Abstract: In some embodiments, a spinal stabilization system may be formed in a patient using quick-connect sleeve assemblies. Each quick-connect sleeve assembly can be coupled to a bone fastener assembly in a fast and intuitive way. In one embodiment, a quick-connect sleeve assembly has a detachable member and a movable member. Both members engage a collar of the bone fastener assembly. In one embodiment, the engagement can be locked via one or more locking features to facilitate screwing a bone fastener of the bone fastener assembly onto a vertebral body in a minimally invasive surgical procedure. Each quick-connect sleeve assembly has a low profile and is particularly shaped for minimally invasive entry.

Abstract: Example implementations relate to metadata operations in a storage system. An example includes a machine-readable medium storing instructions that upon execution cause a processor to: receive a data stream to be stored in persistent storage of a deduplication storage system; store data units of the data stream in a container entity group object according to arrival time, where the data units of the container entity group object are referenced by a plurality of container indexes; generate a data index to list each container index that references at least one data unit included in the container entity group object; and in response to a determination that the total size of the container entity group object exceeds the threshold size, transfer the container entity group object from memory to the persistent storage.

Abstract: A glass syringe barrel is provided that has an at least partially conically shaped upper portion and a longitudinal axis. The glass syringe barrel has a top end through which a liquid can be ejected and a bottom end into which a plunger stopper can be pushed. The glass syringe barrel includes, in a direction from the top end to the bottom end, a cone, a shoulder region, and a body region. The shoulder region has and outer contour that has a concave and substantially circular arc-shaped area c1 with an outer radius r1. The outer contour of the glass syringe barrel in the shoulder region is defined by a certain minimum value the radius of curvature.

Abstract: The present disclosure provides descriptions of electrical box assemblies for supporting heavy fixtures, such as ceiling fans, and facilitating electrical connections to the fixtures. The electrical box assembly includes an electrical box that allows a connection between the box and electrical conduits and a connection, e.g., a weatherproof connection, with a housing of the fixture. The box has an open front face to house electrical connections between the fixture and wires supplying electrical power to the box via the conduits. The box has a bottom wall and an open front face. A reinforcement member fits within the electrical box and includes a panel shaped to conform to at least a portion of the bottom wall and one or more standoffs extending toward the open front face of the box. When the reinforcement member is positioned within the box, mounting holes in the bottom wall of the box and reinforcement member are aligned to allow the box to be attached to a building structure.

Abstract: An adapted elastomer compound, in which the adaptation is based at least in part on load performance data of a rotor/stator test coupon as evaluated on a test apparatus. The test coupon's stator section includes the original elastomer compound before adaptation thereof. The test apparatus includes a motor, a brake, and at least one sensor disposed to evaluate load performance data of the test coupon. The load performance data is the product of the process comprising the steps of: (a) rotating either the rotor section or the stator section on the test apparatus, wherein such rotation section actuates corresponding rotation of the other of the rotor section and the stator section; (b) applying a braking torque to the actuated rotor section or stator section; and (c) responsive to step (b), evaluating load performance data of the test coupon.

Abstract: The invention is a motor/generator that includes a motor/generator housing that encloses a rotor assembly, which rotates a shaft, and a stator assembly that remains stationary, and where the motor/generator is inside a vacuum chamber, which, during normal operation, is evacuated of gas and operates at a lower air pressure than atomospheric air pressure, and a cylindrical vacuum barrier between the rotor assembly and the stator assembly that together with the motor generator housing partitions the motor/generator into an interior rotor volume and an exterior stator volume, enabling the rotor volume and stator volume to operate at different atmospheric pressures.

Abstract: Testing software applications often requires a balancing of thoroughness versus the time and computing resources available to perform such tests. By performing a static analysis on candidate software source code and, from the static analysis, configuring a dynamic analysis component to execute the tests, allows for extraneous tests to be omitted. For example, performing certain vulnerability attacks on a function may be futile if the attack requires a string input but the function only accepts integers. By combining static and dynamic analysis, unnecessary tests may be omitted and the results of each analysis process correlated to identify actual vulnerabilities or falsely indicted vulnerabilities reported by one of the static or dynamic analysis component.

Abstract: A ball-CV style transmission suitable for use in a Positive Displacement Motor (PDM). A shaft provides shaft wings received into housing receptacles on a housing. A ball and a Torque Transfer Element (TTE) is interposed between each shaft wing and housing within each housing receptacle, with the ball received into opposing recesses preferably on the shaft wing and the TTE. The TTEs float within their corresponding housing receptacles so as to maintain torque transfer contact between all thrust surfaces during articulated rotation of the shaft with respect to the housing. The TTEs preferably float generally radially towards the shaft centerline as angular deflection increases during articulated rotation.

Abstract: A method to predict an increased risk of a greater susceptibility to a metal implant sensitivity in a test person. The method includes providing an isolated sample with a genetic material of the test person, and examining a single nucleotide polymorphism rs1143627 SEQ?ID?NO:?1 AGCCTCCTACTTCTGCTTTTGAAAGC[C/T]ATAAAA ACAGCGAGGGAGAACTGG,? in a gene coding for interleukin 1 beta and ascertaining whether a C is present at a position of the single nucleotide polymorphism, and/or examining a VNTR polymorphism rs2234663 with the repeat SEQ?ID?NO:?2 ATCCTGGGGAAAGTGAGGGAAATATGGACATCACATGGAACAACAT CCAGGAGACTCAGGCCTCTAGGAGTAACTGGGTAGTGTGC, in a gene coding for a IL1 receptor antagonist, IL1-RN and ascertaining whether the repeat is present five times.

Abstract: A rubber compound for use in a stator. The stator may be deployed in a positive displacement motor. The rubber compound includes a fiber reinforcement, wherein fibers in the fiber reinforcement create a grain direction in which “with the grain” is generally orthogonal to “across the grain”. In some embodiments, the rubber compound has a first value for 25% tensile Modulus across the grain and a second value for 25% tensile Modulus with the grain, wherein the first value is at least 10% lower than the second value. In such embodiments, the fiber reinforcement may further include a fiber loading of greater than 1.0 phr of fibers. In such embodiments, the rubber compound may further have a 25% tensile Modulus of greater than 400 psi across the grain and a 50% tensile Modulus of greater than 700 psi across the grain.

Abstract: A system for account mapping includes functionality for obtaining more than one labeled accounts labeled by more than one accountant; pre-processing more than one labeled accounts using natural language processing, using the more than one pre-processed labeled accounts to train an account mapping model that performs multinomial classification; receiving an account name from an accounting application where the account name includes a text label for an account included in a chart of accounts; generating an account mapping by applying the account mapping model to the account name, where the account mapping includes a type of the account, a sub-type of the account, a code, and a series associated with an accounting form; returning the account mapping to the accounting application through an Application Programming Interface (API); and receiving a corrected account mapping from an accountant and using the corrected account mapping as a new text label to incrementally update the account mapping model.

Abstract: Techniques for identifying and managing an organization's remote attack surface that account for the fluid nature of the remote attack surface are described. Data collected from organization-issued endpoint devices are obtained and analyzed to determine public IP addresses used by the endpoint devices. The devices connected to external networks (i.e., non-organization networks) at various time windows are identified by distinguishing between public IP addresses that are associated with the organization and those that are not. Data obtained from ongoing global probing of public IP addresses, which at least indicate software instances hosted on networks corresponding to the public IP address, are correlated with each public IP address determined to be associated with an external network to which an endpoint device has connected. From these data, any security risks that connections to external networks may pose to the organization's network can be identified.

Abstract: Devices, methods and systems for generating wideband, high-fidelity arbitrary radio frequency (RF) passband signals are described. A voltage tunable optical filter for arbitrary RF passband signal generation includes a first input configured to receive a broadband optical pulse train, a second input configured to receive a first control voltage representative of an amplitude signal, an electrooptic modulator to receive the broadband optical pulse train and the first control voltage, to modulate the broadband optical pulse train in accordance with the amplitude signal, and to produce two complementary optical outputs that form two arms of an interferometer, an optical delay component to impart an optical path difference into one of the complementary outputs of the electrooptic modulator, and a combiner or a splitter to receive two complementary optical outputs of the electrooptic modulator after impartation of the optical path difference and to produce an output interference pattern of fringes.

Abstract: A sensor pod system includes one or more sensor pods with a plurality of sensors configured to collect data from an environment. A sensor pod may have an effective field of view created by individual sensors with overlapping fields of view. The sensor pod system may include sensors of different types and modalities. Sensor pods of the sensor pod system may be modularly disposed on a vehicle, for example, an autonomous vehicle to collect and provide data of the environment during operation of the vehicle. The sensor pods may be disposed at elevated locations around the vehicle to reduce obstacles within the sensor pods fields of view.

Abstract: Example implementations relate to metadata operations in a storage system. An example storage system includes a machine-readable storage storing instructions executable by a processor to determine to generate a synthetic full backup based on data stream representations of a plurality of data streams. The instructions are also executable to, in response to a determination to generate the synthetic full backup, create a logical group including the data stream representations. The instructions are also executable to specify a cache resource allocation for the logical group, and generate the synthetic full backup from data stream representations using an amount of a cache resource limited by the cache resource allocation for the logical group.

Abstract: A glass container is provided having a glass tube with a first end and a second end and a glass bottom closing the second end. The glass tube has a longitudinal axis and has, in a direction from the first to the second end, a top region, a junction region, a neck region, a shoulder region, and a body region. The top region is at the first end and has an outer diameter (dt), the neck region has an outer diameter (dn) with dn<dt, the body region extends to the second end and has an outer diameter (db) with db>dt, and the glass tube in the body region has a thickness (lb). The outer contour in a transition area between the top and neck regions is defined by a radius of curvature. The glass containers have a neck squeeze test load of at least 1100 N.

Abstract: An anti-polish ring for an internal combustion engine is provided. The anti-polish ring includes an axially extending ring portion that is configured to scrape a top portion of a piston in a cylinder liner. The anti-polish ring is configured to accommodate passage of an intake or exhaust valve thereby. The anti-polish ring may include an alignment feature so that the anti-polish ring is inserted in a predetermined orientation in the cylinder. The anti-polish ring may include a heat shield and/or a seating member.

Abstract: The invention provides a delayed release dosage form and a bolus configured for administration to an animal, wherein said dosage form and said bolus is configured to release a hydrophobic substance to the animal over a period of time. Preferably the hydrophobic substance is a haloform. Also provided is the use of the delayed release dosage form or bolus of the invention to reduce methane production in a ruminant animal. Also provided is the method of manufacturing a bolus of the invention.

Abstract: The invention provides a delayed release dosage form and a bolus configured for administration to an animal, wherein said dosage form and said bolus is configured to release a hydrophobic substance to the animal over a period of time. Preferably the hydrophobic substance is a haloform. Also provided is the use of the delayed release dosage form or bolus of the invention to reduce methane production in a ruminant animal. Also provided is the method of manufacturing a bolus of the invention.

Abstract: Tapered stator designs are engineered in a positive displacement motor (PDM) power section to relieve stator stress concentrations at the lower (downhole) end of the power section in the presence of rotor tilt. A contoured stress relief (i.e. a taper) is provided in the stator to compensate for rotor tilt, where the taper is preferably more aggressive at the lower end of the stator near the bit.