Abstract: The present disclosure provides systems, methods, and computer-readable media for managing graphics processing unit (GPU) allocation for a virtual machine (VM). A first GPU driver, associated with a first GPU, is offloaded from an operating system (OS) of the VM. Then, the first GPU is deallocated from the VM. A second GPU is allocated to the VM, and a second GPU driver, associated with the second GPU, is loaded in the OS of the VM. To restore a GPU context from the first GPU within the second GPU, a GPU command log from the first GPU is replayed to the second GPU.

Abstract: Herein is described the design and synthesis of resorcylate aminopyrazole compounds. These compounds show broad, potent and fungal-selective Hsp90 inhibitory activity. These compounds also find use in treating Hsp90 related diseases.

Abstract: A miR-1983 inhibitor comprising an anti-miR-1983 oligonucleotide that is complementary to at least part of CTCACCTGGAGCATGTTTTCT (SEQ ID NO: 1), the part comprising at least nucleotides 2 to 8 of CTCACCTGGAGCATGTTTTCT (SEQ ID NO: 1).

Abstract: A three-dimensional (3D) untethered mobile actuator having the following parts: (a) a substrate having two or more magnetized panels, and (b) a frame that connects the magnetized panels, the magnetized panels being made of a polymer with embedded permanent magnetic particles, each magnetized panel of the 3D untethered mobile actuator having a magnetic moment in a different direction than a next neighboring panel, and the 3D untethered mobile actuator having a structural configuration that changes between a substantially flat structural configuration in the absence of a magnetic field, and an actuated structural configuration when under influence of a magnetic field. Methods of manufacturing and using the 3D mobile actuator and a system that includes the 3D mobile actuator are provided.

Abstract: Embodiments of the present disclosure relate to generating explanation maps for explaining convolutional neural networks through attribution-based input sampling and block-wise feature aggregation. An example of a disclosed method for generating an explanation map for a convolutional neural network (CNN) includes obtaining an input image resulting in an output determination of the CNN, selecting a plurality of feature maps extracted from a plurality of pooling layers of the CNN, generating a plurality of attribution masks based on the plurality of feature maps, applying the generated attribution masks to the input image to obtain a plurality of visualization maps, and generating an explanation map of the output determination of the CNN based on the plurality of visualization maps.

Abstract: An automated multiplex detector system includes: (a) a nucleic acid amplification compartment for amplifying nucleic acid of one or more targets in a sample, and (b) an analysis compartment in fluid communication with the amplification compartment, the analysis compartment housing a nanoparticle-based multiplex detector capable of using the amplified nucleic acid of the amplification compartment and producing a signal that correlates with the presence of the one or more targets in the sample.

Abstract: This disclosure is directed to novel CD133-binding agents. The disclosure is also directed to uses of novel CD133-binding agents for detecting CD133-expressing cells and/or quantitating levels of cellular CD133 expression, for targeting CD133-expressing cells, for decreasing levels of CD133 in CD133-expressing cells and for treating or preventing cancer.

Abstract: Methods and devices for hardware-supported schemes for efficient metadata retrieval are described. The schemes may use hardware to efficiently enforce type safety and speed up memory bound checks without imposing undue memory overhead. Multiple such schemes may be supported by a device, permitting the selection of an optimal scheme based on a given memory allocation request. The schemes may be compatible with legacy code and applicable to a wide range of data objects and system constraints. Compilation, instrumentation, and linking of code to effect such schemes is also described.

Abstract: A method for scoring training data samples according to an ability to preserve latent decision boundaries for previously observed classes while promoting learning from an input batch of new images from an online data stream, comprising: receiving the input batch of the new images from the online data stream, performing a memory retrieval process that retrieves data to be learned along with a new set of data from the memory to retain the previously learned knowledge, and performing a memory update process that selects and exchanges a small set of data to be saved in the memory in the memory update process. In addition, the method performs data valuation based on KNN-SV for both the memory retrieval and memory update processes to perform strategic and intuitive data selection based on the properties of KNN-SV.

Abstract: Described are methods and devices for the treatment of fecal matter. A column reactor is used to smolder fecal matter to produce and a volatile components stream and smoldered media. The volatile components stream may be subject to catalysis to reduce the emission of noxious substances and/or generate heat energy. Also described is the use of a turntable for removing smoldered media from the column reactor.

Abstract: This disclosure relates to reagents and their use for elemental imaging mass spectrometry of biological samples.

Abstract: In some embodiments, techniques capable of obtaining high-quality fetal ECG (fECG) information using as few as two composite (maternal and fetal) maternal abdominal ECG (aECG) signals to derive the fetal ECG information are provided. In some embodiments, maternal ECG information and fetal ECG information are both obtained from the aECG signals, and are either presented or stored. The techniques may use novel proposed diffusion-based channel selection criteria. To validate the proposed techniques, analysis results of two publicly available databases are described, and compared with other available techniques in the literature.

Abstract: An antibody and/or binding fragment thereof, wherein the antibody and/or binding fragment thereof comprises a light chain variable region and a heavy chain variable region, the light chain variable region comprising complementarity determining region (CDR) CDR-L3 and the heavy chain variable region comprising CDR-H1, CDR-H2 and CDR-H3, with the amino acid sequences of said CDRs comprising one or more of the sequences set forth below: CDR-L3; selected from any one of SEQ ID NOs: 123, 126-130, 142, 148 or 149; CDR-H1: SEQ ID NOs: 121 or 124; CDR-H2; SEQ ID NOs: 122 or 125; and/or CDR-H3: selected from any one of SEQ ID NOs: 196-226.

Abstract: An organic light emitting diode device comprising: a light emitting layer or layers combining both an emissive material comprising a boron subphthalocyanine, or first emitting layer component, that emits substantially orange light; and an emissive material emitting blue light, or second emitting layer component; wherein in combination, the first emitting layer component and the second emitting layer component, in combination, produces an overall white or near-white light emission.

Abstract: An Epidermal Growth Factor Receptor (EGFR, HER1, ErbB1)-binding agent has a heavy chain and a light chain, wherein the dimerization loop from EGFR's Domain II is grafted within complementarity determining region 3 (CDR3) of the heavy chain, and the binding agent is affinity matured. The graft directs the binding agent to bind EGFR at its dimerization region, to thereby inhibit EGFR dimerization and activation. In another embodiment, an EGFR-binding agent is panned out of Library F, a Fab library. The binding agents are for detecting and/or quantifying EGFR expression, for targeting EGFR-expressing cells, and for decreasing levels of EGFR in EGFR-expressing cells.

Abstract: A method for biosynthesis of polymer precursors, including, adipic acid, 1,6-hexanediol, 6-hydroxyhexanoic and 6-aminocaproic acids from carboxylic acids is provided. A method for biosynthesis of adipic acid from six-carbon dicarboxylic acids having ?, ?-enoate reductase activity by treatment with an enzyme is provided. The biocatalytic conversion of aliphatic and hydroxycarboxylic acids to corresponding aldehydes, alcohols, and amines using novel carboxylate reductases, aldehyde reductases, and aminotransferases is described. Also provided are genetically engineered microorganisms for use in the biosynthetic processes.

Abstract: A method for supercritical fluid extraction of metal from a source, the method comprising: providing a reactor chamber; providing a source comprising a target metal; optionally, providing a chelating agent; providing a solvent; adding the source comprising the target metal, the chelating agent and the solvent into the reactor chamber; adjusting the temperature and pressure in the reactor chamber so that the solvent is heated and compressed above its critical temperature and pressure; optionally, providing mechanical agitation to the reactor chamber; recovering a chelate comprising the target metal.

Abstract: There is provided a method and system for linear signal processing with signal decomposition. The system including: a decomposition module to receive an analog input signal and perform signal decomposition, the signal decomposition including slicing the analog input signal into a plurality of slices to produce one or more analog components and one or more digital components, the decomposition module directing each component to a separate signal path; and a processing module to perform one or more linear operations on at least one of the signal paths. In some cases, the signal decomposition includes slicing the analog input signal into the plurality of slices by amplitude. In some cases, the analog components include unsaturated slices of the analog input signal and the digital components include saturated slices of the analog input signal.

Abstract: There is provided a system and method for traffic signal control for an intersection of a traffic network. The method includes: receiving sensor readings including a plurality of physical characteristics associated with vehicles approaching the intersection; discretizing the sensor readings based on a grid of cells; associating a value representing the physical characteristic for each of the cells; generating a matrix associated with the physical characteristic; combining each matrix associated with each of the plurality of physical characteristics as separate layers in a multi-layered matrix; determining, using a machine learning model trained with a traffic control training set, one or more traffic actions with the multi-layered matrix as input, the traffic control training set including previously determined multi-layered matrices for a plurality of traffic scenarios at the intersection; and communicating the one or more actions to the traffic network.

Abstract: A device and method for measuring at least one cellular activity. The device includes: (a) a deformable polymeric base membrane having a first side and a second side, the polymeric base including a well having an opening on the first side, a cavity extending from the opening and a floor formed by the second side of the polymeric base membrane, (b) a deformable polymeric top membrane overlapping the second side of the polymeric base membrane; and (c) a sensing element disposed between the polymeric base membrane and the polymeric top membrane, the sensing element being disposed over the floor of the well, such that a portion of the second side that forms the floor of the well, the sensing element and a portion of the top membrane that overlaps the well form a suspended membrane.