Abstract: The invention relates to lubricating fluids and oil formulations which provide exceptionally low traction, a method of lowering traction coefficients in lubricating compositions, and to uses of such compositions.

Abstract: This invention relates to detergents, lubricating oil additives and compositions, and methods of preparing detergents, lubricating oil additives and compositions. More specifically, this invention relates to novel phenolic dimers.

Abstract: A manual transmission fluid having a VI greater than 160 and a Brookfield viscosity at ?40° C. less than 30,000 cP. It comprises: 1) a base oil (made from a waxy feed) having less than 0.06 wt % aromatics, greater than 5 wt % total molecules with cycloparaffinic functionality, and a ratio of molecules with monocycloparaffinic functionality to molecules with multicycloparaffinic functionality greater than 20; and a manual transmission fluid additive package. In another embodiment, the manual transmission fluid comprises: 1) a base oil having a high VI and a kinematic viscosity at 100° C. greater than 5.5 cSt, 2) less than 0.01 wt % pour point depressant, and 3) a manual transmission fluid additive package. This invention is also directed to a process to make the manual transmission fluid, comprising the steps of hydroisomerization dewaxing, selecting base oil fractions having a high VI, and blending the fractions with an additive package.

Abstract: A soap bar comprising at least two different portions wherein the portions have a difference in solubility of at least 1.0%.

Abstract: The present invention provides a chemical-mechanical polishing (CMP) composition comprising an amino compound, a radical-forming oxidizing agent, a radical trapping agent capable of inhibiting radical-induced oxidation of the amino compound, and an aqueous carrier therefore. The radical trapping agent is a hydroxyl-substituted polyunsaturated cyclic compound, a nitrogenous compound, or a combination thereof. Optionally, the composition comprises a metal oxide abrasive (e.g., silica, alumina, titania, ceria, zirconia, or a combination of two or more of the foregoing abrasives). The invention further provides a method of chemically-mechanically polishing a substrate with the CMP compositions, as well as a method of enhancing the shelf-life of CMP compositions containing an amine and a radical-forming oxidizing agent, in which a radical trapping agent is added to the CMP composition.

Abstract: The present invention relates to a solid laundry detergent composition comprising: (a) from 1 wt % to 40 wt % light density silicate salt having a bulk density of less than 400 g/l and a weight average particle size of less than 300 micrometers; (b) from 5 wt % to 60 wt % detersive surfactant; (c) from 0 wt % to 50 wt % carbonate salt; (d) from 0 wt % to 40 wt % sulphate salt; (e) from 0 wt % to 10 wt % phosphate builder; (f) from 0 wt % to 5 wt % zeolite builder; and (g) from 0 wt % to 15 wt % water; wherein the composition has a bulk density of 600 g/l or less.

Abstract: The present invention relates to water-stable compositions and compounds formed by mixing an organosilane, optionally having a non-hydrolyzable organic group, but having one or more hydrolyzable groups, and an acidified stabilizing solution prepared from at least one acid, at least one glycol ether, and at least one cationic surfactant, preferably at least one quaternary ammonium salt (QAS), in water. The present invention also relates to methods of treating a substrate by mixing or contacting the substrate with the product, compound, or composition of this invention for a period of time sufficient for treatment of the substrate, methods of antimicrobially treating a food article, methods of antimicrobially coating a fluid container, methods of dyeing and treating a substrate, and methods of antimicrobially coating a latex medical article. The invention also pertains to a treated substrate having adhered thereto the product, compound, or composition of this invention.

Abstract: The invention provides a granular anionic surfactant and a detergent composition blended with the same. Disclosed are a process for producing a granular anionic surfactant, which including stirring particles containing 50 to 100 wt % of an anionic surfactant at a temperature at which the anionic surfactant exhibits thermoplasticity at a stirring Froude number as defined below by equation (i) of 0.1 or more and less than 2.0; a granular anionic surfactant obtained by the process; a granular anionic surfactant having a surface roughness (Ra) of 1.0 ?m or less; and a detergent composition comprising the granular anionic surfactant. Fr=V/[(R×g)0.5]??(i) wherein Fr is Froude number, V is the peripheral speed at the top of a stirring blade [m/s], R is the radius of gyration of a stirring blade [m], and g is the acceleration of gravity [m/s2].

Abstract: Use of cardiotrophin in liver diseases. The invention describes the increased expression of cardiotrophin (CT-1) during the process of hepatic regeneration coinciding with maximum proliferation of hepatocytes and the role of CT-1 as a stimulator of hepatic regeneration. Furthermore, it describes the hepatoprotective role of CT-1 in various models of acute liver damage. The importance of using CT-1 in the manufacture of compositions for use in the treatment of hepatopathies is demonstrated. The invention describes such use in various forms and methods, including the recombinant protein and the use of the gene sequences that code for CT-1.

Abstract: The present invention provides methods for stimulating mu-opioid receptors with agonist peptides in a mammal in need thereof. The methods comprise administering to the mammal an effective amount of a selective mu-opioid receptor agonist peptide that comprises at least two ?-amino acid residues. At least one of the amino acid residues has a positive charge. The amino acid residue in the first position is a tyrosine or tyrosine derivative. The amino acid in the second position is a D-?-amino acid. The present invention also provides methods of treating a mammal suffering from conditions or diseases by administering to the mammal an effective amount of the peptides.

Abstract: The present invention relates broadly to the field of sustained release formulations. More specifically, the invention describes compositions and methods relating to formulating proteins and/or peptides with purified gallic acid esters. In one example, the gallic acid ester is PentaGalloylGlucose (PGG) and in anther example the gallic acid ester is epigallocatechin gallate (EGCG).

Abstract: This invention provides for a method for inhibiting new tissue growth in blood vessels in a subject, wherein the subject experienced blood vessel injury, which comprises administering to the subject a pharmaceutically effective amount of an inhibitor of receptor for advanced glycation endproduct (RAGE) so as to inhibit new tissue growth in the subject's blood vessels. The invention also provides for method for inhibiting neointimal formation in blood vessels in a subject, wherein the subject experienced blood vessel injury, which comprises administering to the subject a pharmaceutically effective amount of an inhibitor of receptor for advanced glycation endproduct (RAGE) so as to inhibit neointimal formation in the subject's blood vessels.

Abstract: The present invention aims to provide a substance(s), especially a peptide(s) capable of inhibiting the TGF-? activation reaction. The present invention provides a peptide consisting of 11 to 50 amino acid residues, which comprises an amino acid sequence Gln-Ile-Leu-Ser-X1-X2-X3-X4-Ala-Ser-Pro (SEQ ID NO: 1) wherein each of X1 to X4 independently represents any given amino acid residue, and X1-X2-X3-X4 is a sequence that is not Lys-Leu-Arg-Leu (SEQ ID NO: 12) and is not cleavable by proteases.

Abstract: Nucleic acids comprising the RNA component of a mammalian telomerase are useful as pharmaceutical, therapeutic, and diagnostic reagents.

Abstract: The invention provides a method of treating T-cell mediated diseases and a method of inhibiting the activation of T-cells using certain diketopiperazines. The invention also provides methods of synthesizing diketopiperazines and pharmaceutical compositions comprising certain diketopiperazines. The invention further provides methods of making improved pharmaceutical compositions of proteins and peptides by either increasing or decreasing the content of diketopiperazines in the compositions and the resultant improved pharmaceutical compositions.

Abstract: A novel cyclosporine formulation, which is a pro-nanodispersion at room temperature, featuring solid particles of a relatively large particle size (at least about 150 nm) and yet which is a nanodispersion at body temperature.

Abstract: The present invention is directed to liquid, aqueous pharmaceutical compositions stabilized against chemical and/or physical degradation containing Factor VII polypeptides, and methods for preparing and using such compositions, as well as vials containing such compositions, and the use of such compositions in the treatment of a Factor VII-responsive syndrome. The main embodiment is represented by a liquid, aqueous pharmaceutical composition comprising at least 0.01 mg/mL of a Factor VII polypeptide (i); a buffering agent (ii) suitable for keeping pH in the range of from about 4.0 to about 9.0; and at least one stabilizing agent (iii) comprising a —C(?N-Z1-R1)—NH-Z2-R2 motif, e.g. benzamidine compounds and guanidine compounds such as arginine.

Abstract: The present invention relates to the use of a natriurectic peptide, such as urodilatin, for treating a patient suffering from heart failure, such as acute decompensated heart failure. Preferably, a composition comprising an effective amount of urodilatin is intravenously administered to the patient continuously through a time period of at least 24 hours and up to 120 hours, preferably at least 48 hours.

Abstract: A method for treating demyelinating central nervous system diseases in a subject that comprises administering to the subject a composition comprising a therapeutically active amount of colony stimulating factor or CSF-like ligand. In a preferred embodiment of the present invention, the CSF is a GM-CSF. In a most preferred embodiment of the present invention, CSF is sargramostim.

Abstract: A method for breeding, especially a method for breeding dairy cattle without use of heat detection prior to insemination.

Abstract: Disclosed are EspFU (EspF-like polypeptide encoded by a gene of the cryptic prophage CP-933U of enterohemorrhagic E. coli) polypeptides, fragments thereof, nucleic acids that encode EspFU polypeptides, or fragments thereof, and cells including the polypeptides, fragments, and/or nucleic acids. Also disclosed are model systems, kits, and methods for screening that use, for example, EspFU polypeptides and nucleic acids. Also included are pharmaceutical and diagnostic compositions and methods of diagnosis and treatment of EHEC infections.

Abstract: The present invention relates to compositions and methods for the reduction of atherosclerotic plaques and the decrease in the level of total serum cholesterol, triglycerides, serum LDL cholesterol, and serum HDL cholesterol.

Abstract: The present invention relates to a method for promoting cardiac tissue repair comprising administering to the cardiac tissue a therapeutically effective amount of an angiogenic thrombin derivative peptide and/or inhibiting or reducing vascular occlusion or restenosis. The invention also relates to methods of stimulating revascularization. In yet another embodiment, the invention relates to the use of thrombin derivative peptides in the manufacture of a medicament for the methods described herein.

Abstract: The invention relates to peptides which contain N-methylated amino acid units and have improved water solubility. The invention also relates methods for treating a hormone-dependent tumor or a non-malignant indication that is treatable by LH-RH suppression, the method comprising administering to a patient in need of the treatment a therapeutically effective amount of a compound of the invention. Hormone-dependent cancers that can be treated with the methods of the invention include prostate cancer, breast cancer, ovarian cancer, endometrial cancer, and pancreatic cancer. Non-malignant indications which can be treated by the methods of the invention include benign prostate hyperplasia (BPH), endometriosis, acne, polycystic ovarian disease, dysmenorrhea, precocious puberty, and uterine fibroids and other leiomyomas.

Abstract: The present invention provides compounds represented by the structural formula (I): or pharmaceutically acceptable isomers, salts, solvates or esters of the compound of Formula (I), wherein each of the substituents is as specified herein, formulations including the above compounds, processes for preparing the same and methods for treating atherosclerosis, hypercholesterolemia, or sitosterolemia, and for lowering plasma levels of sterols and/or stanols.

Abstract: C-glycoside compounds are suited for stimulating the synthesis of glycosaminoglycans containing a D-glucosamine and/or N-acetyl-D-glucosamine residue, advantageously hyaluronic acid, and/or proteoglycans, advantageously proteoglycans containing hyaluronic acid, by fibroblasts and/or keratinocytes.

Abstract: The topical application of an azalide antibiotic such as azithromycin to the eye is useful in treating or preventing ocular infections. In one embodiment, the azalide antibiotic is supplied to the eye in a depot for sustained release. A more convenient dosing regimen can also be provided by the use of an appropriate depot. Furthermore, a composition containing a combination of medicaments is also provided.

Abstract: What is described are a compound of the formula in which R1 is C1-C12alkyl, C3-C8cycloalkyl or C2-C12alkenyl; R2 is H, unsubstituted or mono- to pentasubstituted C1-C12alkyl or unsubstituted or mono- to pentasubstituted C1-C12alkenyl; R3 is C2-C12alkyl, mono- to pentasubstituted C1-C12alkyl, unsubstituted or mono- to pentasubstituted C1-C6alkoxy-C1-C6alkyl, unsubstituted or mono- to pentasubstituted C3-C12cycloalkyl, C2-C12alkenyl, C2-C12alkynyl; or R2 and R3 together are an alkylene or alkenylene bridge; with the proviso that R1 is not sec-butyl or isopropyl if R2 is H and R3 is 2-hydroxyethyl, isopropyl, n-octyl or benzyl; or, if appropriate, in E/Z isomer, an E/Z isomer mixture and/or a tautomer thereof; a process for preparing and using these compounds and their tautomers; pesticides whose active compound is selected from these compounds and their tautomers; and a process for preparing these compounds and compositions, and the use of these compounds and compositions.

Abstract: The present invention provides methods for attenuating gene expression in a cell using gene-targeted double stranded RNA (dsRNA). The dsRNA contains a nucleotide sequence that hybridizes under physiologic conditions of the cell to the nucleotide sequence of at least a portion of the gene to be inhibited (the “target” gene).

Abstract: The present invention provides optimized transfection reagents comprising mixtures of cationiclipoids. In particular, the present invention provides DNA delivery vehicles based on identifying the optimal hydrophobicity of novel cationic phospholipid derivatives that, alone or in combination, form complexes with DNA (lipoplexes) and exhibit enhanced transfection activity.

Abstract: RNA interference is provided for inhibition of tumor necrosis factor ? (TNF?) by silencing TNF? cell surface receptor TNF receptor-1 (TNFR1) mRNA expression, or by silencing TNF? converting enzyme (TACE/ADAM17) mRNA expression. Silencing such TNF? targets, in particular, is useful for treating patients having a TNF?-related condition or at risk of developing a TNF?-related condition such as the ocular conditions dry eye, allergic conjunctivitis, or ocular inflammation, or such as dermatitis, rhinitis, or asthma, for example.

Abstract: Antisense therapy which reduces the expression of TRPM-2 provides therapeutic benefits in the treatment of cancer. Seq ID No. 4 (cagcagcagagtcttcatcat) is an antisense oligonucleotide which inhibits expression of TRPM-2 by tumor cells, and which can be combined with a pharmaceutically acceptable carrier suitable for human administration.

Abstract: Nucleotide composition containing a vector and vaccine for immunization against hepatitis. Nucleotide vector comprising at least one gene or one complementary DNA coding for at least a portion of a virus, and a promoter providing for the expression of the gene in muscle cells. The gene may be the S gene of the hepatitis B virus. A nucleotide vector composition when administered to even chronic HBV carriers is capable of breaking T cell tolerance to the surface antigens of hepatitis B virus. A vaccine preparation containing bare DNA is injected into the host previously treated with a substance capable of inducing a coagulating necrosis of the muscle fibers.

Abstract: The present invention relates to Purine Derivatives; compositions comprising an effective amount of a Purine Derivative; and methods for reducing an animal's core body temperature, protecting an animal's heart against myocardial damage during cardioplegia; or for treating or preventing a cardiovascular disease, a neurological disorder, an ophthalmic condition, an ischemic condition, a reperfusion injury, obesity, a wasting disease, or diabetes, comprising administering an effective amount of a Purine Derivative to an animal in need thereof.

Abstract: An ophthalmic pharmaceutical composition comprising trehalose as an effective ingredient and a pharmaceutically-acceptable carrier. The pharmaceutical composition is a safe, long-term continuously-administrable, therapeutic and/or prophylactic agent for the ophthalmologic clinical symptoms and signs in Sjögren syndrome.

Abstract: The present invention have objects to provide an option of non-reducing saccharide by providing a novel non-reducing saccharide composed of glucose as constituents and to provide a novel enzyme forming the non-reducing saccharide, a method and process for producing the same, a DNA encoding the enzyme, a recombinant DNA and transformant comprising the DNA, a composition comprising the non-reducing saccharide, and uses thereof. The present invention solves the above objects by providing an isocyclomaltooligosaccharide(s) having a structure represented by General Formula 1, a novel isocyclomaltooligosaccharide-forming enzyme, a method and process for producing the same, a DNA encoding the enzyme, a recombinant DNA and transformant comprising the DNA, a composition comprising the isocyclomaltooligosaccharide(s) or a saccharide composition comprising the same, and uses thereof. Cyclo{?6)-[?-D-Glcp-(1?4)]n-?-D-Glcp-(1?}??General Formula 1 (In General Formula 1, “n” means a number of 4 or 5).

Abstract: The present invention relates to a biologically active functionalized electrospun matrix to permit immobilization and long-term delivery of biologically active agents. In particular the invention relates to a functionalized polymer matrix comprising a matrix polymer, a compatibilizing polymer and a biomolecule or other small functioning molecule. In certain aspects the electrospun polymer fibers comprise at least one biologically active molecule functionalized with low molecular weight heparin. Examples of active molecules that may be used with the multicomponent polymer of the invention include, for example, a drug, a biopolymer, for example a growth factor, a protein, a peptide, a nucleotide, a polysaccharide, a biological macromolecule or the like. The invention is further directed to the formation of functionalized crosslinked matrices, such as hydrogels, that include at least one functionalized compatibilizing polymer capable of assembly.

Abstract: A method of preventing or reducing the incidence of post-operative adhesions in or associated with a body cavity, which comprises introducing into the body cavity a composition containing an aqueous solution or suspension or gel formulation containing the polysaccharide dextrin.

Abstract: The present invention provides an improved methodology by which therapeutically to overcome resistance to tetracycline in living cells including bacteria, parasites, fungi, and rickettsiae. The methodology employs a blocking agent such as C5 ester derivatives, or 6-deoxy 13-(substituted mercapto) derivatives of tetracycline, in combination with other tetracycline-type antibiotics as a synergistic combination of compositions to be administered simultaneously, sequentially or concurrently. In another embodiment, certain novel compositions are provided which may be administered alone against, for example, a sensitive or resistant strain of gram positive bacteria such as S. aureus and E. faecalis. The concomitantly administered compositions effectively overcome the tetracycline resistant mechanisms present such that the cell is effectively converted from a tetracycline-resistant state to a tetracycline-sensitive state.

Abstract: A method of contraception in mammalian females, which method comprises the oral administration of an estrogenic component and a progestogenic component to a female of childbearing capability in an amount effective to inhibit ovulation, wherein the estrogenic component is selected from the group consisting of substances represented by the following formula (1) in which R1, R2, R3, R4 independently are a hydrogen atom, a hydroxyl group or an alkoxy group with 1-5 carbon atoms; each of R5, R6, R7 is a hydroxyl group; and no more than 3 of R1, R2, R3, R4 are hydrogen atoms; precursors capable of liberating a substance according to the aforementioned formula when used in the present method; and mixtures of one or more of the aforementioned substances and/or precursors. Another aspect of the invention concerns a pharmaceutical kit comprising oral dosage units that contain the aforementioned estrogenic component and/or a progestogenic component.

Abstract: The invention concerns a pharmaceutical composition comprises trimegestone optionally associated with an oestrogen, characterized in that it comprises a buffer solution whereof the pH, when it is introduced in the composition, ranging essentially between 2 and 5.5. The invention also concerns the methods for making such a composition and the primary package containing them.

Abstract: The present invention encompasses compounds of Formula (I) or pharmaceutically acceptable salts or hydrates thereof, which are useful as selective glucocorticoid receptor ligands for treating a variety of autoimmune and inflammatory diseases or conditions. Pharmaceutical compositions and methods of use are also included.

Abstract: The invention relates to an aqueous solution containing at least one species selected from the group consisting of a 1:1 molar complex of TeO2 with a moiety of formula (A) and ammonium salts thereof: HO—X—OH (A); where X is an optionally substituted divalent saturated hydrocarbon group containing 2-8 carbon atoms in the chain connecting the two OH groups; and its use for stimulating cells to produce cytokines and for treating mammalian diseases and conditions responsive to increased production of cytokines. The complex may be used also for treating mammalian cancer which is not responsive to increased production of cytokines.

Abstract: There is provided a series of heterocyclic-containing macrocyclic acyl guanidines of Formula (I) or a stereoisomer; or a nontoxic pharmaceutically acceptable salt thereof, wherein R1, R2, R3, R4, R5, n and X as defined herein, their pharmaceutical compositions and methods of use. These novel compounds inhibit the processing of amyloid precursor protein (APP) by ?-secretase and, more specifically, inhibit the production of A?-peptide. The present disclosure is directed to compounds useful in the treatment of neurological disorders related to ?-amyloid production, such as Alzheimer's disease and other conditions affected by anti-amyloid activity.

Abstract: The invention relates to novel heterocyclic compounds of the formula in which all of the variables are as defined in the specification, in free form or in salt form, to their preparation, to their use as medicaments and to medicaments comprising them.

Abstract: The synthesis and biological activity of indoloazepines and acid amine salts thereof which are structurally related to naturally-occurring hymenialdisine is disclosed. Naturally-occurring hymenialdisine obtained from the sponge is a potent inhibitor of production of cytokines interleukin-2 (IL-2) and tumor necrosis factor-? (TNF-?). The chemically-synthesized indoloazepines of the invention also inhibit production of IL-2 and TNF-?. The indoloazepines are useful for treating inflammatory diseases, particularly diseases associated with kinases NF-?B or GSK-3? activation or NF-?B activated gene expression products. The indoloazepines are useful for the treatment of cancer by the inhibition of kinases CHK1 and CHK2.

Abstract: The invention concerns a novel histamine receptor antagonist and the use of an histamine receptor antagonist for the reduction of intracranial pressure (ICP), in particular for the prevention and treatment of elevated intracranial pressure and/or secondary ischaemida, in particular caused by brain injury, more in particular caused by traumatic (TBI) and non-traumatic brain injury. The novel compounds comprise compounds according to the general Formula (I) the pharmaceutically acceptable acid or base addition salts thereof, the stereochemically isomeric forms thereof and the N-oxide form thereof. In particular, the preferred compound is 3-[2-[4-(11,12-dihydro-6H-benzimidazo[2,1-b][3]benzazepin-6-yl)-2-(phenyl-methyl)-1-piperidinyl]ethyl]-2,10-dimethyl pyrimido[1,2-?]benzimidazol-4(10H)-one, the pharmaceutically acceptable acid or base addition salts thereof, the stereochemically isomeric forms thereof and the N-oxide form thereof.

Abstract: Compounds of Formula (I) and Formula (II) (where variables R1, R2, R4, A, B, W, X, Y and Z are as defined herein) useful as antagonists of CGRP receptors and useful in the treatment or prevention of diseases in which the CGRP is involved, such as headache, migraine and cluster headache. The invention is also directed to pharmaceutical compositions comprising these compounds and the use of these compounds and compositions in the prevention or treatment of such diseases in which CGRP is involved.

Abstract: The present invention relates to a pharmaceutical composition which contains a compound of formula in which R1, R2, R3 and R4 are each n-butyl, where XP? is a counteranion and P is 1, 2 or 3, together with a pharmaceutically acceptable carrier, excipient or adjuvant.

Abstract: The invention relates to compounds of the formula I, wherein R1, R2, R3, R4, R5, R6, R7, A and B are as defined herein, the pharmaceutical compositions and the uses as pharmaceuticals.