Patents by Inventor Arthur M. Krieg

Arthur M. Krieg has filed for patents to protect the following inventions. This listing includes patent applications that are pending as well as patents that have already been granted by the United States Patent and Trademark Office (USPTO).

  • Publication number: 20090137519
    Abstract: The invention relates to specific C-Class semi-soft CpG immunostimulatory oligonucleotides that are useful for stimulating an immune response. In particular the oligonucleotides are useful for treating allergy, such as allergic rhinitis and asthma, cancer and infectious disease, such as hepatitis B and hepatitis C.
    Type: Application
    Filed: December 17, 2008
    Publication date: May 28, 2009
    Applicants: Coley Pharmaceutical Group, Inc., Coley Pharmaceutical GmbH
    Inventors: Arthur M. Krieg, Ulrike Samulowitz, Jorg Vollmer, Eugen Uhlmann
  • Publication number: 20090117132
    Abstract: The invention relates to administration of an anti-CTLA-4 antibody, particularly human antibodies to human CTLA-4, such as those having amino acid sequences of antibodies 3.1.1, 4.1.1, 4.8.1, 4.10.2, 4.13.1, 4.14.3, 6.1.1, 11.2.1, 11.6.1, 11.7.1, 12.3.1.1, 12.9.1.1, and MDX-010, in combination with an immunostimulatory nucleotide, i.e, CpG ODN PF3512676, for treatment of cancer. The invention relates to administering a combination of an anti-CTLA-4 antibody and CpG ODN PF3512676 as neoadjuvant, adjuvant, first-line, second-line, and third-line therapy of cancer, whether localized or metastasized, and at any point(s) along the disease continuum (e.g, at any stage of the cancer).
    Type: Application
    Filed: June 30, 2006
    Publication date: May 7, 2009
    Applicants: Pfizer, Inc., Coley Pharmaceutical Group, Inc.
    Inventors: David Robert John Readett, Jarl Ulf Birger Jungnelius, Jesus Gomez-Navarro, Douglas Hanson, Arthur M. Krieg
  • Patent number: 7524828
    Abstract: Nucleic acid sequences containing unmethylated CpG dinucleotides that modulate an immune response including stimulating a Th1 pattern of immune activation, cytokine production, NK lytic activity, and B cell proliferation are disclosed. The sequences are also useful a synthetic adjuvant.
    Type: Grant
    Filed: August 18, 2004
    Date of Patent: April 28, 2009
    Assignee: University of Iowa Research Foundation
    Inventors: Arthur M. Krieg, Joel N. Kline
  • Patent number: 7517861
    Abstract: Nucleic acids containing unmethylated CpG dinucleotides and therapeutic utilities based on their ability to stimulate an immune response and to redirect a Th2 response to a Th1 response in a subject are disclosed. Methods for treating atopic diseases, including atopic dermatitis, are disclosed.
    Type: Grant
    Filed: July 9, 2004
    Date of Patent: April 14, 2009
    Assignee: University of Iowa Research Foundation
    Inventors: Arthur M. Krieg, Joel N. Kline
  • Publication number: 20090087446
    Abstract: Immunostimulatory oligonucleotides, which contain a CpG immunostimulatory motif and a second motif that is capable of forming secondary structure, including duplex and higher order structures in vitro and in vivo, are disclosed. They include nucleic acids, or pharmaceutically acceptable salts thereof, having base sequences that include 5? TCGTCGTTTTCGGCGCGCGCCGT 3? (SEQ ID NO: 1), in which each C is unmethylated and 3? refers to the 3? end of the nucleic acid. The oligonucleotides activate B cells and NK cells and induce expression of type I interferon and interferon-?. The oligonucleotides are useful for treating a variety of disorders and conditions, including allergy, asthma, infection, and cancer. In addition to their use as single agents and as combination therapies, the disclosed oligonucleotides are useful as adjuvants in vaccines.
    Type: Application
    Filed: August 12, 2008
    Publication date: April 2, 2009
    Inventors: JORG VOLLMER, Eugen Uhlmann, Arthur M. Krieg, Douglas C. Hanson, Ulrike Samulowitz
  • Patent number: 7488490
    Abstract: The present invention relates generally to adjuvants, and in particular to methods and products utilizing a synergistic combination of immunostimulatory oligonucleotides having at least one unmethylated CpG dinucleotide (CpG ODN) and a non-nucleic acid adjuvant. Such combinations of adjuvants may be used with an antigen or alone. The present invention also relates to methods and products utilizing immunostimulatory oligonucleotides having at least one unmethylated CpG dinucleotide (CpG ODN) for induction of cellular immunity in infants.
    Type: Grant
    Filed: December 18, 2001
    Date of Patent: February 10, 2009
    Assignee: University of Iowa Research Foundation
    Inventors: Heather L. Davis, Joachim Schorr, Arthur M. Krieg
  • Patent number: 7402572
    Abstract: Nucleic acids containing unmethylated CpG dinucleotides and therapeutic utilities based on their ability to stimulate an immune response and to redirect a Th2 response to a Th1 response in a subject are disclosed. Methods for treating atopic diseases, including atopic dermatitis, are disclosed.
    Type: Grant
    Filed: April 23, 2004
    Date of Patent: July 22, 2008
    Assignee: University of Iowa Research Foundation
    Inventors: Arthur M. Krieg, Joel N. Kline
  • Patent number: 7271156
    Abstract: The invention relates to immunostimulatory nucleic acid compositions and methods of using the compositions. The T-rich nucleic acids contain poly T sequences and/or have greater than 25% T nucleotide residues. The TG nucleic acids have TG dinucleotides. The C-rich nucleic acids have at least one poly-C region and/ore greater than 50% c nucleotides. These immunostimulatory nucleic acids function in a similar manner to nucleic acids containing CpG motifs. The invention also encompasses preferred CpG nucleic acids.
    Type: Grant
    Filed: December 9, 2002
    Date of Patent: September 18, 2007
    Assignees: University of Iowa Research Foundation, Coley Pharmaceutical GmbH
    Inventors: Arthur M. Krieg, Jörg Vollmer, Christian Schetter
  • Patent number: 7223741
    Abstract: Nucleic acid sequences containing unmethylated CpG dinucleotides that modulate an immune response including stimulating a Th1 pattern of immune activation, cytokine production, NK lytic activity, and B cell proliferation are disclosed. The sequences are also useful a synthetic adjuvant.
    Type: Grant
    Filed: July 14, 2003
    Date of Patent: May 29, 2007
    Assignee: University of Iowa Research Foundation
    Inventor: Arthur M. Krieg
  • Patent number: 6949520
    Abstract: Methods and compositions are provided for extending the clinical utility of IFN-? in the treatment of a variety of viral and proliferative disorders. Among other aspects, the invention provides methods which increase the efficacy of IFN-? treatment and reduce IFN-? treatment-related side effects. In addition, methods are provided for supporting the survival and for activating natural interferon producing cells (IPCs) in vitro without exogenous IL-3 or GM-CSF. The invention is based on the discovery that certain CpG and non-CpG ISNAs promote survival and stimulation of IPCs.
    Type: Grant
    Filed: September 27, 2000
    Date of Patent: September 27, 2005
    Assignees: Coley Pharmaceutical Group, Inc., University of Iowa Research Foundation, Coley Pharmaceutical GmbH
    Inventors: Gunther Hartmann, Robert L. Bratzler, Arthur M. Krieg
  • Patent number: 6821957
    Abstract: The present invention shows that DNA vaccine vectors can be improved by removal of CpG-N motifs and optional addition of CpG-S motifs. In addition, for high and long-lasting levels of expression, the optimized vector should include a promoter/enhancer that is not down-regulated by the cytokines induced by the immunostimulatory CpG motifs. Vectors and methods of use for immununostimulation are provided herein. The invention also provides improved gene therapy vectors by determining the CpG-N and CpG-S motifs present in the construct, removing stimulatory CpG (CpG-S) motifs and/or inserting neutralizing CpG (CpG-N) motifs, thereby producing a nucleic acid construct providing enhanced expression of the therapeutic polypeptide. Methods of use for such vectors are also included herein.
    Type: Grant
    Filed: September 26, 2001
    Date of Patent: November 23, 2004
    Assignee: University of Iowa Research Foundation
    Inventors: Arthur M. Krieg, Heather L. Davis, Tong Wu, Schorr Joachim
  • Publication number: 20040229835
    Abstract: Nucleic acids containing unmethylated CpG dinucleotides and therapeutic utilities based on their ability to stimulate an immune response and to redirect a Th2 response to a response in a subject are disclosed. Methods for treating atopic diseases, including atopic dermatitis, are disclosed.
    Type: Application
    Filed: June 24, 2004
    Publication date: November 18, 2004
    Applicants: The University of Iowa Research Foundation, Coley Pharmaceutical Group, Inc., United States of America, as represented by the Secretary, Department of Health & Human Services
    Inventors: Arthur M. Krieg, Joel Kline, Dennis Klinman, Alfred D. Steinberg
  • Publication number: 20040198688
    Abstract: Nucleic acids containing unmethylated CpG dinucleotides and therapeutic utilities based on their ability to stimulate an immune response and to redirect a Th2 response to a Th1 response in a subject are disclosed. Methods for treating atopic diseases, including atopic dermatitis, are disclosed.
    Type: Application
    Filed: April 2, 2004
    Publication date: October 7, 2004
    Applicants: The University of Iowa Research Foundation, Coley Pharmaceutical Group, Inc., U.S.A., as represented by the Secretary, Department of Health & Human Services
    Inventors: Arthur M. Krieg, Joel Kline, Dennis Klinman, Alfred D. Steinberg
  • Publication number: 20040198680
    Abstract: The invention provides an immunostimulatory nucleic acid comprising CpG motifs, and methods of use thereof in stimulating immunity.
    Type: Application
    Filed: July 3, 2003
    Publication date: October 7, 2004
    Applicant: Coley Pharmaceutical Group, Inc.
    Inventor: Arthur M. Krieg
  • Publication number: 20040186067
    Abstract: The present invention shows that DNA vaccine vectors can be improved by removal of CpG-N motifs and optional addition of CpG-S motifs. In addition, for high and long-lasting levels of expression, the optimized vector should include a promoter/enhancer that is not down-regulated by the cytokines induced by the immunostimulatory CpG motifs. Vectors and methods of use for immunostimulation are provided herein. The invention also provides improved gene therapy vectors by determining the CpG-N and CpG-S motifs present in the construct, removing stimulatory CpG (CpG-S) motifs and/or inserting neutralizing CpG (CpG-N) motifs, thereby producing a nucleic acid construct providing enhanced expression of the therapeutic polypeptide. Methods of use for such vectors are also included herein.
    Type: Application
    Filed: September 26, 2001
    Publication date: September 23, 2004
    Inventors: Arthur M. Krieg, Heather L. Davis, Tong Wu, Joachim Schorr
  • Publication number: 20040181045
    Abstract: Oligonucleotides containing unthylated CpG dinucleotides and therapeutic utilities based on their ability to stimulate an immune response in a subject are disclosed. Also disclosed are therapies for treating diseases associated with immune system activation that are initiated by unthylated CpG dinucleotides in a subject comprising administering to the subject oligonucleotides that do not contain unmethylated CpG sequences (i.e. methylated CpG sequences or no CpG sequence) to outcompete unmethylated CpG nucleic acids for binding. Further disclosed are methylated CpG containing dinucleotides for use antisense therapies or as in vivo hybridization probes, and immunoinhibitory oligonucleotides for use as antiviral therapeutics.
    Type: Application
    Filed: February 26, 2004
    Publication date: September 16, 2004
    Applicants: University of Iowa Research Foundation, Coley Pharmaceutical Group, Inc., The United States of America, as represented by the Secretary, Dept. of Health and Human Services
    Inventors: Arthur M. Krieg, Dennis Klinman, Alfred D. Steinberg
  • Publication number: 20040171150
    Abstract: Oligonucleotides containing unthylated CpG dinucleotides and therapeutic utilities based on their ability to stimulate an immune response in a subject are disclosed. Also disclosed are therapies for treating diseases associated with immune system activation that are initiated by unthylated CpG dinucleotides in a subject comprising administering to the subject oligonucleotides that do not contain unmethylated CpG sequences (i.e. methylated CpG sequences or no CpG sequence) to outcompete unmethylated CpG nucleic acids for binding. Further disclosed are methylated CpG containing dinucleotides for use antisense therapies or as in vivo hybridization probes, and immunoinhibitory oligonucleotides for use as antiviral therapeutics.
    Type: Application
    Filed: February 26, 2004
    Publication date: September 2, 2004
    Applicants: University of Iowa Research Foundation, Coley Pharmaceutical Group, Inc., The USA, as represented by the Secretary, Department of Health and Human Services
    Inventors: Arthur M. Krieg, Dennis Klinman, Alfred D. Steinberg
  • Publication number: 20040171571
    Abstract: The invention relates to a class of CpG immunostimulatory oligonucleotides containing a 5′TCG motif or a CG at or near the 5′ end that are useful for stimulating an immune response.
    Type: Application
    Filed: December 11, 2003
    Publication date: September 2, 2004
    Applicants: Coley Pharmaceutical Group, Inc., Coley Pharmaceutical GmbH
    Inventors: Arthur M. Krieg, Marion Jurk, Jorg Vollmer, Eugen Uhlmann
  • Publication number: 20040167089
    Abstract: Nucleic acids containing unmethylated CpG dinucleotides and therapeutic utilities based on their ability to stimulate an immune response and to redirect a Th2 response to a Th1 response in a subject are disclosed. Methods for treating atopic diseases, including atopic dermatitis, are disclosed.
    Type: Application
    Filed: January 30, 2004
    Publication date: August 26, 2004
    Applicants: The University of Iowa Research Foundation, Coley Pharmacuetical Group, Inc., The USA as represented by the Secretary, Dept. of Health and Human Services
    Inventors: Arthur M. Krieg, Joel Kline, Dennis Klinman, Alfred D. Steinberg
  • Publication number: 20040162262
    Abstract: Oligonucleotides containing unthylated CpG dinucleotides and therapeutic utilities based on their ability to stimulate an immune response in a subject are disclosed. Also disclosed are therapies for treating diseases associated with immune system activation that are initiated by unthylated CpG dinucleotides in a subject comprising administering to the subject oligonucleotides that do not contain unmethylated CpG sequences (i.e. methylated CpG sequences or no CpG sequence) to outcompete unmethylated CpG nucleic acids for binding. Further disclosed are methylated CpG containing dinucleotides for use antisense therapies or as in vivo hybridization probes, and immunoinhibitory oligonucleotides for use as antiviral therapeutics.
    Type: Application
    Filed: February 26, 2004
    Publication date: August 19, 2004
    Applicants: University of Iowa Research Foundation, Coley Pharmacuetical Group, Inc., The U.S.A., as represented by the Secretary, Department of Health and Human Services
    Inventors: Arthur M. Krieg, Dennis Klinman, Alfred D. Steinberg