Small interfering rnas that efficiently inhibit viral expression and methods of use thereof
The invention provides methods, compositions, and kits comprising small interfering RNA (shRNA or siRNA) which are useful for inhibition of viralmediated gene expression. Small interfering RNAs as described herein may be used in methods of treatment of HCV infection. ShRNA and siRNA constructs that target the internal ribosome entry site (IRES) sequence of HCV are described.
Latest SomaGenics Inc. Patents:
- Methods and compositions of short small hairpin RNAs and microRNAs for wound healing
- Chemical modification of short small hairpin RNAs for inhibition of gene expression
- Methods and compositions of short small hairpin RNAS and microRNAS for wound healing
- Methods and compositions for detection of small RNAs
- Methods of constructing small RNA libraries and their use for expression profiling of target RNAs
This application claims the benefit under 35 U.S.C. § 119 of U.S. Provisional Application No. 60/608,574, filed Sep. 10, 2004, which is incorporated herein by reference in its entirety.
STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENTThis invention was made in part during work supported by grant no. 5R43AI056611 from the National Institutes of Health. The government may have certain rights in the invention.
FIELD OF THE INVENTIONThe invention relates to inhibition of viral gene expression, for example, hepatitis C IRES-mediated gene expression, with small interfering RNA (shRNA and siRNA).
BACKGROUND OF THE INVENTIONTreatment and prevention of Hepatitis C virus (HCV) infections remains a major challenge for controlling this worldwide health problem; existing therapies are only partially effective and no vaccine is currently available. Hepatitis C(HCV) virus infects more than 170 million people worldwide and is the leading cause of liver transplants. Existing treatments, including ribavirin and pegylated interferon alpha, are effective only in approximately 50 percent of patients and have substantial side effects. The development of more effective HCV treatments is hampered by the lack of a good small animal model, the inability to stably culture the virus in tissue culture cells, and the high viral mutation rate [1-3]. The availability of an HCV replicon system has allowed the study of HCV replication, host-cell interactions and evaluation of anti-viral agents, and more recently, a transgenic chimeric humanized mouse liver model was developed that allows full HCV infection [4-7]. Moreover, the use of in vivo imaging of HCV IRES-dependent reporter systems has facilitated efficient evaluation of delivery and inhibition by anti-HCV agents in mouse liver over multiple timepoints using the same animals [8].
RNA interference is an evolutionarily conserved pathway that leads to down-regulation of gene expression. The discovery that synthetic short interfering RNAs (siRNAs) of ˜19-29 bp can effectively inhibit gene expression in mammalian cells and animals without activating an immune response has led to a flurry of activity to develop these inhibitors as therapeutics [9]. Chemical stabilization of siRNAs results in increased serum half life [10], suggesting that intravenous administration may achieve positive therapeutic outcomes if delivery issues can be overcome. Furthermore, small hairpin RNAs (shRNA) have also shown robust inhibition of target genes in mammalian cells and can be easily expressed from bacteriophage (e.g. T7, T3 or SP6) or mammalian (pol III such as U6 or H1 or polII) promoters, making them excellent candidates for viral delivery [11].
A substantial effort has been made to find effective nucleic acid-based inhibitors against HCV, as existing treatments are not fully effective (reviewed in [4, 12]). These efforts include traditional antisense oligonucleotides, phosphorodiamidate morpholino oligomers [8], ribozymes and more recently siRNAs. A number of research groups have shown that siRNAs can effectively target HCV in human tissue culture cells [13-19] and in animal systems [20]. However, there have not been reports of the effects of shRNAs in animals.
BRIEF SUMMARY OF THE INVENTIONThe invention provides methods, compositions, and kits for inhibition of IRES-mediated gene expression in a virus.
For the inhibitory RNA sequences listed in
In one aspect, the invention provides a composition comprising at least one small interfering RNA which is at least partially complementary and capable of interacting with a polynucleotide sequence of a virus, wherein inhibition of viral gene expression results from the interaction of the small interfering RNA with the viral target sequence. In one embodiment, the composition comprises at least one shRNA, for example, comprising, consisting of, or consisting essentially of a sequence selected from the group consisting of SEQ ID NO:12, SEQ ID NO:16, SEQ ID NO:17, and SEQ ID NO:18, or comprising or consisting essentially of a sequence selected from the group consisting of SEQ ID NO:27, SEQ ID NO:32, and SEQ ID NO:33. In one embodiment, the shRNA comprises, consists of, or consists essentially of the sequence depicted in SEQ ID NO:12. In another embodiment, the composition comprises at least one siRNA. In one embodiment, the composition comprises at least one siRNA or shRNA, for example, comprising or consisting essentially of a sequence selected from the group consisting of SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:27, SEQ ID NO:32, and SEQ ID NO:33. In some embodiments, the small interfering RNA, e.g., shRNA or siRNA, interacts with a viral sequence of about 19 to about 30 nucleotides, or about 19 to about 25 nucleotides, for example, any of about 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides. In some embodiments, the small interfering RNA binds to a hepatitis C virus sequence. In one embodiment, the small interfering RNA binds to a sequence within the internal ribosome entry site (IRES) sequence of a hepatitis C virus, preferably to the sequence depicted in SEQ ID NO:26 (residues 344-374 of SEQ ID NO:11). In one embodiment, the hepatitis C virus is HCV genotype 1a. In some embodiments, compositions of the invention comprise a pharmaceutically acceptable excipient, for example, water or saline, and optionally are provided in a therapeutically effective amount. In one embodiment, the composition is a pharmaceutical composition comprising, consisting of, or consisting essentially of at least one shRNA or siRNA as described herein and a pharmaceutically acceptable excipient.
In another aspect, the invention provides a kit comprising any of the compositions described above, and optionally further comprising instructions for use in a method of inhibiting gene expression in a virus or treating a viral infection in an individual as described herein. In one embodiment, the kit is for use in a method for treating HCV infection in an individual, such as a human, and comprises an shRNA comprising, consisting of, or consisting essentially of a sequence selected from the group consisting of SEQ ID NO:12, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, or comprising or consisting essentially of a sequence selected from the group consisting of SEQ ID NO:27, SEQ ID NO:32, and SEQ ID NO:33 or an siRNA comprising or consisting essentially of a sequence selected from the group consisting of SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:27, SEQ ID NO:32, and SEQ ID NO:33, and optionally further comprises instructions for use in a method of inhibiting gene expression in a hepatitis C virus, such as HCV genotype 1a, or instructions for use in a method of treating a hepatitis C (such as HCV genotype 1a) viral infection in an individual, such as a human.
In another aspect, the invention provides a method for treatment of a viral infection in an individual, such as a mammal, for example, a human, comprising administering to the individual a therapeutically effective amount of a small interfering RNA, such as shRNA or siRNA, that is at least partially complementary to and capable of binding to a polynucleotide sequence of the virus and a pharmaceutically acceptable excipient, wherein binding of the small interfering RNA to the viral polynucleotide sequence inhibits gene expression in the virus. In one embodiment, the viral infection comprises a hepatitis C virus, such as HCV genotype 1a. In some embodiments, the virus is selected from the group consisting of hepatitis C genotypes 1a, 1b, 2a, and 2b. In some embodiments, the small interfering RNA comprises, consists of, or consists essentially of any of the shRNA or siRNA sequences described herein as well as sequences located within 5 nt of one of the siRNA or shRNA sequences described herein. In some embodiments, the small interfering RNA binds to a viral sequence of about 19 to about 30 nucleotides, or about 19 to about 25 nucleotides, for example, any of about 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides. In one embodiment, the virus is a hepatitis C virus, such as HCV genotype 1a. In one embodiment, the small interfering RNA binds to a sequence of about 19 to about 25 nucleotides within the IRES region of HCV 1a depicted in SEQ ID NO:26. Treatment may include therapy (e.g., amelioration or decrease in at least one symptom of infection) or cure. In some embodiments, the shRNA is administered parenterally, for example, by intravenous injection.
In another aspect, the invention provides a method of inhibiting gene expression in a virus, comprising contacting the virus with a small interfering RNA or introducing a small interfering RNA into a virus-containing cell, wherein the small interfering RNA, e.g., shRNA or siRNA, contains a sequence that is at least partially complementary to a polynucleotide sequence of the virus and capable of inhibiting viralgene expression, for example, by inducing cleavage of viral polynucleotide sequences. In some embodiments, the small interfering RNA comprises, consists of, or consists essentially of any of the shRNA or siRNA sequences described herein. In some embodiments, the small interfering RNA binds to a viral sequence of about 19 to about 30 nucleotides, or about 19 to about 25 nucleotides, for example, any of about 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides. In one embodiment, the virus is a hepatitis C virus, such as HCV 1a. In one embodiment, the small interfering RNA binds to a sequence of about 19 to about 30 nucleotides within the IRES region of HCV genotype 1a depicted in SEQ ID NO:26 as well as sequences located within 5 nt of one of the siRNA or shRNA sequences described herein.
The invention provides compositions, methods, and kits for inhibiting viral gene expression and/or treating a viral infection in a mammal.
RNA interference offers the potential of a novel therapeutic approach for treating viral infections. The invention provides small interfering RNAs (e.g., shRNAs and siRNAs) that target viral sequences and inhibit (i.e., reduce or eliminate) viral gene expression, and methods of using small interfering RNAs for treatment of a viral infection in a mammal, such as a human. In some embodiments, the small interfering RNA constructs of the invention inhibit gene expression in a virus by inducing cleavage of viral polynucleotide sequences within or near the target sequence that is recognized by the antisense sequence of the small interfering RNA.
As used herein, “small interfering RNA” refers to an RNA construct that contains one or more short sequences that are at least partially complementary and capable of interacting with a polynucleotide sequence of a virus. Interaction may be in the form of a direct binding between complementary (antisense) sequences of the small interfering RNA and polynucleotide sequences of the viral target, or in the form of an indirect interaction via enzymatic machinery (e.g., a protein complex) that allows the antisense sequence of the small interfering RNA to recognize the target sequence. Often, recognition of the target sequence by the small interfering RNA results in cleavage of viral sequences within or near the target site that is recognized by the recognition (antisense) sequence of the small interfering RNA. The small interfering RNA may be comprised exclusively of ribonucleotide residues or may contain one or more modified residues, particularly at the ends or on the sense strand. The term “small interfering RNA” as used herein encompasses shRNA and siRNA, both of which are understood and known to those in the art to refer to RNA constructs with particular characteristics and types of configurations.
As used herein, “shRNA” refers to an RNA sequence comprising a double-stranded region and a loop region at one end forming a hairpin loop. The double-stranded region is typically about 19 to about 29 nucleotides in length, and the loop region is typically about 2 to about 10 nucleotides in length. One of our preferred shRNAs, HCVa-wt shRNA, has a 25-bp double-stranded region (SEQ ID #12), a 10-nt loop, a GG extension on the 5′ end, and a UU extension on the 3′ end.
As used herein, “siRNA” refers to an RNA molecule comprising a double stranded region a 3′ overhang of nonhomologous residues at each end. The double-stranded region is typically about 18 to about 30 nucleotides in length, and the overhang may be of any length of nonhomologous residues, but a 2 nucleotide overhang is preferred. One of our preferred siRNAs, HCVa-wt siRNA, has a 25-bp double-stranded region (SEQ ID #12), and a UU extension on each 3′ end.
In one embodiment, a small interfering RNA as described herein comprises a sequence complementary to a sequence of the internal ribosome entry site (IRES) element of hepatitis C (“HCV”). In one embodiment, the virus is HCV genotype 1a.
SiRNA gene inhibition has been shown to robustly inhibit gene expression in a number of mammalian systems. Due to its high level of secondary structure, the HCV IRES has been suggested to be a poor target for si/shRNAs. Mizusawa recently reported, however, successful targeting of the HCV IRES in 293 and Huh7 tissue culture cells, reporting 50 and 74 percent knock-down of gene expression, respectively. Similarly, Seo and coworkers [25] reported the ability of 100 nM siRNA to inhibit HCV replication (˜85% knockdown) in 5-2 Huh7 cells. We have demonstrated that small interfering RNAs (shRNAs and siRNAs) directed against the 3′ end of the HCV IRES, including and downstream of the AUG translation start site, induce 96 percent knockdown of HCV IRES-dependent luciferase expression at 0.3 nM in 293FT cells and 75% knockdown at 0.1 nM in Huh7 cells (see
Recent reports suggest that in vitro-synthesized transcripts from bacteriophage promoters potently induce interferon alpha and beta due to the presence of an unnatural 5′ triphosphate [26]. Furthermore, shRNAs expressed from pol III expression vectors may also induce IFN [27]. How this interferon induction would affect use of shRNAs in a clinical setting for HCV infection is unclear. Current HCV therapy includes treatment with interferon alpha, suggesting that if interferon is induced by shRNA, it may have a positive effect. To date, no interferon-related side effects have been reported in animals following administration of RNAi [3]. Additional concerns have been raised regarding off-target effects of siRNA as well as potential cytotoxic effects when RNAi is delivered by lentiviral vectors [28]. As with other pharmaceutics, proper testing of several potential agents will be required to identify those having the highest activities and screen for those that have unacceptable off-target effects.
The IRES region in the HCV 5′-UTR is highly conserved (92-100% identical [15, 29-31]) and has several segments that appear to be invariant, making the IRES a prime target for nucleic acid-based inhibitors. The region around the AUG translation initiation codon is particularly highly conserved, being invariant at positions +8 to −65 (with the exception of a single nucleotide variation at position −2) over 81 isolates from various geographical locations [32]. Despite the conservation of sequence in the IRES motif, it is unlikely that targeting a single sequence, even if highly conserved, will be sufficient to prevent escape mutants. RNA viruses are notorious for their high mutation rates due to the high error rate of the RNA polymerase and the lack of proofreading activity. On average, each time HCV RNA is replicated one error is incorporated into the new strand. This error rate is compounded by the prodigious production of viral particles in an active infection (approximately a trillion per day in a chronically infected patient) [33]. Therefore, it is likely that several conserved sites will need to be targeted or, alternatively, shRNAs should be used as a component of a combination treatment, such as with ribaviran and pegylated interferon. It should be noted that a single mismatch does not completely block shRNA activity (see
McCaffrey and colleagues recently reported that a phosphorodiamidate morpholino oligonucleotide directed against a conserved HCV IRES site at the AUG translation initiation site potently inhibits reporter gene expression [8]. We used the same morpholino inhibitor for comparison against the shRNA inhibition. Both the morpholine and the shRNA targeting this site potently and robustly inhibited IRES-dependent gene expression. Four mutations in the morpholino were required to block activity, whereas two changes in the shRNA were sufficient, suggesting greater shRNA specificity. This potential advantage, coupled with the lack of unnatural residues in the shRNA inhibitor and presumably fewer resultant side effects, are balanced by the increased stability of the morpholino oligomer.
We used a dual reporter luciferase plasmid where firefly luciferase (fLuc) expression was dependent on the HCV IRES [24]. Expression of the upstream renilla luciferase is not HCV IRES-dependent and is translated in a Cap-dependent process. Direct transfection of HCV IRES shRNAs, or alternatively shRNAs expressed from polIII-promoter vectors, efficiently blocked HCV IRES-mediated fLuc expression in human 293FT and Huh7 cells. Control shRNAs containing a double mutation had little or no effect on fLuc expression, and shRNAs containing only a single mutation showed partial inhibition. These shRNAs were also evaluated in a mouse model where DNA constructs were delivered to cells in the liver by hydrodynamic transfection via the tail vein. The dual luciferase expression plasmid, the shRNAs, and secreted alkaline phosphatase plasmid were used to transfect cells in the liver, and the animals were imaged at time points over 12 to 96 hours In vivo imaging revealed that HCV IRES shRNA directly, or alternatively expressed from a polIII-plasmid vector, inhibited HCV IRES-dependent reporter gene expression; mutant or irrelevant shRNAs had little or no effect. These results suggest that shRNAs, delivered as RNA or expressed from viral or nonviral vectors, are useful as effective antivirals for the control of HCV and related viruses.
Assay of three additional shRNAs targeting different sites on HCV IRES domain IV revealed another potent shRNA, HCVd-wt, whose target position is shifted 6 nt from that of HCVa-wt. HCVb-wt and HCVc-wt were much less efficient inhibitors.
To further investigate local sequence effects on potency, seven in vitro-transcribed shRNA constructs comprising a 19 bp sequence complementary to a sequence of the HCV IRES and the corresponding synthetic siRNA comprising the same 19 bp sequences, targeting all possible positions within the 31-bp site of HCV1a (344-374), were assayed for inhibitory activity. A 25-bp synthetic siRNA corresponding to HCVa-wt shRNA was also tested. All of them exhibited a high level of activity. In general, siRNAs were more potent than shRNAs. The most potent, HCVd-wt was effective at 1 nM (>90% inhibition), 0.1 nM (˜90% inhibition) and even 0.01 mM concentration (˜40% inhibition). Thus, 19-25 bp shRNAs and siRNAs designed to target the region 344-374 on the HCV IRES are generally potent, with some local differences.
Effects of size and sequence of loop region of the shRNA were also investigated. The loop region of the shRNA stem-loop can be as small as 2-3 nt and does not have a clear upper limit on size; as a practical matter it is usually between 4 and 9 nt and of a sequence that does not cause unintended effects, such as being complementary to a non-target gene. Highly structured loop sequences such as the GNRA tetraloop are acceptable. The loop can be at either end of the molecule; that is, the sense strand can be either 5′ or 3′ relative to the loop. Also, a noncomplementary duplex region (approx. 1-6 bp, for example, 4 CG bps) can be placed between the targeting duplex and the loop, for example to serve as a “CG clamp” to strengthen duplex formation. At least 19 bp of target-complementary duplex are needed if a noncomplementary duplex is used.
The 3′ end is preferred to have a non-target-complementary 2-nt overhang, most often UU or dTdT, but it can be any nucleotide including chemically modified nucleotides for enhanced nuclease resistance. In other (less preferred) embodiments, there is one or zero nucleotides overhanging on the 3′ end.
The 5′ end can have a noncomplementary extension as with the two Gs shown in
Other changes that are encompassed by the invention are length variations between about 19 and about 30 bp for the target complementary duplex region, small shifts in the sequence targeted (preferably 0 to about 2 nt, but shifts as large as about 10 nt in either direction along the target may lie within the targetable region). Similarly, mismatches are also tolerated: about 1 to about 2 in the antisense strand and about 1 to about 9 in the sense strand (the latter destabilizing the hairpin duplex but not affecting the strength of binding of the antisense strand to the target; the number tolerated depends partly on the length of the target-complementary duplex. We have successfully used 7 G-U mismatches within a 29-bp target-complementary duplex region. Note that the two mutations shown in
The invention provides methods of inhibiting gene expression in a virus, comprising contacting the virus with a small interfering RNA, such as a shRNA or siRNA as described herein that comprises a sequence that is at least partially complementary and capable of interacting with a polynucleotide sequence of the virus. In some embodiments, contacting the virus comprises introducing the small interfering RNA into a cell that contains the virus, i.e., a virus infected cell. “Inhibiting gene expression” as used herein refers to a reduction (i.e., decrease in level) or elimination of expression of at least one gene of a virus. In some embodiments, inhibition of gene expression is accomplished by cleavage of the viral target sequence to which the small interfering RNA binds.
The invention provides methods for treating a viral infection in a mammal, comprising administering to the mammal a composition comprising a therapeutically effective amount of a small interfering RNA, such as a shRNA or siRNA as described herein that comprises a sequence that is at least partially complementary and capable of interacting with a polynucleotide sequence of the virus. In some embodiments, the mammal is human. In one embodiment, the mammal is a human and the viral infection is a HCV infection, such as an infection with HCV genotype 1a, and the small interfering RNA comprises a sequence that is at least complementary to a sequence of the IRES of the HCV.
As used herein, “therapeutically effective amount” refers to the amount of a small interfering RNA that will render a desired therapeutic outcome (e.g., reduction or elimination of a viral infection). A therapeutically effective amount may be administered in one or more doses.
Generally, in methods for treating a viral infection in a mammal, the small interfering RNA is administered with a pharmaceutically acceptable carrier. As used herein, “pharmaceutically acceptable carrier” (also interchangeably termed “pharmaceutically acceptable excipient” herein) to a relatively inert substance that facilitates administration of the small interfering RNA. For example, a carrier can give form or consistency to the composition or can act as a diluent. A pharmaceutically acceptable carrier is biocompatible (i.e., not toxic to the host) and suitable for a particular route of administration for a pharmacologically effective substance. Suitable pharmaceutically acceptable carriers include but are not limited to stabilizing agents, wetting and emulsifying agents, salts for varying osmolarity, encapsulating agents, buffers, and skin penetration enhancers. In some embodiments, the pharmaceutically acceptable carrier is water or saline. Examples of pharmaceutically acceptable carriers are described in Remington's Pharmaceutical Sciences (Alfonso R. Gennaro, ed., 18th edition, 1990).
In methods for treating a viral infection, small interfering RNAs as described herein are generally administered parenterally, e.g., subcutaneously, intravenously, intramuscularly.
CompositionsThe invention provides compositions for inhibiting viral gene expression and/or treating a viral infection in a mammal comprising at least one small interfering RNA as described herein. Compositions of the invention may comprises two or more small interfering RNAs as described herein. In accordance with the invention, a small interfering RNA, e.g., shRNA or siRNA, comprises a sequence that is substantially complementary to a viral polynucleotide sequence of about 19 to about 30 nucleotides, wherein interaction of the substantially complementary sequence of the small interfering RNA with the polynucleotide sequence of the virus inhibits viral gene expression, for example, by cleavage of viral polynucleotide sequences.
In some embodiments, the composition comprises a shRNA comprising a sequence selected from the group consisting of SEQ ID NOs: 12, 17, 18, 19, 20, 21, 22, 23, 24, and 25. In some embodiments, the composition comprises a siRNA comprising a sequence selected from SEQ ID NOs: 19, 20, 21, 22, 23, 24, and 25. In some embodiments, the composition comprises a shRNA or siRNA that binds to, i.e., comprises a sequence substantially complementary to, a sequence of about 19 to about 30 nucleotides within the IRES element of HCV, for example, HCV genotype 1a.
In some embodiments, the invention provides a pharmaceutical composition comprising a small interfering RNA as described herein and a pharmaceutically acceptable carrier. In some embodiments, the pharmaceutical composition is formulated for parenteral administration to a mammal, for example, a human.
KitsThe invention provides kits comprising a small interfering RNA as described herein. In some embodiments, the kits also include instructions for use in the methods for inhibiting viral gene expression and/or methods for treatment of a viral infection in a mammal described herein. Instructions may be provided in printed form or in the form of an electronic medium such as a floppy disc, CD, or DVD, or in the form of a website address where such instructions may be obtained.
In some embodiments, the kits include a pharmaceutical composition of the invention, for example including at least one unit dose of at least one small interfering RNA such as a shRNA or a siRNA, and instructions providing information to a health care provider regarding usage for treating or preventing a viral infection. The small interfering RNA is often included as a sterile aqueous pharmaceutical composition or dry powder (e.g., lyophilized) composition.
Suitable packaging is provided. As used herein, “packaging” refers to a solid matrix or material customarily used in a system and capable of holding within fixed limits a composition of the invention suitable for administration to an individual. Such materials include glass and plastic (e.g., polyethylene, polypropylene, and polycarbonate) bottles, vials, paper, plastic, and plastic-foil laminated envelopes and the like. If e-beam sterilization techniques are employed, the packaging should have sufficiently low density to permit sterilization of the contents.
Kits may also optionally include equipment for administration of a pharmaceutical composition of the invention, such as, for example, syringes or equipment for intravenous administration, and/or a sterile solution, e.g., a diluent such as water, saline, or a dextrose solution, for preparing a dry powder (e.g., lyophilized) composition for administration.
The following examples are intended to illustrate, but not to limit, the invention.
EXAMPLES Example 1 Design and Construction of ShRNA Expression Cassettes, T7 Transcription Reactions, and Reporter Gene AssaysChemically synthesized oligonucleotides were obtained from IDT (Coralville, Iowa), resuspended in RNase- and pyrogen-free water (Biowhittaker), and annealed as described below. The following oligonucleotide pairs, for making shRNA, contain a T7 promoter element (doubly underlined), sense and antisense HCV IRES sequence and a miR-23 microRNA loop structure (reported to facilitate cytoplasmic localization [21, 22]).
(T7 promoter sequence doubly underlined). T7 transcripts for HCVa-mut shRNA were identical with the exception that nucleotide changes (G→C and C→G) were incorporated into the synthesized oligonucleotides at the singly underlined residues.
HCVa-wt shRNA (
ShRNAs #1-7 (targeting positions 344-362, 345-363, 346-364, 347-365, 348-366, 349-367, 350-368 on the HCV IRES; See
The oligonucleotide pair used to prepare the control shRNA 229 (which targets tumor necrosis factor alpha) is 229-5′-TAATACGACTCACTATAGGGGCG GTGCCTATGTCTCAGCCTCTTCTCACTTCCTGTCATGAGAAGAGGCTGAGACA TAGGCACCGCC TT-3′ (SEQ ID NO:3)
and 229-3′-AAGGCG GTGCCTATGTC TCAGCC TCT TCTCA TGACAGGAAG TGAGA AGAGGCTGA GACATAGGCACCCCTATAGTGAGTCGTATTA-5′ (SEQ ID NO:4).
Pol III U6 ShRNA Expression Vector Construction—Design of Small Hairpin ShRNA Expression VectorsOligonucleotide pairs were incubated together at 95° C. for 2 minutes in RNA polymerase buffer (e.g., 120 μl of each 100 μM oligonucleotide in 60 μl 5× annealing buffer (Promega; 1X=1 mM Tris-HCl (pH 7.5), 50 mM NaCl) and slowly cooled (annealed) over 1 hour to less than 40° C. The oligonucleotides were designed to provide 4-base overhangs for rapid cloning into Bbs1/BamH1-digested pCRII-U6 plasmid (Bbs1 and BamH1 recognition sites or overhangs are underlined in the oligonucleotide sequences). The pCRII-U6 pol III expression plasmid was prepared by subcloning the PCR product obtained from human HT-1080 genomic DNA using primers and huU6-5′ ATCGATCCCCAGTGGAAAGACGCGCAG (SEQ ID NO:5) and huU6-3′-GGATCCGAATTCGAAGACCACGGTGTTTCGTCCTTTCCACAA-5′ (SEQ ID NO:6) [23] into the pCRII vector (Invitrogen) using the TA cloning kit (Invitrogen). The cassette consisting of the annealed oligonucleotides (encoding the HCV IRES shRNA) was ligated into the Bbs1/BamH1-digested pCRII-U6 plasmid. The expressed shRNA contains a miR-23 microRNA loop structure to facilitate cytoplasmic localization [21, 22]. The final pCRII-U6 constructs were confirmed by sequencing. The primers pairs used were: pHCVa-wt 5′-ACCG GAGCACGAATCCTAAACCTCAAAGA CTTCCTGTCA TCTTTGAGGTTTAGGATTCGTGCTC TTTTTTG-3′ (SEQ ID NO:7) and 5′-GATCCAAAAAA GAGCACGAATCCTAAACCTCAAAGA TGACAGGAAG TCTTTGAGGTTTAGGATTCGTGCTC-3′ (SEQ ID NO:8). Oligonucleotides containing the appropriate sequence changes at the underlined residues (see above) were used to generate the pCRII-U6/HCVa-mut (double mutation), HCVsnp1 (single change at 5′ side) and HCVsnp2 (single change at 3′ end) as depicted in
Oligonucleotide pairs were incubated at 95° C. for 2 minutes in RNA polymerase buffer (e.g., 120 μl of each 100 μM Oligonucleotide in 60 μl 5× transcription buffer (Promega)) and slowly cooled (annealed) over 1 hour to less than 40° C. ShRNA was transcribed at 42° C. for 4 hours from 5 μM of the resulting annealed dsDNA template using the AmpliScribe T7 Flash transcription kit (Epicentre Technologies) followed by purification on a gel filtration spin column (Microspin G-50, Amersham Biosciences) that had been thoroughly washed three times with phosphate buffered saline (PBS) to remove preservative.
SiRNAsSiRNAs were prepared by annealing chemically synthesized (Dharmacon) complementary strands of RNA, each containing the appropriate recognition sequence plus an (overhanging) UU extension on the 3′end.
Transfections and Reporter Gene AssaysHuman 293FT (Invitrogen) and Huh7 cells (ATCC) were maintained in DMEM (Biowhittaker) with 10% fetal bovine serum (HyClone), supplemented with 2 mM L-glutamine and 1 mM sodium pyruvate. The day prior to transfection, cells were seeded at 1.7×105 cells/well in a 24-well plate, resulting in ˜80% cell confluency at the time of transfection. Cells were transfected with Lipofectamine 2000 (Invitrogen) following the manufacturer's instructions. For the inhibition experiments, 293FT or Huh7 cells were cotransfected (in triplicate) with 40 ng pCDNA3/HCV IRES dual luciferase (renilla and firefly) reporter construct, 50 ng pSEAP2-control plasmid (BD Biosciences Clontech, as transfection controls) and the indicated amounts of T7-generated shRNA (typical amount 1 pmole) or pCRII-U6 shRNA expression construct (710 ng). Compensatory pUC18 plasmid was added to the transfection mix to give a final concentration of 800 ng total nucleic acid per transfection. 48 hours later, supernatant was removed, heated at 65° C. for 15-30 minutes, and 5-10 μl of the supernatant was added to 150 μl p-nitrophenyl phosphate liquid substrate system (pNPP, Sigma). After a 30-60 minute incubation at room temperature, samples were read (405 nm) on a Molecular Devices Thermomax microplate reader and quantitated using SOFTmax software (Molecular Devices). The remaining cells were lysed and luciferase activity measured using the Dual-Luciferase Reporter assay system (Promega) and MicroLumat LB 96 P luminometer (Berthold).
MiceSix-week old female Balb/c mice were obtained from the animal facility of Stanford University. Animals were treated according to the NIH Guidelines for Animal Care and the Guidelines of Stanford University.
Mouse Hydrodynamic Injections and In Vivo ImagingHydrodynamic tail vein injections were performed as described by McCaffrey and colleagues with minor modifications including omission of RNasin [24]. A total volume of 1.8 ml of phosphate-buffered saline containing inhibitor (RNA or plasmid), 10 μg of pHCV Dual Luc plasmid, and 2 μg pSEAP2-control plasmid (BD Biosciences Clontech, contains the SV40 early promoter), was steadily injected into the mouse tail vein over ˜5 seconds (N=4-6 animals per group). At the indicated times, 100 μl of 30 mg/ml luciferin was injected intraperitoneally. Ten minutes following the injection, live anesthetized mice were analyzed using the IVIS7 imaging system (Xenogen Corp., Alameda, Calif.) and the resulting light emission data quantitated using LivingImage software (Xenogen). Raw values are reported as relative detected light per minute and standard errors of the mean for each group (N=4-5 animals) are shown.
Secreted Alkaline Phosphatase (SEAP) AssayAt day 5, mice were bled through the retro-orbital vein of the eye. The serum was separated from blood cells by microcentrifugation, heated at 65° C. for 30 minutes to inactivate endogenous alkaline phosphates, and 5-10 μl of the serum was added to 150 μl pNPP liquid substrate system (see above). After a 30-60 minute incubation at room temperature, samples were read (405 nm) and quantitated as described above.
Example 2 ShRNA Inhibition of HCV IRES-Mediated Gene Expression in Human Tissue Culture CellsIn this study, short interfering RNAs (shRNAs and siRNAs) designed and constructed as in Example 1 to target a conserved region of the hepatitis C IRES were tested for their ability to inhibit HCV IRES-mediated reporter expression in human tissue culture cells.
We also designed three other shRNAs with the same stem length and loop sequence that target nearby positions in Domain IV of the HCV IRES (
To test the effectiveness of the HCV shRNAs to inhibit HCV IRES-mediated gene expression, human 293FT or hepatocyte Huh7 cells were co-transfected with pCDNA3/HCV IRES dual luciferase expression plasmid, secreted alkaline phosphatase expression plasmid (pSEAP2, to control for efficiency of transfection) as well as in vitro synthesized shRNAs or alternatively, pol III expression vectors containing the corresponding shRNA cassettes.
As seen in
HCVa-wt shRNA targeting the region of the IRES immediately downstream of the AUG translation start site strongly inhibits HCV IRES-mediated fLuc expression in both human 293FT (
To confirm that the shRNAs were acting by degrading their target mRNA, a northern blot analysis was performed (
Dose response experiments showed that the HCVa-wt shRNA effectively inhibited HCV IRES-dependent gene expression at 0.3 nM in 293FT cells (96 percent inhibition, see
To further investigate local sequence effects on potency, seven in vitro-transcribed 19 bp shRNA and the corresponding synthetic 19 bp siRNA, targeting all possible positions within the 31-bp site of HCVa (344-374;
The ability of the HCV shRNA and HCV shRNA expression plasmid to inhibit target gene expression was extended to a mouse model system using hydrodynamic injection to deliver the nucleic acids to mouse liver.
SFV has been used as a model system for more virulent positive-strand RNA viruses. To examine the inhibitory effect of RNAi on SFV growth, we generated shRNAs targeting four SFV genes (nsp-1, nsp-2 and nsp-4, and capsid) and one mismatched control for the nsp-4 site, expressed them from a U6 promoter and tested their ability to inhibit the proliferation of SFV-A7-EGFP, a version of the replication-proficient SFV strain SFV-A7 that expresses a eGFP reporter gene [49]. A modest reduction (˜35%) of SFV-GFP replication was seen with shRNAs targeting the nsp-1 (
A site within the capsid coding region that was previously shown to be effective on Sindbis virus [50] was not effective on SFV. The Sindbis-SFV sequence homology at this site is only 77%. SFV is a very rapidly growing virus, producing up to 200,000 cytoplasmic RNAs during its infectious cycle. To see if we could better protect cells from a slower-growing virus, we also tested the effects of these siRNAs on a replication-deficient strain of SFV-GFP in two separate experiments.
Although the foregoing invention has been described in some detail by way of illustration and examples for purposes of clarity of understanding, it will be apparent to those skilled in the art that certain changes and modifications may be practiced without departing from the spirit and scope of the invention. Therefore, the description should not be construed as limiting the scope of the invention, which is delineated by the appended claims.
All publications, patents and patent applications cited herein are hereby incorporated by reference in their entireties for all purposes to the same extent as if each individual publication, patent or patent application were specifically indicated to be so incorporated by reference.
REFERENCES
- 1. Sookoian, S. C., New therapies on the horizon for hepatitis C. Ann Hepatol, 2003. 2: 164-70.
- 2. Randall, G. and C. M. Rice, Interfering with hepatitis C virus RNA replication. Virus Res, 2004. 102: 19-25.
- 3. Radhakrishnan, S. K., T. J. Layden, and A. L. Gartel, RNA interference as a new strategy against viral hepatitis. Virology, 2004. 323: 173-81.
- 4. Hugle, T. and A. Cerny, Current therapy and new molecular approaches to antiviral treatment and prevention of hepatitis C. Rev Med Virol, 2003. 13: 361-71.
- 5. Blight, K. J., A. A. Kolykhalov, and C. M. Rice, Efficient initiation of HCV RNA replication in cell culture. Science, 2000. 290: 1972-4.
- 6. Pietschmann, T. and R. Bartenschlager, Tissue culture and animal models for hepatitis C virus. Clin Liver Dis, 2003. 7: 23-43.
- 7. Mercer, D. F., D. E. Schiller, J. F. Elliott, D. N. Douglas, C. Hao, A. Rinfret, W. R. Addison, K. P. Fischer, T. A. Churchill, J. R. Lakey, D. L. Tyrrell, and N. M. Kneteman, Hepatitis C virus replication in mice with chimeric human livers. Nat Med, 2001. 7: 927-33.
- 8. McCaffrey, A. P., L. Meuse, M. Karimi, C. H. Contag, and M. A. Kay, A potent and specific morpholino antisense inhibitor of hepatitis C translation in mice. Hepatology, 2003. 38: 503-8.
- 9. Lieberman, J., E. Song, S. K. Lee, and P. Shankar, Interfering with disease: opportunities and roadblocks to harnessing RNA interference. Trends Mol Med, 2003. 9: 397-403.
- 10. Layzer, J. M., A. P. McCaffrey, A. K. Tanner, Z. Huang, M. A. Kay, and B. A. Sullenger, In vivo activity of nuclease-resistant siRNAs. Rna, 2004. 10: 766-71.
- 11. Rossi, J. J. and G. J. Hannon, Unlocking the potential of the human genome with RNA interference. Nature, 2004. 431: 35-43.
- 12. McHutchison, J. G. and K. Patel, Future therapy of hepatitis C. Hepatology, 2002. 36: S245-52.
- 13. Wilson, J. A., S. Jayasena, A. Khvorova, S. Sabatinos, I. G. Rodrigue-Gervais, S. Arya, F. Sarangi, M. Harris-Brandts, S. Beaulieu, and C. D. Richardson, RNA interference blocks gene expression and RNA synthesis from hepatitis C replicons propagated in human liver cells. Proc Natl Acad Sci USA, 2003. 100: 2783-8.
- 14. Randall, G., A. Grakoui, and C. M. Rice, Clearance of replicating hepatitis C virus replicon RNAs in cell culture by small interfering RNAs. Proc Natl Acad Sci USA, 2003. 100: 235-40.
- 15. Yokota, T., N. Sakamoto, N. Enomoto, Y. Tanabe, M. Miyagishi, S. Maekawa, L. Yi, M. Kurosaki, K. Taira, M. Watanabe, and H. Mizusawa, Inhibition of intracellular hepatitis C virus replication by synthetic and vector-derived small interfering RNAs. EMBO Rep, 2003. 4: 602-8.
- 16. Kapadia, S. B., A. Brideau-Andersen, and F. V. Chisari, Interference of hepatitis C virus RNA replication by short interfering RNAs. Proc Natl Acad Sci USA, 2003. 100: 2014-8.
- 17. Kronke, J., R. Kittler, F. Buchholz, M. P. Windisch, T. Pietschmann, R. Bartenschlager, and M. Frese, Alternative approaches for efficient inhibition of hepatitis C virus RNA replication by small interfering RNAs. J Virol, 2004. 78: 3436-46.
- 18. Sen, A., R. Steele, A. K. Ghosh, A. Basu, R. Ray, and R. B. Ray, Inhibition of hepatitis C virus protein expression by RNA interference. Virus Res, 2003. 96: 27-35.
- 19. Zhang, J., O. Yamada, T. Sakamoto, H. Yoshida, T. Iwai, Y. Matsushita, H. Shimamura, H. Araki, and K. Shimotohno, Down-regulation of viral replication by adenoviral-mediated expression of siRNA against cellular cofactors for hepatitis C virus. Virology, 2004. 320: 135-43.
- 20. McCaffrey, A. P., L. Meuse, T. T. Pham, D. S. Conklin, G. J. Hannon, and M. A. Kay, RNA interference in adult mice. Nature, 2002. 418: 38-9.
- 21. Kawasaki, H. and K. Taira, Short hairpin type of dsRNAs that are controlled by tRNA(Val) promoter significantly induce RNAi-mediated gene silencing in the cytoplasm of human cells. Nucleic Acids Res, 2003. 31: 700-7.
- 22. Lagos-Quintana, M., R. Rauhut, W. Lendeckel, and T. Tuschl, Identification of novel genes coding for small expressed RNAs. Science, 2001. 294: 853-8.
- 23. Qin, X. F., D. S. An, I. S. Chen, and D. Baltimore, Inhibiting HIV-1 infection in human T cells by lentiviral-mediated delivery of small interfering RNA against CCR5. Proc Natl Acad Sci USA, 2003. 100: 183-8.
- 24. McCaffrey, A. P., K. Ohashi, L. Meuse, S. Shen, A. M. Lancaster, P. J. Lukavsky, P. Sarnow, and M. A. Kay, Determinants of hepatitis C translational initiation in vitro, in cultured cells and mice. Mol Ther, 2002. 5: 676-84.
- 25. Seo, M. Y., S. Abrignani, M. Houghton, and J. H. Han, Small interfering RNA-mediated inhibition of hepatitis C virus replication in the human hepatoma cell line Huh-7. J Virol, 2003. 77: 810-2.
- 26. Kim, D. H., M. Longo, Y. Han, P. Lundberg, E. Cantin, and J. J. Rossi, Interferon induction by siRNAs and ssRNAs synthesized by phage polymerase. Nat Biotechnol, 2004. 22: 321-5.
- 27. Bridge, A. J., S. Pebernard, A. Ducraux, A. L. Nicoulaz, and R. Iggo, Induction of an interferon response by RNAi vectors in mammalian cells. Nat Genet, 2003. 34: 263-4.
- 28. Fish, R. J. and E. K. Kruithof, Short-term cytotoxic effects and long-term instability of RNAi delivered using lentiviral vectors. BMC Mol Biol, 2004. 5: 9.
- 29. Han, J. H., V. Shyamala, K. H. Richman, M. J. Brauer, B. Irvine, M. S. Urdea, P. Tekamp-Olson, G. Kuo, Q. L. Choo, and M. Houghton, Characterization of the terminal regions of hepatitis C viral RNA: identification of conserved sequences in the 5′ untranslated region and poly(A) tails at the 3′ end. Proc Natl Acad Sci USA, 1991. 88: 1711-5.
- 30. Choo, Q. L., K. H. Richman, J. H. Han, K. Berger, C. Lee, C. Dong, C. Gallegos, D. Coit, R. Medina-Selby, P. J. Barr, and et al., Genetic organization and diversity of the hepatitis C virus. Proc Natl Acad Sci USA, 1991. 88: 2451-5.
- 31. Okamoto, H., S. Okada, Y. Sugiyama, K. Kurai, H. Iizuka, A. Machida, Y. Miyakawa, and M. Mayumi, Nucleotide sequence of the genomic RNA of hepatitis C virus isolated from a human carrier: comparison with reported isolates for conserved and divergent regions. J Gen Virol, 1991. 72 (Pt 11): 2697-704.
- 32. Bukh, J., R. H. Purcell, and R. H. Miller, Sequence analysis of the 5′ noncoding region of hepatitis C virus. Proc Natl Acad Sci USA, 1992. 89: 4942-6.
- 33. Rice, C. M., Virology: fresh assault on hepatitis C. Nature, 2003. 426: 129-31.
- 34. Zhang, H., R. Hanecak, V. Brown-Driver, R. Azad, B. Conklin, M. C. Fox, and K. P. Anderson, Antisense oligonucleotide inhibition of hepatitis C virus (HCV) gene expression in livers of mice infected with an HCV-vaccinia virus recombinant. Antimicrob Agents Chemother, 1999. 43: 347-53.
- 35. Jubin, R., N. E. Vantuno, J. S. Kieft, M. G. Murray, J. A. Doudna, J. Y. Lau, and B. M. Baroudy, Hepatitis C virus internal ribosome entry site (IRES) stem loop IIId contains a phylogenetically conserved GGG triplet essential for translation and IRES folding. J Virol, 2000. 74: 10430-7.
- 36. Seyhan A A, Vlassov A V, Ilves H, Egry L, Kaspar R L, Kazakov S A, Johnston B H. Complete, gene-specific siRNA libraries: production and expression in mammalian cells. RNA. 2005. 11:837-46.
- 37. Wang Q, Contag C H, Ilves H, Johnston B H, Kaspar R L. Small hairpin RNAs efficiently inhibit hepatitis C IRES-mediated gene expression in human tissue culture cells and a mouse model. Mol Ther. 2005. 12:562-8
Claims
1. A method of inhibiting gene expression in a virus, comprising introducing a small interfering RNA into a virus-containing cell, wherein said small interfering RNA comprises a sequence that is at least partially complementary to a polynucleotide sequence of the virus, wherein interaction of said at least partially complementary sequence of the small interfering RNA with said polynucleotide sequence of the virus results in inhibition of gene expression in the virus.
2. A method according to claim 1, wherein the small interfering RNA is a shRNA.
3. A method according to claim 1, wherein the small interfering RNA is an siRNA.
4. A method according to any of claims 1-3, wherein the small interfering RNA recognizes a viral sequence of about 19 to about 30 nucleotides.
5. A method according to claim 1, wherein the virus is a hepatitis C virus.
6. A method according to claim 5, wherein the small interfering RNA interacts with a sequence within the internal ribosome entry site (IRES) sequence of the hepatitis C virus.
7. A method according to claim 6, wherein the IRES sequence comprises the sequence depicted in SEQ ID NO:11.
8. A method according to claim 7, wherein the small interfering RNA recognizes a sequence of about 19 to about 30 nucleotides within the region depicted in SEQ ID NO:26.
9. A method according to any of claims 5-8, wherein the small interfering RNA is a shRNA.
10. A method according to claim 9, wherein the shRNA comprises a sequence selected from the group consisting of SEQ ID NO:12, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:27, SEQ ID NO:32, and SEQ ID NO:33.
11. A method according to claim 10, wherein the shRNA has the sequence depicted in SEQ ID NO:12.
12. A method according to any of claim 5-8, wherein the small interfering RNA is a siRNA.
13. A method according to claim 12, wherein the siRNA comprises a sequence selected from the group consisting of SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ NO: 23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:27, SEQ ID NO:32, and SEQ ID NO:33.
14. A method of treating a viral infection in a mammal, said method comprising administering to the mammal a composition comprising a therapeutically effective amount of a small interfering RNA that comprises a sequence that is at least partially complementary to a polynucleotide sequence of the virus, wherein interaction of said at least partially complementary sequence of the small interfering RNA with said polynucleotide sequence of the virus results in inhibition of gene expression in the virus.
15. A method according to claim 14, wherein the small interfering RNA is an shRNA.
16. A method according to claim 14, wherein the small interfering RNA is an siRNA.
17. A method according to any of claims 14-16, wherein the small interfering RNA recognizes a viral sequence of about 19 to about 30 nucleotides.
18. A method according to claim 14, wherein said mammal is a human and the viral infection comprises a hepatitis C virus.
19. A method according to claim 18, wherein the small interfering RNA comprises a sequence that is at least partially complementary to a polynucleotide sequence within the IRES sequence of the hepatitis C virus.
20. A method according to claim 19, wherein the IRES sequence comprises the sequence depicted in SEQ ID NO:11.
21. A method according to claim 20, wherein the small interfering RNA binds recognizes a sequence of about 19 to about 30 nucleotides within the region depicted in SEQ ID NO:26.
22. A method according to any of claims 18-21, wherein the small interfering RNA is an shRNA.
23. A method according to claim 22, wherein the shRNA comprises a sequence selected from the group consisting of SEQ ID NO:12, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ NO: 23, SEQ ID NO:24, and SEQ ID NO:25, SEQ ID NO:27, SEQ ID NO:32, and SEQ ID NO:33.
24. A method according to claim 23, wherein the shRNA has the sequence depicted in SEQ ID NO:12.
25. A method according to any of claim 18-21, wherein the small interfering RNA is a siRNA.
26. A method according to claim 25, wherein the siRNA comprises a sequence selected from the group consisting of SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ NO: 23, SEQ ID NO:24, and SEQ ID NO:25, SEQ ID NO:27, SEQ ID NO:32, and SEQ ID NO:33.
27. A composition comprising a shRNA comprising a sequence selected from the group consisting of SEQ ID NO:12, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ NO: 23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:27, SEQ ID NO:32, and SEQ ID NO:33.
28. A composition comprising a siRNA comprising a sequence selected from the group consisting of SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ NO: 23, SEQ ID NO:24, SEQ ID NO:25, and SEQ ID NO:27, SEQ ID NO:32, and SEQ ID NO:33.
29. A pharmaceutical composition comprising a shRNA according to claim 27 and a pharmaceutically acceptable excipient.
30. A pharmaceutical composition comprising a siRNA according to claim 28 and a pharmaceutically acceptable excipient.
31. A kit comprising a shRNA and instructions for use in a method according to any of claims 1, 5-8, 14, and 18-21.
32. A kit according to claim 31, wherein the shRNA comprises a sequence selected from the group consisting of SEQ ID NO:12, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ NO: 23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:27, SEQ ID NO:32, and SEQ ID NO:33.
33. A kit comprising a siRNA and instructions for use in a method according to any of claims 1, 5-8, 14, and 18-21.
34. A kit according to claim 33, wherein the siRNA comprises a sequence selected from the group consisting of SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ NO: 23, SEQ ID NO:24, SEQ ID NO:25, and SEQ ID NO:27, SEQ ID NO:32, and SEQ ID NO:33.
35. A method according to claim 18, wherein said hepatitis C virus is genotype 1a.
36. A method according to claim 14, wherein said mammal is a human.
Type: Application
Filed: Sep 12, 2005
Publication Date: Jul 2, 2009
Applicant: SomaGenics Inc. (Santa Cruz, CA)
Inventors: Roger L. Kaspar (Santa Cruz, CA), Heine Ilves (Santa Cruz, CA), Attila A. Seyhan (Lafayette, CO), Alexander V. Vlassov (Santa Cruz, CA), Brian H. Johnston (Scotts Valley, CA)
Application Number: 11/662,506
International Classification: A61K 31/7105 (20060101); C12N 7/01 (20060101); C07H 21/02 (20060101);