plant named ‘Red Dragon’

A new and distinct cultivar of Corylus plant named ‘Red Dragon,’ characterized by its outwardly spreading plant habit, twisting stems, rich dark burgundy-colored leaves, burgundy color of the catkins and leaf buds, and resistance to eastern filbert blight caused by the fungus Anisogramma anomala (Peck) E. Muller.

Latest The State of Oregon, Acting By and Through the State Board of Higher Education; Oregon State Univ Patents:

Skip to: Description  ·  Claims  · Patent History  ·  Patent History
Description

This invention was made with government support under Specific Cooperative Agreement No. 58-5358-4542 awarded by the United States Department of Agriculture. The government has certain rights in the invention.

Latin name of the genus and species of the plant claimed: Corylus avellana.

Variety denomination: ‘Red Dragon’.

BACKGROUND OF THE INVENTION

The present invention relates to a new and distinct cultivar of Corylus plant (hazelnut, filbert), botanically known as Corylus avellana, and hereinafter referred to by the name ‘Red Dragon’.

The new Corylus resulted from a controlled cross of female parent OSU 487.055 and male parent OSU 367.039 made in 1997 by Shawn A. Mehlenbacher and David C. Smith. Neither parent was protected by a plant patent. Hybrid seeds from the cross were harvested in August 1997, stratified, and seedlings grown in the greenhouse during the summer of 1998. From this cross, 42 seedlings with contorted growth habit were planted in the field in October 1998. ‘Red Dragon’ was discovered and selected by the inventors as a single plant within the progeny of the stated cross-pollination in a controlled environment in Corvallis, Oreg., USA. It was originally assigned the designation OSU 897.078, which indicates the row and tree location of the original seedling.

The female parent OSU 487.055 is from a cross of ‘Contorta’×VR 6-28 (which is a cross of ‘Riccia di Talanico’בGasaway’), and the male parent OSU 367.039 is a red-leaf selection from open-pollination of ‘Contorta.’ The presumed pollen parent of OSU 367.039 is the red leaf cultivar ‘Rode Zeller’ (syn. ‘Rote Zellernuss’), which has a dominant allele at the leaf anthocyanin locus. A tree of ‘Rode Zeller’ was near the ‘Contorta’ tree from which open-pollinated nuts were collected. ‘Red Dragon’ and OSU 487.055 carry in heterozygous state a dominant allele for complete resistance to eastern filbert blight (EFB) from ‘Gasaway.’ Contorted growth habit is conferred by a recessive allele from ‘Contorta’ (syn. Corylus avellana var. contorta).

The new cultivar was asexually reproduced by rooted suckers (tie-off layerage of the suckers) annually for three years (2003–2005) in Corvallis, Oreg. and harvested in late November to early January. The layers of ‘Red Dragon’ were moderately vigorous, and rooted with a higher frequency and produced more roots than most other contorted selections. Asexual reproduction was also performed by whip grafting in Corvallis, Oreg. in late spring 2004. ‘Red Dragon’ has been grafted on each of four rootstocks, namely: ‘Barcelona,’ ‘Mortarella,’ ‘Dundee,’ and ‘Newberg.’ ‘Red Dragon’ is also suitable for propagation by micropropagation. The unique features of this new Corylus are stable and reproduced true-to-type in successive generations of asexual reproduction.

SUMMARY OF THE INVENTION

The following traits have been observed and are determined to be the unique characteristics of ‘Red Dragon.’ These characteristics in combination distinguish ‘Red Dragon’ as a new and distinct cultivar:

    • 1. Outwardly spreading plant habit.
    • 2. Twisting stems.
    • 3. Rich dark burgundy-colored developing leaves and rich dark burgundy-colored fully expanded leaves during the spring and summer.
    • 4. Burgundy color of the catkins and leaf buds.
    • 5. Resistance to eastern filbert blight caused by the fungus Anisogramma anomala (Peck) E. Muller.
    • 6. Presence of random amplified polymorphic DNA markers 152-800 and 268-580 in DNA of ‘Red Dragon’ amplified by polymerase chain reaction (PCR). These two markers are linked to a dominant allele for resistance to eastern filbert blight from the cultivar ‘Gasaway,’ not patented.
    • 7. Expression of incompatibility alleles S6 and S26 in the styles.
    • 8. DNA fingerprints at 20 of 28 microsatellite marker loci differ from two plants of ‘Red Majestic’ (U.S. Plant Pat. No. 16,048).

In side-by-side comparisons conducted in Corvallis, Oreg., plants of the new Corylus differed from plants of the Corylus avellena cultivar ‘Contorta,’ not patented, and other cultivars and selections of Corylus avellena known to the inventors primarily in leaf coloration and plant size as plants of the cultivar ‘Contorta’ and other cultivars and selections of Corylus avellana had green-colored leaves and were larger than plants of the new Corylus. ‘Red Dragon’ leaves retain their dark red color better than ‘Red Majestic’ (U.S. Plant Pat. No. 16,048). The DNA fingerprint of ‘Red Dragon’ differs from that of two plants of ‘Red Majestic.’ Furthermore, ‘Red Dragon’ has contorted growth habit whereas both parents have standard growth habit.

BRIEF DESCRIPTION OF THE PHOTOGRAPHS

The accompanying colored photographs illustrate the overall appearance of the new cultivar, showing the colors as true as it is reasonably possible to obtain in colored reproductions of this type.

The photograph on the first sheet comprises a side perspective view of a typical plant of ‘Red Dragon’ in Corvallis, Oreg.

The photograph on the second sheet is a close-up view of a typical plant of ‘Red Dragon.’

The photograph on the third sheet is a close-up view of the leaves of a typical plant of ‘Red Dragon.’

DETAILED DESCRIPTION OF THE INVENTION

The cultivar ‘Red Dragon’ has not been observed under all possible environmental conditions. The phenotype may vary somewhat with variations in environment such as temperature and light intensity, without, however, any variance in genotype. The aforementioned photographs and following observations and measurements describe plants grown in Corvallis, Oreg. under commercial practice outdoors in the field during the fall, winter, and spring. Plants used for the photographs and description were about four years old. In the following description, color references are made to The Royal Horticultural Society Colour Chart, 1966 Edition, except where general terms of ordinary dictionary significance are used.

  • Botanical classification: Corylus avellana cultivar ‘Red Dragon.’
  • Parentage:
      • Female, or seed, parent.—Corylus avellana selection OSU 487.055, not patented.
      • Male, or pollen, parent.—Corylus avellana selection OSU 367.039, not patented.
  • Propagation:
      • Type.—Rooted suckers.
      • Time to initiate roots.—About 30 days at 20° C.
      • Time to produce a rooted young plant.—About six months at 22° C.
      • Root description.—Fine to thick; freely branching; creamy white in color.
      • Type.—Whip grafting.
      • Time to budbreak on the scions.—About 14 days at 25° C.
      • Time to produce a grafted plant.—About six months at 25° C.
  • Plant description:
      • General appearance.—Perennial shrub. Outwardly spreading plant habit.
      • Growth and branching habit.—Freely branching; about 15 lateral branches develop per plant. Pinching, i.e., removal of the terminal apices, enhances branching with lateral branches potentially forming at every node. Strong and moderately vigorous growth habit. Stems twisting or “contorted.”
      • Plant height.—About 2 meters.
      • Plant diameter or spread.—About 2 meters.
      • Lateral branch description.—Length: About 15 cm. Diameter: About 5 mm. Internode length: About 1.3 cm. Texture: Smooth, glabrous. Strength: Strong. Color, immature: 178A. Color, mature: 137A.
  • Foliage description:
      • Arrangement.—Alternate, simple.
      • Length.—About 12 cm.
      • Width.—About 10 cm.
      • Shape.—Oblong to ovate.
      • Apex.—Obtuse to acute.
      • Base.—Cordate.
      • Margin.—Serrate.
      • Texture, upper and lower surfaces.—Slightly pubescent.
      • Venation pattern.—Pinnate.
      • Color.—Developing foliage, upper and lower surfaces: 187A. Fully expanded foliage, upper surface: Spring and summer, 183B; late summer and fall, 137A. Fully expanded foliage, lower surface: Spring and summer, 178A; late summer and fall, 137A. Venation, upper surface: Spring and summer, 183B; late summer and fall, 137A. Venation, lower surface: Spring and summer, 178A; late summer and fall, 138B.
      • Petiole.—Length: About 1 cm. Diameter: About 2.5 mm. Texture, upper and lower surfaces: Pubescent. Color, upper surface: Spring and summer, 183B; late summer and fall, 137A. Color, lower surface: Spring and summer, 178A; late summer and fall, 138B.
      • Leaf bud.—Average length: About 6.5 mm. Average width: About 4.2 mm. Color: 178B.
  • Flower description: Male inflorescences are catkins, color prior to elongation 176B. The average length of the catkin is about 25 mm and the average width of the catkin is about 6 mm. The pollen color is yellow (RHS Canary Yellow 2/1). The female inflorescence are modified leaf buds and have an average length of about 6.5 mm and an average width of about 4.2 mm. Female inflorescence bud color is the same as leaf buds (178B) . Female inflorescence style color is purplish red (183B) . The peduncle is tan (165D) and the average peduncle length is 3 to 6 mm. The surface texture of the peduncle is matte (not glossy).
  • Disease/pathogen/pest resistance: Plants of the new Corylus are resistant to eastern filbert blight caused by the fungus Anisogramma anomala (Peck) E. Muller. Plants of the new Corylus are moderately susceptible to bud mites (Phytoptus avellanae Nal.) as are plants of ‘Contorta.’
  • Temperature tolerance: Plants of the new Corylus have been observed to tolerate temperatures from about −10° C. to about 38° C. in the field in Corvallis, Oreg.

Trees of ‘Red Dragon’ set a moderate number of catkins (rating=2.3) which is less than ‘Contorta’ (rating=3.2) but more than other contorted selections. The catkins elongate in late winter with ‘Contorta.’‘Red Dragon’ has incompatibility alleles S6 and S26 as determined by fluorescence microscopy. Both alleles are expressed in the females, but only S6 is expressed in the pollen because of dominance. Female inflorescences of ‘Red Dragon’ also emerge late in the season, with ‘Contorta.’ ‘Red Dragon’ trees will set a few nuts if its stigmas receive compatible pollen while receptive. The nuts are small, slightly long and compressed. The nuts are borne in clusters of one or two in husks equal in length to the nuts. Pollen of the red-leaf cultivars ‘Rode Zeller’ and ‘Fusco Rubra’ expresses S6 and, thus, is incompatible. ‘Contorta’ (S5 S10) is reciprocally compatible with ‘Red Dragon.’

DNA was extracted from several contorted seedlings and amplified by PCR. Random amplified polymorphic DNA (RAPD) markers UBC 152-800 and UBC 268-580, which flank the ‘Gasaway’ resistance gene, are present in ‘Red Dragon.’ RAPD marker AA12-850, which co-segregates with resistance, is also present. Scions were collected from ‘Red Dragon’ and several other contorted selections and three trees of each were grafted to rooted layers of Corylus avellana. The shoot tips of the grafted trees were inoculated in the greenhouse with a spore suspension of Anisogramma anomala and then held under high humidity. The three inoculated trees of ‘Red Dragon’ remained free of disease, while those of other selections in the same test developed cankers. The lack of cankers confirmed the results of the RAPD markers and indicates complete resistance to eastern filbert blight.

Notably, no trees have been lost to bacterial blight caused by Xanthomonas campestris pv. corylina, however susceptibility to the disease has not been rigorously tested.

Susceptibility to big bud mite (primarily Phytoptus avellanae Nal.) was rated after leaf fall once per year for three years. The scale was from 1 (no blasted buds) to 5 (many blasted buds). The average bud mite rating for ‘Red Dragon’ (3.2) is slightly higher than for ‘Contorta’ (2.6), but the difference is not significant at P=0.05. The nursery trade does not consider bud mite to be a serious problem for ‘Contorta.’ Therefore, bud mite should also not be a serious problem for ‘Red Dragon.’

Fingerprinting with simple sequence repeat (SSR) markers was also performed. A panel of simple sequence repeat marker loci for hazelnut has been developed. Using primers designed for each SSR locus, hazelnut DNA was amplified by PCR as described (Bassil et al. (2005) J. Amer. Soc. Hort. Sci., 130:543-549). The sequences of the primers are provided in Table 1. Forward primers were fluorescently labeled with FAM, HEX, or NED, and the size of the amplified fragment was determined by capillary electrophoresis on an ABI 3100 instrument (Applied Biosystems; Foster City, Calif.). 93 SSR loci were used to amplify 32 hazelnut genotypes. Microsatellite markers in hazelnut are described in Bassil et al. (J. Amer. Soc. Hort. Sci. (2005) 130:543-549), Bassil et al. (Acta Horticulturae (2005) 686:105-110), Boccacci et al. (Mol. Ecol. Notes (2005) 5:934-937), Boccacci et al. (Genome (2006) 49:598-611), and Mehlenbacher et al. (Genome (2005) 49:122-133). The disclosure of each of the above citations is incorporated by reference herein.

TABLE 1 Microsatellite markers used to fingerprint ‘Red Dragon’ and other hazelnuts. Locus Forward Primer Sequence Reverse Primer Sequence A040 TGCTCAAGCAAATATTGCAC GTTTGGGATCCAATTAACCCTCT AJ490 ACTGCAGCCCTTCAACTACG AACGCCTACCTCATGTTTGG B107 GTAGGTGCACTTGATGTGCTTTAC AACACCATATTGAGTCTTTCAAAGC B507 CTAAGCTCACCAAGAGGAAGTTGAT GCTTCTGGGTCTCCTGCTCA B508 GGTCAAGATTTGATAAAGTGGGA GCACTCCACTTGTGCGTTTTC B617 TCCGTGTTGAGTATGGACGA TGTTTTTGGTGGAGCGATG B619 AGTCGGCTCCCCTTTTCTC GCGATCTGACCTCATTTTTG B643 CCAGGTAAGCAGCTCAGTGT ACCTCCCATTTGTGTCTTGC B662 CGAAAGATGGACTTCCATGAC CAAGTTGAGATTCTTCCTGCAA B709 CCAAGCACGAATGAACTCAA GCGGGTTCTCGTTGTACACT B720 CTCTGTGTCGGCTTTCTGGT ATAAACCTCACGCCACACCT B732 GCCCTTCTTCTTTTCTGCAA AGTGCCACCTCAACAAATCC B733 CACCCTCTTCACCACCTCAT CATCCCCTGTTGGAGTTTTC B741 GTTCACAGGCTGTTGGGTTT CGTGTTGCTCATGTGTTGTG B774 GTTTTGCGAGCTCATTGTCA TGTGTGTGGTCTGTAGGCACT B776 TGTATGTACACACGGAGAGAGAGA TGAGGGGAAGAGGTTTGATG C010 GGAGCCACCATGAAATTATACA CACTTATTGCGATTGGTTCA C028 CTACCCCATCGCTTGACAC GGAGACTTGTTTGCCACAGA C119 CTCACCTTTACCCCTTCATTTT GTTTCCTCATCTTCTGAGAACCATC C504 GGTCTCCTTCGCTAACATAACCAA GTTGCCCTCGAGTTGTAGTA K27-28-30 ACACACACACACACACGAA GCACCAAGCAGAACAATC K74-1-19 CTTACAGATAAATGGCTCAAA AAGCAAGAAAGGGATGGT K74-2-36 AGGCATCAGTTCATCCAA GGAAGGTGAGAGAAATCAAGT K74-6-19 TTATTCCACCAAAGTCTACCTC TCCTCACCAATCACACTATTT K76-1-26 AAGGCGGCACTCGCTCAC GAACAACTGAAGACAGCAAAG K80-1-2 CTGGCTTCAAATCAATCATAC GAGGAGAGGAGAGAGAAAGAG Locus Repeat Motif Size Tm SEQ ID NO (F, R) A040 (CA)13 234-248 62 1, 2 AJ490 (CT)14Ns(CT)15 210-224 60 3, 4 B107 (CT)14 112-151 58 5, 6 B507 (GA)1GC(GA)2GC(GA)14 182-202 55 7, 8 B508 (GA)10 142-167 62 9, 10 B617 (GA)15 280-298 60 11, 12 B619 (TC)21 146-180 60 13, 14 B643 (AG)13 180-196 60 15, 16 B662 (TC)15 220-236 60 17, 18 B709 (GA)21 219-233 60 19, 20 B720 (AG)14 159-179 60 21, 22 B732 (GA)13 140-156 60 23, 24 B733 (TC)15 161-183 60 25, 26 B741 (GT)5(GA)12 176-194 60 27, 28 B774 (AG)15 195-213 60 29, 30 B776 (GA)17 134-148 60 31, 32 C010 (GAA)a 272-319 58 33, 34 C028 (GAA)10 131-147 60 35, 36 C119 (GA)7(GA)9 256-264 62 37, 38 C504 (CT)18 161-187 55 39, 40 K27-28-30 (AG)10 328-345 57 41, 42 K74-1-19 (AAAT)5 255-249 54 43, 44 K74-2-36 (AGG)7 328-346 55 45, 46 K74-6-19 (AG)15 366-393 56 47, 48 K76-1-26 (GA)17 240-278 58 49, 50 K80-1-2 (GA)13 188-211 57 51, 52 Shown for each microsatellite marker locus are the sequence of the forward and reverse primers, the repeat motif, the range of sizes generated, the annealing temperature, and the sequence identifiers. a(GAA)7GGA(GAA)2N21(GAA)2ATT(GAA)4N15(GAA)3.

The allele sizes at 26 loci that distinguish 12 hazelnut genotypes are presented below (Table 2). OSU 217.094 is a red leaf seedling of ‘Contorta,’ and its pollen parent is believed to be ‘Rode Zeller.’ DNA of six contorted red leaf selections (two selections of the ‘Red Majestic,’ ‘Red Dragon,’ OSU 897.046, OSU 897.071 and OSU 897.082) was also amplified. ‘Red Majestic’ plants from Spring Meadow and from Klehm are clearly different, as they have different alleles at 19 of the 26 loci. Notably, ‘Red Dragon’ is different from both clones of ‘Red Majestic’ and from all other genotypes in Table 2. Indeed, ‘Red Dragon’ was found to exhibit different allele sizes at certain loci that allowed for it to be distinguish from other hazelnut genotypes such as ‘Contorta’ and ‘Red Majestic.’

TABLE 2 Allele sizes at 26 microsatellite loci of 12 hazelnut genotypes. Genotype Locus A040 AJ490 B107 B507 B508 Gasaway 238/246 218/222 122/128 179/190 147/165 Rode Zeller 238/246 214/216 134/144 189/197 149/149 OSU 217.094 238/246 214/214 130/134 185/197 157/157 Contorta 246/246 212/214 122/130 185/189 147/155 Red Majestic Spring 246/246 212/212 122/130 189/189 147/157 Meadow Red Majestic Klehm 246/246 214/214 122/130 189/189 147/149 OSU 897.046 238/246 212/214 128/134 179/197 147/157 OSU 897.071 246/246 214/224 122/130 179/197 157/165 Red Dragon (OSU 246/246 212/216 128/130 185/189 165/165 897.078) OSU 897.082 246/246 212/216 122/134 179/185 165/165 FuscoRubra 238/248 214/222 120/122 189/199 165/165 Barcelona 236/236 212/224 112/134 181/191 157/157 Genotype Locus B617 B619 B643 B662 B709 Gasaway 292/296 170/174 190/196 230/236 227/227 Rode Zeller 282/292 166/176 192/192 230/230 227/227 OSU 217.094 292/294 170/176 190/190 230/236 227/227 Contorta 282/294 156/170 182/192 232/236 221/227 Red Majestic Spring 282/282 156/170 192/192 226/232 227/227 Meadow Red Majestic Klehm 282/294 170/176 186/196 226/232 221/227 OSU 897.046 294/294 156/176 182/192 230/230 227/227 OSU 897.071 282/292 156/166 182/192 226/236 221/227 Red Dragon (OSU 282/292 156/156 182/192 226/236 225/227 897.078) OSU 897.082 282/292 156/156 190/196 232/236 221/227 FuscoRubra 290/296 156/166 182/192 222/228 225/227 Barcelona 286/290 156/170 190/190 230/232 225/233 Genotype Locus B720 B732 B733 B741 B774 Gasaway 161/163 140/154 173/173 186/188 203/209 Rode Zeller 159/167 150/150 173/173 178/184 203/207 OSU 217.094 167/167 150/154 161/173 178/184 203/203 Contorta 159/167 142/154 161/161 163/184 203/203 Red Majestic Spring 167/167 142/142 161/161 178/184 203/203 Meadow Red Majestic Klehm 159/167 140/140 161/161 163/178 203/209 OSU 897.046 163/167 140/154 161/161 178/186 203/209 OSU 897.071 159/159 140/154 161/161 163/178 203/203 Red Dragon (OSU 163/167 140/150 161/161 178/178 203/209 897.078) OSU 897.082 159/167 140/150 161/161 163/178 203/203 FuscoRubra 165/171 146/150 173/183 178/186 197/213 Barcelona 161/167 150/154 171/173 177/186 203/207 Genotype Locus B776 C101 C028 C119 C504 Gasaway 144/148 281/281 144/144 258/264 161/164 Rode Zeller 134/136 275/278 132/141 256/264 158/164 OSU 217.094 136/146 275/275 132/141 256/258 161/164 Contorta 134/146 281/281 132/132 258/264 158/161 Red Majestic Spring 134/146 275/275 132/141 258/264 158/161 Meadow Red Majestic Klehm 146/146 281/281 132/135 258/264 152/161 OSU 897.046 136/148 275/275 141/144 256/258 161/161 OSU 897.071 134/148 275/281 132/132 258/258 161/161 Red Dragon (OSU 134/148 275/275 132/141 256/258 161/161 897.078) OSU 897.082 146/148 275/281 132/141 258/258 161/161 FuscoRubra 134/136 278/278 135/135 256/264 152/164 Barcelona 134/136 275/278 132/141 258/258 155/155 Genotype Locus K27-28-30 K74-1-19 K74-2-36 Gasaway 331/333 239/248 337/346 Rode Zeller 329/331 234/234 340/343 OSU 217.094 329/329 234/248 337/340 Contorta 331/331 239/248 337/337 Red Majestic Spring 329/331 239/248 337/337 Meadow Red Majestic Klehm 329/329 239/239 337/343 OSU 897.046 331/331 234/248 337/340 OSU 897.071 331/331 239/248 337/340 Red Dragon (OSU 331/331 234/248 337/340 897.078) OSU 897.082 331/331 234/248 337/337 FuscoRubra 329/329 248/248 337/346 Barcelona 329/331 234/248 337/337 Genotype Locus K74-6-19 K76-1-26 K80-1-2 Gasaway 378/390 255/259 194/197 Rode Zeller 392/392 253/255 201/201 OSU 217.094 376/392 253/253 201/201 Contorta 376/376 253/255 201/203 Red Majestic Spring 376/392 253/255 203/203 Meadow Red Majestic Klehm 376/376 253/255 199/203 OSU 897.046 376/390 253/253 197/201 OSU 897.071 376/376 251/253 197/201 Red Dragon (OSU 376/392 253/253 201/203 897.078) OSU 897.082 376/390 253/253 197/201 FuscoRubra 380/392 255/265 197/207 Barcelona 374/378 259/265 203/205

Claims

1. A new and distinct Corylus plant named ‘Red Dragon’ as illustrated and described.

Patent History
Patent number: PP20694
Type: Grant
Filed: Apr 16, 2008
Date of Patent: Feb 2, 2010
Patent Publication Number: 20090265820
Assignee: The State of Oregon, Acting By and Through the State Board of Higher Education; Oregon State Univ (Corvallis, OR)
Inventors: Shawn A. Mehlenbacher (Corvallis, OR), David C. Smith (Corvallis, OR)
Primary Examiner: June Hwu
Attorney: Dann, Dorfman, Herrell & Skillman
Application Number: 12/148,080
Classifications
Current U.S. Class: Nut (including Ornamental Variety) (PLT/152)
International Classification: A01H 5/00 (20060101);