Abstract: The invention concerns a process of the detection of HIV antibodies against HIV by means of an immunoassay wherein at least one antigen of the env gene product gp41 of an HIV1-subtype-D isolate and at least one antigen derived from gp41 of a different HIV1-subtype of the M group is used and/or at least one antigen of gp41 of an HIV1-subtype-E isolate and at least one antigen derived from gp41 of a different HIV1-subtype isolate of the M group. The invention additionally concerns antigens and antigen mixtures with components derived from gp41 of the HIV1-subtype-D isolate and from gp41 of the HIV1-subtype-E isolate, respectively, as well as their use for the detection of HIV antibodies and a reagent kit.

Abstract: A chimeric, carboxy-terminal truncated hepatitis B virus nucleocapsid protein (HBc) is disclosed that contains an immunogen for inducing the production of antibodies to malarial proteins. An immunogenic malarial epitope is expressed between residues 78 and 79 of the HBc immunogenic loop sequence. The chimer preferably contains a malaria-specific T cell epitope and is preferably engineered for both enhanced stability of self-assembled particles and enhanced yield of those chimeric particles. Methods of making and using the chimers are also disclosed.

Abstract: The present invention relates to means for cleaving a nucleic acid cleavage structure in a site-specific manner. Enzymes, including 5′ nucleases and 3′ exonucleases, are used to detect and identify nucleic acids derived from microorganisms. Methods are provided which allow for the detection and identification of bacterial and viral pathogens in a sample.

Abstract: The present invention relates to a method for the rapid, reliable and precise detection of drug-induced mutations in the reverse transcriptase gene allowing the simultaneous characterization of a range of codons involved in drug resistance using specific sets of probes optimized to function together in a reverse-hybridization assay. More particularly, the present invention relates to the genetic detection of the following mutations in the HIV RT gene: K103N/R, V106A/I/L, Q151M/L, Y181C/I, M184V/I, Y188L, G190A/S/R and/or T215Y/F/D/S/A. The present invention also relates to probes and primers for such detection, to a diagnostic kit and a LiPA assay. The present invention further relates to HIV RT sequences comprising previously unknown polymorphisms.

Abstract: The present invention relates to methods for tracing or characterization of neural circuits or neural connections across synapses. The invention relates to recombinant neurotropic viruses which are useful in tracing or characterizing neural connections across multiple synapses.

Abstract: The invention relates to the discovery of a novel RNA sequence at the 3′ terminal sequence of hepatitis C virus (HCV) genome RNA. Included in the invention are the 3′ sequence, its complement, and their use for nucleic-acid based diagnostics and for developing and evaluating novel anti-HCV therapies. This sequence element, which is conserved among HCV genotypes, is likely to be essential for viral replication, and required for construction of full-length HCV cDNA clones capable of yielding infectious RNA, progeny virus or replication-competent HCV replicons. Such functional clones are useful tools for evaluation of therapeutic approaches and as substrates for developing candidate attenuated or inactivated HCV derivatives for vaccination against HCV.

Abstract: This disclosure relates to CryoArrays, which permit the analysis of samples (such as protein, nucleic acid, virus, or cell samples) in arrays that are prepared at low temperatures. Because CryoArrays are constructed as a block of substantially columnar samples, the block can be sliced to provide a plurality of identical or substantially identical individual arrays. The individual arrays can be used for parallel analysis of the same array feature set, for instance with different probes or under different conditions. Also provided are methods of making CryoArrays, devices for making CryoArrays, and kits.

Abstract: A method is described for diagnosing individuals as having hypertrophic cardiomyopathy, e.g. familial or sporadic hypertrophic cardiomyopathy. The method provides a useful diagnostic tool which becomes particularly important when testing asymptomatic individuals suspected of having the disease. Symptomatic individuals have a much better chance of being diagnosed properly by a physician. Asymptomatic individuals from families having a history of familial hypertrophic cardiomyopathy may be selectively screened using the method of this invention allowing for a diagnosis prior to the appearance of any symptoms. Individuals having the mutation responsible for the disease may be counseled to take steps which hopefully would prolong their life, i.e. avoid rigorous exercise. The methodology used in the above method also has broad applicability and may be used to detect other disease-associated mutations in DNA obtained from subjects being tested for other disease-associated mutations.

Abstract: The present invention features a method for producing fine spotted arrays of molecules comprising the following steps of (a) immobilizing affinity anchors onto the array; (b) preparing molecules of interest having affinity for the anchors; (c) contacting the molecules of interest with the array; and (d) washing the array to remove unbound molecules of interest.

Abstract: This invention relates to methods and compositions for diagnosing and treating neuropsychiatric disorders, such as schizophrenia, schizoaffective disorder, bipolar affective disorder, unipolar affective disorder and adolescent conduct disorder. In particular, the invention provides novel variants of DISC1 and DISC2 nucleic acid sequences, as well as novel DISC1 polypeptides encoded by these variant nucleic acid sequences. The variant DISC1 and DISC2 nucleic acid sequences provided by this invention, and the variant gene products they encode, are ones that correlate with the presence of a neuropsychiatric disorder in individuals. The invention, therefore, also provides methods and compositions for using the variant nucleic acids and polypeptides to diagnose and treat such neuropsychiatric disorders in individuals.

Abstract: Methods are disclosed for predicting the potential of an oligonucleotide to hybridize to a target nucleotide sequence. A predetermined number of unique oligonucleotides is identified. The unique oligonucleotides are chosen to sample the entire length of a nucleotide sequence that is hybridizable with the target nucleotide sequence. At least one parameter that is independently predictive of the ability of each of the oligonucleotides of the set to hybridize to the target nucleotide sequence is determined and evaluated for each of the above oligonucleotides. A subset of oligonucleotides within the predetermined number of unique oligonucleotides is identified based on the evaluation of the parameter. Oligonucleotides in the subset are identified that are clustered along a region of the nucleotide sequence that is hybridizable to the target nucleotide sequence. The method may be carried out with the aid of a computer.

Abstract: The present invention relates to Latrophilin (LPH) polynucleotides and polypeptides, and to identifying and treating subjects at risk for eye disease. Specifically, the present invention provides novel human LPH3 and LPH1 polynucleotides and LPH3 polypeptides, assays for detecting variations in LPH polynucleotides associated with eye disease, and methods and compositions for treating eye disease.

Abstract: Methods are disclosed for determining the activity and function of gene products based on their change to the phenotype of cells when contacted with a surrogate molecule identified through screening of a recombinant peptide library. By identifying peptides which bind gene products for which the function is not yet known, tools are provided for determining their function and obtaining drug candidates.

Abstract: The present invention is directed to novel polypeptides and to nucleic acid molecules encoding those polypeptides. Also provided herein are vectors and host cells comprising those nucleic acid sequences, chimeric polypeptide molecules comprising the polypeptides of the present invention fused to heterologous polypeptide sequences, antibodies which bind to the polypeptides of the present invention and to methods for producing the polypeptides of the present invention.

Abstract: Methods and reagents for determining sequence variants present at the TCF-1 locus, which facilitates identifying individuals at risk for Th1 diseases, such as type 1 diabetes or multiple sclerosis, or Th2 diseases, such as allergic asthma or atopy.

Abstract: The present invention is directed to novel polypeptides and to nucleic acid molecules encoding those polypeptides. Also provided herein are vectors and host cells comprising those nucleic acid sequences, chimeric polypeptide molecules comprising the polypeptides of the present invention fused to heterologous polypeptide sequences, antibodies which bind to the polypeptides of the present invention and to methods for producing the polypeptides of the present invention.

Abstract: The present invention is directed to novel polypeptides and to nucleic acid molecules encoding those polypeptides. Also provided herein are vectors and host cells comprising those nucleic acid sequences, chimeric polypeptide molecules comprising the polypeptides of the present invention fused to heterologous polypeptide sequences, antibodies which bind to the polypeptides of the present invention and to methods for producing the polypeptides of the present invention.

Abstract: A method for identifying gene cluster is disclosed. The method may be used for identifying gene clusters involved in the biosynthesis of natural products. A small insert library of DNA fragments of genomic DNA and a large insert library of DNA fragments of genomic DNA are prepared. Fragments in the small insert library are sequenced and compared by homology comparison under computer control to a database containing genes, gene fragments or proteins known to be involved in the biosynthesis of microbial natural products. Fragments having similar structure to genes, gene fragments or proteins known to be involved in the biosynthesis of naturally occurring metabolites are used as probes to screen the large insert library of genomic DNA to detect gene clusters involved in the biosynthesis of microbial natural products.

Abstract: A method for identifying one or more genes involved in a phenotype of cells, tissues or organisms, comprising the steps of contacting cells, tissues or organisms which exhibit the phenotype with a library of antisense oligonucleotides and performing a primary phenotypic assay to determine which antisense oligonucleotides in the library attenuate the phenotype. These antisense oligonucleotides correspond to genes involved in the phenotype. The method may be used to identify genes involved in various disease states.

Abstract: The present invention relates generally to methods and compositions for analyzing binding molecules including proteins and nucleic acid-molecules. In addition the invention relates to the use of microsensors that rely on non-fluorescent detection system consisting of a sensor using microscopic flexible mechanical structures such as micro-cantilevers or micro-membranes integrated into a microscopic chambers for detection of a wide variety of biological-based assays.

Abstract: A method for detecting a plurality of reactive sites on an analyte, comprising allowing reactants on an addressable microsphere and the reactive sites to react, forming reactant-reactive site pairs distinguishable by fluorescence intensity. The invention also provides a method for detecting a plurality of analytes in a sample using addressable microspheres in combination with one or more reporter reagents. Also provided are a method for determining allele zygosity of a genetic locus having two alleles or more alleles using microparticles, and a method for detecting a plurality of SNPs in nucleic acid molecules. The instant invention also provides a composition comprising an addressable microsphere carrying at least two fluorescent reactants capable of forming reactant-analyte pairs distinguishable by their fluorescence intensity, and kits comprising the inventive composition and a plurality of reporter reagents.

Abstract: The invention provides for methods of monitoring the proliferation of cultured prostate cancer cells in the presence of quercetin, methods of treating an individual with prostate cancer or at risk of developing prostate cancer, and methods of reducing the risk of recurrence of prostate cancer in an individual who had previously been treated for prostate cancer. Methods of the invention further include treating an individual with benign prostatic hyperplasia (BPH) with quercetin as well as methods of screening for compounds that inhibit the proliferation of prostate cancer cells. The invention provides for compositions and articles of manufacture containing quercetin in particular formulations, and quercetin with a second compound that also exerts an effect on the androgen receptor.

Abstract: The invention provides methods of detecting a nucleic acid. The methods comprise contacting the nucleic acid with one or more types of particles having oligonucleotides attached thereto. In one embodiment of the method, the oligonucleotides are attached to nanoparticles and have sequences complementary to portions of the sequence of the nucleic acid. A detectable change (preferably a color change) is brought about as a result of the hybridization of the oligonucleotides on the nanoparticles to the nucleic acid. The invention also provides compositions and kits comprising particles. The invention further provides methods of synthesizing unique nanoparticle-oligonucleotide conjugates, the conjugates produced by the methods, and methods of using the conjugates. In addition, the invention provides nanomaterials and nanostructures comprising nanoparticles and methods of nanofabrication utilizing nanoparticles. Finally, the invention provides a method of separating a selected nucleic acid from other nucleic acids.

Abstract: The present invention is directed to novel polypeptides and to nucleic acid molecules encoding those polypeptides. Also provided herein are vectors and host cells comprising those nucleic acid sequences, chimeric polypeptide molecules comprising the polypeptides of the present invention fused to heterologous polypeptide sequences, antibodies which bind to the polypeptides of the present invention and to methods for producing the polypeptides of the present invention.

Abstract: The present invention includes a method and device for performing the automated SELEX process, including automated photoSELEX process embodiments, and automated affinity SELEX process embodiments. The automated photoSELEX embodiments included an embodiment wherein target protein and nucleic acid ligands are photocrosslinked in solution. The steps of the SELEX process are performed at one or more work stations on a work surface by a robotic manipulator controlled by a computer.

Abstract: The present invention contemplates monitoring the amplification of nucleic acid using chromophore-containing polynucleotides having at least two donor chromophores operatively linked to the polynucleotide by linker arms, such that the chromophores are positioned by linkage along the length of the polynucleotide at a donor-donor transfer distance, and at least one fluorescing acceptor chromophore operatively linked to the polynucleotide by a linker arm, such that the fluorescing acceptor chromophore is positioned by linkage at a donor-acceptor transfer distance from at least one of the donor chromophores, to form a photonic structure for collecting photonic energy and transferring the energy to an acceptor chromophore, and methods using the photonic structures.

Abstract: This patent describes a novel in vitro cell-based method for biological validation and pharmacological screening of drugs, new chemical entities (NCEs) and biologics, which is predictive of in vivo testing for efficacy and adverse events in patients, as occurs in clinical trials. The same method can be used to create an in vitro cell-based assay to identify the ‘right marketed medication for the right patient’ (personalized medicine), and to identify responders/non-responders in ongoing clinical trials with NCEs. In addition this approach can be used to identify new indications for existing medicines and new indications for NCEs that were unsuccessful in their intended uses.

Abstract: Compositions and methods for the therapy and diagnosis of cancer, particularly lung cancer, are disclosed. Illustrative compositions comprise one or more lung tumor polypeptides, immunogenic portions thereof, polynucleotides that encode such polypeptides, antigen presenting cell that expresses such polypeptides, and T cells that are specific for cells expressing such polypeptides. The disclosed compositions are useful, for example, in the diagnosis, prevention and/or treatment of diseases, particularly lung cancer.

Abstract: The present application relates to nucleic acids and polypeptides from Cenarchaeum symbiosum. Methods of making the polypeptides and antibodies against the polypeptides are also described.

Abstract: Disclosed is a specific regulator of Ii protein expression or immunoregulatory function. Specifically disclosed are several forms of the specific regulator of Ii, including those which function through the formation of a duplex molecule with an RNA molecule encoding mammalian Ii protein to inhibit Ii protein synthesis at the translation level. This class includes copolymers comprised of nucleotide bases which hybridize specifically to the RNA molecule encoding mammalian Ii protein, and also expressible reverse gene constructs. In other aspects, the disclosure relates to MHC class II-positive antigen presenting cells containing a specific regulator of Ii expression. Such cells are useful, for example, in the display of autodeterminant peptides in association with MHC class II proteins. Compositions of the invention find application in methods for treating diseases, for example malignancies and autoimmune disorders, in a patient by enhancing immunological attack on undesired cells.

Abstract: The invention relates to compositions, kits, and methods for detecting, characterizing, preventing, and treating human colon cancers. A variety of marker genes are provided, wherein changes in the levels of expression of one or more of the marker genes is correlated with the presence of colon cancer.

Abstract: The present invention relates to methods for correlating gene and protein expression in a cell.

Abstract: The present invention relates to novel lung related polynucleotides and the polypeptides encoded by these polynucleotides herein collectively known as “lung antigens,” and the use of such lung antigens for detecting disorders of the lung, particularly the presence of lung cancer and lung cancer metastases. More specifically, isolated lung associated nucleic acid molecules are provided encoding novel lung associated polypeptides. Novel lung polypeptides and antibodies that bind to these polypeptides are provided. Also provided are vectors, host cells, and recombinant and synthetic methods for producing human lung associated polynucleotides and/or polypeptides. The invention further relates to diagnostic and therapeutic methods useful for diagnosing, treating, preventing and/or prognosing disorders related to the lung, including lung cancer, and therapeutic methods for treating such disorders.

Abstract: A method for detecting the fungus Stachybotrys chartarum includes isolating DNA from a sample suspected of containing the fungus Stachybotrys chartarum. The method further includes subjecting the DNA to polymerase chain reaction amplification utilizing at least one of several primers, the several primers each including one of the base sequences 5′GTTGCTTCGGCGGGAAC3′, 5′TTTGCGTTTGCCACTCAGAG3′, 5′ACCTATCGTTGCTTCGGCG3′, and 5′GCGTTTGCCACTCAGAGAATACT3′. The method additionally includes detecting the fungus Stachybotrys chartarum by visualizing the product of the polymerase chain reaction.

Abstract: The present invention is directed to a systematic in silico method to identify new coding sequences, including homologs of coding sequences, in S. cerevisiae and other organisms. The present invention is also directed to novel ORFs and the proteins encoded thereby identified using the in silico methods.

Abstract: The invention relates to polymorphic markers within the costimulatory receptor gene locus. These markers are characterized by sets of oligonucleotide primers according to the invention useful in PCR amplification and DNA segment resolution.

Abstract: The present invention is directed to a method for the determination of a target nucleic acid using a special control nucleic acid, a method for the amplification of a partial sequence of said target nucleic acid using primers, a special control and a kit containing said control. The sequence of these control nucleic acids are at least in part parallel-complementary to the sequence of the target nucleic. These controls have similar properties as the target nucleic acid in hybridization and amplification methods, but can be well differentiated from the target nucleic acid by their different sequence.

Abstract: The present invention relates to novel prostate cancer related polynucleotides and the polypeptides encoded by these polynucleotides herein collectively known as “prostate cancer antigens,” and the use of such prostate cancer antigens for detecting disorders of the prostate, particularly the presence of prostate cancer and prostate cancer metastases. More specifically, isolated prostate cancer associated nucleic acid molecules are provided encoding novel prostate cancer associated polypeptides. Novel prostate cancer polypeptides and antibodies that bind to these polypeptides are provided. Also provided are vectors, host cells, and recombinant and synthetic methods for producing human prostate cancer associated polynucleotides and/or polypeptides. The invention further relates to diagnostic and therapeutic methods useful for diagnosing, treating, preventing and/or prognosing disorders related to the prostate, including prostate cancer, and therapeutic methods for treating such disorders.

Abstract: The present invention provides novel polynucleotides encoding HGPRBMY27 polypeptides, fragments and homologues thereof. Also provided are vectors, host cells, antibodies, and recombinant and synthetic methods for producing said polypeptides. The invention further relates to diagnostic and therapeutic methods for applying these novel HGPRBMY27 polypeptides to the diagnosis, treatment, and/or prevention of various diseases and/or disorders related to these polypeptides. The invention further relates to screening methods for identifying agonists and antagonists of the polynucleotides and polypeptides of the present invention.

Abstract: The present invention relates to novel connective tissue related polynucleotides and the polypeptides encoded by these polynucleotides herein collectively known as “connective tissue antigens,” and the use of such connective tissue antigens for detecting disorders of connective tissue(s), particularly the presence of cancer and cancer metastases. More specifically, isolated connective tissue associated nucleic acid molecules are provided encoding novel connective tissue associated polypeptides. Novel connective tissue polypeptides and antibodies that bind to these polypeptides are provided. Also provided are vectors, host cells, and recombinant and synthetic methods for producing human connective tissue associated polynucleotides and/or polypeptides. The invention further relates to diagnostic and therapeutic methods useful for diagnosing, treating, preventing and/or prognosing disorders related to connective tissue(s), including cancer, and therapeutic methods for treating such disorders.

Abstract: Methods for deceasing non-specific bindings of beads in dual bead assays and related optical bio-discs and disc drive systems. The methods include determining the suitability of a test solid phase for purposes of use in a dual bead assay. The method also includes identifying whether a target agent is present in a biological sample and involves mixing capture beads, reporter beads, and a biological sample. The mixing is performed under binding conditions to permit formation of a dual bead complex if the target agent is present in the sample. The reporter bead and capture bead are each bound to the target agent. Cleavable spacers or displacement linkers may be used in forming the dual bead complexes. The methods also include placing the capture beads and the reporter beads spatially proximally, performing a ligation reaction employing a ligase, and isolating the dual bead complex from the mixture to obtain the isolate.

Abstract: The present invention relates to novel proteins. More specifically, isolated nucleic acid molecules are provided encoding novel polypeptides. Novel polypeptides and antibodies that bind to these polypeptides are provided. Also provided are vectors, host cells, and recombinant and synthetic methods for producing human polynucleotides and/or polypeptides, and antibodies. The invention further relates to diagnostic and therapeutic methods useful for diagnosing, treating, preventing and/or prognosing disorders related to these novel polypeptides. The invention further relates to screening methods for identifying agonists and antagonists of polynucleotides and polypeptides of the invention. The present invention further relates to methods and/or compositions for inhibiting or enhancing the production and function of the polypeptides of the present invention.

Abstract: An object of the present invention is to provide a method for detecting a target nucleotide sequence using a complementary nucleotide sequence that has an excellent sensitivity of detection. The method comprises the steps of converting the target nucleotide sequence to a partially double-stranded nucleotide sequence which is double-stranded at one part and single-stranded in the remaining part and detecting said partially double stranded nucleotide sequence using a nucleotide sequence that is complementary to the target nucleotide sequence.

Abstract: The present invention relates to novel proteins. More specifically, isolated nucleic acid molecules are provided encoding novel polypeptides. Novel polypeptides and antibodies that bind to these polypeptides are provided. Also provided are vectors, host cells, and recombinant and synthetic methods for producing human polynucleotides and/or polypeptides, and antibodies. The invention further relates to diagnostic and therapeutic methods useful for diagnosing, treating, preventing and/or prognosing disorders related to these novel polypeptides. The invention further relates to screening methods for identifying agonists and antagonists of polynucleotides and polypeptides of the invention. The present invention further relates to methods and/or compositions for inhibiting or enhancing the production and function of the polypeptides of the present invention.

Abstract: The genomic structure including the sequence of the intron/exon junctions is disclosed for KVLQT1 and KCNE1 which are genes associated with long QT syndrome. Additional sequence data for the two genes ARE also disclosed. Also disclosed are newly found mutations in KVLQT1 which result in long QT syndrome. The intron/exon junction sequence data allow for the design of primer pairs to amplify and sequence across all of the exons of the two genes. This can be used to screen persons for the presence of mutations which cause long QT syndrome. Assays can be performed to screen persons for the presence of mutations in either the DNA or proteins. The DNA and proteins may also be used in assays to screen for drugs which will be useful in treating or preventing the occurrence of long QT syndrome.

Abstract: This invention provides nucleic acid segments derived from the neurokinin 1 receptor (TACR 1) locus of the human genome, including polymorphic sites. Allele-specific primers and probes hybridizing to these sites and to regions flanking these sites are also provided. This invention further provides methods of analyzing a nucleic acid from an individual or a group of individuals. The nucleic acids, primers, and probes are useful for applications including forensics, paternity testing, medicine, e.g., the correlation of polymorphisms with phenotypic traits, and genetic analysis, e.g., genetic mapping of such phenotypic traits.

Abstract: The invention related to a process for infecting eukaryotic cells with one or more virus species, preferentially hepatitis B or hepatitis C virus, as well as cell cultures infected by the same. To achieve this goal, plasma or serum obtained from individuals infected by viruses, preferentially hepadnaviridae and flaviviridae, is used an inoculum to infect established eukaryotic cell lines or primary cells, preferentially hepatocytes, which in turn produce viral particles. This process, the resulting infected cells and cell culture supernatant can be used in many situations, notably the screening of drug candidates, the detection of antibodies, the generation of a diagnostic kit and the production of vaccines.

Abstract: Integrated systems and methods for diversity generation and screening are provided. The systems use common fluid and array handling components to provide nucleic acid diversification, transcription, translation, product screening and subsequent diversification reactions.

Abstract: Integrated systems and methods for diversity generation and screening are provided. The systems use common fluid and array handling components to provide nucleic acid diversification, transcription, translation, product screening and subsequent diversification reactions.

Abstract: The invention provides human ubiquitin-conjugating enzymes, cDNAs which encode the enzymes, and antibodies which specifically bind the enzymes. The invention also provides expression vectors, host cells, and antagonists and methods for diagnosing, treating or evaluating the treatment of disorders associated with differential expression of human ubiquitin-conjugating enzymes.