Methods and compositions for transposition using minimal segments of the eukaryotic transformation vector piggyBac
The present invention provides a method for transforming an insect genome that has a much enhanced transformation frequency. The vectors and plasmids employed in the method are further described as transposition vectors that include a minimal amount of nucleotide sequence homologous to a 5′ region and a 3′ region of a native piggyBac nucleic acid sequence. The transformed cells or embryos may also be developed into transgenic organisms. Disclosed are minimal piggyBac-based plasmid constructs that comprises a minimal nucleic acid sequence homologous to a 5′ end of a piggyBac nucleic acid sequence (about 60-80 bp, particularly 66 bp) and a relatively long (300 to about 380 bp, particularly 311 bp or 378 bp) continuous nucleic acid sequence homologous to a 3′ end of a piggyBac native nucleic acid sequence. Methods employing these constructs include the use of a helper plasmid. Transformation frequencies employing the constructs are enhanced 100-fold or higher over that transformation frequency obtained using other than the herein described constructs.
Latest University of Notre Dame Du Lac Patents:
- Apparatus, system, and method for improving resolution of frequency-dependent objects in radar contexts
- Deployable wings for an aircraft
- Aerosol jet printing and sintering of thermoelectric devices
- Antibacterial picolinamide compounds
- 3D Compatible 2 Transistor-N Capacitor Ferroelectric Random Access Memory it Quasi-Nondestructive Readout Characteristics
This application is a Continuation-In-Part of U.S. patent application Ser. No. 10/826,523, filed Apr. 19, 2004 entitled “Methods and Compositions for Transposition Using Minimal Segments of the Eukaryotic Transformation Vector PiggyBac,”, now which is a Continuation-In-Part of U.S. patent application Ser. No. 10/001,189, filed Oct. 30, 2001, now issued as U.S. Pat. No. 6,962,810 on Nov. 8, 2005, entitled “Methods and Compositions for Transposition Using Minimal Segments of the Eukaryotic Transformation Vector PiggyBac,” filed Oct. 30, 2001, which claims priority to U.S. Provisional Patent Application No. 60/244,984, filed Nov. 1, 2000, and U.S. Provisional Patent Application No. 60/244,667, filed on Oct. 31, 2000. The entire disclosure and contents of the above-identified applications are hereby incorporated by reference.
INCORPORATION BY REFERENCE OF A SEQUENCE LISTINGThe sequence listing contained in the file “21395-6_2018-05-07_sequence-listing.txt” created on May 7, 2018 and having a file size of 230,681 bytes and which contains SEQ ID NOs. 1-190 for the current application U.S. Ser. No. 11/454,947 filed on Jun. 19, 2006 is incorporated herein by reference in its entirety.
GOVERNMENT INTEREST STATEMENTThe United States Government has rights in this invention pursuant to USDA/NRI Grant 96-35302-3796, NIH-NIAID 1RO1AI40960, NIH/NIAID 1RO1AI48561, and NIH AI48561.
BACKGROUNDField of the Invention
The present invention relates generally to transposable elements, and more particularly to the transposon piggybac.
Related Art
Transposable elements (transposons) can move around a genome of a cell and are useful for inserting genes for the production of transgenic organisms. The Lepidopteran transposon piggyBac is capable of moving within the genomes of a wide variety of species, and is gaining prominence as a useful gene transduction vector. The transposon structure includes a complex repeat configuration consisting of an internal repeat (IR), a spacer, and a terminal repeat (TR) at both ends, and a single open reading frame encoding a transposase.
The Lepidopteran transposable element piggyBac was originally isolated from the TN-368 Trichoplusia ni cell culture as a gene disrupting insertion within spontaneous baculovirus plaque morphology mutants. PiggyBac is a 2475 bp short inverted repeat element that has an asymmetric terminal repeat structure with a 3-bp spacer between the 5′ 13-bp TR (terminal repeat) and the 19-bp IR (internal repeat), and a 31-bp spacer between the 3′ TR and IR. The single 2.1 kb open reading frame encodes a functional transposase (Cary et al., 1989; Fraser et al., 1983, 1995; Elick et al., 1996a; Lobo et al., 1999; Handler et al., 1998).
PiggyBac transposes via a unique cut-and-paste mechanism, inserting exclusively at 5′ TTAA 3′ target sites that are duplicated upon insertion, and excising precisely, leaving no footprint (Elick et al., 1996b; Fraser et al., 1996; Wang and Fraser 1993).
Transient excision and interplasmid transposition assays have verified movement of this element in the SF21AE Spodoptera frugiperda cell line, and embryos of the Lepidopteran Pectinophora glossypiella, Bombyx mori, and T. ni, as well as the Dipteran species Drosophila melanogaster, Aedes aegypti, Aedes triseriatus, Aedes albopictus. Anopheles stephensi and Anopheles gambiae. There is also evidence of transposition in the Cos-7 primate cell line, and embryos of the zebra fish, Danio rerio (Fraser et al., 1995; Buck et al., 1996b; Fraser et ai, 1996; Elick et al, 1997; Thibault et al, 1999; Tamura et al, 2000; Lobo et al, 1999).
The piggyBac element has been used successfully as a helper-dependent gene transfer vector in a wide variety of insect species, including the Mediterranean fruit fly, C. capitata, D. melanogaster, Bombyx mori, P. glossypiella, Tribollium casteneum, and Ae. aegypti (Handler et al, 1998, 1999; Tamura et al, 2000; Berghammer et al, 1999).
Excision assays using both wildtype and mutagenized piggyBac terminal sequences demonstrated that the element does not discriminate between proximal or distal duplicated ends, and suggest that the transposase does not first recognize an internal binding site and then scan towards the ends. In addition, mutagenesis of the terminal trinucleotides or the terminal-proximate three bases of the TTAA target sequence eliminates excision at the altered terminus (Elick et al., 1996b).
Although the reported piggyBac vector is useful, length of genes that could be transferred is limited by the size of the other components of the vector. Minimizing the length of the vector to allow more room for the genetic material to be transferred would improve the versatility of the system and reduce costs of preparing synthetic vectors. Previously, the gene to be expressed or transduced was inserted into the middle of the piggyBac transposon in the plasmid p3E1.2. The final construct included the entire length of the piggyBac transposon (2475 bases) and flanking sequences derived from the baculovirus 25K gene region of approximately 813 bases, as well as the plasmid pUC backbone of 2686 bp, and an overall size of approximately 5962 bp. In cloning sequences into the pUC vector, 12 bp of multiple cloning sites DNA was lost. This size limited the effective size of genes that may be inserted, because plasmids larger than 10 KB are generally more difficult to construct, maintain, and transduce into host genomes.
Another problem was that previous cloning regimens involved the excision of a gene, the promoter controlling the gene, and polyadenylation signals, from one plasmid followed by insertion into the piggyBac transfer vector. This procedure was often complicated by the lack of suitable restriction enzyme sites for these manipulations.
SUMMARYThe present invention identifies the specific sequences in a mobile genetic element, the transposon piggyBac, and sequence configurations outside of piggyBac, that are minimally required for full functionality of the sequence as a transposon. Inserting DNA molecules into cells is enhanced using the methods and compositions of the present invention.
The present invention solves problems in use of the piggyBac vector for gene transfer caused by lack of suitable restriction sites to cut the components needed for gene transfer, and limitations on the sizes (lengths) of genes transferred by use of this vector. Methods and compositions of the present invention enlarge the size of the gene that may be transferred in two ways. First, a minimal sequence cartridge may be easily amplified using primers containing desired restriction endonuclease sites, and the cartridge may then be inserted into any plasmid containing the gene with its attendant promoter and polyadenylation signals intact, converting that plasmid into a piggyBac transposon. Second, a multiple cloning site may be inserted into a minimal plasmid vector, facilitating the insertion of genes in this more traditional plasmid vector. The vectors may both be used for applications including producing transgenic organisms, both plants and animals. The present invention has been successful in exemplary transpositions using the primate Cos-7 vertebrate cell line and embryos of the zebra fish, Danio rerio, among others.
Methods and compositions are disclosed herein for transferring genes using the minimum internal and external sequences of the transformation vector piggyBac In an embodiment of the invention, all non-essential sequences are removed, including the bulk of the piggyBac internal domain and the flanking baculovirus sequences. By means of the minimal piggyBac cartridge, a DNA molecule may be transferred from a plasmid into a host cell.
In one aspect, the invention provides a DNA molecule that in some embodiments comprises at least 163 consecutive nucleotide base pairs of the 3′ terminal region beginning at the 3′ terminal base pair, and at least 125 consecutive nucleotide base pairs of the 5′ terminal region beginning at the 5′ terminal base pair of the piggyBac molecule, the region extending from the restriction site SacI to the end of the piggyBac molecule.
In another aspect, the invention comprises a genetic cartridge designated ITR.
In some embodiments, the invention provides a genetic cartridge designated ITR1.1k.
According to another aspect, the invention provides a vector. In some embodiments, the vector is designated pXL-Bac as shown in
In other aspects, the invention provides a nucleic acid molecule comprising a nucleic acid sequence. In some embodiments, the nucleic acid sequence comprises a minimal sequence of consecutive nucleotide base pairs (a minimal sequence component) having a sequence that is homologous to a nucleic acid sequence of a 5′ terminal region of a piggyBac native nucleic acid sequence, and a longer sequence of consecutive nucleotide base pairs (a longer sequence component) that is homologous to a nucleic acid sequence of a 3′ terminal region of a piggyBac native nucleic acid sequence.
In some embodiments, the minimal sequence of consecutive nucleotide base pairs that is homologous to a nucleic acid sequence of a 5′ terminal region of the piggyBac native nucleic acid sequence is a sequence of nucleotide base pairs that is about 50 to about 80 base pairs in length, or is about 60 to about 70 base pairs in length, or is 66 base pairs in length. In other embodiments, the minimal sequence of consecutive nucleotide base pairs is defined as comprising a nucleic acid sequence that is homologous to a nucleic acid sequence that is the sequence at nucleotide positions 36 to 100 of the native piggyBac nucleic acid sequence.
In some embodiments, the longer sequence of consecutive nucleotide base pairs from the 3′ terminal region of the piggyBac nucleic acid sequence is about 125 to about 450 base pairs in length, or about 200 to about 400 base pairs in length, or about 300 to about 380 base pairs in length, or about 311, 350, or 378 base pairs in length. In some embodiments, the longer sequence of consecutive nucleotide base pairs is defined as comprising a nucleic acid sequence that is homologous to a nucleic acid sequence that is the sequence at nucleotide positions 2031 to 2409 of the native piggyBac sequence.
The homology that the minimal sequence component and the longer sequence component have with the referenced native piggyBac nucleic acid sequence as defined herein is a degree of homology that is sufficient to produce a functionally equivalent activity that is equal or substantially equal to the native piggyBac nucleic acid sequence. Homology may also be described relative to the percent (%) similarity that the minimal sequence component or the longer sequence component has to the referenced native piggyBac nucleic acid sequence. In some embodiments, the homology may be 40% or more, 45% or more, 50% or more, 60% or more, 70% or more, 80% or more, 90% or more, or even up to 100% homology with the nucleic acid sequence of the corresponding native piggyBac sequence.
In some embodiments, the DNA molecule comprises a nucleic acid sequence encoding a phenotypic marker.
In some embodiments, the DNA molecule comprises a nucleic acid sequence encoding a spacer sequence of interest. The spacer sequence may comprise a sequence of any desired length, and in some embodiments, may be described by the term, “stuffer”. This “stuffer” may comprise a nucleic acid sequence of about 10 to about 1000 base pairs, or about 20, 30, 40, 50, 60, 100, 200, 300, 400, 500, 700, 800, or even 1000 base pairs or more. In yet other embodiments, the DNA molecule comprises a nucleic acid sequence encoding a molecule of interest, such as a protein, peptide, or a synthetic or non-synthetic, organic, inorganic, or other type of molecule.
In another aspect, the invention provides a plasmid comprising a nucleic acid sequence of a DNA molecule having the minimal nucleotide sequence of consecutive nucleotide base pairs from the 5′ terminal region of the piggyBac nucleic acid sequence and the longer nucleotide sequence of consecutive nucleotide base pairs from the 3′ terminal region of the piggyBac nucleic acid sequence.
In some embodiments the nucleic acid molecule may comprise a nucleic acid sequence comprising one or more than one minimal sequence of consecutive nucleotide base pairs substantially homologous to a 5′ terminal region of a piggyBac nucleic acid sequence, one or more than one longer nucleotide sequence of consecutive nucleotide base pairs substantially homologous to a 3′ terminal region of a piggyBac nucleic acid sequence, or any combination thereof and in any desired construct arrangement. By way of example and not limitation, one embodiment of such a nucleic acid molecule may comprise a first minimal sequence of consecutive nucleotide base pairs substantially homologous to a 5′ terminal region of a piggyBac nucleic acid sequence, adjacent to a longer nucleotide sequence of consecutive nucleotide base pairs substantially similar to a 3′ terminal region of a piggyBac nucleic acid sequence, and a second minimal sequence of consecutive nucleotide base pairs substantially homologous to a 5′ terminal region of a piggyBac nucleic acid sequence. In some embodiments, this and any other of the constructs of the present invention may include 1 or more of the small repeat sequences, such as the -CAAAAT- or ACTTATT- small repeat sequences.
In some embodiments, the invention provides a plasmid designated pBSII-ITR1.1k-ECFP.
In other embodiments, the invention provides a plasmid designated pCaSpeR-hs-orf.
In still other embodiments, the invention provides a plasmid p(PZ)-Bac-EYFP (
In other embodiments, the invention provides a plasmid pBSII-3xP3-ECFP.
In yet other embodiments, the invention provides a plasmid designated pBSII-ECFP-R4/L. In particular of these embodiments, the plasmid is pBSII-ECFP-R4/L2, pBSII-ECFP-R4/L3, pBSII-ECFP-R4/L4, or pBSII-ECFP-R4/L5 (
Another broad aspect of the invention provides a method for providing high frequency transformation of an insect genome using a vector comprising the minimal 5′ terminal region and longer 3′ terminal region sequence of a piggyBac sequence, in the presence of a helper plasmid. In some embodiments, the vector further comprises a small terminal repeat sequence, CAAAAT. In particular embodiments, the helper plasmid is a plasmid pCaSpeR-hs-orf.
In some embodiments, the insect genome is further described as that of an insect. In some embodiments, the insect is a mosquito.
In some embodiments, the method of high frequency transformation may be described as providing a frequency of transformation that is enhanced 100-fold or higher, than transformation frequency employing a vector other that the minimal 5′, longer 3′ terminal end piggyBac constructs described herein.
In another aspect, the invention provides a transformed cell transformed with a transformation vector comprising a nucleic acid sequence that includes a minimal sequence component homologous to a 5′terminal region of a piggyBac native nucleic acid sequence and a longer sequence component homologous to a 3′ terminal region of a piggyBac native nucleic acid sequence. In some embodiments, the transformed cell is an insect cell, such as Drosophila melanogaster.
The invention will be described in conjunction with the accompanying drawings, in which:
plasmid to form pBSII-IE1-orf; 8B is the nucleotide sequence (SEQ ID NO: 44) of pBSII-IE1-orf;
of the constructs derived from the pIAO-P/L 589 plasmid (Li et al., 2001b). This nucleotide
substitution from C to A (bold and underlined) had no apparent effect on the transposition frequency of any of these constructs relative to the pBac{3xP3-EYFP} control plasmid (SEQ ID NOS 71 & 72 are disclosed respectively in order of appearance).
It is advantageous to define several terms before describing the invention. It should be appreciated that the following definitions are used throughout this application.
DefinitionsWhere the definition of terms departs from the commonly used meaning of the term, applicant intends to utilize the definitions provided below, unless specifically indicated.
For the purposes of the present invention, the term “genetic construct” refers to any artificially assembled combination of DNA sequences.
For the purposes of the present invention, the term “helper construct” refers to any plasmid construction that generates the piggyBac transposase gene product upon transfection of cells or injection of embryos.
For the purposes of the present invention, the term “ID region” or “ID regions” relates to a nucleic acid sequence that is derived from the native piggyBac sequence.
For purposes of the present invention, the term, “long” or “longer” as it refers to the length of a 3′ terminal region of a piggyBac nucleic acid sequence is defined as a sequence that includes 250 base pairs (bp) or more, 300 bp or more, 350 bp or more, 375 or more, or 400 bp or more.
For purposes of the present invention, term “native” refers to any sequence defined as or recognized to be functionally or otherwise homologous to a piggyBac nucleic acid sequence or amino acid sequence in any species, including but not limited to humans, zebra fish, mosquitoes, Drosophila melanogaster, invertebrate.
For the purposes of the present invention, the term “plasmid” refers to any self-replicating extrachromosomal circular DNA molecule capable of maintaining itself in bacteria.
For the purposes of the present invention, the term “spacer” refers to sequences, for example from about 3 bp to about 31 bp or more in length, separating the 5′ and 3′ (respectively) terminal repeat and internal repeat sequences of the piggyBac transposon.
For purposes of the present invention, the term “substantially homologous” is defined as a nucleic acid sequence that has or is able to elicit the same or substantially similar function activity of a native piggyBac sequence.
For the purposes of the present invention, the term “transgenic organism” refers to an organism that has been altered by the addition of foreign DNA sequences to its genome.
For the purposes of the present invention, the term “vector” refers to any plasmid containing piggyBac ends that is capable of moving foreign sequences into the genomes of a target organism or cell.
Description
The minimal sequence cartridges of the present invention facilitate transposition of DNA molecules of interest into cells, and production of transgenic organisms that include the transferred DNA molecule in some or all of their cells. A DNA molecule(s) is excised from a genetic (transformation) construct, and is transferred to a cell where it is inserted into the cell's genome. The DNA molecule is accompanied by regulatory elements sufficient to allow its expression in the host cell. “Cell” as used herein includes eukaryotic and prokaryotic cells. The genetic transposition construct includes a DNA molecule to be transferred flanked by a pair of transposon terminal inverted repeat nucleotide sequences from the piggyBac transposon. The DNA molecule to be transferred may be any molecule capable of being expressed in a host cell and/or transgenic organism. The method would also transfer cells not able to be expressed.
In the present invention, excision (Elick et al., 1996b) and interplasmid transposition assays (Lobo et al., 1999) were used to determine the relative importance of sequences internal to, or external to, the terminal repeat (TR) and internal repeat (IR) sequence configurations for movement of the piggyBac element.
It was found that progressive deletions within the internal sequence of the element have no noticeable effect on either excision or transposition capabilities. In contrast, deletion of the 3′ IR eliminated excision of the element. Construction of vectors having only intact 5′ and 3′ repeat domains regenerates mobility of the plasmids when supplied with a helper vector expressing a transposase. These features permitted construction of a set of minimal vectors for use in transformation experiments.
The length of the intervening sequence between piggyBac termini in the donor plasmid also affects the piggyBac transposition frequency. In an embodiment of the present invention, a minimal distance of 55 nucleotide base pairs (bp) may be used between target sites and termini to provide for movement of the element. This suggests that the piggyBac transposase binds the termini simultaneously before any cleavage may occur, and/or that the formation of the transposition complex requires DNA bending between the two termini.
An aspect of this invention is that it allows the design of minimally sized genetic vectors that are functional for efficient insertion of genes into host genomes, in particular animal, plant, and insect genomes.
Useful Plasmids Created are:
A) A Transposition PiggyBac ITR Cartridge Plasmid: PCR amplifications and restriction endonuclease cleavage and ligation allowed insertion of a 702 bp fragment containing sequences for piggyBac mobility into any given plasmid of choice, converting the recipient plasmid into an operational transposable sequence capable of being mobilized into an animal genome using the piggyBac transposase gene or purified protein. The pCRII (Invitrogen) plasmid re-amplification using specified primers allows this ITR cartridge to be inserted into any plasmid.
B) Operational Transposable Vectors (pXO and pXL-Bac): Standard restriction endonuclease cleavage and ligation allows insertion of any gene of choice between the minimal sequences of the piggyBac transposon necessary for transposition into the genome of an animal. The total size of the resulting plasmid is preferably not larger than 10 kb.
According to an embodiment of the present invention, the inverted repeat configuration indicated as [TTAA/TR/IR . . . IR/31bp/TR/TTAA] may be utilized to obtain a piggyBac transposon. This observation was arrived at through structured deletion mutagenesis within the piggyBac transposon sequence and examining the properties of both excision and interplasmid transposition of the deleted product.
Additionally, according to an embodiment of the present invention, an insertion sequence between the target site on a plasmid having the terminal repeat configuration [IR/31bp/TR/TTAA . . . insertion sequence . . . TTAA/TR/IR] may be approximately 55 bp to achieve mobility.
For ease of manipulation, a cartridge having the configuration [IR/31bp/TR/TTAA . . . 589 . . . TTAA/TR/IR] which may be inserted within a plasmid, converting that plasmid into a functional piggyBac transposon, was constructed. The cartridge was cloned into the plasmid pCRII (Invitrogen). A cartridge is defined herein as a nucleic acid molecule of a specified construction (plasmid) that may be inserted into a vector.
A cartridge was derived from circularization of the construct A and cutting the construct A with BssHII to cleave at a unique BssHII site within the 589 bp spacer. This yielded a fragment BssHII . . . TTAA/TR/31b/IR/BamHI/IR/TR/TTAA . . . . BssHII. Construct B was derived from a pBSII (Stratagene) plasmid by BssHII deletion of the multiple cloning site (MCS). The linearized fragment was then inserted into the pBSIIªBssHII backbone. An MCS primer was synthesized and inserted in the BamHI site.
Construct A allows ease of construction of genetic vectors through use of a simple 702 bp cartridge that may be inserted into any existing plasmid to convert it immediately into a functional transposon.
Construct B allows ease of insertion of any genetic sequence into a plasmid having the minimal terminal sequence requirement for piggyBac mobility. The advantage of this construct is it provides a minimal backbone cloning vector for piggyBac transposon construction.
A kit is contemplated that would contain the two vector constructs along with the original p3E1.2, and/or a helper construct allowing constitutive production of piggyBac transposase in virtually any animal system. Promoter driven expression of the piggyBac transposase using either RSV LTR sequences CMV early promoter, AcMNPV/IE-1 promoter of poly-ubiquitin promoter, among others, is also contemplated.
Excision assays of plasmids containing progressive deletions of the piggyBac internal sequence revealed that the 5′, and 3′ IR, spacer, and TR configurations are sufficient for piggyBac movement when provided with a transposase in the trans position. Interplasmid transposition assays of plasmids having different sequence lengths between the target sites demonstrated a minimal 55 bp intervening sequence provides for satisfactory piggyBac transposition, whereas lengths less than 40 bp result in dramatic decreases in frequency of transpositions. These results suggest that the piggyBac transposase binds the termini simultaneously before cleavage, and/or that the formation of the transposition complex requires DNA bending between the two termini. Based on these results, a 702 bp cartridge having a minimum piggyBac 5′ and 3′ terminal region configuration and intervening sequence was constructed. The ability of this region to convert any existing plasmid into a non-autonomous piggyBac transposon was verified. A minimal piggyBac vector, pXL-Bac, that contains an internal multiple cloning site sequence between the terminal regions, was also constructed. These vectors facilitate manipulations of the piggyBac transposon for use in a wide variety of hosts.
The excision assay provides a rapid way to characterize essential sequences involved in piggyBac transposition. The p3E1.2-d-7 and p3E1.2-d-8 plasmids, which retain the entire 3′ and 5′ IR, spacer and TR sequences, exhibit precise excision. In contrast, the p3E1.2-d-9 plasmid that retains the entire 5′ terminal region and only 36 bp of the 3′ terminal domain, including the TR and a portion of the 31 bp spacer, does not excise at a detectable frequency. The requirement for an internal 3′ IR sequence in the excision process suggests that the IR region might play an essential role in transposase recognition or cleavage of the target site.
An alternative explanation is that simply shortening the internal sequence may hinder the formation of a transposition complex, or the binding of transposase to two termini simultaneously. A similar result is observed with the IS5O elements for which the lengthening of Tn5 internal sequences increases the transposition frequency (Goryshin et al., 1994). However, insertion of a KOα fragment into the p3E1.2-d-9 at the SphI site did not improve the frequency of precise excision events recovered in the excision assay, suggesting that the length of the internal domain is less important than the presence of an intact IR sequence in excision of the piggyBac element.
The interplasmid transposition assays of pIAO-P/L series plasmids demonstrate that when the external sequence separating the terminal repeats is at least 55 bp, the transposition frequency is over 10−4, while reducing the length to less than 40 bp depresses the frequency of transposition. The inhibition of piggyBac transposition as terminal sequences are brought closer together, suggests that formation of a transposition complex likely precedes DNA cleavage or nicking, and the shorter distances between these termini do not allow proper bending of the sequences to permit formation of the complex, or result in steric hindrance of transposase binding at the termini.
These results also imply a necessity for transposase binding of both termini simultaneously before any cleavage (or nicking) may occur. If the simultaneous binding were not necessary, then the transposase could bind one terminal repeat, cleave it, and then bind the second to cleave, and transposition should occur with equivalent frequencies even with smaller intervening sequences.
Interplasmid transposition assays using pCRII-ITR (
Inserting the ITR fragment into pBlueScript II (Stratagene), converts the plasmid into a transposable element that moves with a frequency similar to the intact piggyBac element. This ITR cartridge facilitates the construction of piggyBac transformation vectors from existing plasmids. In addition, the co-integration of the Amp/ori sequences from the donor plasmid into the genome provides an easy way to locate the insertion site because these insertions may be recovered by restriction enzyme digestion, relegation, and transformation. The pXL-Bac (
The following Biological Deposits have been made on the following dates with a recognized International Depository Authority (IDA), the American Tissue Culture Collection (ATCC), at 10801 University Boulevard, Manassas, Va., 20110-2209, U.S.A., in compliance with the guidelines set forth in the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purposes of Patent Procedure. All restrictions on the availability to the public of the materials deposited will be irrevocably removed upon granting of a patent. The deposits will be maintained for a period of 30 years from the date of deposit or for a period of five years after the date of the most recent request of a sample or the enforceable life of the patent, whichever is the longest. If a culture becomes non-viable, it will be replaced with a viable culture of the same kind.
The invention may now be advantageously described by reference to the following representative examples. These examples are in no way to be interpreted to limit the scope and/or description of any embodiment or method of making or using the invention, and are provided solely for illustrative purposes and for satisfaction of providing the best mode of practicing the invention.
EXAMPLES Example 1—Excision Assay of p3E1.2 Internal Deletion Series in T. niThe analysis was begun using three plasmids having the most extensive internal deletions, p3E1.2-d-9, p3E1.2-d-8 and p3E1.2-d-7. Sequencing of these three plasmids revealed that p3E1.2-d-8 and p3E1.2-d-7 retained 163 bp and 303 bp of the 3′ terminal region, respectively, including the IR, 31 bp spacer, and TR sequence. The p3E1.2-d-9 deletion plasmid retained only 36 bp of the 3′ terminal domain, including the 3′ TTAA target site, 3′ TR and a portion of the 31 bp spacer, but lacked the 3′ IR sequence.
Embryos of T. ni were injected with combinations of each of the p3E1.2 deletion plasmids and the phspBac helper plasmid. Loss of piggyBac sequences from the deletion series plasmids renders the plasmids resistant to BsiWI and SphI digestion. Transformation of Hirt extract DNAs digested with BsiWI and SphI were compared with transformations employing equal amounts of uncut DNA as a control to determine the frequency of excision. Precise excision events were initially identified by a quick size screen for the characteristic 3.5 kb plasmid in recovered colonies, and these plasmids were then sequenced to confirm the precise excision events.
A quick size screen method is used to quickly identify the plasmids with changed size directly from colonies (Sekar, 1987). Colonies at least 1 mm in diameter are picked up with pipette tips and resuspended in 10 ml protoplasting buffer (30 mM Tris-HCl pH 8.0, 50 mM NaCl, 20% Sucrose 5 mM EDTA, 100 mg/ml RNase, 100 mg/ml Lysozyme) in the Lux 60 well mini culture plate. A 0.9% agarose gel containing ethidium bromide is preloaded with 4.5 ml lysis solution (80 mM Tris, 0.5% Sucrose, 0.04% Bromophenol Blue, 2% SDS, 2.5 mM EDTA) per well. The bacterial suspension is then loaded into the wells and the gel electrophoresed. Two kinds of markers are needed to distinguish the plasmids with changed size. One is the colony from the control plate or the original plasmid, another is a molecular weight marker. The plasmids with a difference of 500 bp or greater in size are easily distinguished. Both the p3E1.2-d-8 and p3E1.2-d-7 yielded precise excision events at about the same relative frequency, while no excision events were recovered with the maximum deletion plasmid p3E1.2-d-9 (
The interplasmid transposition assay was carried out essentially as previously described by Lobo et al. (1999), Thibault et al. (1999) and Sarkar et al. (1997a). Embryos were injected with a combination of 3 plasmids. The donor plasmid, pB(KOa), carried a piggyBac element marked with the kanamycin resistance gene, ColEl origin of replication, and the lacZ gene. The transposase providing helper plasmid, pCaSpeR-pB-orf, expressed the full length of the piggyBac ORF under the control of the D. melanogaster hsp70 promoter. The target B. subtilis plasmid, pGDV1, is incapable of replication in E. coli, and contains the chloramphenicol resistance gene. Upon transposition of the genetically tagged piggyBac element from pB(KOa) into the target plasmid pGDV1 with the help of the transposase provided by the helper pCaSpeR-pB-orf that expresses the piggyBac transposase protein from a minimal hsp70 promoter (see
A total of 10 blue colonies were randomly picked from each transformation and prepared for sequencing analysis. Initial sequence analysis of the terminal repeat junction showed that all of the sequenced clones had the distinctive duplication of a TTAA tetranucleotide target site, a characteristic feature of piggyBac transposition. A random set of those clones for which the 5′ terminus had been sequenced were also examined at their 3′ terminus to confirm the duplication of the TTAA site at both ends. The accumulated results confirmed transposon insertion at 12 of the 21 possible TTAA target sites in the pGDV1 plasmid, all of which were previously identified as insertion sites in Lepidopteran assays by Lobo et al. (1999) and Thibault et al. (1999).
The relative frequency at which a given pIAO-P/L series plasmid was able to undergo transposition into the target plasmid correlated with the sizes of the intervening sequence between the termini. With intervening sequences greater than 55 bp, the transposition frequency was over 1.2×10−4, which is consistent with the frequency obtained in previous assays with the p3E1.2 derived vectors by Lobo et al. (1999). If the length of the intervening sequence was reduced to 40 bp or less, the frequency of transposition began to decrease dramatically (
According to an embodiment of the present invention, the excision assay described herein shows that a minimum of 163 bp of the 3′ terminal region and 125 bp of the 5′ terminal region (from the restriction site SacI to the end of the element) may be used for excision, while the pIAO-P/L constructs showed that a minimal distance of 55 bp between termini may be utilized to effect movement. These data suggested that the inclusion of intact left and right terminal and internal repeats and spacer domains would be sufficient for transposition.
The pCRII-ITR plasmid was constructed following PCR of the terminal domains from pIAO-P/L-589 using a single IR specific primer. A second construct pCRII-JFO3/04 was also prepared using two primers that annealed to the piggyBac 5′ and 3′ internal domains respectively, in case repeat proximate sequences were required.
The interplasmid transposition assay was performed in T. ni embryos and the plasmids were recovered using LB/Kan/Cam plates (Sambrook et al., 1989) with the controls plated on LB/Amp plates. A total of 10 randomly picked colonies were sequenced, and all were confirmed as resulting from transposition events, having the characteristic tetranucleotide TTAA duplication at the insertion sites. These insertion sites in pGDV1 were among the same previously described (Lobo et al., 1999 and Thibault et al., 1999). The sequencing results also confirmed that all 10 transposition events retained the expected terminal domain configurations. The frequency of transposition events was estimated at 2×10−4, a similar frequency to that obtained with non-mutagenized constructs for this species (Lobo et al., 1999).
Independent verification that the 702 bp PCR cloned fragment (ITR cartridge,
A new piggyBac minimum vector pXL-Bac (
Using the pXL-Bac minimal vector, several derivative vectors may be constructed containing marker genes for detection of successful transformations. In one example, the vectors pXL-Bac-EYFP, pXL-Bac-EGFP, and pXL-Bac-ECFP (
Similar modifications may be made to either the pCRII-ITR or the companion vector, pBSII-ITR, by inserting a marker gene into the plasmid adjacent to the ITR cartridge of these plasmids. In one example, the plasmids pBSII-ITR-ECFP, pBSII-ITR-EGFP, and pBSII-ITR-EYFP (
Expression of the transposase is important in gaining movement of any of the vectors described herein. To facilitate expression of the transposase, a BamHI cartridge containing only the piggyBac open reading frame sequences was PCR amplified from the piggyBac transposon clone p3E1.2 using the primers BamH1E-for 1 (5′ GCTTGATAAGAAGAG 3′) (SEQ ID NO: 4) and BamH1E-rev 1 (5′ GCATGTTGCTTGCTATT 3′) (SEQ ID NO: 5). This cartridge was then cloned into the pCaSpeR-hs vector at a unique BamHI site downstream of the Drosophila heat shock promoter (pCaSpeR-hs-orf) to effect heat shock induced expression of the piggyBac transposase following co-injection with any piggyBac vector.
Example 8—In Vitro Expression of mRNA of PiggyBac TransposaseIn some eukaryotic systems, the heat shock promoter may not function to express the transposase protein. An additional plasmid was constructed to allow in vitro expression of the messenger RNA sequence of the piggyBac transposase. Co-injection of this mRNA into embryos along with the piggyBac vectors would allow translation of the piggyBac transposase without having to rely on the expression of the mRNA from a promoter which may or may not be active in the desired system. In addition, this strategy provides much more transposase protein in the embryos, leading to a greater mobility of the piggyBac vectors. The BamHI cartridge was excised from the plasmid pCaSpeR-hs-orf by restriction digestion with BamHI and ligated into a BamHI digested commercially available vector; pBSII (Stratagene) to make pBSII-IFP2orf (
Further modification of pBSII-IFP2orf may be effected to introduce alternative promoters that would drive expression of the piggyBac transposase gene. Three examples are provided. pBSII-hs-orf (
While all of the constructs in Example 9 permit expression of the transposase in insect systems, they may not permit optimal expression of the transposase in vertebrate systems. Using the commercially available pDsRed1-N1 plasmid (Clonetech) the BamHI cartridge was cloned from pBSII-IFP2orf into the BamHI site adjacent to the CMV promoter to effect efficient expression of the piggyBac transposase in vertebrate systems. This plasmid was further modified by adding the 3xP3 promoter through PCR amplification of this promoter from the plasmid pBacI[3XP3-EYFPafm] (Horn and Wimmer, 2000) using the primers 3XP3-for (5′ ACTCTCGAGGTTCCCACAATGGTTAATTCG 3′) (SEQ ID NO: 8) and 3XP3-rev (5′ ACTGAATTCATGGTGGCGACCGGTGGATCG 3′) (SEQ ID NO: 9) to generate a XhoI/EcoRI tailed cartridge that was then cloned into the XhoI and EcoRI digested pDsRed1-N1 backbone to generate the plasmid p3XP3-DsRed-orf (
In some cases it may be preferable to inject transposase protein to permit movement of the piggyBac transposon. The natural piggyBac transposase sequence is not efficiently expressed in prokaryotic systems due to a preponderance of eukaryotic codons. To achieve better expression of the piggyBac transposase in bacterial systems for purification and functional utility a sequence called optimized piggyBac orf (
Plasmids
p3E1.2 Deletion Series:
The p3E1.2 plasmid (Fraser et al., 1995) was first linearized using the restriction sites BamHI and EcoRI, blunt ended with the klenow fragment, then religated to construct the p3E1.2(DMCS) eliminating the MCS of the pUC18 sequence. Internal deletions were made using the Erase-A-Base System (Promega). p3E1.2(DMCS) was cut at the unique SacI site within the piggyBac element, generating an ExoIII resistant end, and then cut at the BglII site to generate an ExoIII sensitive end. Fractions of the ExoIII deletion reaction from the BglII site toward the 3′ terminus were stopped every 30 seconds, and were blunt ended by S1 nuclease, recircularized, and transformed into DH5a cells. Recovered plasmids were size analyzed using a quick screen method (Sekar, 1987). The presence of intact 3′ termini was confirmed using a BsiWI digestion, and then sequenced. Nine consecutive plasmids in the size range of approximately 100˜200 bp deletions were recovered and named p3E1.2-d-1 to p3E1.2-d-9, with p3E1.2-d-9 having the maximum deletion (
pIAO-P/L Series:
The p3E1.2 B/X plasmid was constructed as a pCRII TA clone (Invitrogen) of the entire piggyBac transposon and flanking TTAA targets sites following PCR from the plasmid p3E1.2 using the BamHI/XbaI-tailed primer M1F34 (5′-GGATCCTCTAGATTAACCCTAGAAAGATA-3′) (SEQ ID NO: 10). The element and flanking TTAA sites were then excised using the enzyme BamHI and ligated to form a circular molecule. Two outward facing internal piggyBac primers, one with a terminal ApaI site (5′-GAAAGGGCCCGTGATACGCCTATTTTTATAGGTT-3′) (SEQ ID NO: 11) and the other with a terminal KpnI site (5′-AATCGGTACCAACGCGCGGGGAGAGGCGGTTTGCG-3′) (SEQ ID NO: 12), were used to generate a linear ApaI/KpnI-tailed fragment. This fragment was ligated to a PCR fragment containing the beta-1 actamase gene and E. coli replication origin amplified from pUC18 using an ApaI-tailed primer (5′-CCAAGGGCCCTGACGTGAACCATTGTCACACGT-3′) (SEQ ID NO: 13) and a KpnI tailed (5′-TGTGGGTACCGTCGATCAAACAAACGCGAGATACCG-3) (SEQ ID NO: 14) primer pair. The resulting pIAO plasmid contains the circularized piggyBac transposon with ends separated by an 18 bp fragment of DNA having the restriction sites configuration xbaI/BamHI/xbaI, with a beta-lactamase gene and the E. coli origin of replication. The lacZ gene under the control of the polyhedron promoter was excised from pD-2/B-gal (Fraser et al., 1996) using restriction enzymes NruI and DraI, and cloned into the unique HpaI site within the piggyBac element of pIAO to form pIAO-polh/lacZ (pIAO-P/L) plasmid.
The pIAO-P/L-TTAA1 plasmid was constructed by digesting pIAO-polh/lacZ with SphI and BsiWI, and the fragment containing the internal-piggyBac sequence was isolated. Two complementing oligonucleotides, SphI (5′-CGTCAATTTTACGCAGACTATCTTTCTAGGG-3′) (SEQ ID NO: 15) and TTAA-SphI (5′-TTAACCCTAGAAAGATAGTCTGCGTAAAATTGACGCATG-3′) (SEQ ID NO: 16), were annealed to form a SphI site on one end and a TTAA overhang on the other end. A second pair of oligonucleotides, BsiWI (5′-GTACGTCACAATATGATTATCYTTCTAGGG-3′) (SEQ ID NO: 17) and TTAA-BsiWI (5′-TTAACCCTAGAAAGATAATCATATTGTGAC-3′) (SEQ ID NO: 18) were annealed to form a BsiWI site on one end and a TTAA overhang on the other. These two primer pairs were joined using the TTAA overlaps and inserted into the SphI and BsiWI sites of the digested pIAO-polh/lacZ plasmid to form the circular pIAO-P/L-TTAA1 plasmid.
The pIAO-P/L-TTAA2 plasmid was constructed in a similar manner by combining the SphI-terminal primer with TTAATTAA-SphI (5′-TTAATTAACCCTAGAAAGATAGTCTGCGTAAAATTGACGCATG-3′) (SEQ ID NO: 19), and the BsiWI primer with TTAATTAA-BsiWI (5′-TTAATTAACCCTAGAAAGATAATCATATTGTGAC-3′) (SEQ ID NO: 20).
The plasmids pIAO-P/L-2.2 kb, pIAO-P/L-589 bp, pIAO-P/L-354 bp, pIAO-P/L-212 bp and pIAO-P/L-73 bp were constructed by insertion of HindIII or PvuII fragments from the bacteriophage lambda into the blunt ended XbaI site between the adjacent TTAA target sites of pIAO-polh/lacZ.
Plasmids pIAO-P/L-55 bp, pIAO-P/L-40 bp and pIAO-P/L-22 bp were constructed by annealing oligonucleotide pIAO-4501 (5′-CTAGTACTAGTGCGCCGCGTACGTCTAGAGACGCGCAGTCTAGAAD-3′) (SEQ ID NO: 21) and pIAO-4502 (5′-TTCTAGACTGCGCGTCTCTAGACGTACGCGGCGCACTAGTACTAGD-3′) (SEQ ID NO: 22), forming two XbaI sites and one SpeI site, and ligating them into the blunt ended pIAO-P/L XbaI fragment to generate pIAO-P/L-55 bp. The pIAO-P/L-40 bp plasmid was constructed by cutting pIAO-P/L-55 bp plasmid at the XbaI sites of the inserted fragment and then religating. Cutting pIAO-P/L-40 bp at the XbaI and SpeI sites, and religating formed the pIAO-P/L-22 bp plasmid.
The pIAO-P/L-18 bp plasmid was constructed by PCR amplification of the pIAO-P/L plasmid using the pIAO-18 bp primer (5′-GATGACCTGCAGTAGGAAGACGD3′) (SEQ ID NO: 23) and the TR-18 bp primer (5′-GACTCTAGACGTACGCGGAGCTTAACCCTAGAAAGATAD3′) (SEQ ID NO: 24). The amplified fragment was cut with XbaI and PstI, and ligated to the pIAO-P/L XbaI and PstI cut fragment.
pCRII-ITR, pCRII-JF03/04 and pBS-ITR Plasmids:
The oligonucleotide ITR (5′-GGATTCCATGCGTCAATTTTACGCAD-3′) (SEQ ID NO: 25), having the piggyBac IR and a terminal BamHI site, was used to PCR amplify the piggyBac 3′ and 5′ IRs and TRs along with their spacer regions from the pIAO-P/L-589 bp plasmid. The PCR fragment was TA cloned into pCRII (Invitrogen). The resulting plasmid, pCRII-ITR, replaces the entire internal sequence of piggyBac with the pCRII plasmid sequences. A second plasmid, pCRII-JF03/04, was constructed using the same strategy with the primers JFO3 (5′-GGATCCTCGATATACAGACCGATAAAAACACATGD-3′) (SEQ ID NO: 26) and JF04 (5′-GGTACCATTGCAAACAGCGACGGATTCGCGCTATD-3′) (SEQ ID NO: 27). JFO3 is 83 bp internal to the 5′ terminus, JF04 is 90 bp internal to the 3′ terminus. To construct the pBS-ITR plasmid, the 702 bp BamHI fragment was excised from the pCRII-ITR plasmid and inserted into the BamHI site of the pBlueScript (Stratagene) plasmid.
pXL-Bac Plasmid:
The 702 bp fragment containing the piggyBac terminal repeats isolated from pCRII-ITR plasmid BamHI digestion was religated to form a circular molecule, followed by BssHII digestion. The pBlueScript II plasmid was also digested by BssHII and the large fragment was band isolated. These two fragments were ligated together to form the pBSII-ITR(Rev) plasmid. The Multiple Cloning Site (MCS) was PCR amplified from the pBSII plasmid using the MCS for (5′-ACGCGTAGATCTTAATACGACTCACTATAGGG-3′) (SEQ ID NO: 28) and MCS-rev (5′-ACGCGTAGATCTAATTAACCCTCACTAAAGGG-3′) (SEQ ID NO: 29) primers, and cloned into BamHI site of pBSII-ITR(Rev) to construct the pXL-Bac plasmid.
The pXL-Bac minimum piggyBac vector was constructed by circularizing an ITR BamHI fragment, followed by BssHII digestion. The resulting BssHII fragment was then ligated to the pBlueScript II BssHII AMP/ori containing fragment. The multiple cloning site was PCR amplified from pBSII plasmid and inserted into BamHI site to form the pXL-Bac vector. Any desired gene may be inserted into the MCS [the BssHII fragment taken from pBSII (Stratagene)] to construct a piggyBac transposon.
Helper Plasmid:
phspBac (formerly pBhsDSac, Handler et al, 1998) is a transposase-providing helper plasmid that expresses the piggyBac ORF under the control of the D. melanogaster hsp70 promoter.
Target Plasmid:
pGDV1 is a Bacillus subtilis plasmid (Sarkar et al., 1997a) containing a chloramphenicol resistance gene, and is incapable of replication in E. coli unless provided with an E. coli origin of replication.
Microinjection:
T. ni embryos were collected approximately 2 hours post oviposition and microinjected as described by Lobo et al., (1999). After injection, the embryos were allowed to develop for one hour at room temperature, heat shocked at 37° C. for one hour, and allowed to recover at room temperature overnight. Plasmids were recovered using a modified Hirt (1967) extraction procedure.
Excision Assay:
The excision assay was performed as described by Thibault et al., (1999). Precise excision events were confirmed by sequencing using a fluorescent labeled M13 reverse primer (Integrated DNA Technologies, Inc.).
Interplasmid Transposition Assay:
The interplasmid transposition assay was performed as described by Lobo et al. (1999) and Sarkar et al. (1997a). Plasmids isolated from the injected and heat-shocked embryos, as well as those passaged through E. coli only, were resuspended in 20 μl of sterile distilled water and 3 μl of the DNAs were then electroporated into 10 μl of competent E. coli DH 10B cells (Gibco-BRL) (Elick et al., 1996a). A 1.0-ml aliquot of SOC (2% w/v Bactotryptone, 0.5% w/v Bacto yeast extract, 8.5 mM NaCl, 2.5 mM Kcl, 10 mM MgC2 20 mM glucose) was added to the electroporated cells, and the cells were allowed to recover at 37° C. for 15 minutes. An aliquot (1%) of the transformed bacteria was plated on LB plates containing amphicilin (100 μg/ml) and X-Gal (5-bromo-4-chloro-3-indolyl-β3-D-galactosidase; 0.025 μg/ml), and the rest were plated on LB plates containing kanamycin (10 μg/ml), chloramphenicol (10 μg/ml) and X-Gal (0.025 μg/ml). Restriction analysis using HindIII and EcoRV and PCR using outward facing primers specific to piggyBac (JF01: 5′-CCTCGATATACAGACCGATAAAACACATG-3′ (SEQ ID NO: 30) and JF02: 5′-GCACGCCTCAGCCGAGCTCCAAGGGCGAC-3′ (SEQ ID NO: 31)) enabled the preliminary identification of clones with putative interplasmid transposition events. The right insertion site of the clones was sequenced, with the Thermo Sequenase fluorescence-labeled primer sequencing kit (Amersham) and an ALF Express Automated Sequencer (Pharmacia Biotech), using the fluorescence-labeled JF02 primer, while the left insertion site was sequenced with the MF 11 reverse primer (5′-GGATCCCTCAAAATTTCTTTCTAAAGTA-3′) (SEQ ID NO: 32).
To check for plasmid replication in the embryos, Hirt-extracted plasmid DNAs recovered from injected D. melanogaster embryos were digested with the restriction enzyme Dpnl (Geier and Modrich, 1979). E. coli cells were transformed with equal volumes of the digested and undigested plasmid DNAs and plated on LB plates containing kanamycin, chloramphenicol and X-Gal as above.
The pIAO-P/L series transposition events were sequenced using the fluorescent labeled MF 11-reverse primer (5′-GGATCCCTCAAAATTTCTTCTAAAGTA-3′) (SEQ ID NO: 33) and JF02 primer (5′-GCACGCCTCAGCCGAGCTCCAAGCGGCGAC-3′) (SEQ ID NO: 34), and the pCRII-ITR and pBSII-ITR transposition events were sequenced using fluorescent labeled M13 reverse primer.
Automatic Thermocycle Sequencing:
Sequencing was performed using the Thermo Sequenase Fluorescent Labeled Primer Sequencing Kit (Amersham) and the ALF Express Automated Sequencer (Pharmacia Biotech), following standard protocols provided by the manufacturers.
Other Plasmids:
The present invention also provides ID sequences adjacent to the TRD of the piggyBac transposon that contribute to a high frequency of germline transformation in D. melanogaster. The present invention provides an analysis of a series of PGR synthesized deletion vectors constructed with the 3xP3-ECFP gene as a transformation marker (Horn and Wimmer, 2000). These vectors define ID sequences immediately adjacent to the 5′ TRD and 3′ TRD adjacent ID sequences that effect efficient germline transformation of D. melanogaster. Using this information, the present invention provides a new ITR cartridge, called ITR1.1K, and verifies its utility in converting an existing plasmid into a mobilizable piggyBac vector that enables efficient germline transformation. The present invention also provides a transposon-based cloning vector, pXL-BacII, for insertion of sequences within a minimal piggyBac transposon and verifies its capabilities in germline transformations.
Example 15—Materials and Methods for Example 12Plasmids
The pCaSpeR-hs-orf helper plasmid was constructed by PCR amplifying the piggyBac open reading frame using IFP2orf_For and IFP2orf_Rev primers, cloning into the pCRII vector (Invitrogen), excising using BamH I, and inserting into the BamH I site of the P element vector, pCaSpeR-hs (Thummel, et al., 1992). A single clone with the correct orientation and sequence was identified and named pCaSpeR-hs-orf (
The p(PZ)-Bac-EYFP plasmid was constructed from the p(PZ) plasmid (Rubin and Spradling, 1983) by digesting with Hind III and recircularizing the 7 kb fragment containing LacZ, hsp70 and Kan/ori sequences to form the p(PZ)-7 kb plasmid. The ITR cartridge was excised from pBSII-ITR (Li et al., 2001b) using Not I and Sal I and blunt end cloned into the Hind III site of the p(PZ)-7 kb plasmid. A 3xP3-EYFP marker gene was PCR amplified from pBac{3xP3-EYFPafm} (Horn and Wimmer, 2000), digested with Spe I, and inserted into the Xba I site to form p(PZ)-Bac-EYFP. It contains the LacZ gene, Drosophila hsp70 promoter, Kanamycin resistance gene, ColE1 replication origin, 3xP3-EYFP marker and the piggyBac terminal repeats-only ITR cartridge (
The pBSII-3xP3-ECFP plasmid was constructed by PCR amplifying the 3xP3-ECFP marker gene from pBac{3xP3-ECFPafm} (Horn and Wimmer, 2000) using the primer pair ExFP_For and ExFP_Rev, then digesting the amplified fragment with Spe I, and cloning it into the Xba I site of pBlueScript II plasmid (Stratagene).
The piggyBac synthetic internal deletion plasmids were constructed by PCR amplification from the pIAO-P/L-589 bp plasmid (Li et al., 2001b) using a series of primers. A total of 9 PCR products were generated using the combination of IFP2_R4 against all five IFP2_L primers and IFP2_L5 against all four IFP2_R primers. Two additional PCR products were also obtained using the IPF2_R-TR+IFP2_L and IFP2_R1+IFP2_L primer pairs. These PCR products were then cloned into the pCR II vector using the TOPO TA cloning kit (Invitrogen), excised using Spe I digestion, and cloned into the Spe I site of the pBSII-3xP3-ECFP plasmid to form the piggyBac internal deletion series (
A separate cloning strategy was used to construct pBS-pBac/DsRed. The 731 bp Ase I-blunted fragment from p3E1.2, including 99 bp of 3′ piggyBac terminal sequence and adjacent NPV insertion site sequence, was ligated into a unique Kpn I-blunted site in pBS-KS (Stratagene). The resulting plasmid was digested with Sac I and blunted, then digested with Pst I, and ligated to a 173 bp Hinc II-Nsi I fragment from p3E1.2, including 38 bp of 5′ piggyBac terminal sequence. The pBS-pBac minimal vector was marked with polyubiquitin-regulated DsRed1 digested from pB[PubDsRed1] (Handler and Harrell, 2001a) and inserted into an EcoR I-Hind III deletion in the internal cloning site within the terminal sequences.
Example 16 Transformation of Drosophila melanogasterThe D. melanogaster w1118 white eye strain was used for all microinjections employing a modification of the standard procedure described by Rubin and Spradling (1982), in which the dechorionation step was eliminated. Equal concentrations (0.5 μg/μl) of each of the internal deletion plasmids, or the control plasmid pBac{3xP3-ECFPafm}, were injected along with an equal amount of the pCaSpeR-hs-orf helper plasmid into fresh fly embryos followed by a one hour heat shock at 37° C. and recovery overnight at room temperature. Emerging adults were individually mated with w1118 flies, and progeny larvae were screened using an Olympus SZX12 fluorescent dissecting microscope equipped with GFP (480 nm excitation/510 nm barrier), CFP (436 nm excitation/480 nm barrier), and YFP (500 nm excitation/530 barrier) filter sets. Two positive adults from each of the vials were crossed with w1118 to establish germline transformed strains. The pBS-pBac/DsRed1 minimal vector was also injected and screened under HQ Texas Red® set no. 41004 (Handler and Harrell, 2001a).
Direct PCR Analysis
Genomic DNAs from each of the transformed stains, the w1118 wild type strain, and a piggyBac positive strain M23.1 (Handler and Harrell, 1999) were prepared using a modified DNAzol procedure. About 60 flies from each strain were combined with 150 μl of DNAzol (Molecular Research Center, Inc.) in a 1.5 ml eppendorf tube. The flies were homogenized, an additional 450 μl of DNAzol was added, and the homogenates were incubated at room temperature for one hour. The DNAs were extracted twice with phenol:chloroform (1:1 ratio), and the aqueous fractions were transferred to new tubes for precipitation of the DNA with an equal volume of 2-propanol. The DNA pellets were washed with 70% ethanol, air dried, and 150 μl of dH2O containing 10 μg of RNase A was added and resuspended.
Two sets of direct PCRs were performed to identify the presence of piggyBac sequences in transformed fly genomes. Primers MF34 and IFP2_L were used to identify the presence of the piggyBac 3′ terminal repeat, while MF34 and IFP2_R1 were used for identifying the piggyBac 5′ terminal repeat. To exclude the possibility of recombination, a second PCR was also performed using the IFP2_R1 and IFP2_L primers to amplify the external stuffer fragment (Li et al., 2001) between the terminal repeat regions.
Southern Hybridization Analysis
Southern hybridization analysis was performed using a standard procedure with minor modifications (Ausubel et al. 1994). Approximately 8 μg of genomic DNA (isolated as above) from each of the transformed fly strains was digested with 40 units of Hind III for four hours, followed by agarose gel electrophoresis at 60 Volts for 4 to 5 hours. The gel was then denatured, neutralized and transferred to nylon membranes, and baked at 80° C. for four hours. The membranes were pre-hybridized in the hybridization buffer overnight. A synthetic probe was prepared by nick translation (Invitrogen kit) using 32P labeled dGTP against the pBSII-ITR1.1K-ECFP plasmid template. The purified probe was hybridized at 65° C. overnight followed by several washes, and the membranes were first exposed on phosphor screens (Kodak) overnight for scanning with a Storm phosphor Scanner (Molecular Dynamics System), and then exposed on X-ray film (Kodak).
Universal PCR and Inverse PCR Analysis
The piggyBac insertion sites in the transformed fly strains were identified using either universal PCR (Beeman et al., 1997) or inverse PCR techniques (Ochman et al., 1988). For the universal PCR, the IFP2_L (3′ TR) or IPR2_R1 (5′ TR) primer was combined with one of 7 universal primers during the first round of PCR (94° C. 1 minute, 40° C. 1 minute, 72° C. 2 minutes, 35 cycles). 2 μl of the reaction mixture from the first round of PCR was then used for a second round of PCR (94° C. 1 minute, 50° C. 1 minute, 72° C. 2 minutes, 35 cycles) using IFP2_L1 (3′ TR) or iPCR_R1 (5′ TR) together with a T7 primer (nested on the universal primer).
Inverse PCRs were performed by digesting 5 ug of the genomic DNAs from each of the transformed strains completely with HinP1 I for the 3′ end or Taq I for the 5′ end, followed by purification using the Geneclean kit (Q-Biogene) and self-ligation in a 100 ul volume overnight. The self-ligated DNAs were precipitated and resuspended in 30 ul ddH2O. A portion of them were then used for first round PCR (94° C. 1 minute, 40° C. 1 minute, 72° C. 2 minutes, 35 cycles) with primer pairs IFP2_R1+MF14 for the 5′ end and JF3+IFP2_Lb for the 3′ end. 2 ul of the first round PCR products were used as templates for the second round PCR (94° C. 1 minute, 50° C. 1 minute, 72° C. 2 minutes, 35 cycles) using primer pairs iPCR_R1+iPCR_6 for the 5′ end and iPCR_L1+MF04 for the 3′ end. The pBSII-ITR1.1k-ECFP strains were slightly different, the primer pair iPCR_L1+IFP2_L-R were used for the 3′ end in the second round PCR. All the PCR products were cloned into the pCRII vector (Invitrogen) and sequenced. The sequences were used to BLAST search the NCBI database to identify the locations of the insertions. MacVector 6.5.3 (Oxford Molecular Group) and ClustalX (Jeanmougin et al., 1998) were used for sequence alignments.
Example 17—Transformation Experiments with Synthetic Deletion ConstructsEach of the piggyBac synthetic internal deletion plasmids was formed by PCR amplifying from the pIAO-P/L-589 plasmid (Li et al., 2001) by PCR amplifying across the facing terminal repeats and spacer with primers that recognize 5′ or 3′ sequences adjacent to the respective TRDs (
Each of the synthetic deletion series plasmids and the control plasmid, pBac{3xP3-ECFPafm}, were co-injected with the hsp70-regulated transposase helper into w1118 embryos, with surviving adults backcrossed, and G1 adult progeny screened for fluorescence. Positive transformants exhibited fluorescent eyes with CFP and GFP filter sets but not with the YFP filter set. Transformation frequencies from all injections are listed in Table 1, below.
Eight of the eleven synthetic ID deletion plasmids yielded positive transformants at an acceptable (not significantly different from control, P<0.05) frequency. The 5′ ID deletion constructs pBSII-ECFP-R1/L5, pBSII-ECFP-R2/L5, pBSII-ECFP-R3/L5 and pBSII-ECFP-R4/L5 had variable deletions of the piggyBac 5′ ID, retaining sequences from 66 bp (nucleotides 36˜101 of the piggyBac sequence, GenBank Accession Number: AR307779) to 542 bp (36˜567 of the piggyBac sequence). Each of these 5′ ID deletions yielded ECFP positive germ line transformants at frequencies from 8.9% to 15.0% (Table 1) when paired with 1 kb of the 3′ ID sequence (nucleotides 1454˜2409 of the piggyBac sequence). These results suggested that a minimal sequence of no more than 66 bp of the 5′ ID may be necessary for efficient germline transposition.
The R4 minimum 5′ ID sequence primer was then used in combination with a series of 3′ ID deletion primers to generate the constructs pBSII-ECFP-R4/L4, pBSII-ECFP-R4/L3, pBSII-ECFP-R4/L2 and pBSII-ECFP-R4/L1. Of these four constructs, only pBSII-ECFP-R4/L1, which represented the greatest deletion of 3′ ID sequence (2284˜2409 of the piggyBac sequence), failed to yield transformants. Once again, frequencies for the positive transformant constructs were similar to the control (Table 1). It was therefore deduced that the minimal 3′ ID sequence requirement for efficient germline transformation was between 125 bp (L1) and 378 bp (L2) of the 3′ TRD adjacent ID sequence.
Example 18—Construction of the ITR1.1k Minimal Sequence piggyBacCartridgeTo construct a minimal sequence cartridge using the information gained from the synthetic deletion analysis, combinations of 5′ and 3′ minimal sequences were assembled and their transformation capabilities were tested. The pBSII-ECFP-R-TR/L construct is composed of a 35 bp 5′ TRD lacking any 5′ ID sequence, coupled to a fragment containing the 65 bp 3′ TRD and 172 bp of the adjacent 3′ ID sequence. This combination did not yield any transformants, confirming the necessity for having 5′ ID sequences in combination with 3′ ID sequences for efficient transformation. Unexpectedly, addition of 101 bp of the 5′ ID sequences to the 5′ TRD sequences in the construct pBSII-ECFP-R1/L was not sufficient to recover transformation capacity when paired with the 172 bp 3′ ID sequences, even though the lower limit of essential 5′ ID sequences had been suggested to be 66 bp using pBSII-ECFP-R1/L5 (Table 1). Increasing the 5′ ID sequences to 276 bp in the pBSII-ITR1.1k-ECFP plasmid recovered the full transformation capability when paired with the 172 bp 3′ ID sequence (Table 2). The minimal operational requirement for 5′ ID sequences is therefore between 276 and 101 bp when coupled to a minimal 3′ ID sequence of 172 bp.
Two independent verifications of the pBSII-ITR1.1k-ECFP plasmid transforming capabilities were conducted for transformation of D. melanogaster. These transformation experiments resulted in calculated frequencies of 13.9% (
Five recovered pBSII-ITR1.1k-ECFP transformed strains were used to perform genetic mapping to identify their chromosome locations. Several of the strains had insertions on the second and third chromosomes (including strain 1), while strain 3 had an insertion on the X chromosome. Strain 1 and strain 3 were chosen for further analyses.
Direct PCR Analysis of Integrations:
Genomic DNAs from each of the transformed strains obtained with the synthetic deletion constructs in
The first set of PCRs utilized the IFP2_R1 and MF34 primers to amplify the 5′ terminal repeat regions, and the second set of PCRs used the IFP2_L and MF34 primers to amplify the 3′ terminal repeat regions. All of the synthetic deletion transformed strains, the M23.1 control strain, and the plasmid control yielded a strong PCR product of the correct size for each of the primer sets, confirming the presence of both of the piggyBac terminal repeat regions in all of the transformed strains. Interestingly, the white eye strain w1118 yielded a very weak product of the correct size with the 5′ terminal repeat PCR amplification, but failed to generate a product with the 3′ terminal specific primer set.
A third set of PCRs was performed using the IFP2_R1 and IFP2_L primers in an attempt to amplify the external lambda phage DNA stuffer sequence which would be present if an insertion resulted from recombination of the entire plasmid sequence rather than transposition. The control product from this PCR reaction is a 925 bp fragment, and no such corresponding fragments were generated with any of the transformed strain genomic DNAs.
Southern Hybridization Analysis:
Southern hybridization analysis was performed to verify the copy number and further confirm transposition of the piggyBac deletion plasmids into the Drosophila genome (
The diagnostic 2960 bp pBSII backbone and 1158 bp ECFP marker fragments were present in all of the transformed strains examined. All of these strains also exhibited at least two additional bands corresponding to the piggyBac termini and adjacent sequences at the integration site (
To further verify that piggyBac-mediated transposition of the synthetic deletion constructs occurred in these transformants, individual insertion sites were examined by isolating joining regions between the transposon and genomic sequences using either universal PCR or inverse PCR. Subsequent sequencing analysis of these joining regions demonstrated that all of the insertions occurred exclusively at single TTAA target sites that were duplicated upon insertion, and all insertion sites had adjacent sequences that were unrelated to the vector. The two pBSII-ITR1.1k-ECFP strains 1 and 3 have a single insertion on the third and X chromosome respectively.
Example 20—Pairings of 5′ PiggyBac Minimum Sequence with Long 3′ End Transposon SequencesIn these studies, transformation results from synthetic unidirectional deletion plasmids demonstrate that no more than 66 bp (nt 36˜101 of the piggyBac sequence) of the piggyBac 5′ ID sequence and 378 bp (nt 2031˜2409 of the native (wild-type) piggyBac sequence) of the piggyBac 3′ ID sequence are necessary for efficient transformation when these deletions are paired with long (378 or 311 bp, respectively, or longer) ID sequences from the opposite end of the transposon. The transformation data from the pBSII-ITR1.1k-ECFP plasmid further defines the 3′ ID essential sequence as 172 bp (nt 2237˜2409 of the native (wild-type) piggyBac sequence). Combining this same 172 bp 3′ ID sequence with only the 5′ TRD in the pBSII-ECFP-R-TR/L plasmid yielded no transformants, demonstrating that the 3′ ID sequence alone was insufficient for full mobility. Unexpectedly, adding the 66 bp 5′ ID sequence in pBSII-ECFP-R1/L also does not allow recovery of full transformation capability in spite of the fact that the same 66 bp does allow full transformation capability when coupled to the larger (378 bp) 3′ ID sequence in the pBSII-ECFP-R1/L2. This result cannot be explained by size alone, since the ITR cartridge strategy used to test this deletion sequence construct effectively replaces the rest of the piggyBac ID with the 2961 bp pBSII plasmid sequence.
There appears to be an important sequence within the additional 206 bp of the L2 3′ ID sequence that compensates for the smaller 5′ ID sequence of R1. The data infer that an analogous sequence at the 5′ end should be located within the 210 bp added to the 5′ ID sequence in construction of the pBSII-ITR1.1k-ECFP, since this construct exhibits full transforming capability using the L 3′ ID sequence. Aligning these two sequences using MacVector 6.5.3 identified two small segments of repeat sequences common between these approximately 200 bp sequences. These repeats, ACTTATT (nt 275˜281, 2120˜2126 and 2163˜2169 of the piggyBac sequence) and CAAAAT (nt 185˜190, 158˜163 and 2200˜2205 of the piggyBac sequence), occur in direct and opposite orientations, and are also found in several other locations of the piggyBac ID (
The present example describes the piggyBac construct materials (e.g. synthetic deletion constructs) used in the transformation of Drosophila melanogaster.
Materials and Methods
Plasmids
The pCaSpeR-hs-orf helper plasmid was constructed by PCR amplifying the piggyBac open reading frame using IFP2orf_For and IFP2orf_Rev primers, cloning into the pCRII vector (Invitrogen), excising with BamH I and inserting into the BamH I site of the P element vector, pCaSpeR-hs (Thummel, et al., 1992). A single clone with the correct orientation and sequence was identified and named pCaSpeR-hs-orf (
The p(PZ)-Bac-EYFP plasmid (
The pBSII-3xP3-ECFP plasmid was constructed by PCR amplifying the 3xP3-ECFP marker gene from pBac{3xP3-ECFPafm} (Horn and Wimmer, 2000) using the primer pair ExFP_For and ExFP_Rev (Table 2), digesting the amplified fragment with Spe I, and cloning it into the Xba I site of pBlueScript II plasmid (Stratagene).
The piggyBac synthetic internal deletion plasmids were constructed by PCR amplification from the pIAO-P/L-589 bp plasmid (Li et al., 2001b) using a series of primers (Table 2). A total of 9 PCR products were generated using the combination of IFP2_R4 against all five IFP2_L primers and IFP2_L5 against all four IFP2_R primers. Two additional PCR products were also obtained using the IPF2_R-TR+IFP2_L and IFP2_R1+IFP2_L primer pairs. These PCR products were then cloned into the pCR II vector (Invitrogen), excised by Spe I digestion, and cloned into the Spe I site of the pBSII-3xP3-ECFP plasmid to form the piggyBac internal deletion series (
The pBS-pBac/DsRed1 plasmid was constructed by excising the 731 bp Ase I-fragment from p3E1.2, including 99 bp of 3′ piggyBac terminal sequence and adjacent NPV insertion site sequence, and ligating it as a blunt fragment into a unique Kpn I-blunted site in pBS-KS (Stratagene). The resulting plasmid was digested with Sac I and blunted, digested with Pst I, and ligated to a 173 bp Hinc II-Nsi I fragment from p3E1.2, including 38 bp of 5′ piggyBac terminal sequence. The pBS-pBac minimal vector was marked with the polyubiquitin-regulated DsRed1 digested from pB[PUbDsRed1] (Handler and Harrell, 2001a) and inserted into an EcoR I-Hind III deletion in the internal cloning site within the terminal sequences.
Transformation of Drosophila melanogaster
The D. melanogaster w1118 white eye strain was used for all microinjections employing a modification of the standard procedure described by Rubin and Spradling (1982) in which the dechorionation step was eliminated. Equal concentrations (0.5 ug/ul) of each of the internal deletion plasmids or the control plasmid pBac{3xP3-ECFPafm}, were injected along with an equal amount of the pCaSpeR-hs-orf helper plasmid into embryos followed by a one hour heat shock at 37° C. and recovery overnight at room temperature. Emerging adults were individually mated with w1118 flies, and progeny were screened as larvae using an Olympus SZX12 fluorescent dissecting microscope equipped with GFP (480 nm excitation/510 nm barrier), CFP (436 nm excitation/480 nm barrier), and YFP (500 nm excitation/530 barrier) filter sets. Two positive adults from each of the vials were crossed with w1118 to establish germ-line transformed strains. The pBS-pBac/DsRed1 minimal vector was also injected and screened using a HQ Texas Red® filter no. 41004 (Handler and Harrell, 2001a).
Direct PCR Analysis
Genomic DNAs from each of the transformed stains, the w1118 wild type strain, and a piggyBac positive strain M23.1 (Handler and Harrell, 1999) were prepared using a modified DNAzol procedure. About 60 flies from each strain were combined with 150 ul of DNAzoI (Molecular Research Center, Inc.) in a 1.5 ml eppendorf tube. The flies were homogenized, an additional 450 ul of DNAzoI was added, and the homogenates were incubated at room temperature for one hour. The DNAs were extracted twice with phenol:chloroform (1:1 ratio), and the aqueous fractions were transferred to new tubes for precipitation of the DNA with an equal volume of 2-propanol. The DNA pellets were washed with 70% ethanol, air dried, and resuspended in 150 ul of dH2O containing 10 ug of RNase A.
Two sets of direct PCRs were performed to identify the presence of piggyBac sequences in transformed fly genomes. Primers MF34 and IFP2_L were used to identify the presence of the piggyBac 3′ terminal repeat, while MF34 and IFP2_R1 were used for identifying the piggyBac 5′ terminal repeat. To exclude the possibility of recombination, a second PCR was also performed using the IFP2_R1 and IFP2_L primers to amplify the external stuffer fragment (Li et al., 2001b) between the terminal repeat regions.
Southern Hybridization Analysis
Southern hybridization analysis was performed using a standard procedure with minor modifications (Ausubel et al. 1994). Approximately 8 ug of genomic DNA (isolated as above) from each of the transformed fly strains was digested with 40 units of Hind III for four hours, followed by agarose gel electrophoresis. The gel was then denatured, neutralized and transferred to nylon membranes, and baked at 80° C. for four hours, and the membranes were pre-hybridized overnight. A synthetic probe was prepared by nick translation (Invitrogen kit) using 32P labeled dGTP against the pBSII-ITR1.1K-ECFP plasmid template. Purified probe was hybridized at 65° C. overnight followed by several washes, and the membranes were first exposed on phosphor screens (Kodak) overnight for scanning with a Storm phosphor Scanner (Molecular Dynamics System), and then exposed on X-ray film (Kodak).
Universal PCR and Inverse PCR Analysis
The piggyBac insertion sites in the transformed fly strains were identified using either universal PCR (Beeman et al., 1997) or inverse PCR techniques (Ochman et al., 1988). For the universal PCR, the IFP2_L (3′ TR) or IPR2_R1 (5′ TR) primer was combined with one of 7 universal primers (Table 2) during the first round of PCR (94° C. 1 min, 40° C. 1 min, 72° C. 2 min, 35 cycles). 2 ul of the reaction mix from the first round PCR was then used for a second round of PCR (94° C. 1 min, 50° C. 1 min, 72° C. 2 min, 35 cycles) using IFP2_L1 (3′ TR) or iPCR_R1 (5′ TR) together with a T7 primer (nested on the universal primer).
Inverse PCRs were performed by digesting 5 ug of the genomic DNAs from each of the transformed strains completely with HinP1 I for the 3′ end or Taq I for the 5′ end, followed by purification using the Geneclean kit (Q-Biogene) and self-ligation in a 100 ul volume overnight. The self-ligated DNAs were precipitated and resuspended in 30 ul ddH2O. A 5 μl portion of each ligation was used for first round PCR (94° C. 1 min, 40° C. 1 min, 72° C. 2 min, 35 cycles) with primer pairs IFP2_R1+MF14 for the 5′ end, and JF3+IFP2_Lb for the 3′ end (Table 2). 2 μl of the first round PCR products were used as templates for the second round PCR (94° C. 1 min, 50° C. 1 min, 72° C. 2 min, 35 cycles) using primer pairs iPCR_R1+iPCR_6 for the 5′ end and iPCR_L1+MF04 for the 3′ end. The primer pair iPCR_L1+IFP2_L-R was used for the second round PCR of the 3′ end of pBSII-ITR1.1k-ECFP strains. All the PCR products were cloned into the pCRII vector (Invitrogen) and sequenced. Sequences were subjected to a BLAST search of the NCBI database to identify the locations of the insertions. MacVector 6.5.3 (Oxford Molecular Group) and ClustalX (Jeanmougin et al., 1998) were used for sequence alignments.
Example 22—Transformation Studies with Synthetic Deletion ConstructsInitial attempts to transform D. melanogaster with plasmids having only TRD sequences as specified in previous reports (Li et al., 2001b) yielded transformation frequencies far less than full length piggyBac constructs. The p(PZ)-Bac-EYFP construct contains the ITR cartridge of Li et al. (2001b) composed of the 5′ and 3′ TRD and the spacer sequence, while the pBS-pBac/DsRed retains only 2 bp of 5′ ID and 36 bp of 3′ ID sequences in addition to the 5′ and 3′ TRD. Neither of these constructs were able to generate germ-line transformants at the frequencies previously reported for full length vectors (Handler and Harrell, 1999) or the less extensive internal deletion construct pBac{3xP3-ECFPafm} (Horn and Wimmer, 2000). The potential involvement of piggyBac ID sequences in generating germ line transformations were therefore reexamined.
The requirements for TRD was examined adjacent ID sequences of the piggyBac transposon using a synthesized cartridge strategy based upon construction of the previously reported ITR cartridge (Li et al., 2001b), rather than digesting with an endonuclease and selecting clones representing an internal deletion series. Each of the piggyBac synthetic internal deletion plasmids was formed from the pIAO-P/L-589 plasmid (Li et al., 2001b) by PCR amplification across the facing TRDs and spacer sequences with primers that recognize 5′ or 3′ ID sequences adjacent to the respective TRDs (
Each of the synthetic deletion series plasmids and the control plasmid, pBac{3xP3-ECFPafm}, were co-injected with the hsp70-regulated transposase helper into w1118 embryos, with surviving adults backcrossed, and G1 adult progeny screened for fluorescence. Positive transformants exhibited fluorescent eyes with CFP and GFP filter sets but not with the YFP filter set. Transformation frequencies from all injections are listed in Table 3. The p(PZ)-Bac-EYFP plasmid, which was constructed using the ITR cartridge previously described (Li et al., 2001b), yielded a relatively low transformation frequency of 0.6% compared to the control plasmid, pBac{3xP3-ECFPafm} frequency of 12.9% (Table 3).
Eight of the eleven synthetic ID deletion plasmids yielded positive transformants at an acceptable frequency compared to the control. The 5′ ID deletion constructs pBSII-ECFP-R1/L5, pBSII-ECFP-R2/L5, pBSII-ECFP-R3/L5 and pBSII-ECFP-R4/L5 had variable deletions of the piggyBac 5′ ID, retaining sequences from 66 bp (nucleotides 36˜101; GenBank Accession Number: AR307779) to 542 bp (nucleotides 36˜567) of the piggyBac sequence. Each of these 5′ ID deletions yielded ECFP positive germ-line transformants at frequencies from 8.9% (+/−1.0%) to 15.0% (+/−0.6%) (Table 3) when paired with 1 kb of the 3′ ID sequence (nucleotides 1454-2409). These results demonstrated a minimal sequence of no more than 66 bp of the 5′ ID is appropriate for effective germ-line transposition.
The R4 minimum 5′ ID sequence primer was then used in combination with a series of 3′ ID deletion primers to generate the constructs pBSII-ECFP-R4/L4, pBSII-ECFP-R4/L3, pBSII-ECFP-R4/L2 and pBSII-ECFP-R4/L1. Of these four constructs, only pBSII-ECFP-R4/L1, which represented the greatest deletion of 3′ ID sequence (2284˜2409 of the piggyBac sequence), failed to yield transformants. Once again, frequencies for the constructs that yielded positive transformants compared favorably with the control (Table 3). It was therefore deduced that the minimal 3′ ID sequence requirement for efficient germline transformation was between 125 bp (L1) and 378 bp (L2) of the 3′ TRD adjacent ID sequence.
Construction of the ITR1.1k Minimal Sequence PiggyBac Cartridge
To construct a minimal sequence cartridge using the information gained from the synthetic deletion analysis combinations of 5′ and 3′ minimal sequences were constructed and tested for their transformation capabilities. The pBSII-ECFP-R-TR/L construct is composed of a 35 bp 5′ TRD lacking any 5′ ID sequence, coupled to a fragment containing the 63 bp 3′ TRD and 172 bp of the adjacent 3′ ID sequence. This combination did not yield any transformants, confirming the necessity for having 5′ ID sequences in combination with 3′ ID sequences for efficient transformation.
Unexpectedly, addition of 66 bp of the 5′ ID sequences to the 5′ TRD sequences in the construct pBSII-ECFP-R1/L was not sufficient to recover transformation capacity when paired with the 172 bp 3′ ID sequences, even though the lower limit of essential 5′ ID sequences as 66 bp using pBSII-ECFP-R1/L5 had been previously defined (Table 4). Increasing the 5′ ID sequences to 276 bp in the pBSII-ITR1.1k-ECFP plasmid recovered the full transformation capability when paired with the 172 bp 3′ ID sequence (Table 4). The minimal operational sequence requirement for 5′ ID sequences is therefore between 276 and 66 bp when coupled to a minimal 3′ ID sequence of 172 bp.
Two independent verifications of the pBSII-ITR1.1k-ECFP plasmid transforming capabilities were conducted for transformation of D. melanogaster. These transformation studies resulted in calculated frequencies of 13.9% (
Five recovered pBSII-ITR1.1k-ECFP transformed strains were used to perform genetic mapping to identify their chromosome locations. Several of the strains had insertions on the second and third chromosomes (including strain 1), while strain 3 had an insertion on the X chromosome. Strain 1 and strain 3 were chosen for further analyses.
Direct PCR Analysis of Integrations:
Genomic DNAs from each of the transformed strains obtained with the synthetic deletion constructs in
The first set of PCRs utilized the IFP2_R1 and MF34 primers to amplify the 5′ terminal repeat regions, and the second set of PCRs used the IFP2_L and MF34 primers to amplify the 3′ terminal repeat regions. All of the synthetic deletion transformed strains, the M23.1 control strain, and the plasmid control yielded a strong PCR product of the correct size for each of the primer sets, confirming the presence of both of the piggyBac terminal repeat regions in all of the transformed strains. The white eye strain w1118 yielded a very weak product of the correct size with the 5′ terminal repeat PCR amplification, but failed to generate a product with the 3′ terminal specific primer set.
A third set of PCRs was performed using the IFP2_R1 and IFP2_L primers in an attempt to amplify the external lambda phage DNA stuffer sequence which would be present if an insertion resulted from recombination of the entire plasmid sequence rather than transposition. The control product from this PCR reaction is a 925 bp fragment, and no such corresponding fragments were generated with any of the transformed strain genomic DNAs.
Example 23—Southern Hybridization AnalysisSouthern hybridization analysis was performed to verify the copy number and further confirm transposition of the piggyBac deletion plasmids into the Drosophila genome (
The diagnostic 2960 bp pBSII backbone and 1158 bp ECFP marker fragments were present in all of the transformed strains examined. All of these strains also exhibited at least two additional bands corresponding to the piggyBac termini and adjacent sequences at the integration site (
To further verify that piggyBac-mediated transposition of the synthetic deletion constructs occurred in these transformants, individual insertion sites were examined by isolating joining regions between the transposon and genomic sequences using either universal PCR or inverse PCR. Subsequent sequencing analysis of these joining regions demonstrated that all of the insertions occurred exclusively at single TTAA target sites that were duplicated upon insertion, and all insertion sites had adjacent sequences that were unrelated to the vector (Table 4). The two pBSII-ITR1.1k-ECFP strains 1 and 3 have a single insertion on the third and X chromosome respectively. This data is consistent with the information obtained from genetic crosses with balancer strains.
During sequence analysis of the integration sites a reported point mutation in the present constructs was confirmed that occurs at position 2426 in the piggyBac sequence, within the 3′ TRD at the boundary of the 31 bp spacer and the internal repeat sequence. This point mutation was apparently generated in constructing the pIAO-P/L plasmid (Li et al., 2001b) and was therefore present in all of the constructs generated by the PCR syntheses employed in these studies. This point mutation had no apparent effect on the transformation frequencies as evidenced by the efficiency of transformation obtained with pBSII-ITR1.1k-ECFP.
The available piggyBac insertion site data from previous reports and these studies were compiled and aligned using ClustalX to identify a potential common insertion site motif (Table 5). No apparent consensus motif arose from the comparison of these sequences outside of the required TTAA target site.
Attempts to transform insects using plasmids containing a previously reported piggyBac ITR minimal sequence cartridge (Li et al., 2001b), that has facing 5′ and 3′ TRDs with their respective TTAA target sites and is completely devoid of ID sequences, failed to produce a transformation frequency that was comparable to frequencies obtained with full length or conservative ID deletion constructs (Handler and Harrell, 1999; Horn and Wimmer, 2000).
Frequencies of transposition obtained for the ITR-based p(PZ)-Bac-EYFP and the similarly constructed pBS-pBac/DsRed were far less than expected. While Southern hybridization and inverse PCR analyses did confirm that the single transformant recovered with p(PZ)-Bac-EYFP had resulted from transpositional insertion, the efficient transposition of piggyBac minimal vectors evidenced in interplasmid transposition assays (Li et al., 2001b) did not necessarily predict the properties of piggyBac transposon movement in germline transformations.
The fact that germline transposition involves distinctly different cell populations than interplasmid transposition in injected embryos may explain these discrepancies. Similar discrepancies between transformation results and artificial transposition assays have been reported with other Class II transposons (Tosi and Beverley, 2000; Lohe and Hartl, 2001; Lozovsky et al., 2002). In addition, the Hermes transposable element undergoes normal cut-and-paste transposition in plasmid-based transposition assays (Sarkar et al., 1997a), but germline integrations in Ae. aegypti seem to occur either through general recombination or through a partial replicative transposition mechanism (Jasinskiene et al., 2000).
The synthetic cartridge approach used to examine the role of ID sequences in effecting efficient germline transposition has the advantage of examining the involvement of sequences through reconstruction rather than by analysis of successive internal deletions. The main disadvantage of this approach in analyzing piggyBac is the high AT content of the transposon, which limits the position of useful primers. As a result, the present analyses does not define the exact limits of the requisite sequences. However, some of the most effective nucleic acid sequences are delimited to a relatively narrow 250 bp of TRD adjacent nucleic acid sequences.
Transformation results from synthetic unidirectional deletion plasmids shown here demonstrates that no more than about 66 bp (nt 36˜101) of the piggyBac 5′ nucleic acid sequence and about 378 bp (nt 2031˜2409) of the piggyBac 3′ nucleic acid sequence are necessary for efficient transformation when these deletions are paired with long (378 or 311 bp, respectively, or longer) nucleic acid sequences from the opposite end of the transposon. The transformation data from the pBSII-ITR1.1k-ECFP plasmid further defines the 3′ nucleic acid sequence as 172 bp (nt 2237˜2409). Combining this same 172 bp 3′ nucleic acid sequence with only the 5′ TRD in the pBSII-ECFP-R-TR/L plasmid yielded no transformants, demonstrating that the 3′ nucleic acid sequence alone was insufficient for full mobility. Unexpectedly, adding the 66 bp 5′ nucleic acid sequence in pBSII-ECFP-R1/L also does not allow recovery of full transformation capability while the same 66 bp does allow full transformation capability when coupled to the larger (955 bp) 3′ nucleic acid sequence in pBSII-ECFP-R1/L5. This result cannot be explained by size alone, since the ITR cartridge strategy used to test these deletion sequence constructs effectively replaces the rest of the piggyBac nucleic acid sequence with the 2961 bp pBSII plasmid sequence.
The frequencies obtained for a given construct may be higher or lower relative to the control. The present studies detect the limits of nucleic acid sequences that yield acceptable transformation frequencies, and do not evaluate the effectiveness of the deleted regions relative to one another.
The present results indicate the presence of important nucleic acid sequences between nucleotides 66 and 311 of the 5′ nucleic acid sequence used for construction of the pBSII-ITR1.1k-ECFP, since this construct exhibits full transforming capability when matched with the L 3′ ID sequence. Compensating sequences must be present in 3′ nucleic acid sequences longer than 172 bp, since the 955 bp 3′ nucleic acid sequence included with primer L5 is able to compensate for the 66 bp 5′ nucleic acid sequence (construct pBSII-ECFP-R1/L5). There was noted a presence of small repeats in the 5′ nucleic acid sequence of pBSII-ITR1.1K-ECFP that are matched by similar sequences in the 3′ nucleic acid sequences included in construct pBSII-ECFP-R1/L5. These relatively small repeats (
Previous observations of efficient interplasmid transposition for the piggyBac ITR construct, completely devoid of piggyBac internal domain nucleic acid sequences (ID), support a mechanism for movement in which the piggyBac transposase binds at the terminal repeat regions (IR, spacer and TR) to effect transposition (Li et al., 2001b). Since the cut-and-paste reactions of excision and transposition do not appear to require ID sequences, the relatively unsuccessful application of the previously constructed ITR cartridge for germ-line transformation suggests the required ID sequences may be involved in other aspects of the transformation process than the mechanics of cut-and-paste. These other aspects seem to be linked to differential movement in germ line cells.
The presence of sequences important for full transforming capability within internal domains of transposons is not without precedent. Transposase binding to target sequences at or near the ends of the element is necessary to generate a synaptic complex that brings the ends of the element together for subsequent DNA cleavage (reviewed by Saedler and Gierl, 1996), but the efficiency of this interaction can be influenced by other sequences in the transposon. Multiple transposase binding sites or accessory factor binding sites are identified in other Class II transposon systems. Efficient transposition of mariner requires the continuity of several internal regions of this element and their proper spacing with respect to the terminal repeats (Lohe and Hartl, 2001; Lozovsky et al., 2002), although they are not essential for in vitro transposition (Tosi and Beverley, 2000). The P element transposase binding occurs at 10 bp subterminal sequences present at both 5′ and 3′ ends, while the 31 bp terminal inverted repeat is recognized by a Drosophila host protein, IRBP (inverted repeat binding protein), and an internally located 11 bp inverted repeat is shown to act as a transpositional enhancer in vivo (Rio and Rubin, 1988; Kaufman et al., 1989; Mullins et al., 1989). The maize Ac transposase binds specifically and cooperatively to repetitive ACG and TCG trinucleotides, which are found in more than 20 copies in both 5′ and 3′ subterminal regions, although the Ac transposase also weakly interacts with the terminal repeats (Kunze and Starlinger 1989; Becker and Kunze 1997). The TNPA transposase of the En/Spm element binds a 12 bp sequence found in multiple copies within the 5′ and 3′ 300 bp subterminal repeat regions (Gierl et al., 1988; Trentmann et al., 1993). The Arabidopsis transposon Tag1 also requires minimal subterminal sequences and a minimal internal spacer between 238 bp and 325 bp for efficient transposition (Liu et al., 2000). The Sleeping Beauty (SB) transposable element contains two transposase binding sites (DRs) at the end of the ˜230 bp terminal inverted repeats (Ivics et al., 1997). The DNA-bending protein HMGB1, a cellular cofactor, was found to interact with the SB transposase in vivo to stimulate preferential binding of the transposase to the DR further from the cleavage site, and promoted bending of DNA fragments containing the transposon IR (Zayed et al., 2003).
These examples demonstrate that the piggyBac transposase or some host accessory factors could be binding to the identified critical TRD adjacent ID regions to promote efficient transposition in germ-line cells. While not intending to be limited to any particular theory or mechanism of action, these subterminal ID sequences may serve as additional piggyBac transposase binding sites, thus increasing the efficiency of movement by cooperative binding of the transposase. Alternatively, these sequences may serve as some accessory factor binding site(s) responsible for efficient alignment of the termini or facilitating association of the transposon with chromatin-complexed genomic sequences.
The present results force a reassessment of the reliability of plasmid-based transposition assays in predicting piggyBac movement for transgenesis. Plasmid-based transposition assays, while facilitating mutational analyses of the transposon, are likely to be reliable predictors of in vivo movement only when alterations lead to a loss of movement. This difference is likely due to the fact that plasmid-based assays indicate the activity of the transposon in somatic cells while transformation assays assess movement in germ-line cells. Chromatin in the primordial germ cells is structured and regulated differently than that of blastoderm cells (reviewed by Wolffe, 1996). This difference could contribute to different results in the two types of assays. Interplamsid transposition assays utilize purified supercoiled DNA as the target, while transformation assays target chromatin. Nucleosome formation on negatively supercoiled DNA occurs virtually instantaneously in vitro (Pfaffle and Jackson, 1990), and target plasmid DNA introduced into the embryo cells would most likely form nucleosome structures, but there will be a significant difference in complexity compared to chromatin. This difference in complexity could be the cause of different transposition results. Alternatively, the absence of additional transposase or accessory factor binding sites on the transposon could result in less efficient translocation of the DNA to the nucleus, or lessened affinity of the transposon/transposase complex for the genomic DNA.
Example 25—TRD Point Mutation AnalysisSequence analysis of integrated constructs and subsequent detailed analysis of all the constructs confirms a point mutation in the TRD of all constructs examined in this study. This mutation is a C-A transversion in the 19 bp internal repeat sequence of the 3′ TRD (
Under the conditions of the present direct PGR amplification using piggyBac 5′ terminus-specific primers, a weak band of the same size as the expected piggyBac band was generated from control w1118 flies. The Southern hybridizations detected a 1.3 kb band in all of the transformants that was distinct from the pBSII backbone fragment (2.96 kb) and 3xP3-ECFP (1.16 kb) marker bands. piggyBac-like. sequences have been detected in many species by PGR and Southern hybridization analysis using probes derived from the piggyBac 5′ terminal region, including moths, flies, beetles, etc. (reviewed by Handler, 2002). A homology search against the available sequence database has identified the existence of the piggyBac-like sequences in the D. melanogaster genome (Sarkar et ai, 2003). These results reflect the presence of one of these degenerate piggyBac-Wke sequences in the Drosophila genome.
The insertion sites in the transformed fly strains were identified by either universal PCR or inverse PCR techniques. All insertions occurred exclusively at TTAA sites verifying that these insertions were due to a specific piggyBac transposase-mediated mechanism (Fraser et al., 1995). A ClustalX alignment of all piggyBac insertion sites identified here, including insertion sites in the transposition assay target plasmid pGDV1 (Sarkar et al., 1997b), baculovirus, and transformed insect genomes, does not reveal any further significant similarities (Table 5). The proposed existence of a larger piggyBac insertion consensus sequence YYTTTTTT/AARTAAYAG (SEQ ID NO: 124) (Y=pyrimidine, R=purine, /=insertion point) by Cary et al. (1989) and Grossman et al. (2000), and a short 8 bp consensus sequence A/TNA/TTTAAA/T (SEQ ID NO: 125) proposed by Li et al. (2001a) seem to be contradicted by the accumulated insertion site data. A decided preference was noted for piggyBac insertion within TTAA target sites flanked by 4-5 Ts on the 5′ side and 5-6 As on the 3′ side (Table 5).
Based on the minimal piggyBac vector pBSII-ITR1.1k-ECFP, a plasmid minimal vector, pXL-BacII-ECFP, was constructed which also yields a high frequency of transformation in D. melanogaster (Table 3). The present results confirm that both the pBSIIITR1.1k-ECFP and the pXL-BacII-ECFP minimal vectors can serve as highly efficient piggyBac transformation vectors.
All documents, patents, journal articles and other materials cited in the present application are hereby incorporated by reference.
Although the present invention has been fully described in conjunction with several embodiments thereof with reference to the accompanying drawings, it is to be understood that various changes and modifications may be apparent to those skilled in the art. Such changes and modifications are to be understood as included within the scope of the present invention as defined by the appended claims, unless they depart therefrom.
BIBLIOGRAPHYThe following materials are hereby specifically incorporated herein by reference in their entirety.
- 1. Ausubel F M, et al. (1994), Current Protocols in Molecular Biology, John Wiley & Sons, Inc.
- 2. Becker H A, Kunze R (1997), Mol. Gen. Genet., 254(3): 219-30.
- 3. Beeman R W, Stauth D M (1997), Insect Mol. Biol., 6(1): 83-8.
- 4. Berghammer A J, et al. (1999), Nature, 402: 370-371.
- 5. Buck T A, et al. (1997), Mol. Gen. Genet., 255: 605-610.
- 6. Cary L C, et al. (1989), Virology, 172: 156-169.
- 7. Elick T A, et al. (1996a), Genetica, 97(2): 127-139.
- 8. Elick T A, Bauser C A, Fraser M J Jr (1996b), Genetica., 98(1): 33-41.
- 9. Elick T A, et al. (1997), Mol. Gen. Genet., 255(6): 605-610.
- 10. Fraser M J Jr, et al. (1983), J. Virol., 47: 287-300.
- 11. Fraser M J Jr, et al. (1985), Virology, 145(2): 356-61.
- 12. Fraser M J Jr, et al. (1995), Virology, 211(2): 397-407.
- 13. Fraser M J Jr, Ciszczon T, Elick T, Bauser C (1996), Insect Mol. Biol., 5(2): 141-51.
- 14. Geier, G. and Modrich, P. (1979) J. Biol. Chem., 254 (4):1408-1413.
- 15. Gierl A, Lutticke S, Saedler H (1988), EMBO J., 7(13): 4045-53.
- 16. Goryshin I Y, et al. (1994), Proc. Natl. Acad. USA, 91: 10834-10838.
- 17. Grossman G L, et al. (2000), Insect Biochem. Mol. Biol., 30(10): 909-14.
- 18. Grossman G L, et al. (2001), Insect Mol. Biol., 10(6): 597-604.
- 19. Grossniklaus U, et al. (1992), Genes Dev., 6(6): 1030-51.
- 20. Handler A M, et al. (1998) Proc. Natl. Acad. Sci. USA, 95(13): 7520-5.
- 21. Handler A M, Harrell R A 2nd (1999), Insect Mol. Biol., 8(4): 449-57.
- 22. Handler A M, McCombs S D (2000), Insect Mol. Biol., 9(6): 605-12.
- 23. Handler A M, Harrell R A 2nd (2001a), Biotechniques, 31(4): pp. 824-8.
- 24. Handler A M, Harrell R A 2nd (2001b), Insect Biochem. Mol. Biol., 31(2): 199-205.
- 25. Handler A M (2002), Insect Biochem. Mol. Biol., 32(10): 1211-20.
- 26. Hediger M, et al. (2001), Insect Mol. Biol., 10(2): 113-9.
- 27. Heinrich J C, et al. (2002), Insect Mol. Biol., 11(1): 1-10.
- 28. Hirt B (1967), J. Mol. Bio., 26: 367-369.
- 29. Horn C, Wimmer E A (2000), Dev. Genes Evol., 210(12): 630-7.
- 30. Ivics Z, Hackett P B, Plasterk R H, Izsvak Z (1997), Cell, 91(4): 501-10.
- 31. Jarvis et al. (1990), Biotechnology, 8 (10): 950-955.
- 32. Jasinskiene N, et al. (2000), Insect Mol. Biol., 9(1): 11-8.
- 33. Kaufman P D, et al. (1989), Cell, 59(2): 359-71.
- 34. Kokoza V, et al. (2001), Insect Biochem. Mol. Biol., 31(12): 1137-43.
- 35. Kunze R, Starlinger P (1989), EMBO J., 8(11): 3177-85.
- 36. Li X, Heinrich J C, Scott M J (2001a), Insect Mol. Biol., 10(5): 447-55.
- 37. Li X, Lobo N, Bauser C A, Fraser M J Jr (2001b), Mol. Genet. Gen., 266(2): 190-8.
- 38. Liu D, et al. (2000), Genetics, 157(2): 817-30.
- 39. Lobo N, Li X, Fraser M J Jr (1999), Mol. Gen. Genet., 261(4-5): 803-10.
- 40. Lobo N, et al. (2001), Mol. Genet. Gen., 265(1): 66-71.
- 41. Lobo N F, et al. (2002), Insect Mol. Biol., 11(2): 133-9.
- 42. Lohe A R, Hartl D L (2001), Genetics, 160(2): 519-26.
- 43. Lozovsky E R, et al. (2002), Genetics, 160(2): 527-35.
- 44. Mandrioli M, Wimmer E A (2002), Insect Biochem. Mol. Biol., 33(1): 1-5.
- 45. Mullins M C, Rio D C, Rubin G M (1989), Genes Dev., 3(5): 729-38.
- 46. Nolan T, et al. (2002), J. Biol. Chem., 277(11): 8759-62.
- 47. Ochman H, et al. (1988), Genetics, 120(3): 621-3.
- 48. Peloquin J J, et al. (2000), Insect Mol. Biol., 9(3): 323-33.
- 49. Perera O P, et al. (2002), Insect Mol. Biol., 11(4): 291-7.
- 50. Pfaffle P, Jackson V (1990), J. Biol. Chem., 265(28): 6821-9.
- 51. Rio, D C, Rubin G M (1988), Proc. Natl. Acad. Sci. USA, 85: 8929-8933.
- 52. Rubin G M, Spradling A C (1982), Science, 218(4570): 348-53.
- 53. Rubin G M, Spradling A C (1983), Nucleic Acids Res., 11(18): 6341-51.
- 54. Saedler H, Gierl A (Editors) (1996) Transposable Elements, Soringer-Verlag, Berlin.
- 55. Sambrook J, Fritsch E F, and Maniatis T (1989) Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Press).
- 56. Sarkar A, Yardley K, Atkinson P W, James A A, O'Brochta D A (1997a), Insect Biochem. Mol. Biol., 27(5): 359-63.
- 57. Sarkar A, et al. (1997b), Genetica., 99(1): 15-29.
- 58. Sarkar A, et al. (2003), Mol. Genet. Genomics, 270(2): 173-80.
- 59. Sekar V (1987), BioTechniques, 5: 11-13.
- 60. Sumitani M, et al. (2003), Insect Biochem. Mol. Biol., 33(4): 449-458.
- 61. Tamura T, et al. (2000), Nat. Biotechnol. 18(1): 81-4.
- 62. Thibault S T, et al. (1999), Insect Mol. Biol., 8(1): 119-23.
- 63. Thomas J L, et al. (2002), Insect Biochem. Mol. Biol., 32(3): 247-53.
- 64. Thummel, C S and Pirrotta, V (1992), Dros. Info. Service, 71: 150-150.
- 65. Tosi L R, Beverley S M (2000), Nucleic Acids Res., 28(3): 784-90.
- 66. Trentmann S M, Saedler H, Gierl A (1993), Mol. Gen. Genet., 238(1-2): 201-208.
- 67. Wang H H, Fraser M J Jr (1993), Insect Mol. Biol., 1: 109-116.
- 68. Zayed H, et al. (2003), Nucleic Acids Res., 31(9): 2313-2322.
Claims
1. A plasmid selected from the group consisting of pBSII-ECFP-R4/L2 deposited as ATCC Accession # PTA-122185, pBSII-ECFP-R4/L3 deposited as ATCC Accession # PTA-122183, and pBSII-ECFP-R4/L4 deposited as ATCC Accession # PTA-122184.
2. The plasmid of claim 1, wherein the plasmid is ECFP-R4/L2 deposited as ATCC Accession # PTA-122185.
3. The plasmid of claim 1, wherein the plasmid is pBSII-ECFP-R4/L3 deposited as ATCC Accession # PTA-122183.
4. The plasmid of claim 1 wherein the plasmid is pBSII-ECFP-R4/L4 deposited as ATCC Accession # PTA-122184.
| 6218185 | April 17, 2001 | Shirk et al. |
| 6551825 | April 22, 2003 | Shirk et al. |
| 6773914 | August 10, 2004 | Handler |
| 6962810 | November 8, 2005 | Fraser et al. |
| 7105343 | September 12, 2006 | Fraser et al. |
| 20020116723 | August 22, 2002 | Grigliatti et al. |
| 20020173634 | November 21, 2002 | Fraser et al. |
| 20020199216 | December 26, 2002 | MacRae |
| WO 2005042753 | May 2005 | WO |
| WO 2006122442 | November 2006 | WO |
- X70275, GI: 406850, publicly available Oct. 1993.
- GenBank Accession No. DQ340395, GI: 84872947, publicly available Dec. 31, 2006.
- Zimowska et al. Highly conserved piggyBac elements in noctuid species of Lepidoptera. Insect Biochemistry and Molecular Biology, vol. 36, pp. 421-428, 2006.
- GenBank Accession No. AF402295, GI: 15986716, publicly available Oct. 9, 2001.
- GenBank Accession No. AR307779, publicly available Jun. 2003.
- Xu et al. Identification and characterization of piggyBac-like elements in the genome of domesticated silkworm, Bombyx mori. Molecular Genetics and Genomics, vol. 276, No. 1, pp. 31-40, Jul. 2006.
- Paveltiz et al. PGDB5: a neural-specific intron-containing piggyBac transposase domesticated over 500 million years ago and conserved from cephalochordates to humans. Mobile DNA, vol. 4, 23, 2013, printed as pp. 1/17-17/17.
- Ausubel, et al., “Short Protocols in Molecular Biology: A Compendium of Methods from Current Protocols in Molecular Biology,” 2002, vol. 1 edition 5, John Wiley & Sons, Inc., cover and bibliographic information only.
- Ausubel, et al., “Short Protocols in Molecular Biology: A Compendium of Methods from Current Protocols in Molecular Biology,” 2002, vol. 2, edition 5, John Wiley & Sons, Inc., cover and bibliographic information only.
- Beeman RW, Stauth DM (1999), Nature, 402: 370-371.
- Becker, et al., “Maize Activator transposase has a bipartite DNA binding that recognizes subterminal sequences and the terminal inverted repeats,” Mol Gen Genet, 1997, p. 219-230, v. 254, Springer-Verlag.
- Beeman, et al., “Rapind cloning of insect transposon insertion junctions using ‘universal’ PCR,” Insect Molecular Biology, 1997, p. 83-88, v. 6 i. 1, Blackwell Science Ltd.
- Berghammer, et al., “A universal marker for transgenic insects,” Nature, Nov. 25, 1999, p. 370-371, v. 402, Macmillan Magazines Ltd.
- Elick, et al., “Analysis of the cis-acting DNA elements required for piggyBac transposable element excision,” Mol Gen Genet, 1997, p. 605-610, v. 255, Springer-Verlag.
- Cary, et al., “Transposon Mutagenesis of Baculoviruses: Analysis of Trichoplusia ni Transposon IFP2 Insertions within the FP-Locus of Nuclear Polyhedrosis Viruses,” Virology, 1989, v. 172, Academic Press, Inc., p. 156-169.
- Elick, et al., “Excision of the piggyback transposable element in vitro is a precise event that is enhanced by the expression of its encoded transposase,” Genetica, 1996, p. 33-41, v. 98, Kluwer Academic Publishers.
- Elick, et al., “PCR analysis of insertion site specificity, transcription, and structural uniformity of the Lepidoptera transposable element IFP2 in the TN-368 cell genome,” Genetica, 1996, p. 127-139, v. 97, Kluwer Academic Publishers.
- Elick, et al., “Analysis of the cis-acting DNA elements required for piggyBack transposable element excision,” Mol Gen Genet, 1997, p. 605-610, v. 255, Springer-Verlag.
- Fraser, et al., “Acquisition of Host Cell DNA Sequences by Baculoviruses: Relationship Between Host DNA Insertions and FP Mutants of Autographa californica and Galleria mellonella Nuclear Polyhedrosis Viruses,” Journal of Virology, 1983, p. 287-300, v. 47 i. 2, american Society for Microbiology.
- Fraser, et al., “Transposon-Mediated Mutagenesis of a Baculovirus,” Virology, 1985, p. 356-361, v. 145, Academic Press, Inc.
- Fraser, et al., “Assay for Movement of Lepidopteran Transposon IFP2 in Insect Cells Using a Baculovirus Genome as a Target DNA,” Virology, 1995, p. 397-407, v. 211, Academic Press, Inc.
- Fraser, et al., “Precise excision of TTAA-specific lepidopteran transposons piggyBac (IFP2) and tagalong (TFP3) from the baculovirus genome in cell lines from two species of Lepidoptera,” Insect Molecular Biology, 1996, p. 141-151, v. 5 i. 2, Blackwell Science Ltd.
- Geier, et al., “Recognition Sequence of the dam Methylase of Escherichia coli K12 and Mode of Cleavage of Dpn I Endonuclease*,” The Journal of Biological Chemistry, 1979, p. 1408-1413, v. 254, n. 4, i. Feb. 25.
- Gierl, et al., “TnpA product encoded by the transposable element En-1 of Zea Mays is a DNA binding protein,” IRL Press Limited, Oxford, England, EMBO J. 7(13) : 4045-53.
- Goryshin, et al., “DNA length, binding, and twisting constraints on IS50 transposition,” Proc. Natl. Acad. Sci. USA., 1994, p. 10834-10838, v. 91.
- Grossman, et al., “The piggyBac element is capable of precise excision and transposition in cells and embryos of the mosquito, Anopheles gamblae,” Insect Biochemistry and Molecular Biology, 2000, p. 909-914, v. 30, Elsevier Science Ltd.
- Grossman, et al., “Germline tranformation of the malaria vector, Anopheles gambiae, with the piggyBac transposable element,” Insect Molecular Biology, 2001, p. 597-604, v. 10 i. 6, Blackwell Science Ltd.
- Grossniklaus, et al., “The Drosophila sloppy paired locus encodes two proteins involved in segmentation that show homology to mammalian transcription factors,” Genes & Development, 1992, p. 1030-1051, v. 6, Cold Spring Harbor Laboratory.
- Handler, et al., “The lepidopteran transposon bector, piggyBac, mediates germ-line transformation in the Mediterranean fruit fly,” Proc. Natl. Acad. Sci. USA, 1998, p. 7520-7525, v. 95, The National Academy of Sciences.
- Handler, et al., “Germline transformation of Drosophila melanogaster with the piggyBac transposon vector,” Insect Molecular Biology, 1999, p. 449457, v. 8 i. 4, US Government.
- Handler, et al., “The piggyBac transposon mediates germ-line transformation in the Oriental fruit fly and closely related elements exist in its genome,” Insect Molecular Biology, 2000, pp. 605-612, v. 9 i. 6, Blackwell Science Ltd.
- Handler, et al., “Polyubiquitin-Regulated DsRed Marker for Transgenic Insects,” BioTechniques, 2001, p. 820-828, v. 31.
- Handler, et al., “Transformation of the Caribbean fruit fly, Anastrepha suspense, with a piggyBac vector marked with polyubiquitin-regulated GFP,” Insect Biochemistry and Molecular Biology, 2000, p. 199-205, v. 31, Elsevier Science Ltd.
- Handler M. Alfred, “Use of the piggyBac transposon for germ-line transformation of insects,” Insect Biochemistry and Molecular Biology, 2002, p. 1211-1220, v. 32, Elsevier Science Ltd.
- Hediger, et al., “Genetic transformation of the housefly Musca domestica with the lepidopteran derived transposon piggyBac,” Insect Molecular Biology, 2001, p. 113-119, v. 10 i. 2, Blackwell Science Ltd.
- Heinrich, et al., “Germ-line transformation of the Australian sheep blowfly Lucilia cuprina,” Insect Molecular Biology, 2002, p. 1-10, v. 11 i. 1, Royal Entomological Society.
- Hirt, Bernhard, “Selective Extraction of Polyoma DNA from Infected Mouse Cell Cultures,” J. Mol. Bio., 1967, p. 367-369, v. 26.
- Horn, et al., “A versatile vector set for animal transgenesis,” Dev Genes Evol, 2000, p. 630-637, v. 210, Springer-Verlag.
- Ivics, et al., “Molecular Reconstruction of Sleeping Beauty, a Tc1-like Transposon from Fish, and Its Transposon in Human Cells,” Cell, 1997, p. 501-510, v. 91, Cell Press.
- Jarvis, et al., “Use of early baculovirus promoters for continuous expression and efficient processing of foreign gene products in stably transformed lepidopteran cells,” Biotechnology, 1990, p. 950-955, v. 8 i. 10, PubMed.
- Jasinskiene, et al., “Structure of Hermes integrations in the germline of the yellow fever mosquito, Aedes aegypti,” Insect Molecular Biology, 2000, p. 11-18, v. 9 i. 1, Blackwell Science Ltd.
- Kaufman, et al., “Drosophila P Element Transposase Recognizes Internal P Element DNA Sequences,” Cell, 1989, p. 359-371, v. 59, Cell Press.
- Kokoza, et al., “Efficient transformation of the yellow fever mosquito Aedes aegypti using the piggyBac transposable element vector pBac[3x P3—EGFP AFM],” Insect Biochemistry and Molecular Biology, 2001, p. 1137-1143, v. 31, Elsevier Science Ltd.
- Kunze, et al., “The putative trasposase of transposable element Ac from Zea Mays L. interacts with subterminal sequences of Ac,” p. 3177-3185, IRL Press, 1989 EMBO J 8 (11).
- Li, et al., “piggyBac-mediated transposition in Drosophila melanogaster: an evaluation of the use of constitutive promoters to control transposase gene expression,” Insect Molecular Biology, 2001, p. 447-455, v. 10 i. 5, Blackwell Science Ltd.
- Li, et al., “The minimum internal and external sequence requirements for transposition of the eukaryotic transformation vector piggBac,” Mol Genet Genomics, 2001, p. 190-198, v. 266, Springer-Verlag.
- Liu, et al., “Function Dissection of the cis-Acting Sequences of the Arabidopsis Transposable Element Tag1 Reveals Dissimilar Subterminal Sequence and Minimal Spacing Requirements for Transposition,” Genetics, 2001, p. 817-830, v. 157, Genetics Society of America.
- Lobo, et al., “Transposition of the piggBac element in embryos of Drosophila melanogaster, Aedes aegypti and Trichoplusia ni,” Mol Gen Genet, 1999, p. 803-810, v. 261, Springer-Verlag.
- Lobo, et al., “Mobiolity of piggyBac transposon in embryos of the vectors of Dengue fever (Aedes albopictus) and La Crosse encephalitits (Ae. Triseriatus),” Mol Genet Genomics, 2001, p. 66-71, v. 265, Springer-Verlag.
- Lobo, et al., “Germ line transformation of the yellow fever mosquito, Aedes aegypti, mediated by transpositional insertion of a piggyBac vector,” Insect Molecular Biology, 2002, p. 133-139, v. 11 i. 2, Royal Entomologigal Society.
- Lohe, et al., “Efficient Mobilization of mariner in Vivo Requires Multiple Internal Sequences,” Genetics, 2002, p. 519-526, v. 160, Genetics Society of America.
- Lozovsky, et al., “Unexpected Stability of mariner Transgenes in Drosophila,” Genetics, 2002, p. 527-535, v. 160, Genetics Society of America.
- Mandrioli, et al. “Stable transformation of a Mamestra brassicae (Lepidoptera) cell line with Lepidopteran-derived transposon piggyback” Insect Biochem. Mol. Bio., 2002, p. 1-5, V. 33 I. 1, Elsevier Science Ltd.
- Mullins, et al. “cis-acting DNA sequence requirements for P-element transposition” Genes & Development., 1989, p. 729-738, v. 3 i. 5, Cold Spring Harbor Laboratory Press.
- Nolan, et al. “piggyback-mediated germline transformation of the malaria mosquito Anopheles stephensi using the red fluorescent protein dsRED as a selectable marker,” The Journal of Biological Chemistry, 2002, p. 8759-8762, v 277 n. 11, The American Society for Biochemistry and Molecular Biology Inc.
- Ochman, et al. “Genetic application of an inverse polymerase chain reaction,” Genetics, 1988, p. 621-623, v. 120 i. 3, Genetics Society of America.
- Peloquin, et al. “Germ-line transformation of pink bollworm (Lepidoptera:gelechiidae) mediated by the piggyback transposable element,” Insect Molecular Biology, 2000, p. 323-333, v. 9 i. 3, Blackwell Science Ltd.
- Perera, et al. “Germ-line transformation of the South American malaria vector, Anopheles albimanus, with a piggyback/EGFP transposon vector is routine and highly efficient” Insect Molecular Biology, 2002, p. 291-297, v. 11 i. 4, The Royal Entomological Society.
- Pfaffle, et al. “Studies on Rates of Nucleosome Formation with DNA under Stress,” The Journal of Biological Chemistry, 1990, p. 16821-16829, v. 265 n. 28 i. of Oct. 5, The American Society for Biochemistry and Molecular Biology, Inc.
- Rio, et al. “Identification and purification of a Drosophila protein that binds to the terminal 31-base-pair inverted repeats of P transposable element,” Proc. Natl. Acad. Sci. USA, 1988, p. 8929-8933, v. 85, Biochemistry.
- Rubin, et al. “Genetic transformation of Drosophila with transposable element vectors,” Science, 1982, p. 348-353, v. 218, AAAS.
- Rubin, et al., “Vectors for P element-mediated gene transfer in Drosophila,” Nucleic Acids Research, 1983, p. 6341-6351, v. 11 n. 18, IRL Press Limited.
- Saedler, et al., Transposable Elements. 1996, Soringer-Verlag, cover, title page, and bibliographic info. only.
- Sambrook, et al., “Molecular Cloning: A Laboratory Manual,”1989, New York: Cold Spring Harbor Press, cover and bibliographis information only.
- Sarkar, et al., “Transposition of the Hermes element in embryos of the vector mosquito, Aedes aegypti,” Insect Biochem. Molec. Biol., 1997, p. 359-363, v. 27 n. 5, Elsevier Science Ltd.
- Sarkar, et al. “The Hermes element from Musca domestica can transpose in four families of cyclorrhaphan flies,” Genetica, 1997, p. 15-29, v. 99, Kluwer Academic Publishers.
- Sarkar, et al., “Molecular evolutionary analysis of the widespread piggyBac transposon family and related “domesticated” sequences,” Mol. Gen Genomics, 2003, p/ 173-180, v. 270, Springer-Verlag.
- Sekar, Vaithilingam, “A Rapid Screening Procedure for the Identification of Recombinant Bacterial Clones,” BioTecniques, 1987, p. 11-13, v. 5 n. 1.
- Sumitani, et al., “Germline transformation of the sawfly, Athalia rosae (Hymenoptera: Symphyta), mediated by a piggyBac-derived vector,” Insect Biochemistry and Molecular Biology, 2003, p. 449-458, v. 33, Elsevier Science Ltd.
- Tamura, et al., “Germline transformation of the silkworm Bombyx mori L. using a piggyBac transposon-derived vector,” Nature Biotechnoly, 2000, p. 81-84, v. 18, Nature America Inc.
- Thibault, et al., “Precise excision and transposition of piggyBac in pink bollworm embryos,” Insect Molecular Biology, 1999, p. 119-123, v. 8 i. 1, Blackwell Science Ltd.
- Thomas, et al., “3xP3-EGFP marker facilitates screening for transgenic silkworm Bombyx mori L. from the embryonic stage onwards,” Insect Biochemistry and Molecular Biology, 2002, p. 247-253, v. 23, Elsevier Science Ltd.
- Thummel, et al., “New pCaSpeR P element vectors,” Drosophila Information Newsletter Repreints, 1992, p. 150-151, v. 71.
- Toshiki, et al., “Germline transformation of the silkworm Bombyx mori L. using a piggyBac transposon-derived vector,” Nature Biotechnology, 2000, p. 81-84, v.18, Nature America Inc.
- Tosi, et al., “cis and trans factors affecting Mos1 mariner evolution and transposition in vitro, and its potential for functional genomics,” Nucleic Acids Research, 2000, p. 784-790, v. 28 n. 3, 2000, Oxford University Press.
- Trentmann, et al., “The transoposable element En/Spm-encoded TNPA protein contains a DNA binding and dimerization domain,” Mol Gen Genet, 1993, p. 201-208, v. 238, Spriner-Verlag.
- Wang, et al., “TTAA serves as the target site for TFP3 Lepidopteran insertions in both nuclear polyhedrosis virus and Trichoplusia ni genomes,” Insect Molecular Biology, 1993, p. 109-116, v. 1 i. 3.
- Zayed, et al., “Teh DNA-bending protein HMGB1 is a cellular cofactor of Sleeping Beauty transposition,” Nucleic Acids Research, 2003, p. 2312-2322, v. 31 n. 9, Oxford University Press.
- Amsterdam et al., (1999), “Retrovirus-mediated insertional mutagenesis in zebrafish,” Methods in Cell Biol., 60:87-98.
- Aoki et al., (1987), “Complete nucleotide sequence of pTZ12, a chloramphenicol-resistance plasmid of Bacillus subtillis,” Gene, 51:107-111.
- Bonin et al., (2004), “A piggyBac transposon gene trap for the analysis of gene expression and function in Drosophila,” Genetics, 167:1801-1811.
- Bron et al., (1990), “Plasmids used in Bacillus,” in Molecular Biology Methods for Bacillus, pp. 75-173, Harwood et al., eds., John Wiley & Sons Ltd.
- Coates et al., (1995), “The transposable element mariner can excise in non-drosophilid insects,” Mol. Gen. Genet., 249:246-252.
- Coates et al., (1997), “Interplasmid transposition of the mariner transposable element in no-drosophilid insects,” Mol Gen. Genet., 253:728-733.
- Ding et al., (2005), “Efficient transposition of the piggyBac (PB) transposon in mammalian cells and mice,” Cell, 122:473-483.
- Fraser et al., (2000), “The TTAA-Specific family of transposable elements: identification, functional characterization, and utility for transformation of insects,” in Insect Transgenesis: Methods and Applications, pp. 249-268, CRC Press LLC.
- Gaiano et al., (1996), “Highly efficient germ-line transmission of proviral insertions in zebrafish,” Proc. Natl. Acad. Sci. USA, 93:7777-7782.
- Gaiano et al., (1996), “Insertional Mutagenesis and rapid cloning of essential genes in zebrafish,” Nature, 383:829-832.
- Gluzman et al., (1981), “SV40-Transformed simian cells support the replication of early SV40 mutants,” Cell, 23:175-182.
- Gonzalez-Estevez et al., (2003), “Transgenic planarian lines obtaines by electroporation using transposon-derived vectors and an eye-specific GFP marker,” Proc. Natl. Acad. Sci. USA, 100:14046-14051.
- Hacker et al., (2003), “piggyBac-based insertional mutagenesis in the presence of stably integrated P elements in Drosophila,” Proc. Natl. Acad. Sci. USA, 100:7720-7725.
- Handler et al., (2004), “Post-integration stabilization of a transposon vector by terminal sequence deletion in Drosophila melanogaster,” Nature Biotech., 22:1150-1154.
- Horn et al., (2003), “piggyBac-based insertional mutagenesis and enhancer detections as a tool for functional insect genomics,” Genetics, 163:647-661.
- Izsvak et al., (2002), “Sleeping beauty, a wide host-range transposon vector for genetic transformation in vertebrates,” J. Mol. Biol., 302:93-102.
- Kawakami et al., (1998), “Excision of the Tol2 transposable element of the medaka fish, Oryzias latipes, in zebrafish, Dani rerio,” Gene, 225:17-22.
- Kawakami et al., (2000), “Identification of a functional transposase of the Tol2 element, an Ac-like element from the Japanese medaka fish, and its transposition in the zebrafish germ lineage,” Proc. Natl. Acad. Sci. USA, 97:11403-11408.
- Kim et al., (2004), “Ectopic expression of a cecropin transgene in the human malaria vector mosquito Anopheles gambiae (diptera: culcidae): effects on susceptibility to plasmodium,” J. Med. Entomol., 41:447-455.
- Korn et al., (1992), Enhancer trap integration in mouse embryonic stem cells gives rise to staining patterns in chimaeric embryos with a high frequency and detects endogenous genes, Mechanisms of Development, 39:95-109.
- Li et al., (2005), “PiggyBac internal sequences are necessary for efficient transformation of target genomes,” Insect Mol. Biol., 14:17-30.
- Lin et al., (1994), “Integration and Germ-Line Transmission of a Pseudotyped Retroviral Vector in Zebrafish,” Science, 265:666-669.
- Linney et al., (1999), “Transgene expression in zebrafish: a comparison of retroviral-vector and DNA-Injection approaches,” Developmental Biol., 213: 207-216.
- Lobo et al., (2006), “Interplasmid transposition demonstrates piggyBac mobility in vertebrate species,” Genetica, 12:347-357.
- Lorenzen et al., (2003), “piggyBac-mediated germline transformation in the beetle Tribolium castaneum,” Insect Mol. Biol., 12:433-440.
- Luo et al., (1998), “Chromosomal transposition of a Tc 1/mariner-like element in mouse embryonic stem cells,” Proc. Natl. Acad. Sci. USA, 95:10769-10773.
- Parks et al., (2004), “Systematic generation of high-resolution deletion coverage of the Drosophila melanogaster genome,” Nature Genetics, 36:288-292.
- Romano et al., (2001), “Efficient in vitro and in vivo gene regulation of a retrovirally delivered pro-apoptotic factor under the control of the Drosophila HSP70 promoter,” Gene Therapy, 8:600-607.
- Ryder et al., (2003), “Transposable elements as tools for genomics and genetics in Drosophila,” Briefings in Functional Genomics and Proteomics, 2:57-71.
- Sablitzky et al., (1993), “High frequency expression of integrated proviruses derived from Enhancer trap retroviruses,” Cell Growth & Differentiation, 4:451-459.
- Thibault et al., (2004), “A complementary transposon tool kit for Drosophila melanogaster using P and piggyBac,” Nature Genetics, 36:283-287.
- Wang et al., (1989), “Transposon mutagenesis of baculoviruses: analysis of TFP3 lepidopteran transposon insertions at the FP locus of nuclear polyhedrosis viruses,” Gene, 81:97-108.
- Xiong et al., (1999), “Retroviral promoter-trap insertion into a novel mammalian septin gene expressed during mouse neuronal development,” Mechanism of Development, 86:183-191.
Type: Grant
Filed: Jun 19, 2006
Date of Patent: Oct 2, 2018
Patent Publication Number: 20100221824
Assignee: University of Notre Dame Du Lac (Notre Dame, IN)
Inventors: Malcolm J. Fraser (Granger, IN), Xu Li (Sharon, MA)
Primary Examiner: Jennifer Ann Dunston
Application Number: 11/454,947
International Classification: C12N 15/85 (20060101); C12N 15/90 (20060101);