Gold Or Platinum Patents (Class 424/649)
-
Publication number: 20130064901Abstract: The invention relates to methods for diagnosis and prognosis of gastric cancer. The approach described herein can distinguish intestinal-type gastric cancer (G-INT) from diffuse-type gastric cancer (G-DIF). The genomic expression signatures of G-INT and G-DIF define two major sets of genes. A diagnosis of gastric cancer G-INT and G-DIF can be made on the basis of the expression levels of these genes. This can lead to a better prognosis and treatment of gastric cancer.Type: ApplicationFiled: April 18, 2012Publication date: March 14, 2013Applicant: Agency for Science, Technology and ResearchInventors: Patrick Tan, Iain Tan
-
Publication number: 20130064880Abstract: N-hydroxy-4-{2-[3-(N,N-dimethylaminomethyl)benzofuran-2-ylcarbonylamino]ethoxy}-benzamide of formula (I): or an addition salt thereof with a pharmaceutically acceptable acid or base, alone or in association with surgery, chemotherapy or hormone therapy treatment or radiotherapy, for use in the treatment of cancer, characterised in that it is administered for 4 consecutive days, that period being followed by 3 consecutive days without any administration of compound of formula (I), with the proviso that the chemotherapy is not FOLFOX.Type: ApplicationFiled: September 6, 2012Publication date: March 14, 2013Applicants: LES LABORATOIRES SERVIERInventors: Ioana Kloos, Renata Robert, Anne Jacquet-Bescond, Stéphane Depil, Marylore Chenel, Sylvain Fouliard, Sriram Balasubramanian
-
Publication number: 20130058987Abstract: A method for the preparation of enhanced fluorescent folic acid mesoporous material, multifluorescent mesoporous materials, their novel properties and applications such as: a mesoporous fluorescent composition suitable for printing identification marks on metals, glass, plastic, ceramics, or paper which are visible only when excited by an external radiation; and applications in life science applications such as diagnostic, biodistribution markers, and targeted drug delivery applications.Type: ApplicationFiled: March 16, 2011Publication date: March 7, 2013Applicant: Nanologica ABInventors: Alfonso E. Garcia-Bennett, Chunfang Zhou
-
Publication number: 20130059015Abstract: Disclosed are identified and successfully targeted microRNAs (miRNAs) associated with human cancer cell line response to a range of anti-cancer agents. The strategy of integrating in vitro miRNA expression and drug sensitivity data not only aid in the characterization of determinants of cytotoxic response, but also in the identification of novel therapeutic targets.Type: ApplicationFiled: March 11, 2011Publication date: March 7, 2013Applicant: H. LEE MOFFITT CANCER CENTER & RESEARCH INSTITUTEInventors: Johnathan Mark Lancaster, Yin Xiong, Ning Chen
-
Publication number: 20130052270Abstract: Disclosed herein is the novel use of a gold nanocluser for ameliorating oxidative stress and/or aging of a cultured cell or a subject having an oxidative stress and/or aging condition mediated by a vascular factor. The gold nanocluster has a particle size ranging from about 0.1 to 20 nm, and preferably is dihydrolipoic acid (DHLA) coated gold nanocluster.Type: ApplicationFiled: August 26, 2011Publication date: February 28, 2013Applicants: CHUNG YUAN CHRISTIAN UNIVERSITY, MACKAY MEMORIAL HOSPITALInventors: Hung-I Yeh, Walter H. Chang, Cheng-An Lin, Hsueh-Hsiao Wang
-
Publication number: 20130045162Abstract: Methods for prevention, treatment or inhibition of the growth or metastasis of cancer cells in a subject are disclosed. One method comprises the step of administering to the subject a therapeutically effective amount of tumor associated antigen binding ligand-coated planetary ball milled (PBM) nanoparticles containing a cytotoxic agent.Type: ApplicationFiled: August 8, 2012Publication date: February 21, 2013Applicant: MOREHOUSE SCHOOL OF MEDICINEInventors: James W. Lillard, JR., Shailesh Singh, Rajesh Singh
-
Publication number: 20130045203Abstract: This disclosure relates to methods of treating or preventing cancer comprising administering a pharmaceutical composition comprising noscapine or noscapine derivatives to a subject diagnosed with a mutated adenomatous polyposis coli (APC) gene.Type: ApplicationFiled: February 25, 2011Publication date: February 21, 2013Applicant: EMORY UNIVERSITYInventors: Harish C. Joshi, Vincent Yang
-
Publication number: 20130045286Abstract: Compounds of Formula I are useful for inhibition of CHK1 and/or CHK2. Methods of using compounds of Formula I and stereoisomers and pharmaceutically acceptable salts thereof, for in vitro, in situ, and in vivo diagnosis, prevention or treatment of such disorders in mammalian cells, or associated pathological conditions are disclosed.Type: ApplicationFiled: March 20, 2012Publication date: February 21, 2013Applicant: ARRAY BIOPHARMA INC.Inventors: Yvan Le Huerou, James F. Blake, Indrani W. Gunwardana, Pete Mohr, Eli M. Wallace, Bin Wang, Mark Joseph Chicarelli, Michael Lyon
-
Publication number: 20130039953Abstract: A method for treating a surface with a therapeutic agent is disclosed. The method comprises precipitating a therapeutic agent from a hydrophilic polymeric base layer with which the therapeutic agent has been complexed, to form a layer comprising microparticles of the therapeutic agent on the hydrophilic polymeric base layer, the hydrophilic polymeric base layer being grafted to the surface. Devices comprising a surface having a hydrophilic polymeric base layer comprising a hydrophilic polymer grafted to the surface and a layer comprising microparticles of a therapeutic agent disposed on and complexed with the hydrophilic polymeric base layer are also disclosed.Type: ApplicationFiled: July 6, 2012Publication date: February 14, 2013Applicant: Covalon TechnologiesInventors: Vyacheslav Dudnyk, Valerio DiTizio
-
Publication number: 20130039971Abstract: Disclosed herein are siRNA compositions and methods useful for inhibiting expression of vascular endothelial growth factor (VEGF) isoforms. Diseases which involve angiogenesis stimulated by overexpression of VEGF, such as diabetic retinopathy, age related macular degeneration and many types of cancer, can be treated by administering small interfering RNAs as disclosed.Type: ApplicationFiled: July 23, 2012Publication date: February 14, 2013Applicant: OPKO OPHTHALMICS, LLCInventor: Nadine Dejneka
-
Publication number: 20130039996Abstract: An improved method for treating gastric cancer, ovarian cancer, non-small cell lung cancer, or colorectal cancer in a patient is described, as well as pharmaceutical compositions useful for the method and a process for preparing said compositions.Type: ApplicationFiled: October 18, 2012Publication date: February 14, 2013Applicant: ELI LILLY AND COMPANYInventor: ELI LILLY AND COMPANY
-
Publication number: 20130039904Abstract: The present invention discloses a gamboge acid cyclization analogs, their preparation methods and applications by semi-synthesis with the following structural formula I-III: Where ring A, ring B or/and ring C is 4-10 membered saturated or/and unsaturated aliphatic ring aliphatic heterocycle or aryl heterocycle. R1, R2, R3, R4, R5, R6, R7, R8, R9, R10, R11 or/and R12 is, independently at each occurrence, optionally substituted substituent of glycosyl, multi-hydroxyl, amino acid, acyloxy, phosphoric acid oxy, sulfonyloxy, alkoxy, aryloxy, heterocyclic oxy, thiol, aliphatic or cyclic group containing oxygen, sulfur, nitrogen or phosphorus, one of the substituents or combinations thereof. The present invention has antitumor activity management, antiviral, antibacterial and antifungal activity management, as anti-tumor, anti-viral, immune, antibacterial and antifungal agents, with other known anti-tumor, anti-viral, immune, together with the application of antibacterial and antifungal.Type: ApplicationFiled: August 2, 2010Publication date: February 14, 2013Applicant: Liaoning Lifeng Scientific & Technology Development Company Ltd.Inventor: Lifeng Xu
-
Publication number: 20130034616Abstract: The present invention relates to pyrrolopyrazines compounds useful as inhibitors of ATR protein kinase. The invention also relates to pharmaceutically acceptable compositions comprising the compounds of this invention; methods of treating of various diseases, disorders, and conditions using the compounds of this invention; processes for preparing the compounds of this invention; intermediates for the preparation of the compounds of this invention; and methods of using the compounds in in vitro applications, such as the study of kinases in biological and pathological phenomena; the study of intracellular signal transduction pathways mediated by such kinases; and the comparative evaluation of new kinase inhibitors. The compounds of this invention have formula I: wherein the variables are as defined herein.Type: ApplicationFiled: June 22, 2012Publication date: February 7, 2013Applicant: VERTEX PHARMACEUTICALS INCORPORATEDInventors: Pierre-Henri Storck, Jean-Damien Charrier, Alistair Rutherford, Michael Paul Mortimore, Somhairle MacCormick, Ronald Marcellus Alphonsus Knegtel, Steven John Durrant
-
Publication number: 20130034598Abstract: The subject invention concerns materials and methods for inhibiting the Akt/PKB pathway. In one embodiment, a compound of the invention inhibits kinase activity and/or phosphorylation levels of Akt proteins. The subject invention also concerns methods for inhibiting or killing a cancer cell or other cell in which expression of an Akt protein is elevated or constitutively active, comprising contacting the cell with an effective amount of a compound of formula I. The subject invention also concerns methods for treating cancer or a tumor in a person or animal comprising administering an effective amount of a compound of formula I to the person or animal.Type: ApplicationFiled: May 21, 2012Publication date: February 7, 2013Inventors: Jin Q. Cheng, Mei Sun, Said M. Sebti
-
Patent number: 8367644Abstract: The present invention provides a method for treating cancer in a mammal comprising contacting the cancer cells with a compound which is a apogossypol, derivative.Type: GrantFiled: October 7, 2010Date of Patent: February 5, 2013Assignee: The Burnham InstituteInventors: John C. Reed, Maurizio Pellecchia
-
Publication number: 20130028989Abstract: Targeting uncontrolled cell proliferation and resistance to DNA damaging chemotherapeutics with at least one reagent has significant potential in cancer treatment. Replication Protein A, the eukaryotic single-strand (ss) DNA binding protein, is essential for genomic maintenance and stability via roles in both DNA replication and repair. Reported herein are small molecules that inhibits the in vitro, in vivo, and cellular ssDNA binding activity of RPA, thereby disrupting the eukaryotic cell cycle, inducing cytotoxicity and increasing the efficacy of chemotherapeutic agents damage DNA, and/or disrupt its replication and/or function. These results provide new insights into the mechanism of RPA-ssDNA interactions in chromosome maintenance and stability. This represents a molecularly targeted eukaryotic DNA binding inhibitor and demonstrates the utility of targeting a protein-DNA interaction as a means of studying the cell cycle and providing a therapeutic strategy for cancer treatment.Type: ApplicationFiled: February 5, 2011Publication date: January 31, 2013Applicant: INDIANA UNIVERSITY RESEARCH AND TECHNOLOGY CORPORATIONInventors: John J. Turchi, Sarah Shuck
-
Publication number: 20130022689Abstract: Amisulpride is used in the therapy of nausea, vomiting or retches. The therapy may utilize a novel injectable formulation, in unit dosage form, comprising less than 50 mg amisulpride.Type: ApplicationFiled: July 26, 2012Publication date: January 24, 2013Inventors: Julian Clive Gilbert, Robert William Gristwood, Nicola Cooper, Gabriel Fox
-
Publication number: 20130022688Abstract: Amisulpride is used in the therapy of nausea, vomiting or retches. The therapy may utilize a novel injectable formulation, in unit dosage form, comprising less than 50 mg amisulpride.Type: ApplicationFiled: July 26, 2012Publication date: January 24, 2013Inventors: Julian Clive GILBERT, Rober William GRISTWOOD, Nicola COOPER, Gabriel FOX
-
Publication number: 20130017272Abstract: A method of treating a human patient afflicted with lung cancer comprising periodically administering to the human patient chemotherapy comprising an amount of a taxane and 640 mg of an anti-clusterin oligonucleotide having the sequence CAGCAGCAGAGTCTTCATCAT (Seq. ID No.: 1), wherein the anti-clusterin oligonucleotide has a phosphorothioate backbone throughout, has sugar moieties of nucleotides 1-4 and 18-21 bearing 2?-O-methoxyethyl modifications, has nucleotides 5-17 which are 2? deoxynucleotides, and has 5-methylcytosines at nucleotides 1, 4, and 19, thereby treating the human patient afflicted with cell lung cancer.Type: ApplicationFiled: May 18, 2012Publication date: January 17, 2013Inventors: Chen DUKSIN, Shoshi Tessler
-
Publication number: 20130017196Abstract: The present invention relates to new substituted imidazole compounds and pharmaceutically acceptable salts, esters or prodrugs thereof, compositions of the new compounds together with pharmaceutically acceptable carriers, and uses of the new compounds.Type: ApplicationFiled: September 13, 2012Publication date: January 17, 2013Inventors: Weibo Wang, Paul A. Barsanti, Yia Xia, Rustum Boyce, Sabina Pecchi, Nathan Brammeier, Megan C. Phillips, Kris Mendenhall, Kelly Wayman, Liana Marie Lagnition, Ryan Constantine, Hong Yang, Elizabeth Mieuli, Savithri Ramurthy, Elisa Jazan, Anu Sharma, Rama Jain, Sharadha Subramanian, Paul A. Renhowe, Kenneth W. Bair, David Duhl, Annette Walter, Tinya Abrams, Kay Huh, Eric Martin, Mark Knapp, Vincent P. Le
-
Publication number: 20130017273Abstract: The present invention relates to pyrrolopyrazines compounds useful as inhibitors of ATR protein kinase. The invention also relates to pharmaceutically acceptable compositions comprising the compounds of this invention; methods of treating of various diseases, disorders, and conditions using the compounds of this invention; processes for preparing the compounds of this invention; intermediates for the preparation of the compounds of this invention; and methods of using the compounds in in vitro applications, such as the study of kinases in biological and pathological phenomena; the study of intracellular signal transduction pathways mediated by such kinases; and the comparative evaluation of new kinase inhibitors. The compounds of this invention have formula I: wherein the variables are as defined herein.Type: ApplicationFiled: June 22, 2012Publication date: January 17, 2013Applicant: VERTEX PHARMACEUTICALS INCORPORATEDInventors: Simon Everitt, Michael Paul Mortimore, Jean-Damien Charrier, Somhairle MacCormick, Pierre-Henri Storck, Ronald Knegtel, Joanne Pinder, Steven John Durrant
-
Publication number: 20130011445Abstract: Described herein are polymer-agent conjugates and particles, which can be used, for example, in the treatment of cancer. Also described herein are mixtures, compositions and dosage forms containing the particles, methods of using the particles (e.g., to treat a disorder), kits including the polymer-agent conjugates and particles, methods of making the polymer-agent conjugates and particles, methods of storing the particles and methods of analyzing the particles.Type: ApplicationFiled: July 12, 2012Publication date: January 10, 2013Inventors: Thomas C. Crawford, Scott Eliasof, Geeti Gangal, Pei-Sze Ng, Lawrence Alan Reiter
-
Publication number: 20130011466Abstract: The present invention provides a method of producing a liposome encapsulating an ammine platinum complex. The method includes A) providing a water-soluble ammine platinum complex, platinum complex raw materials or the combination thereof; B) providing a liposome, liposome raw materials or the combination; and C) preparing a mixture of the water-soluble ammine platinum complex, platinum complex raw materials or the combination thereof and the liposome, liposome raw materials or the combination thereof and subjecting it to a liposome-forming/maintaining condition, wherein the salt of the platinum complex forms when the liposome is in a water-soluble form.Type: ApplicationFiled: September 4, 2012Publication date: January 10, 2013Applicant: KATAYAMA CHEMICAL INDUSTRIES CO., LTD.Inventors: Masahiko Hirai, Koichi Igarashi, Masahiko Chikuma, Kazunori Oie
-
Publication number: 20130011365Abstract: The present invention relates to tetraaza phenalen-3-one compounds which inhibit poly (ADP-ribose) polymerase (PARP) and are useful in the chemosensitization of cancer therapeutics. The induction of peripheral neuropathy is a common side-effect of many of the conventional and newer chemotherapies. The present invention further provides means to reliably prevent or cure chemotherapy-induced neuropathy. The invention also relates to the use of the disclosed PARP inhibitor compounds in enhancing the efficacy of chemotherapeutic agents such as temozolomide. The invention also relates to the use of the disclosed PARP inhibitor compounds to radio sensitize tumor cells to ionizing radiation. The invention also relates to the use of the disclosed PARP inhibitor compounds for treatment of cancers with DNA repair defects.Type: ApplicationFiled: June 19, 2012Publication date: January 10, 2013Applicant: EISAI INC.Inventors: Weizheng XU, Greg Delahanty, Ling Wei, Jie Zhang
-
Publication number: 20130011392Abstract: The invention relates to an in vitro method for determining the ability of a patient with cancer to respond to a monochemotherapy or to a polychemotherapy involving the administration of at least one chemotherapeutic agent the liver elimination of which involves cytidine deaminase (CDA), or to be treated by at least one such chemotherapeutic agent, which method comprises determining the CDA activity in a biological sample of the patient, wherein a CDA activity above 6 U/mg of serum sample total protein is indicative of the inability of the patient to respond to the chemotherapy, a CDA activity between 1.1 U/mg and 6 U/mg of serum sample total protein is indicative of the ability of the patient to be treated by the chemotherapeutic agent when said agent is administered in the context of a monochemotherapy, and a CDA activity between 1.Type: ApplicationFiled: November 19, 2010Publication date: January 10, 2013Applicants: Assistance Publique Hopitaux De Marseille, Universite D'Aix MarseilleInventors: Joseph Ciccolini, Cédric Mercier, Jean-François Seitz, Laetitia Dahan, Athanassios Iliadis, L'Houcine Ouafik
-
Publication number: 20130011496Abstract: A cancer testis antigen biomarker useful to determine whether a non- small cell lung cancer tumor is likely to respond to neoadjuvant chemotherapy is provided. Methods of using the biomarker in the diagnosis, treatment and prognosis of non-small cell lung cancer also are provided.Type: ApplicationFiled: November 23, 2010Publication date: January 10, 2013Applicant: Ludwig Institute for Cancer Research Ltd.Inventors: Jonathan S. Cebon, Arun Azad, Sid Deb
-
Publication number: 20130011497Abstract: A method for the treatment of a proliferative disease comprising providing a E2F-1 protein which is arginine-methylation defective or administering a substance which reduces the expression and/or activity of PRMT5. The invention also provides antibodies, screening methods and kits.Type: ApplicationFiled: December 20, 2010Publication date: January 10, 2013Inventor: Nicholas Lathangue
-
Publication number: 20130011467Abstract: This invention is directed to methods of treating solid tumor cancers, particularly refractory cancers by administration of two pluralities of microparticles, one comprising drug-carrying microparticles sized to lodge at the tumor preferably in the capillary bed of the tumor and the other comprising non-drug-carrying microparticles sized to lodge in the arterial system servicing the tumor so as to embolize the tumor.Type: ApplicationFiled: September 14, 2012Publication date: January 10, 2013Applicant: Abbott Cardiovascular Systems Inc.Inventors: Liangxuan Zhang, Florencia Lim
-
Patent number: 8349067Abstract: A pearlescent pigment, wherein the pigment is an inorganic material and the color of a homogeneous coating of the pigment, measured over a white background, is selected from the group consisting of: a CIELAB L* value of about 30 or less and a chroma value of about 3 or less; a CIELAB hue angle, hab, from about 50 to about 80 degrees, wherein L* is not more than about 85, and the chroma value is greater than 22; a CIELAB hue angle, hab, from about 80 to about 275 degrees, wherein L* is not more than about 80, and the chroma value is greater than about 10; and a CIELAB hue angle, hab, from not less than about 275 to not more than about 50 degrees, wherein L* is not more than about 85, and the chroma value is greater than about 9. The pigments may be used in a variety of applications including cosmetics, plastics, automotive, or architectural coatings.Type: GrantFiled: October 31, 2007Date of Patent: January 8, 2013Assignee: Sun Chemical Corp.Inventors: Aaron M. Hollman, Stephane Nicolas, Philippe Schottland, Marguerite Debacker, Aurelie Antonowicz, Hai Hui Lin
-
Publication number: 20130004482Abstract: The application describes methods for screening subjects with breast cancer to determine if the breast cancer will be responsive to a breast cancer therapy including an anthracycline. The application also describes methods for treating subjects with breast cancer by screening them for the likelihood of the effectiveness of treating the cancer with a therapy including anthracycline and administering the therapy in subjects when it is found that anthracycline is likely to be effective.Type: ApplicationFiled: March 15, 2012Publication date: January 3, 2013Applicants: The University of North Carolina at Chapel Hill, British Columbia Cancer Agency Branch, University of Utah Research Foundation, Washington UniversityInventors: Charles M. Perou, Matthew J. Ellis, Philip S. Bernard, Torsten O. Nielsen
-
Publication number: 20130004592Abstract: The invention comprises various aqueous PEG-carbohydrate-lipid based formulations of pharmaceutical active ingredients including compositions for intravenous injections. This invention relates to methods and compositions for improving solubility and the safety profile of pharmaceutical compounds. More particularly, the present invention relates to employing PEG-carbohydrate-lipid conjugates for formulating drug compositions having increased solubility or dispersivity and enhanced stability.Type: ApplicationFiled: June 25, 2012Publication date: January 3, 2013Inventor: Nian Wu
-
Publication number: 20130004481Abstract: The invention describes anti-cancer therapies comprising using dual Aurora kinase/MEK inhibitors as described herein.Type: ApplicationFiled: January 5, 2012Publication date: January 3, 2013Applicant: BOEHRINGER INGELHEIM INTERNATIONAL GMBHInventors: Flavio Solca, Ulrich Guertler, Michael Sanderson, Ulrike Tontsch-Grunt, Irene Waizenegger
-
Publication number: 20130004488Abstract: There is provided a conjugate of a delivery agent containing a chemical moiety and at least one flavonoid. The flavonoid exists in a monomeric form or dimeric form before conjugation and remains in the monomeric form or dimeric form after conjugation. Preferably, the conjugate comprises two flavonoids. The delivery agent is conjugated at the C6 and/or the C8 position of the A ring of the flavonoid. An anti-cancer agent delivery vehicle comprising an anti-cancer agent and the conjugate is also provided.Type: ApplicationFiled: March 11, 2011Publication date: January 3, 2013Applicant: AGENCY FOR SCIENCE, TECHNOLOGY AND RESEARCHInventors: Motoichi Kurisawa, Kun Liang, Susi Tan, Joo Eun Chung, Jackie Y. Ying
-
Publication number: 20120328610Abstract: The present invention relates to triazolopyridine compounds of general formula (I) which are Monopolar Spindle 1 kinase (Mps-1 or TTK) inhibitors: Formula (I), in which R1, R2, R3, R4, and R5 are as given in the description and in the claims, to methods of preparing said compounds, to pharmaceutical compositions and combinations comprising said compounds, to the use of said compounds for manufacturing a pharmaceutical composition for the treatment or prophylaxis proliferative of diseases, as well as to intermediate compounds useful in the preparation of said compounds.Type: ApplicationFiled: November 17, 2010Publication date: December 27, 2012Applicant: BAYER INTELLECTUAL PROPERTY GMBHInventors: Volker Schulze, Marcus Koppitz, Dirk Kosemund, Hartmut Schirok, Benjamin Bader, Philip Lienau, Antje Margret Wengner, Hans Briem, Simon Holton, Gerhard Siemeister, Stefan Prechtl, Ulf Bömer
-
Publication number: 20120328714Abstract: This document provides methods and materials involved in the early detection of lung cancer (e.g., small cell lung cancer). For example, this document provides methods and materials for assessing nucleic acid obtained from a blood sample of a human for a CpG methylation site profile that, at least in part, indicates that the human has lung cancer (e.g., small cell lung cancer).Type: ApplicationFiled: May 18, 2012Publication date: December 27, 2012Inventors: Ping Yang, Liang Wang
-
Publication number: 20120328691Abstract: The present invention relates to novel Anilinopiperazine Derivatives of Formula (I), compositions comprising the Anilinopiperazine Derivatives, and methods for using the Anilinopiperazine Derivatives for treating or preventing a proliferative disorder, cancer, an anti-proliferative disorder, inflammation, arthritis, a central nervous system disorder, a cardiovascular disease, alopecia, a neuronal disease, an ischemic injury, a viral disease, a fungal infection, or a disorder related to the activity of a protein kinase.Type: ApplicationFiled: October 29, 2007Publication date: December 27, 2012Inventors: Gerald W. Shipps, JR., Cliff C. Cheng, Xiaohua Huang, Thierry O. Fischmann, Jose S. Duca, Matthew Richards, Hongbo Zeng, Binyuan Sun, Panduranga Adulla Reddy, Tzu T. Wong, Praveen K. Tadikonda, M. Arshad Siddiqui, Marc A. Labroli, Cory Poker, Timothy J. Guzi
-
Publication number: 20120328611Abstract: The present invention relates to triazolopyridine compounds of general formula (I) which are Monopolar Spindle 1 kinase (Mps-1 or TTK) inhibitors: Formula (I), in which R1, R2, R3, R4, and R5 are as given in the description and in the claims, to methods of preparing said compounds, to pharmaceutical compositions and combinations comprising said compounds, to the use of said compounds for manufacturing a pharmaceutical composition for the treatment or prophylaxis proliferative of diseases, as well as to intermediate compounds useful in the preparation of said compounds.Type: ApplicationFiled: November 17, 2010Publication date: December 27, 2012Applicant: BAYER INTELLECTUAL PROPERTY GMBHInventors: Volker Schulze, Marcus Koppitz, Dirk Kosemund, Benjamin Bader, Philip Lienau, Hans Briem, Simon Holton, Gerhard Siemeister, Stefan Prechtl, Antje Margret Wengner
-
Publication number: 20120321552Abstract: Screening and diagnostic reagents, kits and methods for primary and/or metastatic stomach or esophageal cancer are disclosed. Compositions for and methods of imaging and treating primary and/or metastatic stomach or esophageal cancer are disclosed. Vaccines compositions and methods of for treating and preventing primary and/or metastatic stomach or esophageal cancer are disclosed.Type: ApplicationFiled: October 20, 2011Publication date: December 20, 2012Applicant: THOMAS JEFFERSON UNIVERSITYInventors: Scott A. Waldman, Jason Park, Stephanie Schulz
-
Publication number: 20120321554Abstract: The present invention relates to plexin D1 for use as a targetable protein in the treatment or diagnosis of disorders that involve expression of plexin D1. Diagnosis is suitably effected by detecting the presence of plexin D1 in the body or a bodily tissue or fluid, whereas treatment is effected by targeting plexin D1 for delivery of therapeutics to the site where treatment is needed. The invention further relates to the use of molecules that bind plexin D1, a nucleic acid encoding plexine D1 or a ligand of plexin D1 for the preparation of a therapeutical composition for the treatment or diagnosis of disorders that involve expression of plexin D1. The disorders comprise disorders in which plexin D1 is expressed on tumor cells, tumor blood vessels or activated macrophages.Type: ApplicationFiled: July 3, 2012Publication date: December 20, 2012Inventors: Wilhelmus Petrus Johannes LEENDERS, Ilse Roodink, Jozef Maria Hendrik Raats
-
Publication number: 20120321622Abstract: The present invention relates to novel thiazole-substituted indolin-2-ones as inhibitors of CSCPK and related kinases; to methods of inhibiting cancer stem cells by using a kinase inhibitor; to pharmaceutical compositions containing such compounds; and to methods of using such compounds in the treatment of a protein kinase related disorder in a mammal; and to processes of making such compounds and intermediates thereof.Type: ApplicationFiled: August 27, 2012Publication date: December 20, 2012Applicant: Boston Biomedical, Inc.Inventors: Chiang Jia Li, Ji-Feng Liu, Youzhi Li, Wei Li, Harry Rogoff
-
Publication number: 20120323163Abstract: The invention provides a method for treating target in need of such a treatments in a subject, comprising (a) administering a liposome containing a photosensitizer and a drug to a subject and (b) irradiating targets at least one time at appropriate time(s). In particular, the irradiation is performed at least two times.Type: ApplicationFiled: May 18, 2012Publication date: December 20, 2012Applicant: National Taiwan UniversityInventors: Chin-Tin Chen, Tsuimin Tsai
-
Publication number: 20120321591Abstract: The present invention provides various uses of VEGF binding peptides, including methods to treat disorders associated with abnormal angiogenesis.Type: ApplicationFiled: August 27, 2012Publication date: December 20, 2012Inventors: Venkata Ramana Doppalapudi, Jing-Yu Lai, Bin Liu, Dingguo Liu, Joel Desharnais, Abhijit Suresh Bhat, Yanwen Fu, Bryan Douglas Oates, Gang Chen, Curt William Bradshaw
-
Publication number: 20120315320Abstract: Disclosed are methods of increasing the chemosensitivity of normal and/or chemoresistant tumor or cancer cells using thyroid hormone analogs and/or nanoparticulate or polymeric forms thereof. Also disclosed are methods of increasing radiosensitivity of normal and/or radioresistant tumor or cancer cells using thyroid hormone analogs and/or nanoparticulate or polymeric forms thereof.Type: ApplicationFiled: January 6, 2012Publication date: December 13, 2012Inventors: Paul J. Davis, Shaker A. Mousa
-
Publication number: 20120315324Abstract: An exosomal composition is provided that comprises a therapeutic agent encapsulated by an exosome. The therapeutic agent can be a phytochemical agent, a chemotherapeutic agent, or a Stat3 inhibitor. Pharmaceutical compositions comprising the exosomal compositions are also provided. Methods for treating an inflammatory disease or a cancer are further provided and include administering an effective amount of an exosomal composition to a subject in need thereof to thereby treat the inflammatory disorder or the cancer.Type: ApplicationFiled: February 4, 2011Publication date: December 13, 2012Applicant: UNIVERSITY OF LOUISVILLE RESEARCH FOUNDATION, INC.Inventor: Huang-Ge Zhang
-
Publication number: 20120308562Abstract: Methods are provided for treating mesothelioma patients with a dual PI3K/mTOR inhibitor, GDC-0980: (S)-1-(4-((2-(2-aminopyrimidin-5-yl)-7-methyl-4-morpholinothieno[3,2-d]pyrimidin-6-yl)methyl)piperazin-1-yl)-2-hydroxypropan-1-one, and having the structure:Type: ApplicationFiled: June 1, 2012Publication date: December 6, 2012Inventors: Mika K. Derynck, Jennifer O'Hara Lauchle
-
Publication number: 20120308645Abstract: RNA interference using small interfering RNAs which target HIF-1 alpha mRNA inhibit expression of the HIF-1 alpha gene. As HIF-1 alpha is a transcriptional regulator of VEGF, expression of VEGF is also inhibited. Control of VEGF production through siRNA-mediated down-regulation of HIF-1 alpha can be used to inhibit angiogenesis, in particularly in diseases such as diabetic retinopathy, age related macular degeneration and many types of cancer.Type: ApplicationFiled: July 23, 2012Publication date: December 6, 2012Applicant: THE TRUSTEES OF THE UNIVERSITY OF PENNSYLVANIAInventors: Samuel Jotham Reich, Enrico Maria Surace, Michael J. Tolentino
-
Publication number: 20120301393Abstract: The present invention refers to novel recombinant proteins obtained from modified ubiquitin capable of binding the extradomain B of fibronectin (ED-B). Furthermore, the invention refers to fusion proteins comprising said recombinant protein fused to a pharmaceutically and/or diagnostically active component.Type: ApplicationFiled: December 14, 2010Publication date: November 29, 2012Inventors: Arnd Steuernagel, Erik Fiedler, Markus Fiedler, Anja Kunert, Joerg Nerkamp, Thomas Goettler, Manja Gloser, Ilka Haenssgen
-
Publication number: 20120301431Abstract: The present invention provides methods of treating (including preventing) a disease or condition associated with abnormal angiogenesis in a subject include administering a therapeutically effective amount of an AA targeting compound of the invention to the subject. The AA targeting compounds comprise AA targeting agent-linker conjugates which are linked to a combining site of an antibody.Type: ApplicationFiled: August 13, 2012Publication date: November 29, 2012Inventors: Curt Bradshaw, Abhijit Bhat, Jing Yu Lai, Venkata Doppalapudi, Dingguo Liu
-
Publication number: 20120294956Abstract: The present invention relates to compositions and methods for reducing cell proliferation and/or promoting cell death by inhibiting Drp1. It is based, at least in part, on the discoveries that (i) Drp1 disruption-induced mitochondrial hyperfusion is functionally linked to the cell cycle regulation apparatus, so that Drp1 inhibition results in a disruption of the cell cycle and DNA aberrancies; (ii) inhibition of both Drp1 and ATR are synthetic lethal causing increased DNA damage and apoptotic cell death; and (iii) even in resistant cell lines, Drp1 inhibitor (e.g., mdivi-1) together with a second antiproliferative agent (e.g., cisplatin or carboplatin) act synergistically to promote apoptosis. Accordingly, the present invention provides for novel anticancer strategies.Type: ApplicationFiled: April 18, 2012Publication date: November 22, 2012Inventors: Wei Qian, Bennett Van Houten
-
Publication number: 20120294957Abstract: Disclosed are methods of treating lung cancer by administering to a human in need thereof effective amounts of FTS, or various analogs thereof, or a pharmaceutically acceptable salt thereof, optionally, in combination with a chemotherapeutic agent. Chemotherapeutic agents, and combinations thereof, for use with FTS, its analogs, or its salts are also disclosed.Type: ApplicationFiled: July 27, 2012Publication date: November 22, 2012Applicant: RAMOT AT TEL-AVIV UNIVERSITY LTD.Inventors: Yoel Kloog, Adi Zundelevich, Roni Haklai