Method for the extraction of periplasmic proteins from prokaryotic microorganisms in the presence of arginine

- Sanofi

The invention relates to a method for the extraction of recombinant periplasmic proteins wherein arginine is used as the extraction agent. In particular, the invention relates to a method for the extraction of a periplasmic protein of interest, which essentially consists in:(i) suspending the pellet of cells or of cell debris from cells, which cells originate from the culture of a prokaryotic microorganism transformed with an expression vector containing a gene coding for the protein and means for its expression in the periplasm of the microorganism, in a buffer solution containing arginine; and(ii) recovering the protein of interest in the supernatant of the bacterial suspension thereby obtained.

Skip to: Description  ·  Claims  ·  References Cited  · Patent History  ·  Patent History

Description

The present invention relates to the extraction of recombinant proteins produced by prokaryotic microorganisms, especially by E. coli.

Increasing use is being made of genetic engineering techniques for the production of proteins of interest such as, for example, insulin, interleukins, growth hormone, and the like.

Generally, the microorganism is transformed with an expression vector containing a gene coding for the protein of interest and means needed for its expression such as the regulator signals. The microorganism is then cultured on a suitable culture medium and according to suitable culture parameters and, when a sufficient number of microorganism cells has been arrived at, the addition of an inducer triggers the so-called expression phase, during which the desired protein is produced at high level and accumulates. On completion of culturing, the cells in suspension are separated from the culture medium, for example by centrifugation or microfiltration, and are then subjected to an extraction method which frequently begins with an operation of disrupting of the walls of the microorganisms.

The expression of a gene coding for a protein of interest in a prokaryotic microorganism can be cytoplasmic, periplasmic or secretory, depending on the nature of the means of expression employed with the said gene (promoter, terminator, ribosome binding site, signal peptide, and the like).

Cytoplasmic expression enables large amounts of proteins to be obtained. However, prior to the extraction of the protein of interest, it is necessary, for proteins comprising one or more disulphide bridges, to carry out a step of denaturation/renaturation, which represents an especially cumbersome and intricate step during production on an industrial scale. The denaturation/renaturation step is carried out according to traditional means well known to a person skilled in the art, using a denaturing agent in the presence of a reducing agent followed by renaturation conditions comprising, in particular, a monitoring of the redox state of the solution. Among denaturing agents used, most particular mention must be made of guanidine hydrochloride, which has been proposed in a method for obtaining human interleukin-2. To this end, reference may be made, for example, to the document EP-A2-0,145,390.

With Gram-negative bacteria, little or no use has been made of secretory expression systems in which the protein of interest is to be found actively in the culture medium, on account of their low productivity. It should be noted here that the medium of a bacterial culture at high density in a bioreactor is not an ideal residence place for sensitive recombinant proteins on account, for example, of the risks of interfacial denaturation.

Periplasmic expression enables recombinant proteins which are, in principle, correctly folded to be obtained directly in a space protected from the environment and, as a result, represents a judicious choice for obtaining proteins, in particular unglycosylated proteins. In this case, it is hence not necessary to subject the proteins to a denaturation/renaturation step.

The methods of cell disruption generally used in this field are, for example, cell lysis by sonication or by mechanical pressure (French Pressure Cell, ball mill), chemical lysis or enzymatic lysis, osmotic shock and treatment using chaotropic agents or detergents. These methods disrupt the majority of cell membranes, including the plasma membranes and membranes of the endoplasmic reticulum, to form a homogeneous suspension of cell debris. The nature of the pellet of cell debris which can be harvested in general after centrifugation (nuclei, cytoskeleton, mitochondria, lysosomes, ribosomes, macromolecules, and the like) is dependent especially on the time and the speed of centrifugation (10 minutes at 1000 g to 3 hours at 150,000 g).

The difficulties encountered during the extraction operations vary according to the type of expression and the extraction methods used, and are, in particular:

loss in yield of the recombinant protein

loss of biological activity of the recombinant protein

proteolytic degradation of the recombinant protein

toxicity of the extraction agents and obligatory monitoring of their removal

difficulty of industrial implementation

mixing of the periplasmic proteins with cytoplasmic proteins.

Furthermore, when the proteins of interest produced are hydrophobic or charged, they may associate with cell components which are themselves hydrophobic or charged, thereby rendering extraction especially difficult.

Considerable benefit might accrue from under-taking the industrial production of recombinant proteins of interest by genetic engineering, but this necessitates the development of extraction methods which avoid or minimize the above drawbacks.

In effect, it is not only important to produce large amounts of protein of interest, but these proteins must also not be contaminated with the extraction agents and must retain their full biological activity.

Various methods have been proposed for this purpose, especially for the extraction/separation of interleukin-2.

The document EP-A2-0,145,390 describes a method for obtaining unglycosylated human interleukin-2 (IL-2) having a specific activity of greater than 104 U/mg, which employs a step of separation by column chromatography to extract the IL-2. This method also involves a denaturation step using guanidine hydrochloride.

The document EP-A2-0,147,819 proposes a method for obtaining homogeneous and pure recombinant interleukin-2. This method consists in culturing a microorganism transformed by means of an expression vector containing the gene coding for interleukin-2, in causing lysis of the cells, in recovering the cell debris, in extracting the IL-2 by washing the cell debris with a suitable washing solution and then in purifying the washing solution by chromatography. The washing solutions used can contain a salt such as sodium chloride or guanidine hydrochloride, or a detergent such as, for example, the product known under the trade name "Triton X.RTM.-100".

According to a preferred variant, the successive use of three washing solutions, namely a washing solution containing sodium chloride, a washing solution containing a detergent and a washing solution containing guanidine hydrochloride, is recommended.

The document EP-A1-0,337,243 describes a method for purifying human interleukin-2 which utilizes a system of two reversed-phase liquid chromatography columns. Before the step of purification by chromatography the insoluble fraction of the bacterial cell lysate is extracted with a solution containing guanidine hydrochloride to obtain a bacterial extract, which is then diluted using a guanidine hydrochloride-free buffer and thereafter chromatographed, elution being carried out with an acetonitrile gradient.

It has now been found, surprisingly, that the extraction of a protein of interest produced by a prokaryotic microorganism, transformed with an expression vector containing a gene coding for the protein of interest and means for its expression such as the regulator signals needed for its periplasmic expression, may be carried out by suspending the pellet of cells or of cell debris from the microorganism, originating from the culture of the said microorganism, in a buffer solution, the said solution advantageously containing arginine, it being possible for the arginine to be in the L and/or D form.

According to a first aspect, the subject of the invention is the use of arginine as an agent for the extraction of periplasmic proteins.

According to another aspect, the subject of the present invention is a method for the extraction of a periplasmic protein of interest, which consists in:

1) suspending the pellet of cells originating from the culture of a microorganism, transformed with an expression vector containing a gene coding for the said protein and all the regulator signals needed for its periplasmic expression, in a buffer solution containing arginine and, after a period of contact under appropriate pH, temperature, bacterial concentration, and the like, conditions,

2) recovering the protein of interest in the supernatant of the bacterial suspension thereby obtained.

A variant of the said method for the extraction of a periplasmic protein of interest consists in suspending the pellet of cell debris, obtained after lysis of the cells originating from the culture, in the buffer solution containing arginine.

Extraction of the periplasmic proteins is especially efficient when the extraction buffer consists of an aqueous solution containing arginine at a concentration equal to at least 0.4M arginine within the limit of solubility of arginine at room temperature in water (in the region of 0.8M in pure water and above this in the presence of salts), and when its pH is slightly alkaline, preferably equal to 8.

Arginine is a natural .alpha.-amino acid which has been proposed as an auxiliary agent for the denaturation/renaturation/substitution of two chains of Abbokinase.RTM. (urinary plasminogen activator), in which chains a native peptide is partially replaced by a synthetic peptide during this operation. To this end, reference may be made to the paper by GA. Homandberg and T. Wai in Biochimica et Biophysica Acta, 1990, 1038, 209-215.

In the method of the invention or its variant, denaturation/renaturation of the protein is not carried out and the arginine participates only in respect of the extraction of a protein from a pellet of cells or of cell debris from microorganisms.

Arginine brings about noteworthy effects on the extraction of the protein, in respect of both the yield and the biological activity of the protein. It was, in effect, found that, for example, the mature form of IL-13 is recovered with the method of the invention in yields of greater than 95% while retaining the biological activity of the molecule. It should be noted that trials of extraction by osmotic shock on the same expression system do not lead to comparable yields.

Comparative trials showed that guanidine. HCl used under the same conditions also enables the IL-13 protein to be recovered in a yield of greater than 95% but, in contrast, the biological activity of the protein thus recovered is impaired more than by the arginine method.

While it is not wished to limit interpretation to some particular theory, arginine is thought to act as a mild and biological chaotropic agent, as opposed to the powerful chaotropic agents which are denaturing at the high concentrations needed, equal to or greater than 5M, in order to effect extraction, such as guanidine hydrochloride.

The method of the invention or its variant may be carried out following any method of culture of a microorganism transformed with an expression vector containing a gene coding for the protein of interest and means for a periplasmic expression of the said protein, such as all the necessary regulator signals.

It is obvious to a person skilled in the art that the method is applicable to bacteria closely related to E. coli, that is to say to so-called facultative anaerobic Gram-negative bacteria which constitute the Enterobacteriaceae group. In this family Enterobacteriaceae, the following species are to be found in particular: Escherichia, Salmonella, Erwinia and also Shigella, Klebsiella, Serratia, Proteus and Enterobacter.

Bearing in mind the chaotropic character of arginine, it is also apparent that arginine can, depending on the case, advantageously substitute for other chaotropic agents. Without it being possible to exemplify on all the families of bacteria on account of the diversity of the living systems in question, a person skilled in the art will know how to apply and adapt the arginine extraction method to his particular case.

Such culture methods are well known to a person skilled in the art. Methods describing the fermenter culture of Gram-negative bacteria are described, for example, in Patent EP-360,641 and EP-356,335 reporting the obtaining and use of the E. coli strains known as SEBR 1250 and TP 2339.

When the desired number of cells has been arrived at, the culture is subjected to a centrifugation (in general) or a microfiltration, and the pellet of biomass obtained is brought into contact with a buffer solution containing arginine according to the method of the invention.

As a general rule, the procedure is performed at a temperature between room temperature of approximately 25.degree. C. and 2.degree. C., preferably at 4.degree. C.

The contact time of the cell pellet with the buffer solution containing arginine must be sufficient to permit passage of the protein of interest into the buffer solution.

In general, when the procedure is performed at 4.degree. C., the contact time is advantageously approximately 1 hour.

The extraction, that is to say passage of the periphasmic protein into the medium, continues during the period of contact of the biomass and the arginine-containing extraction buffer. The contact time providing for complete extraction or an extraction showing no further change in level is between 30 minutes and 16 hours. Trials show that satisfactory extraction yields may be obtained in the space of a few hours at a temperature of 4.degree. C. It has also been noted that gentle stirring of the biomass in its extraction buffer so as to avoid sedimentation of the pellet of microorganisms gives superior results, that is to say higher levels of extraction as a function of time.

The extraction method according to the invention is suitable for extracting both hydrophobic proteins such as, for example, interleukins, especially IL-13 described in the document EP-A1-0,506,574, and hydrophilic proteins such as, for example, growth hormone (hGH). The method of the invention simplifies the obtaining of hGH, which normally necessitates the use of an osmotic shock for its extraction.

To carry out the extraction of the protein of interest directly on the suspension of the cell pellet, a buffer solution containing arginine at a concentration of between 0.4M and 0.8M will be preferred.

When it is desired to carry out the extraction of the periplasmic protein of interest on the pellet of cell debris according to the variant of the method of the invention, the procedure is the same as is used in the method of the invention up to the step of obtaining the cell pellet obtained after centrifugation or microfiltration, and disruption of the cells is then performed according to methods well known to a person skilled in the art. Methods of cell disruption are described, for example, in C. T. Choma and H. Yamazaki, Can. J. Microbiol., 1981, 27, 547-550; L. O. Ingram, Journal of Bacteriology, 1981, 146, 1, 331-336; N. G. Nossal and L. A. Heppel, Journal of Biological Chemistry, 1966, 241, 13, 3065-3072; R. Bennett, D. R. Taylor and A. Hurst, Biochem. Biophys. Acta, 18(3), 512-521 (1966), and in the collective work Fermentation and enzyme technology, Chap. 12, 239-309, J. Wiley and Sons publishers (1979).

The pellet of cell debris harvested, as a general rule, after centrifugation is resuspended and then brought into contact with a buffer solution containing arginine. The contact time of the suspension of cell debris with the buffer solution containing arginine must be sufficient to permit passage of the protein of interest into the buffer solution. In general, for a temperature of 4.degree. C., the contact time providing for almost complete extraction is 48 hours. Similarly, it was noted that gentle stirring of the biomass in its extraction buffer, thereby avoiding sedimentation of the cell debris, gives higher levels of extraction as a function of time.

This variant of the extraction method according to the invention is suitable for extracting especially periplasmic proteins of interest which are strongly associated with the cell membranes, such as, for example, interleukins.

It is well known to a person skilled in the art that the extraction buffer containing arginine according to the invention may also contain an auxiliary detergent which will have the effect of improving the yield and/or the rate of extraction of the protein of interest. Among auxiliary detergents which may be used, a person skilled in the art will be able to choose from those which enable the advantages of using arginine as extraction agent, especially the retention of the biological activity of the protein of interest, to be preserved. Among these mild auxiliary detergents, there may be mentioned, for example, alkyl glycosides such as alkyl maltosides, nonyl .alpha.- or .beta.-D-glycopyranosides, octyl .alpha.- or .beta.-D-glycopyranosides or alkylcarbamoylmethyl .alpha.- or .beta.-D-glycopyranosides such as, for example, Hecameg.RTM., the very low toxicity of which suggests the possibility of allowing it to appear in trace amounts as formulation agent in the final product.

To carry out the extraction of the protein of interest from the suspension of the pellet of cell debris, it will be preferable to use a buffer solution containing arginine at a concentration of between 0.4M and 2.5M, it being possible for a concentration of 2.5M arginine to be obtained especially in the presence of salts.

Moreover, it was found that arginine exerts a considerable beneficial effect on the yields of secreted recombinant periplasmic protein if it is added at unfamiliar concentrations much higher than those encountered in the culture media manufactured from commercial protein hydrolysates, and which enable the arginine requirements of the strain employed to be covered.

Furthermore, it was found that the beneficial effect exerted by arginine is especially considerable if the arginine concentrations added to the culture medium are between 2 g/l and 10 g/l.

Thus, according to another aspect, the subject of the present invention is a method for the culture of a prokaryotic microorganism transformed by means of an expression vector containing a gene coding for a protein of interest, which consists in culturing the said microorganism in the presence of arginine at a concentration equal to at least 2 g/l, and especially at a concentration of between 2 g/l and 10 g/l.

A person skilled in the art will optimize this arginine concentration for each particular case.

This method is especially suitable for the production of proteins having activity of the cytokine type, especially IL-13, as described in the document EP-A1-0,506,574.

The invention will now be described in greater detail by means of the EXAMPLES below, given only by way of illustration.

EXAMPLE 1

Extraction of periplasmic IL-13 from E. coli in the presence of arginine on cell pellet.

1/ Flask culture

In this example, E. coli strain RB 791 (Roger Brent, PNAS 78 (1981) pp. 4204-4208), transformed with the plasmid p922 obtained according to methods similar to those defined in Patents EP 360,641 and 356,335 and whose DNA sequence is the sequence SEQ ID NO:1, was used.

The different sequences which constitute this plasmid p922 are shown below.

PROMOTER SEQUENCE (SEQ ID NO:2)

The hexanucleotides TTGCTT and TATAAT characteristic of the promoters in E. coli are shown in bold characters

  __________________________________________________________________________
      ##STR1##                                                                 
     51ATCTCGACTGCACGGTGCACCAATGCTTCTGGCGTCAGGCAGCCATCGGA                      
     101AGCTGTGGTATGGCTGTGCAGGTCGTAAATCACTGCATAATTCGTGTCGC                     
     151TCAAGGCGCACTCCCGTTCTGGATAATGTTTTTTGCGCCGACATCATAAC                     
      ##STR2##                                                                 
      ##STR3##                                                                 
     __________________________________________________________________________

SEQUENCE OF THE UNTRANSLATED 5-PRIME REGION OF THE MESSENGER (SEQ ID NO:3)

The ribosome binding site is shown in bold characters. The sequence CAT located at the 3-prime end of this sequence is a portion of the hexanucleotide recognized by the restriction enzyme Nde I

  __________________________________________________________________________
      ##STR4##                                                                 
      ##STR5##                                                                 
     __________________________________________________________________________

SEQUENCE CODING FOR THE IL-13 PRECURSOR (SEQ ID NO:4)

The sequence in italics corresponds to the sequence of mature IL-13. The sequence which is not in bold characters is a linker sequence linking the end of the sequence coding for IL-13 to the hexanucleotide recognized by the restriction enzyme BamH I

  __________________________________________________________________________
     338                                                                       
        ATGAAAAAGA                                                             
                TCCTGGCGTT                                                     
                        AGCTGCGCTG                                             
                                ACTACCGTTG                                     
                                        TATTCTCTGC                             
     388                                                                       
        GTCCGCCTTC                                                             
                GCTGGCCCTG                                                     
                        TGCCTCCCAG                                             
                                TACTGCCCTC                                     
                                        AGGGAGCTCA                             
     438                                                                       
        TTGAGGAGCT                                                             
                GGTCAACATC                                                     
                        ACCCAGAACC                                             
                                AGAAGGCTCC                                     
                                        GCTCTGCAAT                             
     488                                                                       
        GGCAGCATGG                                                             
                TATGGAGCAT                                                     
                        CAACCTGACA                                             
                                GCTGGCATGT                                     
                                        ACTGTGCAGC                             
     538                                                                       
        CCTGGAATCC                                                             
                CTGATCAACG                                                     
                        TGTCAGGCTG                                             
                                CAGTGCCATC                                     
                                        GAGAAGACCC                             
     588                                                                       
        AGAGGATGCT                                                             
                GAGCGGATTC                                                     
                        TGCCCGCACA                                             
                                AGGTCTCAGC                                     
                                        TGGGCAGTTT                             
     638                                                                       
        TCCAGCTTGC                                                             
                ATGTCCGAGA                                                     
                        CACCAAAATC                                             
                                GAGGTGGCCC                                     
                                        AGTTTGTAAA                             
     688                                                                       
        GGACCTGCTC                                                             
                TTACATTTAA                                                     
                        AGAAACTTTT                                             
                                TCGCGAGGGA                                     
                                        CGGTTCAACT                             
     738                                                                       
        GAAACTTCGA                                                             
                AAGCATCATT                                                     
                        ATTTG                                                  
     __________________________________________________________________________

TERMINATION SEQUENCES (SEQ ID NO:5)

  __________________________________________________________________________
     763                                                                       
        GGATCCGGCT                                                             
                GCTAACAAAG                                                     
                        CCCGAAAGGA                                             
                                AGCTGAGTTG                                     
                                        GCTGCTGCCA                             
     __________________________________________________________________________

PHAGE T7 GENE 10 TERMINATOR (SEQ ID NO:6)

  __________________________________________________________________________
     813                                                                       
        CCGCTGAGCA                                                             
                ATAACTAGCA                                                     
                        TAACCCCTTG                                             
                                GGGCCTCTAA  ACGGGTCTTG                         
                                        HindIII                                
     863                                                                       
        AGGGGTTTTT                                                             
                TGCTGAAAGG                                                     
                        AGGAACTATA                                             
                                TCCGGATGTA                                     
                                        CCAAGCTTGG                             
     913                                                                       
        CCGGATCAAA                                                             
                GTTTTGTCGT                                                     
                        CTTTCCAGAC                                             
                                GTTAGTAAAT                                     
                                        GAATTTTCTG                             
     963                                                                       
        TATGAGGTTT                                                             
                TGCTAAACAA                                                     
                        CTTTCAACAG                                             
                                TTTCAGCGGA                                     
                                        GTGAGAATAG                             
     __________________________________________________________________________

PHAGE fd TERMINATOR (SEQ ID NO:7)

  __________________________________________________________________________
     1013                                                                      
        AAAGGAACAA                                                             
                CTAAAGGAAT                                                     
                        TGCGAATAAT                                             
                                AATTTTTTCA  CGTTGAAAAT                         
     1063                                                                      
        CTCCAAAAAA                                                             
                AAAGGCTCCA                                                     
                        AAAGGAGCCT                                             
                                TTAATTGTAT                                     
                                        CGGTTTATCA                             
     1113                                                                      
        GCTTGCTTTC                                                             
                GAGGTGAATT                                                     
                        TCTTAAACAG                                             
                                CTTGATACCG                                     
                                        ATAGTTGCGC                             
     1163                                                                      
        CGACAATGAC                                                             
                AACAACCATC                                                     
                        GCCCACGCAT                                             
                                AACCGATATA                                     
                                        TTCGGTCGCT                             
     1213                                                                      
        GAGGCTTGCA                                                             
                GGGAGTCAAA                                                     
                        GGCCGCTTTT                                             
                                GCGGGATCGA                                     
                                        T                                      
     __________________________________________________________________________

GENE CODING FOR THE LACTOSE OPERON REPRESSOR (SEQ ID NO:8)

  __________________________________________________________________________
        SacII                                                                  
     1254                                                                      
        CCGCGGAAGC                                                             
                ATAAAGTGTA                                                     
                        AAGCCTGGGG                                             
                                TGCCTAATGA                                     
                                        GTGAGCTAAC                             
     1304                                                                      
        TCACATTAAT                                                             
                TGCGTTGCGC                                                     
                        TCACTGCCCG                                             
                                CTTTCCAGTC                                     
                                        GGGAAACCTG                             
     1354                                                                      
        TCGTGCCAGC                                                             
                TGCATTAATG                                                     
                        AATCGGCCAA                                             
                                CGCGCGGGGA                                     
                                        GAGGCGGTTT                             
     1404                                                                      
        GCGTATTGGG                                                             
                CGCCAGGGTG                                                     
                        GTTTTTCTTT                                             
                                TCACCAGTGA                                     
                                        GACGGGCAAC                             
     1454                                                                      
        AGCTGATTGC                                                             
                CCTTCACCGC                                                     
                        CTGGCCCTGA                                             
                                GAGAGTTGCA                                     
                                        GCAAGCGGTC                             
     1504                                                                      
        CACGCTGGTT                                                             
                TGCCCCAGCA                                                     
                        GGCGAAAATC                                             
                                CTGTTTGCTG                                     
                                        GTGGTTAACG                             
     1554                                                                      
        GCGGGATATA                                                             
                ACATGAGCTG                                                     
                        TCTTCGGTAT                                             
                                CGTCGTATCC                                     
                                        CACTACCGAG                             
     1604                                                                      
        ATATCCGCAC                                                             
                CAACGCGCAG                                                     
                        CCCGGACTCG                                             
                                GTAATGGCGC                                     
                                        GCATTGCGCC                             
     1654                                                                      
        CAGCGCCATC                                                             
                TGATCGTTGG                                                     
                        CAACCAGCAT                                             
                                CGCAGTGGGA                                     
                                        ACGATGCCCT                             
     1704                                                                      
        CATTCAGCAT                                                             
                TTGCATGGTT                                                     
                        TGTTGAAAAC                                             
                                CGGACATGGC                                     
                                        ACTCCAGTCG                             
     1754                                                                      
        CCTTCCCGTT                                                             
                CCGCTATCGG                                                     
                        CTGAATTTGA                                             
                                TTGCGAGTGA                                     
                                        GATATTTATG                             
     1804                                                                      
        CCAGCCAGCC                                                             
                AGACGCAGAC                                                     
                        GCGCCGAGAC                                             
                                AGAACTTAAT                                     
                                        GGGCCCGCTA                             
     1854                                                                      
        ACAGCGCGAT                                                             
                TTGCTGGTGA                                                     
                        CCCAATGCGA                                             
                                CCAGATGCTC                                     
                                        CACGCCCAGT                             
     1904                                                                      
        CGCGTACCGT                                                             
                CTTCATGGGA                                                     
                        GAAAATAATA                                             
                                CTGTTGATGG                                     
                                        GTGTCTGGTC                             
     1954                                                                      
        AGAGACATCA                                                             
                AGAAATAACG                                                     
                        CCGGAACATT                                             
                                AGTGCAGGCA                                     
                                        GCTTCCACAG                             
     2004                                                                      
        CAATGGCATC                                                             
                CTGGTCATCC                                                     
                        AGCGGATAGT                                             
                                TAATGATCAG                                     
                                        CCCACTGACG                             
     2054                                                                      
        CGTTGCGCGA                                                             
                GAAGATTGTG                                                     
                        CACCGCCGCT                                             
                                TTACAGGCTT                                     
                                        CGACGCCGCT                             
     2104                                                                      
        TCGTTCTACC                                                             
                ATCGACACCA                                                     
                        CCACGCTGGC                                             
                                ACCCAGTTGA                                     
                                        TCGGCGCGAG                             
     2154                                                                      
        ATTTAATCGC                                                             
                CGCGACAATT                                                     
                        TGCGACGGCG                                             
                                CGTGCAGGGC                                     
                                        CAGACTGGAG                             
     2204                                                                      
        GTGGCAACGC                                                             
                CAATCAGCAA                                                     
                        CGACTGTTTG                                             
                                CCCGCCAGTT                                     
                                        GTTGTGCCAC                             
     2254                                                                      
        GCGGTTGGGA                                                             
                ATGTAATTCA                                                     
                        GCTCCGCCAT                                             
                                CGCCGCTTCC                                     
                                        ACTTTTTCCC                             
     2304                                                                      
        GCGTTTTCGC                                                             
                AGAAACGTGG                                                     
                        CTGGCCTGGT                                             
                                TCACCACGCG                                     
                                        GGAAACGGTC                             
     2354                                                                      
        TGATAAGAGA                                                             
                CACCGGCATA                                                     
                        CTCTGCGACA                                             
                                TCGTATAACG                                     
                                        TTACTGGTTT                             
     2404                                                                      
        CACATTCACC                                                             
                ACCCTGAATT                                                     
                        GACTCTCTTC                                             
                                CGGGCGCTAT                                     
                                        CATGCCATAC                             
     2454                                                                      
        CGCGAAAGGT                                                             
                TTTGCGCCAT                                                     
                        TCGATCTACG                                             
                                CCGGACGCAT                                     
                                        CGTGGCCGCA                             
     2504                                                                      
        AA                                                                     
     __________________________________________________________________________

SEQUENCE OF pBR 327 (SEQ ID NO:9)

  __________________________________________________________________________
        PflmI                                                                  
     2506                                                                      
        CCAACCCTTG                                                             
                GCAGAACATA                                                     
                        TCCATCGCGT                                             
                                CCGCCATCTC                                     
                                        CAGCAGCCGC                             
     2556                                                                      
        ACGCGGCGCA                                                             
                TCTCGGGCCG                                                     
                        CGTTGCTGGC                                             
                                GTTTTTCCAT                                     
                                        AGGCTCCGCC                             
     2606                                                                      
        CCCCTGACGA                                                             
                GCATCACAAA                                                     
                        AATCGACGCT                                             
                                CAAGTCAGAG                                     
                                        GTGGCGAAAC                             
     2656                                                                      
        CCGACAGGAC                                                             
                TATAAAGATA                                                     
                        CCAGGCGTTT                                             
                                CCCCCTGGAA                                     
                                        GCTCCCTCGT                             
     2706                                                                      
        GCGCTCTCCT                                                             
                GTTCCGACCC                                                     
                        TGCCGCTTAC                                             
                                CGGATACCTG                                     
                                        TCCGCCTTTC                             
     2756                                                                      
        TCCCTTCGGG                                                             
                AAGCGTGGCG                                                     
                        CTTTCTCAAT                                             
                                GCTCACGCTG                                     
                                        TAGGTATCTC                             
     2806                                                                      
        AGTTCGGTGT                                                             
                AGGTCGTTCG                                                     
                        CTCCAAGCTG                                             
                                GGCTGTGTGC                                     
                                        ACGAACCCCC                             
     2856                                                                      
        CGTTCAGCCC                                                             
                GACCGCTGCG                                                     
                        CCTTATCCGG                                             
                                TAACTATCGT  CTTGAGTCCA                         
     2906                                                                      
        ACCCGGTAAG                                                             
                ACACGACTTA                                                     
                        TCGCCACTGG                                             
                                CAGCAGCCAC                                     
                                        TGGTAACAGG                             
     2956                                                                      
        ATTAGCAGAG                                                             
                CGAGGTATGT                                                     
                        AGGCGGTGCT                                             
                                ACAGAGTTCT                                     
                                        TGAAGTGGTG                             
     3006                                                                      
        GCCTAACTAC                                                             
                GGCTACACTA                                                     
                        GAAGGACAGT                                             
                                ATTTGGTATC                                     
                                        TGCGCTCTGC                             
     3056                                                                      
        TGAAGCCAGT                                                             
                TACCTTCGGA                                                     
                        AAAAGAGTTG                                             
                                GTAGCTCTTG                                     
                                        ATCCGGCAAA                             
     3106                                                                      
        CAAACCACCG                                                             
                CTGGTAGCGG                                                     
                        TGGTTTTTTT                                             
                                GTTTGCAAGC                                     
                                        AGCAGATTAC                             
     3156                                                                      
        GCGCAGAAAA                                                             
                AAAGGATCTC                                                     
                        AAGAAGATCC                                             
                                TTFGATCTTT                                     
                                        TCTACGGGGT                             
     3206                                                                      
        CTGACGCTCA                                                             
                GTGGAACGAA                                                     
                        AACTCACGTT                                             
                                AAGGGATTTT                                     
                                        GGTCATGAGA                             
     3256                                                                      
        TTATCAAAAA                                                             
                GGATCTTCAC                                                     
                        CTAGATCCTT                                             
                                TTAAATTAAA                                     
                                        AATGAAGTTT                             
     3306                                                                      
        TAAATCAATC                                                             
                TAAAGTATAT                                                     
                        ATGAGTAAAC                                             
                                TTGGTCTGAC                                     
                                        AGTTACCAAT                             
     3356                                                                      
        GCTTAATCAG                                                             
                TGAGGCACCT                                                     
                        ATCTCAGCGA                                             
                                TCTGTCTATT                                     
                                        TCGTTCATCC                             
     3406                                                                      
        ATAGTTGCCT                                                             
                GACTCCCCGT                                                     
                        CGTGTAGATA                                             
                                ACTACGATAC                                     
                                        GGGAGGGCTT                             
     3456                                                                      
        ACCATCTGGC                                                             
                CCCAGTGCTG                                                     
                        CAATGATACC                                             
                                GCGAGACCCA                                     
                                        CGCTCACCGG                             
     3506                                                                      
        CTCCAGATTT                                                             
                ATCAGCAATA                                                     
                        AACCAGCCAG                                             
                                CCGGAAGGGC                                     
                                        CGAGCGCAGA                             
     3556                                                                      
        AGTGGTCCTG                                                             
                CAACTTTATC                                                     
                        CGCCTCCATC                                             
                                CAGTCTATTA                                     
                                        ATTGTTGCCG                             
     3606                                                                      
        GGAAGCTAGA                                                             
                GTAAGTAGTT                                                     
                        CGCCAGTTAA                                             
                                TAGTTTGCGC                                     
                                        AACGTTGTTG                             
     3656                                                                      
        CCATTGCTGC                                                             
                AGGCATCGTG                                                     
                        GTGTCACGCT                                             
                                CGTCGTTTGG                                     
                                        TATGGCTTCA                             
     3706                                                                      
        TTCAGCTCCG                                                             
                GTTCCCAACG                                                     
                        ATCAAGGCGA                                             
                                GTTACATGAT                                     
                                        CCCCCATGTT                             
     3756                                                                      
        GTGCAAAAAA                                                             
                GCGGTTAGCT                                                     
                        CCTTCGGTCC                                             
                                TCCGATCGTT                                     
                                        GTCAGAAGTA                             
     3806                                                                      
        AGTTGGCCGC                                                             
                AGTGTTATCA                                                     
                        CTCATGGTTA                                             
                                TGGCAGCACT                                     
                                        GCATAATTCT                             
     3856                                                                      
        CTTACTGTCA                                                             
                TGCCATCCGT                                                     
                        AAGATGCTTT                                             
                                TCTGTGACTG                                     
                                        GTGAGTACTC                             
     3906                                                                      
        AACCAAGTCA                                                             
                TTCTGAGAAT                                                     
                        AGTGTATGCG                                             
                                GCGACCGAGT                                     
                                        TGCTCTTGCC                             
     3956                                                                      
        CGGCGTCAAC                                                             
                ACGGGATAAT                                                     
                        ACCGCGCCAC                                             
                                ATAGCAGAAC                                     
                                        TTTAAAAGTG                             
     4006                                                                      
        CTCATCATTG                                                             
                GAAAACGTTC                                                     
                        TTCGGGGCGA                                             
                                AAACTCTCAA                                     
                                        GGATCTTACC                             
     4056                                                                      
        GCTGTTGAGA                                                             
                TCCAGTTCGA                                                     
                        TGTAACCCAC                                             
                                TCGTGCACCC                                     
                                        AACTGATCTT                             
     4106                                                                      
        CAGCATCTTT                                                             
                TACTTTCACC                                                     
                        AGCGTTTCTG                                             
                                GGTGAGCAAA                                     
                                        AACAGGAAGG                             
     4156                                                                      
        CAAAATGCCG                                                             
                CAAAAAAGGG                                                     
                        AATAAGGGCG                                             
                                ACACGGAAAT                                     
                                        GTTGAATACT                             
     4206                                                                      
        CATACTCTTC                                                             
                CTTTTTCAAT                                                     
                        ATTATTGAAG                                             
                                CATTTATCAG                                     
                                        GGTTATTGTC                             
     4256                                                                      
        TCATGAGCGG                                                             
                ATACATATTT                                                     
                        GAATGTATTT                                             
                                AGAAAAATAA                                     
                                        ACAAATAGGG                             
     4306                                                                      
        GTTCCGCGCA                                                             
                CATTTCCCCG                                                     
                        AAAAGTGCCA                                             
                                CCTGACGTCT                                     
                                        AAGAAACCAT                             
     4356                                                                      
        TATTATCATG                                                             
                ACATTAACCT                                                     
                        ATAAAAATAG                                             
                                GCGTATCACG                                     
                                        AGGCCCTTTC                             
     4406                                                                      
        GTCCC                                                                  
     __________________________________________________________________________

(Plasmid pBR 327 is described in Gene, 9, 287-305 (1980))

This strain E. coli RB 791/p922 was set up in preculture overnight at 30.degree. C. with stirring at 200 rpm on L medium (Luria broth described in Molecular Cloning, A Laboratory Manual Sambrook, Fritsch, Maniatis; Cold Spring Harbor Laboratory Press, 2nd edition 1989) containing 100 mg/l of ampicillin. From this preculture, a further flask of L medium was inoculated such that the initial OD (OD=optical density at 600 nm, OD=1 corresponds to 400-450 mg biomass/liter) was 0.6. After waiting for one hour, the culture was induced with 1 mM IPTG (isopropyl .beta.-D-1-thiogalactopyranoside) and culturing was continued for 3 hours. The samples of the bacterial suspension were centrifuged and the bacterial pellets thus recovered were suspended in the extraction buffers below, such that the final OD was 10, this being equivalent to 4.5 g biomass/liter, at the time of extraction.

The extraction buffers used in this example are the following:

A: 0.8M arginine pH 8.0 corrected with HCl in Milli-Q.RTM. water (Millipore)

B: 5M guanidine.HCl in Milli-Q.RTM. water without pH correction.

Extraction was performed in 1 hour at 4.degree. C. with gentle magnetic stirring.

To measure the efficiency of extraction, samples equivalent to 1 ml of culture suspension with an OD of 0.2 were removed, and the corresponding bacterial pellets obtained by centrifugation at 5,000 g for 10 min were applied to 16.5% polyacrylamide gel after denaturation with SDS. The bacterial suspensions were also centrifuged and their supernatants were desalted by ultrafiltration (Millipore Ultrafree-MC filtration device with a cut-off threshold of 5,000 Da) before being applied to gel. The gel itself was visualized by Western blotting using an anti-CHO IL-13 antibody and quantified with a PhosphorImager.RTM. (Molecular Dynamics). The anti-CHO (Chinese hamster ovary) IL-13 antibody used in this example was obtained by immunizing rabbits.

It was found in this example that extraction in the presence of guanidine.HCl or alternatively in the presence of arginine is virtually complete for the mature form, with extraction yields greater than 99% in both cases. It was also noted that, in the supernatant extracted in the presence of arginine, the precursor form of IL-13 is not seen, in distinction to the extract obtained in the presence of guanidine.HCl.

2/Fermenter culture

E. coli strain RB 791/p922 was set up on L medium with 100 mg/l ampicillin and incubated at 30.degree. C. with stirring to constitute a preculture. A 100 ml volume of this preculture was used as inoculum for an MBR brand fermenter of total volume 2.5 liters. Culturing was performed in a volume of 1.2 liters on a medium whose composition is given below and under the conditions defined below.

Medium for fermenter--E. coli strain RB 791/p922

The formula is given for 1 liter final, the volume of the inoculum is to be subtracted.

  ______________________________________                                    
     1. Dissolve in 700 ml of Milli-O .RTM. water:                             
     Component       Mass/liter                                                
     ______________________________________                                    
     EDTA                  1      g                                            
     FeSO.sub.4.7H.sub.2 O 45     mg                                           
     MgSO.sub.4.7H.sub.2 O 1.5    g                                            
     K.sub.2 SO.sub.4      0.75   g                                            
     CaCl.sub.2.2H.sub.2 O 32     mg                                           
     NaCl                  1.45   g                                            
     KCl                   5      g                                            
     HY-SOY .RTM.          75     g                                            
     L-methionine          1.4    g                                            
     Tryptophan            1      g                                            
     Trace elements*       2      ml                                           
     Yeast extract         10     g                                            
     ______________________________________                                    

Make to 800 ml with Milli-Q.RTM. water, autoclave min at 120.degree. C.

  ______________________________________                                    
     2. Filter through 0.2 .mu.m in 100 ml of Milli-O .RTM.                    
     water:                                                                    
            Glycerol       15    g                                             
            K.sub.2 HPO.sub.4                                                  
                           7.1   g                                             
     ______________________________________                                    

The glycerol concentration will be maintained at between 10 and 15 g/l during culture.

  ______________________________________                                    
     3. At the time of induction add:                                          
     IPTG                  1      g                                            
     6-Aminocaproic        0.65   g                                            
     acid                                                                      
     HY-SOY .RTM.          40     g                                            
     L-cysteine            0.3    g                                            
     ______________________________________                                    

The volume of this addition is not included in the other calculations.

*Solution of trace elements

This is used in the proportion of 1 ml/liter.

For 1 liter of Milli-Q.RTM. water final, dissolve in 800 ml:

  ______________________________________                                    
                    mass/l                                                     
     ______________________________________                                    
     H.sub.3 BO.sub.3      3      mg                                           
     NaMoO.sub.4.2H.sub.2 O                                                    
                           4.8    mg                                           
     MnSO.sub.4.H.sub.2 O  59     mg                                           
     CoCl.sub.2.6H.sub.2 O 23.8   mg                                           
     CuSO.sub.4.5H.sub.2 O 8.7    mg                                           
     ZnSO.sub.4.7H.sub.2 O 13     mg                                           
     AlCl.sub.3.6H.sub.2 O 60     mg                                           
     KCr(SO.sub.4).sub.2.12H.sub.2 O                                           
                           6      mg                                           
     KI (added at the      60     mg                                           
     time of use)                                                              
     NiSO.sub.4.6H.sub.2 O 2.6    mg                                           
     ______________________________________                                    

Add 100 ml of concentrated HCl. Make to 1000 ml with Milli-Q.RTM. water.

When the OD has reached 58, the expression of IL-13 is triggered by the addition of IPTG at a concentration of 1 g/l and continued for 5 hours.

The fermenter culture parameters were as follows:

pH=7.4

T=30.degree. C.

pO.sub.2 =40 mm Hg regulated by stirring, with a flow rate of air of between 1 and 3 liters/min.

The methods of extraction and of measurement of the biological activity which are applied are the same as those described in section 1 above.

It is found that extraction--on a bacterial pellet obtained in a fermenter, no longer in a flask--in the presence of guanidine.HCl or alternatively in the presence of arginine is virtually complete for the mature form of IL-13, with extraction yields of greater than 97% in both cases.

EXAMPLE 2

Biological activity of the IL-13 thus extracted

The extracts obtained in the presence of guanidine.HCl or of arginine in Example 1 were desalted by ultrafiltration as described above. After serial dilution, they were brought into contact with an IL-13-dependent subclone of the B9 cell line. The IL-13 activity of the diluted samples induces the growth of B9 cells, and the half-proliferation concentration was determined. Cell growth was stopped after 3 days of contact by adding MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide), and measured in a spectrophotometer by the absorption of the blue colouration produced at 565 nm. The IL-13 biological activity was expressed in ng/ml relative to an IL-13 standard which was itself calibrated against the candidate international standard, obtained from an CHO IL-13 culture, obtained by immunizing rabbits according to N. Vita, Archives of Biochemistry and Biophysics, 1983, 225, 2, 436-445.

                TABLE II                                                    
     ______________________________________                                    
     Trial on B9        Biological activity                                    
                                     Specific biological                       
     cell line                                                                 
             IL-13 in ng/ml                                                    
                        in ng/ml     activity                                  
     ______________________________________                                    
     Control   500        500        100                                       
     Arginine                                                                  
             3,200      1,376        43                                        
     Guanidine                                                                 
             4,300      1,098        25                                        
     ______________________________________                                    

The above results show that the specific biological activity of the arginine extract is, before any other subsequent purification operation, greater than that of the guanidine hydrochloride extract.

EXAMPLE 3

Extraction of periplasmic hGH from E. coli in the presence of arginine on cell pellet

The strain SEBR 1250 (EP-360,641 and EP-356,335) was set up in preculture overnight at 37.degree. C. with stirring at 200 rpm on L medium (Luria broth) containing 100 mg/l of ampicillin. From this pre-culture, a further flask of L medium was inoculated such that the initial OD was 0.2. After waiting for one hour, the culture was induced with 1 mM IPTG and culturing was continued for 3 hours. The samples of the bacterial suspension were centrifuged, and the bacterial pellets thus recovered were suspended in the extraction buffers such that the final OD was 10, this being equivalent to .about.4.5 g biomass/liter, at the time of extraction.

The extraction conditions were as follows:

  ______________________________________                                    
     Chaotropic agent                                                          
                  pH        T       time                                       
     ______________________________________                                    
     0.8M Arginine                                                             
                  8.0       22.degree. C.                                      
                                    20 hours                                   
     0.8M Arginine                                                             
                  8.0        4.degree. C.                                      
                                    20 hours                                   
     ______________________________________                                    

To measure the efficacy of extraction, samples equivalent to 1 ml of culture suspension with an OD of 0.2 were removed, and the corresponding bacterial pellets obtained by centrifugation at 5,000 g for 10 minutes were applied to 16.5% polyacrylamide gel after denaturation with SDS. The bacterial suspensions were also centrifuged and their supernatants applied to gel. The gel itself was visualized by Western blotting using an anti-hGH antibody, and quantified with a PhosphorImager.RTM. (Molecular Dynamics). The anti-hGH antibodies used were obtained by immunizing rabbits.

Analysis of the bands obtained with the PhosphorImager.RTM. enables the conclusion to be drawn that the extraction of human periplasmic hGH produced in E. coli in the presence of arginine is efficient. In this example, a yield of at least 60% may be achieved in the presence of 0.8M arginine, pH 8.0, T 22.degree. C. and a period of 20 hours, and an extraction yield of greater than 80% may be achieved in the presence of 0.8M arginine, pH 8.0, T 4.degree. C. and a period of 20 hours.

Since hGH is a hydrophilic protein, it may be concluded from this that recombinant proteins differing greatly in nature, accumulated in the periplasm of E. coli, may be extracted simply in the presence of arginine.

EXAMPLE 4

Extraction of periplasmic IL-13 from E. coli on cell debris in the presence of arginine

1/ Fermenter culture

In this example, E. coli strain TP2339 (EP 360,641 and EP 356,335), transformed with plasmid p922 obtained according to methods similar to those defined in EXAMPLE 1 was used.

E. coli strain TP2339/p922 was set up on L medium with 100 mg/l ampicillin and incubated at 30.degree. C. with stirring to constitute a preculture. A 100 ml volume of this preculture was used as inoculum for an MBR.RTM. brand fermenter of total volume 2.5 liters. Culturing was performed in a volume of 1.2 liters in a medium and under conditions defined below.

Medium for fermenter--E. coli strain TP2339/p922

Calculated for a final volume of 1.2 liters, the culture medium consists of the addition of one liter of autoclaved phase and 0.1 liter of filtered phase whose compositions are described below, and of 0.1 liter of preculture defined above.

1/ Autoclaved phase(1000 ml)

Dissolve in 900 ml of Milli-Q.RTM. water:

  ______________________________________                                    
                   Mass/l                                                      
     ______________________________________                                    
     Tricine         360          mg                                           
     FeSO.sub.4.7H.sub.2 O                                                     
                     280          mg                                           
     CaCl.sub.2.2H.sub.2 O                                                     
                     6.7          mg                                           
     MgCl.sub.2.6H.sub.2 O                                                     
                     1.27         g                                            
     K.sub.2 SO.sub.4                                                          
                     8.71         g                                            
     NaCl            500          mg                                           
     KCl             5            g                                            
     Hy-Case(SF) .RTM.                                                         
                     25           g                                            
     Yeast extract   18           g                                            
     Trace elements* 1            ml                                           
     L-arginine      1.5          g                                            
     ______________________________________                                    

Adjust the pH to 7.4 with KOH solution and then make to 1000 ml with Milli-Q.RTM. water. Autoclave 30 minutes at 120.degree. C.

2/ Filtered phase (100 ml)

Filter under sterile conditions through a 0.2 .mu.m membrane:

  ______________________________________                                    
            Glucose                                                            
                   20            g                                             
            Glycerol                                                           
                   50            g                                             
            K.sub.2 HPO.sub.4                                                  
                   5             g                                             
     ______________________________________                                    

The glucose concentration will be maintained during culturing at a concentration of between 5 and 15 g/l.

When the OD has reached 40 (approximately 16 g of dry matter/liter), the expression of IL-13 is triggered by the addition of IPTG at a concentration of 1 g/l and continued for 5 hours. The culture parameters were as follows:

pH=7.4 regulated with 3N HCl and KOH

T=37.degree. C.

pO.sub.2 =50 mbar regulated by stirring, with a flow rate of air of between 1 and 3 liters/min.

2/ Recovery and grinding of the bacterial bodies

One liter of culture suspension is centrifuged for 20 minutes at -6400 g. The pellet is taken up in the same volume of 10 mM Tris buffer, 1 mM EDTA, 1 mg/l pepstatin, pH 8, with mechanical stirring using a propeller-type paddle.

Grinding is accomplished in a Manton-Gaulin press at a pressure of 700 bars in two runs. The ground preparation as it is may be stored at -80.degree. C. in this example.

3/ Extraction

After thawing, 5 ml of the ground preparation with an OD equal to 75 (30 g of dry matter/liter) are removed and then centrifuged for 50 minutes at 23,300 g.

The pellet thereby obtained is taken up in one third of the initial volume with 0.1 mM Tris buffer, pH 7.0, and then made to the initial volume with a solution containing arginine such that the final arginine concentration is 2.5M and the pH 8.0.

For this example, an auxiliary detergent (Hecameg.RTM. at a final concentration of 20 g/l) was combined with the arginine.

The suspension of cell debris made up in this way is placed at 4.degree. C. on a rotary stirrer at 300 rpm for 2 days.

The suspension is then centrifuged a final time for 50 minutes at 23,300 g, the supernatant constituting the expected extract.

4/ Biochemical analysis and analysis of biological activity

a) Assay of total proteins was performed by the Biorad.RTM. "Protein Assay" method.

b) The method of assay of recombinant IL-13 is that used in Example 1.

Yield of IL-13 thus extracted: the results obtained are described in the following table:

  ______________________________________                                    
                 In the suspension                                             
                           In the                                              
                 of cell debris                                                
                           supernatant after                                   
                 before extraction                                             
                           extraction                                          
     ______________________________________                                    
     Total proteins                                                            
                   324     .mu.g/ml                                            
                                   108    .mu.g/ml                             
     Recombinant IL-13                                                         
                   575     ng/ml   390    ng/ml                                
     ______________________________________                                    

It was found in this example that the extraction carried out on cell debris in the presence of 2.5M arginine and an auxiliary detergent enabled an extraction yield of approximately 70% to be obtained.

EXAMPLE 5

Expression of IL-13 in the presence of arginine in the culture medium

E. coli strain RB 791/p922 was cultured on L medium with 100 mg/l ampicillin in the presence of different concentrations of arginine. Induction was triggered 1 hour after inoculation by the addition of 1 mM IPTG, and culturing was continued for 3 hours.

The samples of bacterial pellets--equivalent to 1 ml of culture suspension with an OD of 0.2--and the corresponding samples of supernatant were applied to gel, visualized and quantified as described above. The results are given in the table below:

  ______________________________________                                    
     Sample       OD end of culture                                            
                              IL-13 in ng/l OD 1                               
     ______________________________________                                    
     Control      1.17        388                                              
     Arginine 2 g/l                                                            
                  1.24        455                                              
     Arginine 4 g/l                                                            
                  1.24        600                                              
     Arginine 8 g/l                                                            
                  1           720                                              
     ______________________________________                                    

It is apparent that, under the experimental conditions and in the expression system in question:

arginine increases the expression of periplasmic IL-13 from 2 g/l, and substantially from 4, g/l

growth of the bacterium is slowed down at a concentration of 8 g/l

at these concentrations, arginine does not cause leakage of IL-13 into the supernatant.

The value of the arginine extraction method according to the invention is the ability to use protein extracts as they are or with a minimum of treatment in tests of biological activity.

This simplification of the extraction method affords an advantage both for the industrial production of recombinant periplasmic proteins, and for screening by assaying the biological activity on the laboratory scale in relation, for example, to mutated proteins.

In distinction to guanidine.HCl, frequently used as extraction agent, arginine does not attack the materials employed in industry, in particular steels. Furthermore, arginine is a non-polluting agent, which thus does not require an expensive effluent treatment process.

The value of expressing a periplasmic protein in the presence of arginine at concentrations equal to at least 2 g/l, and especially at concentrations of between 2 g/l and 10 g/l, in the culture medium is demonstrated by the increase in the yield of secreted recombinant protein obtained in vivo.

  __________________________________________________________________________
     SEQUENCE LISTING                                                          
     (1) GENERAL INFORMATION:                                                  
     (iii) NUMBER OF SEQUENCES: 9                                              
     (2) INFORMATION FOR SEQ ID NO: 1:                                         
     (i) SEQUENCE CHARACTERISTICS:                                             
     (A) LENGTH: 4410 base pairs                                               
     (B) TYPE: nucleic acid                                                    
     (C) STRANDEDNESS: single                                                  
     (D) TOPOLOGY: linear                                                      
     (ii) MOLECULE TYPE: DNA (genomic)                                         
     (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 1:                                  
     TCGAGTGGGTTTGAGGCGATCACACTTCTGTTAACGCAGAACCTAAACGCATCTCGACTG60            
     CACGGTGCACCAATGCTTCTGGCGTCAGGCAGCCATCGGAAGCTGTGGTATGGCTGTGCA120           
     GGTCGTAAATCACTGCATAATTCGTGTCGCTCAAGGCGCACTCCCGTTCTGGATAATGTT180           
     TTTTGCGCCGACATCATAACGGTTCTGGCAAATATTCTGAAATGAGCTGTTTCGAGCTGA240           
     CTGACTGTTGCTTATATTACATCGATAGCGTATAATGTGTGGAATTGTGAGCGGATAACA300           
     ATTTCACACAGTTTTTCGCGAAGAAGGAGATATACATATGAAAAAGATCCTGGCGTTAGC360           
     TGCGCTGACTACCGTTGTATTCTCTGCGTCCGCCTTCGCTGGCCCTGTGCCTCCCAGTAC420           
     TGCCCTCAGGGAGCTCATTGAGGAGCTGGTCAACATCACCCAGAACCAGAAGGCTCCGCT480           
     CTGCAATGGCAGCATGGTATGGAGCATCAACCTGACAGCTGGCATGTACTGTGCAGCCCT540           
     GGAATCCCTGATCAACGTGTCAGGCTGCAGTGCCATCGAGAAGACCCAGAGGATGCTGAG600           
     CGGATTCTGCCCGCACAAGGTCTCAGCTGGGCAGTTTTCCAGCTTGCATGTCCGAGACAC660           
     CAAAATCGAGGTGGCCCAGTTTGTAAAGGACCTGCTCTTACATTTAAAGAAACTTTTTCG720           
     CGAGGGACGGTTCAACTGAAACTTCGAAAGCATCATTATTTGGGATCCGGCTGCTAACAA780           
     AGCCCGAAAGGAAGCTGAGTTGGCTGCTGCCACCGCTGAGCAATAACTAGCATAACCCCT840           
     TGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTGCTGAAAGGAGGAACTATATCCGGATG900           
     TACCAAGCTTGGCCGGATCAAAGTTTTGTCGTCTTTCCAGACGTTAGTAAATGAATTTTC960           
     TGTATGAGGTTTTGCTAAACAACTTTCAACAGTTTCAGCGGAGTGAGAATAGAAAGGAAC1020          
     AACTAAAGGAATTGCGAATAATAATTTTTTCACGTTGAAAATCTCCAAAAAAAAAGGCTC1080          
     CAAAAGGAGCCTTTAATTGTATCGGTTTATCAGCTTGCTTTCGAGGTGAATTTCTTAAAC1140          
     AGCTTGATACCGATAGTTGCGCCGACAATGACAACAACCATCGCCCACGCATAACCGATA1200          
     TATTCGGTCGCTGAGGCTTGCAGGGAGTCAAAGGCCGCTTTTGCGGGATCGATCCGCGGA1260          
     AGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTG1320          
     CGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGC1380          
     CAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCCAGGGTGGTTTTTCTTTTCACCAG1440          
     TGAGACGGGCAACAGCTGATTGCCCTTCACCGCCTGGCCCTGAGAGAGTTGCAGCAAGCG1500          
     GTCCACGCTGGTTTGCCCCAGCAGGCGAAAATCCTGTTTGCTGGTGGTTAACGGCGGGAT1560          
     ATAACATGAGCTGTCTTCGGTATCGTCGTATCCCACTACCGAGATATCCGCACCAACGCG1620          
     CAGCCCGGACTCGGTAATGGCGCGCATTGCGCCCAGCGCCATCTGATCGTTGGCAACCAG1680          
     CATCGCAGTGGGAACGATGCCCTCATTCAGCATTTGCATGGTTTGTTGAAAACCGGACAT1740          
     GGCACTCCAGTCGCCTTCCCGTTCCGCTATCGGCTGAATTTGATTGCGAGTGAGATATTT1800          
     ATGCCAGCCAGCCAGACGCAGACGCGCCGAGACAGAACTTAATGGGCCCGCTAACAGCGC1860          
     GATTTGCTGGTGACCCAATGCGACCAGATGCTCCACGCCCAGTCGCGTACCGTCTTCATG1920          
     GGAGAAAATAATACTGTTGATGGGTGTCTGGTCAGAGACATCAAGAAATAACGCCGGAAC1980          
     ATTAGTGCAGGCAGCTTCCACAGCAATGGCATCCTGGTCATCCAGCGGATAGTTAATGAT2040          
     CAGCCCACTGACGCGTTGCGCGAGAAGATTGTGCACCGCCGCTTTACAGGCTTCGACGCC2100          
     GCTTCGTTCTACCATCGACACCACCACGCTGGCACCCAGTTGATCGGCGCGAGATTTAAT2160          
     CGCCGCGACAATTTGCGACGGCGCGTGCAGGGCCAGACTGGAGGTGGCAACGCCAATCAG2220          
     CAACGACTGTTTGCCCGCCAGTTGTTGTGCCACGCGGTTGGGAATGTAATTCAGCTCCGC2280          
     CATCGCCGCTTCCACTTTTTCCCGCGTTTTCGCAGAAACGTGGCTGGCCTGGTTCACCAC2340          
     GCGGGAAACGGTCTGATAAGAGACACCGGCATACTCTGCGACATCGTATAACGTTACTGG2400          
     TTTCACATTCACCACCCTGAATTGACTCTCTTCCGGGCGCTATCATGCCATACCGCGAAA2460          
     GGTTTTGCGCCATTCGATCTACGCCGGACGCATCGTGGCCGCAAACCAACCCTTGGCAGA2520          
     ACATATCCATCGCGTCCGCCATCTCCAGCAGCCGCACGCGGCGCATCTCGGGCCGCGTTG2580          
     CTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGT2640          
     CAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCC2700          
     CTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCT2760          
     TCGGGAAGCGTGGCGCTTTCTCAATGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTC2820          
     GTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTA2880          
     TCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCA2940          
     GCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAG3000          
     TGGTGGCCTAACTACGGCTACACTAGAAGGACAGTATTTGGTATCTGCGCTCTGCTGAAG3060          
     CCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGT3120          
     AGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAA3180          
     GATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGG3240          
     ATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGA3300          
     AGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTA3360          
     ATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTC3420          
     CCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATG3480          
     ATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGA3540          
     AGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGT3600          
     TGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATT3660          
     GCTGCAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCC3720          
     CAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTC3780          
     GGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCA3840          
     GCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAG3900          
     TACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCG3960          
     TCAACACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAA4020          
     CGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAA4080          
     CCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGA4140          
     GCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGA4200          
     ATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATG4260          
     AGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTT4320          
     CCCCGAAAAGTGCCACCTGACGTCTAAGAAACCATTATTATCATGACATTAACCTATAAA4380          
     AATAGGCGTATCACGAGGCCCTTTCGTCCC4410                                        
     (2) INFORMATION FOR SEQ ID NO: 2:                                         
     (i) SEQUENCE CHARACTERISTICS:                                             
     (A) LENGTH: 282 base pairs                                                
     (B) TYPE: nucleic acid                                                    
     (C) STRANDEDNESS: single                                                  
     (D) TOPOLOGY: linear                                                      
     (ii) MOLECULE TYPE: DNA (genomic)                                         
     (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 2:                                  
     TCGAGTGGGTTTGAGGCGATCACACTTCTGTTAACGCAGAACCTAAACGCATCTCGACTG60            
     CACGGTGCACCAATGCTTCTGGCGTCAGGCAGCCATCGGAAGCTGTGGTATGGCTGTGCA120           
     GGTCGTAAATCACTGCATAATTCGTGTCGCTCAAGGCGCACTCCCGTTCTGGATAATGTT180           
     TTTTGCGCCGACATCATAACGGTTCTGGCAAATATTCTGAAATGAGCTGTTTCGAGCTGA240           
     CTGACTGTTGCTTATATTACATCGATAGCGTATAATGTGTGG282                             
     (2) INFORMATION FOR SEQ ID NO: 3:                                         
     (i) SEQUENCE CHARACTERISTICS:                                             
     (A) LENGTH: 55 base pairs                                                 
     (B) TYPE: nucleic acid                                                    
     (C) STRANDEDNESS: single                                                  
     (D) TOPOLOGY: linear                                                      
     (ii) MOLECULE TYPE: DNA (genomic)                                         
     (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 3:                                  
     AATTGTGAGCGGATAACAATTTCACACAGTTTTTCGCGAAGAAGGAGATATACAT55                 
     (2) INFORMATION FOR SEQ ID NO: 4:                                         
     (i) SEQUENCE CHARACTERISTICS:                                             
     (A) LENGTH: 425 base pairs                                                
     (B) TYPE: nucleic acid                                                    
     (C) STRANDEDNESS: single                                                  
     (D) TOPOLOGY: linear                                                      
     (ii) MOLECULE TYPE: DNA (genomic)                                         
     (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 4:                                  
     ATGAAAAAGATCCTGGCGTTAGCTGCGCTGACTACCGTTGTATTCTCTGCGTCCGCCTTC60            
     GCTGGCCCTGTGCCTCCCAGTACTGCCCTCAGGGAGCTCATTGAGGAGCTGGTCAACATC120           
     ACCCAGAACCAGAAGGCTCCGCTCTGCAATGGCAGCATGGTATGGAGCATCAACCTGACA180           
     GCTGGCATGTACTGTGCAGCCCTGGAATCCCTGATCAACGTGTCAGGCTGCAGTGCCATC240           
     GAGAAGACCCAGAGGATGCTGAGCGGATTCTGCCCGCACAAGGTCTCAGCTGGGCAGTTT300           
     TCCAGCTTGCATGTCCGAGACACCAAAATCGAGGTGGCCCAGTTTGTAAAGGACCTGCTC360           
     TTACATTTAAAGAAACTTTTTCGCGAGGGACGGTTCAACTGAAACTTCGAAAGCATCATT420           
     ATTTG425                                                                  
     (2) INFORMATION FOR SEQ ID NO: 5:                                         
     (i) SEQUENCE CHARACTERISTICS:                                             
     (A) LENGTH: 50 base pairs                                                 
     (B) TYPE: nucleic acid                                                    
     (C) STRANDEDNESS: single                                                  
     (D) TOPOLOGY: linear                                                      
     (ii) MOLECULE TYPE: DNA (genomic)                                         
     (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 5:                                  
     GGATCCGGCTGCTAACAAAGCCCGAAAGGAAGCTGAGTTGGCTGCTGCCA50                      
     (2) INFORMATION FOR SEQ ID NO: 6:                                         
     (i) SEQUENCE CHARACTERISTICS:                                             
     (A) LENGTH: 200 base pairs                                                
     (B) TYPE: nucleic acid                                                    
     (C) STRANDEDNESS: single                                                  
     (D) TOPOLOGY: linear                                                      
     (ii) MOLECULE TYPE: DNA (genomic)                                         
     (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 6:                                  
     CCGCTGAGCAATAACTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTT60            
     TGCTGAAAGGAGGAACTATATCCGGATGTACCAAGCTTGGCCGGATCAAAGTTTTGTCGT120           
     CTTTCCAGACGTTAGTAAATGAATTTTCTGTATGAGGTTTTGCTAAACAACTTTCAACAG180           
     TTTCAGCGGAGTGAGAATAG200                                                   
     (2) INFORMATION FOR SEQ ID NO: 7:                                         
     (i) SEQUENCE CHARACTERISTICS:                                             
     (A) LENGTH: 241 base pairs                                                
     (B) TYPE: nucleic acid                                                    
     (C) STRANDEDNESS: single                                                  
     (D) TOPOLOGY: linear                                                      
     (ii) MOLECULE TYPE: DNA (genomic)                                         
     (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 7:                                  
     AAAGGAACAACTAAAGGAATTGCGAATAATAATTTTTTCACGTTGAAAATCTCCAAAAAA60            
     AAAGGCTCCAAAAGGAGCCTTTAATTGTATCGGTTTATCAGCTTGCTTTCGAGGTGAATT120           
     TCTTAAACAGCTTGATACCGATAGTTGCGCCGACAATGACAACAACCATCGCCCACGCAT180           
     AACCGATATATTCGGTCGCTGAGGCTTGCAGGGAGTCAAAGGCCGCTTTTGCGGGATCGA240           
     T241                                                                      
     (2) INFORMATION FOR SEQ ID NO: 8:                                         
     (i) SEQUENCE CHARACTERISTICS:                                             
     (A) LENGTH: 1252 base pairs                                               
     (B) TYPE: nucleic acid                                                    
     (C) STRANDEDNESS: single                                                  
     (D) TOPOLOGY: linear                                                      
     (ii) MOLECULE TYPE: DNA (genomic)                                         
     (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 8:                                  
     CCGCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATTAAT60            
     TGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATG120           
     AATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCCAGGGTGGTTTTTCTTT180           
     TCACCAGTGAGACGGGCAACAGCTGATTGCCCTTCACCGCCTGGCCCTGAGAGAGTTGCA240           
     GCAAGCGGTCCACGCTGGTTTGCCCCAGCAGGCGAAAATCCTGTTTGCTGGTGGTTAACG300           
     GCGGGATATAACATGAGCTGTCTTCGGTATCGTCGTATCCCACTACCGAGATATCCGCAC360           
     CAACGCGCAGCCCGGACTCGGTAATGGCGCGCATTGCGCCCAGCGCCATCTGATCGTTGG420           
     CAACCAGCATCGCAGTGGGAACGATGCCCTCATTCAGCATTTGCATGGTTTGTTGAAAAC480           
     CGGACATGGCACTCCAGTCGCCTTCCCGTTCCGCTATCGGCTGAATTTGATTGCGAGTGA540           
     GATATTTATGCCAGCCAGCCAGACGCAGACGCGCCGAGACAGAACTTAATGGGCCCGCTA600           
     ACAGCGCGATTTGCTGGTGACCCAATGCGACCAGATGCTCCACGCCCAGTCGCGTACCGT660           
     CTTCATGGGAGAAAATAATACTGTTGATGGGTGTCTGGTCAGAGACATCAAGAAATAACG720           
     CCGGAACATTAGTGCAGGCAGCTTCCACAGCAATGGCATCCTGGTCATCCAGCGGATAGT780           
     TAATGATCAGCCCACTGACGCGTTGCGCGAGAAGATTGTGCACCGCCGCTTTACAGGCTT840           
     CGACGCCGCTTCGTTCTACCATCGACACCACCACGCTGGCACCCAGTTGATCGGCGCGAG900           
     ATTTAATCGCCGCGACAATTTGCGACGGCGCGTGCAGGGCCAGACTGGAGGTGGCAACGC960           
     CAATCAGCAACGACTGTTTGCCCGCCAGTTGTTGTGCCACGCGGTTGGGAATGTAATTCA1020          
     GCTCCGCCATCGCCGCTTCCACTTTTTCCCGCGTTTTCGCAGAAACGTGGCTGGCCTGGT1080          
     TCACCACGCGGGAAACGGTCTGATAAGAGACACCGGCATACTCTGCGACATCGTATAACG1140          
     TTACTGGTTTCACATTCACCACCCTGAATTGACTCTCTTCCGGGCGCTATCATGCCATAC1200          
     CGCGAAAGGTTTTGCGCCATTCGATCTACGCCGGACGCATCGTGGCCGCAAA1252                  
     (2) INFORMATION FOR SEQ ID NO: 9:                                         
     (i) SEQUENCE CHARACTERISTICS:                                             
     (A) LENGTH: 1905 base pairs                                               
     (B) TYPE: nucleic acid                                                    
     (C) STRANDEDNESS: single                                                  
     (D) TOPOLOGY: linear                                                      
     (ii) MOLECULE TYPE: DNA (genomic)                                         
     (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 9:                                  
     CCAACCCTTGGCAGAACATATCCATCGCGTCCGCCATCTCCAGCAGCCGCACGCGGCGCA60            
     TCTCGGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAA120           
     AATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTT180           
     CCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTG240           
     TCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCAATGCTCACGCTGTAGGTATCTC300           
     AGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCC360           
     GACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTA420           
     TCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCT480           
     ACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGGACAGTATTTGGTATC540           
     TGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAA600           
     CAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAA660           
     AAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAA720           
     AACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTT780           
     TTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGAC840           
     AGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCC900           
     ATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGC960           
     CCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATA1020          
     AACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATC1080          
     CAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGC1140          
     AACGTTGTTGCCATTGCTGCAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCA1200          
     TTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAA1260          
     GCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCA1320          
     CTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTT1380          
     TCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGT1440          
     TGCTCTTGCCCGGCGTCAACACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTG1500          
     CTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGA1560          
     TCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACC1620          
     AGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCG1680          
     ACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAG1740          
     GGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGG1800          
     GTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGTCTAAGAAACCATTATTATCATG1860          
     ACATTAACCTATAAAAATAGGCGTATCACGAGGCCCTTTCGTCCC1905                         
     __________________________________________________________________________

Claims

1. In a method for the extraction of recombinant periplasmic proteins, wherein the improvement comprises carrying out the extraction in the presence of arginine.

2. A method for the extraction of a periplasmic protein of interest, which comprises the steps of

(i) culturing a prokaryotic microorganism of the Enterobacteriaceae family transformed with an expression vector containing a gene coding for said protein of interest and means for a periplasmic expression thereof,
(ii) subjecting the resulting culture to centrifugation or microfiltration thereby producing a cell pellet,
(iii) suspending the resulting cell pellet in a buffer solution containing arginine thereby producing a suspension,
(iv) centrifuging the resulting suspension thereby producing a supernatant, and
(v) recovering the protein of interest from the supernatant thereby obtained.

3. The method according to claim 2, wherein the buffer solution containing arginine is an alkaline aqueous solution having an arginine concentration of at least 0.4M.

4. The method according to claim 2, wherein the protein of interest is IL-13.

5. The method according to claim 2, wherein the protein of interest is hGH.

6. The method according to claim 3, wherein the arginine concentration is between 0.4M and 0.8M.

7. The method according to claim 3, wherein the protein of interest is IL-13.

8. The method according to claim 3, wherein the protein of interest is hGH.

9. A method for the extraction of a periplasmic protein of interest, which comprises the steps of

(i) culturing a prokaryotic microorganism of the Enterobacteriaceae family transformed with an expression vector containing a gene coding for said protein of interest and means for a periplasmic expression thereof,
(ii) subjecting the resulting culture to centrifugation or microfiltration thereby producing a cell pellet,
(iii) lysing the cells from the cell pellet thereby obtained and centrifuging the resulting lysate thereby producing a pellet of cell debris,
(iv) suspending the pellet of cell debris thereby obtained in a buffer solution containing arginine thereby producing a suspension,
(v) centrifuging the resulting suspension thereby producing a supernatant, and
(iv) recovering the protein of interest from the supernatant thereby obtained.

10. The method according to claim 9, wherein the buffer solution containing arginine is an alkaline aqueous solution having an arginine concentration of at least 0.4M.

11. The method according to claim 9, wherein the protein of interest is IL-13.

12. The method according to claim 9, wherein the protein of interest is hGH.

13. The method according to claim 10, wherein the arginine concentration is between 0.4M and 2.5M.

14. The method according to claim 10, wherein the protein of interest is IL-13.

15. The method according to claim 10, wherein the protein of interest is hGH.

16. A method for the culture of a prokaryotic microorganism of the Enterobacteriaceae family transformed with an expression vector containing a gene coding for a protein of interest, which comprises culturing said microorganism in the presence of arginine at a concentration of at least 2 g/l.

17. The method according to claim 16, wherein said arginine concentration is between 2 g/l and 10 g/l.

18. The method according to claim 16, wherein the protein of interest is IL-13.

Referenced Cited

Foreign Patent Documents

0 217 379 April 1987 EPX
0 360 641 March 1990 EPX
0 393 725 October 1990 EPX
88 10307 December 1988 WOX
92 22665 December 1992 WOX

Other references

  • Patent Abstracts of Japan, vol. 11 No. 246 (C-439), Aug. 11, 1987 & JP-A-62 051983 (Yoshihide Hagiwara) Mar. 6, 1987. Patent Abstracts of Japan, vol. 11 No. 232 (C-437), 29 Juillet 1987 & JP-A-62 044198 (Hanaka Keizo) Feb. 26, 1987. Dissertation Abstracts International B, vol. 37, No. 5, 1976 pp. 200-201, Brown et al. "Purification by Bioaffinity Chromatography of Two Arginine-Specific Periplasmic Binding Proteins".

Patent History

Patent number: 5700665
Type: Grant
Filed: Jan 31, 1996
Date of Patent: Dec 23, 1997
Assignee: Sanofi (Paris)
Inventors: Richard Legoux (Le Faget), Paul Maldonado (Symphorien d'Ozon), Marc Salome (Castanet Tolosan)
Primary Examiner: George C. Elliott
Assistant Examiner: Robert Schwartzman
Law Firm: Bacon & Thomas
Application Number: 8/594,469

Classifications

Current U.S. Class: 435/712; 435/694; 435/6952; 435/2523
International Classification: C12N 120; C12N 121; C12P 2100;