invention, the albumin gene (prepro-HSA) and the S. cerevisiae PGK terminator inside the plasmid pYG611 described above. This generates the plasmid pYG615. The SaII--SacI fragment (containing the complete promoter region of FIG. 1, the prepro-serum albumin-encoding gene, and the terminator of the S. cerevisiae PGK gene) may then be isolated by digestion. This fragment constitutes a second albumin expression cassette using the promoter sequence of the invention.

c) Construction of albumin expression vectors

Albumin expression vectors may be constructed by inserting the expression cassettes obtained above inside K. lactis/E. coli shuttle plasmids such as pYG72 (FIG. 10). In particular, an expression vector was obtained (vector pYG621) by inserting the SaII--SacI fragment from pYG615, containing the albumin expression cassette, inside the vector pYG72 (see FIG. 10). This vector corresponds to the plasmid pKan 707 (see EP 361,991 ) from which the SacI fragment, containing the URA3 gene, has been removed, as well as the unique HindIII site present in the aph gene, so as to facilitate subsequent constructions. The aph gene encodes aminoglycoside 3'-phosphotransferase I (Oka et al., J. Mol. Biol. 147:217, 1981) and is used in yeast as a marker for resistance to G418. The PstI fragment of the plasmid pKan 707, containing the aph gene, was subcloned into the bacteriophage M13mp7 to give the vector pYG64 (FIG. 9). The HindIII site present in this gene was destroyed by site-directed mutagenesis according to the method described by Taylor et al., (Nucleic Acid Res. 13:8749, 1985). The resulting plasmid was called pYG65 (FIG. 9). The oligodeoxynucleotide used for the mutagenesis had the sequence 5'-GAA ATG CAT AAG CTC TTG CCA TTC TCA CCG-3'[SEQ ID NO: 9] and transformed the triplet CTT encoding the amino acid 185 (Leu) to CTC. This change does not modify the resulting protein sequence. To construct the plasmid pYG72, the part containing the bacterial replicon of the vector pKan 707 was isolated by digestion with the enzyme EcoRI and recircularization with T4 DNA ligase so as to obtain pYG69. The PstI fragment present in this latter vector, containing the aph gene, was replaced by the equivalent mutant fragment derived from pYG65. This construct was called pYG70. The 4.7 kb pKDI sequence between the EcoRI and SacI sites was introduced inside this latter vector so as to obtain pYG72. The vector pYG621 (FIG. 11) was obtained by insertion of the SaII--SacI fragment containing the albumin expression cassette derived from pYG615.

Example 3 Construction of a Cassette Enabling the Promoter Region to be Used in the 2 Directions

This construct was obtained by introducing a SaII site and a HindIII site on either side of the region between the two open reading frames identified in FIG. 2: ORF PGK and ORF X, that is, at nucleotides 1343 and 2246 in FIG. 1.

This construct was produced by the PCR technique using oligodeoxynucleotide A [SEQ ID NO: 5], which introduces a SaII site in the -1 position relative to the site of initiation of translation of the PGK gene, and oligodeoxynucleotide B [SEQ ID NO: 6], which introduces a HindIII site in the -1 position relative to the site of initiation of translation of the X gene (see FIG. 6(a)). Three PCR reactions were carried out using the plasmid pYG610 as the template, so as to remove a HindIII site present in the promoter region:

The first 2 PCRs amplified the regions on either side of the HindIII site using the oligodeoxynucleotides A and B [SEQ ID NOS: 5 and 6] coupled to oligodeoxynucleotides C [SEQ ID NO: 7] and D [SEQ ID NO: 8] respectively (FIG. 6). Oligodeoxynucleotides C and D are complementary and enable a point mutation to be introduced at the level of the inner hindIII site.

The last PCR generated the final fragment, containing the modified promoter region, using the previous 2 amplification products as primer.

This region is then introduced into the vectors described in Example 2, and used as a bi-directional promoter.

Example 4 Expression of Albumin

The vector pYG621 was introduced, by transformation, into the K. lactis strain MW98-8C (CBS 579.88), using the ethylene glycol/dimethyl sulphoxide technique (Durrens et al. Curr. Genet. 18:7, 1990). This strain is derived from the wild strain CBS2359 and is of the genotype: Mat .alpha., uraA, lysA, argA, R+, cir. The transformant yeast are selected for the G418-resistant phenotype, which the plasmid pYG621 confers, using YPD media (10 g/l yeast extract, 20 g/l peptone, 20 g/l glucose) containing 0.2 g/l of geneticin. Plasmid pYG72-transformed strains not containing an expression cassette were selected to serve as controls in the production tests. Moreover, vector pYG19-transformed strains were also selected in order to compare the efficiency of the K. lactis PGK promoter according to the invention with that from S. cerevisiae. The vector pYG19 is similar to the vector pYG621 except that the albumin gene is under the control of the S. cerevisiae PGK promoter (EP 361,991).

a) Analysis of the mRNAs

The cells were cultured at 28.degree. C. in selective YPD media containing 0.2 g/l of geneticin. The total RNAs were extracted (Sherman et al., Methods in Yeast Genetics, Cold Spring Harbor Laboratory, 143, 1986) and separated by electrophoresis on an agarose gel. The RNAs were hybridized to a probe corresponding to the albumin structural gene (1.9 kb HindIII--HindIII fragment) derived from the vector pYG18 (FIG. 7) following the Northern blot method (Maniatis et al., Molecular cloning, Cold Spring Harbor, Laboratory Press, 1982). Autoradiography showed a 2.3 kb band specific to albumin (FIG. 13). Moreover, it is clearly evident that the level of transcription of the albumin gene is substantially higher in the strains containing a promoter region of the invention (pYG621) than in those containing the intact S. cerevisiae PGK promoter (pYG 19).

b) Analysis of the proteins

The cells were cultured in Erlenmeyer flasks in selective YPD media containing 0.2 g/l geneticin at 28.degree. C. with shaking. After 96 hours in culture, 30 .mu.l of supernatant were collected and mixed with an equivalent volume of 2.times.Laemmli buffer (Laemmli, Nature 227:680, 1970). After heating at 96.degree. C. for 10 minutes, the sample proteins were separated on an 8.5% SDS polyacrylamide gel. The production of albumin was then visualized by staining the gel with coomassie blue, and production from the different vectors was compared. FIG. 14 shows that the 4 clones which were obtained separately by transforming the strain MW98-8C using the vector pYG621, secreted substantially more albumin than those obtained by transformation using the vector pYG19.

It is evident that the promoter region of the invention permits excellent albumin production by yeast, greater than that obtained with the S. cerevisiae PGK promoter. This region, or reduced forms or derivatives thereof, constitute(s) an important industrial tool for microbiological, and more particularly eukaryotic, production systems.

One skilled in the art will readily appreciate the present invention is well adapted to carry out the objects and obtain the ends and advantages mentioned, as well as those inherent therein. The DNA sequences, recombinant DNAs, vectors, cells, methods, procedures, and techniques described herein are presented as representative of the preferred embodiments, or intended to be exemplary and not intended as limitations on the scope of the present invention. Changes therein and other uses will occur to those of skill in the art which are encompassed within the spirit of the invention or defined by the scope of the appended claims.

Deposit of Strains Useful in Practicing the Invention

Deposits of biologically pure cultures of the following strains were made pursuant to, and in satisfaction of, the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purpose of Patent Procedure, with the American Type Culture Collection, 12301 Parklawn Drive, Rockville, Md. The Accession Numbers indicated were assigned after successful viability testing, and the requisite fees were paid. Access to said cultures will be available during pendency of the patent application to one determined by the Commissioner to be entitled thereto under 37 C.F.R. .sctn.1.14 and 35 U.S.C. .sctn.122. All restriction on availability of said cultures to the public will be irrevocably removed upon the granting of a patent based upon the application and said cultures will remain permanently available for a term of at least five years after the most recent request for the furnishing of a sample and in any case for a period of at least 30 years after the date of the deposit. Should the cultures become nonviable or be inadvertently destroyed, they will be replaced with viable culture(s) of the same taxonomic description.

  ______________________________________                                    
     Strain/Plasmid ATCC No.  Deposit Date                                     
     ______________________________________                                    
  __________________________________________________________________________
     SEQUENCE LISTING                                                          
     (1) GENERAL INFORMATION:                                                  
     (iii) NUMBER OF SEQUENCES: 9                                              
     (2) INFORMATION FOR SEQ ID NO:1:                                          
     (i) SEQUENCE CHARACTERISTICS:                                             
     (A) LENGTH: 2250 base pairs                                               
     (B) TYPE: nucleic acid                                                    
     (C) STRANDEDNESS: double                                                  
     (D) TOPOLOGY: linear                                                      
     (ii) MOLECULE TYPE: DNA (genomic)                                         
     (iii) HYPOTHETICAL: NO                                                    
     (iv) ANTI-SENSE: NO                                                       
     (vi) ORIGINAL SOURCE:                                                     
     (A) ORGANISM: Kluyveromyces lactis                                        
     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:                                   
     TCTAGATTTAGCGGGTCATCGAAATTTAGTAGCGAGTCTATTAGGGACCAGAGTTGCAAC60            
     CTGAGGTTTAATGCGTCATCCTGTCGTTGCTTCAAGTTCCCCACTTGAATCACTTGGACA120           
     AACCGTTTCATTGGTTTGAGGAAGGTGACGGATCTGGGTAGAAACTGGACTACTGCATCT180           
     GTTGGTAGTCTTGATGCCATGGTGATGAGCCATTGCCATTGGAAAAGAGTGAATTCAGAT240           
     TCCAAGATTTGGTCAATGATTGATTTTGTAAGATTGAGATCGTAATCCTGATACTCTTTG300           
     AGCCATGTTTCCAACAGTTCTTCGGAATCTGCCGGTGTGGAAACGAGTATTTCGGAGTAC360           
     AATCTCGGTGGTTGCGTTATCTGAGAGGATGGTGTAGTGGTTTGATGTTGCTGTGTGAAA420           
     GATGATGCAGAGCTGATCAACGATTCGAACTGGGAGATCACTTCGTTCACTTCTTCCTGG480           
     TTCCCGTTACCTGTTTGCGTTTCCTCATACATTGGTACGCTATCCTCATCTTCAGATAAC540           
     GAAATATCAAACTCATCGGAATCGGACGCGTCGTTCAAATCGCCCTCATCCTTGGTAATG600           
     TTCTTGAACCGGTCGAGAAGGTTGAGAATCTCTGTCGGAACACCACCCTGCGGCGTATAC660           
     CAGAACCAGAATAAATTGTAGCACATCTTAACTTTCTCTAAGGAAACATCTGAACTCTGA720           
     TCAACGCATTCCGTAAGTATACTGTTTGCCTTGTCTCTGGTGAATTTATGAGGGTAAGAC780           
     TCTGAGATCATAAGTAACTGTTGAGCATCGAAGTTGTTGTAGTTTGAAATTAGGGATCTG840           
     GAAAGATGCGGTACCACTGCTTTGATGACATTATCTGGCGGGTTCAACGGTACCAATTCC900           
     TGCAAGAATAGCGAATCCAACGGTTTTAACTCAGAGTAATGGTTGATCAACTCGATGAAA960           
     ACGTCCCAATGGATGGATTGCATCAAGTGTTGATGTTCCACCAAATTAAGACAATATTTC1020          
     GTAACGTTTTCGAGTGAAACTGACACGGGCCTGCCCTCAGCACTCGTAGACACGAGTAAC1080          
     GTCTTGAGACCTCTCGTACAGGGAAGCGACATATCGTTCAATAGACTATGGAACAAAGTG1140          
     TACACCGCAGCGATATCCTTGCATTTGCAAAACGATTGAATAAGTGACGTCGATGCTAAA1200          
     TCCTGGATAAGTACGCTGGTATCGTGTAAGCCCATGAGAACGACACGTTCCTCATCACTA1260          
     GAAGCCGAACTGTTGTCTTCAGTGGGGATTGGTTCGACATTTTGCCAATTGCTGTCGATG1320          
     TACCCTTTCAAAGCCATGTACCTTAAATCTTCATCCTTGGCCAAGTAGATTCATCGGGTG1380          
     TGTTTGAAGTAAGAATATTTGCTTGTTTTTATGGTATCAAAGGTATATGTTGTAGAAGAC1440          
     AATTTCCGGTAATCCAATTGTCTGTCTGCTCAGTTTAGCACATGTATAGTACGTTGCACA1500          
     TAGTCTACAATATTCAGCATTCAGCATTCAGTATACAGCATATGGCTAAATGATCACAAA1560          
     TGTGATTGATGATTTGACACGACTAGAAAAGAGAACGAAAAAGGGAAATTCATGTCACGT1620          
     GCGTTGGCACGTGACATGGAATATCGAAGAAAGAAAAAAAAAAACGATCTCGTCCTAGTG1680          
     GAAGCCCAGAGTCTGGTCCCCCCGGAGTCTTCCCAAAACAAGAAGCTGACACATGTTGAC1740          
     ACAGAACACCCCACAGCAAATGCACCACGCTACGTAGATCAGGAAGCTTAACTCTAGCGA1800          
     CCTGTCGCTCGCCCCACAGAACCTCACCCGAGAACCACACATTACACGCCGCCAGCTCCC1860          
     ACTATACTCATCTTGCTTCCCTTAAGCGTTCTCACGATTCGTTCGCTGCCCTTCTTCAAG1920          
     AGTCTTCTGATTCTAATTCTCATTCGAAATCCTCTACAGTTAATGAATTGCTTGACATGA1980          
     CATTCATTGTCTCATGGTTTTGGCTTTTTGGCTTTTGTCTTTTAAAGCTATATCAACTTT2040          
     ACATATAAATATACGTCAAAAGGGGATTCATTAATTAGAAAATTCTCTTTTTCAATAGTT2100          
     GCTATTCATTATCAATCTATTCAACTCAATTGGTTATTATTTTCATCTTTTTGTCATCCT2160          
     AAACCATCAACAATATTTAAATATATCTGTTGCTACATTAAGAGTTACTTCAGAAATAAC2220          
     AAAAAAATCGATCAAGAATTAATAAAAATG2250                                        
     (2) INFORMATION FOR SEQ ID NO:2:                                          
     (i) SEQUENCE CHARACTERISTICS:                                             
     (A) LENGTH: 917 base pairs                                                
     (B) TYPE: nucleic acid                                                    
     (C) STRANDEDNESS: double                                                  
     (D) TOPOLOGY: linear                                                      
     (ii) MOLECULE TYPE: DNA (genomic)                                         
     (iii) HYPOTHETICAL: NO                                                    
     (iv) ANTI-SENSE: NO                                                       
     (vi) ORIGINAL SOURCE:                                                     
     (A) ORGANISM: Kluyveromyces lactis                                        
     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:                                   
     AAGCTTTTAAATCTTCATCCTTGGCAAGTAGATTCATCGGGTGTGTTTGAAGTAAGAATA60            
     TTTGCTTGTTTTTATGGTATCAAAGGTATATGTTGTAGAAGACAATTTCCGGTAATCCAA120           
     TTGTCTGTCTGCTCAGTTTAGCACATGTATAGTACGTTGCACATAGTCTACAATATTCAG180           
     CATTCAGCATTCAGTATACAGCATATGGCTAAATGATCACAAATGTGATTGATGATTTGA240           
     CACGACTAGAAAAGAGAACGAAAAAGGGAAATTCATGTCACGTGCGTTGGCACGTGACAT300           
     GGAATATCGAAGAAAGAAAAAAAAAAACGATCTCGTCCTAGTGGAAGCCCAGAGTCTGGT360           
     CCCCCCGGAGTCTTCCCAAAACAAGAAGCTGACACATGTTGACACAGAACACCCCACAGC420           
     AAATGCACCACGCTACGTAGATCAGGAAGCTTAACTCTAGCGACCTGTCGCTCGCCCCAC480           
     AGAACCTCACCCGAGAACCACACATTACACGCCGCCAGCTCCCACTATACTCATCTTGCT540           
     TCCCTTAAGCGTTCTCACGATTCGTTCGCTGCCCTTCTTCAAGAGTCTTCTGATTCTAAT600           
     TCTCATTCGAAATCCTCTACAGTTAATGAATTGCTTGACATGACATTCATTGTCTCATGG660           
     TTTTGGCTTTTTGGCTTTTGTCTTTTAAAGCTATATCAACTTTACATATAAATATACGTC720           
     AAAAGGGGATTCATTAATTAGAAAATTCTCTTTTTCAATAGTTGCTATTCATTATCAATC780           
     TATTCAACTCAATTGGTTATTATTTTCATCTTTTTGTCATCCTAAACCATCAACAATATT840           
     TAAATATATCTGTTGCTACATTAAGAGTTACTTCAGAAATAACAAAAAAATCGATCAAGA900           
     ATTAATAAAAAGTCGAC917                                                      
     (2) INFORMATION FOR SEQ ID NO:3:                                          
     (i) SEQUENCE CHARACTERISTICS:                                             
     (A) LENGTH: 33 base pairs                                                 
     (B) TYPE: nucleic acid                                                    
     (C) STRANDEDNESS: single                                                  
     (D) TOPOLOGY: linear                                                      
     (ii) MOLECULE TYPE: other nucleic acid                                    
     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:                                   
     GGGAATTCGTCGACTTAACTCTAGCGACCTGTC33                                       
     (2) INFORMATION FOR SEQ ID NO:4:                                          
     (i) SEQUENCE CHARACTERISTICS:                                             
     (A) LENGTH: 36 base pairs                                                 
     (B) TYPE: nucleic acid                                                    
     (C) STRANDEDNESS: single                                                  
     (D) TOPOLOGY: linear                                                      
     (ii) MOLECULE TYPE: other nucleic acid                                    
     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:                                   
     GGGAATTCAAGCTTTAATTCTTGATCGATTTTTTTG36                                    
     (2) INFORMATION FOR SEQ ID NO:5:                                          
     (i) SEQUENCE CHARACTERISTICS:                                             
     (A) LENGTH: 31 base pairs                                                 
     (B) TYPE: nucleic acid                                                    
     (C) STRANDEDNESS: single                                                  
     (D) TOPOLOGY: linear                                                      
     (ii) MOLECULE TYPE: other nucleic acid                                    
     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:5:                                   
     CATGTCGACTTTTTATTAATTCTTGATCGAT31                                         
     (2) INFORMATION FOR SEQ ID NO:6:                                          
     (i) SEQUENCE CHARACTERISTICS:                                             
     (A) LENGTH: 26 base pairs                                                 
     (B) TYPE: nucleic acid                                                    
     (C) STRANDEDNESS: single                                                  
     (D) TOPOLOGY: linear                                                      
     (ii) MOLECULE TYPE: other nucleic acid                                    
     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:6:                                   
     ATGAAGCTTAAATCTTCATCCTTGGC26                                              
     (2) INFORMATION FOR SEQ ID NO:7:                                          
     (i) SEQUENCE CHARACTERISTICS:                                             
     (A) LENGTH: 53 base pairs                                                 
     (B) TYPE: nucleic acid                                                    
     (C) STRANDEDNESS: single                                                  
     (D) TOPOLOGY: linear                                                      
     (ii) MOLECULE TYPE: other nucleic acid                                    
     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:7:                                   
     GGGTGAGGTTCTGTGGGGCGAGCGACAGGTCGCTAGAGTTAAGCATCCTGATC53                   
     (2) INFORMATION FOR SEQ ID NO:8:                                          
     (i) SEQUENCE CHARACTERISTICS:                                             
     (A) LENGTH: 53 base pairs                                                 
     (B) TYPE: nucleic acid                                                    
     (C) STRANDEDNESS: single                                                  
     (D) TOPOLOGY: linear                                                      
     (ii) MOLECULE TYPE: other nucleic acid                                    
     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:8:                                   
     GATCAGGATGCTTAACTCTAGCGACCTGTCGCTCGCCCCACAGAACCTCACCC53                   
     (2) INFORMATION FOR SEQ ID NO:9:                                          
     (i) SEQUENCE CHARACTERISTICS:                                             
     (A) LENGTH: 30 base pairs                                                 
     (B) TYPE: nucleic acid                                                    
     (C) STRANDEDNESS: single                                                  
     (D) TOPOLOGY: linear                                                      
     (ii) MOLECULE TYPE: other nucleic acid                                    
     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:9:                                   
     GAAATGCATAAGCTCTTGCCATTCTCACCG30                                          
     __________________________________________________________________________

Claims

1. An isolated and purified DNA sequence selected from the group consisting of:

(a) the sequence presented in FIG. 1 (SEQ ID NO: 1);
(b) a derivative of the sequence of (a); and
(c) a fragment of the sequence of (a);

2. A recombinantly prepared DNA comprising a DNA sequence according to claim 1.

3. A recombinantly prepared DNA according to claim 2, further comprising one or more structural genes.

4. A recombinantly prepared DNA according to claim 3, wherein said one or more structural genes is human serum albumin.

5. A recombinantly prepared DNA according to claim 3, further comprising signals permitting the secretion of the expression product of said structural gene(s).

6. A recombinantly prepared DNA according to claim 3, wherein said sequence is a bidirectional promoter and said genes are inserted on each side of the promoter, in the 2 opposite orientations.

7. An autonomous or integrative expression plasmid comprising the recombinantly prepared DNA according to claim 3.

8. A recombinantly prepared cell containing a DNA sequence according to claim 1.

9. The recombinantly prepared cell according to claim 8, characterized in that it is a yeast cell.

10. The recombinantly prepared cell according to claim 9, characterized in that said yeast cell is of the Kluyveromyces genus.

11. A process for the preparation of a recombinant protein by expression of the gene encoding said protein in a cellular host comprising expression of the said gene under the transcriptional control of a sequence according to claim 1.

12. A process according to claim 11, characterized in that the protein is human serum albumin.

13. The process of claim 11, further comprising simultaneous expression of isolated and purified genes, wherein said sequence is a bidirectional promoter and said genes are inserted on each side of the promoter, in the 2 opposite orientations.

14. An isolated and purified DNA sequence according to claim 1, comprising all or part of the sequence presented in FIG. 6(b) (SEQ ID NO: 2).

15. A recombinantly prepared DNA comprising a DNA sequence according to claim 14.

16. A recombinantly prepared DNA according to claim 15, further comprising, one or more structural genes.

17. A recombinantly prepared DNA according to claim 16, further comprising signals permitting the secretion of the expression product of the said structural gene(s).

18. An autonomous or integrative expression plasmid comprising the recombinantly prepared DNA according to claim 16.

19. A recombinantly prepared cell containing a DNA sequence according to claim 14.

20. The recombinantly prepared cell according to claim 19, characterized in that it is a yeast cell.

21. The recombinantly prepared cell according to claim 20, wherein said yeast cell is of the Kluyveromyces genus.

22. A process for the preparation of a recombinant protein comprising expression of the gene encoding said protein in a cellular host wherein the expression of said gene is under the transcriptional control of a sequence according to claim 14.

23. The process of claim 22, further comprising simultaneous expression of isolated and purified genes, wherein said sequence is a bidirectional promoter and said genes are inserted on each side of the promoter, in the 2 opposite orientations.

Referenced Cited
Other references
  • Nucleic Acids Res. 10(8):2625-2637, 1982, Dobson, Kingsman, Tuite, Kingsman, & Roberts, Conservation of high efficiency promoter sequences in Saccharomyces cerevisiae. Nucleic Acids Res. 18(2)365, 1990, Fournier, Fleer, Yeh, & Mayaux, The primary structure of the 3-phosphoglycerate kinase (PGK) gene from Kluyveromyces-lactis. Bio/Technology 8:135-139, 1990, van der Berg, van der Laken, van Ooyen, Renniers, Rietveld et al. Kluyveromyces as a Host for Heterologous Gene Expression: Expression and Secretion of Prochymosin. Nucleic Acids Res. 10(23):7791-7808, 1982, Hitzeman, Hagie, Hayflick, Chen, Seeburg & Derynck The Primary Structure of the Saccharomyces cerevisiae gene for 3-phosphoglycerate kinase. Mol. Cell Biol. 9(7):3058-3072, 1989, Linton, Yen, Selby, Chen, Chinsky et al. Dual Bidirectional Promoters at the Mouse dhfr Locus: Cloning and Characterization of two messenger RNA Classes of the divergently transcribed rep-1 gene. EP 0361991 filed Aug. 9, 1989, issued Apr. 4, 1990, Fleer, Fukuhara & Yeh, Method for the microbiological preparation of human serum albumin and other proteins in yeast.
Patent History
Patent number: 5646012
Type: Grant
Filed: Jun 7, 1995
Date of Patent: Jul 8, 1997
Assignee: Rhone-Poulenc Rorer S.A. (Antony)
Inventors: Reinhard Fleer (Bures Sur Yvette), Alain Fournier (Chatenay Malabry), Jean-Francois Mayaux (Fontenay aux Roses), Patrice Yeh (Paris)
Primary Examiner: Nancy T. Vogel
Application Number: 8/483,639
Classifications
Current U.S. Class: 435/691; 435/2542; 435/3201; 435/1723; 530/263; 536/255; 536/241
International Classification: C12P 2102; C12N 119; C12N 1581; C07K 19765;