Abstract: This invention relates to methods, kits and compositions suitable for the improved detection, analysis and quantitation of nucleic acid target sequences using probe based hybridization assays. The invention is more specifically directed to methods, kits and compositions suitable for suppressing the binding of detectable nucleic acid probes or detectable PNA probes to non-target nucleic acid sequences in an assay for a target nucleic acid sequence to thereby improve the reliability, sensitivity and specificity of the assay. The methods, kits and compositions of this invention are particularly well suited to the detection and analysis of nucleic acid point mutations.

Abstract: The invention provides methods and compositions for defining a cell type, generally involving the steps of (a) amplifying the mRNA of a single cell of a heterogenous population of cells; (b) probing a comprehensive expression library with the amplified mRNA to define a gross expression profile of the cell; and (c) comparing the gross expression profile of the cell with a gross expression profile of one or more other cells to define a unique expression profile of the cell, wherein the unique expression profile of the cell provides a marker defining the cell type.

Abstract: This invention comprises nucleic acid ligand for use as a diagnostic reagent for detecting the presence or absence of a target molecule in a sample, and a diagnostic reagent to measure the amount of a target molecule in a sample. In a preferred embodiment the nucleic acid ligands are identified by the method of the invention referred to as the Systematic Evolution of Ligands by EXponential enrichment (SELEX), wherein a candidate mixture of nucleic acids are iteratively enriched in high affinity nucleic acids and amplified by further partitioning.

Abstract: An amplification primer and probe which can be used in an in vitro diagnostic test for the presence of S. neurona in equine blood or cerebrospinal fluid. Sarcocystis neurona is responsible for the equine condition of protozoal myelitis. The amplification primer is seventeen nucleotides in length and complementary to a unique section of the small ribosomal subunit of Sarcocystis neurona. The primer encompasses nucleotide positions 1470-1487 of the small ribosomal subunit of S. neurona. The primer has the sequence 5' CCATTCCGGACGCGGGT SEQ ID NO:1.

Abstract: The invention features methods for detecting polymorphic restriction sites and single nucleotide polymorphisms in nucleic acid molecules and kits for carrying out these methods.

Abstract: A sample containing nucleotide sequences is characterized or "fingerprinted" by contacting it, or portions thereof, with of plurality of primer pairs; detecting nucleotide regions delineated by subsequences hydridized with each primer pair; determining a physical characteristic of each such detected region; and indexing such physical characteristics as a function of the primer pair that hydridized to the delineating subsequences of the corresponding region. An apparatus for fingerprinting a sample containing nucleotide sequences includes functionality for carrying out such a process.

Abstract: The present invention provides oligonucleotides that can be used as primers to amplify a region of the 16S rRNA of M. pneumoniae. Also provided are probes and kits for detection of amplified RNA and typing of M. pneumoniae strains. The primers, probes, methods and kits are useful for diagnosing M. pneumoniae.

Abstract: A method for synthesizing a nucleic acid molecule comprising at least one non-canonical nucleoside triphosphate using a mutant polymerase having a reduced discrimination between canonical and non-canonical substrates is disclosed. The method comprises incubating a template nucleic acid in a reaction mixture comprising the mutant nucleic acid polymerase and the appropriate canonical and non-canonical nucleoside triphosphates which are desired substrates for the mutant nucleic acid polymerase. The present invention is also a method of determining the sequence of a nucleic acid molecule using the mutant polymerase to create a nucleic acid molecule comprising at least one non-canonical nucleoside triphosphate.

Abstract: A sequence of the FMR-1 gene is disclosed. This sequence and related probes, cosmids and unique repeats are used to detect X-linked diseases and especially the fragile X syndrome.

Abstract: A method is described for the direct, exponential amplification and sequencing ("DEXAS") of a DNA molecule from a complex mixture of nucleic acids, wherein truncated DNA molecules as well as DNA molecules of full length are synthesized simultaneously and exponentially between two positions on the said DNA molecule, which initially contains a DNA molecule in a thermocycling reaction, a first primer, a second primer, a reaction buffer, a thermostable DNA polymerase, a thermostable pyrophosphatase (optionally), deoxynucleotides or derivatives thereof and a dideoxynucleotide or derivatives thereof.

Abstract: This invention relates to the identification of restriction fragment length polymorphisms (RFLP) of the human pancreatic cholesterol esterase gene. Specifically, the invention relates to the use of RFLP analysis for identifying individuals with a particular genetic variant of the human pancreatic cholesterol esterase gene. The invention also relates to treatment of individuals with therapeutic drugs for the prevention or alleviation of disease states in a human related to cholesterol metabolism.

Abstract: The invention relates to isolated nucleic acid sequences encoding PRAD1, and fragments thereof. The invention further relates to transgenic mice bearing a transgene which includes a nucleic acid sequence encoding PRAD 1 under transcriptional control of a heterologous promoter, and cells or cell lines derived from such an mice.

Abstract: A method for determining if a pig is predisposed to boar taint comprising assaying for a low molecular weight isoform of cytochrome b5 in a sample from the pig.

Abstract: The hop mosaic virus (HMV) gene has been isolated and purified, and the base sequence thereof elucidated. HMV can be detected by simple and accurate methods using nucleic sequences from the isolated HMV gene. These methods are especially useful for detecting HMV infection in plants. Using the methods provided by the present invention, it is possible to detect HMV more simply and accurately as compared to the conventional immunological methods, such as ELISA.

Abstract: A method of isolating genomic or RNA-derived duplex fragments which are unique to one of two fragment mixtures. The fragments in positive-source and negative-source mixtures are separately equipped with end linkers, and each mixture is amplified by successive primed-strand replications, using a single primer which is homologous to the associated linker. The second-source linker is biotinylated, and the fragments in this mixture are hybridized in molar excess with the fragments in the positive-source mixture. DNA species which are not hybridized with the biotinylated species, i.e., species that are unique to the positive-source mixture, are isolated after removal of hybridized species by affinity chromatography. Also disclosed is a method of amplifying a mixture of DNA fragments by repeated linker/primer replication.

Abstract: A testing apparatus is described that contains a test sample and one or more reagents, or reaction solutions associated with chemical reactions and a resilient, compressible, porous material, and which is amenable to subsequent process or reaction steps or liquid transfer steps. A piece of sponge or foam rubber, which is compatible with the amplification reactions and amplification products, is introduced into the reaction vessel and absorbs the test sample and reagents, or reaction solutions associated with an amplification process, or amplification products thus, reducing their loss through aerosolation.

Abstract: A gene (cDNA) encoding a bovine myostatin protein. The nucleic acid coding sequence is identified as SEQ ID NO:1 and the protein sequence is identified as SEQ ID NO:2. A mutant gene (SEQ ID NO:3) in which the coding sequence lacks an 11-base pair consecutive sequence (SEQ ID NO:11) of the sequence encoding bovine protein having myostatin activity has been sequenced. It has been shown that cattle of the Belgian Blue breed homozygous for the mutant gene lacking myostatin activity are double-muscled. A method for determining the presence of muscular hyperplasia in a mammal is described. The method includes obtaining a sample of material containing DNA from the mammal and ascertaining whether a sequence of the DNA encoding (a) a protein having biological activity of myostatin, is present, and whether a sequence of the DNA encoding (b) an allelic protein lacking the activity of (a), is present. The absence of (a) and the presence of (b) indicates the presence of muscular hyperplasia in the mammal.

Abstract: The human DNA polymerase .alpha. catalytic polypeptide has been functionally over-expressed by a recombinant baculovirus in insect cells at >1000 fold higher levels than that found in cultured normal human cells.

Abstract: Unimolecular and bimolecular hybridization probes for the detection of nucleic acid target sequences comprise a target complement sequence, an affinity pair holding the probe in a closed conformation in the absence of target sequence, and either a label pair that interacts when the probe is in the closed conformation or, for certain unimolecular probes, a non-interactive label. Hybridization of the target and target complement sequences shifts the probe to an open conformation. The shift is detectable due to reduced interaction of the label pair or by detecting a signal from a non-interactive label. Certain unimolecular probes can discriminate between target and non-target sequences differing by as little as one nucleotide. Also, universal stems and kits useful for constructing said probes. Also, assays utilizing said probes and kits for performing such assays.

Abstract: The invention provides a human phospholipase A2 protein PHPLA2 and polynucleotides which identify and encode PHPLA2. The invention also provides expression vectors, host cells, agonists, antibodies and antagonists. The invention also provides methods for treating disorders associated with expression of PHPLA2.

Abstract: Method for identifying novel secreted mammalian proteins in yeast are described. Reporter polypeptides which allow detection of signal sequences by growth selection are also described.

Abstract: A method for the rapid, high-sensitivity detection of bacteria in a malt beverage comprising liquid and solid components, wherein the method comprises the steps of:aseptically sampling said malt beverage;separating the solids in the sample from the liquid by means of a substrate having antibodies attached thereto;extracting DNA from the separated solids;subjecting the extracted DNA to a nested polymerase chain reaction, said reaction comprising:enzymatically amplifying at least one fragment of said extracted DNA using at least one highly conserved primer to produce a first amplified sample;enzymatically amplifying a product sequence from said first amplified sample, using a less highly conserved primer to produce a second amplified sample;examining said second amplified sample for the presence of DNA fragments associated with said bacteria.

Abstract: Methods of genotyping amplified mixtures of DNAs, nucleic acid markers and methods of obtaining markers, kits, recombinant plants, positional cloning and integrated systems for making genotypes and assessing hybridizations are provided. These features are applicable to DNA fingerprinting, marker assisted selection, genotyping, cladistic analysis of variance, and high throughput laboratory screening methods.

Abstract: Disclosed are methods for detecting mammalian genes encoding proteins which can function in microorganisms, particularly yeast, to modify, complement, or suppress a genetic defect associated with an identifiable phenotypic alteration or characteristic in the microorganism. Disclosed also are mammalian DNA sequences cloned by the above method, as well as polypeptide products of the expression of the DNA sequences in procaryotic or eucaryotic host cells and antibody substances which are specifically immunoreactive with said expression products. More specifically, the present invention relates to methods for cloning mammalian genes which encode products which modify, complement or suppress a genetic defect in a biochemical pathway in which cAMP participates or in a biochemical pathway which is controlled, directly or indirectly, by a RAS-related protein, to products (RNA, proteins) encoded by the mammalian genes cloned in this manner, and to antibodies which can bind the encoded proteins.

Abstract: The present invention provides a novel, single-stranded DNA probe which comprises an anti-target segment, a strand of a promoter, and a reporter segment, arranged so that a target segment, which has a 3'-hydroxyl at its terminus, can prime DNA polymerase-catalyzed extension of the target segment along the probe as template, when the target segment is hybridized to the anti-target segment of the probe, to provide an extension product from which transcripts, with the sequence complementary to that of the reporter segment of the probe, can be made by transcription from the promoter corresponding to the promoter segment of the probe. The transcripts, optionally after further amplification or other processing, can be detected. In one embodiment of the invention, the transcripts will be autocatalytically replicatable by an RNA replicase such as Q.beta. replicase.

Abstract: The present invention discloses hybridization assay probes, amplification primers, nucleic acid compositions and methods useful for detecting Neisseria nucleic acids. Hybridization assay probes and amplification primers that selectively detect Neisseria meningitidis and distinguish those Neisseria meningitidis from Neisseria gonorrohoeae are disclosed. Other hybridization probes selectively detect Neisseria gonorrohoeae and not Neisseria meningitidis are also described.

Abstract: The human DNA polymerase .alpha. catalytic polypeptide has been functionally over-expressed by a recombinant baculovirus in insect cells at >1000 fold higher levels than that found in cultured normal human cells.

Abstract: Disclosed are novel G-CSF receptor agonist proteins, DNAs which encode the multi-functional hematopoietic receptor agonists proteins, methods of making the multi-functional hematopoietic receptor agonists proteins and methods of using the multi-functional hematopoietic receptor agonists proteins.

Abstract: The invention provides a number of strategies for transferring and/or evolving gene(s) associated with cellular DNA uptake so that they confer or enhance DNA-uptake capacity of a recipient cell. Evolution is achieved by recursive cycles of recombination and screening/selection. One such strategy entails evolving genes that confer competence in one species to confer either greater competence in that species, or comparable or greater competence in a second species. Another strategy entails evolving genes for use as components of cloning vector to confer enhanced uptake of the vector. Other strategies entail evolving viral receptors, viruses, and genes that mediate conjugal transfer.

Abstract: A probe that is a labelled segment of RNA complementary to and capable of specifically hybridizing with denatured HCV RNA, and prepared from 5' sense, GGCGACACTCCACCATGAAT and 3' antisense, ccagagcatctggcacgtgg primers, from the 5' untranslated region of the HCV genome, is employed for detecting and identifying the presence of hepatitis C virus (HCV) in tissue.

Abstract: A method for the detection of a polynucleotide target sequence is described. The method involves the formation of a covalent or non-covalent bonded pair of nucleotide sequences formed in response to a target polynucleotide sequence, adding nucleotide sequence specific binding proteins each capable of binding one member of the pair of nucleotide sequences, and detecting the specific binding proteins complexed to the pair of nucleotide sequences.

Abstract: We describe herein the isolation and purification of a multi-protein complex for DNA replication from MDA MB-468 human breast cancer cells as well as human breast tumor tissue and xenografts from nude mice injected with human breast cancer cell line MCF-7. This complex, designated the "DNA synthesome", fully supports the in vitro replication of simian virus 40 (SV40) origin-containing DNA in the presence of the viral large T-antigen. Since the SV40 virus utilizes the host's cellular proteins for its own DNA replication, our results indicate that the DNA synthesome plays a role not only in viral DNA synthesis but in human breast cell DNA replication as well. Our studies demonstrate that the following DNA proteins are incorporated into the DNA synthesome: DNA polymerase .alpha., DNA primase, DNA polymerase .delta., proliferating cell nuclear antigen (PCNA), replication protein A (RP-A), replication protein C (RF-C), DNA topoisomerase I and II, and DNA polymerase .epsilon..

Abstract: This invention relates to plant LPAATs, means to identify such proteins, amino acid and nucleic acid sequences associated with such protein, and methods to obtain, make and/or use such plant LPAATs. Purification, especially the removal of plant membranes and the substantial separation away from other plant proteins, and use of the plant LPAAT is provided, including the use of the protein as a tool in gene isolation for biotechnological applications. In addition, nucleic acid sequences encoding LPAAT protein regions are provided, and uses of such sequences for isolation of LPAAT genes from plants are considered.

Abstract: The present invention relates to an isolated protein or polypeptide corresponding to a protein or polypeptide of a Rupestris stem pitting associated virus. The encoding DNA molecule, either alone in isolated form, in an expression system, a host cell, or a transgenic grape plant, is also disclosed. Other aspects of the present invention relate to a method of imparting Rupestris stem pitting associated virus resistance to grape plants by transforming them with the DNA molecule of the present invention, and a method of detecting the presence of a Rupestris stem pitting associated virus, such as RSPaV-1, in a sample.

Abstract: Disclosed is a method for exact identification of the attenuated varicella virus Oka strain or a strain derived therefrom capable of functioning as an attenuated varicella live vaccine virus, which comprises analyzing the difference in the genomic DNA and fragments thereof between the Oka strain and a sample varicella strain, and determining whether or not a sample strain satisfies all of the following eight characteristics: the sizes of the HpaI-K fragment and the EcoRI-P fragment; the size of R2-487 region of Gene14 and the analysis by PCR-SSCP; the sizes of the restriction fragments obtained by digesting the R2-1764 fragment with AccIII; the absence or presence of a PstI cleavage site; the homology of the amino acid sequences coded by R2-487 coding region; and the homology of the amino acid sequences coded by the coding region of VZV Gene14. The method of the present invention is extremely useful for the quality control and quality assurance of attenuated varicella live vaccines.

Abstract: The differential display (DD) technique, widely used previously for eukaryotic gene discovery, is optimized to detect differential mRNA transcription (an expressed gene) from both pure culture and soil derived bacterial RNA. A model system using toluene induction of TodC1 in Pseudomonas putida F1 is used to optimize the procedure. Once optimized, an arbitrary primer for the RT step in conjunction with the same arbitrary primer and a Shine-Dalgarno (SD) primer for the PCR reaction is used to detect the expressed gene. The invention thus provides a method for discovery and acquisition of novel genes from environmental microbial communities that avoids the traditional steps and inherent bias due to the culturing of environmental isolates.

Abstract: The present invention relates to a method for quantitatively determining the expression of a gene, comprising providing at least two types of samples each containing a cDNA coding for the gene, adding a different adaptor to each of the cDNAs contained in the samples, mixing equal amounts of the samples each containing the adaptor-tagged cDNA, amplifying the resultant cDNAs and calculating an amount ratio between the amplified products.

Abstract: The present invention relates to a process for detecting the presence of at least one specific nucleic acid sequence in a sample containing a nucleic acid or a mixture of nucleic acids by amplifying the nucleic acid using polymerase chain reaction, cleaving the amplified products with uracil DNA glycosylase to obtain short DNA segments and detecting the DNA fragments by using reverse blot hybridization.

Abstract: A method for detecting disease-associated alleles in patient genetic material is provided whereby a first group of oligonucleotide molecules, synthesized to compliment base sequences of the disease associated alleles is immobilized on a predetermined position on a substrate, and then contacted with patient genetic material to form duplexes. The duplexes are then contacted with a second group of oligonucleotide molecules which are synthesized to extend the predetermined length of the oligonucleotide molecules of the first group, and where each of the oligonucleotide molecules of the second group are tagged and either incorporate universal bases or a mixture of guanine, cytosine, thymine, and adenine, or complementary nucleotide strands that are tagged with a different fluorochrome which radiates light at a predetermined wavelength.

Abstract: The invention provides a method for isolating nucleic acid from a sample, said method comprising boiling said sample and allowing it to cool, and condensing the nucleic acid onto a high-surface area solid support, and in particular the use of such a method in the preparation of nucleic acid samples for subsequent amplification. The method has particular utility in the isolation of nucleic acid from aged, fixed or otherwise distressed samples.

Abstract: This invention features methods and apparatus for performing nucleic acid hybridization and amplification processes on a support. Such methods and apparatus are useful for synthesizing nucleic acid and detecting target nucleic acid for diagnostics and therapeutics.

Abstract: A cytotoxin associated immunodominant antigen and the nucleic acid encoding the antigen from Helicobacter pylori are described. This antigen was identified from the cytotoxin positive CCUG 17874 Helicobacter pylori strain, and both the antigen and the DNA encoding it have been sequenced. The antigen is a hydrophilic, surface-exposed protein having a molecular weight of 120-132 kDa. The nucleic acid encoding the antigen may be incorporated into a vector for transformation of host cells for expression of the antigen. Both the DNA and the antigen can be used in assays for detection of disease or infection by Helicobacter pylori, and may find use in treating and preventing infection by Helicobacter pylori and the diseases associated with such infection.

Abstract: The invention involves methods for quantifying or identifying nucleic acid molecules in samples. The method involves using different, double stranded additions to nucleic acid molecules, followed by cross hybridization and identification of one type of molecule.

Abstract: Disclosed are diagnostic techniques for the detection of human prostate cancer. Genetic probes and methods useful in monitoring the progression and diagnosis of prostate cancer are described. The invention relates particularly to probes and methods for evaluating the presence of RNA species that are differentially expressed in prostate cancer compared to normal human prostate or benign prostatic hyperplasia.

Abstract: The subject invention concerns the novel use of formyl-CoA transferase enzyme together with oxalyl-CoA decarboxylase enzyme for the detection and measurement of oxalate in biological samples. The use of the enzyme system according to the subject invention results in the conversion of oxalate into carbon dioxide and formate. Because the production of formate is directly correlated to the concentration of oxalate present in a sample, the determination of the resulting formate concentration provides an accurate, sensitive and rapid means for detecting even low levels of oxalate. The subject invention further concerns the cloning, sequencing and expression of the genes that encode the formyl-CoA transferase enzyme and the oxalyl-CoA decarboxylase enzyme of Oxalobacter formigenes. The subject invention also concerns methods for detecting the presence of Oxalobacter formigenes organisms in a sample, and the polynucleotide probes and primers used in the detection method.

Abstract: Non-template 3' nucleotide addition to a transcript is reduced by transcribing a transcript from a template comprising an ultimate and/or penultimate 5' ribose having a C'2 substituent such as methoxy, which reduces non-template 3' nucleotide addition to the transcript. The methods are shown to be applicable to a wide variety of polymerases, including Taq, T7 RNA polymerase, etc.

Abstract: A single-stranded nucleotide fragment belonging to a variable region of the ribosomal RNA 23S of species of the genus mycobacterium. Probes and primers with sequences belonging to those of the single-stranded nucleotide fragments, a reagent and a method for identifying the mycobacterial species.

Abstract: The present invention provides labeled nucleic acid amplification oligonucleotides, which can be linear or hairpin primers or blocking oligonucleotides. The oligonucleotides of the invention are labeled with donor and/or acceptor moieties of molecular energy transfer pairs. The moieties can be fluorophores, such that fluorescent energy emitted by the donor is absorbed by the acceptor. The acceptor may be a fluorophore that fluoresces at a wavelength different from the donor moiety, or it may be a quencher. The oligonucleotides of the invention are configured so that a donor moiety and an acceptor moiety are incorporated into the amplification product. The invention also provides methods and kits for directly detecting amplification products employing the nucleic acid amplification primers. When labeled linear primers are used, treatment with exonuclease or by using specific temperature eliminates the need for separation of unincorporated primers.

Abstract: A method is provided for multiplying the number of copies of a target polynucleotide sequence comprising a series of primer hybridization, extending, and denaturing steps to provide an intermediate double-stranded DNA molecule containing a promoter sequence (through the use of a promoter-sequence-containing primer) incorporated upstream from the target sequence. The double-stranded DNA intermediate is then used to grow multiple RNA copies of the target sequence. The resulting RNA copies can be used as target sequences to produce further copies. Multiple cycles of this sort can thereby exponentially increase the number of target sequence copies.

Abstract: A method for judging a possibility of the onset of bovine leukemia caused by bovine leukemia virus BLV, wherein a bovine individual, in which an amino acid sequence defined by the amino acid numbers 75 to 78 of the .beta.1 domain of the bovine MHC Class II DR.beta. chain is Val-Asp-Thr-Tyr, is judged to have a possibility of the onset of the leukemia: and a method for judging a resistance to the onset of bovine leukemia caused by the bovine leukemia virus BLV, wherein a bovine individual, in which an amino acid defined by the amino acid number 78 of the .beta.1 domain of the bovine MHC Class II DR.beta. chain is Val, is judged to have a resistance to the onset of the leukemia.