Abstract: A sealing assembly for a battery cell cap having an access port is described. The sealing assembly includes a fastener with an enlarged head defining a cupped opening and the outside diameter of the enlarged head being greater than the diameter of the access port. The enlarged head is connected to an elongated body with an outside diameter being less than the diameter of the access port. The fastener is configured to be driven by a broaching member exerting a force on walls of the cupped opening within the enlarged head that causes an expansion of the outside diameter of the fastener to tightly engage and seal the access port of the battery cell cap.

Abstract: A glass syringe barrel is provided that has an at least partially conically shaped upper portion and a longitudinal axis. The glass syringe barrel has a top end through which a liquid can be ejected and a bottom end into which a plunger stopper can be pushed. The glass syringe barrel includes, in a direction from the top end to the bottom end, a cone, a shoulder region, and a body region. The shoulder region has and outer contour that has a concave and substantially circular arc-shaped area c1 with an outer radius r1. The outer contour of the glass syringe barrel in the shoulder region is defined by a certain minimum value the radius of curvature.

Abstract: A glass syringe barrel is provided that has an at least partially conically shaped upper portion and a longitudinal axis. The glass syringe barrel has a top end through which a liquid can be ejected and a bottom end into which a plunger stopper can be pushed. The glass syringe barrel includes, in a direction from the top end to the bottom end, a cone, a shoulder region, and a body region. The shoulder region has and outer contour that has a concave and substantially circular arc-shaped area c1 with an outer radius r1. The outer contour of the glass syringe barrel in the shoulder region is defined by a certain value for r1.

Abstract: A system for managing multiple parallel library preparation workflows with shared resources includes at least two assay bays configured to prepare a library of samples according to a workflow. A common resource is configured to assist in preparation of the library of samples according to a common resource schedule. The system also includes a scheduler for scheduling workflows according to the common resource schedule. The system receives a first workflow scheduling request for a first assay bay that utilizes the common resource, and a second workflow scheduling request for a second assay bay that utilizes the common resource. The system determines that the first and second workflows conflict in time or space with respect to the common resource, obtains characteristics of the first and second workflows, and assigns the first and second workflows to the common resource schedule based on the characteristics to resolve the conflict.

Abstract: A glass container is provided having a glass tube with a first end and a second end and a glass bottom closing the second end. The glass tube has a longitudinal axis and has, in a direction from the first to the second end, a top region, a junction region, a neck region, a shoulder region, and a body region. The top region is at the first end and has an outer diameter (dt), the neck region has an outer diameter (dn) with dn<dt, the body region extends to the second end and has an outer diameter (db) with db>dt, and the glass tube in the body region has a thickness (lb). The outer contour in a transition area between the top and neck regions is defined by a radius of curvature. The glass containers have a neck squeeze test load of at least 1100 N.

Abstract: There is provided a control system for controlling a system, the control system comprising one or more controllers, configured to: receive a rule configuration signal, the rule configuration signal specifying properties of a rule, the properties comprising an indicator of an action to be carried out and at least one associated trigger condition; store the indicator of the action and the at least one associated trigger condition at a storage location; determine whether the rule is to be evaluated by the control system; and if the determination indicates that the rule is to be evaluated by the control system, and upon the at least one associated trigger condition being met: generate at least one control signal in accordance with the indicated action; and output the at least one control signal to at least one vehicle system to be controlled.

Abstract: A system and method for dynamically discounting trade debt through the use of a forward auction is provided. In one example, a system that allows a seller to auction inventory to a plurality of bidders. According to this embodiment, the system may determine eligibility for acceptance of bids submitted by the bidders and a plurality of bids may be determined to be eligible for acceptance. Further, a margin by which the bids are acceptable may be determined and a representation of the margin may be communicated. In another example, a method is provided for discounting debt using an auction system. According to this embodiment, a seller may configure an auction event with auction parameters, such as hurdle rates, that will best serve the goals of the auction. The seller may alter event parameters while the event is ongoing, thus further enhancing the ability of the seller to meet auction objectives.

Abstract: A system and method for dynamically discounting trade debt through the use of a forward auction is provided. In one example, a system that allows a seller to auction inventory to a plurality of bidders. According to this embodiment, the system may determine eligibility for acceptance of bids submitted by the bidders and a plurality of bids may be determined to be eligible for acceptance. Further, a margin by which the bids are acceptable may be determined and a representation of the margin may be communicated. In another example, a method is provided for discounting debt using an auction system. According to this embodiment, a seller may configure an auction event with auction parameters, such as hurdle rates, that will best serve the goals of the auction. The seller may alter event parameters while the event is ongoing, thus further enhancing the ability of the seller to meet auction objectives.

Abstract: Library preparation systems and methods are disclosed. In an implementation, a modular bay for preparing a library of samples for sequencing, the modular bay comprising a contact dispenser and a working area comprising a working plate receptacle adapted to receive a working plate, a thermocycler, a magnet, and a drawer. The drawer comprising a consumables area adapted to receive a sample plate adapted to contain a sample, and a plurality of consumables for interacting with the sample in the working plate. The contact dispenser is linearly movable in a longitudinal direction between the consumables area and the working area, such that the contact dispenser is configured to (i) move the sample from the sample plate in the consumables area to the working plate in the working area, and (ii) move the plurality of consumables between the consumables area and the working plate in the working area.

Abstract: A glass syringe barrel is provided that has an at least partially conically shaped upper portion and a longitudinal axis. The glass syringe barrel has a top end through which a liquid can be ejected and a bottom end into which a plunger stopper can be pushed. The glass syringe barrel includes, in a direction from the top end to the bottom end, a cone, a shoulder region, and a body region. The shoulder region has and outer contour that has a concave and substantially circular arc-shaped area ci with an outer radius r1. The outer contour of the glass syringe barrel in the shoulder region is defined by a certain value for r1.

Abstract: A glass syringe barrel is provided that has an at least partially conically shaped upper portion and a longitudinal axis. The glass syringe barrel has a top end through which a liquid can be ejected and a bottom end into which a plunger stopper can be pushed. The glass syringe barrel includes, in a direction from the top end to the bottom end, a cone, a shoulder region, and a body region. The shoulder region has and outer contour that has a concave and substantially circular arc-shaped area c1 with an outer radius r1. The outer contour of the glass syringe barrel in the shoulder region is defined by a certain value for r1.

Abstract: A method for producing a container includes identifying a location at a body, with the body at this location having a stress parameter which has a value less than or equal to a threshold value. The identifying includes deriving the threshold value from a simulation result of a simulation based on a finite element method of the stress parameter for a surface area and/or a volume area of the body with or without a marking element present, the identifying also includes obtaining a mean value by the simulation for the stress parameter for at least a part of at least one of the surface area or the volume area of the body. The threshold value is a sum of the mean value and 1000 % or less of an absolute value of the mean value. A marking element is provided which allows identification of the container at the identified location.

Abstract: A glass syringe barrel is provided that has an at least partially conically shaped upper portion and a longitudinal axis. The glass syringe barrel has a top end through which a liquid can be ejected and a bottom end into which a plunger stopper can be pushed. The glass syringe barrel includes, in a direction from the top end to the bottom end, a cone, a shoulder region, and a body region. The shoulder region has and outer contour that has a concave and substantially circular arc-shaped area c1 with an outer radius r1. The outer contour of the glass syringe barrel in the shoulder region is defined by a certain minimum value the radius of curvature.

Abstract: A system and method for the dynamic discovery of prices through the use of an auction is provided. In one embodiment, the system allows a seller to auction homogenous assets or liabilities to a plurality of bidders. The assets or liabilities may be organized in baskets by maturity, by geographic location, by type, by a property, etc. The system may determine the eligibility for acceptance of bids submitted by the bidders and a plurality of bids may be determined to be eligible for acceptance using the same or different criteria. Further, a margin by which the bids are acceptable may be determined and a representation of the margin may be communicated to the seller or a bidder. The seller may configure an auction event with auction parameters, such as bid floors and hurdle rates and may alter event parameters while the auction is ongoing.

Abstract: A glass container is provided having a glass tube with a first end and a second end and a glass bottom closing the second end. The glass tube has a longitudinal axis and has, in a direction from the first to the second end, a top region, a junction region, a neck region, a shoulder region, and a body region. The top region is at the first end and has an outer diameter (dt), the neck region has an outer diameter (dn) with dn<dt, the body region extends to the second end and has an outer diameter (db) with db>dt, and the glass tube in the body region has a thickness (lb). The outer contour in a transition area between the top and neck regions is defined by a radius of curvature. The glass containers have a neck squeeze test load of at least 1100 N.

Abstract: A glass syringe barrel is provided that has an at least partially conically shaped upper portion and a longitudinal axis. The glass syringe barrel has a top end through which a liquid can be ejected and a bottom end into which a plunger stopper can be pushed. The glass syringe barrel includes, in a direction from the top end to the bottom end, a cone, a shoulder region, and a body region. The shoulder region has and outer contour that has a concave and substantially circular arc-shaped area c1 with an outer radius r1. The outer contour of the glass syringe barrel in the shoulder region is defined by a certain minimum value the radius of curvature.

Abstract: A method to predict an increased risk of a greater susceptibility to a metal implant sensitivity in a test person. The method includes providing an isolated sample with a genetic material of the test person, and examining a single nucleotide polymorphism rs1143627 SEQ?ID?NO:?1 AGCCTCCTACTTCTGCTTTTGAAAGC[C/T]ATAAAA ACAGCGAGGGAGAACTGG,? in a gene coding for interleukin 1 beta and ascertaining whether a C is present at a position of the single nucleotide polymorphism, and/or examining a VNTR polymorphism rs2234663 with the repeat SEQ?ID?NO:?2 ATCCTGGGGAAAGTGAGGGAAATATGGACATCACATGGAACAACAT CCAGGAGACTCAGGCCTCTAGGAGTAACTGGGTAGTGTGC, in a gene coding for a IL1 receptor antagonist, IL1-RN and ascertaining whether the repeat is present five times.

Abstract: A system for account mapping includes functionality for obtaining more than one labeled accounts labeled by more than one accountant; pre-processing more than one labeled accounts using natural language processing, using the more than one pre-processed labeled accounts to train an account mapping model that performs multinomial classification; receiving an account name from an accounting application where the account name includes a text label for an account included in a chart of accounts; generating an account mapping by applying the account mapping model to the account name, where the account mapping includes a type of the account, a sub-type of the account, a code, and a series associated with an accounting form; returning the account mapping to the accounting application through an Application Programming Interface (API); and receiving a corrected account mapping from an accountant and using the corrected account mapping as a new text label to incrementally update the account mapping model.

Abstract: A thermally tempered glass element is provided made of glass with two opposite faces that are under compressive stress of at least 40 MPa. The glass has a working point at which the glass has a viscosity of 104 dPa·s of at most 1350° C. The glass has a viscosity versus temperature profile and a coefficient of thermal expansion versus temperature profile of the glass are such that a variable (750° C.-T13)/(CTELiq-CTEsSol) has a value of at most 5*106 K2. The CTELiq is a coefficient of linear thermal expansion of the glass above a glass transition temperature Tg, the CTESol is a coefficient of linear thermal expansion of the glass in a temperature range from 20° C. to 300° C., and the T13 is a temperature at which the glass has a viscosity of 1013 dPa·s.