Patents by Inventor Peter Thomas

Peter Thomas has filed for patents to protect the following inventions. This listing includes patent applications that are pending as well as patents that have already been granted by the United States Patent and Trademark Office (USPTO).

  • Publication number: 20230325306
    Abstract: Testing software applications is routinely limited by time or testing iterations rather than exhaustively testing ever possible permutation of inputs or execution paths. By configuring a testing device to only perform relevant tests, the test results are more meaningful (e.g., few false-positives) and relevant to the application. Additional effects include reduced processing times and storage requirements. As described herein, source code is analyzed to determine elements that indicate a particular environment for the source code's corresponding machine code. When the source code indicates that a particular environment is not a candidate for execution of the machine code, tests associated with that particular environment are excluded. The testing device is then configured to perform those tests, either statically or dynamically, that are relevant for those environments that actually apply.
    Type: Application
    Filed: April 8, 2022
    Publication date: October 12, 2023
    Applicant: MICRO FOCUS LLC
    Inventors: Alexander Hoole, James Wesley Rabon, Peter Thomas Blay
  • Publication number: 20230318274
    Abstract: The present disclosure provides descriptions of electrical box assemblies for supporting heavy fixtures, such as ceiling fans, and facilitating electrical connections to the fixtures. The electrical box assembly includes an electrical box that allows a connection between the box and electrical conduits and a connection, e.g., a weatherproof connection, with a housing of the fixture. The box has an open front face to house electrical connections between the fixture and wires supplying electrical power to the box via the conduits. The box has a bottom wall and an open front face. A reinforcement member fits within the electrical box and includes a panel shaped to conform to at least a portion of the bottom wall and one or more standoffs extending toward the open front face of the box. When the reinforcement member is positioned within the box, mounting holes in the bottom wall of the box and reinforcement member are aligned to allow the box to be attached to a building structure.
    Type: Application
    Filed: June 2, 2023
    Publication date: October 5, 2023
    Inventor: Jason Peter Thomas
  • Publication number: 20230296138
    Abstract: A ball-CV style transmission suitable for use in a Positive Displacement Motor (PDM). A shaft provides shaft wings received into housing receptacles on a housing. A Unitary Torque Transfer Element (UTTE) is interposed between each shaft wing and housing within each housing receptacle, with a spherical surface on the UTTE received into a recess preferably on the housing. The UTTEs float within their corresponding housing receptacles so as to maintain torque transfer contact between all thrust surfaces during articulated rotation of the shaft with respect to the housing. The UTTEs preferably float generally radially towards the shaft centerline as angular deflection increases during articulated rotation.
    Type: Application
    Filed: May 24, 2023
    Publication date: September 21, 2023
    Inventors: Jing Lu, Peter Thomas Cariveau, Damon T. Landrum, Steven C. Gaare
  • Patent number: 11760313
    Abstract: A sensor pod system includes one or more sensor pods with a plurality of sensors configured to collect data from an environment. The sensor pod system may include a cleaning system to clean sensing surfaces of sensor pods during operation. The sensor pod system may include sensors of different types and modalities. Sensor pods of the sensor pod system may be modularly installed on a vehicle, for example, an autonomous vehicle and collect and provide data of the environment during operation of the vehicle.
    Type: Grant
    Filed: April 30, 2020
    Date of Patent: September 19, 2023
    Assignee: Zoox, Inc.
    Inventors: Derek Adams, Daniel Glenn Johnson, Christopher William Labadie, Ryan McMichael, Daniel Miller, Peter Thomas Mitros, Anubhav Thakur, Joseph Patrick Warga, Austin In-Jei Yi
  • Publication number: 20230278745
    Abstract: A glass container is provided having a glass tube with a first end and a second end and a glass bottom closing the second end. The glass tube has a longitudinal axis and has, in a direction from the first to the second end, a top region, a junction region, a neck region, a shoulder region, and a body region. The top region is at the first end and has an outer diameter (dt), the neck region has an outer diameter (dn) with dn<dt, the body region extends to the second end and has an outer diameter (db) with db>dt, and the glass tube in the body region has a thickness (lb). The outer contour in a transition area between the top and neck regions is defined by a radius of curvature. The glass containers have a neck squeeze test load of at least 1100 N.
    Type: Application
    Filed: February 15, 2023
    Publication date: September 7, 2023
    Applicant: SCHOTT AG
    Inventors: Andreas Langsdorf, Florian Maurer, Peter Thomas, Alexander Humbertjean, Tobias Wetzel, Hanspeter Kummer
  • Publication number: 20230281086
    Abstract: A method of database recovery includes starting a first database server, starting a second database server, starting a third database server, and starting an application server after starting the first database server, the second database server, and the third. The first, second, and third database servers are configured to store data according to first, second, and third database management systems, respectively, and the application server is configured to run application modules of a set of application modules. The method of database recovery further includes starting a search module, starting a product catalog management module, starting a web connectivity module after starting the search module, starting a graphical user interface module after starting the web connectivity module, and starting at least one business operations module.
    Type: Application
    Filed: March 4, 2022
    Publication date: September 7, 2023
    Inventors: Shana Meyers, Meghasyam Bokam, Ian Bundock, Larry N. Cotten, JR., Jason Fleck, Jason Garland, David Gilboy, Jeffrey J. Hodges, Chun-Kai Jason Hsu, Lori McFadden, Peter Thomas McLean, Abhijit Moharil
  • Patent number: 11737794
    Abstract: In some embodiments, a spinal stabilization system may be formed in a patient using quick-connect sleeve assemblies. Each quick-connect sleeve assembly can be coupled to a bone fastener assembly in a fast and intuitive way. In one embodiment, a quick-connect sleeve assembly has a detachable member and a movable member. Both members engage a collar of the bone fastener assembly. In one embodiment, the engagement can be locked via one or more locking features to facilitate screwing a bone fastener of the bone fastener assembly onto a vertebral body in a minimally invasive surgical procedure. Each quick-connect sleeve assembly has a low profile and is particularly shaped for minimally invasive entry.
    Type: Grant
    Filed: February 11, 2021
    Date of Patent: August 29, 2023
    Assignee: Zimmer Spine, Inc.
    Inventors: Michael E. Landry, Larry T. Khoo, Charles R. Forton, Brian Bergeron, Bruce A. Riceman, Peter Thomas Miller, Kameron Scott Ely
  • Publication number: 20230259488
    Abstract: Example implementations relate to metadata operations in a storage system. An example includes a machine-readable medium storing instructions that upon execution cause a processor to: receive a data stream to be stored in persistent storage of a deduplication storage system; store data units of the data stream in a container entity group object according to arrival time, where the data units of the container entity group object are referenced by a plurality of container indexes; generate a data index to list each container index that references at least one data unit included in the container entity group object; and in response to a determination that the total size of the container entity group object exceeds the threshold size, transfer the container entity group object from memory to the persistent storage.
    Type: Application
    Filed: January 25, 2022
    Publication date: August 17, 2023
    Inventors: Richard Phillip Mayo, Peter Thomas Camble, David Malcolm Falkinder
  • Publication number: 20230233769
    Abstract: A glass syringe barrel is provided that has an at least partially conically shaped upper portion and a longitudinal axis. The glass syringe barrel has a top end through which a liquid can be ejected and a bottom end into which a plunger stopper can be pushed. The glass syringe barrel includes, in a direction from the top end to the bottom end, a cone, a shoulder region, and a body region. The shoulder region has and outer contour that has a concave and substantially circular arc-shaped area c1 with an outer radius r1. The outer contour of the glass syringe barrel in the shoulder region is defined by a certain minimum value the radius of curvature.
    Type: Application
    Filed: February 26, 2023
    Publication date: July 27, 2023
    Applicant: SCHOTT AG
    Inventors: Roman Oberhänsli, Ivo Andreoli, Martha Strassmann, Andreas Langsdorf, Peter Thomas
  • Patent number: 11710952
    Abstract: The present disclosure provides descriptions of electrical box assemblies for supporting heavy fixtures, such as ceiling fans, and facilitating electrical connections to the fixtures. The electrical box assembly includes an electrical box that allows a connection between the box and electrical conduits and a connection, e.g., a weatherproof connection, with a housing of the fixture. The box has an open front face to house electrical connections between the fixture and wires supplying electrical power to the box via the conduits. The box has a bottom wall and an open front face. A reinforcement member fits within the electrical box and includes a panel shaped to conform to at least a portion of the bottom wall and one or more standoffs extending toward the open front face of the box. When the reinforcement member is positioned within the box, mounting holes in the bottom wall of the box and reinforcement member are aligned to allow the box to be attached to a building structure.
    Type: Grant
    Filed: May 19, 2021
    Date of Patent: July 25, 2023
    Assignee: HUBBELL INCORPORATED
    Inventor: Jason Peter Thomas
  • Patent number: 11692911
    Abstract: An adapted elastomer compound, in which the adaptation is based at least in part on load performance data of a rotor/stator test coupon as evaluated on a test apparatus. The test coupon's stator section includes the original elastomer compound before adaptation thereof. The test apparatus includes a motor, a brake, and at least one sensor disposed to evaluate load performance data of the test coupon. The load performance data is the product of the process comprising the steps of: (a) rotating either the rotor section or the stator section on the test apparatus, wherein such rotation section actuates corresponding rotation of the other of the rotor section and the stator section; (b) applying a braking torque to the actuated rotor section or stator section; and (c) responsive to step (b), evaluating load performance data of the test coupon.
    Type: Grant
    Filed: November 13, 2020
    Date of Patent: July 4, 2023
    Assignee: Abaco Drilling Technologies LLC
    Inventors: Peter Thomas Cariveau, Timothy Mark Miller, Jing Lu, Jonathan Jared McCalip, Jorge A. Gonzalez
  • Patent number: 11682943
    Abstract: The invention is a motor/generator that includes a motor/generator housing that encloses a rotor assembly, which rotates a shaft, and a stator assembly that remains stationary, and where the motor/generator is inside a vacuum chamber, which, during normal operation, is evacuated of gas and operates at a lower air pressure than atomospheric air pressure, and a cylindrical vacuum barrier between the rotor assembly and the stator assembly that together with the motor generator housing partitions the motor/generator into an interior rotor volume and an exterior stator volume, enabling the rotor volume and stator volume to operate at different atmospheric pressures.
    Type: Grant
    Filed: March 30, 2021
    Date of Patent: June 20, 2023
    Assignee: Amber Kinetics, Inc.
    Inventors: Mark J. Holloway, Peter Thomas Tennessen
  • Publication number: 20230185922
    Abstract: Testing software applications often requires a balancing of thoroughness versus the time and computing resources available to perform such tests. By performing a static analysis on candidate software source code and, from the static analysis, configuring a dynamic analysis component to execute the tests, allows for extraneous tests to be omitted. For example, performing certain vulnerability attacks on a function may be futile if the attack requires a string input but the function only accepts integers. By combining static and dynamic analysis, unnecessary tests may be omitted and the results of each analysis process correlated to identify actual vulnerabilities or falsely indicted vulnerabilities reported by one of the static or dynamic analysis component.
    Type: Application
    Filed: December 15, 2021
    Publication date: June 15, 2023
    Applicant: MICRO FOCUS LLC
    Inventors: Gerald E. Sullivan, Justin Michael Alwine, Peter Thomas Blay, Nidhi Govindram Kejriwal
  • Patent number: 11661972
    Abstract: A ball-CV style transmission suitable for use in a Positive Displacement Motor (PDM). A shaft provides shaft wings received into housing receptacles on a housing. A ball and a Torque Transfer Element (TTE) is interposed between each shaft wing and housing within each housing receptacle, with the ball received into opposing recesses preferably on the shaft wing and the TTE. The TTEs float within their corresponding housing receptacles so as to maintain torque transfer contact between all thrust surfaces during articulated rotation of the shaft with respect to the housing. The TTEs preferably float generally radially towards the shaft centerline as angular deflection increases during articulated rotation.
    Type: Grant
    Filed: February 21, 2020
    Date of Patent: May 30, 2023
    Assignee: Abaco Drilling Technologies LLC
    Inventors: Jing Lu, Peter Thomas Cariveau, Damon T. Landrum, Steven C. Gaare
  • Patent number: 11649501
    Abstract: A method to predict an increased risk of a greater susceptibility to a metal implant sensitivity in a test person. The method includes providing an isolated sample with a genetic material of the test person, and examining a single nucleotide polymorphism rs1143627 SEQ?ID?NO:?1 AGCCTCCTACTTCTGCTTTTGAAAGC[C/T]ATAAAA ACAGCGAGGGAGAACTGG,? in a gene coding for interleukin 1 beta and ascertaining whether a C is present at a position of the single nucleotide polymorphism, and/or examining a VNTR polymorphism rs2234663 with the repeat SEQ?ID?NO:?2 ATCCTGGGGAAAGTGAGGGAAATATGGACATCACATGGAACAACAT CCAGGAGACTCAGGCCTCTAGGAGTAACTGGGTAGTGTGC, in a gene coding for a IL1 receptor antagonist, IL1-RN and ascertaining whether the repeat is present five times.
    Type: Grant
    Filed: February 4, 2019
    Date of Patent: May 16, 2023
    Assignee: KLINIKUM DER UNIVERSITAET MUENCHEN
    Inventors: Burkhard Summer, Peter Thomas, Sylvia Usbeck, Diana Lill
  • Publication number: 20230141414
    Abstract: A rubber compound for use in a stator. The stator may be deployed in a positive displacement motor. The rubber compound includes a fiber reinforcement, wherein fibers in the fiber reinforcement create a grain direction in which “with the grain” is generally orthogonal to “across the grain”. In some embodiments, the rubber compound has a first value for 25% tensile Modulus across the grain and a second value for 25% tensile Modulus with the grain, wherein the first value is at least 10% lower than the second value. In such embodiments, the fiber reinforcement may further include a fiber loading of greater than 1.0 phr of fibers. In such embodiments, the rubber compound may further have a 25% tensile Modulus of greater than 400 psi across the grain and a 50% tensile Modulus of greater than 700 psi across the grain.
    Type: Application
    Filed: December 28, 2022
    Publication date: May 11, 2023
    Inventors: Peter Thomas Cariveau, Robert Bohmer
  • Patent number: 11640641
    Abstract: A system for account mapping includes functionality for obtaining more than one labeled accounts labeled by more than one accountant; pre-processing more than one labeled accounts using natural language processing, using the more than one pre-processed labeled accounts to train an account mapping model that performs multinomial classification; receiving an account name from an accounting application where the account name includes a text label for an account included in a chart of accounts; generating an account mapping by applying the account mapping model to the account name, where the account mapping includes a type of the account, a sub-type of the account, a code, and a series associated with an accounting form; returning the account mapping to the accounting application through an Application Programming Interface (API); and receiving a corrected account mapping from an accountant and using the corrected account mapping as a new text label to incrementally update the account mapping model.
    Type: Grant
    Filed: October 29, 2019
    Date of Patent: May 2, 2023
    Assignee: Intuit Inc.
    Inventors: Yogish Pai, Anu Singh, Peter Thomas, Madhusudhanan Dharumaraj, Steve George Goyette, Ram Shamanna
  • Publication number: 20230121331
    Abstract: Techniques for identifying and managing an organization's remote attack surface that account for the fluid nature of the remote attack surface are described. Data collected from organization-issued endpoint devices are obtained and analyzed to determine public IP addresses used by the endpoint devices. The devices connected to external networks (i.e., non-organization networks) at various time windows are identified by distinguishing between public IP addresses that are associated with the organization and those that are not. Data obtained from ongoing global probing of public IP addresses, which at least indicate software instances hosted on networks corresponding to the public IP address, are correlated with each public IP address determined to be associated with an external network to which an endpoint device has connected. From these data, any security risks that connections to external networks may pose to the organization's network can be identified.
    Type: Application
    Filed: July 21, 2022
    Publication date: April 20, 2023
    Inventors: Matthew Stephen Kraning, Corey James Fredericks, Andrew Clayton Scott, Peter Thomas Dickinson
  • Patent number: 11630368
    Abstract: Devices, methods and systems for generating wideband, high-fidelity arbitrary radio frequency (RF) passband signals are described. A voltage tunable optical filter for arbitrary RF passband signal generation includes a first input configured to receive a broadband optical pulse train, a second input configured to receive a first control voltage representative of an amplitude signal, an electrooptic modulator to receive the broadband optical pulse train and the first control voltage, to modulate the broadband optical pulse train in accordance with the amplitude signal, and to produce two complementary optical outputs that form two arms of an interferometer, an optical delay component to impart an optical path difference into one of the complementary outputs of the electrooptic modulator, and a combiner or a splitter to receive two complementary optical outputs of the electrooptic modulator after impartation of the optical path difference and to produce an output interference pattern of fringes.
    Type: Grant
    Filed: December 10, 2021
    Date of Patent: April 18, 2023
    Assignee: LAWRENCE LIVERMORE NATIONAL SECURITY, LLC
    Inventors: Apurva Shantharaj Gowda, Jacky Chak-Kee Chan, Peter Thomas Setsuda DeVore, David Simon Perlmutter, Jason Thomas Chou
  • Patent number: 11623585
    Abstract: A sensor pod system includes one or more sensor pods with a plurality of sensors configured to collect data from an environment. A sensor pod may have an effective field of view created by individual sensors with overlapping fields of view. The sensor pod system may include sensors of different types and modalities. Sensor pods of the sensor pod system may be modularly disposed on a vehicle, for example, an autonomous vehicle to collect and provide data of the environment during operation of the vehicle. The sensor pods may be disposed at elevated locations around the vehicle to reduce obstacles within the sensor pods fields of view.
    Type: Grant
    Filed: April 30, 2020
    Date of Patent: April 11, 2023
    Assignee: Zoox, Inc.
    Inventors: Derek Adams, Daniel Glenn Johnson, Christopher William Labadie, Ryan McMichael, Daniel Miller, Peter Thomas Mitros, Anubhav Thakur, Joseph Patrick Warga, Austin In-Jei Yi