Genes encoding operon and promoter for branched chain keto acid dehydrogenase of pseudomonas putida and methods
DNA sequences coding for branched chain keto dehydrogenase, a promoter and branched chain keto dehydrogenase, and the promoter are disclosed. Also disclosed are recombinant vectors comprising one of the foregoing DNA sequences, transformed hosts comprising one of the foregoing recombinant vectors, and a method of making the polypeptide encoded by the DNA sequence.
Latest The Board of Regents of the University of Oklahoma Patents:
- SURFACE-MODIFIED DOPED TITANIUM DIOXIDE NANOPARTICLES AND USES
- WELLS HAVING NON-CIRCULAR CROSS-SECTIONS AND METHODS OF USE THEREOF
- TREATMENTS FOR TOBACCO SMOKE-EXPOSED SUBJECTS INFECTED WITH INFLUENZA VIRUS
- 1,5-pentanediol-based polyester compositions with enhanced crystallization rates and methods of manufacture
- Gain-scheduling system and method for improving fan speed control in air handling units
This application is a continuation of U.S. Ser. No. 07/603,781, filed Oct. 19, 1990, entitled GENES ENCODING OPERON AND PROMOTOR FOR BRANCHED CHAIN KETO ACID DEHYDROGENASE OF PSEUDOMONAS PUTIDA AND METHODS, now abandoned, which is a continuation in part application of U.S. Ser. No. 07/498,458 filed Mar. 21, 1990 entitled MOLECULAR CLONING OF GENES ENCODING BRANCHED CHAIN KETO ACID DEHYDROGENASE OF PSEUDOMONAS PUTIDA, now abandoned, which is a continuation of U.S. Ser. No. 07/172,148 filed Mar. 23, 1988 of the same title, now abandoned.
GOVERNMENT SUPPORTThis invention was made with government support under Public Health Service grants AM21737 and GM30428 from the National Institutes of Health. The government has certain rights in this invention.
FIELD OF THE INVENTIONThe present invention relates to DNA coding for branched chain keto dehydrogenase operon and promoter, and methods of use.
SUMMARY OF THE INVENTIONThe present invention comprises an isolated double stranded DNA sequence encoding a polypeptide possessing activity of branched chain keto acid dehydrogenase, and the polypeptide encoded by this sequence. The activity of the branched chain keto acid dehydrogenase is to catalyze the oxidation of branched chain keto acids. Also, the present invention comprises an isolated double stranded DNA sequence useful as a promoter of gene expression in the genus Pseudomonas or Escherichia.
The present invention further comprises a bacterium from the genus Escherichia comprising at least one recombinant vector comprising a gene encoding branched chain keto acid dehydrogenase, and a bacterium from the genus Pseudomonas comprising at least one recombinant vector comprising a promoter of gene expression having the characteristics of the DNA sequence of ATCC 88403.
The present invention further comprises a recombinant expression vector comprising a DNA sequence encoding branched chain keto acid dehydrogenase. The vector is capable of expressing branched chain keto acid dehydrogenase in a transformed microorganism or cell culture. Another recombinant expression vector comprises the DNA sequence of a promoter of gene expression in the genus Pseudomonas or Escherichia having the characteristics of the DNA sequence of ATCC 88403.
Additionally, the present invention comprises a method of producing the polypeptide branched chain keto acid dehydrogenase comprising isolating the gene encoding branched chain keto acid dehydrogenase. The isolated gene is disposed in a vector capable of permitting expression of the gene. The recombinant vector is then disposed in a host capable of permitting expression of the gene and the gene expressed.
BRIEF DESCRIPTION OF THE DRAWINGSFIG. 1 shows a restriction map of the bkd operon (Sequence ID No. 1) and clones. The location of the transcriptional start of the operona is +1. The structural genes are bkdA1=E1&agr; (Sequence ID No. 2), bkdA2=E1&bgr; (Sequence ID No. 3), bkdB=E2 (Sequence ID No. 4), and lpdV=LPD-val (Sequence ID No. 5). ORF indicates the unidentified open reading frame on the strand opposite that encoding the bkd operon (Sequence ID No. 1). Abbreviations for the restriction enzyme sites are: C=ClaI; K=KpnI; P=PstI; sp=SphI; Ss=SstI; Sm=SmaI.
FIG. 2 shows the effect of deletions in the promoter region on bkd promoter (Sequence ID No. 6) activity. Streptomycin resistance was determined by growth on L-agar plus 8 mg streptomycin/ml. Numbers designated either the first (left) or last (right) base of the deletion clone as numbered in Table 2.
FIG. 3 shows the subcloning protocol used to isolate pJRS1 and pJRS2 with the insert of P. putida DNA in opposite orientations.
FIG. 4 shows the restriction maps of plasmids which contain structural genes for branched chain keto acid dehydrogenase THe N-terminal coding region is at the left, and the transcription is from left to right for all structural genes.
DESCRIPTION OF THE PREFERRED EMBODIMENTSBranched chain keto acid dehydrogenase is a multienzyme complex which catalyzes the oxidation of branched chain keto acids formed by the transamination of branched chain amino acids. This enzyme is induced in Pseudomonas putida and Pseudomonas aeruginosa by growth in media containing branched chain amino acids or branched chain keto acids, the latter being the true inducers. Branched chain keto acid dehydrogenase purified from P. putida or P. aeruginosa consists of three functional components, E1 (Sequence ID No. 2 and Sequence ID No. 3), E2 (Sequence ID No. 4), and E3 (Sequence ID No. 5).
The E1 component (Sequence ID No. 2 and Sequence ID No. 3) consists of two nonidentical subunits, E1&agr; (Sequence No. 2) and E1&agr; (Sequence ID No. 3), and catalyzes the oxidative decarboxylation of the keto acid substrates. The E2 component (Sequence ID No. 4) contains covalently bound lipoic acid which is reduced by E1 and to which the acyl agroup becomes attached. The E3 component (Sequence ID No. 5) of Pseudomonas branched chain keto acid dehyrogenase is a specific lipoamide dehydrogenase named LPD-val since it is induced in media containing valine or other branched chain amino acids.
The present invention comprises the gene that encodes for branched chain keto acid dehydrogenase (hereafter “bkad gene”) produced by recombinant DNA techniques. By using the recombinant bkad gene, branched chain keto acid dehydrogenase can now be economically produced.
The present invention also comprises the bkad gene and any promoter which expresses the gene of the present invention. One example of a promoter of the present invention is the promoter normally found in Pseudomonas putida which expresses the bkad gene (herafter “bkad promoter”). The bkad promoter (Sequence ID No. 6) may also be used to express homologous and heterologous genes in Pseudomonas for genes other than bkad genes.
The genus Pseudomonas can be a better host for use in recombinant DNA techniques than the genus Escherichia. Many genes expressed in E. coli, the usual host used for recombinant DNA procedures, produce proteins that are insoluble and improperly folded. In order to retrieve the protein of interest, the protein must be dissolved in denaturing agents and slowly allowed to refold. Rarely does the protein fold in the proper configuration due to the presence of granules, therefore, the advantage of over-expression is lost. In a preferred embodiment, genes expressed from the bkad promoter (Sequence ID No. 6) expressed in Pseudomonas putida at least ten-fold greater than when expressed from the &bgr;-lactamase promoter of pKT230 and 50-100 fold greater than in the wild type organism of Pseudomonas putida.
The gene of interest could be inserted immediately behind the bkad promoter (Sequence ID No. 6) and leader of the present invention which would control the expression of this gene. The resulting plasmid would then be transferred to a Pseudomonas host such as Pseudomonas putida grown in a simple medium such as L-broth, which would result in high expression of the gene of interest without forming granules.
Some examples of recombinant plasmids constructed in accordance with the present invention are pJRS54, pJRS55 and pSS1-1. pJRS54 comprises an insert of Pseudomonas putida genomic DNA comprising the promoter, leader, ribosome binding site and the four structural genes of the branched chain keto acid dehydrogenase operon. The vector is pUC19 and the host is Escherichia coli DH5&agr;. pJRS54 has been deposited in the American Type Culture Collection at Rockville, Md. under number ATCC 68405.
pJRS55 comprises the promoter, leader, ribosome binding site and the coding sequence of the four N-terminal amino acids of the first protein encoded by the branched chain keto acid dehydrogenase operon. The vector is pKT240 and the host is Escherichia coli DH5&agr;. pJRS55 has been deposited in the American Type Culture Collection at Rockville, Md. under number ATCC 68403.
pSS1-1 comprises the ribosome binding site and the four structural genes of the branched chain keto acid dehydrogenase operon. The vector is pKT230 and the host is Pseudomonas putida JS112. pSS1-1 has been deposited in the American Type Culture Collection at Rockville, Md. under number ATCC 68404. This plasmid may be used when a promoter other than the bkad promoter is to be used.
Branched chain keto acid dehydrogenase produced by the bkad gene of the present invention may be used to increase the yield of an end-product of a metabolic pathway by increasing the flow of precursors. For example, the avermectin group of antibiotics produced by Streptomyces avermitilis contain branched chain fatty acids that are formed by the action of branched chain keto acid dehydrogenase. The commerical preparation of the avermectin antibiotics can be increased by providing a sufficient amount of branched chain keto acid dehydrogenase. In a preferred embodiment, Steptomyces avermitilis can be transformed with pJRS54 in a multi-copy Steptomyces vector.
The following examples illustrate the practice of preferred embodiments of the present invention. However, the present invention is not limited to the examples set forth.
EXAMPLE 1Materials and Methods
Bacterial Strains, Plasmids, Phage and Culture Conditions
The strains, plasmids and phage used are as follows:
TABLE 1 Strain, plasmid, Relevant genotype Source or or phage or phenotypea reference P. putida PpG2 Wild type I. C. Gunsalus JS113 bkdA1 (Sequence ID No. 2) Sykes, P. J., et bkdA2 (Sequence ID No. 3) al., “Conjugative mapping of pyruvate, 2-ketoglutarate and branched chain keto acid dehydrogenase genes in Pseudomonas putida mutants.” J. Bacteriol. 162:203- 208 (1985) KT2440 mt-2hsdR1 (r− m+) Köhler, T., et al., “Involvement of Pseudomonas putida RpoN sigma factor in regulation of various metabolic functions.” J. Bacteriol. 171:4326- 4333 (1989) rpoN mutant KmrrpoN− Köhler, T., et al., “Involvement of Pseudomonas putida RpoN sigma factor in regulation of various metabolic functions.” J. Bacteriol. 171:4326- 4333 (1989) E. coli TB1 aralacZ &dgr;M15 BRL &dgr;(lac−proAB) &phgr;80 hsdR17 (r− m+) strA DH5&agr; F−&phgr;80d lacZ &dgr;M15 BRL &dgr;(lacZYA-argF) U169 endA1hsdR17 (r− m+) recA1 supE44 lambda- thi- 1gyrArelA1 JM101 &dgr;(lac-proAB) supE Yanisch-Perron, C., thi [F′, traD36, et al., “Improved proAB,lacIqZ &dgr;M15] M13 phage cloning vectors and host strains: nucleotide sequences of the M13mp18 and pUC19 vectors.” Gene. 33:103-119 (1985) Plasmids pKT240 IncQ mob+ Apr Kmr Bagdasarian, M. M., et al., “Activity of the hybrid trp- lac (tac) promoter of Escherichiacoli in Pseudomonas putida. Construction of broad-host- range, controlled- expression vectors.” Gene. 26:273-282 (1983) pJRS25 bkd promoter described herein (Sequence ID No. 6) in pUC19, same orientation as lacZ pJRS40 bkd promoter described herein (Sequence ID No. 6) in pUC19, opposite to lacZ pJRS43 bkd promoter described herein (Sequence ID No. 6) with bkdA1 (Sequence ID No. 2) and bkdA2 (Sequence ID No. 3) in pUC19, opposite to lacZ pJRS44 bkd promoter described herein (Sequence ID No. 6) with bkdA in pUC19, same as orientation as lacZ pJRS47 Same insert as described herein pJRS25 and pJRS40 in pKT240, opposite to aph pJRS48 Same insert as described herein JRS25 and pJRS40 in pKT240, same orientation as aph pJRS49 Same insert as described herein pJRS43 and pJRS44 in pKT240, opposite to aph pJRS50 Same insert as described herein pJRS43 and pJRS44 in pKT240, same orientation as aph pRK2013 ColE1 mob+ tra+ Goldberg, J. B., et (RK2)Kmr al., “Cloning and expression in Pseudomonas aeruginosa of a gene involved in the production of alginate.” J. Bacteriol. 158:1115-1121 (1984) pUC19 Apr Yanisch-Perron, C., et al., “Improved M13 phage cloning vectors and host strains: nucleotide sequences of the M13mp18 and pUC19 vectors.” Gene. 33:103-119 (1985) Phage M13mp19 Yanisch-Perron, C., et al., “Improved M13 phage cloning vectors and host strains: nucleotide sequences of the M13mp18 and pUC19 vectors.” Gene. 33:103-119 (1985) aGene designations for P.putida are: bkdA1, E1&agr; subunit and bkdA2, E1&bgr; subunit of branched chain keto acid dehydrogenase.The growth conditions and media used are described in Sykes, P. U. et al., “Molecular cloning of genes encoding branched chain keto acid dehydrogenase of Psudomonas putida”, J. Bacteriol. 169: 1619-1625 (1987) and Sykes, P. J., et al., “Conjugative mapping of pyruvate, 2-ketoglutarate and branched chain keto acid dehydrogenase genes in Pseudomonas putida mutants”, J. Bacteriol. 162:203-208 (1985). Pseudomonas isolation agar was from DIFCO Laboratories.
RNA was prepared from P. putida grown in a minimal medium with either 0.3% valine and 0.1% isoleucine (valine/isoleucine medium) according to the method described in Sykes, P. J., et al., “Conjugative mapping of pyruvate, 2-ketoglutarate and branched chain keto acid dehydrogenase genes in Pseudomonas putida mutants”, J. Bacteriol. 162:203-208 (1985), or 10 mM glucose as the sole carbon source or in L-broth according to Lennox, E. S., “Transduction of linked genetic characters of the host by bacteriophage P1”, Virol. 1:190-205 (1955).
GASV medium was used for mutants affected in keto acid dehydrogenases, including branched chain keto acid dehydrogenase and contains 10 mM glucose, 2 mM acetate, 2 mM succinate, 0.3% L-valine and 0.1% L-isoleucine according to the method described in Sykes, P. J. et al., “Molecular cloning of genes encoding branched chain keto acid dehydrogenase of Pseudomonas putida”, J. Bacteriol. 169: 1619-1625 (1987). When antibiotic supplements were added, the final concentrations were (&mgr;g/ml): ampicillin, 200; kanamycin, 90; and carbenicillin, 2000.
Enzymes and Chemicals
Restriction endonucleases and other DNA enzymes were obtained from Promega Corporation or Bethesada Research Laboratories, Inc. The (&tgr;-32P)dCTP, (&agr;-32P)dATP were from New England Nuclear Corporation. Isopropyl-&bgr;-D-thiogalactopryanoside (IPTG), 5-bromo-4-chloro-3-indolyl-&bgr;-D-galactopyranoside (X-gal), RNase A, ampicillin, kanamycin and carbenicllin were from Sigma Chemical Co. All other chemicals were of analytical reagent grade.
Enzyme Assays
The assay for E1 component (Sequence ID No. 2 and Sequence ID No. 3) of branched chain keto acid dehydrogenase was performed in the presence of excess E2 (Sequence ID No. 4) and LPD-val (Sequence ID No. 5). The latter two components were proved by a 90,000×g supernatant fraction of E. coli TB1 (pKRS3) according to the method described in Sykes, P. U. et al, “Molecular cloning of genes encoding branched chain keto acid dehydrogenase of Pseudomonas putida”, J. Bacteriol. 169: 1619-1625 (1987).
The conditions of the assay for branched chain keto acid dehydrogenase are described in Sokatch, J. R. et al., “Purification of a branched chain keto acid dehydrogenase for Pseudomonas putida”, J. Bacteriol. 148: 647-652 (1981). The assay for E1 (Sequence ID No. 2 and Sequence ID No. 3) activity used the same conditions except that the assay was supplemented with 300 &mgr;g of a 90,000×g supernatant fraction prepared from E. coli TB1 (pJRS3). This fraction supplies excess E2 (Sequence ID No. 5) and LPD-val (Sequence ID No. 5) so that the rate of NADH formation depends on amount of E1&agr; (Sequence ID No. 2) and E1&bgr; (Sequence ID No. 3).
Nucleic Acid Preparations
Plasmid and phage DNA were prepared according to the method of Maniatis, T, et al., Molecular cloning: A Laboratory Manual, 1987, Cold Spring Harbor Laboratory, Cold Spring Harbor, N. Y. RNA was prepared according to the method of Burns, G., et al., “Sequence analysis of the lpdV gene for lipoamide dehydrogenase of branched chain oxoacid dehydrogenase of Pseudomonas putida”, Eur. J. Biochem. 179:61-69. Nick translation of DNA was performed according to manufacturer's recommendations using a kit from Bethesda Research Laboratories. End labelling of synthetic oligonucleotides was performed according to the method of Maniatis, T, et al., Molecular cloning: A Laboratory Manual, 1987, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
Screening of P. putida Genomic Library
An SphI genomic library of P. putida DNA in pUC19 in E. coli TB1 was used. The nick translated probe for screening the library was prepared from pSS1-2 [see Burns, G., et al., “Similarity of the E1 subunits of branched chain-oxoacid dehydrogenase from Pseudomonas putida to the corresponding subunits of mammalian branched chain-oxoacid and pyruvate dehydrogenases”, Eur. J. Biochem. 176:311-317 (1988)] by digestion with Sst I and PstI.
This relased a 1.45 kb fragment of DNA that included bkdA1 (Sequence ID No. 2) and part of bkdA2 (Sequence ID No. 3). The library was plated on L-agar containing ampicillin and the colonies were lifted using Colony-Plaque screen (NEN Corporation). DNA fixation, hybridization and washing conditions were those suggested by the manufacturer.
Subcloning and DNA Sequencing
The genomic DNA insert from the positive clone, pJRS25, was excised from pUC19 by digesting the DNA with SphI and the excised fragment was cloned in both orientations into the SphI site of M13mp19. These clones were digested at the KpnI and BamHI sites of the vector, treated with ExoIII and S1 nucleases and ligated, yielding a set of ordered deletions according to the method described in Henikoff, S., “Unidirectional digestion with exonuclease III creates targeted breakpoints for DNA sequencing”, Gene 28:351-359 (1984), for DNA sequencing which was done using a Sequenase kit (US Biochemical Corporation).
To avoid band compressions due to high GC content, DITP was used in place of dGTP as suggested by the manufacturer. Samples were electrophoresed in 7M urea-6% acrylamide (acrylamide to bis acrylamide ration, 19:1) gels in 89 mM Tris-89 mM boric acid −2.5 mM EDTA, pH 8.3.
S1 Nuclease and Reverse Transcriptase Mapping
A clone containing bases 1-1354 of the strand encoding the bkd operon in M13mp19 was used to prepare radiolabelled, single-stranded DNA according to the method described in Aldea, M. et al. “Transcript mapping using [35S]DNA probes, trichloroacetate solvent and dideoxy sequencing ladders: a rapid method for identification of transcriptional start points”, Gene 65:101-110 (1988), to identify the start of transcription. A 17 mer universal primer was annealed to single-stranded DNA of the M13mp19 subclones and the complementary strand was synthesized using (&agr;32P)dCTP, dNTPs and Klenow polymerase.
To minimize the amount of uncopied M13mp19 template, a 5 fold molar excess of primer and cold nucleotides were included in the synthesis reaction according to the method described in Calzone, F. J. et al., “Mapping of gene transcripts by nuclease protection assays and cDNA primer extension”, Methods Enzymol. 152:611-632 (1987).
RNA (50 &mgr;g), extracted from P. putida grown in valine/isoleucine or glucose synthetic media and labelled DNA (10,000 cpm) were mixed in 30 &mgr;l of hybridization buffer (0.4M NaCl, 0.2M PIPES, pH 6.5, 5 mM EDTA, 80% formamide) according to Debarbouille, M., et al., “Expression of the Escherichia coli malPO operon remains unaffected after drastic alteration of its promoter”, J. Bacteriol. 153:1221-1227 (1983). The solution was heated for 10 minutes at 75° C. and incubated at 40° C. overnight for hybridization of the DNA probe with branched chain keto acid dehydrogenase specific mRNA.
Unhybridized DNA was digested with 500 U of S1 nuclease in S1 buffer (0.25 N NaCl, 30 mM potassium acetate, pH 4.5, 1 mM ZnSO4, 5% glycerol) at 40° C. for 1 hours. Nucleic acids were extracted with phenol, precipitated with ethanol and the pellet dissolved in deionized formamide and tracking dyes. The solution was heated to denature nucleic acids then loaded on a sequencing gel along with dideoxy sequencing ladders for precise sizing.
Reverse transcriptase mapping was carried out according to the method described in Shelness, G. S., et al., “Apolipoprotein II messenger RNA: Transcriptional and splicing heterogeneity yields six 5′- untranslated leader sequences”, J. Biol. Chem., 259:9929-9935 (1984). A synthetic oligonucleotide (Sequence ID No. 7) beginning 546 bp upstream of the branched chain keto acid dehydrogenase ATG initiation codon and complementary to the mRNA was used as primer. It was synthesized at the Molecular Biology Resource facility of the Saint Francis Hospital of Tulsa, Okla. The 5′ end labelled primer (5,000-10,000 cpm) was combined with 50 &mgr;g of RNA from P. putida grown on valine/isoleucine in 50 &mgr;l of buffer (100 mM tris-HCl, pH 8.3, 10 mM MgCl2, 120 mM KCl, 5 mM DTT, 1 mM deoxynucleotide triphosphates).
After the addition of 15 U of avian myelobastosis virus reverse transcriptase, samples were incubated for 1 hour at 42° C. and the reaction was stopped by bringing the temperature to 75° C. for 10 minutes. After cooling to 40° C., 5 &mgr;g of boiled RNAse A was added to this mixture and further incubated for 1 hour at 37° C. The nucleic acids were precipitated with ethanol and analyzed by electrophoresis as described above for S1 protection analysis.
Molecular Cloning
The insert containing the bkd promoter (Sequence ID No. 6) was excised from pJRS25 by digestion with SphI and inserted into pUC19. Two constructs were obtained, one with the insert in the same orientation as the lacZ, that is, the same as pJRS25, and a second, pJRS40, which had the insert in the opposite orientation to the lacZ.
In order to determine how much of the insert was required for promoter activity, a set of ordered deletions was prepared from these clones by digestion with ExoIII an S1 nucleases according to Henikoff, S., “Unidirectional digestion with exonuclease III creates targeted breakpoints for DNA sequencing”, Gene 28:351-359 (1984). The inserts were excised from the multiple cloning sites of pUC19 by digestion with EcoRI and HindIII, isolated by agarose gel electrophoresis, and inserted into pKT240, also digested with EcoRI and HindIII.
E. coli DH5&agr; was the host for transformation and transformants were selected using L-agar containing ampicillin. These constructs were transferred from E. coli DH5a to P. putida PpG2 by tri-parental mating according to the method described in Goldberg, J. B. et al., “Cloning and expression in Pseudomonas aeruginosa of a gene involved in the production of alginate”, J. Bacteriol. 158: 1115-1121 (1984), and the exconjugants were plated on Pseudomonas isolation agar containing carbenicillin.
Clones with bkdA1 (Sequence ID No. 2) and bkdA2 (Sequence ID No. 3) as the reporter genes for the bkd promoter (Sequence ID No. 6) were constructed from pSO2, and 18 kb cosmid clone in pLAFR1 which contains the entire bkd operon (Sequence ID No. 1) plus 18 kb of flanking sequence according to the method described in S. K. Oh, M.S. thesis, University of Oklahoma Health Sciences Center, Oklahoma City, Okla., 1989. The cosmid, pSO2, was digested with SmaI releasing a 6.8 kb fragment containing the entire operon which was inserted into the SmaI site of pUC19, yielding pJRS51.
The insert was removed from pJRS51 by digestion with ClaI and BamHI. The ClaI site is at base 828 (FIG. 1) and the BamHI site is in the polylinker of pUC19. The ends of the insert were blunted with Klenow fragment and deoxynucleotide triphosphates and the fragment cloned into the SmaI site of pUC19. The resulting plasmid was digested with KpnI, which cuts into bkdB (Sequence ID No. 4), leaving bkdA1 (Sequence ID No. 2) and bkdA2 (Sequence ID No. 3) intact and into the polylinker upstream of the operon (FIG. 1).
Two constructs were obtained, pJRS43 with the promoter (Sequence ID No. 6), bkdA1 (Sequence ID No. 2) and bkdA2 (Sequence ID No. 3) in the opposite orientation as lacZ and pPJRS44, with the insert in the same orientation as lacZ. The inserts were then isolated from pUC19 by digestion with EcoRI and HindIII and inserted into pKT240 similarly digested. Again, two constructs were obtained, pJRS49, which has the insert in the opposite orientation to the aph gene and pJRS50 which has the insert in the same orientation as aph. The constructs were then transferred from E. coli DH5&agr; to P. putida JS113 by tri-parental mating using pRK2013 according to the method described in Goldberg, J. B. et al., “Cloning and expression in Pseudomonas aeruginosa of a gene involved in the production of alginate”, J. Bacteriol. 158:1115-1121 (1984).
Results
Isolation of bkd Promoter
A SphI genomic library of P. putida DNA in pUC19 was screened using a 1.45 kb nick-translated SstI-PstI fragment of P. putida DNA from pSS1-2 which contained all of bkdA1 (Sequence ID No. 2) and part of bkdA2 (Sequence ID No. 3)(FIG. 1) according to the method used in Burns, G. et al., “Similarity of the E1 subunits of branched chain-oxoacid dehydrogenase from Pseudomonas putida to the corresponding subunits of mammalian branched chain-oxoacid and pyruvate dehydrogenases”, Eur. J. Biochem 176:311-317 (1988). Several positive colonies were identified during the initial screening which were further screened by restriction digestion of minipreparations, and Southern blotting usng the 1.45 kb probe. A clone containing 1.87 kb insert was obtained that contained 244 bp of bkdA1 (Sequence ID No. 2) gene and 1628 bp of upstream DNA. This clone was named pJRS25 and the restriction map of the insert is shown in FIG. 1.
Nucelotide Sequence of pJRS25 Insert
The nucleotide sequence of bases 721-1679 of pJRS25 is shown in Table 2. pJRS25 contains the bdk promoter (Sequence ID No. 6) at bases 728-1628, and the initial portion of bkdA1 (Sequence ID No. 2) from bases 1629-1674.
TABLE 2 721 CACCCCACGGGCCATCTGCAGGCGGCGGCCTTCGAGAAAGCCTTCGGCGGTCATCACCTT GTGGGGTGCCCGGTAGACGTCCGCCGCCGGAAGCTCTTTCGGAAGCCGCCAGTA V G R A M Q L R R G E L F G E A T M 781 GCCGCGTGGGACGCCGTTGAGGTCGGGGGTGACGCATTCGATTTCATCGATGCCCTGGAG 841 CTGAGCGATGCTCATGACGCTTGTCCTTGTTGTTGTAGGCTGACAACAACATAGGCTGGG ————————> <———————— 901 GGTGTTTAAAATATCAAGCAGCCTCTCGAACGCCTGGGGCCTCTTCTATCGCGCAAGGTC 961 ATGCCATTGGCCGGCAACGGCAAGGCTGTCTTGTAGCGCACCTGTTTCAAGGCAAAACTC * 1021 GAGCGGATATTCGCCACACCCGGCAACCGGGTCAGGTAATCGAGAAACCGCTCCAGCGCC 1081 TGGATACTCGGCAGCAGTACCCGCAACAGGTAGTCCGGGTCGCCCGTCATCAGGTAGCAC ——————> ——————> 1141 TCCATCACCTCGGGCCGTTCGGCAATTTCTTCCTCGAAGCGGTGCAGCGACTGCTCTACC 1201 TGTTTTTCCAGGCTGACATGGATGAACACATTCACATCCAGCCCCAACGCCTCGGGCGAC 1261 AACAAGGTCACCTGCTGGCGGATCACCCCCAGTTCTTCCATGGCCCGCACCCGGTTGAAA <————————— 1321 CAGGGCGTGGGCGACAGGTTGACCGAGCGTGCCAGCTCGGCGTTGGTGATGCGGGCGTTT <————————— 1381 TCCTGCAGGCTGTTGAGAATGCCGATATCGGTACGATCGAGTTTGCGCATGAGACAAAAT 1441 CACCGGTTTTTTGTGTTTATGCGGAATGTTTATCTGCCCCGCTCGGCAAAGGCAATCAAC ——————> ——————> 1501 TTGAGAGAAAAATTCTCCTGCCGGACCACTAAGATGTAGGGGACGCTGACTTACCAGTCA 1561 CAAGCCGGTACTCAGCGGCGGCCGCTTCAGAGCTCACAAAAACAAATACCCGAGCGAGCG SD 1621 TAAAAAGCATGAACGAGTACGCCCCCCTGCGTTTGCATGTGCCCGAGCCCACCGGCCGG 1679 M N E Y A P L R L H V P E P T G RThe codon for the initiating methionine of bkdA1 (Sequence ID No. 2) starts at position 1629 and the translated amino acid sequence matched exactly that of E1&agr; (Sequence ID No. 2). The nucleotide sequence of the strand containing bkdA1 (Sequence ID No. 2) was translated in all three frames but no additional open reading frames were found on that strand which means that there is a large non-coding segment of DNA upstream of bkdA1 (Sequence ID No. 2)(Table 2).
There is a region of dyad symmetry from bases 868-876 and 883-891 with a modest, but probably significant free energy of formation of −14 kcal. Bases 280-286 of Sequence ID No. 1 repeat at bases 304-310 of Sequence ID No. 1, and there is another tandem repeat at bases 477-486 of Sequence ID No. 1 and bases 496-505 of Sequence ID No. 1.
There is a kind of symmetry beginning at bases 627-633 of Sequence ID No. 1 where the sequence is followed by its complement, bases 640-646 of Sequence ID No. 1. The GC content of the leader sequence (bases 775-1628, Table 2) is 56.7% which is distinctly lower than the 65.2% for the structural genes of the bkd operon (Sequence ID No. 1).
This agrees with the belief that RNA polymerase binds preferentially to AT rich regions of the promoter. A low GC content of the promoter region might also contribute to promoter strength by providing less resistance to DNA unwinding. Similar observations of low GC content for Pseudomonas promoter were made in the case of the algD and nah and sal promoters.
The strand opposite that encoding the branched chain keto acid dehydrogenase operon was translated into three reading frames and an open reading frame was found starting at 774 bp (FIG. 2). However, there does not seem to be a strong ribosome binding site preceding the start codon. This reading frame encoded 258 amino acids without a stop codon and the codon usage was consistent with that of other Pseudomonas genes.
The amino acid sequence was compared with the amino acid sequences of known regulatory proteins of bacteria in the Protein Information Resource data base, but no significant homology was found. However, a search by FASTP according to the method of Lipman, D. J. et al., “Rapid and sensitive protein similarity searches”, Science 227:1435-1441 (1985), showed some homology with several glutamine synthetases ranging from 22-31% identity over a span of about 130 amino acids, and always to the same part of glutamine sythetase, residues 175-305.
Transcriptional Start of the bkd Operon (Sequence ID No. 1)
The approximate start of the bkd transcript was first determined by S1 nuclease protection experiments. A single-stranded DNA template in M13mp19 was constructed by ExoIII nuclease digestion according to the method described in Henikoff, S., “Unidirectional digestion with exonuclease III creates targeted breakpoints for DNA sequencing”, Gene 28:351-359 (1984) which included bases 1-1354 of the pJRS25 insert. The M13 sequencing primer was annealed to the single-stranded DNA, and the complementary strand was synthesized using Klenow polymerase, dNTPs and (&agr;32P)dCTP.
The radioactive DNA probe was hybridized to total cellular RNA extracted from P. putida grown in valine/isoleucine medium followed by treatment with a single-strand-specific S1 nuclease to destroy unprotected probe sequences according to the methods in Aldea, M., et al., “Transcript mapping using [35S]DNA probes, trichloroacetate solvent and dideoxy sequencing ladders: a rapid method for identification of transcriptional start points”, Gene 65:101-110 (1988) and Calzone, F. J., et al., “Mappng of gene transcripts by nuclease protection assays and cDNA primer extension”, Methods Enzymol. 152:611-632 (1987).
These experiments show that the transcriptional start of the bkd operon (Sequence ID No. 1) was located about 600 bases upstream from the translational start. In order to locate the transcriptional start precisely, reverse transcriptase mapping was done by primer extension. A 15 mer oligonucleotide was constructed complementary to bases 1083-1097, i.e., 59 bp downstream from the start of transcription (Table 2). The end-labelled primer was hybridized to cellular RNA from P. putida PpG2 grown on valine/isoleucine medium and extended to the length of branched chain keto acid dehydrogenase mRNA with avian myeloblastosis virus reverse transcriptase.
The product was electrophoresed alongside dideoxy sequencing reaction mixtures using the same oligonucleotide primer (FIG. 2). A singles transcript was obtained, the mobility of which corresponded to base number 1037 of the pJRS25 insert. Therefore, the first base of the transcript is a cytidine nucleotide which means that the distance between the transcriptional and translational start is 592 bp.
In order to find the transcriptional initiation site of the message for the unknown open reading frame on the opposite strand, reverse transcriptase mapping was done using a 18 mer oligonucleotide that hybridized between 1097 and 1115 bp on the opposite strand (FIG. 2). The end-labelled oligonucleotide was annealed to RNA extracted from P. putida grown on L broth and minimal medium containing glucose or valine/isoleucine as the carbon sources.
No primer extension was evidenced after denaturing gel electrophoresis, indicating that there may not be a transcript or the transcript was not produced under the conditions which the cells were grown. Thus it is not clear if we are dealing with two promoters or if the bkd promoter is bidirectional.
Expression from the bkd Promoter (Sequence ID No. 6)
The promoter activity of the insert of P. putida DNA in pJRS25 was studied using pKT240 which has a promoterless aminoglycoside phosphotransferase (aph) gene. When a DNA fragment containing a promoter is cloned in the correct orientation upstream of the aph gene, the host cell becomes streptomycin resistant.
The entire insert of pJRS25 was cloned into pKT240 in both orientations yielding pJRS47, with the insert opposed to aph, and pJRS48, with the insert in the same orientation as aph (Table 1). E. coli DH5&agr; containing either pJRS47 or pJRS48 did not grow on L agar containing streptomycin at concentrations of 0.3 to 0.5 mg/ml indicating that E. coli does not read the bkd promoter (Sequence ID No. 6) well.
pJRS47 and pJRS48 were then mobilized from E. coli DH5&agr; to P. putida PpG2 by tri-parental mating according to the method described in Goldberg, J. B. et al., “Cloning and expression in Pseudomonas aeruginosa of a gene involved in the production of alginate”, J. Bacteriol. 158: 115-1121 (1984). The exconjugants were replica-plated on minimal medium containing valine/isoleucine or glucose as the carbon source plus various concentrations of streptomycin.
P. putida PpG2 containing either pJRS47 or pJRS48 was resistant to streptomycin at concentrations up to 10 mg/ml in both enriched and minimal media with either glucose or valine/isoleucine carbon sources. These results indicate the promoter was read in both directions and that streptomycin resistance was constitutive (FIG. 2). The finding that streptomycin resistance was not inducible strongly favors negative regulation of the bkd operon (Sequence ID No. 1).
E. coli DH5&agr; and P. putida PpG2 (pKT240) did not grow at streptomycin concentrations beyond 0.25 and 2 mg/ml respectively. Expression of streptomycin resistance from pJRS47 was not expected, and this result suggests the presence of another promoter, possibly for the expression of the unidentified open reading frame on the strand opposite that of the bkd operon (Sequence ID No. 1) or that the bkd promoter (Sequence ID No. 6) is bidirectional.
A series of ordered deletions were created where the insert isolated from pJRS25 was shortened from both ends and then introduced into pKT240 to see what effect this had on promoter activity (FIG. 2). There is a span of about 550 bp which is essential from promoter activity in P. putida which begins 100 bp upstream of the start of transcription and ends 450 bp downstream from the start of transcription.
The two tandem repeats and the one dyad repeat downstream of the start are included in this essential region. However, the dyad repeat about 200 bp upstream of the start of transcription is not included. Perhaps this latter structure is involved in the expression of the unidentified open reading frame.
Expression of the bkd Operon (Sequence ID No. 1) Does Not Require the rpoN Gene Product
Four deletion clones were mobilized into P. putida KT2440 and into the rpoN mutant. Two of the clones, those beginning at bases 783 and 905 (FIG. 2) conferred streptomycin resistance to both P. putida KT2440 and it rpoN mutant. The other two clones, those beginning at bases 1086 and 1304 (FIG. 2) failed to confer streptomycin resistance to either strain of P. putida KT2440.
In addition, the rpoN mutant of P. putida KT2440 is able to grow in synthetic medium with 2-ketoisovalerate as the sole carbon source, so it is clear that the rpoN sigma factor is not required for expression of branched chain keto acid dehydrogenase. As a control, it was confirmed that the rpoN mutant cannot grow in medium with valine/isoleucine as the carbon source, hence RpoN is required either for transport or transamination of branched chain amino acids.
Expression of bkdA1 (Sequence ID No. 2) and bkdA2 (Sequence ID No. 3) from the bkd Promoter (Sequence ID No. 6)
In order to study the expression of the bkd operon (Sequence ID No. 1), pJRS49 and pJRS50 were constructed (FIG. 1) which contain the bkd promoter (Sequence ID No. 6), bkdA1 (Sequence ID No. 2), and bkdA2 (Sequence ID No. 3) and part of bkdB (Sequence ID No. 4) in both orientations with respect to aph of pKT240. In these constructs, streptomycin resistance depends on the strength of the promoter upstream of aph and all are carbenicillin resistant due to the &bgr;-lactamase gene which is constitutively expressed.
pJRS43 and pJRS44 were transferred to P. putida JS113, a bkdA mutant, and plated on several media. P. putida JS113, a bkdA mutant, and plated on several media. P. putida JS113 containing either pJRS49 or pJRS50 grew on L-agar plus 8 mg/ml of streptomycin, however, P. putida JS113 (pJRS50), was more resistant to streptomycin than P. putida carrying pJRS49. These results show that read-through to aph occurred in both orientations.
P. putida JS113 (pJRS50) grew on valine/isoleucine agar plus streptomycin therefore the insert complemented the mutation in P. putida JS113. However, P. putida JS113 (pJRS49) did not grow on valine/isoleucine agar containing either carbenicillin or streptomycin for reasons which are not clear, but may be related to interference by these antibiotics with expression of the clone bkd genes.
In order to measure the level of expression of bkdA1 (Sequence ID No. 2) and bkdA2 (Sequence ID No. 3) from the bkd promoter (Sequence ID No. 6), E1 enzyme assays were performed on 90,000×g supernatant fractions prepared from cultures grown in the media shown in Table 3.
TABLE 3 Expression of structural genes for E1 subunits (Sequence ID No. 2 and Sequence ID No. 3) of P. putida branched chain keto acid dehydrogenase. Plasmid Organism and Specific activityb mediuma pKT240 pJRS50 pJRS49 E. coli DH5&agr; GASV 0 0.014 0.018 P. putida JS113 L broth 0.009 2.37 2.59 L broth + 0.0007 2.68 1.50 valine/ isoleucine Minimal NDC 5.23 NDC medium + valine/ isoleucine Minimal 0.004 0.133 0.10 medium + glucose aCompositions of media are given in Materials and Methods. bSpecific activity is &mgr;moles of NADH/min/mg protein. All assays of E1 (Sequence ID No. 2 and Sequence ID No. 3) were done by supplementing with excess E2 (Sequence ID No. 4) and LPD-val (Sequence ID No. 5). cDoes not grow in this medium. dThe specific activities of P.putida grown in L broth, L broth + valine/isoleucine, minimal medium + glucose and minimal medium + valine/isoleucine were 0.010, 0.010, 0.004 and 0.063 respectively. Extracts of P.putida PpG2 (pKT240) and P.putida PgG2 (pJRS48) in L broth gave specific activities of 0.032 and 0.033 respectively.There was very little expression of bkdA1 (Sequence ID No. 2) and bkdA2 (Sequence ID No. 3) in E. coli DH5&agr; containing either pJRS49 or pJRS50. However, there was high expression of bkdA1 (Sequence ID No. 2) and bkdA2 (Sequence ID No. 3) in P. putida JS113 containing either pJRS49 or pJRS50 grown in L-broth indicating that expression was constitutive as was streptomycin resistance in the case of P. putida PpG2 (pJRS48).
The level of E1 (Sequence ID No. 2 and Sequence ID No. 3) activity was surprisingly high compared to extracts of P. putida PpG2 grown in Valine/sioleucine medium (Table 3). Thus expression of bkdA1 (Sequence ID No. 2) and bkdA2 (Sequence ID No. 3) from P. putida JS113 (pJRS50) was nearly 40 times that obtained in P. putida PpG2 which seems to be much higher than could be accounted for by copy number alone.
When P. putida JS113 (pJRS50) was grown in valine/isoleucine medium, the specific activity was about twice that obtained in L-broth. These results also suggest that the bkd operon (Sequence ID No. 1) is negatively regulated, probably by a small amount of endogeneous repressor which is titrated by the multiple copies of pJRS50 in the cell.
Again, P. putida JS113 (pJRS49), did not grow in this medium suggesting that bkdA1 (Sequence ID No. 2) and bkdA2 (Sequence ID No. 3) were not expressed. bkdA1 (Sequence ID No. 2) and bkdA2 (Sequence ID No. 3) expression was repressed by glucose (Table 3). It is pertinent to note that pseudomonads do not contain appreciable amounts of cAMP.
EXAMPLE 2Materials and Methods
Bacterial strains and plasmids. The P. putida strains and plasmids used in this study are listed in Table 4.
TABLE 4 Strains of P. putida Strain and Genotypea or plasmid description Source P. putida PpG2 Wild type I. C. Gunsalus JS112 bkdABlpdV Sykes, P. J., et (Sequence ID Nos. 2, 3, 4, and 5) al., “Conjugative mapping of pyruvate, 2- ketoglutarate, and branched chain keto acid dehydrogenase genes in Pseudomonas putida mutants.” J. Bacteriol. 162:203- 208 (1985) JS113 bkdA Sykes, P. J., et (Sequence ID No. 1 and al., “Conjugative (Sequence ID No. 2) mapping of pyruvate, 2- ketoglutarate, and branched chain keto acid dehydrogenase genes in Pseudomonas putida mutants.” J. Bacteriol. 162:203- 208 (1985) JS287 lpdV Sokatch, J. R., et (Sequence ID No. 5) al., “Mutations affecting lipoamide dehydrogenases of Pseudomonas putida.” J. Bacteriol. 153:969- 975 (1983) JS326 bkdABlpdV Sykes, P. J., et (Sequence ID Nos. 2, 3, 4, and 5) al., “Conjugative mapping of pyruvate, 2- ketoglutarate, and branched chain keto acid dehydrogenase genes in Pseudomonas putida mutants.” J. Bacteriol. 162:203- 208 (1985) PRS2003 pKT230 catB Kanr M. Shanley Strr Plasmids pKT230 Derived from Basdarian, M. et RSF1010 and al. “Specific pACYC1771 purpose plasmid cloning vectors II. Broad host range, copy number RSF 1010 - derived vectors, and a host-vector system fro gene cloning Pseudomonas”, Gene 16:237-247 (1981). pJRS1 bkdABlpdV described herein (Sequence ID Nos. 2, 3, 4, and 5) in pUC18 pJRS2 bkdABlpdV described herein (Sequence ID Nos. 2, 3, 4, and 5) in pUC19 pJRS3 bkdBlpdV described herein (Sequence ID Nos. 2, 3, 4, and 5) in pUC19 pJRS4 bkdABlpdV described herein (Sequence ID Nos. 2, 3, 4, and 5) in pUC18 pJRS10 bkdA (Sequence ID No. 1 described herein and Sequence ID No. 2) in pUC18 pJRS23 lpdV (Sequence ID No. 5) described herein in pUC18 pJRS24 bkdB (Sequence ID No. 4) described herein in pUC19 aGene designations for strains and plasmids in this table are bkdAB, E1 and E2 subunits of branched chain keto acid dehydrogenase; lpdV, LPD-Val (E3 subunit); catB, cis,cis-muconate lactonizing enzyme; Kan, kanamycin; Str, streptomycin.Branched chain keto acid dehydrogenase mutants listed in Table 4 cannot grow on the valine-isoleucine agar described in the next paragraph. The strains of E. coli used were JM109 [Yanish-Perron, C., et al., “Improved M13 phage cloning vectors and host strains: nucleotide sequences of the M13mp18 and pUC19 vectors”, Gene. 33:103-119 (1985)], HB101 [Boyer, H. W. et al., “A complementary analysis of the restriction and modifications of DNA in Escherichia coli”, J. Mol. Biol. 141:459-427 (1969)], and TB1 which was obtained from Bethesda Research Laboratories, Inc. (Gaithersburg, Md.). TB1 is similar to JM83 except that TB1 is hsdr hsdM+. The plasmid vector pKT230 was described by Bagdasarian et al., “Specific purpose plasmid cloning vectors,” Gene 16:237-247 (1981) and was provided by Mark Shanley, Department of Biology, Yale University.
Media. Valine-isoleucine agar contained 0.3% L-valine and 0.1% L-isoleucine in the basal medium as described in Marshall, V. P., et al., “Regulation of valine catabolism in Pseudomonas putida.” J. Bacteriol. 110:1073-1081 (1972). Basal medium free of ammonium ion was obtained by omitting ammonium sulfate from the basal G solution. To test the inducibility of subunits of the complex in organisms unable to grow on valine-isoleucine agar, we used GASV medium. GASV medium contains 10 mM glucose, 2 mM acetate, 2 mM succinate, 0.3% valine, and 0.1% isoleucine. Valine is deaminated to 2-ketoisovalerate, the inducer of branched chain keto acid dehydrogenase, allowing expression of branched chain keto acid dehydrogenase. GAS medium lacks valine and isoleucine and was used to grow keto acid dehydrogenase mutants which might require acetate or succinate for growth as described in Guest, J. R., “Aspects of the molecular biology of lipoamide dehydrogenase”, Adv. Neurol. 21:219-244 (1978). L broth was used as described in Lennox, E. S., “Transduction of linked genetic characters of the host of phage P1. ”Virology. 1:190-206 (1955) and 2×YT medium as described in Miller, J. H., “Experiments in molecular genetics.” Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. (1976). When antibiotic supplements were used, the final concentrations were (micrograms per milliliter): streptomycin, 100; kanamycin, 90; ampicillin, 200.
DNA preparation. pKT230 was isolated from P. putida PRS2003 grown in 800 ml of L broth plus kanamycin by using two successive cesium chloride-ethidium bromide centrifugations of cleared lysates by the method of Clewell, D. B., et al., “Properties of a supercoiled deoxyribonucleic acid-protein relaxation complex and strand specificity of the relaxation event”, Biochemistry 9:4428-4440 (1970). P. putida chromosomal DNA was isolated from a single cesium chloride-ethidium bromide centrifugation by the same method as for plasmid preparation with omission of the sodium chloride precipitation step. DNA restriction fragments were separated by electrophoresis in 0.8% agarose gel.
Cloning procedures. A limited digest of P. putida chromosomal DNA by EcoRI and SstI produced a majority of fragments in the 5- to 15-kilobase (kb) size range. This was mixed with a complete EcoRI-SstI digest of pKT230 with chromosome-to-vector DNA ratios of 10:1 and ligated with T4 ligase. EcoRI-SstI digestion of pKT230 inactivates the streptomycin resistance gene, but leaves the &bgr;-lactamase promoter, which controls this gene, intact. Recombinant plasmids were Kmr and Sms. The amount of DNA used in the ligations and transformations ranged from 0.06 to 0.2 &mgr;g. Ligation was done in a total volume of 50 &mgr;l containing 2 U of T4 ligase, and the mixture was left overnight at 14° C. The transformation procedure used for P. putida was that described by Bagdasarian, M. et al., “Host: vector systems for gene cloning in Pseudomonas.” Curr. Top. Microbiol. Immunol. 96:47-67 (1982). Direct selection for recombinant molecules was achieved by complementation of P. putida branched chain keto acid dehydrogenase mutants listed in Table 4 for growth on valine-isoleucine medium and sensitivity to streptomycin. pSS1 and pSS1-1, which are recombinant derivatives of pKT230, were created in this fashion.
pJRS1 was created by digesting pSS1-1 with SstI and inserting the fragment into pUC18 also digested with SstI (FIG. 3). pJRS2 was created by digesting pJRS1 with EcoRI and HindIII which cut into the polylinker of pUC18, removing the insert of P. putida DNA which was ligated into pUC19 similarly digested. This procedure produced plasmids with inserts of P. putida DNA in opposite orientations.
pJRS3 was constructed from a PstI-SalI digest of pJRS2, and the resulting fragment was inserted into the polylinker of pUC19.
pJRS4 was constructed from pJRS1 by digestion with EcoRI and ClaI, which released a 6-kb fragment and left 1.8 kb of DNA still attached to pUC18. The 1.8-kb fragment was released by digestion with AccI which also created a sticky end in the polylinker compatible with ClaI. The 6-kb fragment was then ligated into pUC18 with EcoRI-ClaI sticky ends, yielding pJRS4.
pJRS10 was created by digestion of pJRS1 with KpnI which removed 4.5 kp of P. putida DNA. The remaining DNA (pUC18 plus insert of 3.3 kb) was then religated, yielding pJRS10.
pJRS23 was made by digesting the P. putida DNA insert of pJRS1 with Bal 31 so that deletions were created from the SstI restriction site at the E1 end of the coding region according to the method of Gilmore, M. S., et al., “A new strategy for ordered DNA sequencing based on a newer method for the rapid purification of near-milligram quantities of a cloned restriction fragment”, Gene Anal. Tech. 2:108-114 (1985). The resulting DNA fragment contained a blunt end and a HindIII sticky end which was ligated into pUC18. This plasmid, pJRS21, was cut with SalI and EcoRI which released 2.3 kb of DNA. The remaining 2.9 kb of DNA was ligated into pUC18.
pJRS24 was obtained by digesting the polylinker of pJRS3 with BamHI and SstI and treating with ExoIII and S1 nucleases according to the method of Henikoff, S., “Unidirectional digestion with exonuclease III creates targeted breakpoints for DNA sequencing”, Gene 28:351-359 (1984) and recircularizing the shortened plasmid with T4 ligase. The 3′ overhang left by SstI protected the vector from digestion with ExoIII, while the 5′ overhang left by BamHI allowed pJRS3 to be shortened from the E3 end, leaving only the E2 gene.
Genomic DNA-plasmid DNA hybridizations were done as described by Southern, E. M., “Detection of specific sequences among DNA fragments separated by gel electrophoresis.” J. Mol. Biol. 98:503-517 (1975), using 0.33 &mgr;g of pSS1-1, pJRS1, or pJRS2 (1.3×107 cpm/&mgr;g) and 5 to 6 &mgr;g of E. coli, P. aeruginosa, or P. putida DNA digested with EcoRI. To reduce hybridization with vector DNA, we included 0.6 &mgr;g of cold pKT230 or pUC18.
Minicells. The minicell strain used in these experiments was E. coli x925 which was obtained from Roy Curtiss. The experiment was performed essentially as described by Clarke-Curtiss, J. E., et al., “Analysis of recombinant DNA using Escherichia coli minicells.” Methods Enzymol. 101:347-362 (1983), using 5 &mgr;Ci of [35S]methionine and with electrophoresis in 7.5% cross-linked polyacrylamide. Minicell cultures were grown in GASV medium since E. coli does not grow in valine-isoleucine medium.
In vitro transcription-translation. The procaryotic DNA-directed translation kit was purchased from Amersham and used as described in their instructions with 2.5 &mgr;g of DNA template for each reaction.
Enzyme assays. Preparation of extracts and the assays for branched chain keto acid dehydrogenase and lipoamide dehydrogenase have been described previously. The E1 (Sequence ID No. 2 and Sequence ID No. 3) and E2 (Sequence ID No. 4) assays were performed according to the method described in Sykes, P. J., et al., “Conjugative mapping of pyruvate, 2-ketoglutarate, and branched chain keto acid dehydrogenase genes in Pseudomonas putida mutants”, J. Bacteriol. 162:203-208 (1985), and McCully, V. et al., “Resolution of branched chain oxo acid dehydrogenase complex of Pseudomonas aeruginosa PAO”, Biochem. J. 233:737-742 (1986).
Stability of pSS1-1 in P. putida. Cultures of strain JS287 transformed with pKT230 and pSS1-1 were grown overnight in 4 ml of L broth plus kanamycin, and 0.1 ml of this culture was used to inoculate another 4 ml of L broth without kanamycin. Dilutions of overnight cultures were plated onto L agar, and resulting colonies were replica plated onto valine-isoleucine agar, valine-isoleucine agar plus kanamycin, and L agar plus kanamycin. Colonies growing on valine-isoleucine agar plus kanamycin were scored as carrying pSS1-1, colonies growing on valine-isoleucine agar without kanamycin were revertants, and those growing on L agar plus kanamycin but not valine-isoleucine agar plus kanamycin were carrying pKT230. These numbers were compared with the total number of colonies growing on L agar without kanamycin which included cells which had lost their plasmids.
Results
Cloning strategy. The vector used in these studies was pKT230, a broad-host-range plasmid of 11.9 kb able to replicate in P. putida and E. coli. Direct selection for recombinant molecules containing structural genes for subunits of branched chain keto acid dehydrogenase was achieved by complementation of P. putida branched chain keto acid dehydrogenase mutants. Complementation was detected by the ability of transformed mutants to grow on valine-isoleucine agar. Directed cloning with EcoRI-SstI digests yielded colonies on L agar plus kanamycin after transformation, 50 to 60% of which were Str8 as a consequence of cloning into the streptomycin site. Direct plating of the transformation mixture onto valine-isoleucine agar yielded several colonies, one of which contained a plasmid with an insert of 11 kb and complemented strains JS112, JS113, JS326, and JS287. The results suggested that the plasmid, designated pSS1, contained all the structural genes for branched chain keto acid dehydrogenase.
pSS1 was subcloned by religation of a limited SalI digest which removed a 3.3-kb segment of DNA. The resulting plasmid, pSS1-1, also complemented all branched chain keto acid dehydrogenase mutants. pSS1-1 DNA hybridized with DNA from P. putida and P. aeruginosa, but not with DNA from E. coli. The insert was subcloned in pUC18 and pUC19 with the objective of determining the direction of transcription. The resulting plasmids were named pJRS1 and pJRS2, respectively (FIG. 3).
Stability of pDSS1-1 in P. putida. The stability of pSS1-1 in P. putida was determined by subculturing in L broth with or without kanamycin. All colonies of P. putida JS287(pKT230) were Kanr after 11 serial transfers, showing that pKT230 was fully retained. However, strain JS287(pSS1-1) maintained the plasmid for three serial transfers after which kanamycin-sensitive, valine-isoleucine-negative colonies appeared, and by the eleventh transfer, only 3% of the colonies were kanamycin positive.
Expression of structural genes of pSS1-1 in P. putida mutants. Several pieces of data led to the conclusion that pSS1-1 contained structural genes for all subunits of branched chain keto acid dehydrogenase. The presence of pSS1-1 resulted in production of branched chain keto acid dehydrogenase activity in mutants lacking E1 (JS113); E1 (Sequence ID No. 2 and Sequence ID No. 3), E2, and LPD-Val (Sequence ID Nos. 2 and 3, Sequence ID No. 4, and Sequence ID No. 5, respectively) (JS326); and LPD-Val (Sequence ID No. 5) (JS287) (Table 5).
TABLE 5 Branched chain keto acid dehydrogenase activities of P. putida mutants transformed with pSS1-1 Sp act of branched chain keto acid Strain Plasmid dehydrogenasea JS113 pKT230 0 JS113 pSS1-1 142 JS326 pKT230 1 JS236 pSS1-1 94 JS287 pKT230 4 JS287 pSS1-1 160 aThe specific activity of branched chain keto acid dehydrogenase is nanomoles of NAD reduced per minute per milligram of protein. Cultures were grown in GASV medium.For comparison, the specific activities of P. putida PpG2(pKT230) and P. putida PpG2(pSS1-1) grown in valine-isoleucine medium were 54 and 314 nmol of NADH produced per min per mg of protein, respectively. P. putida mutants transformed with pKT230 did not regain branched chain keto acid dehydrogenase activity. The presence of all three subunits of branched chain keto acid dehydrogenase was demonstrated in mutants of P. putida (pSS1-1) by enzyme assays for E1 (Sequence ID No. 2 and Sequence ID No. 3) and E2 (Sequence ID No. 4) and by precipitation of LPD-Val (Sequence ID No. 5) with specific antisera. When the complex was purified from P. putida JS112(pSS1-1) it contained four polypeptides with the same molecular weights as complex purified from the wild type.
Regulation of branched chain keto acid dehydrogenase formation. Branched chain keto acid dehydrogenase activity was regulated by limitation of ammonium ion and by catabolite repression in P. putida PpG2 (Table 6).
TABLE 6 Nitrogen control of branched chain keto acid dehydrogenase synthesis Sp act of Additions to valine-isoleucine medium branched chain 20 mM 30 mM keto acid 40 mM NH4 glucose succinate dehydrogenasea P.putida PpG2 + − − 53 − − − 65 + + − 12 − + − 34 + − + 20 − − + 31 P.putida JS112 (pSS1-1) + − − 234 − − − 206 + + − 202 − + − 151 + − + 266 − − + 265 aThe specific activity of branched chain keto acid dehydrogenase is nanomoles of NAD reduced per minute per milligram of protein. Cultures were grown in GASV medium.Valine-isoleucine medium, which contained 40 mM ammonium ion, was used to obtain the data in Table 6. Where indicated, ammonium ion was deleted from the salt solution, leaving valine and isoleucine as the nitrogen sources. The presence of ammonium ion repressed complex formation, in particular, when supplemented with glucose. This is the typical situation for metabolism of N-containing compounds by gram-negative bacteria. Glucose and succinate also repressed branched chain keto acid dehydrogenase formation compared with that of control cells grown on valine-isoleucine medium. In contrast, neither the source of nitrogen nor the presence of glucose or succinate had any effect on complex formation by P. putida JS112(pSS1-1) which produced branched chain keto acid dehydrogenase constitutively. All other mutants of P. putida transformed with pSS1-1 also produced branched chain keto acid dehydrogenase constitutively.
Expression of branched chain keto acid dehydrogenase in E. coli. E. coli does not grow in media containing branched chain amino acids as the carbon sources. Therefore, production of branched chain keto acid dehydrogenase by E. coli carrying pSS1-1 would be evidence that structural genes had been cloned. E. coli HB101 was transformed with pKT230 and pSS1-1 and grown in GAS and GASV media, and cell extracts were examined for branched chain keto acid dehydrogenase. Surprisingly, the data in Table 7 show that E. coli HB101(pSS1-1) produced higher amounts of branched chain keto acid dehydrogenase in media containing valine.
TABLE 7 Expression of pSS1-1 structural genes in E. coli HB101 Sp act Branched chain keto acid Plasmid Medium E1a dehydrogenseb pKT230 GAS 0.0 0 pKT230 GASV 0.4 0 pSS1-1 GAS 7.7 7 pSS1-1 GASV 20 48 aThe specific activity is nanomoles of carbon dioxide released per 15 min per milligram of protein. bThe specific activity of branched chain keto acid dehydrogenase is nanomoles of NAD reduced per minute per milligram of protein. Cultures were grown in GASV medium.This is also reflected in the specific activity of the E1 subunit (Sequence ID No. 2 and Sequence ID No. 3) which was nearly three times higher when HB101(pSS1-1) was grown in GASV medium compared with growth in GAS medium. It was not possible to measure E2 (Sequence ID No. 4) activity since E. coli contains a deacylase which gave a high endogenous rate with isobutyryl coenzyme A.
The data in Table 8 reinforce this result and show that relatively high amounts of L-valine are needed for induction of branched chain keto acid dehdrogenase in HB101(pSS1-1), while P. putida JS287(pSS1-1) produced branched chain keto acid dehydrogenase constitutively.
TABLE 8 Induction of branched chain keto acid dehydrogenase in E. coli HB101 (pSS1-1) Sp act of branched chain keto acid dehydrogenasea in: Concn of L-valine E.coli P.putida in medium (mM) HB101 (pSS1-1) JS287 (pss1-1) 0.0 12 300 0.1 14 296 0.5 11 325 2.0 7 264 10.0 38 231 25.0 112 234 aThe specific activity of branched chain keto acid dehydrogenase is nanomoles of NAD reduced per minute per milligram of protein. Cultures were grown in GASV medium.Extracts of E. coli HB101(pSS1-1) required coenzyme A for branched chain keto acid dehydrogenase activity and were slightly dependent on thiamine PPi and L-valine, although the latter dependence is difficult to demonstrate in cell extracts.
Expression in minicells. To demonstrate the production of branched chain keto acid dehydrogenase subunits, we transformed a minicell-producing strain, E. coli x925, was transformed with pKT230 and pSS1-1. The minicells carrying pSS1-1 produced three radioactive peptides with molecular weights in sodium dodecyl sulfate-polyacrylamide gel electrophoresis of 39,000, 45,000, and 53,000 compared with molecular weights of 37,000, 39,000, 46,000, and 49,000 for the purified complex. Enzyme assays of cell extracts of E. coli x925(pSS1-1) verified that branched chain keto acid dehydrogenase activity was present.
Expression of branched chain keto acid dehydrogenase from pJRS1 and pJRS2 templates. To resolve the problem of expression of branched chain keto acid dehydrogenase structural genes from pSS1-1 in minicells, E. coli JM109 was transformed with pJRS1 and pJRS2 which contained the insert of P. putida DNA in opposite orientations. E. coli JM109(pJRS1) produced large amounts of E1 (Sequence ID No. 2 and Sequence ID No. 3) and of branched chain keto acid dehydrogenase (Table 9).
TABLE 9 Expression of structural genes of pJRS1 and pJRS2 in E. coli JM109 Addition Sp act to 2 x YT Branched chain medium Lipoamide keto acid plasmid (mM) E1a dehydrogenaseb dehydrogenasec pUC18 None 1.5 190 0.0 Glucose (10) NDd 170 0.0 IPTGe (0.15) 1.5 120 0.0 pJRS1 None 141 1,700 130 Glucose (10) 82 800 110 IPTG (0.15) 191 1,800 150 pJRS2 None 6.4 310 0.0 Glucose (10) ND 180 0.0 IPTG (0.15) 4.0 400 0.6 aThe specific activity of branched chain keto acid dehydrogenase is nanomoles of NAD reduced per minute per milligram of protein. Cultures were grown in GASV medium. bThe specific activity is nanomoles of NADH oxidized per minute per milligram of protein. cThe specific activity of branched chain keto acid dehydrogenase is nanomoles of NAD reduced per minute per milligram of protein. Cultures were grown in GASV medium. dND, Not determined. eIPTG, Isopropyl-&bgr;-D-thiogalactopyranoside.The formation of LPD-Val (Sequence ID No. 5) was demonstrated directly by the use of specific antiserum and indirectly by the greatly increased activity of lipoamide dehydrogenase in extracts of E. coli JM109(pJRS1). In contrast, E. coli JM109(pJRS2) produced negligible amounts of branched chain keto acid dehydrogenase (Table 9). The expression of branched chain keto acid dehydrogenase is clearly constitutive in E. coli JM109(pJRS1), although glucose had a slight repressive effect and isopropyl-&bgr;-D-thiogalactopyranoside appeared to have a slight inductive effect. However, failure of E. coli JM109(pJRS2) to produce significant amounts of branched chain keto acid dehydrogenase indicated that it was the pUC promoter which was read by E. coli RNA polymerase.
pUC18, pJRS1, and pJRS2 were used as DNA templates in the in vitro procaryotic translation system to determine the size and number of transcripts on the P. putida DNA. With pJRS1 as the template, four polypeptides were produced with molecular weights of 37,000, 39,000, 47,000, and 49,000 which were superimposable on those from a purified preparation of branched chain keto acid dehydrogenase included as a control. When pJRS2 was the template, trace amounts of these same four polypeptides were produced, suggesting that Pseudomonas promoters were being read by E. coli RNA polymerase, although rather inefficiently. In this same experiment, pKT230, pSS1, and pSS1-1 were also used as DNA templates, but no radioactive proteins were formed other than those associated with pKT230.
Location of structural genes. The location and order of structural genes for branched chain keto acid dehydrogenase were established by subcloning into pUC18 or pUC19 and identifying the gene products by the methods described below (FIG. 4). The N-terminal coding region of each gene is shown at the left of FIG. 4. The smallest fragment which contained all the structural genes was pJRS4, which is 6 kp in length. Extracts of E. coli TB1(pJRS4) contained branched chain keto acid dehydrogenase, and when pJRS4 was used as the DNA template in the transcription-translation system, four protein bands with the correct molecular weights were produced. pJRS10 contains the structural genes for the E1 subunit(s) (Sequence ID No. 2 and Sequence ID No. 3). Proteins with molecular weights of 37,000 and 39,000 were produced when pJRS10 was the template in the transcription-translation system. Also, extracts of E. coli TB1(pJRS10) supplemented the heat-treated Sepharose CL4B fraction which contains active E2 and E3 (Sequence ID No. 4 and Sequence ID No. 5, respectively) subunits, producing active branched chain keto acid dehydrogenase. pJRS23 contains the complete structural gene for LPD-Val (Sequence ID No. 5) which was established by showing that extracts of E. coli TB1(pJRS23) reacted with specific anti-LPD-Val serum and complemented extracts of P. putida JS287. pJRS24 contained only the structural genes for the E2 subunit since extracts of E. coli TB1(pJRS10) and purified LPD-Val yielded active branched chain keto acid dehydrogenase. No activity was obtained when extracts of E. coli TB1(pJRS10) and E. coli TB1(pJRS24) were mixed unless purified LPD-Val was added, showing that pJRS24 did not contain the structural gene for LPD-Val (Sequence ID No. 5).
EXAMPLE 3An example of how to express foreign genes in Pseudomonas putida using the bkad promoter (Sequence ID No. 6) is to start with plasmid pJRS55 (ATCC #68403). In order to insert a gene, pJRS55 could be digested with SacI and the 11 kb fragment containing the promoter (Sequence ID No. 6) and leader isolated. The sticky ends could be blunted with Klenow Regent and deoxynucleoside triphosphates. This provides a restriction site behind the promoter (Sequence ID No. 6) and leader which can be used with any blunt-ended DNA fragment.
As an example of a gene that could be inserted, lpdV of P. putida could be removed from plasmid pJRS54 (#68405) by digestion with ScaI. This digest would release the entire lpdV gene (Sequence ID No. 5) in a blunt-ended fragment which can be ligated to the 11 kb promoter-leader fragment. This would provide a mixture of the desired plasmid plus a construct with the lpdV gene (Sequence ID No. 5) in the opposite orientation to the bkad promoter (Sequence ID No. 6) . The ligation mixture could be used to transform P. putida which is placated on L-agar plus ampicillin. The correct construct could be identified by picking several colonies, isolating the plasmid and digesting it with several restriction enzymes in order to determine the orientation of the insert.
All patent applications and publications cited herein are hereby incorporated by reference into the present application.
Changes may be made in the embodiments of the invention described herein or in parts or elements of the embodiments described herein or in the steps or in the sequence of steps of the methods described herein without departing from the spirit and scope of the invention as defined in the following claims.
# SEQUENCE LISTING (1) GENERAL INFORMATION: (iii) NUMBER OF SEQUENCES: 7 (2) INFORMATION FOR SEQ ID NO: 1: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 6122 base #pairs (B) TYPE: Nucleic acid (C) STRANDEDNESS: Double #stranded (D) TOPOLOGY: Circular (ii) MOLECULE TYPE: Genomic DNA (A) DESCRIPTION: Seq ID # No 1 is genomic DNA from P. putida strain Pp #G2 which contains the control region regulating expression #of the bkd operon and the four structural genes of #the bkd operon, bkdA1, bkdA2, bkdB and lpdV. (iii) HYPOTHETICAL: No (iv) ANTI-SENSE: No (v) FRAGMENT TYPE: Not applicable (vi) ORIGINAL SOURCE: (A) ORGANISM: Pseudomonas #putida (B) STRAIN: PpG2 (C) INDIVIDUAL ISOLATE: #Not applicable (D) DEVELOPMENTAL STAGE: #Not applicable (E) HAPLOTYPE: Not appl #icable (F) TISSUE TYPE: Not #applicable (G) CELL TYPE: Gram #negative, aerobic bacilli (H) CELL LINE: Not a #pplicable (I) ORGANELLE: Not appl #icable (vii) IMMEDIATE SOURCE: (A) LIBRARY: Genomic DN #A from Pseudomonas putida (B) CLONE: pJRS54 (viii) POSITION IN GENOME: (A) CHROMOSOME/SEGMENT: (B) MAP POSITION: 35 #Minutes (C) UNITS: (ix) FEATURE: (A) NAME/KEY: Promoter #plus leader (B) LOCATION: 1-792 (C) IDENTIFICATION METHOD: # By experiment (D) OTHER INFORMATION: #The promoter plus leader are responsible #for expression of the bkd operon in Pseudomonas #putida (ix) FEATURE: (A) NAME/KEY: bkdA1, Ge #ne encoding branched-chain keto acid dehydrogenas #e-decarboxylase E1 alpha subunit. (B) LOCATION: 805-2031. # Initiating methionine codon is at position #802, however mature peptide does not contain N- terminal #methionine. (C) IDENTIFICATION METHOD: # By experiment (D) OTHER INFORMATION: #The E1 component of branched chain keto acid dehy #drogenase catalyzes the oxidative decarboxylat #ion of the keto acid substrate. E1 is composed #of two subunits, E1 alpha and E1 beta. (ix) FEATURE: (A) NAME/KEY: bkdA2, #Gene encoding branched-chain keto acid dehydrogenas #e-decarboxylase E1 beta subunit. (B) LOCATION: 2078-3091. #Initiating methionine codon is position #2075, however mature peptide does not contain N-terminal #methionine. (C) IDENTIFICATION METHOD: # By experiment (D) OTHER INFORMATION: #See description for Feature 2 above. (ix) FEATURE: (A) NAME/KEY: bkdB Gene # encoding the E2 component of branched chain ket #o acid dehydrogenase (B) LOCATION: 3098-4363 #Initiating methionine codon is position #3095, however mature peptide does not contain N-terminal #methionine. (C) IDENTIFICATION METHOD: # By experiment (D) OTHER INFORMATION: #E2 catalyzes the transacylation of the fatty acy #l group from the lipoyl residue of E2 to coenzyme #A. E2 is the core of the complex and bin #ds E1 and E3 #components. (ix) FEATURE: (A) NAME/KEY: lpdV, Gen #e encoding the E3 component of branched chain ket #o acid dehydrogenase. (B) LOCATION: 4369-5745. #N-terminal methionine is present on mature pe #ptide. (C) IDENTIFICATION METHOD: # By experiment (D) OTHER INFORMATION: #E3 is LPD-val, the specific lipoamide dehydrogenas #e which catalyzes oxidation of the dihydrolipoy #l residue of the E2 component of branched chain ket #o acid dehydrogenase and the reduction of NAD+. (x) PUBLICATION INFORMATION: (A) AUTHORS: Sokatch, J #ohn R. McCully, #Vicki Gebrosky, #Janet Sokatch, #David,J. (B) TITLE: Isolation of # a specific lipoamide dehydrogenase for a #branched-chain keto acid dehydrogenase from Pseu #domonas putida (C) JOURNAL: Journal of # Bacteriology (D) VOLUME: 148 (E) ISSUE: (F) PAGES: 639-646 (G) DATE: 1981 (A) AUTHORS: Sokatch,John #R. McCully, #Vicki Roberts, #C.M. (B) TITLE: Purification #of a branched-chain keto acid dehydrogenas #e from Pseudomonas putida (C) JOURNAL: Journal of # Bacteriology (D) VOLUME: 148 (E) ISSUE: (F) PAGES: 647-652 (G) DATE: 1981 (A) AUTHORS: Sykes, Pam #ela Burns, Ga #yle Menard, J #oan Hatter, K #enneth Sokatch, #John R. (B) TITLE: Molecular cl #oning of genes encoding branched-chain keto acid # dehydrogenase of Pseudomonas putida (C) JOURNAL: Journal of # Bacteriology (D) VOLUME: 169 (E) ISSUE: (F) PAGES: 1619-1625 (G) DATE: 1987 (A) AUTHORS: Burns, Gay #le Brown, Tr #acy Hatter, K #enneth Sokatch, #John R. (B) TITLE: Comparison o #f the amino acid sequences of the transacylase # components of branched-chain oxoacid dehydrogenas #e of Pseudomonas putida, and the pyruvate and 2-oxo #glutarate dehydrogenases of Escherichia coli (C) JOURNAL: European J #ournal of Biochemistry (D) VOLUME: 176 (E) ISSUE: (F) PAGES: 165-169 (G) DATE: 1988 (A) AUTHORS: Burns,Gayle Brown, Tr #acy Hatter, K #enneth Idriss, J #ohn M. Sokatch, #John R. (B) TITLE: Similarity o #f the E1 subunits of branched-chain- oxoacid d #ehydrogenase from Pseudomonas putida to the correspondin #g subunits of mammalian branched-chain- oxoacid a #nd pyruvate dehydrogenases (C) JOURNAL: European J #ournal of Biochemistry (D) VOLUME: 176 (E) ISSUE: (F) PAGES: 311-317 (G) DATE: 1988 (A) AUTHORS: Burns, Gay #le Brown, Tr #acy Hatter, K #enneth Sokatch, #John R. (B) TITLE: Sequence ana #lysis of the lpdV gene for lipoamide dehydrogenas #e of Pseudomonas putida (C) JOURNAL: European J #ournal of Biochemistry (D) VOLUME: 179 (E) ISSUE: (F) PAGES: 61-69 (G) DATE: 1989 (A) AUTHORS: Madhusudhan, #K.T. Huang, G. Burns, Ga #yle Sokatch, #J.R. (B) TITLE: Transcriptional # analysis of the promoter region of the branc #hed chain keto acid dehydrogenase operon of Pseudomonas #putida (C) JOURNAL: Journal of # Bacteriology (D) VOLUME: 172 (E) ISSUE: October, #1990 (F) PAGES: 5655-5663 (G) DATE: 1990 (K) RELEVANT RESIDUES I #N SEQ ID NO:1: FROM 1 TO 6122 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:1: CGATGCCCTG GAGCTGAGCG ATGCTCATGA CGCTTGTCCT TGTTGTTGTA GG #CTGACAAC 60 AACATAGGCT GGGGGTGTTT AAAATATCAA GCAGCCTCTC GAACGCCTGG GG #CCTCTTCT 120 ATCGCGCAAG GTCATGCCAT TGGCCGGCAA CGGCAAGGCT GTCTTGTAGC GC #ACCTGTTT 180 CAAGGCAAAA CTCGAGCGGA TATTCGCCAC ACCCGGCAAC CGGGTCAGGT AA #TCGAGAAA 240 CCGCTCCAGC GCCTGGATAC TCGGCAGCAG TACCCGCAAC AGGTAGTCCG GG #TCGCCCGT 300 CATCAGGTAG CACTCCATCA CCTCGGGCCG TTCGGCAATT TCTTCCTCGA AG #CGGTGCAG 360 CGACTGCTCT ACCTGTTTTT CCAGGCTGAC ATGGATGAAC ACATTCACAT CC #AGCCCCAA 420 CGCCTCGGGC GACAACAAGG TCACCTGCTG GCGGATCACC CCCAGTTCTT CC #ATGGCCCG 480 CACCCGGTTG AAACAGGGCG TGGGCGACAG GTTGACCGAG CGTGCCAGCT CG #GCGTTGGT 540 GATGCGGGCG TTTTCCTGCA GGCTGTTGAG AATGCCGATA TCGGTACGAT CG #AGTTTGCG 600 CATGAGACAA AATCACCGGT TTTTTGTGTT TATGCGGAAT GTTTATCTGC CC #CGCTCGGC 660 AAAGGCAATC AACTTGAGAG AAAAATTCTC CTGCCGGACC ACTAAGATGT AG #GGGACGCT 720 GACTTACCAG TCACAAGCCG GTACTCAGCG GCGGCCGCTT CAGAGCTCAC AA #AAACAAAT 780 ACCCGAGCGA GCGTAAAAAG CATG AAC GAG TAC GCC CCC #CTG CGT TTG 828 # Asn Glu Tyr Ala Pro # Leu Arg Leu # # 5 CAT GTG CCC GAG CCC ACC GGC CGG CCA GGC TG #C CAG ACC GAT TTT TCC 876 His Val Pro Glu Pro Thr Gly Arg Pro Gly Cy #s Gln Thr Asp Phe Ser 10 # 15 # 20 TAC CTG CGC CTG AAC GAT GCA GGT CAA GCC CG #T AAA CCC CCT GTC GAT 924 Tyr Leu Arg Leu Asn Asp Ala Gly Gln Ala Ar #g Lys Pro Pro Val Asp 25 # 30 # 35 # 40 GTC GAC GCT GCC GAC ACC GCC GAC CTG TCC TA #C AGC CTG GTC CGC GTG 972 Val Asp Ala Ala Asp Thr Ala Asp Leu Ser Ty #r Ser Leu Val Arg Val 45 # 50 # 55 CTC GAC GAG CAA GGC GAC GCC CAA GGC CCG TG #G GCT GAA GAC ATC GAC 1020 Leu Asp Glu Gln Gly Asp Ala Gln Gly Pro Tr #p Ala Glu Asp Ile Asp 60 # 65 # 70 CCG CAG ATC CTG CGC CAA GGC ATG CGC GCC AT #G CTC AAG ACG CGG ATC 1068 Pro Gln Ile Leu Arg Gln Gly Met Arg Ala Me #t Leu Lys Thr Arg Ile 75 # 80 # 85 TTC GAC AGC CGC ATG GTG GTT GCC CAG CGC CA #G AAG AAG ATG TCC TTC 1116 Phe Asp Ser Arg Met Val Val Ala Gln Arg Gl #n Lys Lys Met Ser Phe 90 # 95 # 100 TAC ATG CAG AGC CTG GGC GAA GAA GCC ATC GG #C AGC GGC CAG GCG CTG 1164 Tyr Met Gln Ser Leu Gly Glu Glu Ala Ile Gl #y Ser Gly Gln Ala Leu 105 1 #10 1 #15 1 #20 GCG CTT AAC CGC ACC GAC ATG TGC TTC CCC AC #C TAC CGT CAG CAA AGC 1212 Ala Leu Asn Arg Thr Asp Met Cys Phe Pro Th #r Tyr Arg Gln Gln Ser 125 # 130 # 135 ATC CTG ATG GCC CGC GAC GTG TCG CTG GTG GA #G ATG ATC TGC CAG TTG 1260 Ile Leu Met Ala Arg Asp Val Ser Leu Val Gl #u Met Ile Cys Gln Leu 140 # 145 # 150 CTG TCC AAC GAA CGC GAC CCC CTC AAG GGC CG #C CAG CTG CCG ATC ATG 1308 Leu Ser Asn Glu Arg Asp Pro Leu Lys Gly Ar #g Gln Leu Pro Ile Met 155 # 160 # 165 TAC TCG GTA CGC GAG GCC GGC TTC TTC ACC AT #C AGC GGC AAC CTG GCG 1356 Tyr Ser Val Arg Glu Ala Gly Phe Phe Thr Il #e Ser Gly Asn Leu Ala 170 # 175 # 180 ACC CAG TTC GTG CAG GCG GTC GGC TGG GCC AT #G GCC TCG GCG ATC AAG 1404 Thr Gln Phe Val Gln Ala Val Gly Trp Ala Me #t Ala Ser Ala Ile Lys 185 1 #90 1 #95 2 #00 GGC GAT ACC AAG ATT GCC TCG GCC TGG ATC GG #C GAC GGC GCC ACT GCC 1452 Gly Asp Thr Lys Ile Ala Ser Ala Trp Ile Gl #y Asp Gly Ala Thr Ala 205 # 210 # 215 GAA TCG GAC TTC CAC ACC GCC CTC ACC TTT GC #C CAC GTT TAC CGC GCC 1500 Glu Ser Asp Phe His Thr Ala Leu Thr Phe Al #a His Val Tyr Arg Ala 220 # 225 # 230 CCG GTG ATC CTC AAC GTG GTC AAC AAC CAG TG #G GCC ATC TCA ACC TTC 1548 Pro Val Ile Leu Asn Val Val Asn Asn Gln Tr #p Ala Ile Ser Thr Phe 235 # 240 # 245 CAG GCC ATC GCC GGT GGC GAG TCG ACC ACC TT #C GCC GGC CGT GGC GTG 1596 Gln Ala Ile Ala Gly Gly Glu Ser Thr Thr Ph #e Ala Gly Arg Gly Val 250 # 255 # 260 GGC TGC GGC ATC GCT TCG CTG CGG GTG GAC GG #C AAC GAC TTC GTC GCC 1644 Gly Cys Gly Ile Ala Ser Leu Arg Val Asp Gl #y Asn Asp Phe Val Ala 265 2 #70 2 #75 2 #80 GTT TAC GCC GCT TCG CGC TGG GCT GCC GAA CG #T GCC CGC CGT GGT TTG 1692 Val Tyr Ala Ala Ser Arg Trp Ala Ala Glu Ar #g Ala Arg Arg Gly Leu 285 # 290 # 295 GGC CCG AGC CTG ATC GAG TGG GTC ACC TAC CG #T GCC GGC CCG CAC TCG 1740 Gly Pro Ser Leu Ile Glu Trp Val Thr Tyr Ar #g Ala Gly Pro His Ser 300 # 305 # 310 ACC TCG GAC GAC CCG TCC AAG TAC CGC CCT GC #C GAT GAC TGG AGC CAC 1788 Thr Ser Asp Asp Pro Ser Lys Tyr Arg Pro Al #a Asp Asp Trp Ser His 315 # 320 # 325 TTC CCG CTG GGT GAC CCG ATC GCC CGC CTG AA #G CAG CAC CTG ATC AAG 1836 Phe Pro Leu Gly Asp Pro Ile Ala Arg Leu Ly #s Gln His Leu Ile Lys 330 # 335 # 340 ATC GGC CAC TGG TGC GAA GAA GAA CAC CAG GC #C ACC ACG GCC GAG TTC 1884 Ile Gly His Trp Cys Glu Glu Glu His Gln Al #a Thr Thr Ala Glu Phe 345 3 #50 3 #55 3 #60 GAA GCG GCC GTG ATT GCT GCG CAA AAA GAA GC #C GAG CAG TAC GGC ACC 1932 Glu Ala Ala Val Ile Ala Ala Gln Lys Glu Al #a Glu Gln Tyr Gly Thr 365 # 370 # 375 CTG GCC AAC GGT CAC ATC CCG AGC GCC GCC TC #G ATG TTC GAG GAC GTG 1980 Leu Ala Asn Gly His Ile Pro Ser Ala Ala Se #r Met Phe Glu Asp Val 380 # 385 # 390 TAC AAG GAG ATG CCC GAC CAC CTG CGC CGC CA #A CGC CAG GAA CTG GGG 2028 Tyr Lys Glu Met Pro Asp His Leu Arg Arg Gl #n Arg Gln Glu Leu Gly 395 # 400 # 405 GTT TGAGATGAAC GACCACAACA ACAGCATCAA CCCGGAAACC GCCATG #GCC ACC 2083 Val # # Ala #Thr ACT ACC ATG ACC ATG ATC CAG GCC CTG CGC TC #G GCC ATG GAT GTC ATG 2131 Thr Thr Met Thr Met Ile Gln Ala Leu Arg Se #r Ala Met Asp Val Met 5 # 10 # 15 CTT GAG CGC GAC GAC AAT GTG GTG GTG TAC GG #C CAG GAC GTC GGC TAC 2179 Leu Glu Arg Asp Asp Asn Val Val Val Tyr Gl #y Gln Asp Val Gly Tyr 20 # 25 # 30 TTC GGC GGC GTG TTC CGC TGC ACC GAA GGC CT #G CAG ACC AAG TAC GGC 2227 Phe Gly Gly Val Phe Arg Cys Thr Glu Gly Le #u Gln Thr Lys Tyr Gly 35 # 40 # 45 # 50 AAG TCC CGC GTG TTC GAC GCG CCC ATC TCT GA #A AGC GGC ATC GTC GGC 2275 Lys Ser Arg Val Phe Asp Ala Pro Ile Ser Gl #u Ser Gly Ile Val Gly 55 # 60 # 65 ACC GCC GTG GGC ATG GGT GCC TAC GGC CTG CG #C CCG GTG GTG GAA ATC 2323 Thr Ala Val Gly Met Gly Ala Tyr Gly Leu Ar #g Pro Val Val Glu Ile 70 # 75 # 80 CAG TTC GCT GAC TAC TTC TAC CCG GCC TCC GA #C CAG ATC GTT TCT GAA 2371 Gln Phe Ala Asp Tyr Phe Tyr Pro Ala Ser As #p Gln Ile Val Ser Glu 85 # 90 # 95 ATG GCC CGC CTG CGC TAC CGT TCG GCC GGC GA #G TTC ATC GCC CCG CTG 2419 Met Ala Arg Leu Arg Tyr Arg Ser Ala Gly Gl #u Phe Ile Ala Pro Leu 100 # 105 # 110 ACC CTG CGT ATG CCC TGC GGT GGC GGT ATC TA #T GGC GGC CAG ACA CAC 2467 Thr Leu Arg Met Pro Cys Gly Gly Gly Ile Ty #r Gly Gly Gln Thr His 115 1 #20 1 #25 1 #30 AGC CAG AGC CCG GAA GCG ATG TTC ACT CAG GT #G TGC GGC CTG CGC ACC 2515 Ser Gln Ser Pro Glu Ala Met Phe Thr Gln Va #l Cys Gly Leu Arg Thr 135 # 140 # 145 GTA ATG CCA TCC AAC CCG TAC GAC GCC AAA GG #C CTG CTG ATT GCC TCG 2563 Val Met Pro Ser Asn Pro Tyr Asp Ala Lys Gl #y Leu Leu Ile Ala Ser 150 # 155 # 160 ATC GAA TGC GAC GAC CCG GTG ATC TTC CTG GA #G CCC AAG CGC CTG TAC 2611 Ile Glu Cys Asp Asp Pro Val Ile Phe Leu Gl #u Pro Lys Arg Leu Tyr 165 # 170 # 175 AAC GGC CCG TTC GAC GGC CAC CAT GAC CGC CC #G GTT ACG CCG TGG TCG 2659 Asn Gly Pro Phe Asp Gly His His Asp Arg Pr #o Val Thr Pro Trp Ser 180 # 185 # 190 AAA CAC CCG CAC AGC GCC GTG CCC GAT GGC TA #C TAC ACC GTG CCA CTG 2707 Lys His Pro His Ser Ala Val Pro Asp Gly Ty #r Tyr Thr Val Pro Leu 195 2 #00 2 #05 2 #10 GAC AAG GCC GCC ATC ACC CGC CCC GGC AAT GA #C GTG AGC GTG CTC ACC 2755 Asp Lys Ala Ala Ile Thr Arg Pro Gly Asn As #p Val Ser Val Leu Thr 215 # 220 # 225 TAT GGC ACC ACC GTG TAC GTG GCC CAG GTG GC #C GCC GAA GAA AGT GGC 2803 Tyr Gly Thr Thr Val Tyr Val Ala Gln Val Al #a Ala Glu Glu Ser Gly 230 # 235 # 240 GTG GAT GCC GAA GTG ATC GAC CTG CGC AGC CT #G TGG CCG CTA GAC CTG 2851 Val Asp Ala Glu Val Ile Asp Leu Arg Ser Le #u Trp Pro Leu Asp Leu 245 # 250 # 255 GAC ACC ATC GTC GAG TCG GTG AAA AAG ACC GG #C CGT TGC GTG GTA GTA 2899 Asp Thr Ile Val Glu Ser Val Lys Lys Thr Gl #y Arg Cys Val Val Val 260 # 265 # 270 CAC GAG GCC ACC CGT ACT TGT GGC TTT GGC GC #A GAA CTG GTG TCG CTG 2947 His Glu Ala Thr Arg Thr Cys Gly Phe Gly Al #a Glu Leu Val Ser Leu 275 2 #80 2 #85 2 #90 GTG CAG GAG CAC TGC TTC CAC CAC CTG GAG GC #G CCG ATC GAG CGC GTC 2995 Val Gln Glu His Cys Phe His His Leu Glu Al #a Pro Ile Glu Arg Val 295 # 300 # 305 ACC GGT TGG GAC ACC CCC TAC CCT CAC GCG CA #G GAA TGG GCT TAC TTC 3043 Thr Gly Trp Asp Thr Pro Tyr Pro His Ala Gl #n Glu Trp Ala Tyr Phe 310 # 315 # 320 CCA GGG CCT TCG CGG GTA GGT GCG GCA TTG AA #A AAG GTC ATG GAG GTC 3091 Pro Gly Pro Ser Arg Val Gly Ala Ala Leu Ly #s Lys Val Met Glu Val 325 # 330 # 335 TGAATG GGC ACG CAC GTC ATC AAG ATG CCG GAC #ATT GGC GAA GGC ATC 3139 Gly Thr His Val Ile Lys Me #t Pro Asp Ile Gly Glu Gly Ile # 5 # 10 GCG CAG GTC GAA TTG GTG GAA TGG TTC GTC AA #G GTG GGC GAC ATC ATC 3187 Ala Gln Val Glu Leu Val Glu Trp Phe Val Ly #s Val Gly Asp Ile Ile 15 # 20 # 25 # 30 GCC GAG GAC CAA GTG GTA GCC GAC GTC ATG AC #C GAC AAG GCC ACC GTG 3235 Ala Glu Asp Gln Val Val Ala Asp Val Met Th #r Asp Lys Ala Thr Val 35 # 40 # 45 GAA ATC CCG TCG CCG GTC AGC GGC AAG GTG CT #G GCC CTG GGT GGC CAG 3283 Glu Ile Pro Ser Pro Val Ser Gly Lys Val Le #u Ala Leu Gly Gly Gln 50 # 55 # 60 CCA GGT GAA GTG ATG GCG GTC GGC AGT GAG CT #G ATC CGC ATC GAA GTG 3331 Pro Gly Glu Val Met Ala Val Gly Ser Glu Le #u Ile Arg Ile Glu Val 65 # 70 # 75 GAA GGC AGC GGC AAC CAT GTG GAT GTG CCG CA #A GCC AAG CCG GCC GAA 3379 Glu Gly Ser Gly Asn His Val Asp Val Pro Gl #n Ala Lys Pro Ala Glu 80 # 85 # 90 GTG CCT GCG GCA CCG GTA GCC GCT AAA CCT GA #A CCA CAG AAA GAC GTT 3427 Val Pro Ala Ala Pro Val Ala Ala Lys Pro Gl #u Pro Gln Lys Asp Val 95 #100 #105 #110 AAA CCG GCG GCG TAC CAG GCG TCA GCC AGC CA #C GAG GCA GCG CCC ATC 3475 Lys Pro Ala Ala Tyr Gln Ala Ser Ala Ser Hi #s Glu Ala Ala Pro Ile 115 # 120 # 125 GTG CCG CGC CAG CCG GGC GAC AAG CCG CTG GC #C TCG CCG GCG GTG CGC 3523 Val Pro Arg Gln Pro Gly Asp Lys Pro Leu Al #a Ser Pro Ala Val Arg 130 # 135 # 140 AAA CGC GCC CTC GAT GCC GGC ATC GAA TTG CG #T TAT GTG CAC GGC AGC 3571 Lys Arg Ala Leu Asp Ala Gly Ile Glu Leu Ar #g Tyr Val His Gly Ser 145 # 150 # 155 GGC CCG GCC GGG CGC ATC CTG CAC GAA GAC CT #C GAC GCG TTC ATG AGC 3619 Gly Pro Ala Gly Arg Ile Leu His Glu Asp Le #u Asp Ala Phe Met Ser 160 # 165 # 170 AAA CCG CAA AGC GCT GCC GGG CAA ACC CCC AA #T GGC TAT GCC AGG CGC 3667 Lys Pro Gln Ser Ala Ala Gly Gln Thr Pro As #n Gly Tyr Ala Arg Arg 175 1 #80 1 #85 1 #90 ACC GAC AGC GAG CAG GTG CCG GTG ATC GGC CT #G CGC CGC AAG ATC GCC 3715 Thr Asp Ser Glu Gln Val Pro Val Ile Gly Le #u Arg Arg Lys Ile Ala 195 # 200 # 205 CAG CGC ATG CAG GAC GCC AAG CGC CGG GTC GC #G CAC TTC AGC TAT GTG 3763 Gln Arg Met Gln Asp Ala Lys Arg Arg Val Al #a His Phe Ser Tyr Val 210 # 215 # 220 GAA GAA ATC GAC GTC ACC GCC CTG GAA GCC CT #G CGC CAG CAG CTC AAC 3811 Glu Glu Ile Asp Val Thr Ala Leu Glu Ala Le #u Arg Gln Gln Leu Asn 225 # 230 # 235 AGC AAG CAC GGC GAC AGC CGC GGC AAG CTG AC #A CTG CTG CCG TTC CTG 3859 Ser Lys His Gly Asp Ser Arg Gly Lys Leu Th #r Leu Leu Pro Phe Leu 240 # 245 # 250 GTG CGC GCC CTG GTC GTG GCA CTG CGT GAC TT #C CCG CAG ATA AAC GCC 3907 Val Arg Ala Leu Val Val Ala Leu Arg Asp Ph #e Pro Gln Ile Asn Ala 255 2 #60 2 #65 2 #70 ACC TAC GAT GAC GAA GCG CAG ATC ATC ACC CG #C CAT GGC GCG GTG CAT 3955 Thr Tyr Asp Asp Glu Ala Gln Ile Ile Thr Ar #g His Gly Ala Val His 275 # 280 # 285 GTG GGC ATC GCC ACC CAA GGT GAC AAC GGC CT #G ATG GTA CCC GTG CTG 4003 Val Gly Ile Ala Thr Gln Gly Asp Asn Gly Le #u Met Val Pro Val Leu 290 # 295 # 300 CGC CAC GCC GAA GCG GGC AGC CTG TGG GCC AA #T GCC GGT GAG ATT TCA 4051 Arg His Ala Glu Ala Gly Ser Leu Trp Ala As #n Ala Gly Glu Ile Ser 305 # 310 # 315 CGC CTG GCC AAC GCT GCG CGC AAC AAC AAG GC #C AGC CGC GAA GAG CTG 4099 Arg Leu Ala Asn Ala Ala Arg Asn Asn Lys Al #a Ser Arg Glu Glu Leu 320 # 325 # 330 TCC GGT TCG ACC ATT ACC CTG ACC AGC CTC GG #C GCC CTG GGC GGC ATC 4147 Ser Gly Ser Thr Ile Thr Leu Thr Ser Leu Gl #y Ala Leu Gly Gly Ile 335 3 #40 3 #45 3 #50 GTC AGC ACG CCG GTG GTC AAC ACC CCG GAA GT #G GCG ATC GTC GGT GTC 4195 Val Ser Thr Pro Val Val Asn Thr Pro Glu Va #l Ala Ile Val Gly Val 355 # 360 # 365 AAC CGC ATG GTT GAG CGG CCC GTG GTG ATC GA #C GGC CAG ATC GTC GTG 4243 Asn Arg Met Val Glu Arg Pro Val Val Ile As #p Gly Gln Ile Val Val 370 # 375 # 380 CGC AAG ATG ATG AAC CTG TCC AGC TCG TTC GA #C CAC CGC GTG GTC GAT 4291 Arg Lys Met Met Asn Leu Ser Ser Ser Phe As #p His Arg Val Val Asp 385 # 390 # 395 GGC ATG GAC GCC GCC CTG TTC ATC CAG GCC GT #G CGT GGC CTG CTC GAA 4339 Gly Met Asp Ala Ala Leu Phe Ile Gln Ala Va #l Arg Gly Leu Leu Glu 400 # 405 # 410 CAA CCC GCC TGC CTG TTC GTG GAG TGAGC ATG #CAA CAG ACT ATC 438 #3 Gln Pro Ala Cys Leu Phe Val Glu # Met Gln Gln Thr Ile 415 4 #20 # 5 CAG ACA ACC CTG TTG ATC ATC GGC GGC GGC CC #T GGC GGC TAT GTG GCG 4431 Gln Thr Thr Leu Leu Ile Ile Gly Gly Gly Pr #o Gly Gly Tyr Val Ala 10 # 15 # 20 GCC ATC CGC GCC GGG CAA CTG GGC ATC CCT AC #C GTG CTG GTG GAA GGC 4479 Ala Ile Arg Ala Gly Gln Leu Gly Ile Pro Th #r Val Leu Val Glu Gly 25 # 30 # 35 CAG GCG CTG GGC GGT ACC TGC CTG AAC ATC GG #C TGC ATT CCG TCC AAG 4527 Gln Ala Leu Gly Gly Thr Cys Leu Asn Ile Gl #y Cys Ile Pro Ser Lys 40 # 45 # 50 GCG CTG ATC CAT GTG GCC GAG CAG TTC CAC CA #G GCC TCG CGC TTT ACC 4575 Ala Leu Ile His Val Ala Glu Gln Phe His Gl #n Ala Ser Arg Phe Thr 55 # 60 # 65 GAA CCC TCG CCG CTG GGC ATC AGC GTG GCT TC #G CCA CGC CTG GAC ATC 4623 Glu Pro Ser Pro Leu Gly Ile Ser Val Ala Se #r Pro Arg Leu Asp Ile 70 # 75 #80 # 85 GGC CAG AGC GTG GCC TGG AAA GAC GGC ATC GT #C GAT CGC CTG ACC ACT 4671 Gly Gln Ser Val Ala Trp Lys Asp Gly Ile Va #l Asp Arg Leu Thr Thr 90 # 95 # 100 GGT GTC GCC GCC CTG CTG AAA AAG CAC GGG GT #G AAG GTG GTG CAC GGC 4719 Gly Val Ala Ala Leu Leu Lys Lys His Gly Va #l Lys Val Val His Gly 105 # 110 # 115 TGG GCC AAG GTG CTT GAT GGC AAG CAG GTC GA #G GTG GAT GGC CAG CGC 4767 Trp Ala Lys Val Leu Asp Gly Lys Gln Val Gl #u Val Asp Gly Gln Arg 110 # 115 # 120 ATC CAG TGC GAG CAC CTG TTG CTG GCC ACG GG #C TCC AGC AGT GTC GAA 4815 Ile Gln Cys Glu His Leu Leu Leu Ala Thr Gl #y Ser Ser Ser Val Glu 125 # 130 # 135 CTG CCG ATG CTG CCG TTG GGT GGG CCG GTG AT #T TCC TCG ACC GAG GCC 4863 Leu Pro Met Leu Pro Leu Gly Gly Pro Val Il #e Ser Ser Thr Glu Ala 140 1 #45 1 #50 1 #55 CTG GCA CCG AAA GCC CTG CCG CAA CAC CTG GT #G GTG GTG GGC GGT GGC 4911 Leu Ala Pro Lys Ala Leu Pro Gln His Leu Va #l Val Val Gly Gly Gly 160 # 165 # 170 TAC ATC GGC CTG GAG CTG GGT ATC GCC TAC CG #C AAG CTC GGC GCG CAG 4959 Tyr Ile Gly Leu Glu Leu Gly Ile Ala Tyr Ar #g Lys Leu Gly Ala Gln 175 # 180 # 185 GTC AGC GTG GTG GAA GCG CGC GAG CGC ATC CT #G CCG ACT TAC GAC AGC 5007 Val Ser Val Val Glu Ala Arg Glu Arg Ile Le #u Pro Thr Tyr Asp Ser 190 # 195 # 200 GAA CTG ACC GCC CCG GTG GCC GAG TCG CTG AA #A AAG CTG GGT ATC GCC 5055 Glu Leu Thr Ala Pro Val Ala Glu Ser Leu Ly #s Lys Leu Gly Ile Ala 205 # 210 # 215 CTG CAC CTT GGC CAC AGC GTC GAA GGT TAC GA #A AAT GGC TGC CTG CTG 5103 Leu His Leu Gly His Ser Val Glu Gly Tyr Gl #u Asn Gly Cys Leu Leu 220 2 #25 2 #30 2 #35 GCC AAC GAT GGC AAG GGC GGA CAA CTG CGC CT #G GAA GCC GAC CGG GTG 5151 Ala Asn Asp Gly Lys Gly Gly Gln Leu Arg Le #u Glu Ala Asp Arg Val 240 # 245 # 250 CTG GTG GCC GTG GGC CGC CGC CCA CGC ACC AA #G GGC TTC AAC CTG GAA 5199 Leu Val Ala Val Gly Arg Arg Pro Arg Thr Ly #s Gly Phe Asn Leu Glu 255 # 260 # 265 TGC CTG GAC CTG AAG ATG AAT GGT GCC GCG AT #T GCC ATC GAC GAG CGC 5247 Cys Leu Asp Leu Lys Met Asn Gly Ala Ala Il #e Ala Ile Asp Glu Arg 270 # 275 # 280 TGC CAG ACC AGC ATG CAC AAC GTC TGG GCC AT #C GGC GAC GTG GCC GGC 5295 Cys Gln Thr Ser Met His Asn Val Trp Ala Il #e Gly Asp Val Ala Gly 285 # 290 # 295 GAA CCG ATG CTG GCG CAC CGG GCC ATG GCC CA #G GGC GAG ATG GTG GCC 5343 Glu Pro Met Leu Ala His Arg Ala Met Ala Gl #n Gly Glu Met Val Ala 300 3 #05 3 #10 3 #15 GAG ATC ATC GCC GGC AAG GCA CGC CGC TTC GA #A CCC GCT GCG ATA GCC 5391 Glu Ile Ile Ala Gly Lys Ala Arg Arg Phe Gl #u Pro Ala Ala Ile Ala 320 # 325 # 330 GCC GTG TGC TTC ACC GAC CCG GAA GTG GTC GT #G GTC GGC AAG ACG CCG 5439 Ala Val Cys Phe Thr Asp Pro Glu Val Val Va #l Val Gly Lys Thr Pro 335 # 340 # 345 GAA CAG GCC AGT CAG CAA GGC CTG GAC TGC AT #C GTC GCG CAG TTC CCG 5487 Glu Gln Ala Ser Gln Gln Gly Leu Asp Cys Il #e Val Ala Gln Phe Pro 350 # 355 # 360 TTC GCC GCC AAC GGC CGG GCC ATG AGC CTG GA #G TCG AAA AGC GGT TTC 5535 Phe Ala Ala Asn Gly Arg Ala Met Ser Leu Gl #u Ser Lys Ser Gly Phe 365 # 370 # 375 GTG CGC GTG GTC GCG CGG CGT GAC AAC CAC CT #G ATC CTG GGC TGG CAA 5583 Val Arg Val Val Ala Arg Arg Asp Asn His Le #u Ile Leu Gly Trp Gln 380 3 #85 3 #90 3 #95 GCG GTT GGC GTG GCG GTT TCC GAG CTG TCC AC #G GCG TTT GCC CAG TCG 5631 Ala Val Gly Val Ala Val Ser Glu Leu Ser Th #r Ala Phe Ala Gln Ser 400 # 405 # 410 CTG GAG ATG GGT GCC TGC CTG GAG GAT GTG GC #C GGT ACC ATC CAT GCC 5679 Leu Glu Met Gly Ala Cys Leu Glu Asp Val Al #a Gly Thr Ile His Ala 415 # 420 # 425 CAC CCG ACC CTG GGT GAA GCG GTA CAG GAA GC #G GCA CTG CGT GCC CTG 5727 His Pro Thr Leu Gly Glu Ala Val Gln Glu Al #a Ala Leu Arg Ala Leu 430 # 435 # 440 GGC CAC GCC CTG CAT ATC TGACACTGAA GCGGCCGAGG CC #GATTTGGC 5775 Gly His Ala Leu His Ile 445 CCGCCGCGCC GAGAGGCGCT GCGGGTCTTT TTTATACCTG TACCGGCAAA CC #AATTCACT 5835 CGGCGATGGC ATTCTTGCNG GCCCTTTTGG CCCGGTACAT TGCCTTATCA GC #CCNNNNCC 5895 AGNNGCGNAT GCTNGGTCCT CCCCTTCCTG CCACTGCACC ACGCCATAAC TC #ATGGTCAG 5955 ACGGCACTCC CCCACNGGTT NCAGTTNNCG CCATNCNNCC NNGNAAGCGC CC #GGCGACAT 6015 CCAGCGCCTC GCCCAGCGTG CTCTGCGGCA GTACGATAAC GAACTCGTCC CC #GCCCCAGC 6075 GCGCCAACAG GTCCATGTTC GCGCAGGCAG GTCCGCAGGC TGTCGAC # 6122 (2) INFORMATION FOR SEQ ID NO:2: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 409 Amino #acids (B) TYPE: Amino aci #d (D) TOPOLOGY: Linear (ii) MOLECULE TYPE: Protein (ix) FEATURE: (A) NAME/KEY: Alpha sub #unit of E1 component (B) LOCATION: 805-2031, #Does not include initiating methionine (C) IDENTIFICATION METHOD: # N-terminal amino acid sequence (x) PUBLICATION INFORMATION: (A) AUTHORS: Burns, Gay #le Brown, Tr #acy Hatter, K #enneth Idriss, J #ohn. M. Sokatch, #John R. (B) TITLE: Similarity o #f the E1 subunits of branched-chain oxoacid d #ehydrogenase from Pseudomonas putida to the correspondin #g subunits of mammalian branched-chain- oxoacid a #nd pyruvate dehydrogenases (C) JOURNAL: European J #ournal of Biochemistry (D) VOLUME: 176 (F) PAGES: 311-317 (G) DATE: 1988 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:2: Asn Glu Tyr Ala Pro Leu Arg Leu His Val Pr #o Glu Pro Thr Gly #5 #10 #15 Arg Pro Gly Cys Gln Thr Asp Phe Ser Tyr Le #u Arg Leu Asn Asp 20 # 25 # 30 Ala Gly Gln Ala Arg Lys Pro Pro Val Asp Va #l Asp Ala Ala Asp 35 # 40 # 45 Thr Ala Asp Leu Ser Tyr Ser Leu Val Arg Va #l Leu Asp Glu Gln 50 # 55 # 60 Gly Asp Ala Gln Gly Pro Trp Ala Glu Asp Il #e Asp Pro Gln Ile 65 # 70 # 75 Leu Arg Gln Gly Met Arg Ala Met Leu Lys Th #r Arg Ile Phe Asp 80 # 85 # 90 Ser Arg Met Val Val Ala Gln Arg Gln Lys Ly #s Met Ser Phe Tyr 95 # 100 # 105 Met Gln Ser Leu Gly Glu Glu Ala Ile Gly Se #r Gly Gln Ala Leu 110 # 115 # 120 Ala Leu Asn Arg Thr Asp Met Cys Phe Pro Th #r Tyr Arg Gln Gln 125 # 130 # 135 Ser Ile Leu Met Ala Arg Asp Val Ser Leu Va #l Glu Met Ile Cys 140 # 145 # 150 Gln Leu Leu Ser Asn Glu Arg Asp Pro Leu Ly #s Gly Arg Gln Leu 155 # 160 # 165 Pro Ile Met Tyr Ser Val Arg Glu Ala Gly Ph #e Phe Thr Ile Ser 170 # 175 # 180 Gly Asn Leu Ala Thr Gln Phe Val Gln Ala Va #l Gly Trp Ala Met 185 # 190 # 195 Ala Ser Ala Ile Lys Gly Asp Thr Lys Ile Al #a Ser Ala Trp Ile 200 # 205 # 210 Gly Asp Gly Ala Thr Ala Glu Ser Asp Phe Hi #s Thr Ala Leu Thr 215 # 220 # 225 Phe Ala His Val Tyr Arg Ala Pro Val Ile Le #u Asn Val Val Asn 230 # 235 # 240 Asn Gln Trp Ala Ile Ser Thr Phe Gln Ala Il #e Ala Gly Gly Glu 245 # 250 # 255 Ser Thr Thr Phe Ala Gly Arg Gly Val Gly Cy #s Gly Ile Ala Ser 260 # 265 # 270 Leu Arg Val Asp Gly Asn Asp Phe Val Ala Va #l Tyr Ala Ala Ser 275 # 280 # 285 Arg Trp Ala Ala Glu Arg Ala Arg Arg Gly Le #u Gly Pro Ser Leu 290 # 295 # 300 Ile Glu Trp Val Thr Tyr Arg Ala Gly Pro Hi #s Ser Thr Ser Asp 305 # 310 # 315 Asp Pro Ser Lys Tyr Arg Pro Ala Asp Asp Tr #p Ser His Phe Pro 320 # 325 # 330 Leu Gly Asp Pro Ile Ala Arg Leu Lys Gln Hi #s Leu Ile Lys Ile 335 # 340 # 345 Gly His Trp Cys Glu Glu Glu His Gln Ala Th #r Thr Ala Glu Phe 350 # 355 # 360 Glu Ala Ala Val Ile Ala Ala Gln Lys Glu Al #a Glu Gln Tyr Gly 365 # 370 # 375 Thr Leu Ala Asn Gly His Ile Pro Ser Ala Al #a Ser Met Phe Glu 380 # 385 # 390 Asp Val Tyr Lys Glu Met Pro Asp His Leu Ar #g Arg Gln Arg Gln 395 # 400 # 405 Glu Leu Gly Val (2) INFORMATION FOR SEQ ID NO:3: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 338 Amino #acids (B) TYPE: Amino acid (D) TOPOLOGY: Linear (ii) MOLECULE TYPE: Protein (ix) FEATURE: (A) NAME/KEY: Beta subu #nit of E1 component (B) LOCATION: 2078-3091, #Does not include inidiating methionine (C) IDENTIFICATION METHOD: # N-terminal amino acid sequence (x) PUBLICATION INFORMATION: (A) AUTHORS: Burns, Gay #le Brown, Tr #acy Hatter, K #enneth Idriss, J #ohn M. Sokatch, #John R. (B) TITLE: Similarity o #f the E1 subunits of branched-chain- oxoacid d #ehydrogenase from Pseudomonas putida to the correspondin #g subunits of mammalian branched-chain- oxoacid a #nd pyruvate dehydrogenases (C) JOURNAL: European J #ournal of Biochemistry (D) VOLUME: 176 (F) PAGES: 31-317 (G) DATE: 1988 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:3: Ala Thr Thr Thr Met Thr Met Ile Gln Ala Le #u Arg Ser Ala Met #5 #10 #15 Asp Val Met Leu Glu Arg Asp Asp Asn Val Va #l Val Tyr Gly Gln 20 # 25 # 30 Asp Val Gly Tyr Phe Gly Gly Val Phe Arg Cy #s Thr Glu Gly Leu 35 # 40 # 45 Gln Thr Lys Tyr Gly Lys Ser Arg Val Phe As #p Ala Pro Ile Ser 50 # 55 # 60 Glu Ser Gly Ile Val Gly Thr Ala Val Gly Me #t Gly Ala Tyr Gly 65 # 70 # 75 Leu Arg Pro Val Val Glu Ile Gln Phe Ala As #p Tyr Phe Tyr Pro 80 # 85 # 90 Ala Ser Asp Gln Ile Val Ser Glu Met Ala Ar #g Leu Arg Tyr Arg 95 # 100 # 105 Ser Ala Gly Glu Phe Ile Ala Pro Leu Thr Le #u Arg Met Pro Cys 110 # 115 # 120 Gly Gly Gly Ile Tyr Gly Gly Gln Thr His Se #r Gln Ser Pro Glu 125 # 130 # 135 Ala Met Phe Thr Gln Val Cys Gly Leu Arg Th #r Val Met Pro Ser 140 # 145 # 150 Asn Pro Tyr Asp Ala Lys Gly Leu Leu Ile Al #a Ser Ile Glu Cys 155 # 160 # 165 Asp Asp Pro Val Ile Phe Leu Glu Pro Lys Ar #g Leu Tyr Asn Gly 170 # 175 # 180 Pro Phe Asp Gly His His Asp Arg Pro Val Th #r Pro Trp Ser Lys 185 # 190 # 195 His Pro His Ser Ala Val Pro Asp Gly Tyr Ty #r Thr Val Pro Leu 200 # 205 # 210 Asp Lys Ala Ala Ile Thr Arg Pro Gly Asn As #p Val Ser Val Leu 215 # 220 # 225 Thr Tyr Gly Thr Thr Val Tyr Val Ala Gln Va #l Ala Ala Glu Glu 230 # 235 # 240 Ser Gly Val Asp Ala Glu Val Ile Asp Leu Ar #g Ser Leu Trp Pro 245 # 250 # 255 Leu Asp Leu Asp Thr Ile Val Glu Ser Val Ly #s Lys Thr Gly Arg 260 # 265 # 270 Cys Val Val Val His Glu Ala Thr Arg Thr Cy #s Gly Phe Gly Ala 275 # 280 # 285 Glu Leu Val Ser Leu Val Gln Glu His Cys Ph #e His His Leu Glu 290 # 295 # 300 Ala Pro Ile Glu Arg Val Thr Gly Trp Asp Th #r Pro Tyr Pro His 305 # 310 # 315 Ala Gln Glu Trp Ala Tyr Phe Pro Gly Pro Se #r Arg Val Gly Ala 320 # 325 # 330 Ala Leu Lys Lys Val Met Glu Val 335 (2) INFORMATION FOR SEQ ID NO:4: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 422 Amino #acids (B) TYPE: Amino acid (D) TOPOLOGY: Linear (ii) MOLECULE TYPE: Protein (ix) FEATURE: (A) NAME/KEY: E2 compon #ent (B) LOCATION: 3098-4363, #does not include initiating methionine (C) IDENTIFICATION METHOD: # N-terminal sequence (x) PUBLICATION INFORMATION: (A) AUTHORS: Burns, Gay #le Brown, Tr #acy Hatter, K #enneth Sokatch, #John R. (B) TITLE: Compaarison #of the amion acid sequences of the transacylase # components of branched-chain oxoacid dehydrogenas #e of Pseudomonas putida, and the pyruvate and 2-oxoglutara #te dehydrogenases of Escherichia coli (C) JOURNAL: European J #ournal of Biochemistry (D) VOLUME: 176 (F) PAGES: 165-169 (D) DATE: 1988 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:4: Gly Thr His Val Ile Lys Met Pro Asp Ile Gl #y Glu Gly Ile Ala #5 #10 #15 Gln Val Glu Leu Val Glu Trp Phe Val Lys Va #l Gly Asp Ile Ile 20 # 25 # 30 Ala Glu Asp Gln Val Val Ala Asp Val Met Th #r Asp Lys Ala Thr 35 # 40 # 45 Val Glu Ile Pro Ser Pro Val Ser Gly Lys Va #l Leu Ala Leu Gly 50 # 55 # 60 Gly Gln Pro Gly Glu Val Met Ala Val Gly Se #r Glu Leu Ile Arg 65 # 70 # 75 Ile Glu Val Glu Gly Ser Gly Asn His Val As #p Val Pro Gln Ala 80 # 85 # 90 Lys Pro Ala Glu Val Pro Ala Ala Pro Val Al #a Ala Lys Pro Glu 95 # 100 # 105 Pro Gln Lys Asp Val Lys Pro Ala Ala Tyr Gl #n Ala Ser Ala Ser 110 # 115 # 120 His Glu Ala Ala Pro Ile Val Pro Arg Gln Pr #o Gly Asp Lys Pro 125 # 130 # 135 Leu Ala Ser Pro Ala Val Arg Lys Arg Ala Le #u Asp Ala Gly Ile 140 # 145 # 150 Glu Leu Arg Tyr Val His Gly Ser Gly Pro Al #a Gly Arg Ile Leu 155 # 160 # 165 His Glu Asp Leu Asp Ala Phe Met Ser Lys Pr #o Gln Ser Ala Ala 170 # 175 # 180 Gly Gln Thr Pro Asn Gly Tyr Ala Arg Arg Th #r Asp Ser Glu Gln 185 # 190 # 195 Val Pro Val Ile Gly Leu Arg Arg Lys Ile Al #a Gln Arg Met Gln 200 # 205 # 210 Asp Ala Lys Arg Arg Val Ala His Phe Ser Ty #r Val Glu Glu Ile 215 # 220 # 225 Asp Val Thr Ala Leu Glu Ala Leu Arg Gln Gl #n Leu Asn Ser Lys 230 # 235 # 240 His Gly Asp Ser Arg Gly Lys Leu Thr Leu Le #u Pro Phe Leu Val 245 # 250 # 255 Arg Ala Leu Val Val Ala Leu Arg Asp Phe Pr #o Gln Ile Asn Ala 260 # 265 # 270 Thr Tyr Asp Asp Glu Ala Gln Ile Ile Thr Ar #g His Gly Ala Val 275 # 280 # 285 His Val Gly Ile Ala Thr Gln Gly Asp Asn Gl #y Leu Met Val Pro 290 # 295 # 300 Val Leu Arg His Ala Glu Ala Gly Ser Leu Tr #p Ala Asn Ala Gly 305 # 310 # 315 Glu Ile Ser Arg Leu Ala Asn Ala Ala Arg As #n Asn Lys Ala Ser 320 # 325 # 330 Arg Glu Glu Leu Ser Gly Ser Thr Ile Thr Le #u Thr Ser Leu Gly 335 # 340 # 345 Ala Leu Gly Gly Ile Val Ser Thr Pro Val Va #l Asn Thr Pro Glu 350 # 355 # 360 Val Ala Ile Val Gly Val Asn Arg Met Val Gl #u Arg Pro Val Val 365 # 370 # 375 Ile Asp Gly Gln Ile Val Val Arg Lys Met Me #t Asn Leu Ser Ser 380 # 385 # 390 Ser Phe Asp His Arg Val Val Asp Gly Met As #p Ala Ala Leu Phe 395 # 400 # 405 Ile Gln Ala Val Arg Gly Leu Leu Glu Gln Pr #o Ala Cys Leu Phe 410 # 415 # 420 Val Glu (2) INFORMATION FOR SEQ ID NO:5: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 459 Amino #acids (B) TYPE: Amino acid (D) TOPOLOGY: Linear (ii) MOLECULE TYPE: Protein (ix) FEATURE: (A) NAME/KEY: Lpd-val, #the E3 component (B) LOCATION: 4369-574 #5, N-terminal methionine is present on mature pr #otein (C) IDENTIFICATION METHOD: # Sequence of cyanogen bromide peptides (x) PUBLICATION INFORMATION: (A) AUTHORS: Burns, Gay #le Brown, Tr #acy Hatter, K #enneth Sokatch, #John R. (B) TITLE: Sequence ana #lysis of the lpdV gene for lipoamide dehodrogenas #e of Pseudomonas putida (C) JOURNAL: European J #ournal of Biochemistry (D) VOLUME: 179 (F) PAGES: 61-69 (G) DATE: 1989 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:5: Met Gln Gln Thr Ile Gln Thr Thr Leu Leu Il #e Ile Gly Gly Gly #5 #10 #15 Pro Gly Gly Tyr Val Ala Ala Ile Arg Ala Gl #y Gln Leu Gly Ile 20 # 25 # 30 Pro Thr Val Leu Val Glu Gly Gln Ala Leu Gl #y Gly Thr Cys Leu 35 # 40 # 45 Asn Ile Gly Cys Ile Pro Ser Lys Ala Leu Il #e His Val Ala Glu 50 # 55 # 60 Gln Phe His Gln Ala Ser Arg Phe Thr Glu Pr #o Ser Pro Leu Gly 65 # 70 # 75 Ile Ser Val Ala Ser Pro Arg Leu Asp Ile Gl #y Gln Ser Val Ala 80 # 85 # 90 Trp Lys Asp Gly Ile Val Asp Arg Leu Thr Th #r Gly Val Ala Ala 95 # 100 # 105 Leu Leu Lys Lys His Gly Val Lys Val Val Hi #s Gly Trp Ala Lys 110 # 115 # 120 Val Leu Asp Gly Lys Gln Val Glu Val Asp Gl #y Gln Arg Ile Gln 125 # 130 # 135 Cys Glu His Leu Leu Leu Ala Thr Gly Ser Se #r Ser Val Glu Leu 140 # 145 # 150 Pro Met Leu Pro Leu Gly Gly Pro Val Ile Se #r Ser Thr Glu Ala 155 # 160 # 165 Leu Ala Pro Lys Ala Leu Pro Gln His Leu Va #l Val Val Gly Gly 170 # 175 # 180 Gly Tyr Ile Gly Leu Glu Leu Gly Ile Ala Ty #r Arg Lys Leu Gly 185 # 190 # 195 Ala Gln Val Ser Val Val Glu Ala Arg Glu Ar #g Ile Leu Pro Thr 200 # 205 # 210 Tyr Asp Ser Glu Leu Thr Ala Pro Val Ala Gl #u Ser Leu Lys Lys 215 # 220 # 225 Leu Gly Ile Ala Leu His Leu Gly His Ser Va #l Glu Gly Tyr Glu 230 # 235 # 240 Asn Gly Cys Leu Leu Ala Asn Asp Gly Lys Gl #y Gly Gln Leu Arg 245 # 250 # 255 Leu Glu Ala Asp Arg Val Leu Val Ala Val Gl #y Arg Arg Pro Arg 260 # 265 # 270 Thr Lys Gly Phe Asn Leu Glu Cys Leu Asp Le #u Lys Met Asn Gly 275 # 280 # 285 Ala Ala Ile Ala Ile Asp Glu Arg Cys Gln Th #r Ser Met His Asn 290 # 295 # 300 Val Trp Ala Ile Gly Asp Val Ala Gly Glu Pr #o Met Leu Ala His 305 # 310 # 315 Arg Ala Met Ala Gln Gly Glu Met Val Ala Gl #u Ile Ile Ala Gly 320 # 325 # 330 Lys Ala Arg Arg Phe Glu Pro Ala Ala Ile Al #a Ala Val Cys Phe 335 # 340 # 345 Thr Asp Pro Glu Val Val Val Val Gly Lys Th #r Pro Glu Gln Ala 350 # 355 # 360 Ser Gln Gln Gly Leu Asp Cys Ile Val Ala Gl #n Phe Pro Phe Ala 365 # 370 # 375 Ala Asn Gly Arg Ala Met Ser Leu Glu Ser Ly #s Ser Gly Phe Val 380 # 385 # 390 Arg Val Val Ala Arg Arg Asp Asn His Leu Il #e Leu Gly Trp Gln 395 # 400 # 405 Ala Val Gly Val Ala Val Ser Glu Leu Ser Th #r Ala Phe Ala Gln 410 # 415 # 420 Ser Leu Glu Met Gly Ala Cys Leu Glu Asp Va #l Ala Gly Thr Ile 425 # 430 # 435 His Ala His Pro Thr Leu Gly Glu Ala Val Gl #n Glu Ala Ala Leu 440 # 445 # 450 Arg Ala Leu Gly His Ala Leu His Ile 455 (2) INFORMATION FOR SEQ ID NO:6: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 792 Base #pairs (B) TYPE: Nucleic acid (C) STRANDEDNESS: Double-s #tranded (D) TOPOLOGY: Circular (ii) MOLECULE TYPE: Nucleic acid (ix) FEATURE: (A) NAME/KEY: Control r #egion regulating expression of the bkd operon (B) LOCATION: 1-792 (C) IDENTIFICATION METHOD: # S1 nuclease and reverse transcriptas #e mapping (x) PUBLICATION INFORMATION: (A) AUTHORS: Madhusudhan, #K.T. Huang, G. Burns, Ga #yle Sokatch, #John R. (B) TITLE: Transcriptional # analysis of the promoter region of the branc #hed chain keto acid dehyrogenase operon of Pseudomonas #putida (C) JOURNAL: Journal of # Bacteriology (D) VOLUME: 172 (F) PAGES: 5655-5663 (G) DATE: 1990 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:6: CGATGCCCTG GAGCTGAGCG ATGCTCATGA CGCTTGTCCT TGTTGTTGTA GG #CTGACAAC 60 AACATAGGCT GGGGGTGTTT AAAATATCAA GCAGCCTCTC GAACGCCTGG GG #CCTCTTCT 120 ATCGCGCAAG GTCATGCCAT TGGCCGGCAA CGGCAAGGCT GTCTTGTAGC GC #ACCTGTTT 180 CAAGGCAAAA CTCGAGCGGA TATTCGCCAC ACCCGGCAAC CGGGTCAGGT AA #TCGAGAAA 240 CCGCTCCAGC GCCTGGATAC TCGGCAGCAG TACCCGCAAC AGGTAGTCCG GG #TCGCCCGT 300 CATCAGGTAG CACTCCATCA CCTCGGGCCG TTCGGCAATT TCTTCCTCGA AG #CGGTGCAG 360 CGACTGCTCT ACCTGTTTTT CCAGGCTGAC ATGGATGAAC ACATTCACAT CC #AGCCCCAA 420 CGCCTCGGGC GACAACAAGG TCACCTGCTG GCGGATCACC CCCAGTTCTT CC #ATGGCCCG 480 CACCCGGTTG AAACAGGGCG TGGGCGACAG GTTGACCGAG CGTGCCAGCT CG #GCGTTGGT 540 GATGCGGGCG TTTTCCTGCA GGCTGTTGAG AATGCCGATA TCGGTACGAT CG #AGTTTGCG 600 CATGAGACAA AATCACCGGT TTTTTGTGTT TATGCGGAAT GTTTATCTGC CC #CGCTCGGC 660 AAAGGCAATC AACTTGAGAG AAAAATTCTC CTGCCGGACC ACTAAGATGT AG #GGGACGCT 720 GACTTACCAG TCACAAGCCG GTACTCAGCG GCGGCCGCTT CAGAGCTCAC AA #AAACAAAT 780 ACCCGAGCGA GC # # # 792 (2) INFORMATION FOR SEQ ID NO:7: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 15 Bases (B) TYPE: Nucleic acid (C) STRANDEDNESS: Single #stranded (D) TOPOLOGY: Linear (ii) MOLECULE TYPE: Nucleic acid (A) DESCRIPTION: Seq ID # No:7 is a synthetic nucleic acid used to determ #ine the transcriptional start of the bkd operon. (ix) FEATURE: (A) NAME/KEY: Synthetic #nucleic acid used to determine the transcriptio #nal start of the bkd operon by primer extension #from the 3′ end. (B) LOCATION: Complementar #y to bases 256-270 of Seq ID No:1 (x) PUBLICATION INFORMATION: (A) AUTHORS: Madhusudhan,K #.T. Huang,G. Burns,G. Sokatch,John # R. (B) TITLE: Transcriptional # analysis of the promoter region of the branc #hed chain keto acid dehydrogenase operon of Pseudomonas #putida (C) JOURNAL: Journal of # Bacteriology (D) VOLUME: 172 (F) PAGES: 5655-5663 (G) DATE: 1990 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:7: CTGCTGCCGA GTATC # # # 15Claims
1. A recombinant DNA molecule comprising a sequence comprising:
- a branched chain keto acid dehydrogenase complex promoter of Pseudomonas putida.
2. The recombinant DNA molecule of claim 1 wherein the sequence for the promoter comprises Sequence ID No. 6.
3. A plasmid comprising the DNA molecule of claim 1.
4. A transformant bacterial host comprising the plasmid of claim 3.
5. A recombinant DNA molecule comprising a sequence comprising the following elements in the 5′ to 3′ direction, said elements which are operably linked:
- a branched chain keto acid dehydrogenase complex promoter of Pseudomonas putida; and
- genes encoding all the subunits of branched chain keto acid dehydrogenase complex of Pseudomonas putida.
6. The recombinant DNA molecule of claim 5 wherein the sequence is Sequence ID No. 1.
7. The recombinant DNA molecule of claim 1 wherein the sequence for the promoter comprises Sequence ID No. 6.
8. The recombinant DNA molecule of claim 5 wherein the sequence for the all the subunits of branched chain keto acid dehydrogenase complex comprise Sequence ID Nos. 2, 3, 4, and 5.
9. The recombinant DNA molecule of claim 5 wherein the sequence comprises Sequence ID Nos. 6, 2, 3, 4, and 5.
10. A plasmid comprising the DNA molecule of claim 5.
11. A transformant bacterial host comprising the plasmid of claim 10.
| 5656483 | August 12, 1997 | Sokatch et al. |
- Sykes et al., Apr. 1985, Journal Of Bacteriology, vol. 162, pp. 203-208, Conjugative Mapping Of Pyruvate, 2-Ketoglutarate, and Branched-Chain Keto Acid Dehydrogenase Genes in Pseudomonas putida Mutants.
- Luthi et al., 1986, Journal of general Microbiology, vol. 132, pp. 2667-2675, The arcABC Operon Required for Fermentative Growth of Pseudomonas aeruginosa on Arginine: Tn5-751-assisted Cloning and Localization of Structural Genes.
- Inouye et al., Jun. 1986, Journal of Bacteriology, vol. 166, pp. 739-745, Nucleotide Sequence of a DNA Segment Promoting Transcription in Pseudomonas putida.
- Minton et al., Dec. 1983, Journal of Bacteriology, vol. 156, pp. 1222-1227, Molecular Cloning of the Pseudomonas Carboxypeptidase G 2 Gene and Its Expression in Escherichia coli and Pseudomonas putida.
- Schell, Feb. 1983, Journal of Bacteriology, vol. 153, pp. 822-829, Cloning and Expression in Escherichia coli of the Naphthalene Degradation Genes from Plasmid NAH7.
- Madhusudhan et al., Oct. 1990, Journal of Bacteriology, vol. 172, pp. 5655-5663, Transcriptional Analysis of the Promoter region of the Pseudomonas putida Branched-Chain Keto Acid Dehydrogenase Operon.
- Sokatch et al., Nov. 1981, Journal of Bacteriology, vol. 148, pp. 639-646, Isolation of a Specific Lipoamide Dehydrogenase for a Branched-Chain Keto Acid Dehydrogenase from Pseudomonas putida.
- Burns et al., Feb. 1988, Eur. Journal of Biochemistry, vol. 176, pp. 165-169, Comparison of the amino acid sequences of the transacylase components of branched chain oxoacid dehydrogenase of Pseudomonas putida and the pyruvate and 2-oxoglutarate dehydrogenases of Escherichia coli.
- Sykes et al., Apr. 1987, Journal of Bacteriology, vol. 169, pp. 1619-1625, Molecular Cloning of Genes Encoding Branched-Chain Keto Acid Dehydrogenase of Pseudomonas putida.
- Burns et al., Feb. 1988, Eur. Journal of Biochemistry, vol. 176, pp. 165-169, Comparison of the amino acid sequences of the transacylase components of branched chain oxoacid dehydrogenase of Pseudomonas putida and the pyruvate and 2-oxoglutarate dehydrogenases of Escherichia coli.
- Yanisch-Perroc et al., 1985, Gene, vol. 33, pp. 103-119, Improved M13 phage cloning vectors and host strains: nucleotide sequences of the M13mp18 and p UC19 vectors.
- Sokatch et al., Nov. 1981, Journal of Bacteriology, vol. 148, pp. 647-652, Purification of a Branched-Chain Keto Acid Dehydrogenase from Pseodomonas putida.
- Bahdasarian et al., 1981, Gene, vol. 16, pp. 237-247, Specific-purpose plasmid cloning vectors.
Type: Grant
Filed: Mar 14, 1995
Date of Patent: Jan 2, 2001
Assignee: The Board of Regents of the University of Oklahoma (Norman, OK)
Inventors: John R. Sokatch (Oklahoma City, OK), Pamela J. Sykes (Adelaide), K. T. Madhusudhan (Oklahoma City, OK), Soo-Kyung Oh (late of Palo Alto, CA)
Primary Examiner: Mary E. Mosher
Attorney, Agent or Law Firm: Dunlap, Codding & Rogers, P.C.
Application Number: 08/404,381
International Classification: C12N/1552; C12N/1531; C12N/1567; C12N/121;