Method to protect DNA ends
A method of protecting the 3′ end of a DNA molecule from nuclease damage is disclosed. In one embodiment, the method comprises the step of exposing the DNA molecule to a preparation of DdrA protein.
Latest Wisconsin Alumni Research Foundation Patents:
- Modified gene vaccines against avian coronaviruses and methods of using the same
- Neural network processor with on-chip convolution kernel storage
- System and method for percutaneous needle insertion
- Method for producing tertiary ?-hydroxy-?-amino acids
- High-efficiency drive circuit and bidirectional FET
This application is a divisional of U.S. Ser. No. 11/123,701 filed on May 6, 2005, now U.S. Pat. No. 7,211,393 and claims priority to U.S. provisional Ser. No. 60/569,198, filed May 7, 2004, incorporated by reference herein.
STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENTThis invention is made with United States government support awarded by the following agency: NIH Grants: GM052725 and GM 067085. The United States government has certain rights in this invention.
BACKGROUND OF THE INVENTIONDeinococcus radiodurans is a non-sporeforming bacterium notable for its capacity to tolerate exposure to ionizing radiation (Battista and Rainey, Phylum BIV. “Deinococcus-Thermus” Family 1. Deinococcaceae Brooks and Murray 1981, 356,vp emend. Rainey, Nobre, Schumann, Stackebrandt and da Costa 1997, 513. In: Boone D R, Castenholz R W, editors, Bergey's Manual of Systematic Bacteriology, 2nd ed. New York: Springer, pp. 395-414, 2001). The D37 dose for D. radiodurans R1 is approximately 6500Gy, at least 200-fold higher than the D37 dose of E. coli cultures irradiated under the same conditions. The energy deposited by 6500Gy γ radiation should introduce thousands of DNA lesions including hundreds of double strand breaks (Smith, et al., Molecular biology of radiation resistant bacteria, In: Herbert R A, Sharp R J, editors, Molecular biology and biotechnology of extremophiles, New York: Chapman & Hall, pp. 258-280, 1992). The mechanisms responsible for this species' resilience are poorly described and recent analyses of DNA damage-induced changes in the proteome (Lipton, et al., Proc. Natl. Acad. Sci. USA 99(17):11049-11054, 2002) and transcriptome (Liu, et al., Proc. Natl. Acad. Sci. USA 100(7):4191-4196, 2003) of D. radiodurans cultures have done little to improve our understanding of D. radiodurans' radioresistance (Edwards and Battista, Trends Biotechnol. 21(9):381-382, 2003; Narumi, Trends Microbiol. 11(9):422-425, 2003).
For most species, the intracellular generation of strand breaks has lethal consequences; exposed free ends serving as substrates for intracellular exonucleases that degrade the genome. However, in D. radiodurans the presence of strand breaks does not result in a catastrophic loss of genetic information (Dean, et al., Nature 209(18):49-52, 1966; Lett, et al., Proc. R. Soc. Lond. B. Biol. Sci. 167(7):184-201, 1967; Vukovic-Nagy, et al., Int. J. Radiat. Biol. Relat. Stud. Phys. Chem. Med. 25(4):329-337, 1974). Instead this species appears to have the ability to control DNA degradation post-irradiation by synthesizing proteins that prevent extensive digestion of the genome, and it has been suggested that the DNA degradation observed in this species is an integral part of the process of DNA repair, generating single-stranded DNA that promotes homologous recombination and restitution of the damaged genome (Battista, et al, Phylum BIV. “Deinococcus-Thermus” Family 1. Deinococcaceae Brooks and Murray 1981, 356,vp emend. Rainey, Nobre, Schumann, Stackebrandt and da Costa 1997, 513. In: Boone D R, Castenholz R W, editors. Bergey's Manual of Systematic Bacteriology. 2nd ed. New York: Springer, pp. 395-414, 1999).
When D. radiodurans is exposed to a high dose of ionizing radiation, a number of genes are induced that lack readily identifiable homologues among known prokaryotic proteins (Liu, et al., supra, 2003; Tanaka, et al., Genetics 168:210-233, 2003). Among these is the gene designated DR0423 (Q9RX92). This locus is one of the most highly induced genes in Deinococcus following γ-irradiation, expression increasing 20-30 fold relative to an untreated control. Although originally annotated as a “hypothetical” protein (White, et al, Science 286(5444):1571-1577, 1999), a more detailed analysis (Iyer, et al., BMC Genomics 3(1):8, 2002) has identified an evolutionary relationship between DR0423p and the important eukaryotic recombination protein Rad52 (P06778). Rad52 is part of a larger family of proteins exhibiting structural similarity but little sequence homology, including the prokaryotic Redβ.(P03698), RecT (NC 000913.1), and Erf (P04892) proteins (Passy, et al., Proc. Natl. Acad. Sci. USA 96(8):4279-4284, 1999; Iyer, et al., supra, 2002).
BRIEF SUMMARY OF THE INVENTIONIn one embodiment, the present invention is a method of protecting the 3′ end of a DNA molecule from nuclease damage comprising the step of exposing the DNA molecule to an amount of a preparation of DdrA protein effective to decrease nuclease damage. Preferably, the DdrA protein is incubated with at least a first and a second linear duplex DNA each with a 3′-ending strand and a 5′-ending strand, wherein the first linear duplex DNAs comprises an end that is complementary to an end of the second linear duplex DNA. One could expose the first and second DNA molecule to a exonuclease, wherein the DdrA protein protects the 3′ ending strands while allowing the 5′ ending strands to be degraded, thereby producing single-stranded extensions with 3′ ends on both first and second DNAs. Preferably, the method comprises the steps of annealing the single stranded extensions of the first and second DNAs, thereby producing a joined first and second DNA. One would then process the joined DNA with a nuclease, a DNA polymerase, and a DNA ligase to make the joined DNA contiguous.
The present invention is also a preparation of DdrA protein, and a polynucleotide encoding the protein.
Other embodiments, features and advantages of the present invention will become apparent on review of the specification, claims and drawings.
The bacterium Deinococcus radiodurans can withstand extraordinary levels of ionizing radiation, reflecting an equally extraordinary capacity for DNA repair. The hypothetical gene product DR0423 has been implicated in the recovery of this organism from DNA damage, indicating that this protein is a novel component of the D. radiodurans DNA repair system. DR0423 is a homologue of the eukaryotic Rad52 protein.
The examples below show that following exposure to ionizing radiation, DR0423 expression is induced relative to an untreated control, and strains carrying a deletion of the DR0423 gene exhibit increased sensitivity to ionizing radiation. When recovering from ionizing radiation-induced DNA damage in the absence of nutrients, wild type D. radiodurans reassembles its genome while the mutant lacking DR0423 function does not.
We have found that the purified DR0423 protein binds to single-stranded DNA in vitro with an apparent affinity for 3′ ends and protects those ends from nuclease degradation. We propose that DR0423 is part of a DNA end-protection system that helps to preserve genome integrity following exposure to ionizing radiation. We designate the DR0423 protein DdrA (DNA damage response protein A). The DNA and protein sequence of DdrA are disclosed at SEQ ID No. 1 and 2.
In one embodiment of the present invention, the purified DdrA protein can be used by itself, and in combination with other factors, to specifically block DNA 3′ ends in protocols requiring the generation of single-strand 3′ extensions on duplex DNA. The protein can also be used in protocols designed to introduce engineered DNA at site-specific genomic locations in a wide range of cells and to join together large fragments of DNA. These embodiments of the present invention are discussed in more detail below.
By “DdrA protein” we mean that minor or conservative amino acid substitutions may be introduced to the protein and still result in a DdrA protein with equivalent functional activity. Specifically, we mean to define functional activity in terms of single-stranded DNA binding with affinity of 3′ ends and protection of those ends from nuclease degradation. One may evaluate equivalent functional activity by reference to the Examples and the DNA binding assays disclosed below.
Harris, et al., PLOS Biology 2(10)e304, October 2004 (incorporated herein by reference) and the examples below describe experiments showing the evidence for a DNA end-protection system in D. radiodurans and the characterization of the DR0423 protein as a component of that system. Bernstein, et al., Proc. Natl. Acad. Sci. 101(23):8575-8580, 2004, incorporated herein by reference, describes the crystal structure of Deinococcus radiodurans SSB protein (DrSSB). Tanaka, et al., Genetics 168:210-233 (September, 2004), incorporated herein by reference, describes the analysis of D. radiodurans transcriptional response to ionizing radiation.
As disclosed above, we envision that one would wish to use the DdrA protein in various methods to protect DNA ends in cloning methods. For example, one may wish to add the DdrA protein to a double-stranded or single-stranded preparation of DNA that may be exposed to exonuclease activity. The presence of the DdrA protein will ensure that the 3′-end is protected from nuclease degradation.
In another preferable method of the present invention, one could use the DdrA protein to join DNA strands. For example, one would obtain the DdrA protein through conventional molecular biological methods and expose the protein to specific DNA molecules in the following manner: DdrA protein could be incubated with different linear duplex DNAs that included overlapping sequences at their ends (for example, see
In such protocols, the DdrA protein would be used at concentrations ranging from 1-5 nanomolar to 100 micromolar. The DNA fragments or molecules would be typically used at 0.1-100 nanomolar concentrations (in total molecules). Preferably, one would wish to use concentrations of DdrA of 1-10 micromolar. Preferably, the DNA is protected for at least 30 minutes. Typically, a reaction condition of pH 7-7.5 and 25-36° C. is preferred. Other preferred conditions are described below in the Examples.
Additionally, one may wish to use the method of the present invention as part of larger system involving other protective molecules. For example, we have demonstrated that the D. radiodurans SSB protein is also involved in DNA end protection and one might wish to use two proteins synergistically in the following manner: DrSSB could be used as an additional reagent to facilitate the reactions of
The present invention is also a preparation of the DdrA protein and an isolated polynucleotide encoding these proteins. By “preparation” we mean any version of the DdrA protein that is purified relative to its naturally occurring embodiment in D. radiodurans. A crude preparation of D. radiodurans in which the DdrA protein is enhanced is a “preparation of the DdrA protein.” Preferably, for use in the cloning and molecular biology protocols described above, one would wish to use the DdrA protein in a highly purified form. Most preferably, this protein would be substantially pure. One would obtain the isolated polynucleotide encoding the protein through standard molecular biological methods using the information described in the Exhibits.
SEQ ID NOs: 1 and 2 are nucleic acid and protein sequences for DdrA. The gene encoding DrSSB protein was incorrectly sequenced and annotated as two separate genes listed as DR0099 and DR0100 in White, et al. Science 286:1571-1577, 1999. The sequence has recently been corrected (The single-stranded DNA-binding protein of Deinococcus radiodurans, Eggington, et al., BMC Microbiology 4:2, 2004), demonstrating that the ssb gene consists of sequences making up both DR0099, DR0100, and intervening sequences combined into one single gene. The DR0099 and DR0100 genes have accession number NC—001263. The corrected ssb sequence, reported here, has accession number AY293617.
EXAMPLESIn this report, we provide evidence for a DNA end-protection system in D. radiodurans, and characterize the DR0423 protein as a component of that system. Our studies suggest that DNA end-protection might be particularly important to this species in the context of long-term survival during desiccation and recovery in a nutrient-poor environment. The majority of the work in this Example may be found in Harris, et al., supra.
Results
Transcripts Corresponding to the Coding Sequence Designated DR0423 Increase in Response to Sub-Lethal Doses of Ionizing Radiation
During the course of microarray studies intended to establish which R1 loci respond to ionizing radiation, it was noted that transcripts of DR0423 were among the mostly highly induced (Tanaka, et al., supra, 2003). As an independent confirmation of these microarray results, the expression of this gene was monitored using quantitative real time PCR. Total RNA was isolated from exponential phase cultures of R1 immediately after and at 30 and 60 minutes following exposure to 3000Gy ionizing radiation. Changes in transcript abundance for the recA (DR2340) (P42443), gap (DR1343) (Q9RUP1) and DR0423 genes were determined as previously described (Earl, et al, J. Bacteriol. 184(22):6216-6224, 2002a). The results of these analyses are listed in Table 1. Consistent with previous results, levels of recA transcript increased post-irradiation (Narumi, et al, J. Bacteriol. 183(23):6951-6956, 2001; Bonacossa de Almeida, et al, Mol. Genet. Genomics 268(1):28-41, 2002; Satoh, et al., J. Biochem. (Tokyo) 131(1): 121-129, 2002), whereas gap induction remained unchanged (Earl, et al., J. Bacteriol. 184(22):6216-6224, 2002a). The gap gene encodes glyceraldehyde 3-phosphate dehydrogenase, and does not respond to DNA damage. Within one half hour post-irradiation, levels of DR0423 transcript increased between 20-30 fold, suggesting that DR0423p may be a previously unrecognized component of the cell's defense against ionizing radiation-induced damage.
Deletion of DR0423 Sensitizes D. radiodurans R1 to Ionizing Radiation and Mitomycin C
The DR0423 gene was inactivated by deletion in D. radiodurans R1, as described elsewhere (Tanaka, et al., supra, 2003; Funayama, et al., Mutat. Res. 435(2):151-161, 1999), and the resulting strain designated TNK104. Confirmation of the gene deletion is provided in
A ddrA recA Double Mutant is More Sensitive to Ionizing Radiation than Either Single Mutant
The recA gene (DR2340) was deleted from R1 and TNK104 (see
Evidence that the DdrA Protein Contributes to Genome Restitution
To determine if loss of DdrA affected genome restitution and stability post-irradiation, we followed the recovery of cultures of R1 and TNK104 following a 5000Gy dose of γ radiation. Initially, exponential phase cultures were harvested and suspended in 10 mM MgSO4 and irradiated. No carbon source was added. Restoration of the genome was monitored by pulsed field gel electrophoresis and aliquots retrieved from the recovering cultures were used to determine viability. Cultures were left in this medium and sampled at 24 hour intervals over a 120 hour time course.
The gel depicted in
Irradiated TNK104 cultures are significantly more vulnerable ionizing radiation during a prolonged incubation in MgSO4 (
We also directly examined the influence of DdrA on the fate of genomic DNA (
We also examined genome restitution in a rich medium (TGY broth). Consistent with the survival curve depicted in
The Purified DdrA Protein Binds the 3′ Ends of Single-stranded DNA and Protects Them from Digestion by an Exonuclease
The ddrA gene was cloned and expressed in E. coli, and the protein was purified to homogeneity (
DdrA exhibited no ATPase, helicase, recombinase, or nuclease activity (data not shown). However, it bound to single-stranded DNA as determined by an electrophoretic mobility shift assay (EMSA) (
DdrA also protected the single-stranded DNA from degradation by exonuclease I from E. coli, which digests single-stranded DNA from the 3′ end (
The eukaryotic Rad52 protein has a single-strand annealing activity that may be important to its in vivo function (Mortensen, et al., Proc. Natl. Acad. Sci. USA 93: 10729-10734, 1996; Sugiyama, et al., Proc. Natl. Acad. Sci. USA 95(11):6049-6054, 1998). We carried out several tests to determine if the DdrA protein had a similar annealing activity. In multiple trials using oligonucleotides 30 and 51 nucleotides in length, no DNA strand annealing activity was detected over a range of DdrA concentrations and conditions (data not shown).
Discussion
The extraordinary resistance of Deinococcus radiodurans to DNA damage arose not as an adaptation to high levels of radiation, but rather as a response to desiccation (Mattimore and Battista, supra, 1996). In an arid environment, dormant D. radiodurans cells would gradually accumulate DNA lesions of all kinds, including strand breaks. Since DNA repair is highly reliant on metabolic energy and appropriate nutrients cannot be assured upon rehydration, it is not unreasonable to expect that this species possesses a means to efficiently repair accumulated damage that minimizes energy use. In this context, mechanisms must have evolved to maintain the genome and protect it from unnecessary degradation by nucleases and other agents. In this study we have identified functions associated with a “hypothetical” protein encoded by D. radiodurans R1 that contributes to this species' capacity to tolerate exposure to ionizing radiation and mitomycin C. We propose that the DR0423 protein, which we have designated DdrA, is part of a DNA end-protection system. Induced in response to the appearance of strand breaks generated by ionizing radiation (or subsequent to desiccation), DdrA would cap the strand breaks and help stabilize the genome until such time as conditions were more amenable to systematic DNA repair.
The results we have obtained both in vivo and in vitro are consistent with this hypothesis. When the ddrA (DR0423) gene is deleted from R1, an otherwise wild type cell becomes more sensitive to DNA damaging agents (
Even though the R1 strain was able restore its genome following irradiation and incubation in 10 mM MgSO4, there was no evidence of genome re-assembly in similarly treated cultures of TNK104, the □ddrA derivative of R1 (
DdrA is not needed if cells are allowed to recover in a nutrient-rich medium (
The increased sensitivity observed in TNK110 (□recA □ddrA) relative to TNK106 (□recA) indicates that DdrA participates in a process that complements RecA-mediated survival mechanisms (
DdrA's capacity to protect the 3′ ends of single-stranded DNA from digestion should help maintain the integrity of DNA fragments generated following DNA damage whether those fragments are a result of the direct action of the damaging agent or arise as a consequence of a repair process that cleaves the phosphodiester backbone. By limiting degradation, proteins that protect DNA ends should enhance DNA damage tolerance and cell survival; the stabilized fragments serving as a long-lived substrate for homologous recombination or single-strand annealing. In other words, we suspect that the ability to preserve genetic information is one key to understanding DdrA function and in a larger context the DNA damage tolerance of this species. DNA binding proteins, like DdrA, may be particularly important for surviving desiccation. Like ionizing radiation, the process of desiccation is inherently DNA damaging, introducing large numbers of DNA double strand breaks. Following an extended period of desiccation, broken DNA ends would presumably need to be protected to minimize loss of genetic information. We know of no precedent for an activity of this sort in bacteria, although its existence has been predicted at least once (Clark, Biochimie 73(4):523-532, 1991). Bacteriophage are known to encode proteins (e.g., the gene 2 protein of T4 (Wang, et al., J. Bacteriol. 182(3):672-679, 2000)) that prevent exonucleolytic digestion of their genomes during infection, and, given its sequence similarity to other phage proteins, it is possible that D. radiodurans acquired DdrA from a phage during its evolution.
Since inactivation of DdrA reduces but does not eliminate the DNA damage resistance of Deinococcus, we suggest that other proteins with complementary functions, possibly designed to bind DNA ends with different structures, are also encoded by this species, and that the protection provided by these proteins contributes significantly to DNA damage tolerance. By itself, DdrA protein does not enhance the radiation resistance of Escherichia coli strains in which it has been expressed (L. Alice Simmons and J. Battista, unpublished data).
It seems likely that Deinococcus radiodurans, and other bacteria with similar capacities to survive high DNA damage loads, employs multiple systems to repair their DNA. The DNA end-protection system we have begun to explore may be supplemented by special genome architectures (Levin-Zaidman, et al., Science 299(5604):254-256, 2003), traditional DNA repair systems (some with unusual properties (Kim and Cox, Proc. Natl. Acad. Sci. USA 99(12):7917-7921, 2002), and perhaps novel enzymatic systems not previously examined. Although we have detected no apparent enzymatic activities in DdrA to augment its DNA binding function, further work is needed to determine if DdrA contributes to single strand annealing or other potential DNA repair pathways. Bound to 3′ DNA ends, DdrA would be at a focus of DNA repair activity once genome restitution was initiated. The evolutionary relationship of DdrA to Rad52 may also telegraph a facilitating role in other DNA repair processes.
Materials and Methods
Strains, Growth Conditions, and Treatment
Strains and plasmids used in this study are described in Table 2. All genes are identified as described in the published genome sequence available on the world wide web courtesy of TIGR CMR. All strains derived from D. radiodurans were grown at 30° C. in TGY broth (0.5% tryptone, 0.3% yeast extract, 0.1% glucose) or on TGY agar (1.5% agar). E. coli strains were grown in Luria-Bertani (LB) broth or on LB plates at 37° C. Plasmids were routinely propagated in E. coli strain DH5αMCR. D. radiodurans cultures were evaluated for their ability to survive exposure to DNA damaging agents in exponential growth (OD600=0.08−0.15, 5×106−1×107 cfu/ml). All cultures were treated at 25° C. Gamma irradiation was conducted using a Model 484R 60Co irradiator (J. L. Shepherd & Associates, San Fernando, Calif.) at a rate of 30 Gy/min. Resistance to mitomycin C was determined by adding one microgram of mitomycin C (Sigma, St. Louis, Mo.) to one ml broth cultures of the D. radiodurans strain. Aliquots of the treated culture were removed at one half hour intervals over the next two hours, washed in 10 mM MgSO4, and plated on TGY agar to determine viability.
Construction of TNK104, TNK106, and TNK110
The genes DR0423 and DR2340 (recA) were disrupted by targeted mutagenesis using techniques described previously (Funayama, et al., Mutat. Res. 435(2):151-161, 1999). A deletion cassette was created for each locus and transformed into an exponential phase D. radiodurans R1 culture. Recombinants were selected on TGY plates containing an appropriate antibiotic. Since D. radiodurans is multi-genomic, individual colonies were screened to determine if they were homozygous for the disruption by isolating genomic DNA from putative recombinants and using a PCR-based analysis to determine whether the gene of interest had been deleted. Details for how each strain was generated are given below.
The construction of TNK104 began with the creation of a drug cassette capable of conferring hygromycin resistance on D. radiodurans. The hygromycin b phosphotransferase gene (hyg) from pHP45omega-hyg (Blondelet-Rouault, et al., Gene 190(2):315-317, 1997) was spliced to the 120 bp of sequence immediately upstream of the initiation codon of the D. radiodurans katA gene (DR1998) (Funayama, et al., supra, 1999) using primers whose sequences overlapped. Subsequently, the katA-hyg fusion product was joined to PCR fragments (Horton, et al., Gene 77(1):61-68, 1989) derived from the sequence 1.0 kbp immediately upstream and 0.9 kbp immediately downstream of DR0423. This hybrid fragment was cloned into pGEM-T (Promega, Madison, Wis.), creating pTNK205. pTNK205 was propagated E. coli DH5□-MCR. The deletion of DR0423 was accomplished by transforming (Earl, et al., J. Bacteriol. 184(4): 1003-1009, 2002b) an exponential phase R1 culture with linear pTNK205. Hygromycin resistant (HygR) recombinants were selected on TGY plates containing 37.5 μg/ml hygromycin.
To confirm gene replacement, primers, which anneal outside the coding sequence of DR0423, were used to generate PCR fragments from genomic DNA from HygR colonies and R1. The purified PCR products were restricted with EcoRI and EcoRV. The hyg gene contains an EcoRI site, but DR0423 does not. DR0423 contains an EcoRV site, but hyg does not. In the recombinant, designated TNK104, a single 1.3 kbp fragment, corresponding to the katA-hyg cassette was amplified, whereas there was no trace of the 0.85 kbp fragment, indicative of DR0423 amplification (
The recA deletion strain TNK106 was constructed in a manner similar to that of TNK104. Initially, the katA promoter of D. radiodurans was fused to the chloramphenicol acetyltransferase gene (cat) from pBC (Stratagene Cloning Systems, La Jolla, Calif.). This drug cassette was then spliced to PCR products corresponding to genomic DNA sequence 1.6 kbp upstream and 1.2 kbp downstream of recA by overlap extension, before being cloned into pGEM-T. The resulting plasmid was designated pTNK210. An exponential phase R1 culture was transformed with the replacement cassette from pTNK210 and chloramphenicol resistant (CmR) recombinants selected on TGY plates containing 3 μg/ml chloramphenicol. Genomic DNA of each recombinant was amplified to determine if the recA coding region was deleted. Purified PCR products amplified using primers that anneal to sequences flanking recA were treated with PvuII and BglII. The cat carries PvuII site, but recA does not. recA contains BglII site, but cat does not. A 1.3 kbp fragment, corresponding to katA-cat cassette, was obtained from a recombinant designated TNK106, but DNA from this recombinant did not generate the 1.5 kbp fragment corresponding to recA (
Pulsed-Field Gel Electrophoresis (PFGE). After irradiation at 5.0 kGy cells were collected by centrifugation (6000×g, 15 minutes, 4° C.) and re-suspended in either TGY broth or 10 mM MgSO4 solution, before being placed in a shaking incubator at 30° C. for 24 hours. Aliquots of these cultures were removed at various time points, and cells were washed in 0.9% NaCl and suspended in 0.125 M EDTA pH 8.0 at a density of 5×108 cells/ml. The suspensions were mixed with low melting-point agarose (Sigma, St Louis, Mo.) to obtain a final concentration of 0.8% agarose. Agarose blocks containing the cell suspension were incubated overnight at 37° C. in 0.05 M EDTA pH 7.5 containing 1 mg/ml of lysozyme. After lysozyme treatment, agarose plugs were placed in ESP buffer (EDTA 0.5 M pH 9-9.5, 1% lauroyl sarcosine, 1 mg/ml proteinase K) at 50° C. for 6 hours, followed by a two day incubation at 37° C. Prior to digestion with restriction enzymes, agarose plugs were washed once with TE buffer pH 7.5 containing 1 mM phenylmethylsulfonyl fluoride (PMSF) and then four times with TE buffer pH 7.5. DNA contained within the agarose plugs was digested with 10 units of NotI restriction enzyme (New England Biolabs, Beverley, Mass.) overnight at 37° C. Restriction digests were analyzed on 1% agarose gels in 0.5×TBE, using a CHEF-MAPPER electrophoresis system (Bio-Rad, Hercules, Calif.) at 6 V/cm for 22 hours at 12° C., with a linear pulse ramp of 10-60 s with a switching angle of 120°. Gels were stained with water containing 0.5 mg/ml ethidium bromide for 20 minutes and destained for 10 minutes in water.
Quantitative Real-time PCR
The protocol followed was the same as that described previously (Earl, et al., supra, 2002a). Total RNA was extracted from one liter cultures of irradiated and non-irradiated exponential phase D. radiodurans cultures using TRI Reagent™, (Molecular Research Center, Cincinnati, Ohio) following manufacturer's instructions. Cell disruption was accomplished by adding 100 μl of 0.1 mm zirconia/silica beads (Biospec Products, Bartlesville, Okla.) and TRI Reagent to the cell paste from one liter of cells and vigorously agitating this mixture for 6 minutes with a vortex mixer. Two micrograms of each DNase I-treated, purified RNA sample were converted to cDNA using SUPERSCRIPT II™ RNase H− Reverse Transcriptase (Invitrogen, Carlsbad, Calif.) combined with 25 pmol of random hexamers to initiate synthesis. Conditions for this reaction followed the manufacturer's instructions.
Approximately 100 bp of unique sequence from the genes encoding DR0423, RecA (DR2340) and glyceraldehyde 3-phosphate dehydrogenase (DRI 343) were amplified using the following primer sets: DR0423up (5′GGTGCAGGACCGACTCGACGCCGTTTGCC3′, SEQ ID NO:4), DR0423down (5′CCTCGCGGGTCACGCCGAGCACGGTCAGG3′, SEQ ID NO:5), DR2340up (5′GTCAGCACCGGCAGCCTCAGCCTTGACCTC3′, SEQ ID NO:6), DR2340dwn (5′GATGGCGAGGGCCAGGGTGGTCTTGC3′, SEQ ID NO:7), and DR1343up (5′CTTCACCAGCCGCGAAGGGGCCTCCAAGC3′, SEQ ID NO:8), DR1343dwn (5′GCCCAGCACGATGGAGAAGTCCTCGCC3′, SEQ ID NO:9). The PCR reaction (50 μl) for amplifying these genes contained the appropriate primers at a final concentration of 0.2 μM, 1 μl of the cDNA template and SYBR Green PCR Core Reagents (Applied Biosystems, Foster City, Calif.). Amplifications were carried out by incubating reactions at 95° C. for 3 minutes prior to 40 cycles of 30 seconds at 95° C. followed by 30 seconds at 65° C. and 72° C. for 30 seconds. Data was collected and analyzed at each 72° C. interval. Each 96-well plate consisted of standard curves for each primer set run in duplicate. Standard curves were constructed using cDNA obtained from the un-irradiated wild type organism. A dilution series (1−1×10−4) of each experimental sample was generated and run in duplicate. Negative controls without cDNA template were run on every plate analyzed. All assays were performed using the iCycler iQ™ Real-Time Detection System (Bio-Rad, Hercules, Calif.). All data was PCR baseline subtracted before threshold cycle values were designated and standard curves were constructed. Mean concentrations of the transcripts in each sample were calculated from the standard curves generated using the DR2340 primer set. Induction levels were determined by dividing the calculated concentration of transcript from the irradiated sample by the concentration of transcript from the unirradiated sample for each strain. The mean concentration of the glyceraldehyde 3-phosphate dehydrogenase (gap) transcript, a housekeeping gene whose expression is unaffected by ionizing radiation, was also determined before and after irradiation for each strain.
DNA Content Measurement in TNK 104 and R1 Cells
Overnight cultures growing in TGY media were harvested at room temperature. Control cultures aliquots were fixed with 1% toluene (final vol/vol), shaken vigorously and stored at 4° C. The fixed bacteria were diluted (1/10, 1/100 and 1/1000) in 3 ml (final volume) of dilution buffer: 10 mM NaCl, 6.6 mM Na2SO4, 5 mM N′-2-hydroxyethylpiperazine-N′-2-ethanesulfonic acid (HEPES; pH 7.0). The remaining cultures were centrifuged for 20 minutes at 4° C. at 7,000 rpm. Bacterial pellets were washed twice and resuspended in 10 mM.
MgSO4 for gamma irradiation. Cell suspensions were irradiated at 5,000 Gy and incubated at 30° C. for 120 hours. Aliquots were removed immediately following irradiation, at 48 and at 120 hours post-irradiation. Cells were toluene-fixed as previously described above. 100 ml of DAPI (stock solution at 3 mg/ml) was added to each dilution tube and mixed. The fluorescence intensity was measured with excitation at 350 nm and emission at 450 nm.b
Cloning, Overexpression, and Purification of DR0423 (DdrA)
DR0423 gene was amplified using the genomic DNA from Deinococcus radiodurans strain R1. PCR primers were designed according to the DR0423 gene sequence annotated in the genomic bank available on the world wide web courtesy of NCBI. The gene was cloned in E. coli overexpressing plasmid pEAW298. DR0423 overproducing cells were lysed with lysozyme and the protein was precipitated from the supernatant by adding ammonium sulfate to 30% saturation. The protein was purified with DEAE and hydroxyapatite chromatography to >99% purity. The identity of the purified protein was confirmed by N-terminal sequencing (Protein and Nucleic Acid Chemistry Laboratory, Washington University School of Medicine, St. Louis, Mo.) and accurate mass determination (Biotech Center, University of Wisconsin, Madison, Wis.). The protein was transferred into the storage buffer (20 mM Tris-Acetate, 80% cation, pH 7.5/50% (w/v) glycerol/0.5M NaCl/0.1 mM EDTA/1 mM DTT) and stored at −80° C.
Determination of the Extinction Coefficient for Pure DR0423 (DdrA) Protein.
The extinction coefficient for DdrA protein protein was determined using a modification of a published procedure (6). UV absorbance spectra were measured by using a Cary 300 dual-beam spectrophotometer (Varian). The temperature was maintained using a circulating water bath. Cell path length and bandwidth were 1 cm and 0.5 nm, respectively. The extinction coefficient for native DdrA protein was determined in the storage buffer, by comparing the absorbance spectra of the native protein to the absorbance spectra of the protein denatured in 6 M guanidine hydrochloride (Gnd-HCl) in storage buffer. The extinction coefficients at 280 nm of glycyl-L-tyrosylglycine and N-acetyl-L-tryptophanamide in 6 M Gnd-HCl are 1280 M−1 cm−1 and 5690 M−1 cm−1, respectively (7). In the DdrA protein there are 5 tyrosine, 5 tryptophan and 2 cysteine residues in a protein with a total molecular mass of 23 kDa. Even if all cysteine residues were involved in disulfide bonds, the contribution of cystine to the absorbance of DdrA protein is predicted to be less than 1% and was neglected from our calculations. The extinction coefficient at 280 nm for denatured DdrA protein in 6 M Gnd-HCl was calculated as εdenat, 280nm=5×5690+5×1280=3.485×104 M−1 cm−1. Absorbance spectra of native and denatured (6 M Gnd-HCl) DdrA protein were scanned at 25□C, from 320 to 240 nm, for 5 different dilutions and with two different protein preparations. DdrA protein was diluted in storage buffer or storage buffer +6 M Gnd-HCl (final concentration) in a total volume of 80 μl and was pre-incubated at 25° C. for 5 minutes before scanning. Each dilution was carried out in triplicate and the absorbance values at 280 nm were averaged. The concentrations of native and denatured protein were equal to each other in each scan at each dilution. The extinction coefficient of native DdrA protein at 280 nm was determined according to the expression (8): εnat, 280nm=εdenat, 280nm×Absnat, 280nm/Absdenat, 280nm. We used 5 determinations with two different protein preparations, yielding an average extinction coefficient of εnat, 280 nm=2.8728+/−0.1999×104 M−1 cm−1 in storage buffer at 25° C. The A280/A260 ratio for the native DdrA protein is 1.575+/−0.00091. The error in both cases is one standard deviation.
DNA Binding Assay
The duplex oligonucleotide with a 3′ single strand extension was hairpin-forming oligonucleotide A (5′ TTA ACG ACC GTC GAC CTG CAG GTC GAC GGT CGT TAA CGT CTC TCA GAT TGT 3′, SEQ ID NO:10), which was labeled at the 3′ terminus with [α-32P]ddATP, using terminal transferase. After labeling, hairpin formation generated an 18 bp duplex hairpin with a 16 nucleotide 3′ extension. The duplex oligonucleotide with a 5′ single strand extension was hairpin-forming oligonucleotide B (5′ CGT CTC TCA GAT TGT TTA ACG ACC GTC GAC CTG CAG GTC GAC GGT CGT TAA 3′, SEQ ID NO:11). The oligo was labelled at the 5′ end using [γ-32p] and polynucleotide kinase. After labelling, hairpin formation generated a DNA with 18 bp in the hairpin duplex and a 15 nt 5′ extension. A blunt-ended duplex DNA fragment was prepared by annealing oligonucleotide C (5′ GGT CTT TCA AAT TGT TTA AGG AAG AAA CTA ATG CTA GCC ACG GTC CGA GCC 3′, SEQ ID NO:12) 32P-labeled at its 5′ end, with unlabeled oligonucleotide D (5′ GGC TCG GAC CGT GGC TAG CAT TAG TFT CTT CCT TAA ACA ATT TGA AAG ACC 3′, SEQ ID NO:13). The single-stranded oligonucleotide was the end-labeled oligo C. Electrophoretic mobility shift assays (EMSA) for DNA binding were carried out in 15 μl reaction mixtures containing the reaction buffer (40 mM Tris-Acetate, pH 7.5, 10% glycerol (w/v), 0.1 M NaCl, 0.1 mM EDTA, 1 mM DTT) and 0.7 nM (60 nM nt) 32P-labeled duplex.
DNA. The reaction was initiated by adding the DR0423 (DdrA) protein to the required concentration. The reaction mixture was incubated at 30° C. for 30 minutes and loaded onto 10% native polyacrylimide gel. The electrophoresis was performed in 1×TBE (89 mM Tris-Borate (pH 8.3), 2 mM EDTA) at room temperature. After the electrophoresis was complete the gel was dried and exposed with phosphoimager.
Identification of DdrA Protein in DNA-protein Complex
The general strategy of this experiment was to incubate a DNA duplex with a 3′ extension with DdrA protein, resolve the protein-complex in native PAGE, excise the complex from the gel, extract the protein from the slice and analyze the protein in SDS-PAGE. If the protein is DdrA it will co-migrate with DdrA protein in SDS-PAGE.
A 32P-labeled oligonucleotide (30 nt; 5′-GTG CGC TCC GAG CTC AGC TAC CGC GAG GCC-3′, SEQ ID NO:14) was annealed with a longer unlabeled oligonucleotide (50 nt; 5′-GGC CTC GCG GTA GCT GAG CTC GGA GCG CAC GAT TCG CAC TGC TGA TGT TC -3′, SEQ ID NO:15). Annealing was carried out in a 40 μl solution containing 0.5 μM of each oligonucleotide in 25 mM Tris HCl (pH 8), 50 mM NaCl, and 12.5 mM MgCl2. The solution was heated briefly at 100° C. by transferring the closed tube to a beaker of boiling water, and allowed to cool slowly overnight. The tube was refrigerated for several hours and then stored at −20° C. until use.
The resulting labeled duplex DNA with a 3′ extension (0.7 nM) was incubated with 4 μM DdrA protein under the DNA binding conditions described above. The mixture was loaded onto a 10% native polyacrylamide gel. Electrophoresis was performed as described above. The gel was exposed with X-ray film to map the position of the protein-duplex complex. The complex was cut out of the gel. The gel slice was frozen in liquid nitrogen and crushed into a slurry with a plastic stick. The slurry was mixed with an equal volume of SDS-PAGE loading buffer, and boiled for 3 minutes. The mixture was loaded onto a 12% SDS-PAGE gel and the protein present compared to molecular weight standards and purified DdrA protein.
Exonuclease Assay
The duplex with a 3′ extension was prepared by annealing oligonucleotide A (5′ CTA GCA TTA GTT TCT TCC TTA AAC AAT TTG AAA GAC C 3′, SEQ ID NO:16), which was labelled at the 5′ terminus with [γ-32P]ATP, and cold oligonucleotide B (5′ GGT CTT TCA AAT TGT TTA AGG AAG AAA CTA ATG CTA GCC ACG GTC CGA GCC 3′, SEQ ID NO:12). The annealing generated a 14 nt 3′ extension at one end of the short duplex. Before adding the exonuclease, the 32P-labeled duplex (60 nM (nucleotides)) was preincubated with the DR0423 (DdrA) protein at the indicated concentration in 15 μl of the exonuclease reaction buffer (40 mM Tris-acetate, pH 7.5, 0.1 M NaCl, 10 mM MgCl2, 0.1 mM EDTA, 1 mM DTT, 10% glycerol) at room temperature for 10 minutes. In the control experiment, the DR0423 protein was replaced with BSA. Exonuclease I was added to 200 U/ml and the reaction mixture was incubated at 37° C. for 30 minutes. After the incubation was complete, the reactions 5-8 and 10 was deproteinized with 0.2% SDS and 0.2 mg/ml proteinase K at 37° C. for 15 minutes. The DNA-protein complexes were resolved in the native polyacrylamide gel as above.
Fluorescence Anisotropy Data for DdrA Binding to Single-Stranded DNA
Referring to
Claims
1. A purified DdrA protein comprising SEQ ID NO: 2 wherein the protein is >99% pure.
- Carroll et al. (“Expression of recA in Deinococcus radiodurans” J Bacteriol. Jan. 1996;178(1):130-5).
- Bernstein D, et al., “Crystal structure of the Deinococcus radiodurans single-stranded DNA-binding protein suggests a mechanism for coping with DNA damage,” Proc. Natl. Acad. Sci. USA 101:8575-8580 (2004).
- Clark A, “rec genes and homologous recombination proteins in Escherichia coli,” Biochimie. 73:523-532 (1991).
- Harris D, et al., “Preserving genome integrity: the DdrA protein of Deinococcus radiodurans R1,” PLoS Biol. 2:e304 (2004).
- Tanaka M, et al., “Analysis of Deinococcus radiodurans's transcriptional response to ionizing radiation and desiccation reveals novel proteins that contribute to extreme radioresistance,” Genetics 168:21-33 (2004).
Type: Grant
Filed: Mar 20, 2007
Date of Patent: Jun 23, 2009
Patent Publication Number: 20070249810
Assignees: Wisconsin Alumni Research Foundation (Madison, WI), Board of Supervisors of Louisiana State University and Agricultural and Mechanical College (Baton Rouge, LA)
Inventors: Michael M. Cox (Oregon, WI), Dennis R. Harris (Madison, WI), Sergei V. Saveliev (Madison, WI), John R. Battista (Baton Rouge, LA), Edmond Jolivet (Limours-en-Hurepoix), Masashi Tanaka (Kagoshima), Julie M. Eggington (Madison, WI)
Primary Examiner: Kenneth R. Horlick
Assistant Examiner: Christopher M. Babic
Attorney: Quarles & Brady LLP
Application Number: 11/688,706
International Classification: C07K 14/00 (20060101);