Abstract: A method for managing electromagnetic interference (EMI) includes: obtaining a request; in response to the request: terminating EMI generation by EMI emitting devices in an EMI suppressed internal volume of a data processing device to place the EMI emitting devices in a quiet state; placing the EMI suppressed internal volume into an EMI suppression compromised state to obtain access to the EMI emitting devices in the quiet state; replacing one of the EMI emitting devices in the quiet state, to obtain updated EMI emitting devices, while: the EMI suppressed internal volume is in the EMI suppression compromised state, and the EMI emitting devices are in the quiet state; placing the EMI suppressed internal volume into an EMI suppressed state after replacing the one of the EMI emitting devices; and enabling EMI generation by the updated EMI emitting devices to place the updated EMI emitting devices into an active state.

Abstract: A plurality of computing devices are communicatively coupled to each other via a network, and each of the plurality of computing devices is operably coupled to one or more of a plurality of storage devices. A plurality of failure resilient address spaces are distributed across the plurality of storage devices such that each of the plurality of failure resilient address spaces spans a plurality of the storage devices. The plurality of computing devices maintains metadata that maps each failure resilient address space to one of the plurality of computing devices. The metadata is grouped into buckets. Each bucket is stored in a group of computing devices. However, only the leader of the group is able to directly access a particular bucket at any given time.

Abstract: A device which runs software applications includes a network interface, a non-transitory computer readable storage medium and at least one processor. The device identifies that a link for installation of a new software application is selected by user interaction with a software application that is running on the device. In response to the identification, an installation client is invoked to run in the background on the device without exiting the currently-running software application. The installation client is instructed to automatically download an installation file of the new software application over the network using the network interface. The new software application is installed on the device using the downloaded installation file.

Abstract: The present invention relates to the use of limited amounts of cysteine and tryptophan in the cell culture medium during production of recombinant proteins, and in particular antibodies. Proteins and antibodies produced under such controlled conditions exhibit reduced heterogeneity, in particular reduced charge variants heterogeneity.

Abstract: A method of unlearning a training example from a neural network, comprising: during training of the neural network on a training dataset, recording a plurality of recordings in a recording dataset, wherein a recording includes weight values of the neural network at the time at which the recording is recorded, selecting an unlearning training example to unlearn from the neural network, computing a total-loss value of a change in a loss function for each of plurality of training examples induced by a change of weights of the neural network in response to the unlearning training example, determining a certain recording to use to remove the unlearning training example according to the total-loss values, and re-training the neural network from the determined certain recording using an adapted training dataset excluding the unlearning training example; and producing an unlearned neural network.

Abstract: An alignment mechanism has a base with a front right quadrant, a front left quadrant, a rear right quadrant, and a rear left quadrant. The base further defines a yaw axis and a pitch axis. A ball and socket linkage is located on the base at either the front right quadrant or front left quadrant at the intersection of the yaw axis and the pitch axis. A pressure plate assembly is also on the bottom surface of the base at the other of the front right quadrant and front left quadrant. A spring is in contact with one of the rear right quadrant and rear left quadrant and kitty-corner with the ball and socket linkage, with a yaw alignment surface on the other of the rear right quadrant and rear left quadrant. A pitch alignment surface is also on one of the rear right quadrant and rear left quadrant.

Abstract: An alignment mechanism uses two adjustment plates. A first adjustment plate is pivotal about a first adjustment axis and a second adjustment plate is rotatable about a second adjustment axis. The first and second adjustment axes are perpendicular to one another. The first plate has a front portion through which the first adjustment axis passes and a rear portion having a first alignment surface and a tension spring secured to the rear portion opposite the first alignment surface. The second adjustment plate has a front portion and a rear portion having a second alignment surface and a tension spring secured between the second alignment surface and the rear portion of the first adjustment plate.

Abstract: A receipt capture tool residing on a customer mobile device may be initiated when a customer completes an in-store or online purchase. The receipt capture tool may prompt the customer to capture an image of a receipt detailing a purchase and an item (e.g., product or service) purchased. For instance, the photo of a physical receipt may be taken by the mobile device, or an electronic receipt or email detailing the purchasing transmitted from a physical merchant or online merchant server may be stored. Receipt information may be extracted and saved with other information pertinent to the item purchased, including warranty information. If the customer needs to return or repair the item purchased at a future date, the receipt and warranty information may be subsequently accessed via their mobile device. The receipt and warranty information may also be stored in a searchable database to facilitate easy retrieval by the customer.

Abstract: A tool holder includes a tool shank and a tool head connected to the tool shank. The tool head has a rear surface. An insert seat or a blade pocket is partially formed on both the tool head and the tool shank, and extends rearwardly of the tool head's rear surface. Adjacent to at least a portion of a shank side surface there is a reinforcement portion connecting the shank side surface and the tool head.

Abstract: Techniques related to distributing the video encoding processing of an input video across hardware and software systems. Such techniques include evaluating the content of the video and determine whether or the encoding operation is best to be done on the hardware system only, software system only or a hybrid hardware and software system.

Abstract: Systems and methods for imaging a body part during a medical procedure e.g., by imaging the body part using at least one image capture unit, where the image capture unit is configured to sense light at least in the IR spectrum; illuminating at least a portion of the body part with light in the infrared (IR) spectrum, using at least one IR light source such that IR illumination of at least one of the at least one IR light source is coaxial with an optical axis of one of the at least one image capture unit; and outputting imagery data emanating from the at least one image capture unit for displaying thereof.

Abstract: In one implementation, a method for providing security on controllers includes detecting computer-readable code running on a controller, the computer-readable code including code portions that each include instructions to be performed by the controller; identifying a current code portion of the computer-readable code; accessing an in-memory graph that models an operational flow of the computer-readable code, wherein the in-memory graph includes a plurality of nodes, each of the nodes corresponding to one of the code portions and each of the nodes having a risk value for the associated code portion that is a measure of security risk for the associated code portion; identifying the risk value for the current code portion; selecting, from a plurality of available flow control integrity (IMV) schemes, an IMV scheme based on the identified risk value; and applying, to the code portion as the code portion is running on the controller, the selected IMV scheme.

Abstract: A method for manufacturing a first optoelectronic device operating at a wavelength ?1 and a second optoelectronic device operating at a wavelength ?2>?1, the first device comprising a first stack comprising a first encapsulation layer of thickness e10 and layers of thickness eli (i=1 . . . n), and the second device comprising a second stack comprising a second encapsulation layer of thickness e20 and layers of thickness e2i (i=1 . . . n). The method includes forming the second stack by sizing the thicknesses e20 and e2i according to ?2, forming the first stack by sizing the thicknesses eli by homothety and adjusting the thickness e10 such that the stacks have the same height, and performing out one same technological step on the stacks.

Abstract: Treatments and methods for inhibiting late Na current use fibroblast growth factor homologous factor (FHF), an endogenous channel modulator, to inhibit late Na current with high potency. A minimal effector domain is engineered within FHF (the “FHF-inhibiting-X-region” (FixR)) as a peptide inhibitor of late Na current that may be delivered intracellularly, for example as a cell-penetrating peptide, or via viral or plasmid delivery. As a non-limiting example, human adenovirus type 5 may be genetically modified with the sequence 5?-ATGGCTGCGGCGATAGCCAGCTCCTTGATCCGGCAGAAGCGGCAGGCGAGGGAG TCCAACAGCGACCGAGTGTCGGCCTCCAAGCGCCGCTCCAGCCCCAGCAAAGAC GGGCGCTCC-3? (SEQ ID NO: 1).

Abstract: Methods, devices, and systems for segmenting and annotating videos for analysis are disclosed. A user identifies specific moments of the video that provide a teachable moment. A pre-context and a post-context portion of the video surrounding the identified moment are used to create a tile video. One or more tile videos are compiled in a user-defined order to generate a weave video with a specific focus or theme. The generated weave video is shared with one or more users and can be annotated to facilitate teaching and/or discussion.

Abstract: A method includes identifying a printing location of a first set of alignment marks on a wafer outside a geometric shadow defined by a numerical aperture and a die height of a die. The method includes fabricating an overlay metrology target by printing the first set of alignment marks based on the identified print location and printing a second set of alignment marks on a surface of the die. The method includes identifying a metrology recipe including a set of measurement parameters, where the set of measurement parameters include at least a focal position of an objective lens. The focal position of the objective lens may be a predetermined distance below a top surface of the die defined by a maximal numerical aperture and the die height of the die. The method includes measuring overlay of the overlay metrology target in accordance with the identified metrology recipe.

Abstract: The present invention relates to the field of fermentation and in particular to methods of improving the flavour and quality of beer produced by fermentation.

Abstract: The present invention concerns computer-implemented methods for use in lateral flow test evaluation. One embodiment of such a method comprises obtaining, preferably by a mobile electronic device (110), a digital image (202) that depicts at least one test cassette (100), wherein the test cassette (100) comprises at least one viewport (102) and wherein the viewport (102) comprises at least one test indicator (104). The method may comprise performing, preferably by the mobile electronic device (110), an image segmentation step (204) to recognize at least one test indicator (104) depicted in the digital image (202), and performing an evaluation step (206) for producing at least one evaluation result (208) based, at least in part, on the recognized at least one test indicator (104).

Abstract: An unmanned aerial vehicle (UAV) is disclosed. The UAV comprises a body; a propulsion unit; a controller; and at least one adjustable camera unit. In some embodiments, each adjustable camera unit comprises, a camera; and a gimbal, mounting the camera, and configured to move the field of view (FOV) of the camera in at least two axes. In some embodiments, the controller is configured to: continuously receive a stream of images from the at least one camera; identify a tilted target in the stream of images; control the propulsion unit to approach the tilted target; and simultaneously control at least one gimble to rotate a corresponding camera such that the tilted target is continuously being identified in the stream of images.

Abstract: A method and system includes a network interface and a processor. The processor is configured to augment third-party code, via the network interface, with auxiliary code implementing a process for facilitating enforcement of one or more computer-usage rules, such that execution of the third-party code carries out the process. Other embodiments are also described.