Culturing human cells and tissues in an N-glycolylneuraminic acid-free environment
This application is in the field of sialic acid chemistry, metabolism, antigenicity, and the production of transgenic non-human mammals with altered sialic acid production. More particularly, this application relates to N-glycolylneuraminic acid (Neu5Gc) being an immunogen in humans, and the production of Neu5Gc-free mammalian products for laboratory and human use.
Latest The Regents of the University of California Patents:
- Prestrain adhesive for external respiratory measurement sensors
- Transabdominal fetal oximetry based on frequency-modulated continuous-wave near-infrared spectroscopy
- Asparagus cultivar MM4.256.78
- Scalable and high-performance pressure sensors for wearable electronics
- Use of 3D-printed freestanding structures for ex vivo tissue
This application claims the benefit of priority to Provisional Application U.S. Ser. No. 60/688,867, which was filed on Jun. 8, 2005.
GOVERNMENT INTERESTSThis invention was made with government support from the National Institutes of Health under grant number R01-CA38701.
TECHNICAL FIELDThis application is in the field of sialic acid chemistry, metabolism, antigenicity, and the production of transgenic non-human mammals with altered sialic acid production. More particularly, this application relates to N-glycolylneuraminic acid (Neu5Gc) being an immunogen in humans, and the production of Neu5Gc-free mammalian products for laboratory and human use.
BACKGROUND OF THE INVENTIONAll cells are covered with a dense and complex array of sugar chains. Sialic acids (Sias) are a family of nine-carbon sugars that are typically present at the outermost units of these chains. By virtue of their terminal position, sialic acids act as binding sites for many exogenous and endogenous receptors such as the Influenza viruses and the Siglic family of endogenous proteins. Such sugars are thus useful drug targets for the prevention and treatment of infection. They are also involved in various biological and pathological processes such as neuronal plasticity and cancer metastasis. In many of these instances, the precise structures of the sialic acid and the residues it is attached to play critical roles. Thus, studying sialic acid functions is of great biological importance. In addition, sialic acids can be taken up from certain dietary sources (red meat and dairy products), and may also be associated with certain disease states, such as cancer and heart disease.
Cytidine monophosphate-N-acetylneuraminic acid hydroxylase (CMAH) converts the sialic acid N-acetylneuraminic acid (Neu5Ac) to N-glycolylneuraminic acid (Neu5Gc.) In non-human mammals, Neu5Gc is recognized by a number of endogenous binding proteins, as well as by pathogenic organisms such as bacteria and viruses. Humans are unable to produce endogenous Neu5Gc because of an evolutionary inactivating mutation in their CMAH gene. Specifically, this mutation involves a frame-shifting exon deletion of 92 base pairs in the 5′ region that gives rise to a truncated protein that lacks the amino acid residues that are necessary for enzymatic activity (Schlenzka, W., et al., FEBS Lett. (1996) 385: 197-200.) This mutation occurred sometime after the divergence of humans from their last common ancestor, so humans are the only known animals missing a functional CMAH gene (Chou, H-H, et al., Proc. Nat. Acad. Sci. (2002), 99(18): 11736-11741.) Although the cause for this mutation is unknown, it may have been caused by negative selection of individuals that were CMAH+, because of the recognition of Neu5Gc by pathogens.
Neu5Gc is known to be immunogenic in humans (Noguchi A., et al., J. Biochem. Tokyo (1995), 117(1): 59-62.) Such immunogenicity is believed to play a role in the immune response observed in humans that come into contact with mammalian products, such as cosmetics, food, mammalian cells and cell products, as well as therapeutic agents derived from non-human mammals or exposed to non-human mammalian products. Attempts have been undertaken to try to diminish the Neu5Gc content of recombinantly produced human glycoproteins in cell lines by altering the cell lines using RNAi to suppress expression of the CMAH gene (Chenu S., et al., Biochim. Biophys. Acta. (2003), 1622(2): 133-144.)
However, there remains a need to produce biological products for human use that lack Neu5Gc, such as the production of human cells or tissues in the absence of Neu5Gc medium, and by using transgenic non-human mammals lacking a fully functional CMAH gene to produce Neu5Gc products for human use.
SUMMARY OF THE INVENTIONThis application is in the field of sialic acid chemistry, metabolism antigenicity, and the production of transgenic non-human mammals with altered sialic acid production. More particularly, this application relates to the problem of N-glycolylneuraminic acid (Neu5Gc) being an immunogen in humans, and the production of Neu5Gc-free mammalian products for laboratory and human use.
In one aspect, the present invention relates to a method for preparing a culture of human cells devoid of N-glycolylneuraminic acid (Neu5Gc) comprising the steps of: preselecting the human cells to be cultured; placing the human cells in a culture medium comprising serum selected from the group consisting of: animal-free serum replacement, mammalian-free serum, human serum, heat-inactivated human serum; and allowing the human cells to grow in the culture medium to a desired density.
Such cells can be selected from human embryonic stem cells, embryoid bodies, carcinoma cells and differentiated progenitor cells, as well as any other human cells that are easily cultured in the laboratory. Usually, the cells when grown to the desired density will contain 1% or less Neu5Gc when compared to the total sialic acid content.
The culture medium, while containing all the normal nutrients required for the growth of human cells in culture, will also optionally contain animal free serum replacement, and/or human serum. In addition, to avoid exposure to Neu5Gc antibodies, the cells may be grown on a non-human feeder layer.
In one embodiment, the cells are human embryonic stem cells, and the medium comprises human serum as the only serum source, and the human embryonic stem cells are cultured on a human cell feeder layer, wherein the human embryonic stem cells have never before been exposed to animal products.
In another embodiment, the cells may form embryoid bodies, and wherein the medium comprises human serum as the only serum source.
Under the right growth conditions, it is desired that the cells and the medium after the cells have grown to the desired density contain low levels of anti-Neu5Gc antibodies.
This application is in the field of sialic acid chemistry, metabolism, antigenicity, and the production of transgenic non-human mammals with altered sialic acid production. More particularly, this application relates to N-glycolylneuraminic acid (Neu5Gc) being an immunogen in humans, and the production of Neu5Gc-free mammalian products for laboratory and human use.
The three related problems that are addressed by the present invention are: 1) there is a need for Neu5Gc-free animal cell lines, which can be used to produce Neu5Gc biotherapeutic products; 2) there is a need for the production of human cells and tissues for human use, as well as the maintenance of human organs for transplation, under Neu5Gc-free conditions; and 3) there is a need for the production of transgenic Neu5Gc null mammals from which non-human animal products can be derived for human use.
Sialic Acid Chemistry and MetabolismSialic acid (Sia) is a generic name for a family of acidic nine carbon sugars typically found as the outermost units of glycan chains on the vertebrate cellular glycocalyx and on secreted glycoproteins. Their location and widespread occurrence on all vertebrate cells allow them to be involved in processes such as ligand-receptor interactions, cell-cell recognition, cell-pathogen binding, inflammatory processes, immune responses and tumor metastases.
There are more than 50 kinds of Sias known in nature. Most are derived via biosynthetic modification of a Sia called N-acetylneuraminic acid (Neu5Ac). The addition of a single oxygen atom to the N-acetyl group of Neu5Ac gives rise to a very common variation called N-glycolylneuraminic acid (Neu5Gc). The surfaces of most primate cell types studied to date are dominated by these two major Sias.
Neu5Gc is perhaps the most widely expressed sialic acid in non-human mammalian cells. While humans are genetically deficient in producing Neu5Gc, small amounts are present in human cells. A dietary origin was suggested by human volunteer studies, and by observing that free Neu5Gc is metabolically incorporated into cultured human cells by unknown mechanisms. Research has shown that the incorporation of Neu5Gc may predominantly originate from dietary sources (Tangvoranuntakul, P. et al. Proc. Natl. Acad. Sci. (USA) (2003) 100:12045-12050.)
Red meat from sources such as beef, pork and lamb are particularly rich in Neu5Gc and are likely the primary sources of Neu5Gc in the human diet. Also, dairy products contain Neu5Gc, although at somewhat lower levels than in red meat.
In order for a Sia molecule to get attached to glycoconjugates, it must first be activated by conversion to the sugar nucleotide derivative, cytidine-monophosphate-Sia (CMP-Sia). Thus, Sias are converted to CMP-Sias in the nucleus, which then return to the cytosol in order to be transported into the Golgi apparatus, where they serve as high-energy donors for attaching Sias to newly synthesized glycoconjugates on their way to the cell surface. The biosynthetic transformation of Neu5Ac to Neu5Gc occurs at this sugar nucleotide level, wherein the CMP-Neu5Ac hydroxylase (CMAH) catalyzes the transfer of an oxygen atom to CMP-Neu5Ac, generating CMP-Neu5Gc. CMP-Neu5Gc can then be transported into the Golgi apparatus and used, in the same manner as CMP-Neu5Ac, to add Neu5Gc to newly synthesized glycoconjugates. Indeed, these two nucleotide sugars appear to be used interchangeably by the Golgi CMP-Sia transporter and by the mammalian sialyltransferases, which transfer Sia residues to cell surface and secreted glycoconjugates. Neu5Ac or Neu5Gc molecules that are released from glycoconjugates during lysosomal degradation processes can also be exported back into the cytosolic compartment by a specific transporter. There, they are both available as substrates for conversion to their respective CMP-Sia forms. Again, there appears to be no major difference in their conversion by CMP-Sia synthases. In this manner, Neu5Gc can be “recycled” for repeated use in Golgi sialation reactions.
It has been demonstrated that free Neu5Gc uptake occurs in a variety of mammalian cells and tissues, such as secretory cells, cancer cells, and blood vessels. Inhibitors of certain non-clathrin mediated (i.e. receptor independent) endocytic pathways reduce Neu5Gc accumulation. Studies with human mutant cells show that the lysosomal sialic acid transporter is required for metabolic incorporation of free Neu5Gc. Incorporation of glycosidically-bound Neu5Gc from exogenous glycoconjugates (relevant to human gut epithelial exposure to dietary Neu5Gc) requires the transporter, as well as the lysosomal sialidase, which presumably acts to release free Neu5Gc. Thus, exogenous Neu5Gc reaches lysosomes via pinocytic/endocytic pathways, and is exported in free form into the cytosol, becoming available for activation and transfer to glycoconjugates. In contrast, N-glycolylmannosamine (ManNGc) apparently traverses the plasma membrane by passive diffusion and becomes available for conversion to Neu5Gc in the cytosol. This mechanism can also explain the metabolic incorporation of chemically synthesized unnatural sialic acids.
Sialic Acid Genetics and ImmunogenicityMost normal healthy humans have a certain amount of circulating anti-Neu5Gc antibodies, likely because of the fact that most humans ingest food sources derived from non-human mammals containing high levels of Neu5Gc. Thus, xenogenic (i.e., non-human) culture methodologies may compromise implantation/transplantation success, due to uptake and expression of Neu5Gc on the surface of any tissue developed from human cells exposed to Neu5Gc-containing products. This problem might also affect recombinant soluble biotherapeutic products.
Although Neu5Gc is a major Sia in most mammalian cells, it was long thought to be absent from healthy human tissues (Traving, C., et al. (1998) Cell. Mol. Life. Sci. 54: 1330-1349.) Indeed, humans are genetically unable to synthesize Neu5Gc, due to an exon deletion/frame shift mutation in the human CMAH gene (Varki, A. (2002) Yearb. Phys. Anthropol. 44:54-69; Chou, H. H., et al. (1998) Proc. Ntl. Acad. Sci. USA 95:11751-11756; and Irie, A., et al. (1998) J. Biol. Chem. 273: 15866-15871.). It has been estimated that this mutation occurred in the hominid lineage—2.5 to 3 million years ago (Chou, H. H. et al. (2002) Proc. Natl. Acad. Sci. USA 99:11736-11741.) One dramatic consequence of this human-specific genetic defect appears to have been the sudden unmasking of the CD33-related Siglecs during human evolution, since the ancestral condition of these molecules was to recognize Neu5Gc (Sonnengurg, J. L., et al. (2004) Glycobiology 14:339-346.)
Despite the absence of any known alternative pathway for the synthesis of Neu5Gc in humans, various groups have used antibodies to study the expression of Neu5Gc in human tumors, particularly in various carcinomas (Hirabayashy, Y. et al. (1987) Jpn. J. Cancer Res. 78:251-260; Miyoshi, I. et al. (1986) Mol. Immunol. 23:631-638; Marquina, G. et al. (1996) Cancer Res. 56:5165-5171; Carr, A. et al. (2000) Hybridoma 19:241-247; Devine, P. L., et al. (1991) Cancer Res. 51:5826-5836; Kawachi S. et al. (1988) Int. Arch. Allergy Appl. Immunol. 85:381-383; and Higashi, H. et al. (1998) Jpn. J. Cancer Res. 79:952:956.) Recent studies have reexplored these findings, confirming prior reports of Neu5Gc expression in human cancers and extending the finding to normal human tissues, including detecting small amounts of Neu5Gc in epithelial and endothelial cells of normal humans. Definitive confirmation resulted from releasing and purifying sialic acids from such tissues utilizing a fluorescent derivatized form of Neu5Gc by HPLC and mass spectrometry analysis (Tangvoranuntakal, P., et al. (2003) Proc. Natl. Acad. Sci. USA 100:12045-12050.) Moreover, it was shown that exogenously added free Neu5Gc is incorporated into cultured human carcinoma cells in vitro. In addition, oral ingestion studies of Neu5Gc in human volunteers were carried out, providing evidence that the Neu5Gc found in human tissues originates from dietary sources, particularly from red meat and milk products.
Because of the immunogenicity of Neu5Gc in humans, the production of animal products that lack Neu5Gc is, in some ways, half the story. Such animal products if they are to be acceptable for human use must also lack anti-Neu5Gc antibodies which would be carried over to human hosts receiving such animal products. Accordingly, it is desirable to limit the amount of anti-Neu5Gc antibodies in such products. In one instance, it is desirable to limit the amount of anti-Neu5Gc antibodies to within 10% (i.e., a “low” level of antibodies) of the level found in control systems that were prepared in the absence of a source of Neu5Gc. These experiments are described in greater detail elsewhere herein.
Neu5Gc Null MammalsThe mammals that are used in the practice of the invention are those animals generally regarded as useful for the production of mammalian products for human use, such as cosmetics, food stuffs, milk, mammalian cells and cell products, and therapeutic substances. Such mammals include, for example, ovine such as lamb, bovine such as beef cattle and milk cows, piscine and porcine, as well as rodents, such as mice and rats.
In one embodiment, the invention is a method to produce Neu5Gc-free transgenic mammals and products therefrom comprising mutating the CMAH gene such that it produces CMAH with less or no activity, and thereby reducing or eliminating Neu5Gc from the biological material of the non-human mammals. As detailed in
The same methodology used to knock out CMAH in mice is easily adapted for disruption of CMAH gene expression in domesticated animals, because of the high level of homology between CMAH genes in all mammals. For mice, a frameshift mutation, similar to the one found in the human CMAH, was introduced using the cre-lox recombination system. While normal wild-type mice express equal levels of Neu5Gc and Neu5Ac in their muscle tissue, and approximately 5% Neu5Gc in their milk, the transgenic mice exhibit no evidence of Neu5Gc expression in tissues or milk Since the mice are otherwise viable and fertile (as are humans), we can predict that other CMAH null animals will also be the same.
The use of Neu5Gc-free products is useful in several commercial settings. First, since consumption of Neu5Gc may pose a significant risk to human health, meat from Neu5Gc-free animals provides a safer alternative source of red meat. Second, as described in greater detail below, Neu5Gc-free serum can replace normal animal serum, which is currently used to culture human cells in laboratories. Third, the use of Neu5Gc-free bovine products in cosmetics reduces the risk of immune responses against such products.
Culturing Human Cells in Neu5Gc-Free MediumConsidering that most humans also have antibodies to Neu5Gc, incorporation of Neu5Gc is hypothesized to be one of the factors contributing to the health risks associated with high consumption of red meat (such as heart disease and certain types of cancers). In addition, the presence of Neu5Gc in human cells that are cultured in animal products for use in human therapeutic agents is also a potential source of allergenicity. More particularly, when human cells are cultured in serum from animals, they can take up and incorporate Neu5Gc, potentially resulting in immunological rejection if such cells are used for therapy (e.g., transplantation of human embryonic stem cell-derived grafts.) It has now been demonstrated that targeted disruption of the CMAH gene in mice completely abolished the expression of Neu5Gc in all tissues as well as in their secretions. Similar disruption of the CMAH gene in domesticated livestock (cows, pigs, goats, etc.) may provide a source of Neu5Gc-free animal products, which are commonly used as research materials (e.g., serum and cell extracts), as well as in cosmetics.
As described above, by targeting one single gene, CMAH, Neu5Gc can be eliminated from all mammalian tissues and secretions, including serum, muscle tissue and milk. Since Neu5Gc is immunogenic to humans, eliminating CMAH from domesticated animals would provide a source of non-immunogenic Neu5Gc-free products for human cell culture, tissue culture, and even organ preservation. For example, a CMAH null cow will not uptake and incorporate Neu5Gc from ingested meat, milk etc. Accordingly, this invention provides a way of preparing transgenic animals whose serum and other products can be used to produce cell cultures and tissues that will reduce the risk of developing potentially autoreactive antibodies after implantation of such cells and tissues into humans. The absence of Neu5Gc in mammalian serum products used for human cell tissue culture would also provide more human-like growth conditions.
HESCs can potentially generate every body cell type, making them excellent candidates for cell and tissue replacement therapies. HESCs are typically cultured with animal-derived “serum replacements” on murine feeder layers. Both of these are sources of the non-human sialic acid Neu5Gc, against which many humans have circulating antibodies. Both HESC and derived embryoid bodies metabolically incorporate significant amounts of Neu5Gc under standard conditions. Exposure to human sera with anti-Neu5Gc antibodies results in binding of immunoglobulin and deposition of complement, which leads to cell killing in vivo. Levels of Neu5Gc on HESCs and embryoid bodies dropped after culture in heat-inactivated anti-Neu5Gc-antibody-negative human serum, reducing binding of antibodies and complement from high titer sera, while allowing maintenance of the undifferentiated state. Absent the availability of Neu5Gc-free mammalian products, complete elimination of Neu5Gc would likely require using human serum with human feeder layers, ideally starting with fresh HESCs that have never been exposed to animal products.
The pluripotent abilities of HESCs have potential for treating many diseases by transplantation of HESC-derived tissues. While safety is a major issue regarding infection or tuinorigenicity, the possibility of rejection is also of concern. Current culture methods useing animal products also carry the risk of infection by non-human pathogens. HESC lines are traditionally cultured on mitotically-inactivated mouse embryonic fibroblasts (so-called “feeder layers”), and in a media containing fetal calf serum. To avoid animal serum, certain proprietary serum replacements are sometimes used. However, these also contain animal products. When HESCs are removed from the feeder layer and grown in suspension, they differentiate into aggregates called embryoid bodies (EB). EBs are formed by precursors of several cell lineages and can be induced to differentiate into many cell types. Although the feeder layer is no longer necessary, EBs must still be maintained in “serum replacement” medium, which likewise may contain Neu5Gc positive animal products.
Production of Transgenic Non-Human Animals.
The production of transgenic non-human animals is now a common method used in the laboratory to alter the metabolism of various animals for use as models of particular disease states. For instance, there are insulin free mice, immunologically deficient animals of many species and the like. Accordingly, such methods are commonly practice by those of skill in the art and could easily be adapted to the teachings herein to produce any animal models without undue experimentation. This is especially true since the critical sequences of the HESC gene associated with its active site are well characterized and highly conserved.
In one embodiment, the present invention provides knockout non-human mammals lacking a functional CMAH. “Knock-out” refers to partial or complete suppression of the expression of a protein encoded by an endogenous DNA sequence in a cell. The “knock-out” can be affected by targeted deletion of the whole or part of a gene encoding a protein in an embryonic stem cell. As a result, the deletion may prevent or reduce the expression of the protein in any cell in the whole animal in which it is normally expressed. For example, a “CMAH knock-out animal” refers to an animal in which the expression CMAH has been reduced or suppressed by the introduction of a recombinant nucleic acid molecule that lacks at least a portion of the genomic DNA sequence encoding CMAH.
“Transgenic animal” refers to an animal to which exogenous DNA has been introduced while the animal is still in its embryonic stage. In most cases, the transgenic approach aims at specific modifications of the genome, e.g., by introducing whole transcriptional units into the genome, or by up- or down-regulating preexisting cellular genes. The targeted character of certain of these procedures sets transgenic technologies apart from experimental methods in which random mutations are conferred to the germline, such as administration of chemical mutagens or treatment with ionizing solution.
The term “knockout mammal” and the like, refers to a transgenic mammal wherein a given gene has been suppressed by recombination with a targeting vector. It is to be emphasized that the term is intended to include all progeny generations. Thus, the founder animal and all F1, F2, F3, and so on, progeny thereof are included.
The term “chimera,” “mosaic,” “chimeric mammal” and the like, refers to a transgenic mammal with a knockout in some of its genome-containing cells.
The term “heterozygote,” “heterozygotic mammal” and the like, refers to a transgenic mammal with a disruption on one of a chromosome pair in all of its genomecontaining cells.
The term “homozygote,” “homozygotic mammal” and the like, refers to a transgenic mammal with a disruption on both members of a chromosome pair in all of its genome-containing cells.
A “non-human mammal” of the invention includes mammals such as rodents, primates, sheeps, dogs (ovine such as lamb, bovine such as beef cattle and milk cows, piscine and porcine.)
Although the invention uses a typical non-human rodent animal (e.g., rats and mice), other mammals can similarly be genetically modified using the methods and compositions of the invention.
A “mutation” is a detectable change in the genetic material in the animal, which is transmitted to the animal's progeny. A mutation is usually a change in one or more deoxyribonucleotides, the modification being obtained by, for example, adding, deleting, inverting, or substituting nucleotides.
Typically, the genome of the transgenic non-human animal comprises one or more deletions in one or more exons of the genes as depicted in the boxes in
In principle, knockout animals may have one or both copies of the gene sequence of interest disrupted. In the latter case, in which a homozygous disruption is present, the mutation is termed a “null” mutation. In the case where only one copy of the nucleic acid sequence of interest is disrupted, the knockout animal is termed a “heterozygous knockout animal”. The knockout animals of the invention are typically homozygous for the disruption of both CMAH genes being targeted.
It is important to note that it is not necessary to disrupt a gene to generate a transgenic organism lacking functional expression. The invention includes the use of antisense molecules that are transformed into a cell, such that production of an OAT polypeptide is inhibited. Such an antisense molecule is incorporated into a germ cell as described more fully herein operably linked to a promoter such that the antisense construct is expressed in all cells of a transgenic organism.
Techniques for obtaining the transgenic animals of the invention are well known in the art. The techniques for introducing foreign DNA sequences into the mammalian germ line were originally developed in mice. One route of introducing foreign DNA into a germ line entails the direct microinjection of linear DNA molecules into a pronucleus of a fertilized one-cell egg. Microinjected eggs are subsequently transferred into the oviducts of pseudopregnant foster mothers and allowed to develop. About 25% of the progeny mice inherit one or more copies of the micro-injected DNA. Currently, the most frequently used techniques for generating chimeric and transgenic animals are based on genetically altered embryonic stem cells or embryonic germ cells. Techniques suitable for obtaining transgenic animals have been amply described. A suitable technique for obtaining completely ES cell derived transgenic non-human animals is described in WO 98/06834.
Knockout animals of the invention can be obtained by standard gene targeting methods as described above, typically by using ES cells. Thus, the invention relates to a method for producing a knockout non-human mammal comprising (i) providing an embryonic stem (ES) cell from the relevant animal species comprising an intact CMAH gene; (ii) providing a targeting vector capable of disrupting the intact CMAH gene; (iii) introducing the targeting vector into the ES cells under conditions where the intact CMAH undergoes homologous recombination with the targeting vector to produce a mutant CMAH gene; (iv) introducing the ES cells carrying a disrupted CMAH gene into a blastocyst; (v) implanting the blastocyst into the uterus, of pseudopregnant female; (vi) delivering animals from said females, identifying a mutant animal that carries the mutant allele and (vii) selecting for knockout animals and breeding them.
A “targeting vector” is a vector comprising sequences that can be inserted into the gene to be disrupted, e.g., by homologous recombination. The targeting vector generally has a 5′ flanking region and a 3′ flanking region homologous to segments of the gene of interest, surrounding a foreign DNA sequence to be inserted into the gene. For example, the foreign DNA sequence may encode a selectable marker, such as an antibiotics resistance gene. Examples for suitable selectable markers are the neomycin resistance gene (NEO) and the hygromycin P-phosphotransferase gene. The 5′ flanking region and the 3′ flanking region are homologous to regions within the gene surrounding the portion of the gene to be replaced with the unrelated DNA sequence. DNA comprising the targeting vector and the native gene of interest are contacted under conditions that favor homologous recombination. For example, the targeting vector and native gene sequence of interest can be used to transform embryonic stem (ES) cells, in which they can subsequently undergo homologous recombination.
Thus, a targeting vector refers to a nucleic acid that can be used to decrease or suppress expression of a protein encoded by endogenous DNA sequences in a cell. In a simple example, the knockout construct is comprised of a CMAH polynucleotide with a deletion in a critical portion of the polynucleotide (e.g., the 5′ terminus of the CMAH gene) so that a functional CMAH cannot be expressed therefrom. Alternatively, a number of termination codons can be added to the native polynucleotide to cause early termination of the protein or an intron junction can be inactivated. In a typical knockout construct, some portion of the polynucleotide is replaced with a selectable marker (such as the neo gene) so that the polynucleotide can be represented as follows: CMAH 5′/neo/CMAH 3′, where CMAH 5′ and CMAH 3′, refer to genomic or cDNA sequences which are, respectively, upstream and downstream relative to a portion of the CMAH polynucleotide and where neo refers to a neomycin resistance gene.
Proper homologous recombination can be confirmed by Southern blot analysis of restriction endonuclease digested DNA using, as a probe, a non-disrupted region of the gene. Since the native gene will exhibit a restriction pattern different from that of the disrupted gene, the presence of a disrupted gene can be determined from the size of the restriction fragments that hybridize to the probe.
In an animal obtained by the methods above, the extent of the contribution of the ES cells that contain the disrupted CMAH gene to the somatic tissues of the transgenic animal can be determined visually by choosing animal strains for the source of the ES cells and blastocyst that have different coat colors.
The transgenic animals can contain a transgene, such as reporter gene, under the control of a CMAH promoter or fragment thereof. Methods for obtaining transgenic and knockout non-human animals are known in the art. Knock out mice are generated by homologous integration of a “targeting vector” construct into a mouse embryonic stem cell chromosome which encodes a gene to be knocked out. In one embodiment, gene targeting, which is a method of using homologous recombination to modify an animal's genome, can be used to introduce changes into cultured embryonic stem cells. By targeting a CMAH gene of interest in ES cells, these changes can be introduced into the germlines of animals to generate chimeras. The gene targeting procedure is accomplished by introducing into tissue culture cells a DNA targeting vector that includes a segment homologous to a target CMAH locus, and which also includes an intended sequence modification to the CMAH genomic sequence (e.g., insertion, deletion, point mutation.) The treated cells are then screened for accurate targeting to identify and isolate those which have been properly targeted.
Generally, the embryonic stem cells (ES cells) used to produce the knockout animals will be of the same species as the knockout animal to be generated. Thus for example, mouse embryonic stem cells will usually be used for generation of knockout mice.
Embryonic stem cells are generated and maintained using methods well known to the skilled artisan such as those described by Doetschman et al. (1985), J. Embryol. Exp. Mol. Biol. 87:27-45. Any line of ES cells can be used, however, the line chosen is typically selected for the ability of the cells to integrate into and become part of the germ line of a developing embryo so as to create germ line transmission of the knockout construct. Thus, any ES cell line that is believed to have this capability is suitable for use herein. One mouse strain that is typically used for production of ES cells, is the 129J strain. Another ES cell line is murine cell line D3 (American Type Culture Collection, catalog no. CKL 1934). Still another ES cell line is the WW6 cell line (Ioffe et al. (1995) Proc. Nat. Acad. Sci. 92:7357-7361.) The cells are cultured and prepared for knockout construct insertion using methods well known to the skilled artisan, such as those set forth in: Teratocarcinomas and Embryonic Stem Cells: A Practical Approach, E. J. Robertson, ed. IRL Press, Washington, D.C. ([1987]; Bradley et al. (1986) Current Topics in Devel. Biol. 20:357-371; and Hogan et al., Manipulating the Mouse Embryo: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1986).
A targeting vector construct refers to a uniquely configured fragment of nucleic acid which is introduced into a stem cell line and allowed to recombine with the genome at the chromosomal locus of the gene of interest to be mutated. Thus, a given knock out construct is specific for a given gene to be targeted for disruption. Nonetheless, many common elements exist among these constructs and these elements are well known in the art. A typical targeting vector contains nucleic acid fragments of not less than about 0.5 kb nor more than about 10.0 kb from both the 5′ and the 3′ ends of the genomic locus which encodes the gene to be mutated. These two fragments are separated by an intervening fragment of nucleic acid which encodes a positive selectable marker, such as the neomycin resistance gene (neo). The resulting nucleic acid fragment, consisting of a nucleic acid from the extreme 5′ end of the genomic locus linked to a nucleic acid encoding a positive selectable marker which is in turn linked to a nucleic acid from the extreme 3′ end of the genomic locus of interest, omits most of the coding sequence for CMAH or other gene of interest to be knocked out. When the resulting construct recombines homologously with the chromosome at this locus, it results in the loss of the omitted coding sequence, otherwise known as the structural gene, from the genomic locus. A stem cell in which such a homologous recombination event has taken place can be selected for by virtue of the stable integration into the genome of the nucleic acid of the gene encoding the positive selectable marker and subsequent selection for cells expressing this marker gene in the presence of an appropriate drug (neomycin in this example).
Variations on this basic technique also exist and are well known in the art. For example, a “knock-in” construct refers to the same basic arrangement of a nucleic acid encoding a 5′ genomic locus fragment linked to nucleic acid encoding a positive selectable marker which in turn is linked to a nucleic acid encoding a 3′ genomic locus fragment, but which differs in that none of the coding sequence is omitted and thus the 5′ and the 3′ genomic fragments used were initially contiguous before being disrupted by the introduction of the nucleic acid encoding the positive selectable marker gene. This “knock-in” type of construct is thus very useful for the construction of mutant transgenic animals when only a limited region of the genomic locus of the gene to be mutated, such as a single exon, is available for cloning and genetic manipulation. Alternatively, the “knock-in” construct can be used to specifically eliminate a single functional domain of the targeted gene, resulting in a transgenic animal which expresses a polypeptide of the targeted gene which is defective in one function, while retaining the unction of other domains of the encoded polypeptide. This type of “knock-in” mutant frequently has the characteristic of a so-called “dominant negative” mutant because, especially in the case of proteins which homomultimerize, it can specifically block the action of (or “poison”) the polypeptide product of the wild-type gene from which it was derived. In a variation of the knock-in technique, a marker gene is integrated at the genomic locus of interest such that expression of the marker gene comes under the control of the transcriptional regulatory elements of the targeted gene. One skilled in the art will be familiar with useful markers and the means for detecting their presence in a given cell.
As mentioned above, the homologous recombination of the above described “knock out” and “knock in” constructs is sometimes rare and such a construct can insert nonhomologously into a random region of the genome where it has no effect on the gene which has been targeted for deletion, and where it can potentially recombine so as to disrupt another gene which was otherwise not intended to be altered. Such non-homologous recombination events can be selected against by modifying the above-mentioned targeting vectors so that they are flanked by negative selectable markers at either end (particularly through the use of two allelic variants of the thymidine kinase gene, the polypeptide product of which can be selected against in expressing cell lines in an appropriate tissue culture medium well known in the art, i.e. one containing a drug such as 5-bromodeoxyuridine.) Non-homologous recombination between the resulting targeting vector comprising the negative selectable marker and the genome will usually result in the stable integration of one or both of these negative selectable marker genes and hence cells which have undergone nonhomologous recombination can be selected against by growth in the appropriate selective media (e.g. media containing a drug such as 5-bromodeoxyuridine for example.) Simultaneous selection for the positive selectable marker and against the negative selectable marker will result in a vast enriclunent for clones in which the knock out construct has recombined homologously at the locus of the gene intended to be mutated. The presence of the predicted chromosomal alteration at the targeted gene locus in the resulting knock out stem cell line can be confirmed by means of Southern blot analytical techniques which are well known to those familiar in the art. Alternatively, PCR can be used.
Each targeting vector to be inserted into the cell is linearized. Linearization is accomplished by digesting the DNA with a suitable restriction endonuelease selected to cut only within the vector sequence and not the 5′ or 3′ homologous regions or the selectable marker region.
For insertion, the targeting vector is added to the ES cells under appropriate conditions for the insertion method chosen, as is known to the skilled artisan. For example, if the ES cells are to be electroporated, the ES cells and targeting vector are exposed to an electric pulse using an electroporation machine and following the manufacturer's guidelines for use. After electroporation, the ES cells are typically allowed to recover under suitable incubation conditions. The cells are then screened for the presence of the targeting vector as explained herein. Where more than one construct is to be introduced into the ES cell, each targeting vector can be introduced simultaneously or one at a time.
After suitable ES cells containing the knockout construct in the proper location have been identified by the selection techniques outlined above, the cells can be inserted into an embryo. Insertion may be accomplished in a variety of ways known to the skilled artisan, however the typical method is by microinjection. For microinjection, about 10-30 cells are collected into a micropipet and injected into embryos that are at the proper stage of development to permit integration of the foreign ES cell containing the recombination construct into the developing embryo. For instance, the transformed ES cells can be microinjected into blastocytes. The suitable stage of development for the embryo used for insertion of ES cells is very species dependent, however for mice it is about 3.5 days. The embryos are obtained by perfusing the uterus of pregnant females. Suitable methods for accomplishing this are known to the skilled artisan.
While any embryo of the right stage of development is suitable for use, typical embryos are male. In mice, the typical embryos also have genes coding for a coat color that is different from the coat color encoded by the ES cell genes. In this way, the offspring can be screened easily for the presence of the knockout construct by looking for mosaic coat color (indicating that the ES cell was incorporated into the developing embryo.) Thus, for example, if the ES cell line carries the genes for white fur, the embryo selected will carry genes for black or brown fur.
After the ES cell has been introduced into the embryo, the embryo may be implanted into the uterus of a pseudopregnant foster mother for gestation. While any foster mother may be used, the foster mother is typically selected for her ability to breed and reproduce well, and for her ability to care for the young. Such foster mothers are typically prepared by mating with vasectomized males of the same species. The stage of the pseudopregnant foster mother is important for successful implantation, and it is species dependent. For mice, this stage is about 2-3 days pseudopregnant.
Offspring that are born to the foster mother may be screened initially for mosaic coat color where the coat color selection strategy (as described above, and in the examples) has been employed. In addition, or as an alternative, DNA from tail tissue of the offspring may be screened for the presence of the knockout construct using Southern blots and/or PCR as described above. Offspring that appear to be mosaics may then be crossed to each other, if they are believed to carry the knockout construct in their germ line, in order to generate homozygous knockout animals. Homozygotes may be identified by Southern blotting of equivalent amounts of genomic DNA from mice that are the product of this cross, as well as mice that are known heterozygotes and wild type mice.
Other means of identifying and characterizing the knockout offspring are available. For example, Northern blots can be used to probe the mRNA for the presence or absence of transcripts encoding either the gene knocked out, the marker gene, or both. In addition, Western blots can be used to assess the level of expression of the CMAH gene knocked out in various tissues of the offspring by probing the Western blot with an antibody against the particular CMAH protein, or an antibody against the marker gene product (i.e., the presence of Neu5GC using an antibody as identified in PCT application no. PCT/US2004/022415.) Finally, in situ analysis (such as fixing the cells and labeling with antibody) and/or FACS (fluorescence activated cell sorting) analysis of various cells from the offspring can be conducted using suitable antibodies to look for the presence or absence of the knockout construct gene product.
Yet other methods of making knock-out or disruption transgenic animals are also generally known. See, for example, Manipulating the Mouse Embryo, (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1986). Recombinase dependent knockouts can also be generated, e.g. by homologous recombination to insert target sequences, such that tissue specific and/or temporal control of inactivation of an OAT gene can be controlled by recombinase sequences.
Animals containing more than one knockout construct and/or more than one transgene expression construct are prepared in any of several ways. A typical manner of preparation is to generate a series of mammals, each containing one of the desired transgenic phenotypes. Such animals are bred together through a series of crosses, backcrosses and selections, to ultimately generate a single animal containing all desired knockout constructs and/or expression constructs, where the animal is otherwise congenic (genetically identical) to the wild type except for the presence of the knockout construct(s) and/or transgene(s).
In another aspect, a transgenic animal can be obtained by introducing into a single stage embryo a targeting vector. The zygote is the best target for micro-injection. In the mouse, the male pronucleus reaches the size of approximately 20 micrometers in diameter which allows reproducible injection of 1-2 pL of DNA solution. The use of zygotes as a target for gene transfer has an advantage in that in most cases the injected DNA will be incorporated into the host gene before the first cleavage (Brinster et al. (1985) Proc. Nat. Acad. Sci. 82:4438-4442.) As a consequence, all cells of the transgenic animal will carry the incorporated nucleic acids of the targeting vector. This will in general also be reflected in the efficient transmission to offspring of the founder since 50% of the germ cells will harbor the transgene.
Normally, fertilized embryos are incubated in suitable media until the pronuclei appear. At about this time, the nucleotide sequence comprising the transgene is introduced into the female or male pronucleus. In some species such as mice, the male pronucleus is typically used. Typically the exogenous genetic material be added to the male DNA complement of the zygote prior to its being processed by the ovum nucleus or the zygote female pronucleus. It is thought that the ovum nucleus or female pronucleus release molecules which may affect the male DNA complement, perhaps by replacing the protamines of the male DNA with histones, thereby facilitating the combination of the female and male DNA complements to form the diploid zygote.
Thus, the exogenous genetic material is typically added to the male complement of DNA or any other complement of DNA prior to its being affected by the female pronucleus. For example, the exogenous genetic material is added to the early male pronucleus, as soon as possible after the formation of the male pronucleus, which is when the male and female pronuclei are well separated and both are located close to the cell membrane. Alternatively, the exogenous genetic material could be added to the nucleus of the sperm after it has been induced to undergo decondensation. Sperm containing the exogenous genetic material can then be added to the ovum or the decondensed sperm could be added to the ovum with the transgene constructs being added as soon as possible thereafter.
Introduction of the a exogenous nucleic acid (e.g., a targeting vector) into the embryo may be accomplished by any means known in the art such as, for example, microinjection, electroporation, or lipofection. Following introduction of the exogenous nucleic acid into the embryo, the embryo may be incubated in vitro for varying amounts of time, or reimplanted into the surrogate host, or both. In vitro incubation to maturity is within the scope of this invention. One common method in to incubate the embryos in vitro for about 1-7 days, depending on the species, and then reimplant them into the surrogate host.
For the purposes of this invention a zygote is essentially the formation of a diploid cell which is capable of developing into a complete organism. Generally, the zygote will be comprised of an egg containing a nucleus formed, either naturally or artificially, by the fusion of two haploid nuclei from a gamete or gametes. Thus, the gamete nuclei must be ones which are naturally compatible, i.e., ones which result in a viable zygote capable of undergoing differentiation and developing into a functioning organism. Generally, a euploid zygote is used. If an aneuploid zygote is obtained, then the number of chromosomes should not vary by more than one with respect to the euploid number of the organism from which either gamete originated.
In addition to similar biological considerations, physical ones also govern the amount (e.g., volume) of exogenous genetic material which can be added to the nucleus of the zygote or to the genetic material which forms a part of the zygote nucleus. If no genetic material is removed, then the amount of exogenous genetic material which can be added is limited by the amount which will be absorbed without being physically disruptive. Generally, the volume of exogenous genetic material inserted will not exceed about 10 picoliters. The physical effects of addition must not be so great as to physically destroy the viability of the zygote. The biological limit of the number and variety of DNA will vary depending upon the particular zygote and functions of the exogenous genetic material and will be readily apparent to one skilled in the air, because the genetic material, including the exogenous genetic material, of the resulting zygote must be biologically capable of initiating and maintaining the differentiation and development of the zygote into a functional organism.
The number of copies of a transgene (e.g., the exogenous genetic material or targeting vector constructs) which are added to the zygote is dependent upon the total amount of exogenous genetic material added and will be the amount which enables the genetic transformation to occur. Theoretically only one copy is required; however, generally, numerous copies are utilized, for example, 1,000-20,000 copies of a targeting vector construct, in order to insure that one copy is functional.
Reimplantation is accomplished using standard methods. Usually, the surrogate host is anesthetized, and the embryos are inserted into the oviduct. The number of embryos implanted into a particular host will vary by species, but will usually be comparable to the number of off spring the species naturally produces.
Transgenic offspring of the surrogate host may be screened for the presence and/or expression of an exogenous polynucleotide (e.g, that of a targeting vector) by any suitable method as described herein. Alternative or additional methods include biochemical assays such as enzyme and/or immunological assays, histological stains for particular marker or enzyme activities, flow cytometric analysis, and the like.
Progeny of the transgenic animals may be obtained by mating the transgenic animal with a suitable partner, or by in vitro fertilization of eggs and/or sperm obtained from the transgenic animal. Where mating with a partner is to be performed, the partner may or may not be transgenic and/or a knockout; where it is transgenic, it may contain the same or a different knockout, or both. Alternatively, the partner may be a parental line. Where in vitro fertilization is used, the fertilized embryo may be implanted into a surrogate host or incubated in hitro, or both. Using either method, the progeny may be evaluated using methods described above, or other appropriate methods.
Retroviral infection can also be used to introduce a targeting vector into a non-human animal. The developing non-human embryo can be cultured in vitro to the blastocyst stage. During this time, the blastomeres can be targets for retroviral infection (Jaenich, R. (1976) Proc. Nat. Acad. Sci. 73:1260-1264.) Efficient infection of the blastomeres is obtained by enzymatic treatment to remove the zona pellucida (Manipulating the Mouse Embryo, Hogan eds., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, 1986.) The viral vector system used to introduce the targeting vector is typically a replication-defective retrovirus carrying the exogenous nucleic acid (Jahner et al. (1985) Proc. Nat. Acad. Sci. 82:6927-6931; Van der Putten et al. (1985) Proc. Nat. Acad. Sci. 82:6148-6152.) Transfection is easily and efficiently obtained by culturing the blastomeres on a monolayer of virus-producing cells (Van der Putten, supra; Stewart et al. (1987) EMBO J. 6:383-388). Alternatively, infection can be performed at a later stage. Virus or virus-producing cells can be injected into the blastocoele (Jahner et al. (1982) Nature 298:623-628). Most of the founders will be mosaic for the targeting vector (e.g., the exogenous nucleic acids) since incorporation occurs only in a subset of the cells which formed the transgenic non-human animal. Further, the founder may contain various retroviral insertions of the transgene at different positions in the genome which generally will segregate in the offspring. In addition, it is also possible to introduce transgenes into the germ line by intrauterine retroviral infection of the midgestation embryo (Jahner et al. (1982), supra.)
The cre-lox system, an approach based on the ability of transgenic mice, carrying the bacteriophage Cre gene, to promote recombination between, for example, 34 bp repeats termed loxP sites, allows ablation of a given gene in a tissue specific and a developmentally regulated manner (Orban, et al. (1992) Proc. Nat. Acad. Sci. 89:6861-6865.) LoxP sites can be placed flanking an exon of any given gene. Thus, transgenic mice carrying the Cre gene under the control of a selected promoter can be crossed with transgenic mice carrying a transgene flanked by loxP sites to generate doubly transgenic mice. The pioneering work in developing this system was carried out by Orban et al. (1992) Proc. Nat. Acad. Sci. 89:6861-6865. In one embodiment, the invention uses this technology to target specific tissues in mice (e.g., expressing CMAH), in a developmentally regulated fashion in order to produce a mouse lacking Neu5Gc. This same method can easily be adapted for other mammalian species.
Gene targeting producing gene knock-outs allows one to assess in vivo function of a gene which has been altered and used to replace a normal copy and to generate knockout animals with utility as food. The modifications include insertion of mutant stop codons, the deletion of DNA sequences, or the inclusion of recombination elements (lox p sites) recognized by enzymes such as Cre recombinase. The Cre-lox system as used in one embodiment of the present invention allows for the ablation of a given gene or the ablation of a certain portion of the gene sequence. The Cre-lox system was used to generate CMAH knockout mice exhibiting reduced Neu5GC.
In another aspect, the invention relates to the use of a CMAH knockout animal, in particular an animal used for food stuff to generate food, food products, pharmaceuticals, and biologics for use.
In a further embodiment, the invention relates to cells and tissues that carry mutations in CMAH. The cells can be primary cells or established cell lines obtained from the transgenic animals of the invention according to routine methods, i.e. by isolating and disintegrating tissue.
Such cells and tissues derived from the animals of the invention, in which the activity of CMAH has been reduced or abolished, are useful in in vitro methods relating to the study of sialic acid moieties, binding and diseases and disorders related thereto.
Cells and cell lines derived from the knockout animals are further useful in screening systems. The invention demonstrates that knockout of CMAH results specific decreases of Neu5Gc. No obvious morphological defects were noted in CMAH knockout mice.
Other Sources for Neu5Gc-Free Cells and Biological Medium.In addition to producing Neu5Gc-free non-human mammalian products utilizing transgenic techniques, many general cell culture techniques can be used instead. As used herein, the term “devoid of Neu5Gc” intends that the ratio of Neu5Gc to total sialic acids is less than 5%, and even less than 1%. For example, the immunogenicity of Neu5Gc can be exploited by utilizing anti-Neu5Gc antibodies in an affinity column to remove any Neu5Gc present in the products. Alternately, human cells of many varieties, tissues, embryoid bodies, neural lineage cells, carcinoma cells, skin cells, and organs (collectively referred to herein as “cells”) can be cultured and preserved in Neu5Gc-environments, so long as they are free of Neu5Gc which can be incorporated therein and are relatively free of anti-Neu5Gc antibodies, which would then be potentially passed on to their human recipients. In another embodiment, serum replacements are now available to culture cells and tissues that lack animal products altogether. Human ortholgs and recombinant proteins lacking Neu5Gc are also suitable for incorporation into cell growth medium.
Besides HESCs, other cell types that are within the scope of the present invention include, for example, islet cells, endothelium, liver cells, kidney cells, cardiac cells, fibroblasts, etc. Most notably, however, progenitor cells and pluripotent cells that are not yet completely differentiated are of great use to scientific studies as potential sources for therapeutic treatments involving cellular implantation. In addition, the methods described herein can be used to preserve human organs prior to transplation under conditions that avoid passing on anti-Neu5Gc antibodies or incorporation of additional Neu5Gc.
In most instances, cells are cultured on animal feeder layers, most commonly mouse fibroblasts. However, for reasons discussed elsewhere herein, these feeder layers only serve as additional sources for undesirable Neu5Gc, which can then be incorporated into the cells being cultured. Accordingly, in an attempt to be overcautious, it may be necessary to completely eliminate Neu5Gc by using human serum in the culture medium with human feeder layers, ideally starting with fresh HESCs that have never before been exposed to non-human mammals.
Both the lysosomal sialidase and the lysosomal sialic acid transporter are required for incorporation of glycoprotein-bound NeuGc into human cells. Inhibitors of such enzymes and transporter systems are known. By incorporating these inhibitors, Neu5Gc uptake in cell and tissue cultures, as well as organs being preserved for transplantation can be eliminated.
EXAMPLES Example I Mechanism of Uptake and Incorporation of Neu5Gc into Human Cells Experimental ProceduresMaterials—Neu5Gc and Neu5Ac were purchased from Inalco Spa (Milano, Italy) and Pfanstiehl Laboratories, Inc. (Waukegan, Ill.) 1,2-diamino-4,5-methylene dioxybenzene (DMB), chlorpromazine, gemstein, nystatin, amiloride, and saponin were purschased from Sigma-Aldrich (St Louis, Mo.) Premium Human Serum type AB was purchased from Irvine Scientific (Santa Ana, Calif.) Neu5Ac aldolase was purchased from ICN (Costa Mesa, Calif.) All the reagents used were HPLC grade.
Cell Lines—Caco-2 cells (human epithelial cells isolated from a primary colon carcinoma), normal human skin fibroblasts (CCD-919-SK) and chinese hamster ovary (CHO-K1) cells were purchased from ATCC (Manassas, Va.) Mutant human skin fibroblasts (GM05520, GM08496 and GM01718) were obtained from the Coriell Institute for Medical Research (Camden, N.J.) Chimpanzee Fred and human LB EBV-transformed lymphoblasts were a gift from Dr. Peter Parham, Stanford University, CA.
Cell Culture—Caco-2 cells were propagated in alpha-MEM containing GLUTAMAX™ (Invitrogen, San Diego, Calif.) and a mixture of ribonucleosides and deoxyribonucleosides (Gibco/Invitrogen, San Diego, Calif.) supplemented with 20% FCS. All the fibroblast cell lines and CHO-K1 cells were cultured in the same media supplemented respectively with 15% non-heat inactivated FCS or 10% heat inactivated FCS. Chimpanzee Fred and human LB EBV-transformed lymphoblasts were cultured in RPMI-1640 (Gibco/Invitrogen, San Diego, Calif.) supplemented with 10% heat inactivated FCS or 15% human serum. All of the cultures were maintained at 37° C., 5% CO2 atmosphere. In order to deplete any remaining Neu5Gc from FCS, the cells were split and cultured prior to Neu5Gc feeding experiments for at least 4 days in alpha-MEM supplemented with an adequate percentage of heat-inactivated premium human serum instead of FCS. The cells were then maintained under the same conditions during the whole feeding experiment. The human serum was heat inactivated at 56° C. for 30 min. before use.
Preparation of ManNGc from Neu5Gc—ManNGc was prepared by incubating 73 μmoles of Neu5Gc with 624 U Lactate dehydrogenase, 30 μmoles NADH and 10 U Neu5Ac Aldolase, EC 4.1.3.3, in 15 ml of 100 mM potassium phosphate buffer, pH 7.2. The incubation was carried out at 37° C. for 16 h. The ManNGc was separated from any unreacted Neu5Gc by passing the product serially over AG50WX-2 and AGIX-8 (Bio-Rad, Richmond, Calif.) ion-exchange resins. The run-through and 5 column volumes of water washes were collected and concentrated by freeze-drying. The reaction yield (91-98%) was followed by the disappearance of Neu5Gc, using DMB derivatization of the reaction mixture and analysis by HPLC (as described elsewhere herein.)
Preparation and Purification of Sia from Bovine Submaxillary Mucin—A mixture of standard Sias were prepared from bovine submaxillary mucin. Total mucins were extracted from frozen submaxillary glands using known methods. Sias then were released with mild acid, collected by dialysis (1000 daltons molecular-weight-cut-off) and purified on ion exchange columns under conditions determined to minimize loss of O-acetylation.
Neu5Gc and ManNGc Feeding Experiment—Neu5Ac, Neu5Gc or ManNGc were dried, dissolved in the appropriate media supplemented with heat-inactivated human serum, sterilized using a Spin-X® (Corning Inc., Corning, N.Y.) and then added to the cells. The pH of the media containing Sia was adjusted to neutrality using sterilized 1M NaOH before starting the feeding experiment. Cells were cultured in the presence of up to 3 mM free Sia or ManNGc for 1 or 3 days at 37° C. At the end of the feeding, cells were washed with cold PBS, harvested either by scraping or with 2 mM EDTA for fibroblasts, and washed again with cold PBS prior to fractionation.
Fractionation of the Labeled Cells—Washed cell pellets were sonicated into 500 μL of 20 mM sodium phosphate buffer or 20 mM Tris-HCl, pH 7.5, using 4×15 second pulses of a sonicator cell disrupter, model Some Dismembrator (Fisher Scientific, Hampton, N.J.) at a probe setting of 3. The sonicate was centrifuged at 75×g for 15 min., and the pellet obtained consisted primarily of nuclei and unbroken cells. The pellet contained <5% of the incorporated sialic acid as determined using a radioactive tracer (data not shown.) The supernatant was therefore considered as the “total homogenate” fraction. A portion (20%) of the “total homogenate” fraction was taken for protein quantification and Sia analysis by DMB derivatization and HPLC analysis (as discussed below.) The remainder was centrifuged at 100,000×g for 1 h. The resulting pellet, called the “membrane” fraction, was then resuspended by sonication (15 sec.) in 200 μl of sodium acetate buffer, pH 5.5. The 100,000×g supernatant, called the “soluble” fraction was adjusted to 90% ethanol using absolute ice-cold ethanol, and placed overnight at −20° C. The flocculant precipitate, which represents the “soluble protein” fraction, was washed 3 times with 90% ice-cold ethanol and then resuspended in 200 μl of water. The supernatant fluid representing the cytosolic low molecular weight (LMW) fraction was dried and brought up in 100 μL with water prior to Sia analysis. All the Sias in these fractions were released with mild acid hydrolysis if necessary and then analyzed by HPLC after DMB derivatization. Protein quantification was performed on the total homogenate, membrane and soluble protein fractions by using the BCA protein assay kit from Pierce (Rockford, Ill.) In some experiments, the resulting data obtained for the Sia bound to the membrane fraction and to the soluble proteins were pooled and presented here as a High Molecular Weight (HMW) fraction.
Sialic Acid Release, DMB Derivatization and HPLC Analysis—The bound Sias from the total homogenate, membrane and soluble protein fractions were released using 2M acetic acid hydrolysis, 3 h. at 80° C. The released Sias, or free Sias, contained in the soluble LMW fraction were passed through a Microcon® YM-10 filter (Millipore, Bedford, Mass.) prior to DMB derivatization, which was done according to Hara et al., 1989. DMB-Sia derivatives from the different fractions were then analyzed by HPLC using a C18 column (Microsorb Mv-TM 100 A, Varian, Palo Alto, Calif.) Isocratic elution was achieved using 7% methanol, 8% acetonitrile in water during 50 min. at 0.9 ml/min flow. The eluant was monitored by fluorescence.
Quantification of Sias—For all HPLC chromatograms, the quantification of Sias was done by comparison with known quantities of DMB derivatized Neu5Gc and Neu5Ac used as standards and then reported in terms of pmoles of Sia. For total homogenate, membrane and cytosolic protein fractions, this number was expressed per mg of protein. Due to minor sample-to-sample variations in amounts and recoveries, the data in the Figures is presented as percent of Neu5Gc over total Sias, rather than as absolute amounts.
MS and MS/MS Analysis of DUB Derivatives—In some experiments, the nature of the DMB derivatives of Sias was confirmed by mass spectrometry on a Finnigan MAT HPLC (Thermo, Waltham, Mass.) with online mass spectrometry system using a model LCQ-Mass. Spectrometer System A. A Varian C18 column was used and eluted in the isocratic mode with 8% acetonitrile, 7% methanol, 0.1% formic acid in water at 0.9 ml/min over 50 min. The eluant was simultaneously monitored by UV absorbance at 373 nm and by electrospray ionization (ESI) mass spectrometry. The ESI settings used were capillary temperature of 210° C., capillary voltage at 31 V and the lens offset voltage at 0 V. Spectra were acquired by scanning from m/z 150-2000 in the positive ion mode. In some instances, MS/MS was acquired by selecting the parent mass and using a 20% normalized collision energy. Data analysis was performed using the XCALIBUR data analysis program from the instrument manufacturer.
Endocytosis Inhibition Experiments—Caco-2 or normal fibroblast cells were split and cultured in alpha-MEM media supplemented respectively with 20% or 15% human serum for 4 days before starting the endocytosis drug inhibition experiments in order to deplete any Neu5Gc derived from FCS. Cells were then pre-treated for 2 h. with the specific inhibitors under the same culture conditions. Fresh media containing the same amount of inhibitor and 3 mM of Neu5Gc was then added to the cells, which were incubated for 16 h or 3 days and finally harvested and fractionated as described above. Based on known methods, chlorpromazine, genistein, nystatin and amiloride were used at final concentrations of 6˜Lg/mL, 200 ltM, 25 pg/mL and 3 mM, respectively.
Western Blot Analysis—Membrane proteins extracted from Neu5Gc-fed, ManNGc-fed or non-fed human wild-type (WT) and mutant fibroblasts were separated by SDS-PAGE electrophoresis using an 8% polyacrylamide gel. The separated proteins were transferred onto a nitrocellulose membrane, which was blocked overnight with tris buffered saline containing 0.1% of Tween-20 (TBS-T.) Immunodetection was then performed using an anti-Neu5Gc antibody (1:10,000 in TBS-T, 3 h., room temperature (RT).) Binding of the anti-Neu5Gc antibody was detected using a secondary horse radish peroxidase (HRP)-conjugated donkey anti-chicken IgY antibody diluted at 1:30,000 in TBS-T for 45 min. at room temperature (RT) (Jackson ImmunoResearch Laboratories, West Grove, Pa.) Final development of the blots was performed using Supersignal West Pico ECL reagent (Pierce, Rockford, Ill.) and X-GMAT Kodak (Rochester, N.Y.) films.
Flow Cytometry—Human WT and mutant fibroblasts grown in media with 10% FCS+20% horse serum for 3 days were lightly trypsinized (0.04% trypsin, 0.53 mM EDTA for 5 min.) to release cells from the flasks. The cells were washed with PBS and then fixed overnight with 1% paraformaldehyde in PBS. Fixed cells were permeabilized or not with 0.1% saponin in PBS at RT for 20 min. Chicken anti-Neu5Gc antibody was added to cells at a 1:200 dilution in PBS and incubated at RT for 30 min. Cells were then washed with PBS and resuspended in FITC-conjugated goat anti-chicken IgY (1 μg/100 μl) (Southern Biotechnology Associates, Birmingham, Ala.) and allowed to incubate for 30 min. at RT. Labeled cells were washed with PBS and resuspended in 500 μl PBS for analysis of FITC fluorescence on a FACS Calibur (BD Bioseiences, San Jose, Calif.)
Fluorescence Microscopy—Human WT and mutant fibroblasts were grown on poly-D-lysine-coated glass chamber slides (Nalge Nunc. International, Naperville, Ill.) with media containing 10% FCS+20% horse serum for 4 days. Cells were fixed onto slides using 1% paraformaldehyde in PBS for 30 min. at RT before permeabilizing with 0.1% saponin for 20 min. at RT. Chicken anti-Neu5Gc antibody was then added at 1:50 dilution in PBS along with 1 μg of mouse anti-LAMP-1 (clone H4A3, BD Pharmingen, San Diego, Calif.) and incubated at RT for 1 h. Bound antibodies were then detected with FITC-goat anti-chicken IgY and Cascade Blue (Invitrogen, San Diego, Calif.)-goat anti-mouse IgG (each at 1 l.μg/100 μl) at RT for 1 h. Cells were washed with PBS and covered with Gel/Mount (Biomedia, Foster City, Calif.) before fluorescence imaging with a Zeiss (Carl Zeiss, Germany) microscope at 400× magnification with emission filters at 400 and 520 nm for Cascade Blue and FITC, respectively.
ResultsFree Neu5Gc can be taken up by human epithelial cells from an exogenous source and incorporated into different subcellular fractions. Evidence was presented suggesting that the small amounts of Neu5Gc found in some human tissues originated from dietary sources and showed that human Caco-2 cells (human epithelial cells from a primary colon carcinoma) in culture could metabolically incorporate free Neu5Gc, as determined by a Western blot of a total homogenate using and anti-Neu5Gc antibody. Increasing incorporation of Neu5Gc was found in the total homogenate fraction of the cells over time, with the highest level reached after incubation with 3 mM Neu5Gc for 3 days. Moreover, western blotting with an anti-Neu15Gc antibody demonstrated metabolic incorporation of Neu5Gc into glycoproteins of these cells.
The partitioning of the exogenous Neu5Gc into different subcellular fractions of these cells has also been analyzed. Prior to feeding, Caco-2 cells were split and cultured in human serum instead of FCS in order to eliminate traces of Neu5Gc in the cells. Culture was continued for 3 days in the presence of 3 mM Neu5Gc using 3 mM ManNGc and Neu5Ac as positive controls. Indeed, it was shown that Neu5Ac and ManNGc can be incorporated into cells and that ManNGc or its peracetylated form can be metabolized into Neu5Gc. After the 3 day feeding, the cells were harvested and the Neu5Gc content of the different subcellular fractions were analyzed by DMB derivatization, HPLC, MS and MS/MS analysis. As shown in
These analyses confirmed the presence of Neu5Gc associated specifically within the glycoconjugates of the membranes of Caco-2 cells fed with ManNGc or Neu5Gc. All other sub-cellular fractions were also studied using the same DMB-HPLC approach. Due to sample-to-sample variations in amounts and recoveries, data is presented in this and subsequent figures as percent of Neu5Gc over total Sias, rather than as absolute amounts.
The uptake mechanism of free Neu5Gc is not specific for human epithelial cells. The above experiments showed that free Neu5Gc can be taken up by human epithelial carcinoma cells from the media, and incorporated into different subcellular fractions such as membrane-bound glycoconjugates, soluble proteins, and low molecular weight compounds present in the cytosol. To see if this is a specialized mechanism inhuman carcinoma cells, similar Neu5Gc feeding experiments were done on other human cell types such as normal skin fibroblasts and neuroblastomas. It was found that fibroblast cells can also take up free Neu5Gc from the media, albeit in a less efficient manner. As presented in
The uptake mechanism of free Neu5Gc is also not specific for human cells. To determine if the uptake mechanism of free Neu5Gc is specific for human cells, Neu5Gc feeding of human and chimpanzee lymphoblasts was compared. Humans are evolutionarily most closely related to the chimpanzee, whose proteins are ˜99% identical to those of humans. Of course, great apes such as chimpanzees are able to express Neu5Gc in large amounts because they have an active form of the CMP-Neu5Ac hydroxylase. Prior to the feeding experiment, both cell types were split and cultured in human serum instead of FCS for a couple of weeks. As expected, the Neu5Gc content of chimpanzee lymphoblasts could not be eliminated completely because of the endogenous production of Neu5Gc. After a 3 day feeding of 3 mM Neu5Gc or Neu5Ac, the cells were harvested, fractionated and the Neu5Gc content of the different subcellular fractions were analyzed. As shown in
Free Neu5Ac and Neu5Gc are taken up and incorporated by the same pathways. From these data, it appears that Neu5Ac and Neu5Gc can be taken up by many kinds of cells from an exogenous source and incorporated into endogenous glycoconjugates. It has previously been demonstrated that Neu5Gc and Neu5Ac are used interchangeably by essentially all of the steps leading to their final incorporation into glycoconjugates. Higa, H. H. et al. ((1985) J. Biol. Chem. 260:8838-8849) showed that CMP-Sia synthetases from calf brain and from bovine and equine submaxillary glands both converted Neu5Ac and Neu5Gc to their CMP derivatives efficiently. They also studied six mammalian sialyltransferases purified from porcine, rat, and bovine tissues and concluded that CMP-NeuAc and CMP-NeuGc were equally good donor substrates for all the enzymes. Schauer, R. et al. ((1980) Hoppe-Seyler's Z. Physiol. Chem. 361:641-648) showed that the frog liver CMP-Sia synthetases had very similar Km values for Neu5Ac and Neu5Gc. It has also previously been shown that CMP-Neu5Gc and CMP-Neu5Ac could be taken up by Golgi vesicles and incorporated into endogenous glycoproteins at an approximately equal rate. Similar observations were made by Lepers, A. et al. ((1989) FEBS Lett. 250:245-250) in rat and mouse liver Golgi. Thus, by doing competition experiments in Caco-2 and human normal fibroblast cells, it can be determined whether Neu5Gc and Neu5Ac are taken up and incorporated via the same pathways. Both cell lines gave similar results, and only the results for Caco-2 cells are presented in
Free Neu5Gc enters into cells via pathways of endocytosis. Negatively charged hydrophilic molecules like sialic acids usually do not cross membranes. To understand how free Neu5Gc enters into cells, the hypothesis that it does so via endocytic pathways was explored. Thus, Neu5Gc feeding experiments on Caco-2 cells were done in the presence of drugs that are known to inhibit various endocytic pathways common to most cell types. Based on known studies in the field, it was decided to use chlorpromazine for blocking the clathrin dependent pathway and nystatin and genistein for the clathrin independent pathways (with an additional specific action of nystatin on caveolar uptake.) Amiloride was used as an inhibitor of fluid phase pinocytosis. All of these drugs were used at concentrations based on prior studies. As before, the Caco-2 cells were incubated in an appropriate media containing human serum instead of FCS and pre-treated with the drug for 2 hours, followed by the addition of 3 mM of Neu5Gc for 16 h. or 3 days. As shown in
The lysosomal sialic acid transporter is required for export of free NeuGe from the lysosome to tile Cytosol. Free Neu5Gc molecules entering the cell via endocytic pathways would still be restricted from passively diffusing out of endosomes into the cytosol. It was hypothesized that they would eventually reach the lysosome where they would have the opportunity to utilize the previously known lysosomal sialic acid transporter (58-60) to reach the cytosol. To test this hypothesis, fibroblasts from a patient (GM05520) with a severe infantile form of sialic acid storage disease (ISSD), a disease that is caused by a genetic defect in this transporter, were used. As shown in
Both the lysosomal sialidase and the lysosomal sialic acid transporter are required for incorporation of glycoprotein-bound NeuGc into Human cells. Several studies have shown that when human cells are transferred from conventional media containing FCS into serum-free media or human serum, the small amounts of endogenous Neu5Gc in these cells gradually disappear. It has always been assumed that this is because FCS contains many glycoproteins with attached Neu5Gc. However, the pathway by which these glycosidically-bound Neu5Gc molecules enter the cell and eventually become incorporated into endogenous glycoproteins has never been defined. This question is also of direct relevance to human gut epithelial cells, which would be exposed to glycoprotein-bound Neu5Gc of dietary origin (red meat, milk products for example.) Based on the above findings, it is reasonable to hypothesize that the Neu5Gc carrying serum glycoproteins enter the cell via fluid phase pinocytosis, eventually reaching the lysosome where they are exposed to the lysosomal sialidase. The resulting free Neu5Gc in the lysosome would then have the opportunity to use the lysosomal sialic acid transporter to reach the cytosol in order to be salvaged and eventually converted to CMP-Neu5Gc.
To test this hypothesis, the GM05520 mutant human fibroblasts, which are completely deficient in the lysosomal sialic acid transporter, as well as GM01718 mutant human fibroblasts, which have less than 1% lysosomal sialidase activity compared to normal fibroblasts, were used. For these studies, it was important to differentiate between cell surface and internal Neu5Gc. Thus, instead of subcellular fractionation, the method of flow cytometry was utilized, using affinity purified Neu5Gc-specific chicken antibody. As shown in
The results with the sialidase-deficient fibroblasts confirm the hypothesis that this enzyme must act to release free Neu5Gc from glycoproteins and to make it available for metabolic incorporation. The acclunulation of Neu5Gc glycoconjugates in the lysosomal transporter mutant was unexpected. A likely explanation is that accumulation of free Sia at a high concentration in the lysosomes inhibits the action of the lysosomal sialidase, resulting in accumulation of glycosidically-bound Neu5Gc. The residual levels of Neu5Gc detected on the surface of both mutant cells might be explained by direct incorporation of gangliosides and GPI-anchored proteins bearing Neu5Gc from the serum. Taken together, these data indicate that bound Neu5Gc molecules that enter into human cells via pinocytosis are released by the lysosomal sialidase and are then transported by the lysosomal sialic acid transporter to the cytosol, where they are available for activation and incorporated into glycoconjugates (
It has long been assumed that free sialic acids could not be efficiently incorporated into cells because of their negative charge and hydrophilic nature. Thus, neutral ManNAc has traditionally been used as a precursor to feed cells for conversion into Neu5Ac. The same concept has been applied to various unnatural mannosamine derivatives, and the addition of O-acetyl esters to the hydroxyl groups of mannosamine derivatives has been used to enhance delivery across the plasma membrane. In fact, one early study suggested that radioactive sialic acids could be incorporated into cells, and more recent work of others has shown “efficient” uptake of a variety of kinds of sialic acids into cells. However, the kinetics of incorporation showed no evidence of saturation even at >10 mM concentrations, suggesting that the uptake was not due to a high efficiency cell surface transporter for sialic acids. Studies using a natural sialic acid (Neu5Gc) gave similar results.
It has been shown that sialic acids from the medium can be taken up into cells via non-clathrin-mediated mechanisms, mostly amiloride-sensitive fluid-phase pinocytosis. The content of the resulting pinocytotic vesicles and endosomes would eventually be delivered to the lysosome, where the previously described sialic acid transporter then delivers the molecules into the cytosol. It has also been shown that the incorporation of glycosidically-bound Neu5Gc from exogenous glycoproteins occurs by similar delivery to the lysosome, and release by the lysosomal sialidase, followed by export into the cytosol (
Most recently, it has been shown that human embryonic stem cells can incorporate Neu5Gc from medium glycoconjugates, making them targets for the naturally occurring antibodies that circulate in most humans. Preliminary data also suggest that these antibodies could also be related to diseases in intact humans. Thus, the mechanism by which Neu5Gc is incorporated into human cells is of potentially great importance. Further studies of this process are also relevant both to the ongoing attempts by various groups to incorporate different kinds of unnatural sialic acids into cultured cells, and also to efforts to understand how exogenous dietary Neu5Gc gain entry into normal human tissues. In this regard, it is of note that Neu5Gc accumulation appears to be enhanced in naturally occurring tumors, and in fetal tissues. It is suggested that this may be explained by the fact that fluid phase macropinocytosis is enhanced by growth factors, which are expected to be very prominent in these two situations.
Finally, the studies described herein demonstrate, perhaps for the first time, that an extracellular small molecule that cannot cross the plasma membrane is delivered efficiently to the cytosol utilizing fluid pinocytosis and a specific lysosomal transporter. This approach could thus potentially be generalized to any small molecule that has a specific lysosomal transporter, but not a plasma membrane transporter. For example, one could envisage that the neutral sugars GlcNAc and GalNAc, which do not have a high efficiency plasma membrane transporter, could nevertheless be delivered to the cytosol via the lysosomal GlcNAc/GalNAc transporter. The prediction is that adding millimolar concentrations of these sugars into the medium would result in significant delivery to the cytosol.
Example II Human Embryonic Stem Cells Express an Immunogenic Nonhuman Sialic AcidThe HI ES cell line (WiCell Research Institute, Inc., Madison, Wis.) cells were cultured on mitotically inactivated (mitomycin C treated) mouse embryonic fibroblasts (MEF, Specialty Media, Phillipsbuurg, N.J.) in DMEMJF12 Glutamax (Gibco), 20% “knockout” serum replacement (Gibco) or pooled human blood-type AB serum (Pel-Freeze, Rogers, Ark.), 0.1 in M non-essential aminoacids (Gibco), 0.1 mM betamercaptoethanol (Gibco), and 4 ng/mL βFGF-2 (R&D Systems, Minneapolis, Minn.). For EB culture, HI ES cells were grown in suspension for 7-10 days, using the same medium without FGF-2 and 10% serum. Cells were changed to a new dish every day to eliminate eventual fibroblast contamination.
HESC Transfection—HI HESC were stably transfected to express green fluorescent protein (GFP) by CAG-EGFP SIN lentivirus infection. The SIN lentiviral vector expressing EGFP under control of the CAG promoter was derived from a multiply attenuated HIV vector system, but included a U3 deletion and introduction of a cPPT element. Vectors were produced by triple transduction of HEK 293 cells (Graham et al., J. Gen Virol (1977), 36(1):59-74) followed by ultracentrifugation and titration. Undifferentiated cells were exposed to the virus at a titer of 0.5×1010 gtu/mL for 1 hour followed by a 2 day recovery period. EGFP was detected by native fluorescence at day 3 after transduction. Cells expressing EGFP were FACS sorted for uniform EGFP expression. No loss in EGFP expression was observed during propagation or EB differentiation and up to 10 months after transduction. The EGFP positive cells derived from these colonies are thus polyclonal in origin. The GFP positive ES cells maintain a similar phenotype to the wild type cells (SSEA-4, SSEA-3 and Oct4-positive.)
Oct4 antibody (1:500) was from Santa Cruz (Santa Cruz, Calif.), the other marker antibodies (SSEA-3, TRA-1-60, alkaline phosphatase and nestin) were from Chemicon (Temecula, Calif.; dilution 1:100), and the secondary Cy3 antibody from Sigma (San Louis, Mo.; dilution 1:250). Alkaline Phosphatase (AP) activity was measured using the Vector Red Alkaline Phosphatase substrate kit I from Vector laboratories (Burlingame, Calif.)
Human sera—Sera from several healthy human donors were obtained after written consent and Institutional Review Board approval, and anonymously numbered before further use. Anti-Neu5Gc antibody levels in several serum samples were determined using known methods. Two specific sera, corresponding to the lowest and highest extremes of the range, were selected for the experiments. Another serum with a high level of anti-Neu5Gc antibodies was also studied with identical results to those presented in the figures.
Determination of Neu5Gc content—Sias from HESC, feeder layer cells, EB or culture medium were released by mild acid, derivatized with 1,2-diamino-4,5-methylene dioxybenzene (DMB) and analyzed by HPLC to determine the percentage of Neu5Gc in total Sias.
Flow cytometry—Cells were harvested into 2 mM EDTA in phosphate buffer (PBS) and washed with PBS. 1×105 cells were incubated with a chicken anti-Neu5Gc (1.5 μg/100 μL) and stained with a donkey anti-chicken IgY conjugated to Cy5 (Jackson, West Grove, Pa.; dilution 1:100 in PBS.) Neu5Gc-specific antibody binding was partially blocked by co-incubation with 1% chimpanzee serum, which (unlike human serum) is rich in Neu5Gc.
For human serum antibody deposition studies, HESC were harvested and exposed to individual human sera. Human IgGs deposited on the cells were stained with an anti-human IgG conjugated to Alexa 594 (Molecular Probes, Carlsbad, Calif.; dilution 1:100 in PBS.) For C3b deposition, HESC were exposed to human serum, then incubated with a goat anti-human C3b (Fitzgerald, Concord, Mass.; dilution 1:100 in PBS) and finally stained with an anti-goat I-G conjugated to Alexa 594 as above.
Cytoioxicity assays—A standard procedure for testing antibody, complement-mediated cytotoxicity after exposure to human sera, was followed. HESCs were harvested and resuspended into GVB2+ buffer (Sigma) alone (control) or GBV2+ containing 25% human serum. Cells were incubated for 2 h. at 37° C. and gently shaken. Dead cells were stained with propidium iodide (5 μg/mL) and analyzed by FACS. For cytotoxicity assays on the plate, cells were exposed to serum-free HESC culture medium containing 25% of the test human sera. After 30 minutes at 37° C., they were harvested and stained with propidium iodide.
Statistical analysis—Sia content from at least two experiments run in duplicate was analyzed using the T test in Microsoft Excel. Data are expressed as mean ±standard deviation.
Presence of Neu5Gc on HESC grown under standard conditions—Neu5Gc on HESC was detected using an affinity-purified chicken polyclonal monospecific anti-Neu5Gc antibody. HESC stably expressing EGFP were gated for EGFP-positivity to separate them from contaminating feeder layer fibroblasts. The antibody stained HESCs growing in standard conditions, and binding was partially blocked by Neu5Gc-containing glycoproteins from chimpanzee serum (
To chemically analyze the Sia content of HESCs, they were separated from the feeder layer fibroblasts by FACS sorting using their EGFP signal. Feeder-layer-free EB derived from HESC were also examined without sorting. Both the membrane and cytosolic fractions from HESC and EB had a peak corresponding to Neu5Gc (
Identifying potential sources of Neu5Gc in HESC—Since human cells are unable to synthesize Neu5Gc, the Neu5Gc detected likely originated from elsewhere, eventually being metabolically incorporated by the HESC. As expected for other mammals, Neu5Gc represented 20% of total Sias in the mouse feeder layer (0.92±0.13 mmoles/million cells.) However, uptake from feeder cells cannot explain all the Neu5Gc found in HESC, since removal of the layer to obtain EB did not eliminate it. It was shown that human cells can take up Neu5Gc from the medium and metabolically incorporate it into membrane glycoconjugates. The “serum replacement” containing medium used to support HESC growth was found to contain 35.93 nmoles Neu5Gc/mL, representing 54% of total Sias. The commercial “knockout” serum replacement used for preparing this medium is the major source of Neu5Gc, since it contains 129 nmoles/mL. In contrast, medium without any additives is poor in Neu5Ge (0.008 nmoles/mL.)
Neu5Gc content of HESC is reduced by growth in heat-inactivated human serum with low anti-Neu5Gc antibodies—Culture in heat-inactivated pooled normal human serum could markedly reduce Neu5Gc in human colon carcinoma cells, apparently due to metabolic replacement by Neu5Ac in the human serum. HESC was therefore incubated in medium containing heat inactivated human serum instead of the standard serum replacement (an approach already suggested by others for different reasons.) First, a lot of pooled human serum was screened and defined in which natural anti-Neu5Gc antibodies were very low (hereafter called NHS.) In case any residual antibodies were active, heat inactivation was used to eliminate complement. HESC incubated in such NHS remained undifferentiated on the feeder layer, expressing typical levels of markers of non-differentiation (alkaline phosphatase, Oct-4, SSEA-3, SSEA-4, TRA-1-60, and TRA-1-81 and lack of all differentiation markers tested (
Neu5Gc incorporation into HESC membranes dropped after 3 days (from ˜4 pmoles/μg protein to 0.34±0.06 pmoles/μg protein) and down to 0.13±0.01 pmoles/μg protein after one week (−1% of total Sia as Neu5Gc, see
Natural human anti-Ncu5Gc antibodies bind to HESC and cause complement deposition—Healthy humans have variable levels of “natural” circulating anti-Neu5Gc antibodies. It was determined whether such antibodies could recognize Neu5Gc-containing epitopes on HESC grown under standard conditions. Cells exposed to a high-level anti-Neu5Gc antibody-containing human serum (Hi-GcAbHS) showed human IgG binding (
Cell surface antibody deposition can activate the classical complement pathway, eventually leading to killing or phagocytosis. It was determined whether complement C3b deposition occurred following exposure to Hi-GcAbHS. As before, the data was gated for EGFP+HESC. When HESC were grown under the standard conditions, 37% were positive for C3b (FIG. 13c; compare to 0% background in
Such binding of antibody and complement to HESC would target them for death in vivo, via recognition by macrophages and NK cells. Regardless, attempts were made to directly determine antibody:complement-mediated cytolysis on HESCs in vitro. The standard single cell suspension required for such analyses caused extensive cell death even under control conditions (without serum.) Exposure to Hi-GcAbHS caused increased death above background levels seen with NHS, from 40% to 60-70%. In contrast, the percentage of dead HESCs after exposure to Lo-GcAbHS was similar to that of the control. When the assay was performed directly on the culture dish for shorter time, more HESCs remained alive. Cell death with Hi-GcAbHS was higher than that of the control (14% vs. 10%), whereas the death rate after exposure to Lo-GcAbHS remained unchanged.
HESCs and EB can incorporate the non-human Sia Neu5Gc from the murine feeder layer and/or the medium, leading to an immune response mediated by “natural” anti-Neu5Gc antibodies present in most humans. In effect, HESCs appear like animal cells to the human immune system. Pooled, heat-inactivated human serum selected for low titers of anti-Neu5Gc antibodies could be substituted for the traditional animal serum or serum replacement, supporting the undifferentiated growth of HESCs. This approach markedly reduced the immune response, by reducing the Neu5Gc content on the HESCs.
Most existing HESC lines have been grown or derived with mouse feeder layer. Standard culture conditions also include animal serum, or a serum replacement. It is shown here that the commercial “serum replacement” is also a rich source of Neu5Gc, and both HESCs and EB are able to incorporate it. The composition of this serum replacement is described in PCT WO 98/30679, and includes proteins like transferrin, which are likely to be from animal sources and therefore, would carry Neu5Gc. Human orthologs or recombinant proteins synthesized in bacteria could be used instead.
Many efforts have been recently made to eliminate these animal-derived components. The use of a feeder-free system, such as Matrigel or other components of the extracellular matrices, have been explored. However, feeder-free conditions seem to facilitate in vitro evolution of HESCs, selecting for aneuploid cells. Moreover, many of the medium and matrix components are still from animal sources and contamination with Neu5Gc can be expected.
Human feeders of different origins have also been tried. Richards et al. first reported successful derivation and culture of some HESC lines in the complete absence of non-human components, using feeder layers from human tissues with human serum and supplements, further demonstrating the ability to develop teratomas, i.e., confirming the maintenance of pluripotentiality. It was also noted that human serum did not cause any change in the undifferentiated state of the HESCs. Others have also tried similar xeno-free techniques on hematopoietic stem cells by growing them on human stromal cells and using medium containing human AB serum. Of course, the use of an “all-human” environment carries a different set of risks (unexpected contamination with novel or newly emerging pathogens).
There are also potential implications for the incorporation of Neu5Gc with regard to general HESC biology. Many characteristic markers of HESC(SSEA-3, SSEA-4, TRA-1-60, and TRA-1-81) are glycolipids or glycoproteins, many of which can carry Sias. SSEA-4, which is highly expressed even in long-term cultures of HESCs, is the sialylated form of the globo-series glycolipid SSEA-3 (Gb5.) TRA-1-60 is a sialylated keratan sulfate protein and the TRA-1-81 epitope became accessible only after sialidase treatment. Neural lineage cells derived from EB express the polysialylated form of NCAM, as well as the antigen A2B5, which corresponds to polysialylated gangliosides. Since Sias are involved in self-recognition events, the presence of Neu5Gc instead of Neu5Ac could lead to unexpected impairments of cell function and tissue development.
Another possible solution is growth in heat-inactivated serum from the actual patient who is going to receive the therapy. Similar alternatives have been suggested for hematopoietic stem cells. Even if the patient serum contains anti-Neu5Gc antibodies, heat inactivation could prevent complement activation, until such time as the pre-existing Neu5Gc in the HESCs is metabolically eliminated by the Neu5Ac in the serum. An added advantage to this approach is that it would screen for allogeneic cytotoxic antibodies in the recipient's serum.
Example III Elimination of N-glycolylneuraminic Acid Hydroxylase in a Mouse Model Material and MethodsGeneration of targeting construct pFlox-Ex-SL for elimination of CMAH expression. A 10 kb genomic DNA region spanning the CMAH gene that includes the 92 bp corresponding to exon 6 of the murine CMAH was isolated from a BAC clone by digesting the clone with EcoRI with subsequent Southern Blotting using a radiolabeled probe corresponding to exon 6. The 10 kb piece was subcloned into pBluescript II KS+, generating the construct pBS-35. Mapping of the restriction sites of the 10 kb piece was performed by digesting pBS-35 with various restriction enzymes. A 535 bp piece containing exon 6 was isolated from pBS-35 by digesting with NheI and XbaI, and cloned into the BamHI site in the pFlox vector. A 1150 bp intronic region directly upstream of the 535 bp piece was isolated by digesting with NheI and subcloning into the pBluescript II KS+vector. This was then used for PCR using forward primer CGGCTCGAGTGAGCTACATGAGAT and reverse primer GGGCTCGAGTAATCACCAAGCAAA, thereby adding XhoI restriction site the ends of the 1150 bp piece. The PCR product was subcloned into pBluescript II KS+vector, which was then digested with XhoI and cloned into the Xho site in the pFlox-Exon vector, creating the pFlox-Ex-S vector. Next, a 4850 bp piece directly downstream of the 535 bp piece was excise from pBS-35′ by digesting with XbaI and NheI and cloned into the XbaI site in pFlox-Ex-S vector, generating the final targeting construct, pFlox-Ex-SL.
Generation of CMAH null mice. pFlox-Ex-SL plasmid DNA was purified by a standard cesium chloride method and linearized by digestion with restriction enzyme Not I. The solution containing digested plasmid DNA is then subjected to sequential phenol, 1:1 phenol:chloroform, and chloroform extraction. The aqueous phase containing the linearized DNA is then subjected to sodium acetate precipitation. The resulting DNA pellet is washed 2 times in ice-cold 70% ethanol, air dried, and resuspended in TE. The generation of the transgenic mice was performed by the UCSD Transgenic Mouse Core. In brief, the linearized transgenic constructs were electroporated into embryonic stem cells (ES cells) isolated from the 129/SvJ mouse strain. The ES cells then underwent drug selection, subclone isolation, and growth of isolated clones. Each clone was grown in triplicate plates, one that was kept by the Core as a master plate that was frozen at −80° C. and two that were returned to investigators for the identification of homologous recombinants. DNA was purified from each clone and subjected to screening by PCR and Southern Blot analysis as described below. Homologous recombinants were thawed, expanded, and reconfirmed by PCR and Southern Blot analysis. For the generation of the CMAH null mouse, homologous recombinant clones were subjected to transfection with Cre-recombinase expression vector, underwent gancyclovir drug selection against the presence of thymidine kinase (TK), subclone isolation, and growth of isolated clones. The desired type of recombination was then identified by PCR analysis. Karyotyping was then performed and two of the best clones were selected for blastocyst injection. Chimeric mice were then generated and bred to C57B1/6 females to allow germline transmission of the transgene.
PCR genotyping analysis of CMAH null mice. To genotype the mice, DNA isolated from toe clips were used for PCR analysis. Toe clips performed to mark the identity of the mice were collected and digested in 20 ul of buffer containing 50 mM Tris, pH 8.0, 20 mM NaCl, 1 mM EDTA, 1% SDS, and 250 ug/ml Proteinase K at 55° C. until the soft tissue dissolved. The sample was then diluted with 180 ul of water and boiled to inactivate the enzyme. For genotyping of CMAH null mice, PCR primers UpExon6 (CCAGGAGGAGTTACCCTGAA), Exon6#2 (TCAATCAATTGCATGGGTCT), and DwExon6 (CGAGGACAGCCCAGAGACTA) were designed based on the published murine CMAH sequence. Analysis was performed using the following PCR cycle: 94° C. for 5 min; 40 cycles of 94° C. for 30 sec, 53° C. for 30 sec, and 72° C. for 1 min; and 72° C. for 5 min. A PCR product of 305 bp is generated from the deletion allele while a product of 490 bp is generated from the wild-type allele.
Southern blot analysis of the CMAH null mice. To genotype the mice, DNA isolated from tail clips were analyzed by PCR. Tail clips were digested overnight at 55° C. in buffer containing 10 mM Tris-HCl, pH 8.0+1 mM EDTA (TE), 1% SDS, 140 mM NaCl, and 0.3 mg/ml Proteinase K. A solution of TE, 5.3M NaCl, and chloroform was the added. The genomic DNA in the upper aqueous phase was subjected to ethanol precipitation and resuspended in TE.
DMB-HPLC analysis of Neu5Gc content in cells and tissues. Cells or tissues were homogenized and subjected to acid hydrolysis using 2M acetic acid at 80° C. for 3 h to release sialic acids from cellular glycoconjugates. After centrifugation at 20,000 g, the supernatant was filtered through a Microcon 10 unit, dried down, and reconstituted in water. Aliquots were derivatized with 1,2-diamino-4,5-methylene dioxybenzene (DMB) and analyzed by HPLC (DMB-HPLC). To remove O-acetyl esters, samples were incubated with 0.1 M NaOH for 30 min at room temperature to remove base-labile O-acetyl esters.
Immunohistochemistry using the anti-Neu5Gc antibody. Tissues were collected from autopsies or unused pathological material frozen in OCT compound and archived at −70° C. Frozen tissue sections were air-dried for 30 min, fixed in 10% buffered formalin for 30 min, endogenous peroxidase activity quenched and non-specific binding sites blocked with 5% (Neu5Gc free) human serum in PBS for 30 min. Sections were then incubated with the anti-Neu5Gc antibody in 5% human serum/PBS at a 1:200 dilution at RT for 2 h. After washing, HRP-conjugated donkey anti-chicken IgY antibody in 5% human serum/PBS at a 1:100 dilution was applied for 1 hr. Control sections were incubated with secondary reagent only or a control chicken IgY antibody. Specific binding was detected using the Nova Red substrate kit.
ResultsGeneration of CMAH null mice—To investigate physiological functions of Neu5Gc in vivo, mice were generated that were deficient in CMP-N-acetylneuraminic acid hydroxylase (CMAH) activity. The original goal was to produce CMAH conditional mutant mice using the Cre/loxP system. Thus, a targeting vector, pFlox-Ex-SL, was first prepared in which exon 6 of CMAH and the TK/Neo cassette, are flanked by loxP sites (
Mice deficient in CMAH were viable and fertile and showed no gross morphological or histological abnormalities in many organs studied, and their growth was equivalent to that of wild-type littermates (data not shown). Transmission of the null allele occurred at the expected Mendelian frequency in pups resulting from heterozygous breeding as depicted below in Table 1:
CMAH null mice are deficient in Neu5Gc expression. To verify that CMAH null mice were deficient in CMAH expression, the mice were analyzed for Neu5Gc expression by immunohistochemistry using a chicken antibody specific for Neu5Gc, and biochemically, by derivatization with 1,2-diamino-4,5-methylene dioxybenzene (DMB) and HPLC analysis. Using the anti-Neu5Gc antibody, there was no staining in any tissues except for the mucinous secretions of the small intestine and colon. To confirm the lack of Neu5Gc in these tissues as well as those not stained positive, various tissues were homogenized and the sialic acids in glycopeptides and lipid extracts were released by acid and purified by ion exchange chromatography, derivatized with DMB and analyzed by HPLC (DMB-HPLC). No Neu5Gc was detectable in tissues staining negative with the anti-Neu5Gc antibody (data not shown), nor could we find evidence for presence of Neu5Gc in the intestine or the colon (
The examples set forth above are provided to give those of ordinary skill in the art with a complete disclosure and description of how to make and use the preferred embodiments of the invention, and are not intended to limit the scope of what the inventors regard as their invention. Modifications of the above-described modes for carrying out the invention that are obvious to persons of skill in the art are intended to be within the scope of the following claims. All publications, patents, and patent applications cited in this specification are incorporated herein by reference as if each such publication, patent or patent application were specifically and individually indicated to be incorporated herein by reference.
Claims
1. A method for preparing a culture of human cells devoid of N-glycolylneuraminic acid (Neu5Gc) comprising the steps of:
- preselecting the human cells to be cultured;
- placing the human cells in a culture medium comprising serum selected from the group consisting of: animal-free serum replacement, mammalian-free serum, human serum, heat-inactivated human serum, and Neu5Gc deficient animal serum; and
- allowing the human cells to grow in the culture medium to a desired density.
2. The method of claim 1, wherein the human cells are selected from the group consisting of human embryonic stem cells, embryoid bodies, carcinoma cells and differentiated progenitor cells.
3. The method of claim 1, wherein the cultured cells after growing to a desired density comprise less than 1% Neu5Gc by weight when compared to total sialic acids.
4. The method of claim 1, wherein the culture medium comprises animal free serum replacement.
5. The method of claim 1, wherein the culture medium comprises human serum.
6. The method of claim 1, wherein the cells are not grown on a non-human feeder layer.
7. The method of claim 1, wherein the cells are human embryonic stem cells, and wherein the medium comprises human serum as the only serum source, and wherein the human embryonic stem cells are cultured on a human cell feeder layer, and wherein the human embryonic stem cells have never before been exposed to animal products.
8. The method of claim 1, wherein the cells are embryoid bodies, and wherein the medium comprises human serum as the only serum source.
9. The method of claim 1, wherein the cells and the medium after the cells have grown to the desired density contain low levels of anti-Neu5Gc antibodies.
Type: Application
Filed: Jun 8, 2006
Publication Date: Jul 10, 2008
Applicant: The Regents of the University of California (Oakland, CA)
Inventors: Ajit Varki (La Jolla, CA), Anna Maria Hedlund (San Diego, CA), Dzung Nguyen (San Diego, CA)
Application Number: 11/449,167
International Classification: C12N 5/06 (20060101);