Abstract: The invention relates to a gene which encodes reverse transcriptase having DNA polymerase activity and substantially no RNase H activity. The invention also relates to vectors containing the gene and hosts transformed with the vectors of the invention. The invention also relates to a method of producing reverse transcriptase having DNA polymerase activity and substantially no RNase H activity by expressing the reverse transcriptase genes of the present invention in a host. The invention also relates to a method of producing cDNA from mRNA using the reverse transcriptase of the invention. The invention also relates to a kit for the preparation of cDNA from mRNA comprising the reverse transcriptase of the invention.

Abstract: A method for the detection of a polynucleotide target sequence is described. The method involves the formation of a covalent or non-covalent bonded pair of nucleotide sequences formed in response to a target polynucleotide sequence, adding nucleotide sequence specific binding proteins each capable of binding one member of the pair of nucleotide sequences, and detecting the specific binding proteins completed to the pair of nucleotide sequences.

Abstract: This invention relates to a process for amplifying a specific nucleic acid sequence. The process involves synthesizing single-stranded RNA, single-stranded DNA and double-stranded DNA. The single-stranded RNA is a first template for a first primer, the single-stranded DNA is a second template for a second primer, and the double stranded DNA is a third template for synthesis of a plurality of copies of the first template. A sequence of the first primer or the second primer is complementary to a sequence of the specific nucleic acid and a sequence of the first primer or the second primer is homologous to a sequence of the specific nucleic acid. The amplification process may be used to increase the quantity of the specific nucleic acid sequence to allow detection, or to increase the purity of the specific nucleic acid sequence as a substitute for conventional cloning methodology.

Abstract: A method is provided for the rapid, substantially isostatic, segregation and amplification of the sequence information of a target nucleic acid sequence positioned within a single- or double-stranded polynucleotide. The method is based on the serial generation of double-stranded DNA engineered to contain terminal nicking sites, nicking of those sites, and extensions from those nicks, thereby displacing any existing polynucleotides. Further provided is a method for detecting polynucleotides using the method of the invention. A kit combining the components commonly used in practicing the method of the invention is also provided.

Abstract: A method of forming a macromolecular microgene polymer comprises allowing DNA polymerase to act on oligonucleotides A and B complementary at least partially to each other to effect polymerase chain reaction. According to the present invention, there can be obtained a polymer consisting of a repeating microgene, which is efficiently and simply formed.

Abstract: Reliable and cost effective testing for mutations in the RB1 gene can be accomplished by (a) quantitatively amplifying exons of the sample RB1 gene using primers complementary to intron regions flanking each exon; and (b) determining the lengths and/or quantities of the amplification products for each exon and comparing that length or quantity to the length or quantity of amplification products obtained when a wild-type RB1 gene is amplified using the same primers. Differences in length between an amplified sample exon and the corresponding amplified wild-type exon reflect the occurrence on an insertion or deletion mutation in the sample RB1 gene. Differences in quantity reflect the complete absence of an exon, or heterozygosity for a mutant exon. Next, the nucleic acid sequence of each exon found to contain an insertion or deletion mutation is determined, or of all exons in the event no insertion or deletion mutations are identified.

Abstract: Systems, processes, and devices are provided which are useful for testing blood or plasma donations to detect those specific donations which are contaminated by a virus above a predetermined level. An apparatus and process is described which forms individual, separately sealed and connected sample containers from a flexible hollow tubing segment connected to a fluid donation container. The tubing segment is sealed at spaced-apart intervals along its length, with tubing segment portions in the intervals between the seals defining containers, each of which holds a portion of a plasma sample. The contents of the containers are formed into pools which are subsequently tested for virus contamination by a high-sensitivity test such as PCR The pools are tested in accordance with an algorithm by which a sample from each donation is mapped to each element of an N-dimensional matrix or grid. Each element of the matrix is identified by a matrix identifier, X.sub.rcs, where rcs defines the dimensional index.

Abstract: The present invention relates to a method for the comparative assessment of the level of specific nucleic acid sequences in samples derived from different sources. More specifically, the invention relates to a method using oligonucleotides covalently linked to a solid support, such as beads, to isolate specific labeled nucleic acid sequences from complex mixtures. The methods disclosed allow quantitative comparisons of the amount of nucleic acid of defined sequence in a plurality of different samples of nucleic acid, e.g., from different cells or tissues or from genetic libraries. Nucleic acids from the samples are labeled in such a fashion that the signals can be distinguished and compared following hybridization to the oligonucleotides on the beads. According to the invention, the solid supports with the hybridized nucleic acid may be retrieved, and the target nucleic acid eluted and analyzed.

Abstract: Amplification primers and methods for specific amplification and detection of a Shigella spp. and enteroinvasive strains of Escherichia coli (EIEC) target are disclosed. The primer-target binding sequences are useful for amplification and detection of Shigella and EIEC target in a variety of amplification and detection reactions.

Abstract: The present invention relates to methods and kits for generating or analyzing nucleic acid populations or desired nucleic acid sequences based upon replication or amplification reactions. The invention comprises methods employing adaptors ligated to nucleic acids that preferentially permit replication or amplification of desired nucleic acid sequences or preferentially eliminate undesired nucleic acids from replication or amplification. The invention also comprises adaptors useful in the methods and in kits for replicating or amplifying nucleic acids. In one embodiment, the adaptors function to protect desired nucleic acids from cleavage by a restriction enzyme while other nucleic acids are cleaved. The protected, desired nucleic acids can then be preferentially replicated or amplified. Accordingly, the invention can be used for the amplification of desired nucleic acids and the effective removal of undesired nucleic acids from a population.

Abstract: A method is disclosed for determining the chromosomal identity of a sample of genomic DNA. The genomic DNA is amplified and labeled by polymerase chain reaction using primers substantially complementary to interspersed repetitive DNA sequences. The amplified and labeled genomic DNA fragments are then contacted with chromosomal DNA of known identity under conditions in which the chromosome-specific, but not the interspersed repetitive DNA sequences, of the amplified and labeled genomic DNA fragments are available for hybridization. Specific hybridization to chromosomal DNA of known identity determines the chromosomal identity of the sample of genomic DNA.

Abstract: This invention features methods, apparatus and kits for performing nucleic acid hybridization and amplification reactions on a support. Such methods and apparatus are useful in diagnostic and therapeutic processes for synthesizing nucleic acid and detecting target nucleic acids in a sample.

Abstract: A method for detecting the presence of an assayed nucleic acid sequence in a sample is an essentially two stage-procedure. As illustrated, in a first stage the sample is reacted in a manner which gives rise to the production of a triggering oligonucleotide where the sample contains the assayed sequence. In the second stage, the reaction product is incubated under appropriate conditions with an amplification system whereby, in the presence of triggering oligonucleotide, a large amount of a nucleic acid product is obtained. The detection of this product thus indicates the presence of the assayed sequence in the sample.

Abstract: Disclosed is a process for identifying clones having a specified activity of interest, which process comprises (i) generating one or more expression libraries derived from nucleic acid directly isolated from the environment; and (ii) screening said libraries utilizing an assay system. More particularly, this is a process for identifying clones having a specified activity of interest by (i) generating one or more expression libraries derived from nucleic acid directly or indirectly isolated from the environment; (ii) exposing said libraries to a particular substrate or substrates of interest; and (iii) screening said exposed libraries utilizing a fluorescence activated cell sorter to identify clones which react with the substrate or substrates.

Abstract: Entry of HIV-1 into target cells requires cell surface CD4 as well as additional host cell cofactors. A cofactor required for infection with virus adapted for growth in transformed T cell lines was recently identified and named fusin. Fusin, however, does not promote entry of macrophage-tropic viruses that are believed to be the key pathogenic strains in vivo. It has now been determined that the principal cofactor for entry mediated by the envelope glycoproteins of primary macrophage-tropic strains of HIV-1 is CC-CKR5, a receptor for the .beta.-chemokines RANTES, MIP-1.alpha., and MIP-1.beta.. It has also been found that individuals who are homozygous for a mutation of the CKR-5 receptor are resistent to HIV infection; in vitro infection requires a 1000-fold higher dose of HIV than normal cells. The mutation results in complete suppression of CKR-5 expression.

Abstract: A method for the analysis of DNA sequences and PCR products comprises the steps of constructing an oligonucleotide-labeled beadset, and labeled complementary probe, and exposing the beadset and probe to a DNA fragment or PCR product under hybridizing conditions and analyzing the combined sample/beadset by flow cytometry. Flow cytometric measurements are used to classify beads within an exposed beadset to determine the presence of identical or nonidentical sequences within the test sample. The inventive technology enables the rapid analysis of DNA sequences and detection of point mutations, deletions and/or inversions while also reducing the cost and time for performing genetic assays.

Abstract: This invention relates to agents and conjugates that can be used to detect and isolate target components from complex mixtures such as nucleic acids from biological samples, cells from bodily fluids, and nascent proteins from translation reactions. Agents comprise a detectable moiety bound to a photoreactive moiety. Conjugates comprise agents coupled to substrates by covalent bounds which can be selectively cleaved with the administration of electromagnetic radiation. Targets substances labeled with detectable molecules can be easily identified and separated from a heterologous mixture of substances. Exposure of the conjugate to radiation releases the target in a functional form and completely unaltered. Using photocleavable molecular precursors as the conjugates, label can be incorporated into macromolecules, the nascent macromolecules isolated and the label completely removed.

Abstract: The present invention provides a compound of general formula (I): ##STR1## wherein X represents group (II) or (III): ##STR2## wherein Y represents a leaving group and Z represents an oligonucleotide. The compound can specifically transfer oligonucleotides to cells which specifically recognize a specified saccharide construction. Accordingly, the compound can be used as an antiviral agent or an antitumor agent.

Abstract: The invention relates to modified oligonucleotide primers used to adjust the amplification efficiency of an abundant target without affecting the amplification of other targets in a DNA synthesis reaction. The invention may be used in PCR.TM. or any other primer dependent DNA transcription technology.

Abstract: Methods for detecting metastasis of melanoma and breast cancer cells, detecting subclinical metastasis, and monitoring treatment are disclosed. Kits for use in such methods also are disclosed. The methods provide for the detection of nucleic acids corresponding to multiple melanoma or breast cancer specific markers using template dependent amplification processes. Methods using multiple markers provide increased sensitivity over existing methods.

Abstract: Single-stranded signal primers are modified by linkage to two dyes which form a donor/acceptor dye pair. The two dyes are positioned in sufficiently close spatial proximity on the signal primer that the fluorescence of the first dye is quenched by the second dye. The signal primer may further comprise a restriction endonuclease recognition site (RERS) between the two dyes. As the signal primer is initially single-stranded and remains single-stranded in the absence of target, the restriction endonuclease recognition site is not cleavable or nickable by the restriction endonuclease. In the presence of target, however, signal primer and the restriction endonuclease recognition site are rendered double-stranded and cleavable or nickable by the restriction endonuclease. Cleavage or nicking separates the two dyes and a change in fluorescence due to decreased quenching is detected as an indication of the presence of the target sequence or of target sequence amplification.

Abstract: The present invention relates to method for isolation of DNA sequences having a target DNA of known sequence which accelerates and simplifies obtaining DNA especially from small amounts of tissue. This method uses polymerase having strand displacement capability, one primer and a circular DNA template.

Abstract: The present invention pertains to a process which can be fully automated for accurately determining the alleles of genetic markers. More specifically, the present invention is related to performing PCR amplification on locations of DNA to generate a reproducible pattern, labeling the PCR products, converting the labels into a signal, operating on the signal, and then determining the genotype of the location of the DNA. An amplification can include multiple locations from the DNA of one or more individuals. The invention also pertains to genetics applications and systems which can effectively use this genotyping information.

Abstract: A method is disclosed of amplifying the signal of target nucleic acid sequence analyte using a rolling circle replication mechanism and a bidirectional primer. The repeating signal amplification sequence units contain tags which are directly or indirectly detectable. In addition, methods of capturing the tagged complementary nucleic acid sequence of the target nucleic acid sequence onto an array surface and detecting the captured target nucleic acid sequences are disclosed. Kits are also disclosed for enhancing detection of target nucleic acid sequences using a mechanism of rolling circle replication and a bidirectional primer to attach to the complementary nucleic acid sequence of the target nucleic acid sequence a large number of detectable tags.

Abstract: A nucleic acid amplifying enzyme having a short reaction time and high fidelity is provided. The enzyme of this invention is a thermostable DNA polymerase having a nucleic acid extension rate of at least 30 bases per second and a 3'-5' exonuclease activity. Also provided are a method and kit for amplifying nucleic acid.

Abstract: A novel class of compounds, exemplified by oligomers comprised of purine, pyrimidine, and other nucleobase monomers are disclosed. The nucleobase oligomers hydrogen bond through Watson/Crick base pairing to complementary nucleic acids, such as DNA and RNA, in an opposing strand. Each internal nucleobases in the oligomer has two attachment sites and is attached to two nucleobases by linkers. Terminating groups may contain reactive functionality, labels, reporters, or nucleic acids. The nucleobase oligomer compounds are useful as sequence specific recognition molecules for complementary nucleic acids. Where the molecule consists of sections of nucleobase oligomer and nucleic acid, the chimera may be an enzyme substrate in cleavage, ligation, and primer extension methods such as PCR and DNA sequencing.

Abstract: The invention provides a purified and isolated Cryptosporidium DNA sequence comprising the nucleotide sequence:GATGGTACTGGATAGATAGTGGAAGTCCCGTATCAGTTCGAGATTCTGAAATTA ATTGGACATCAAGTTATAAAGCAAGCTGGTTATTAAGATTCAAATTTCCCTTTGA AAAGTGTGGCTTTTTTGATATTGGAGGGTTAGGAAGAAGGTT plus methods and kits for detecting and/or identifying the presence of Cryptosporidium.

Abstract: Polynucleotides and oligonucleotides for identification of species of the Streptococcus genus and the Enterococcus genus are provided. The polynucleotides and oligonucleotides are useful as probes and primers. Polypeptides expressed by the polynucleotides and oligonucleotides are useful for the preparation of monoclonal and polyclonal antibodies that recognize the polypeptides.

Abstract: A substantially non-invasive and efficient method for collecting cells from the internal organs of a subject is provided. In one embodiment, energy from an external energy source is applied to the subject that is sufficient to loosen the cells from an internal cellular surface of an internal organ so that at least a portion of the loosened cells are detached from the internal cellular surface or the organ. The detached cells are collected from the subject and can be analyzed for a disease state. The methods described herein provide methods for detecting of disease states before macroscopic evidence of the disease state that also facilitate inexpensive mass screening.

Abstract: This invention relates to methods for screening nucleic acids for mutations by analyzing nonrandomly fragmented nucleic acids using mass spectrometric techniques and to procedures for improving mass resolution and mass accuracy of these methods of detecting

Abstract: Disclosed are materials and methods for performing multiplex assays for nucleic acids, in which a transponder is associated with the bead(s) forming the solid phase used in the assay, nucleic acid probes are bound to the surface of the particles, and data concerning the assay is encoded on the transponder. A dedicated read/write device is used to remotely encode or read the data.

Abstract: This invention relates to polynucleotides encoding Glycoprotein B from the RFHV/KSHV subfamily of gamma herpes viruses, three members of which are characterized in detail. DNA extracts were obtained from Macaque nemestrina and Macaque mulatta monkeys affected with retroperitoneal fibromatosis (RF), and human AIDS patients affected with Kaposi's sarcoma (KS). The extracts were amplified using consensus-degenerate oligonucleotide probes designed from known protein and DNA sequences of gamma herpes viruses. The nucleotide sequences of a 319 base pair fragment are about 76% identical between RFHV1 and KSHV, and about 60-63% identical with the closest related gamma herpes viruses outside the RFHV/KSHV subfamily. Protein sequences encoded within these fragments are are about 91% identical between RFHV1 and KSHV, and <.about.65% identical to that of other gamma herpes viruses.

Abstract: Hepatitis GB Virus (HGBV) nucleic acid and amino acid sequences useful for a variety of diagnostic and therapeutic applications, kits for using the HGBV nucleic acid or amino acid sequences, HGBV immunogenic particles, and antibodies which specifically bind to HGBV. Also provided are methods for producing antibodies, polyclonal or monoclonal, from the HGBV nucleic acid or amino acid sequences.

Abstract: This invention relates to an improved process for detecting and quantifying a desired nucleic acid sequence. The process involves synthesizing single stranded RNA, single stranded DNA, double-stranded DNA followed by detection using an electrochemiluminescent labeled binding species.

Abstract: A method of analyzing a DNA molecule is disclosed. In one embodiment the method comprises the steps of exposing a DNA molecule to an effective amount of a chemical modification reagent wherein the reagent converts guanine to 8-hydroxyguanine. The oxidized product is then exposed to a DNA glycosylase enzyme and the DNA molecule is cleaved at the site of the 8-hydroxyguanine. The fragments are then resolved by electrophoresis and the position of guanine residues within the DNA molecule is determined. In a preferred embodiment of the present invention, the modification reagent is a thiazine dye and the enzyme is FPG protein.

Abstract: A step-wise integrated process for identifying sequence variations in polynucleotide sequences is disclosed. The identification process is composed of three stages, including allele specific hybridization assays of known sequence variations (Stage I), sequence variation locating assays (Stage II), and direct sequencing (Stage III). The methods can be used for efficient and accurate detection of mutations in any test gene sample.

Abstract: A first sensor (18) for electrically sensing a molecular binding event includes a receptor-supporting element (20) into which a reagent is diffusable, at least one molecular receptor (22) supported by the receptor-supporting element (20), and a first electrode (24) embedded in the receptor-supporting element (20). A second sensor for electrically sensing a molecular binding event includes a receptor-supporting element (130), at least one molecular receptor (132) supported by the receptor-supporting element (130), an electrode (134) coupled to the receptor-supporting element (130), and a porous electrode (136) coupled to the receptor-supporting element (130).

Abstract: An oligonucleotide is provided which has a nucleotide sequence derived from SEQ ID NO:1, characterized in that it contains at least one site capable of amplifying a nucleotide sequence characteristic of Vibrio parahaemolyticus. The oligonucleotide may have a nucleotide sequence not derived from SEQ ID NO:3, or incapable of amplifying nucleotide sequences originating in Vibrio alginolyticus and Vibrio harveyi, and may be represented by SEQ ID NO:5 or SEQ ID NO:6. A method of detecting Vibrio parahaemolyticus in a specimen is also provided which comprises preparing a primer set comprising two of the above oligonucleotides, selectively amplifying therewith a DNA gyrase subunit B gene sequence contained in the specimen as a target, and determining whether or not there is a gyrB unit specific for Vibrio parahaemolyticus in the specimen.

Abstract: A novel Pseudomonas fluorescens is disclosed which has an antagonist property against pathogenic fungi of the genera Pythium, Rhizoctonia, Sclerotinia and Gaeumannomyces and which has a DNA that forms a PCR product band at about 800 bp when replicated and amplified by PCR using a primer DNA having the base sequence of 5'-GGCAACTGCACAAGCGCCA (SEQ ID NO: 1) and a primer DNA having the base sequence of 5'-GCCAATCACGCCCTCAAGCT (SEQ ID NO: 2) and then electrophoresed on agarose gel. This microorganism can also promote the growth of plants. A material for controlling pathogenic fungi of plants, particularly, lawn grass, a plant growth promoting material and a compost comprising the microorganism are also disclosed.

Abstract: A method is described for determining the sequence of nucleic acids. The method employs small solid phase particles having transponders, with a primary layer of an oligonucleotide of known sequence attached to the outer surface of the particle. A read/write scanner device is used to encode and decode data on the transponder. The stored data includes the sequence of the oligonucleotide immobilized on the transponder. The sequence of sample nucleic acids is determined by detecting annealing to an oligonucleotide bound to a particle, followed by decoding the transponder to determine the sequence of the oligonucleotide.

Abstract: A computational method maximizing open reading frame length in an assembly consensus sequence is provided. Systems employing the method are also provided.

Abstract: The present invention is an improved method of making a partially modified PCR product from a DNA fragment with a polymerase chain reaction (PCR). In a standard PCR process, the DNA fragment is combined with starting deoxynucleoside triphosphates, a primer, a buffer and a DNA polymerase in a PCR mixture. The PCR mixture is then reacted in the PCR producing copies of the DNA fragment. The improvement of the present invention is adding an amount of a modifier at any step prior to completion of the PCR process thereby randomly and partially modifying the copies of the DNA fragment as a partially modified PCR product. The partially modified PCR product may then be digested with an enzyme that cuts the partially modified PCR product at unmodified sites thereby producing an array of DNA restriction fragments.

Abstract: A method for the preparation of optimally labeled oligonucleotides wherein label-conjugated nucleotide triphosphates are incorporated into a nucleic acid sequence in a defined repetitive manner which allows for the optimal specific detectability of the oligonucleotide. The oligonucleotides of the present invention are useful in the assay of a wide variety of nucleic acid sequences, specifically wherever labeled nucleic acid probes are desired.

Abstract: The invention features methods for identifying gene products that mediate a phenotype, such as drug resistance or sensitivity, as well as methods for identifying new bioactive compounds, by detecting differences in sensitivity of growth rate between host cells that differ in target gene product dosage (e.g., two copies of a target gene product-encoding sequence compared to one copy).

Abstract: The method of this invention relates to the use of improved anchor primers and a novel purification process to increase the efficiency and accuracy of the differential display technique.

Abstract: An improved method of extracting nucleic acids from a sample comprising mixing the sample with a carrier which is at least one member selected from the group consisting of dextran, acrylamide and carboxymethyl cellulose to form a liquid mixture; mixing said liquid mixture with reagent C to render the nucleic acids and the carrier insoluble, said reagent C containing at least one reagent A selected from the group consisting of guanidinium thiocyanate, guanidinium hydrochloride, potassium thiocyanate and sodium thiocyanate and at least one reagent B selected from the group consisting of n-propyl alcohol, isopropyl alcohol, n-butyl alcohol, sec-butyl alcohol, tert-butyl alcohol, and tert-amyl alcohol; and separating the insolubilized nucleic acids and carrier from the liquid phase.

Abstract: The invention relates to novel chimeric phosphoramidate oligonucleotides and their use in primer-extension methods such as DNA sequencing and nucleic acid amplification. The subject chimeric phosphoramidate oligonucleotides have both N3'-phosphoramidate linkages and phosphodiester linkages. The invention includes methods of primer extension using the subject chimeric oligonucleotides as primers. Primer extension methods of interest include nucleic acid amplification reactions, e.g. PCR, and polynucleotide sequencing reactions. In the primer extension methods of the invention, a chimeric phosphoramidate oligonucleotide primer is annealed to a polynucleotide template. After annealing, the chimeric oligonucleotide primer is extended by joining a nucleotide to the 3' end of the primer by a DNA polymerase catalyzed reaction. Other embodiments of the invention include methods of primer extension using phosphoramidate linkage containing polynucleotide templates.

Abstract: A method for determining whether an individual is at increased risk for thrombosis, comprising detecting the presence or absence of a genetic mutation located in the 3' untanslated region of the prothrombin gene (G to A mutation at position 20210) that is correlated with elevated prothrombin levels in individuals with the mutation, wherein the elevated prothrombin levels are associated with increased risk for thrombosis. Also provided are kits and primers that specifically hybridize adjacent to the region of the prothrombin gene that contains the G to A mutation at position 20210.

Abstract: A method for primer walking cycle sequencing of nucleic acid is provided using a presynthesized set of walking primers wherein the primers have a raised annealing temperature and/or improved annealing properties without increasing sequence complexity.

Abstract: The invention provides fast and highly accurate mass spectrometer based processes for detecting a particular nucleic acid sequence in a biological sample. Depending on the sequence to be detected, the processes can be used, for example, to diagnose a genetic disease or chromosomal abnormality; a predisposition to a disease or condition, infection by a pathogenic organism, or for determining identity or heredity.