Genetically Modified Photoautotrophic Ethanol Producing Host Cells, Method For Producing The Host Cells, Constructs For The Transformation Of The Host Cells, Method For Testing A Photoautotrophic Strain For A Desired Growth Property And Method Of Producing Ethanol Using The Host Cells

The invention provides genetically modified photoautotrophic ethanol producing host cells. Ethanol production is controlled by an inducible promoter. Promoters utilized may be endogenous or heterologous, and genetic modification may be obtained by extrachromosomal means or chromosomal insertion.

Skip to: Description  ·  Claims  · Patent History  ·  Patent History
Description
CROSS-REFERENCE TO RELATED APPLICATION

This application is a continuation of International Application No. PCT/EP2009/000892, filed Feb. 9, 2009, which claims priority to U.S. Provisional Application No. 61/065,292 filed on Feb. 8, 2008; both applications are incorporated herein by reference.

REFERENCE TO SEQUENCE LISTING

This application contains a sequence listing submitted by EFS-Web, thereby satisfying the requirements of 37 C.F.R. §§1.821-1.825.

FIELD OF THE INVENTION

This invention is related to the field of ethanol production using genetically modified cells.

BACKGROUND OF THE INVENTION

Without new methods for biofuel production, the world will continue to depend on fossil fuels for transportation. Accelerating demand, diminishing reserves and geopolitic risks have in recent years dramatically driven up the cost of fossil fuels. Use of fossil fuels also releases carbon dioxide into the atmosphere, which may cause deleterious environmental effects. Many governments have prescribed a reduction in the use of fossil fuels in favor of alternative renewable biofuels in an effort to stem the release of carbon dioxide from transportation vehicles.

Ethanol can be used as renewable biofuel but methods do not currently exist that can produce ethanol in sufficient quantities and at a price that could lead to a widespread adoption of ethanol as a major alternative to fossil fuels in the worldwide transportation fuel market.

The patent and scientific literature cited herein establishes the knowledge that is available to those with skill in the art. The issued U.S. and foreign patents, published U.S. and foreign patent applications, and all other publications cited herein are hereby incorporated by reference. Additionally, all amino acid and nucleic acid sequences with the respective amino acid sequences encoded thereby identified by database accession number are hereby incorporated by reference.

Aspects of the invention utilize techniques and methods common to the fields of molecular biology, microbiology and cell culture. Useful laboratory references for these types of methodologies are readily available to those skilled in the art. See, for example, Molecular Cloning: A Laboratory Manual (Third Edition), Sambrook, J., et al. (2001) Cold Spring Harbor Laboratory Press; Current Protocols in Microbiology (2007) Edited by Coico, R, et al., John Wiley and Sons, Inc.; The Molecular Biology of Cyanobacteria (1994) Donald Bryant (Ed.), Springer Netherlands; Handbook Of Microalgal Culture Biotechnology And Applied Phycology (2003) Richmond, A.; (ed.), Blackwell Publishing; and “The cyanobacteria, molecular Biology, Genomics and Evolution”, Edited by Antonia Herrero and Enrique Flores, Caister Academic Press, Norfolk, UK, 2008.

SUMMARY OF THE INVENTION Invention 1

It has been discovered that photoautotrophic cells having increased metabolite production produce more ethanol. The inventors have genetically modified photoautotrophic cells in order to increase the activity or affinity of metabolic enzymes, resulting in increased metabolite formation (e.g., pyruvate, acetaldehyde, acetyl-CoA, or precursors thereof) compared to the respective wildtype host cell. Moreover, the inventors have discovered that by further genetically modifying these cells with the overexpression of at least one enzyme of an ethanol pathway, an increased production of ethanol is obtained compared to wildtype photoautotrophic host cell.

These discoveries have been exploited to provide the present invention, which includes compositions of matter directed to these advantageous, genetically modified, photoautotrophic ethanol producing host cells, nucleic acid constructs and methods of making the same.

In a first aspect, the invention provides a genetically modified photoautotrophic, ethanol producing host cell comprising at least one first genetic modification changing the enzymatic activity or affinity of an endogenous host cell enzyme, the first genetic modification resulting in an enhanced level of biosynthesis of acetaldehyde, pyruvate, acetyl-CoA or precursors thereof compared to the respective wild type host cell, and at least one second genetic modification different from the first genetic modification comprising an overexpressed enzyme for the formation of ethanol.

In one embodiment, the at least one endogenous host cell enzyme is selected from enzymes of the glycolysis pathway, Calvin-cycle, intermediate steps of metabolism, amino acid metabolism pathway, the fermentation pathway and the citric acid cycle, wherein the activity of at least one of these enzymes is enhanced compared to the respective wild type host cell. In a further embodiment thereof, the genetically modified host cell has at least one endogenous host cell enzyme that is overexpressed.

Various other embodiments of the invention provide a genetically modified, photoautotrophic ethanol producing host cell wherein the at least one endogenous host cell enzyme is selected from a group consisting of phosphoglycerate mutase, enolase, and pyruvate kinase. In a particular embodiment, the endogenous host cell enzyme of the first genetic modification is malate dehydrogenase.

Certain other embodiments of the invention are directed to a genetically modified, photoautotrophic ethanol producing host cell wherein the at least one endogenous host cell enzyme of the first genetic modification comprises an NAD+/NADH-cofactor-specific enzyme that has been genetically engineered to become NADP+/NADPH-cofactor specific enzyme. In embodiments thereof, the NAD+/NADH-cofactor specific enzyme is malate dehydrogenase.

In another embodiment, the invention provides a genetically modified, photoautotrophic ethanol producing host cell wherein the at least one endogenous host cell enzyme is selected from the glycolysis pathway or the citric acid cycle and is dependent upon a cofactor, and the host cell further comprises an enhanced level of biosynthesis of this cofactor compared to the respective wild type host cell. In embodiments thereof, the invention provides a genetically modified host cell wherein the at least one endogenous host cell enzyme comprises a NAD(P)+/NAD(P)H-cofactor-specific enzyme, and the host cell comprises an enhanced level of NAD(P)+/NAD(P)H biosynthesis compared to the respective wild type host cell. In a particular embodiment thereof, the genetically modified, photoautotrophic host cell comprises an NAD(P)+ transhydrogenase that is overexpressed and converts NADPH to NADH.

Alternative embodiments of this aspect of the invention also provide for a genetically modified, photoautotrophic host cell comprising a host cell NADH dehydrogenase converting NADH to NAD+, wherein the activity of the NADH dehydrogenase is reduced compared to its activity in the wild type host cell. In one particular embodiment thereof, the gene coding for the NADH dehydrogenase is disrupted by a heterologous nucleic acid sequence.

Various other embodiments provide a genetically modified, photoautotrophic host cell wherein the at least one endogenous host cell enzyme is for the conversion of pyruvate or acetyl-CoA or for the formation of reserve compounds and wherein its activity or affinity is reduced. In an embodiment thereof, the genetically modified host cell the reduction of activity is the result of a disruption of the gene encoding the at least one endogenous host cell enzyme. Another embodiment thereof provides genetically modified, photoautotrophic host cell wherein the gene disruption is caused by insertion of a biocide resistance gene into the respective gene.

A different embodiment of the invention provides a genetically modified, photoautotrophic host cell wherein the at least one first genetic modification comprises the transcription of an antisense mRNA molecule that binds to the mRNA encoding the at least one endogenous host cell enzyme and wherein binding results in a reduction of activity of the at least one endogenous host cell enzyme.

In another embodiment, the activity of a metabolic enzyme of the invention can be decreased or eliminated by RNA interference technology. RNA interference (RNAi) is a post-transcriptional gene silencing technique in which double-stranded RNAs (dsRNAs) are introduced in an exogenous or transgenic fashion. RNAi molecules that are complementary to known mRNA's specifically destroy that particular mRNA, thereby diminishing or abolishing gene expression. There are many teachings in the art known to one of ordinary skill. For example, see RNAi: A Guide to Gene Silencing, edited by Gregory J. Hannon. 2003. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. ISBN: 0-87969-641-9; Current Protocols in Molecular Biology, UNIT 26.6 RNAi in Transgenic Plants, (2005) Yinl, Y., Chory, J., and Baulcombe, D., John Wiley & Sons, Inc.; Transgenic microalgae as green cell-factories (2004) León-Bañares, R., et al., Trends in Biotechnology 22(1): 45-52; ALGAL TRANSGENICS IN THE GENOMIC ERA (2005) Walker, T. L., et al., Journal of Phycology 41(6):1077-1093.

Various other embodiments of the invention provide a genetically modified, photoautotrophic host cell wherein the at least one endogenous host cell enzyme is selected from a group consisting of: ADP-glucose-pyrophosphorylase, glycogen synthase, alanine dehydrogenase, lactate dehydrogenase, pyruvate water dikinase, phosphotransacetylase, pyruvate dehydrogenase and acetate kinase. In an embodiment thereof, the at least one endogenous host cell enzyme is glycogen synthase.

Different embodiments of the invention also provide a genetically modified host cell wherein the reserve compounds are selected from a group consisting of glycogen, polyhydroxyalkanoates (e.g. poly-3-hydroxybutyrate or poly-4-hydroxybutyrate), polyhydroxyvalerate, polyhydroxyhexanoate, polyhydroxyoctanoate, amylopectin, starch, cyanophycin and their copolymers, glucosylglycerol and extracellular polysaccharides.

Further embodiments of the invention provide a genetically modified, photoautotrophic host cell wherein the at least one overexpressed enzyme for the formation of ethanol is an alcohol dehydrogenase enzyme. In an embodiment thereof, the alcohol dehydrogenase enzyme is a thermophilic alcohol dehydrogenase. Other embodiments thereof provide a genetically modified, photoautotrophic host cell wherein the alcohol dehydrogenase is AdhE directly converting acetyl-CoA to ethanol. Another embodiment thereof provides a genetically modified, photoautotrophic host cell wherein the alcohol dehydrogenase comprises an amino acid sequence at least 60% identical to AdhE from Thermosynechococcus elongatus BP-1. A further embodiment is a genetically modified, photoautotrophic host cell wherein the alcohol dehydrogenase is AdhE from Thermosynechococcus elongatus BP-1. Different embodiments thereof provide a genetically modified, photoautotrophic host cell wherein the alcohol dehydrogenase enzyme is a Zn2+-dependent dehydrogenase. In a preferred embodiment thereof, the invention provides a genetically modified, photoautotrophic host cell wherein the alcohol dehydrogenase enzyme is AdhI or AdhII from Zymomonas mobilis or ADH from Synechocystis.

Certain embodiments of the invention provide a genetically modified, photoautotrophic host cell comprising a pyruvate decarboxylase enzyme converting pyruvate to acetaldehyde, and an alcohol dehydrogenase enzyme converting the acetaldehyde to ethanol. An embodiment thereof provides a genetically modified, photoautotrophic host cell wherein the pyruvate decarboxylase enzyme is from Zymomonas mobilis or Zymobacter palmae.

Other embodiments of the invention provide a genetically modified, photoautotrophic host cell comprising a gene encoding the at least one overexpressed enzyme for the formation of ethanol which is integrated into the host cell genome. In an embodiment thereof, the genetically modified, photoautotrophic host cell further comprises a host gene encoding the at least one endogenous host cell enzyme converting pyruvate, acetaldehyde or acetyl-CoA or forming reserve compounds, wherein a gene encoding the at least one overexpressed enzyme for the formation of ethanol is integrated into said host gene thereby disrupting the host gene.

Various embodiments of the invention provide a genetically modified, photoautotrophic host cell wherein the gene encoding the at least one overexpressed enzyme for the formation of ethanol is under the transcriptional control of a promoter endogenous to the host cell.

Various embodiments of the invention provide a genetically modified, photoautotrophic host wherein the gene encoding the at least one overexpressed enzyme for the formation of ethanol is under the transcriptional control of a heterologous promoter.

Various embodiments of the invention provide a genetically modified, photoautotrophic host cell wherein the gene encoding the at least one overexpressed enzyme for the formation of ethanol is under the transcriptional control of an inducible promoter. In embodiments thereof, the inducible promoter is induced under conditions of nutrient starvation, by stationary growth phase, by heat shock, by cold shock, by oxidative stress, by salt stress, by light or by darkness. In a further embodiment thereof, the inducible promoters are selected from a group consisting of ntcA, nblA, isiA, petJ, petE, ggpS, psbA2, psaA, sigB, lrtA, htpG, nirA, hspA, clpB1, hliB, and crhC. Other embodiments of the invention provide a genetically modified, photoautotrophic host cell wherein the gene encoding the at least one overexpressed enzyme for the formation of ethanol is under the transcriptional control of a constitutive promoter, such as the rbcLS promoter.

In a second aspect, the invention provides a genetically modified, photoautotrophic ethanol producing host cell comprising at least one first genetic modification changing the enzymatic activity or affinity of an endogenous host cell enzyme, the first genetic modification resulting in a level of biosynthesis of a first metabolic intermediate for energy production or metabolism of the host cell that is enhanced compared to level of biosynthesis in the respective wild type host cell, and at least one second genetic modification different from the first genetic modification comprising an overexpressed first enzyme for the formation of ethanol from the first metabolic intermediate.

An embodiment thereof provides a genetically modified host, photoautotrophic cell further comprising at least one overexpressed second enzyme, converting the first metabolic intermediate into a second metabolic intermediate, wherein the at least one overexpressed first enzyme converts the second metabolic intermediate into ethanol.

Other embodiments of the second aspect provide a genetically modified, photoautotrophic host cell wherein the endogenous host cell enzyme is for conversion of the first metabolic intermediate and wherein the activity of said host cell enzyme is reduced compared to the respective wild type host cell. Certain other embodiments herein provide a genetically modified, photoautotrophic host cell wherein the endogenous host cell enzyme is for the formation of the first metabolic intermediate and wherein the activity of said host enzyme is enhanced compared to the respective wild type host cell.

Another embodiment of the second aspect relates to a genetically modified, photoautotrophic host cell wherein the first metabolic intermediate comprises acetyl-CoA and the at least one overexpressed first enzyme for ethanol formation comprises alcohol dehydrogenase AdhE converting acetyl-CoA into ethanol.

Another embodiment of the second aspect relates to a genetically modified, photoautotrophic host cell wherein the first metabolic intermediate comprises pyruvate. the second metabolic intermediate comprises acetaldehyde, and the at least one overexpressed second enzyme for ethanol formation comprises pyruvate decarboxylase, converting pyruvate into acetaldehyde, and the at least one overexpressed first enzyme for ethanol formation comprises alcohol dehydrogenase Adh, converting acetaldehyde into ethanol. In another embodiment thereof, the invention provides a genetically modified, photoautotrophic host cell wherein the host gene encoding the at least one host cell enzyme is disrupted by a heterologous nucleic acid sequence. In a further embodiment thereof, the genetically modified, photoautotrophic host cell further comprises a second gene encoding the at least one host cell enzyme, wherein the second gene is under the transcriptional control of an inducible promoter.

In a third aspect, the invention provides a genetically modified, photoautotrophic, ethanol producing host cell comprising at least one first genetic modification of at least one endogenous host cell enzyme that is not pyruvate decarboxylase or alcohol dehydrogenase, wherein the first genetic modification results in an enhanced level of biosynthesis of acetaldehyde, pyruvate, acetyl-CoA or precursors thereof compared to the respective wild type host cell, and at least one second genetic modification comprising at least one overexpressed enzyme for the formation of ethanol.

In a fourth aspect, the invention provides a construct for the transformation of a host cell by disrupting a host gene encoding a host cell enzyme for conversion of a first metabolic intermediate for energy production or metabolism of the host cell or for formation of reserve compounds comprising a heterologous nucleic acid sequence comprising a promoter and a biocide resistance conferring gene under the transcriptional control of the promoter, wherein the heterologous nucleic acid sequence is flanked at its 5′ and 3′ end by nucleic acid sequences that bind said host gene.

In a fifth aspect, the invention provides a construct for the transformation of a host cell by disrupting a host gene encoding a host cell enzyme for conversion of a first metabolic intermediate for energy production or metabolism of the host cell or for formation of reserve compounds comprising a coding nucleic acid sequence comprising a promoter and a first gene encoding at least one overexpressed first enzyme for the formation of ethanol from the first metabolic intermediate under the transcriptional control of the promoter, wherein the coding nucleic acid sequence is flanked at its 5′ and 3′ end by nucleic acid sequences that bind to said host gene.

In an embodiment of the fifth aspect, the construct comprises a coding nucleic acid sequence further comprising a second gene encoding at least one overexpressed second enzyme converting the first metabolic intermediate into a second metabolic intermediate, wherein the at least one overexpressed first enzyme converts the second metabolic intermediate into ethanol. In an embodiment thereof, the first metabolic intermediate comprises pyruvate, and the second metabolic intermediate comprises acetaldehyde, the second gene encodes pyruvate decarboxylase enzyme, converting pyruvate into acetaldehyde, and the first gene encodes alcohol dehydrogenase enzyme, converting acetaldehyde into ethanol.

An embodiment of the fourth aspect provides a construct wherein the first metabolic intermediate comprises acetyl-CoA and the first gene encodes alcohol dehydrogenase AdhE, converting acetyl-CoA into ethanol.

In a sixth aspect, the invention provides a construct for the transformation of a host cell by disrupting a host gene encoding a host cell enzyme for conversion of a first metabolic intermediate for energy production or metabolism of the host cell or for formation of reserve compounds comprising a coding nucleic acid sequence comprising an inducible promoter and a gene encoding said host cell enzyme under the transcriptional control of the inducible promoter, wherein the coding nucleic acid sequence is flanked at its 5′ and 3′ end by nucleic acid sequences that bind to said host gene.

Various embodiments of the fourth, fifth and sixth aspect provide a construct wherein the 5′ and 3′ flanking nucleic acid sequences are at least 60% identical to at least a part of the host gene. In an embodiment thereof, the 5′ and 3′ flanking nucleic acid sequences are identical to the host gene, thereby enabling the insertion of the coding nucleic acid sequence into the host gene by homologous recombination.

In other embodiments of the fourth, fifth and sixth aspect, the invention provides a construct wherein said host gene encodes glycogen synthase. In further embodiments thereof, the construct comprises a recombinant plasmid.

In a seventh aspect, the invention provides a method for producing the genetically modified, photoautotrophic host cells according to the first, second, third, fourth, fifth and sixth aspect. The method comprises (A) providing a wild type host cell showing a wildtype level of biosynthesis of a first metabolic intermediate for energy production of the host cell, (B) introducing at least one first genetic modification into the wild type host cell enhancing the level of biosynthesis of the first metabolic intermediate in comparison to the respective wild type host cell, and (C) introducing at least one second genetic modification into the wild type host cell resulting in at least one overexpressed first enzyme for the formation of ethanol from the first metabolic intermediate.

In an embodiment thereof, the method comprises that in step (C) a further second genetic modification is introduced into the host cell resulting in at least one overexpressed second enzyme for the formation of ethanol, the at least one overexpressed second enzyme converting the first metabolic intermediate into a second metabolic intermediate, wherein the at least one overexpressed first enzyme converts the second metabolic intermediate into ethanol. In an embodiment thereof, the first metabolic intermediate comprises pyruvate, and the second metabolic intermediate comprises acetaldehyde, and the overexpressed second enzyme comprises pyruvate decarboxylase enzyme, converting pyruvate into acetaldehyde, and the overexpressed first enzyme comprises alcohol dehydrogenase enzyme Adh, converting acetaldehyde into ethanol.

The invention also provides an embodiment of the seventh aspect wherein the first metabolic intermediate comprises acetyl-CoA, and the overexpressed first enzyme comprises alcohol dehydrogenase enzyme AdhE converting acetyl-CoA into ethanol.

Various embodiments of the seventh aspect provide a method wherein in step (A) a wild type host cell is provided, which further comprises a first host gene encoding at least one first host cell enzyme for conversion of the first metabolic intermediate or for forming reserve compounds, the first host cell gene is under the transcriptional control of a first host promoter, and in step (B) the activity or the affinity of the at least one first host enzyme is reduced. In an embodiment thereof, the method comprises that in step (B) the activity of the at least one host enzyme is reduced by mutating either the first host promoter or the first host gene or by disrupting the first host gene by introducing a heterologous nucleic acid sequence into the first host gene.

Other embodiments of the seventh aspect related to a method wherein in step (A) a wild type host cell is provided, which further comprises a second host gene encoding at least one second host cell enzyme for formation of the first metabolic intermediate or precursors thereof, the second host gene is under the transcriptional control of a second host promoter, and in step (B) the activity or affinity of the at least one second host enzyme is enhanced. In an embodiment thereof, the method provides that in step (B) the activity of the at least one second host enzyme is enhanced by mutating either the second host promoter or the second host gene or by overexpressing the second host enzyme.

A further embodiment of the seventh aspect provides a method wherein the first metabolic intermediate comprises pyruvate, acetyl-CoA or acetaldehyde.

Invention 2

It has been discovered that there are advantages to producing ethanol from genetically modified, photoautotrophic cells having a Zn2+ dependent alcohol dehydrogenase enzyme. This discovery has been exploited to provide the following invention, which includes compositions of matter directed to these advantageous, genetically modified, photoautotrophic ethanol producing host cells, nucleic acid constructs and methods of making the same.

In an eighth aspect, the invention provides genetically modified photoautotrophic, ethanol producing host cell comprising an overexpressed pyruvate decarboxylase enzyme converting pyruvate to acetaldehyde and an overexpressed Zn2+ dependent alcohol dehydrogenase enzyme converting acetaldehyde to ethanol.

In an embodiment thereof, the Zn2+ dependent alcohol dehydrogenase enzyme comprises AdhI from Zymomonas mobilis.

In another embodiment thereof, the Zn2+ dependent alcohol dehydrogenase enzyme comprises Synechocystis Adh.

In a ninth aspect, the invention provides a construct for the transformation of a photoautotrophic host cell, the construct comprising a heterologous nucleic acid sequence comprising a first gene encoding a Zn2+ dependent alcohol dehydrogenase, wherein the heterologous nucleic acid sequence is flanked at its 5′ and 3′ end by nucleic acid sequences that bind to said host genome for integration of the heterologous nucleic acid sequence into the host genome.

In an embodiment thereof, the construct further comprises a heterologous or endogenous promoter controlling the transcription of the first gene.

In a tenth aspect, the invention provides a construct for the transformation of a photoautotrophic host cell comprising a heterologous nucleic acid sequence comprising a heterologous promoter and a first gene encoding a Zn2+ dependent alcohol dehydrogenase enzyme, wherein the first gene is under the transcriptional control of the heterologous promoter.

Various embodiments of the ninth and tenth aspect related to a construct further comprising a second gene encoding pyruvate decarboxylase enzyme.

Other variant embodiments of the constructs of the ninth and tenth aspect are directed to constructs that are a recombinant circular plasmid.

Invention 3

It has been discovered that there are advantages to producing ethanol from genetically modified, photoautotrophic cells having a alcohol dehydrogenase enzyme that converts acetyl-CoA directly to ethanol. This discovery has been exploited to provide the following invention, which includes compositions of matter directed to these advantageous, genetically modified, photoautotrophic ethanol producing host cells, nucleic acid constructs and methods of making the same.

In an eleventh aspect, the invention provides a genetically modified, photoautotrophic ethanol producing host cell comprising an overexpressed alcohol dehydrogenase enzyme directly converting acetyl-CoA to ethanol.

In an embodiment thereof, the alcohol dehydrogenase comprises AdhE. In a further embodiment thereof, the alcohol dehydrogenase enzyme is a thermophilic alcohol dehydrogenase. In another embodiment the AdhE-type alcohol dehydrogenase is from E. coli.

In a twelfth aspect, the invention provides a construct for the transformation of a photoautotrophic host cell comprising a heterologous nucleic acid sequence comprising a gene encoding an alcohol dehydrogenase, directly converting acetyl-CoA to ethanol, wherein the heterologous nucleic acid sequence is flanked at its 5′ and 3′ ends by nucleic acid sequences, that bind to said host genome for integration of the heterologous nucleic acid sequence into the host genome. In an embodiment thereof, the construct further comprises a heterologous promoter controlling the transcription of the gene.

In a thirteenth aspect, the invention provides a construct for the transformation of a photoautotrophic host cell comprising a heterologous nucleic acid sequence comprising a heterologous promoter and a gene encoding an alcohol dehydrogenase, directly converting acetyl-CoA to ethanol, wherein the gene is under the transcriptional control of the heterologous promoter.

Invention 4

It has been discovered that there are advantages to producing ethanol from genetically modified, photoautotrophic cells comprising an enhanced level of enzyme cofactor biosynthesis. This discovery has been exploited to provide the following invention, which includes compositions of matter directed to these advantageous, genetically modified, photoautotrophic ethanol producing host cells.

In a fourteenth aspect, the invention provides a genetically modified photoautotrophic, ethanol producing host cell comprising an overexpressed NAD+/NADH-cofactor specific alcohol dehydrogenase enzyme, wherein the host cell comprises an enhanced level of NAD+/NADH biosynthesis compared to the respective wild type host cell.

In an embodiment thereof, the genetically modified, photoautotrophic host cell comprises a host NADH dehydrogenase enzyme converting NADH to NAD+, wherein the activity of the NADH dehydrogenase enzyme is reduced compared to the wild type host cell.

In a further embodiment, the genetically modified, photoautotrophic host cell comprises a NAD(P)+ transhydrogenase converting NADPH to NADH, wherein this NAD(P)+ transhydrogenase is overexpressed.

Invention 5

It has been discovered that there are advantages to producing ethanol from genetically modified, photoautotrophic cells comprising the overexpression of enzyme(s) for ethanol production. This discovery has been exploited to provide the following invention, which includes compositions of matter directed to these advantageous, genetically modified, photoautotrophic ethanol producing host cells.

In a fifteenth aspect, the invention provides a genetically modified photoautotrophic, ethanol producing host cell comprising a coding nucleic acid sequence comprising a promoter and a gene encoding at least one overexpressed enzyme for the formation of ethanol under the transcriptional control of the promoter, wherein the promoter can be induced by nutrient starvation, oxidative stress, darkness, light, heat shock, salt stress, cold shock or stationary growth of the host cell.

In an embodiment thereof, the inducible promoter is selected from a group of promoters consisting of ntcA, nblA, isiA, petJ, petE, sigB, lrtA, htpG, hspA, clpB1, hliB, ggpS, psbA2, psaA, nirA and crhC.

In a sixteenth aspect, the invention provides a construct for the transformation of a photoautotrophic host cell, comprising a coding nucleic acid sequence comprising a promoter, which can be induced by nutrient starvation of the host cell, and a gene encoding at least one overexpressed enzyme for the formation of ethanol under the transcriptional control of the promoter.

In an embodiment thereof, the coding nucleic acid sequence is flanked at its 5′ and 3′ ends by nucleic acid sequences, that bind to said host genome for integration of the coding sequence into the host genome.

Invention 6

It has been discovered that photoautotrophic cell(s) can be selected for certain advantageous growth properties. The invention provides methods for selecting and identifying these cells having wide ranging advantageous properties.

In a seventeenth aspect, the invention provides a method for testing a photoautotrophic strain for a desired growth property selected from a group of properties consisting of ethanol tolerance, salt tolerance, above neutral pH tolerance, mechanical stress tolerance, temperature tolerance and light tolerance. The steps of this method comprise (a) providing a photoautotrophic strain to be tested, (b) cultivating the photoautotrophic strain to be tested in a liquid growth medium and subjecting the photoautotrophic strain to a condition selected from a group of conditions consisting of (i) adding ethanol to the growth medium, (ii) adding salt to the growth medium, (iii) increasing the pH of the growth medium, (iv) agitating the growing culture, (v) increasing the temperature of the growing culture, (vi) subjecting the photoautotrophic strain to high light, and (c) determining the viability of the cells of the photoautotrophic strain cultivated in step (b).

In an embodiment thereof, determining the viability comprises determining at least one parameter selected from a group of parameters consisting of growth rate of the photoautotrophic strain, ratio of living to dead cells, ability to be recultivable in a liquid growth medium in the absence of the respective conditions (i) to (vi), and microscopic analysis of the photoautotrophic strain. In an embodiment thereof, the ratio of living to dead cells is determined by detecting the presence of a photopigment in the cells of the photoautotrophic strain. In a further embodiment thereof, the presence of a photopigment is detected by measuring the fluorescence of the photopigment.

In various embodiments of the seventeenth aspect, the growth rate of the photoautotrophic strain is determined by measuring the optical density of the cultivated cells.

In various embodiments of the seventeenth aspect, the steps (b) and (c) are repeated alternatively and wherein in a subsequent step (b2) the conditions are changed in comparison to the foregoing step (b1) by at least one of increasing the amount of ethanol in the growth medium, increasing the amount of salt in the growth medium, increasing the pH in the growth medium, increasing the rate of agitation during cultivation, and increasing the temperature during cultivation. In an embodiment thereof the amount of ethanol in the growth medium is increased stepwise. In a further embodiment thereof the amount of ethanol in continuously increased during step (b). Another embodiment thereof provides for that during method step (b) adding the ethanol to the growth medium with a flow rate, and the flow rate is increased between successive steps (b) until a maximum flow rate is reached and then the flow rate is reduced between successive steps (b).

Various embodiments of the seventeenth aspect comprise method step (b) comprising the sub steps (b1) and (b2) and method step (c) comprises the sub steps (c1) and (c2) and a plurality of different photoautotrophic strains to be tested are first subjected to a first condition including adding a first amount of ethanol to the growth medium and cultivating the different photoautotrophic strains for a first period of time during method step (b1) and identifying the photoautotrophic strains found to be tolerant to the first condition in method step (c1) are thereafter subjecting the photoautotrophic strains identified in method step (c1) to a second amount of ethanol for a second period of time in a subsequent step (b2), and identifying the photoautotrophic strains tolerant to the second condition in a method step (c2) the first amount of ethanol being higher than the second amount of ethanol, and the first period of time being smaller than the second period of time.

In various embodiments of the seventeenth aspect during method step (b) salt is added to the growth medium by adding a salty growth medium. In an embodiment thereof a salty medium is added selected from a group consisting of brackish water, salt water, artificial sea water.

In various embodiments of the seventeenth aspect the photoautotrophic strain is cultivated in a growth medium with a pH of above 9, preferably above 10 to 12.

In various embodiments of the seventeenth aspect during method step (b) the growth medium is stirred during the cultivation.

In various embodiments of the seventeenth aspect during method step (b) the photoautotrophic strain is cultivated in a growth medium at temperatures of at least 42° C.

In various embodiments of the seventeenth aspect during method step (b) the photoautotrophic strain is subjected to a first light intensity in the lag- and exponential growth phase and a first CO2 concentration, and after having reached stationary phase the light intensity is increased to a second light intensity and the CO2 concentration is increased to a second CO2 concentration.

In various embodiments of the seventeenth aspect for identifying toxin producing photoautotrophic strains the method further comprises the method step of determining the presence and amount of toxins produced by the photoautotrophic strain.

In various embodiments of the seventeenth aspect for identifying genetically transformable photoautotrophic strains the method further comprises the method step of subjecting the photoautotrophic strain to a transforming factor, conferring a marker property, and detecting the presence of the marker property in the strain.

In various embodiments of the seventeenth aspect the method further comprises the further method step of determining the photosynthetic activity of the photoautotrophic strain to be tested.

In various embodiments of the seventeenth aspect for identifying a photoautotrophic strain with a tolerance for at least a first and a second growth condition selected from the growth conditions (i) to (vi) from a plurality of different photoautotrophic strains the method comprises culturing the plurality of different photoautotrophic strains under a first growth condition in method step (b1), identifying the photoautotrophic strains tolerant to the first growth condition in method step (c1) and thereafter culturing the photoautotrophic strains identified in method step (c1) under a second growth condition in a further step (b2), the second growth condition being different from the first growth condition, identifying the photoautotrophic strains tolerant to the second growth condition in method step (c2). In an embodiment thereof the method further comprises identifying additionally at least one desired property, selected from a group consisting of high photosynthetic activity, lack of ability to produce toxins and ability to be genetically transformable, from the plurality of different photoautotrophic strains, wherein the method comprises at least one further method step (d) selected from a group of method steps consisting of (vii) determining the photosynthetic activity of the photoautotrophic strain, (viii) subjecting the photoautotrophic strain to a transforming factor, conferring a marker property, and detecting the presence of the marker property in the strain, and (ix) determining the presence and amount of toxins produced by the photoautotrophic strain, and identifying the photoautotrophic strain having any of the abilities (vii) to (ix) in a further method step (e), wherein the methods steps (d) and (e) can be performed before or after the method steps (b1) and (c1) or (b2) and (c2).

In various embodiments of the seventeenth aspect the photoautotrophic strains to be tested are from a collection of different photoautotrophic strains. In an embodiment thereof the photoautotrophic strains are obtained from a publicly available strain database.

In various embodiments of the seventeenth aspect the photoautotrophic strains to be tested are preselected from a group of strains known to be fast growing, dominant strains with high photosynthetic activity, known to be able to produce mass populations in nature. In an embodiment thereof the photoautotrophic strains to be tested are Cyanobacteria or algae selected from Synechocystis, Synechococcus, Spirulina, Arthrospira, Nostoc, Anabaena, Trichodesmium, Leptolyngbya, Plectonema, Myxosarcina, Pleurocapsa, Oscillatoria, Phormidium, Pseudanabaena.

Common Claims

In an eighteenth aspect, the inventions provided herein relating to a genetically modified, photoautotrophic ethanol producing host cell further comprise the cell to be tolerant to at least one growth condition selected from a group consisting of ethanol tolerance, salt tolerance, above neutral pH tolerance, mechanical stress tolerance, temperature tolerance and light tolerance, and additionally having at least one desired property, selected from a group consisting of high photosynthetic activity, lack of ability to produce toxins and ability to be genetically transformable, wherein the host cell is identified by a method according to the seventeenth aspect.

In an nineteenth aspect, the aspects of the disclosure provided herewith relating to a genetically modified, photoautotrophic ethanol producing host cell further comprise a host cell that is an aquatic organism. In an embodiment thereof, the host cell is selected from a group consisting of algae, protists, and bacteria. In a further embodiment thereof the host cell is a cyanobacterium. In a further embodiment thereof the cyanobacterium is selected from a group consisting of Synechococcus, Synechocystis, and Phormidium.

In an twentieth aspect, a method of producing ethanol is provided, the method steps including (A) providing and culturing genetically modified host cells according to any aspect of the disclosure provided herein in a growth medium under the exposure of light and CO2, the host cell(s) accumulating ethanol while being cultured, and (B) isolating the ethanol from the host cell(s) and/or the growth medium. In an embodiment thereof in method step (A) host cells are provided, which comprise a genetically modified gene encoding at least one enzyme for the formation of ethanol under the transcriptional control of an inducible promoter, which can be induced by exposure to an exogenous stimulus, the method step (A) further comprising (A1) culturing the host cells under the absence of the exogenous stimulus, and thereafter (A2) providing the exogenous stimulus, thereby inducing ethanol production. In a further embodiment thereof the exogenic stimulus can be provided by changing the environmental conditions of the host cells. In an even further embodiment thereof the exogenous stimulus can be provided by subjecting the host cells to a stimulus selected from a group consisting of darkness, nutrient starvation, oxidative stress, salt stress, heat shock, cold shock, stationary growth and light. In an embodiment thereof the exogenous stimulus comprises nutrient starvation, and no new growth medium is added to the host cell culture in method step (A), the host cell culture thereby growing into nutrient starvation when reaching stationary growth phase.

A further embodiment of the twentieth aspect comprises in method step (A) host cells are provided, which comprise a genetically modified gene encoding at least one enzyme for the formation of ethanol under the transcriptional control of a constitutive promoter, the method step (A) comprising culturing the host cells and producing ethanol.

In further embodiment of the twentieth aspect method step (A) further comprises the method step of: (A3) adding a substrate to the growth medium, the substrate used by the at least one overexpressed enzyme for ethanol production to produce ethanol. In an embodiment thereof the substrate is acetaldehyde.

In further embodiment of the twentieth aspect the method further comprising the additional method step (C) using the host cells after having isolated the ethanol in method step (B) as a substrate for a heterotrophic organism. In an embodiment thereof a heterotrophic fermentative organism is used to produce ethanol.

In further embodiment of the twentieth aspect during method step (A) the genetically modified host cells produces a first metabolic intermediate and at least partially secrete the first metabolic intermediate into the growth medium, and during method step (A) a microorganism is added to the growth medium, the microorganism converting the first metabolic intermediate into ethanol.

In a twenty-first aspect an isolated nucleic acid molecule suitable to effect a change in gene expression of a target genome in a photoautotrophic cell is provided, the isolated nucleic acid comprising (a) a first polynucleotide sequence comprising a promoter sequence operationally linked to a coding sequence, wherein the coding sequence alters metabolism of the cell having the target genome, (b) a second polynucleotide sequence, wherein the second polynucleotide sequence is homologous to the target genome and is located 5′ to the first polynucleotide sequence; and (c) a third polynucleotide sequence, wherein the third polynucleotide sequence is homologous to the target genome and is located 3′ to the first polynucleotide sequence, and wherein the second and third polynucleotide sequence are each at least about 500 bases and up to 1.5 to 2 kilobases in length, the sequence of which is obtained from a single gene selected from the group consisting of ADP-glucose-pyrophosphorylase, glycogen synthase, alanine dehydrogenase, lactate dehydrogenase, pyruvate water dikinase, phosphotransacetylase, pyruvate dehydrogenase and acetate kinase, and wherein the second and third polynucleotide sequence facilitate homologous recombination into the target genome of the photoautotrophic cell.

A twenty-second aspect is directed to method of producing the genetically modified, photoautotrophic ethanol producing host cell of aspects 1, 2 or 3 described herein, the steps of the method comprising (a) providing a wild type host cell; (b) measuring the level of biosynthesis of acetaldehyde, pyruvate, acetyl-CoA or precursors thereof; (c) introducing at least one first genetic modification into the wild type cell changing the enzymatic activity or affinity of at least one endogenous host cell enzyme; (d) introducing at least one second genetic modification, different from the first genetic modification, comprising at least one overexpressed enzyme for the formation of ethanol; and (e) measuring and identifying an enhanced level of biosynthesis of acetaldehyde, pyruvate, acetyl-CoA or precursors thereof compared to the respective wild type host cell. An embodiment thereof wherein step (e) identifies an enhanced level of biosynthesis for pyruvate or acetyl-CoA. In an embodiment thereof an enhanced level of biosynthesis of pyruvate is identified. An embodiment thereof wherein an enhanced level of biosynthesis of acetyl-CoA is identified.

In a further embodiment of the twenty-second aspect the second genetic modification of step (d) comprises an overexpressed pyruvate decarboxylase enzyme and an overexpressed alcohol dehydrogenase enzyme. Another embodiment thereof comprises in step (d) the at least one overexpressed enzyme for the formation of ethanol is alcohol dehydrogenase E.

An embodiment of the twenty-second aspect wherein the first genetic modification of step (c) comprises the overexpression of at least one endogenous host cell enzyme.

An embodiment of the twenty-second aspect wherein the first genetic modification of step (c) comprises two genetic alterations, the first genetic alteration comprising an insertion into or deletion of an endogenous host cell enzyme and the second genetic alteration comprising the introduction of a metabolic enzyme gene sequence that is overexpressed.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1, comprising 1A, 1B, 1C, 1D, 1E, and 1F illustrates some relevant metabolic pathways

FIG. 2 illustrates possible pathways leading to ethanol production.

FIG. 3 illustrates possible pathways leading to ethanol production

FIG. 4a presents the amino acid sequence of a glycogen synthase gene of Synechocystis sp. PCC 6803 that is encoded by the gene sll0945 (glgA1). (SEQ ID NO:1)

FIG. 4B presents the amino acid sequence of a second glycogen synthase of Synechocystis sp. PCC 6803 that is encoded by the gene sll1393 (glgA2). (SEQ ID NO:2)

FIG. 4C presents a schematic representation of restriction sites used in the cloning strategy for pUC19-glgA1-Cm.

FIG. 4D is a schematic representation of gene organization for the plasmid pUC19-glgA1-Cm.

FIG. 4E presents the nucleotide sequence of the construct pUC19-glgA1-Cm. (SEQ ID NO:3)

FIG. 4F presents a schematic representation of restriction sites used in the cloning strategy for pUC19-glgA2-Kan.

FIG. 4G is a schematic representation of gene organization for the plasmid pUC19-glgA2-Kan.

FIG. 4H presents the nucleotide sequence of the construct pUC19-glgA2-Kan. (SEQ ID NO:4)

FIG. 5A presents the amino acid sequence of the open reading frame sll1682, which encodes alanine dehydrogenase (EC 1.4.1.1) (Genbank No BAA16790) of Synechocystis sp. strain PCC6803. (SEQ ID NO:5)

FIG. 5B presents a schematic representation of gene organization for the plasmid pGEM-T/ald-KManti.

FIG. 5C presents the nucleotide sequence of the insert of construct pGEM-T/ald-KManti. (SEQ ID NO:6)

FIG. 6A presents the amino acid sequence of the open reading frame slr1176, which encodes ADP-glucose pyrophosphorylase (EC 2.7.7.27) (Genbank No BAA18822) of Synechocystis sp. strain PCC6803. (SEQ ID NO:7)

FIG. 6B presents a schematic representation of gene organization for the plasmid pGEM-T/glgC-KManti.

FIG. 6C presents the nucleotide sequence of the insert of construct pGEM-T/glgC-KManti. (SEQ ID NO:8)

FIG. 6D presents a schematic representation of gene organization for the plasmid pDrive/glgC-CMantisense.

FIG. 6E presents the nucleotide sequence of the insert of construct pDrive/glgC-CMantisense. (SEQ ID NO:9)

FIG. 7A presents the amino acid sequence of the open reading frame slr0301 that encodes pyruvate water dikinase/PEP synthase (EC 2.7.9.2) (Genbank No BAA10668) of Synechocystis sp. strain PCC6803. (SEQ ID NO:10)

FIG. 7B presents a schematic of gene organization for the plasmid pGEM-T/ppsA-anti.

FIG. 7C presents the nucleotide sequence of the insert of construct pGEM-T/ppsA-anti. (SEQ ID NO:11)

FIG. 8A presents the amino acid sequence of open reading frame slr 1556 that encodes a putative lactate dehydrogense (EC 1.1.1.28), (annotated as 2-hydroxyaciddehydrogenase homolog) (GenBank No. P74586) of Synechocystis sp. strain PCC6803. (SEQ ID NO:12)

FIG. 8B presents a schematic representation of restriction sites used in the cloning strategy for pBlue ldh-Kan-a.

FIG. 8C presents a schematic for the gene organization of the plasmid pBlue ldh-Kan-a.

FIG. 8D presents the nucleotide sequence of the insert contained in the construct pBlue ldh-Kan-a. (SEQ ID NO:13)

FIG. 9A presents the amino acid sequence of the open reading frame sll 1299 that encodes a putative acetate kinase (EC 2.7.2.1) (Genbank No. P73162). (SEQ ID NO:14)

FIG. 9B presents a schematic representation of restriction sites used in the cloning strategy for pBlue-ack-Kan-b.

FIG. 9C presents a schematic for the gene organization of the plasmid pBlue-ack-Kan-b.

FIG. 9D presents the nucleotide sequence of the insert of construct pBlue-ack-Kan-b. (SEQ ID NO:15)

FIG. 10A presents the amino acid sequence of the open reading frame sir2132 that encodes a phosphoacetyltransacetylase (EC 2.3.1.8) (Genbank No. P73662) of Synechocystis sp. strain PCC6803. (SEQ ID NO:16)

FIG. 10B presents a schematic representation of restriction sites used in the cloning strategy for pUC pta-Cm.

FIG. 10C presents a schematic for the gene organization of the plasmid pUC pta-Cm.

FIG. 10D presents the nucleotide sequence of the insert of construct pUC pta-Cm. (SEQ ID NO:17)

FIG. 11A presents the amino acid sequence of open reading frame slr1830 that encodes poly(3-hydroxyalkanoate) synthase [EC:2.3.1.] (Genbank No BAA17430) of Synechocystis sp. strain PCC6803. (SEQ ID NO:18)

FIG. 11B presents a schematic representation of gene structure for the plasmid as pIC20H/AphaC-KM.

FIG. 11C presents the nucleotide sequence of the insert of construct as pIC20H/AphaC-KM. (SEQ ID NO:19)

FIG. 11D presents the amino acid sequence of ORF a114645 for PCC 7120 (SEQ ID NO:20).

FIG. 11E presents a schematic representation of restriction sites and gene organization for the PCC 7120 glgC knockout.

FIG. 11F presents the sequence of the insert of pRL271 agp (a114645)::C.K3-PpetE-pdc-adhll (SEQ ID NO:21).

FIG. 11G presents the amino acid sequence of Glucose-1-phosphate adenylyltransferase (ADP-glucose-pyrophosphorylase, agp, glgC), EC 2.7.7.27, of Anabaena variabilis ATCC29314. (SEQ ID NO:22)

FIG. 12A presents the amino acid sequence of open reading frame sll1721 that encodes the β-subunit of the E1 component of the pyruvate dehydrogenase (EC 1.2.4.1) (Genbank No BAA17445) of Synechocystis sp. strain PCC6803. (SEQ ID NO:23)

FIG. 12B presents a schematic of gene organization for the plasmid pSK9/pdhBanti.

FIG. 12C presents the nucleotide sequence of the insert for pSK9/pdhBanti. (SEQ ID NO:24)

FIG. 12D presents a schematic representation of gene organization for the plasmid pSK9/pdhB.

FIG. 12E presents the nucleotide sequence of the insert for the construct pSK9/pdhB. (SEQ ID NO:25)

FIG. 12F presents a schematic of gene organization for the plasmid pGEM-T/ApdhB-KMantisense.

FIG. 12G presents the nucleotide sequence of the insert of construct pGEM-T/ApdhB-KMantisense. (SEQ ID NO:26)

FIG. 13A presents a schematic representation of the cloning vector pGEM-T.

FIG. 13B presents the nucleotide sequence of vector pGEM-T. (SEQ ID NO:27)

FIG. 14A presents a schematic representation of the cloning vector pDrive.

FIG. 14B presents the nucleotide sequence of vector pDrive. (SEQ ID NO:28)

FIG. 15A presents a schematic representation of the cloning vector pBluescript II SK (+).

FIG. 15B presents the nucleotide sequence of the vector pBluescript II SK (+).(SEQ ID NO:29)

FIG. 16A presents a schematic representation of the cloning vector pUC19.

FIG. 16B presents the nucleotide sequence of the vector pUC 19. (SEQ ID NO:30)

FIG. 17A presents a schematic representation of genes organized in the vector pSK9.

FIG. 17B presents the nucleotide sequence of the vector pSK9. (SEQ ID NO:31)

FIG. 18A presents the amino acid sequence of open reading frame slr0721 that encodes malic enzyme 1 (EC 1.1.1.38) (Genbank No P72661) of Synechocystis sp. strain PCC6803. (SEQ ID NO:32)

FIG. 18B presents a schematic of genes organized in the construct of Synechocystis sp. strain PCC6803.

FIG. 18C presents the nucleotide sequence of the insert of construct pSK9/me-long. (SEQ ID NO:33)

FIG. 19A presents the amino acid sequence of open reading frame sll0891 that encodes malate dehydrogenase (EC 1.1.1.37) (Genbank No Q55383) of Synechocystis sp. strain PCC6803. (SEQ ID NO:34)

FIG. 19B presents a schematic representation of gene organization for the construct pSK9-mdh.

FIG. 19C presents the nucleotide sequence of the insert of construct pSK9-mdh. (SEQ ID NO:35)

FIG. 19D presents a schematic representation of gene organization for the construct pSK9/me-mdh.

FIG. 19E presents the nucleotide sequence of the insert of construct pSK9/me-mdh. (SEQ ID NO:36)

FIG. 20A presents the amino acid sequence of open reading frame sll0587 that encodes a pyruvate kinase 1 (EC 2.7.1.40 (PK1)) (Genbank No Q55863) of Synechocystis sp. strain PCC6803. (SEQ ID NO:37)

FIG. 20B presents a schematic representation of gene organization for the construct pVZ321-pyk1.

FIG. 20C presents the nucleotide sequence of the insert of construct pVZ321-pyk1. (SEQ ID NO:38)

FIG. 20D presents a schematic representation of gene organization for the construct pVZ321 PpetJ pyk1.

FIG. 20E presents the nucleotide sequence of the insert found in construct pVZ321 PpetJ pyk1. (SEQ ID NO:39)

FIG. 21A presents the amino acid sequence of open reading frame sll1275 that encodes pyruvate kinase 2 (EC 2.7.1.40 (PK2)) (Genbank No P73534) of Synechocystis sp. strain PCC6803. (SEQ ID NO:40)

FIG. 21B presents a schematic representation of gene organization for the construct pVZ321pyk2.

FIG. 21C presents the nucleotide sequence of the insert of pVZ321pyk2. (SEQ ID NO:41)

FIG. 21D presents a schematic representation of gene organization for the construct. pVZ321 PpetJ pyk2.

FIG. 21E presents the nucleotide sequence for the insert of the construct pVZ321 PpetJ pyk2. (SEQ ID NO:42)

FIG. 22A presents a schematic representation of the gene organization for the p67 insert.

FIG. 22B presents the amino acid sequence of pyruvate kinase I (E. coli K12). (SEQ ID NO:43)

FIG. 22C presents the amino acid sequence of enolase (Zymomonas mobilis). (SEQ ID NO:44)

FIG. 22D presents the amino acid sequence of phosphoglycerate mutase (Zymomonas mobilis). (SEQ ID NO:45)

FIG. 22E presents the nucleotide sequence of the insert of plasmid #67. (SEQ ID NO:46)

FIG. 22F presents a schematic representation of gene organization for the construct pVZ321-p67.

FIG. 22G presents a schematic representation of gene organization for construct pVZ322-p67.

FIG. 23A presents the amino acid sequence of open reading frame slr0752 that encodes the enolase (eno, 2-phosphoglycerate dehydratase) (EC 4.2.1.11) (Genbank No. BAA18749) of Synechocystis sp. strain PCC6803. (SEQ ID NO:47)

FIG. 23B presents a schematic representation of gene organization for construct pVZ321 PpetJ eno.

FIG. 23C presents the nucleotide sequence of the insert of construct pVZ321-PpetJ-eno. (SEQ ID NO:48)

FIG. 24A presents the amino acid sequence of open reading frame slr1124 that encodes the phosphoglycerate mutase (pgm or gpmB) (EC 5.4.2.1) (Genbank No. BAA16651) of Synechocystis sp. strain PCC6803. (SEQ ID NO:49)

FIG. 24B presents a schematic representation of the gene organization of construct pVZ321-PpetJ-pgm.

FIG. 24C presents the nucleotide sequence of the insert of construct pVZ321-PpetJ-pgm. (SEQ ID NO:50)

FIG. 24D presents a schematic representation of gene organization for the construct pVZ322-PpetJ-pyk1-eno-pgm.

FIG. 24E presents a schematic representation of gene organization for the construct pVZ322-PpetJ-pyk2-eno-pgm.

FIG. 24F presents the nucleotide sequence of the insert of construct pVZ322-PpetJ-pyk1-eno-pgm. (SEQ ID NO:51) 24G presents the nucleotide sequence of the insert of construct pVZ322-PpetJ-pyk2-eno-pgm. (SEQ ID NO:52)

FIG. 25A presents the amino acid sequence for open reading frame slr0453 that encodes the probable phosphoketolase (phk), (EC 4.1.2.-) (Genbank No. P74690) of Synechocystis sp. strain PCC6803. (SEQ ID NO:53)

FIG. 25B presents a schematic representation of the gene organization for the construct pVZ322 PpetJ-phk.

FIG. 25C presents the nucleotide sequence of the insert of the construct pVZ322 PpetJ-phk. (SEQ ID NO:54)

FIG. 26A presents the amino acid sequence of open reading frame slr2132 that encodes a phosphoacetyltransacetylase (pta) (EC 2.3.1.8) (Genbank No. P73662) of Synechocystis sp. strain PCC6803. (SEQ ID NO:55)

FIG. 26B presents a schematic representation of gene organization in the construct pVZ322 PpetJ pta.

FIG. 26C presents the nucleotide sequence of the insert of construct pVZ322 PpetJ pta. (SEQ ID NO:56)

FIG. 26D presents a schematic representation of gene organization in construct pVZ322 PpetJ phk pta.

FIG. 26E presents the nucleotide sequence of the insert of construct pVZ322 PpetJ phk pta. (SEQ ID NO:57)

FIG. 27A presents the amino acid sequence of open reading frame slr0091 encodes a aldehyde dehydrogenase (aldh) (EC 1.2.1.3) (Genbank No. BAA10564) of Synechocystis sp. strain PCC6803. (SEQ ID NO:58)

FIG. 27B is a schematic representation of gene organization in construct pVZ 322 PpetJ aldh.

FIG. 27C presents the nucleotide sequence of the insert of construct pVZ 322 PpetJ aldh. (SEQ ID NO:59)

FIG. 28A presents the amino acid sequence of open reading frame sll0920 that encodes phosphoenolpyruvate carboxylase (EC 4.1.1.31) (Genbank No. BAA18393) of Synechocystis sp. strain PCC6803. (SEQ ID NO:60)

FIG. 28B is a schematic representation of gene organization in pVZ321-PpetJ-ppc.

FIG. 28C presents the nucleotide sequence of the insert of construct pVZ321-PpetJ-ppc. (SEQ ID NO:61)

FIG. 28D presents the nucleotide sequence of primer SynRbc-BglII-fw (SEQ ID NO:62).

FIG. 28E presents the nucleotide sequence of primer SynRbc-PstI-rev (SEQ ID NO:63).

FIG. 28F presents the nucleotide sequence of primer SynRbc-SacI-fw (SEQ ID NO:64).

FIG. 28G presents the nucleotide sequence of the rbcLXS operon of Synechocystis PCC 6803 (SEQ ID NO:65).

FIG. 28H presents the amino acid sequence of the rbcL large subunit of Synechocystis PCC 6803 (SEQ ID NO:66).

FIG. 28I presents the amino acid sequence of the rbcX Rubisco chaperonin protein of Synechocystis PCC 6803 (SEQ ID NO:67).

FIG. 28J presents the amino acid sequence of the ribulose bisphosphate carboxylase small subunit (rbcS) of Synechocystis PCC 6803 (SEQ ID NO:68).

FIG. 28K is a schematic presentation of gene organization for plasmid pVZ321b-Prbc-SynRbcLXS.

FIG. 29A is a schematic representation of the structure of the vector pSK9.

FIG. 29B presents the nucleotide sequence of the vector pSK9. (SEQ ID NO:69)

FIG. 30A is a schematic representation of gene organization in construct pVZ321. (GenBank No. AF100176).

FIG. 30B presents the nucleotide sequence of the pVZ321 vector. (SEQ ID NO:70)

FIG. 31A is a schematic representation of gene organization for construct pVZ322.

FIG. 31B presents the nucleotide sequence of the pVZ322 vector (SEQ ID NO:71).

FIG. 32A is a schematic representation of gene organization of construct pIC PpetJ.

FIG. 32B presents the nucleotide sequence of the construct pIC PpetJ. (SEQ ID NO:72)

FIG. 32C is a graphic presentation demonstrating growth properties and extracellular pyruvate levels of the ΔglgA1/ΔglgA2 double mutant (M8) under nitrogen replete and nitrogen starved conditions.

FIG. 32D is a graphic presentation of pyruvate levels in wildtype and mutant (ΔglgA1/ΔglgA2) media/cells as determined enzymatically and by ion chromatography.

FIG. 32E is a graphic presentation of the conductimetric detection of pyruvate in methanol extracts (snapshot) of cultures of wildtype and a glycogen synthase deficient mutant after 24 h under N-deficient conditions.

FIG. 32F is a graphic depiction showing the that the pyruvate concentration in the growth medium is higher for the M8 mutant without Adh and Pdc enzymes than for the M8 mutant including both ethanol forming enzymes under the conditions of nitrogen starvation.

FIG. 32G is a graphic depiction of the ethanol concentration determined in the growth medium for the M8 mutant with the Adh and Pdc enzymes under the conditions of nitrogen starvation and without nitrogen starvation.

FIG. 32H is a graphic depiction of ethanol generation in glycogen deficient Synechocystis pVC mutants with ZmPDC and ZmADHII under the control of the iron-dependent isiA promoter.

FIG. 32I is a graphic presentation of ethanol production in wildtype, ack and ack/pta double mutant cells.

FIG. 32J is a graphic presentation of ethanol production in wildtype, ack and ack/pta double mutant cells when normalized for optical density.

FIG. 32K is a graphic presentation of demonstrating that pVZ321b-Prbc-SynRbcLXS grows as fast as the Synechocystis wild type and shows no phenotypical differences except for the chlorophyll content that is reduced by 20-30% compared to wild type.

FIG. 32L is a graphic presentation of demonstrating the growth parameter (OD at 750 nm and Chlorophyll content) of Synechocystis wild type and a mutant that over-express the endogenous RuBisCO operon.

FIG. 32M is a graphic presentation of ethanol production for the mutant Synechocystis PCC6803 harboring the pSK10-PisiA-PDC/ADHII plasmid and the mutant additionally containing the vector pVZ321b-Prbc-SynRbc.

FIG. 32N is a graphic presentation of ethanol production normalized to the OD750 for the mutant Synechocystis PCC6803 harboring the pSK10-PisiA-PDC/ADHII plasmid and the mutant additionally containing the vector pVZ321b-Prbc-SynRbc

FIG. 33A is a schematic representation of gene organization for the construct pVZ-PisiA-pdc/adh.

FIG. 33B is a schematic representation of gene organization for the construct pVZ-PntcA-pdc/adh.

FIG. 33C is a schematic representation of gene organization for the construct pVZ-PnblA-pdc/adh.

FIG. 33D presents the nucleotide sequence of the insert of the vector pCB4-LR(TF)pa that encodes Z. mobilis adhII and pdc genes. (SEQ ID NO:73)

FIG. 33E is a schematic representation of restriction sites present in the Z. mobilis adhII and pdc fragment.

FIG. 33F presents the amino acid sequence of Z. mobilis pdc protein. (SEQ ID NO:74)

FIG. 33G presents the amino acid sequence of the Z. mobilis AdhII protein. (SEQ ID NO:75)

FIG. 34A presents the nucleotide sequence for the isiA promoter (Synechocystis sp. PCC6803) (isiA gene: sll0247), which is induced under iron starvation conditions. (SEQ ID NO:76)

FIG. 34B presents the nucleotide sequence for the nblA promoter (Synechocystis sp. PCC6803) (nblA gene: ss10452), which is induced under nitrogen starvation conditions. (SEQ ID NO:77)

FIG. 34C presents the nucleotide sequence for the ntcA promoter (Synechocystis sp. PCC6803) (ntcA gene: sll1423), which is induced under nitrogen starvation. (SEQ ID NO:78)

FIG. 35A presents the nucleotide sequence of the cloning vector pVZ321b, a derivative of pVZ321. (SEQ ID NO:79)

FIG. 35B is a schematic representation of gene organization for the cloning vector pVZ321b.

FIG. 36A presents the nucleotide sequence for the petJ promoter (Synechocystis sp. PCC 6803) (petJ gene: sll1796) (encoding for cytochrome c553), which is induced under copper starvation conditions. (SEQ ID NO:80)

FIG. 36B is a schematic representation of gene organization for the construct pVZ321b-PpetJ-PDC-ADHII.

FIG. 36C presents the nucleotide sequence of the sigB promoter (Synechocystis sp. PCC 6803) (sigB gene: sll0306) (encoding for RNA polymerase group 2 sigma factor), which is induced after heat shock, in stationary growth phase/nitrogen starvation and darkness. (SEQ ID NO:81)

FIG. 36D is a schematic representation of gene organization for the construct pVZ321b-PsigB-PDC-ADHII.

FIG. 36E presents the nucleotide sequence of the htpG promoter (Synechocystis sp. PCC 6803) (htpG gene: sll0430) (encoding for heat shock protein 90, molecular chaperone), which is induced after heat shock. (SEQ ID NO:82)

FIG. 36F is a schematic representation of gene organization for the construct pVZ321b-PhtpG-PDC-ADHII.

FIG. 36G presents the nucleotide sequence of the lrtA promoter (Synechocystis sp. PCC 6803) (1rtA gene: sll0947) (encoding the light repressed protein A homology, which is induced after light to dark transition. (SEQ ID NO:83)

FIG. 36H is a schematic representation of gene organization in the construct pVZ321b-PlrtA-PDC-ADHII.

FIG. 36I presents the nucleotide sequence of the psbA2 promoter (Synechocystis sp. PCC 6803) (psbA2 gene: slr1311) (encoding the photosystem II D1 protein), which is induced after dark to light transition. (SEQ ID NO:84)

FIG. 36J is a schematic representation of gene organization for the construct pVZ321b-PpsbA2-PDC-ADHII.

FIG. 36K presents the nucleotide sequence of the rbcL promoter (Synechocystis sp. PCC 6803) (rbcL gene: slr0009) (encoding the ribulose biphosphate carboxylase/oxygenase large subunit), which is a constitutive and strong promoter under continuous light conditions. (SEQ ID NO:85)

FIG. 36L is a schematic representation of gene organization for the construct pVZ321b-PrbcL-PDC-ADHII.

FIG. 36M presents the nucleotide sequence for the psaA promoter (Synechocystis sp. PCC6803) (PsaA gene: slr1834) (encoding P700 apoprotein subunit Ia), which is induced under low white light and orange light, low expression level under high light and red light, and repressed in darkness. (SEQ ID NO:86)

FIG. 36N is a schematic representation of the gene organization of the construct pVZ321b-PpsaA-PDC-ADHII.

FIG. 36O presents the nucleotide sequence of the ggpS promoter (Synechocystis sp. PCC6803) (ggpS gene: sll1566)(encoding glucosylglycerolphosphate synthase), which is induced after salt stress. (SEQ ID NO:87)

FIG. 36P is a schematic representation of the gene organization of the construct pVZ321b-PggpS-PDC-ADHII.

FIG. 36Q presents the nucleotide sequence of the nirA promoter (Synechocystis sp. PCC6803) (nirA gene: slr0898) (encoding ferredoxin-nitrite reductase), which is induced after transition from ammonia to nitrate. (SEQ ID NO:88)

FIG. 36R is a schematic representation of the gene organization of the construct pVZ321c-PnirA-PDC-ADHII.

FIG. 36S presents the nucleotide sequence of the petE promoter (Anabaena sp. PCC7120) (petE gene: a110258) (encoding plastocyanin precursor), which is induced at elevated copper concentrations. (SEQ ID NO:89)

FIG. 36T is a schematic representation of gene organization for the construct pVZ321c-PpetE-PDC-ADHII.

FIG. 36U presents the nucleotide sequence of the hspA promoter (Synechocystis sp. PCC6803) (hspA gene: sll1514) 16.6 kDa small heat shock protein, molecular chaperone multi-stress responsive promoter (heat, cold, salt and oxidative stress). (SEQ ID NO:90)

FIG. 36V is s schematic representation of gene organization for the construct pVZ321c-PhspA-PDC-ADHII.

FIG. 36W presents the nucleotide sequence for the hliB promoter (Synechocystis sp. PCC6803) (hliB gene: ssr2595) high light-inducible polypeptide HliB, CAB/ELIP/HLIP superfamily) (multi-stress responsible promoter (heat, cold, salt and oxidative stress). (SEQ ID NO:91)

FIG. 36X is a schematic representation of gene organization of the construct pVZ321c-PhliB-PDC-ADHII.

FIG. 36Y presents the nucleotide sequence of the clpB1 promoter (Synechocystis sp. PCC6803) (clpB1 gene: slr1641) ATP-dependent Clp protease, Hsp 100, ATP-binding subunit ClpB multi-stress responsible promoter (heat, cold, salt and oxidative stress). (SEQ ID NO:92)

FIG. 36Z is a schematic representation of the gene organization for the construct pVZ321c-PclpB1-PDC-ADHII.

FIG. 37A presents the nucleotide sequence of the adhA gene from Zymomonas mobilis ZM4. (SEQ ID NO:93)

FIG. 37B presents the amino acid sequence for the ZmAdhI protein sequence (AAV89860). (SEQ ID NO:94)

FIG. 37C is a schematic presentation of the gene organization for construct pVZ321b-PisiA-PDC-ADHI.

FIG. 37D is a schematic presentation of the gene organization for construct pVZ321b-PntcA-PDC-ZmADHI.

FIG. 37E is a schematic presentation of the gene organization for construct pVZ321b-PnblA-PDC-ZmADHI.

FIG. 38A presents the nucleotide sequence of SynAdh, the adh gene (slr1192) of Synechocystis sp. PCC 6803. (SEQ ID NO:95)

FIG. 38B presents the amino acid sequence of SynAdh (protein sequence BAA18840) of Synechocystis sp. PCC 6803. (SEQ ID NO:96)

FIG. 38C is a schematic representation of the gene organization for construct pVZ321b-PisiA-PDC-SynADH.

FIG. 38D is a schematic representation of the gene organization for construct pVZ321b-PntcA-PDC-SynADH.

FIG. 38E is a schematic representation of the gene organization for construct pVZ321b-PnblA-PDC-SynADH.

FIG. 39A presents the nucleotide sequence of EcAdhE, the AdhE gene from E. coli K12. (SEQ ID NO:97)

FIG. 39B presents the amino acid sequence of EcAdhE (protein sequence NP 415757). (SEQ ID NO:98)

FIG. 39C is a schematic representation of the gene organization for construct pVZ321b-PisiA-PDC-EcAdhE.

FIG. 39D is a schematic representation of the gene organization for construct pVZ321b-PntcA-PDC-EcAdhE.

FIG. 39E is a schematic representation of the gene organization for construct pVZ321b-PnblA-PDC-EcAdhE.

FIG. 40A presents the nucleotide sequence of ThAdhE, the adhE gene (tlr0227) from Thermosynechococcus elongatus BP-1. (SEQ ID NO:99)

FIG. 40B presents the amino acid sequence of ThAdhE (protein sequence BAC07780). (SEQ ID NO:100)

FIG. 40C is a schematic representation of the gene organization for the construct pVZ321b-PisiA-ThAdhE.

FIG. 40D is a schematic representation of the gene organization for the construct pVZ321b-PntcA-ThAdhE.

FIG. 40E is a schematic representation of the gene organization for the construct pVZ321b-PnblA-ThAdhE.

FIG. 41A presents the nucleotide sequence of ZpPdcpdc gene from Zymobacter palmae ATCC 51623 (SEQ ID NO:101)

FIG. 41B presents the amino acid sequence of ZpPdc (protein sequence AAM49566). (SEQ ID NO:102)

FIG. 42A presents the nucleotide sequence of pSK10 cloning vector (derivate of pSK9 [V. V. Zinchenko, Moscow, Russia; unpublished]). (SEQ ID NO:103)

FIG. 42B is a schematic representation of the gene organization for the plasmid pSK10.

FIG. 42C is a schematic representation of the gene organization of the construct pSK10-PisiA-PDC-ADHII.

FIG. 42D is a schematic representation of the gene organization of the construct pSK10-PnblA-PDC-ADHII.

FIG. 42E is a schematic representation of the gene organization of the construct pSK10-PntcA-PDC-ADHII.

FIG. 42F is a schematic representation of the gene organization of the construct pSK10-PisiA-PDC-ADHI.

FIG. 42G is a schematic representation of the gene organization of the construct pSK10-PnblA-PDC-ADHI.

FIG. 42H is a schematic representation of the gene organization of the construct pSK10-PntcA-PDC-ADHI.

FIG. 42I is a schematic representation of the gene organization of the construct pSK10-PisiA-PDC-SynADH.

FIG. 42J is a schematic representation of the gene organization of the construct pSK10-PnblA-PDC-SynADH.

FIG. 42K is a schematic representation of the gene organization of the construct pSK10-PntcA-PDC-SynADH.

FIG. 42L is a schematic representation of the gene organization of the construct pSK10-PisiA-PDC-EcAdhE.

FIG. 42M is a schematic representation of the gene organization of the construct pSK10-PnblA-PDC-EcAdhE.

FIG. 42N is a schematic representation of the gene organization of the construct pSK10-PntcA-PDC-EcAdhE.

FIG. 42O is a schematic representation of the gene organization of the construct pSK10-PisiA-PDC-ThAdhE.

FIG. 42P is a schematic representation of the gene organization of the construct pSK10-PnblA-PDC-ThAdhE.

FIG. 42Q is a schematic representation of the gene organization of the construct pSK10-PntcA-PDC-ThAdhE.

FIG. 42R presents the nucleotide sequence of the crhC promoter (Anabaena sp. PCC7120) (crhC gene: alr4718, RNA helicase crhC cold shock inducible) (SEQ ID NO:104).

FIG. 42S presents the nucleotide sequence of the petE promoter (Anabaena sp. PCC7120) petE gene: a110258, plastocyanin precursor (petE) induced by addition of Cu. (SEQ ID NO:105)

FIG. 42T presents the gene organization of plasmid pRL1049-PpetE-PDC-ADHII.

FIG. 42U presents the nucleotide sequence of plasmid pRL1049-PpetE-PDC-ADHII (SEQ ID NO:106).

FIG. 42V depicts the gene organization of plasmid pRL593-PisiA-PDC-ADHII.

FIG. 42W presents the nucleotide sequence of plasmid pRL593-PisiA-PDC-ADHII (SEQ ID NO:107).

FIG. 42X is a graphic depiction of ethanol production rate in Anabaena PCC7120 harboring pRL593-PisiA-PDC-ADHII following induction by iron starvation was measured in BG11 medium (+N) and in medium lacking combined nitrogen(—N) in day (12 h)/night (12 h) cycle.

FIG. 42Y is a graphic depiction of ethanol production rate in Anabaena PCC7120 harboring pRL593-PisiA-PDC-ADHII following induction by iron starvation was measured in BG11 medium (+N) and in medium lacking combined nitrogen(—N) in day (12 h)/night (12 h) cycle, wherein values are normalized for optical density.

FIG. 43A is a photographic depiction of a Western Blot that was used to quantify the induction rate of the used promoters by determining the relative abundance of the Z. mobilis ADHII and PDC enzymes expressed in Synechocystis with and without nutrient starvation.

FIG. 43B is a photograph of a Western Blot that was used to determine the relative abundance of the Z. mobilis ADHII and PDC enzymes expressed in Synechocystis with and without nutrient starvation.

FIG. 44A is a graphic representation of ethanol production rates of genetically modified photoautotrophic host cells containing Zymomonas mobilis PDC and ADHII as a second genetic modification.

FIG. 44B is a graphic representation of ethanol production in Synechocystis pVZ mutants having ZmPdC and ZmADHII under the control of isiA, and iron-dependent promoter.

FIG. 44C is a graphic presentation of ethanol production in glycogen deficient Synechocystis pVZ mutants having ZmPdc and ZmAdhII under the control of isiA, an iron-dependent promoter.

FIG. 44D is a graphic presentation of ethanol production in Synechocystis pVZ mutants having ZmPdc and SynAdh under the control of rbcLS, a constitutive promoter.

FIG. 45 is a graphic presentation of ethanol production in Synechocystis expressing different 3 variants of E. coli AdhE compared to wild-type.

FIG. 46A is a graphic representation of growth over time for the captioned mutant strains.

FIG. 46B is a graphic representation of ethanol production over time(% v/v) for the captioned mutant strains.

FIG. 46C is a graphic representation of ethanol production per growth for the captioned mutant strains.

FIG. 46D is a graphic representation of measurements on outgas samples of Synechocystis mutants that express ZmPdc/ZmAdhI (dashed line), ZmPdc/ZmAdhII (solid line) and ZmPdc/SynAdh (dotted line) analyzed by gas chromatography. The grey arrow indicates the acetaldehyde, and the black arrow indicates the ethanol peak.

FIG. 46E is a graphic depiction of acetaldehyde production after addition of ethanol in different concentrations. Wild type and ethanol producing transgenic cells are presented.

FIG. 46F is a graphic depiction of the pH-dependency of acetaldehyde reduction by crude extracts containing the Synechocystis Adh.

FIG. 46G is a graphic depiction summarizing the acetaldehyde reduction rates at different cosubstrate concentrations. Measurements were performed at pH 6.1

FIG. 46H is a graphic depiction of Lineweaver-Burk plots, which depict the reciprocal of the rate of acetaldehyde reduction versus the reciprocal of the concentration of NADH (squares) or NADPH (rhombi), respectively. Km and vmax values are discussed in the text.

46-I is a photographic depiction of SDS/PAGE analysis of recombinantly expressed SynAdh showing that SynAdh was enriched, but not purified to homogeneity.

FIG. 47A presents a phylogenetic analysis examining different zinc binding ADH proteins.

FIG. 47B presents in tabular form all genes identified by the Zn-binding, SynAdh Glade.

FIG. 47C presents the amino acid sequence of a zinc-containing alcohol dehydrogenase family protein of Synechocystis sp. PCC 6803, identified by Genbank Accession No. NP 443028.1. (SEQ ID NO:108)

FIG. 47D presents the amino acid sequence of a zinc-containing alcohol dehydrogenase family protein of Oceanobacter sp. RED65, identified by Genbank Accession No. ZP01306627.1. (SEQ ID NO:109)

FIG. 47E presents the amino acid sequence of an alcohol dehydrogenase, zinc-binding protein of Limnobacter sp. MED105, identified by Genbank Accession No. ZP01914609.1. (SEQ ID NO:110)

FIG. 47F presents the amino acid sequence of an alcohol dehydrogenase GroES-like protein of Psychrobacter cryohalolentis K5, identified by Genbank Accession No. YP581659.1. (SEQ ID NO:111)

FIG. 47G presents the amino acid sequence of an alcohol dehydrogenase GroES-like domain family of Verrucomicrobiae bacterium DG1235, identified by Genbank Accession No. EDY84203.1. (SEQ ID NO:112)

FIG. 47H presents the amino acid sequence of a zinc-containing alcohol dehydrogenase family protein of Saccharophagus degradans 2-40, identified by Genbank

Accession No. YP529423.1. (SEQ ID NO:113)

FIG. 47I presents the amino acid sequence of a zinc-containing alcohol dehydrogenase family protein of Alteromonas macleodii ‘Deep ecotype’, identified by Genbank Accession No. YP002126870.1. (SEQ ID NO:114)

FIG. 47J presents the amino acid sequence of a zinc-containing alcohol dehydrogenase family protein of Acaryochloris marina MBIC11017, identified by Genbank Accession No. YP001519107.1. (SEQ ID NO:115)

FIG. 47K presents the amino acid sequence of an alcohol dehydrogenase GroES domain protein of Cyanothece sp. PCC 7424, identified by Genbank Accession No. YP002380432.1. (SEQ ID NO:116)

FIG. 47L presents the amino acid sequence of an alcohol dehydrogenase GroES domain protein of Cyanothece sp. PCC 7424, identified by Genbank Accession No. ZP02976085.1. (SEQ ID NO:117)

FIG. 47M presents the amino acid sequence of an alcohol dehydrogenase GroES domain protein of Cyanothece sp. PCC 7822, identified by Genbank Accession No. ZP03154326.1. (SEQ ID NO:118)

FIG. 47N presents the amino acid sequence of an alcohol dehydrogenase GroES domain protein of Cyanothece sp. PCC 8801, identified by Genbank Accession No. YP002371662.1. (SEQ ID NO:119)

FIG. 47O presents the amino acid sequence of an alcohol dehydrogenase GroES domain protein of Cyanothece sp. PCC 8801, identified by Genbank Accession No. ZP02941996.1. (SEQ ID NO:120)

FIG. 47P presents the amino acid sequence of an alcohol dehydrogenase GroES domain protein of Cyanothece sp. PCC 8802, identified by Genbank Accession No. ZP03143898.1. (SEQ ID NO:121)

FIG. 47Q presents the amino acid sequence of an alcohol dehydrogenase GroES-like domain family of Microcoleus chthonoplastes PCC 7420, identified by Genbank Accession No. EDX77810.1. (SEQ ID NO:122)

FIG. 47R presents the amino acid sequence of an uncharacterized zinc-type alcohol dehydrogenase-like protein of Microcystis aeruginosa NIES-843, identified by Genbank Accession No. YP001659961.1. (SEQ ID NO:123)

FIG. 47S presents the amino acid sequence of an unnamed protein product of Microcystis aeruginosa PCC 7806, identified by Genbank Accession No. CA090817.1. (SEQ ID NO:124)

FIG. 47T presents the amino acid sequence of a zinc-containing alcohol dehydrogenase superfamily protein of Synechococcus sp. WH 5701, identified by Genbank Accession No. ZP01085101.1. (SEQ ID NO:125)

FIG. 47U presents the amino acid sequence of a zinc-containing alcohol dehydrogenase superfamily protein of Synechococcus sp. RS9917, identified by Genbank Accession No. ZP01079933.1. (SEQ ID NO:126)

FIG. 47V presents the amino acid sequence of a zinc-containing alcohol dehydrogenase superfamily protein of Synechococcus sp. WH 5701, identified by Genbank Accession No. ZP01085101.1. (SEQ ID NO:127)

FIG. 47W presents the amino acid sequence of a zn-dependent alcohol dehydrogenase of Synechococcus sp. WH 7803, identified by Genbank Accession No. YP001224538.1. (SEQ ID NO:128)

FIG. 47X presents the amino acid sequence of a zinc-containing alcohol dehydrogenase superfamily protein of Synechococcus sp. WH 7805, identified by Genbank Accession No. ZP01125148.1. (SEQ ID NO:129)

FIG. 48A is a graphic depiction of the OD750 growth properties of Synechocystis wild type and mutants that express Pdc/Adh enzyme and Pdc enzyme alone.

FIG. 48B is a graphic depiction of ethanol production for Synechocystis wild type and mutants that express Pdc/Adh enzyme and Pdc enzyme alone.

FIG. 48C is a graphical presentation of data for an ethanol concentration time course under limiting CO2 conditions; these data are presented in tabular form in FIG. 48C.

FIG. 48D is a graphical presentation of data for an ethanol concentration time course under limiting CO2 conditions; these data are presented in tabular form in FIG. 48E.

FIG. 48E is a graphical presentation of data for an ethanol concentration time course under limiting CO2 conditions; these data are presented in tabular form in FIG. 48G.

FIG. 48F is a graphical presentation of data for an ethanol concentration time course under limiting CO2 conditions; these data are presented in tabular form in FIG. 48I.

FIG. 49A is a tabular presentation of cyanobacterial promoters used to express ethanologenic enzymes in Synechocystis 6803.

FIG. 49B is a graphic depiction of growth properties of 6803 transformed with pVZ321b-PisiA-PDC/ADH as monitored by determining the OD750.

FIG. 49C is a graphic depiction of iron-induced ethanol production of 6803 transformed with pVZ321b-PisiA-PDC/ADH.

FIG. 49D is a graphic depiction of ethanol production of Synechocystis 6803 pVZ321b-PnblA-PDC/ADH that express Pdc/Adh enzymes under the control of the nitrogen dependent nblA-promoter.

FIG. 49E is a graphic depiction of the growth properties of cells with PnirA-PDC when nitrogen is provided by ammonia or nitrate.

FIG. 49F is a graphic depiction of ethanol production of cells with PnirA-PDC when nitrogen is provided by ammonia or nitrate.

FIG. 49G is a graphic depiction of ethanol production normalized for culture optical density of cells with PnirA-PDC when nitrogen is provided by ammonia or nitrate.

FIG. 49H is a graphic depiction of growth of Synechocystis 6803 pVZ321b-PpetJ-PDC/ADH.

FIG. 49I is a graphic depiction of ethanol production of Synechocystis 6803 pVZ321b-PpetJ-PDC/ADH.

FIG. 49J is a graphic depiction ethanol productivity per growth of Synechocystis 6803 pVZ321b-PpetJ-PDC/ADH.

FIG. 49K is a graphic depiction of the growth of Synechocystis 6803 pVZ321b-PpetE-PDC/ADH.

FIG. 49L is a graphic depiction ethanol production of Synechocystis 6803 pVZ321b-PpetE-PDC/ADH.

FIG. 49M is a graphic depiction of ethanol production of Synechocystis 6803 pVZ321b-PcrhC-PDC/ADH.

FIG. 49N is a graphic depiction of growth properties of Synechocystis 6803 pVZ321b-PhspA-PDC, pVZ321b-PhtpG-PDC, pVZ321b-PhliB-PDC and pVZ321b-PclpB1-PDC.

FIG. 49O is a graphic depiction of ethanol production of Synechocystis 6803 pVZ321b-PhspA-PDC, pVZ321b-PhtpG-PDC, pVZ321b-PhliB-PDC and pVZ321b-PclpB1-PDC.

FIG. 49P is a graphic presentation of growth properties under different conditions of cells containing pVZ321b-PpetJ-PDC/SynADH.

FIG. 49Q is a graphic presentation of ethanol production under different growth conditions of cells containing pVZ321b-PpetJ-PDC/SynADH.

FIG. 49R is a graphic presentation of ethanol production per OD under different growth conditions of cells containing pVZ321b-PpetJ-PDC/SynADH.

FIG. 50A presents the nucleotide sequence of ScPDC1. (SEQ ID NO:130)

FIG. 50B presents the amino acid sequence of ScPDC1. (SEQ ID NO:131)

FIG. 50C presents the nucleotide sequence of ScADH1. (SEQ ID NO:132)

FIG. 50D presents the amino acid sequence of ScADH1. (SEQ ID NO:133)

FIG. 50E presents the nucleotide sequence of Chlamydomonas Pcyc6. (SEQ ID NO:134)

FIG. 50F presents the nucleotide sequence of Chlamydomonas FEA1. (SEQ ID NO:135)

FIG. 50G presents the nucleotide sequence of a synthetic ble marker gene. (SEQ ID NO:136)

FIG. 50H presents the nucleotide sequence of ARG7 gene of Chlamydomonas. (SEQ ID NO:137)

FIG. 50I is a schematic presentation of gene organization of pSP124S.

FIG. 50J presents the nucleotide sequence of pSP124S. (SEQ ID NO:138)

FIG. 50K is a schematic presentation of gene organization of pXX311.

FIG. 50L presents the nucleotide sequence of pXX311. (SEQ ID NO:139)

FIG. 50M is a schematic presentation of gene organization of ARG7_pKS.

FIG. 50N is a schematic presentation illustrating the construction of ScPDC1 3′UTR pKS.

FIG. 50O is a schematic presentation illustrating the construction of Pcyc6 ScPDC1 3′UTR pKS.

FIG. 50P is a schematic presentation illustrating the construction of Pcyc6ScPDC1 3′UTR Pcyc6 ScADH1 3′UTR pKS.

FIG. 50Q is a schematic presentation of gene organization for pCYC6-PDC1-ADH1 pSP124S.

FIG. 50R is a schematic presentation of gene organization for pFEA1-PDC1-ADH1 pSP124S.

FIG. 50S is a schematic presentation of gene organization for pCYC6-PDC1-ADH1 ARG7.

FIG. 50T is a schematic presentation of gene organization for pFEA1-PDC1-ADH1 ARG7.

FIG. 50U is a schematic presentation of gene organization for ScPDC1-pXX311.

FIG. 50V is a graphic presentation of Chlamydomonas ethanol production.

FIG. 50W presents in tabular format results for all high priority tests (photosynthetic activity, the long and short term ethanol tolerance test and the salt and thermo tolerance test).

FIG. 51A is a graphic representation of ethanol production after the addition of acetaldehyde. Different acetaldehyde concentrations were added to a culture of strain 6803pVZPisiA, and the ethanol content in the medium was measured for 60 minutes.

FIG. 51B is a graphic representation of the correlation of ethanol production rate and acetaldehyde concentration. Given are the initial ethanol rates (calculated with FIG. 51A) in correlation to the initial acetaldehyde concentrations.

FIG. 51C (Lineweaver-Burk-Plot) is a graphic representation of the reciprocal of the initial velocity versus the reciprocal of the acetaldehyde concentration. Intact cells were used.

FIG. 51D (Lineweaver-Burk-Plot) is a graphic representation of the reciprocal of the initial velocity versus the reciprocal of the acetaldehyde concentration. The results shown are from a repeat of the experiment with intact cells.

FIG. 51E (Lineweaver-Burk-Plot) is a graphic representation of the Adh activities of a crude extract of strain 6803PVZPisiA were measured in presence of different concentration of acetaldehyde. In contrast to the experiments with intact cells in this experiment NADH was added in excess. Shown is the reciprocal of the initial velocity versus reciprocal of the concentration of acetaldehyde.

FIG. 51F (Lineweaver-Burk-Plot) Similar to the experiment summarized in FIG. 51E, Adh activities of a crude extract of strain 6803PVZPisiA were measured in the presence of different concentrations of acetaldehyde. The assays contained an over excess either of NADH or of NADPH. Substantial differences between NADH (squares) and NADPH (diamonds) were not observed.

DETAILED DESCRIPTION OF EMBODIMENTS Definitions

As used herein, the term “genetically modified” refers to any change in the endogenous genome of a wild type cell or to the addition of non-endogenous genetic code to a wild type cell, e.g., the introduction of a heterologous gene. More specifically, such changes are made by the hand of man through the use of recombinant DNA technology or mutagenesis. The changes can involve protein coding sequences or non-protein coding sequences such as regulatory sequences as promoters or enhancers.

The term “nucleic acid” is intended to include nucleic acid molecules, e.g., polynucleotides which include an open reading frame encoding a polypeptide, and can further include non-coding regulatory sequences, and introns. In addition, the terms are intended to include one or more genes that map to a functional locus. In addition, the terms are intended to include a specific gene for a selected purpose. The gene can be endogenous to the host cell or can be recombinantly introduced into the host cell.

The phrase “operably linked” means that the nucleotide sequence of the nucleic acid molecule or gene of interest is linked to the regulatory sequence(s) in a manner which allows for expression (e.g., enhanced, increased, constitutive, basal, attenuated, decreased or repressed expression) of the nucleotide sequence and expression of a gene product encoded by the nucleotide sequence (e.g., when the recombinant nucleic acid molecule is included in a recombinant vector, as defined herein, and is introduced into a microorganism).

The term “recombinant nucleic acid molecule” includes a nucleic acid molecule (e.g., a DNA molecule) that has been altered, modified or engineered such that it differs in nucleotide sequence from the native or natural nucleic acid molecule from which the recombinant nucleic acid molecule was derived (e.g., by addition, deletion or substitution of one or more nucleotides). Advantageously, a recombinant nucleic acid molecule (e.g., a recombinant DNA molecule) includes an isolated nucleic acid molecule or gene of the present invention

The terms “host cell” and “recombinant host cell” are intended to include a cell suitable for genetic manipulation, e.g., which can incorporate heterologous polynucleotide sequences, e.g., which can be transfected. The cell can be a prokaryotic or a eukaryotic cell. The term is intended to include progeny of the cell originally transfected. In particular embodiments, the cell is a prokaryotic cell, e.g., a cyanobacterial cell. Particularly, the term recombinant host cell is intended to include a cell that has already been selected or engineered to have certain desirable properties and suitable for further modification using the compositions and methods of the invention.

The term “promoter” is intended to include a polynucleotide segment that can transcriptionally control a gene-of-interest, e.g., a pyruvate decarboxylase gene, that it does or does not transcriptionally control in nature. In one embodiment, the transcriptional control of a promoter results in an increase in expression of the gene-of-interest. In another embodiment, a promoter is placed 5′ to the gene-of-interest. A promoter can be used to replace the natural promoter, or can be used in addition to the natural promoter. A promoter can be endogenous with regard to the host cell in which it is used or it can be a heterologous polynucleotide sequence introduced into the host cell, e.g., exogenous with regard to the host cell in which it is used. Promoters of the invention may also be inducible, meaning that certain exogenous stimuli (e.g., nutrient starvation, heat shock, mechanical stress, light exposure, etc.).

The term “about” is used herein to mean approximately, in the region of, roughly, or around. When the term “about” is used in conjunction with a numerical value/range, it modifies that value/range by extending the boundaries above and below the numerical value(s) set forth. In general, the term “about” is used herein to modify a numerical value(s) above and below the stated value(s) by a variance of 20%.

As used herein, the phrase “increased activity” refers to any genetic modification resulting in increased levels of enzyme in a host cell. As known to one of ordinary skill in the art, enzyme activity may be increased by increasing the level of transcription, either by modifying promoter function or by increasing gene copy number, increasing translational efficiency of an enzyme messenger RNA, e.g., by modifying ribosomal binding, or by increasing the stability of a enzyme protein, which because the half-life of the protein is increased, will lead to more enzyme molecules in the cell. All of these represent non-limiting examples of increasing the activity of an enzyme. (mRNA Processing and Metabolism: Methods and Protocols, Edited by Daniel R. Schoenberg, Humana Press Inc., Totowa, N.J.; 2004; ISBN 1-59259-750-5; Prokaryotic Gene Expression (1999) Baumberg, S., Oxford University Press, ISBN 0199636036; The Structure and Function of Plastids (2006) Wise, R. R. and Hoober J. K., Springer, ISBN 140203217X; The Biomedical Engineering Handbook (2000) Bronzino, J. D., Springer, ISBN 354066808X).

In one aspect the invention also provides nucleic acids, which are at least 60%, 70%, 80% 90% or 95% identical to the promoter nucleic acids disclosed therein and to the nucleic acids, which encode proteins, for example enzymes for ethanol formation or host cell enzymes involved in the conversion or formation of acetyl CoA, acetaldehyde or pyruvate or for formation of reserve compounds. The invention also provides amino acid sequences for enzymes for ethanol formation or host cell enzymes involved in the conversion or formation of acetyl-CoA, acetaldehyde or pyruvate or for formation of reserve compounds, which are at least 60%, 70%, 80% 90% or 95% identical to the amino acid sequences disclosed therein.

The percentage of identity of two nucleic acid sequences or two amino acid sequences can be determined using the algorithm of Thompson et al. (CLUSTALW, 1994 Nucleic Acid Research 22: 4673-4, 680). A nucleotide sequence or an amino acid sequence can also be used as a so-called “query sequence” to perform against public nucleic acid or protein sequence databases in order, for example, to identify further unknown homologous promoters, which can also be used in embodiments of this invention. In addition, any nucleic acid sequences or protein sequences disclosed in this patent application can also be used as a “query sequence” in order to identify yet unknown sequences in public databases, which can encode for example new enzymes, which could be useful in this invention. Such searches can be performed using the algorithm of Karlin and Altschul (1999 Proceedings of the National Academy of Sciences U.S.A. 87: 2,264 to 2,268), modified as in Karlin and Altschul (1993 Proceedings of the National Academy of Sciences U.S.A. 90: 5,873 to 5,877). Such an algorithm is incorporated in the NBLAST and XBLAST programs of Altschul et al. (1999 Journal of Molecular Biology 215: 403 to 410). Suitable parameters for these database searches with these programs are, for example, a score of 100 and a word length of 12 for BLAST nucleotide searches as performed with the NBLAST program. BLAST protein searches are performed with the XBLAST program with a score of 50 and a word length of 3. Where gaps exist between two sequences, gapped BLAST is utilized as described in Altschul et al. (1997 Nucleic Acid Research, 25: 3,389 to 3,402).

Database entry numbers given in the following are for the CyanoBase, the genome database for cyanobacteria (http://bacteria.kazusa.or.jp/cyanobase/index.html); Yazukazu et al. “CyanoBase, the genome database for Synechocystis sp. Strain PCC6803: status for the year 2000”, Nucleic Acid Research, 2000, Vol. 18, page 72.

Embodiments

It is one object of embodiments of the invention to provide a genetically modified host cell, which can be used for production of ethanol.

This object is reached by providing a genetically modified host cell according to base claim 1. Further embodiments of the genetically modified host cell, as well as constructs for producing the genetically modified host cells and a method for producing ethanol using the genetically modified host cells are subject matters of further claims.

Embodiment of genetic knockout and/or overexpression of metabolic pathway enzymes

In a first aspect the invention provides a genetically modified photoautotrophic, ethanol producing host cell comprising:

    • at least one first genetic modification changing the enzymatic activity or affinity of an endogenous host cell enzyme,
    • the first genetic modification resulting in an enhanced level of biosynthesis of acetaldehyde, pyruvate, acetyl-CoA or precursors thereof compared to the respective wild type host cell,
    • at least one second genetic modification different from the first genetic modification comprising an overexpressed enzyme for the formation of ethanol.

Acetaldehyde, pyruvate and acetyl-coA or their precursors are important metabolic intermediates for energy production in cells. In photoautotrophic cells, which use light, CO2, and water as a source of energy to produce carbohydrates via photosynthesis, acetaldehyde, pyruvate, acetyl-CoA and their precursors can be formed by conversion of organic molecules obtained via CO2 fixation in the Calvin-cycle, for example 3-phosphoglycerate. Pyruvate, acetyl-CoA and their precursors are important metabolic intermediates obtained e.g. by photosynthetic CO2 fixation in photoautotrophic cells. Acetaldehyde is a metabolic intermediate of the anoxygenic fermentation pathway in many photoautotrophic cells.

Precursors of pyruvate and acetyl-CoA are organic compounds, which can be converted into these important metabolic intermediates via the enzymatic action of enzymes of the photoautotrophic cell. For example the organic compounds 2-phosphoglycerate, 3-phosphoglycerate or phosphoenolpyruvate can be converted into pyruvate by enzymes of the glycolytic pathway in photoautotrophic cells.

The genetically modified photoautotrophic ethanol producing host cell comprises at least two different genetic modifications, a first and a second genetic modification. The first genetic modification changes the enzymatic activity or affinity of an endogenous host enzyme, resulting in a higher level of biosynthesis of acetyl-CoA, acetaldehyde, pyruvate or precursors thereof. The endogenous host enzyme is already present in an unmodified wild type host cell and its activity or affinity is changed by the first genetic modification in order to increase the level of biosynthesis of metabolic intermediates, which are also present in the wild type host cell and which can be used to form ethanol.

Furthermore the genetically modified photoautotrophic ethanol producing host cell comprises a second genetic modification in the form of at least one overexpressed enzyme, which can form ethanol, for example from the above-mentioned important metabolic intermediates. In a further embodiment the overexpressed enzyme for ethanol formation can catalyze the last step of ethanol formation leading to the final product ethanol. The overexpressed enzyme for ethanol formation can also catalyze the penultimate step of ethanol formation resulting in a metabolic intermediate, which can further be converted by another enzyme for ethanol formation into the final product ethanol.

The enzyme for ethanol formation can, for example, be an endogenous enzyme already present in a wild type photoautotrophic host cell, which is not genetically modified. In this case the activity or affinity of the enzyme for ethanol formation can be enhanced by the second genetic modification, for example by genetic engineering or random mutagenesis. This can, for example, be done by genetically modifying the amino acid sequence of the enzyme by site directed or random mutagenesis of the gene encoding this endogenous enzyme, thereby enhancing its activity for formation of ethanol. Another possibility is to increase the number of gene copies encoding for the enzyme in the host cell or simply by enhancing the rate of transcription of the gene already present in the wild type cell to increase the abundance of its messenger RNA in the second genetic modification. This can be done for example by replacing or mutating the endogenous promoter controlling the transcription of the endogenous gene encoding the enzyme for ethanol formation.

Alternatively or additionally a heterologous enzyme for ethanol formation can be introduced into the host cell by the second genetic modification, if that enzyme is not present in an genetically unmodified wild type host cell. This can be done, for example, by introducing a construct, for example a DNA vector into the host cell including a heterologous gene encoding the overexpressed enzyme for ethanol formation. In the case that an endogenous enzyme for ethanol formation is already present in a photoautotrophic wild type host cell, the heterologous enzyme for ethanol formation can enhance the activity of the endogenous enzyme resulting in a higher rate of ethanol formation.

The enzymatic activity and the affinity of an enzyme for its substrate are important kinetic constants. The enzymatic activity is given by the parameter Vmax, which reflects the maximal velocity of an enzymatic reaction occurring at high substrate concentrations when the enzyme is saturated with its substrate. The affinity is given by the Michaelis-Menten constant Km which is the substrate concentration required for an enzyme to reach one-half its maximum velocity. In order to increase the enzymatic activity Vmax has to be increased, whereas for increasing the affinity Km has to be reduced. Regarding a further explanation of enzyme kinetics we refer to the chapter “enzyme kinetics” in the textbook “Biochemistry” by Donald Voet and Judith Voet (John Wiley & Sons, 1990, pages 335 to 340).

The higher level of biosynthesis of acetyl-CoA, acetaldehyde, pyruvate or precursors thereof results in a change of the flux of the acetyl-CoA, acetaldehyde, pyruvate or precursors thereof in the direction of the at least one overexpressed enzyme for ethanol formation so that formation of ethanol can be increased in comparison to a photoautotrophic ethanol producing host cell harboring only the second genetic modification, but lacking the first genetic modification. Acetyl-CoA, acetaldehyde, pyruvate or precursors thereof are transient metabolic intermediates, which are often rapidly processed into other metabolites by the photoautotrophic host cell and therefore a change in the level of biosynthesis of these metabolic intermediates can be hard to detect in photoautotrophic host cells featuring the first genetic modification but lacking the second genetic modification.

A first genetic modification therefore results in a higher level of biosynthesis of acetyl-CoA, acetaldehyde, pyruvate or precursors thereof compared to the respective wild type host cell, if after introduction of the second genetic modification a higher level of ethanol formation can be detected in a cell harboring the first and second genetic modification than in a cell only harboring the second genetic modification but lacking the first genetic modification. This even applies if a change in the level of biosynthesis of these metabolic intermediates could not be detected in the photoautotrophic host cell harboring the first genetic modification but lacking the second genetic modification in comparison to the respective wild-type photoautotrophic host cell, which does not harbor the first and second genetic modification.

The genetically modified photoautotrophic host cell can comprise more than one first genetic modification and also more than one second genetic modification. For example the first genetic modification can comprise at least two genetic modifications, one first genetic modification (a), which is a down-regulation or a knock out of gene expression of a metabolic enzyme and at least one further first genetic modification (b), which is an increase in metabolic enzyme activity and/or substrate affinity for a endogenous enzyme for formation of acetyl-CoA, pyruvate or acetaldehyde or precursors thereof.

In a further embodiment thereof, the total number of possible one first genetic modifications (a) is represented by N, wherein N is a number from 0 to 50, and N indicates the number of genetic modifications resulting in the down-regulation or knockout of metabolic enzyme activity and/or substrate affinity, and the number of further first genetic modifications (b) is represented by P, wherein P is a number from 0 to 50, resulting in an increase in metabolic enzyme activity and/or substrate affinity for a endogenous enzyme for formation of acetyl-CoA, pyruvate or acetaldehyde or precursors thereof. The numerical values for genetic modification (a) N and genetic modification (b) P are selected independently from one another as long as the sum of P+N is at least one. By way of non-limiting example, (a) N may have a numerical value of 1, indicating a single genetic modification, and (b) P may have a numerical value of 2, indicating two genetic modifications. Alternatively (a) N may have numerical value of 2, indicating two genetic modifications, and (b) P may have a numerical value of 1, indicating a single genetic modification. Thus, as will be understood to those skilled in the art, the invention provides herein for a wide variety of genetically modified, photoautotrophic ethanol producing host cells comprising a multitude of genetic modifications, the combination of which result in an enhanced level of biosynthesis of acetaldehyde, pyruvate, acetyl-CoA or precursors thereof.

The genetically modified photoautotrophic host cell shows a high production of ethanol due to the fact that the ethanol forming enzyme is overexpressed due to the second genetic modification leading to a high enzymatic activity or activity for ethanol formation and that at the same time a higher level of biosynthesis of acetaldehyde, pyruvate, acetyl-CoA or their precursors is formed in the cells compared to the respective wild type cells due to the first genetic modification. Acetaldehyde, pyruvate, acetyl-CoA or their precursors serve as substrates for the ethanol production. These metabolic intermediates can either be a direct substrate for the overexpressed enzyme for the formation of ethanol or for another second overexpressed enzyme for ethanol formation, which then catalyzes the formation of a substrate for the first overexpressed enzyme for ethanol formation.

In yet another embodiment of the genetically modified host cell

    • the at least one endogenous host cell enzyme is selected from enzymes of the glycolysis pathway, Calvin-cycle, intermediate steps of metabolism, amino acid metabolism, the fermentation pathway and the citric acid cycle, wherein the activity of at least one of these enzymes is enhanced compared to the respective wild type host cell.
    • Enzymes of intermediate steps of metabolism are enzymes which connect different metabolic pathways. For example the glycolysis and the citric acid cycle are connected via the enzyme malic enzyme converting malate into pyruvate.

In particular the endogenous host cell enzyme can be selected from only one of the above pathways or in the case that more than one endogenous host cell enzyme is mutated in a first genetic modification can be selected from any possible combination of the above pathways.

The Calvin-cycle is an important part of photosynthesis and includes the light-independent reactions, where CO2 is captured from the environment of the cell and converted into organic compounds, for example three-carbon compounds such as 3-phosphoglycerate. CO2 may also be captured by alternative routes into four-carbon compounds such as oxaloacetate. These processes are also referred to as C3-carbon fixation and C4-carbon fixation.

Photosynthetic CO2 fixation can lead to the production of carbon storage compounds such as reserve carbohydrates like glycogen, starch or sucrose.

The glycolysis pathway is normally the first step of carbohydrate catabolism in order to generate adenosine triphosphate (ATP) and reductants such as nicotinamide adenine dinucleotide (NADH). Glycolysis furthermore can produce pyruvate which is an important compound for the citric acid cycle that generates reductant for aerobic respiration and intermediates for biosynthesis. Furthermore, glycolysis serves to synthesize various 6- and 3-carbon intermediate compounds which can be used for other cellular processes such as amino acid biosynthesis.

Pyruvate produced via glycolysis is one of the major sources for the citric acid cycle, which is an important part of a metabolic pathway for the chemical conversion of carbo-hydrates, fat and proteins into carbon dioxide and water to generate energy for the host cell. Pyruvate can, for example, be fed into the citric acid cycle via acetyl-CoA (acetyl-CoA). Furthermore, pyruvate can also be metabolized to acetaldehyde via other enzymes. Therefore, enhancing the activity or affinity of at least one of the endogenous host cell enzymes of the Calvin-cycle or glycolysis pathway or the citric acid cycle in a first genetic modification can result in a higher level of biosynthesis of pyruvate, or acetyl-CoA or their precursors, respectively. This in turn can result in a higher ethanol production due to the fact that these metabolic intermediates can be ultimately converted to ethanol via the at least one overexpressed enzyme for the formation of ethanol provided by the second genetic modification.

In certain aspects and embodiments of the invention the enzymatic activity or affinity of any of these enzymes can be enhanced, for example, by increasing the activity or affinity of the enzymes present in the wild type host cell. Non-limiting examples contemplated by the invention include site directed mutagenesis or random mutagenesis and by increasing the amount of enzymes in the host cell. The latter is achieved, for example by introducing mutations in the promoter regions controlling the transcriptional activity of the genes encoding the enzymes or by introducing additional gene copies coding for these enzymes into the host cell.

In a further embodiment at least one enzyme of the glycolysis pathway, the citric acid cycle, the intermediate steps of metabolism, the amino acid metabolism, the fermentation pathway or the Calvin-cycle of the host cell is overexpressed. Overexpression of an enzyme already present in a wild type host cell is an effective method to enhance the enzymatic activity of enzymes in a cell. Overexpression can also be achieved by introducing a heterologous enzyme into the host cell, which exhibits the same enzymatic activity as the host cell enzyme, which should be overexpressed. For example if 3-phosphoglycerate mutase should be overexpressed in the cyanobacterium Synechocystis a plasmid comprising a heterologous gene encoding 3-phosphoglycerate mutase from Zymomonas mobilis can be introduced into the host cell. Another non-limiting example is the overexpression of pyruvate kinase from E. coli in Synechocystis, thereby raising the enzymatic activity of the endogenous host cell enzyme pyruvate kinase in Synechocystis.

In the case that the enzymatic activity of malate dehydrogenase, an enzyme of the citric acid cycle and malic enzyme, an enzyme of the intermediate steps of metabolism is enhanced, malate dehydrogenase can stimulate the conversion of oxaloacetate to pyruvate via malate. Malate dehydrogenase catalyzes the conversion of oxaloacetate to malate using NADH:


Oxaloacetate+NADH+H+→malate+NAD+

Malic enzyme catalyzes the conversion of malate into pyruvate using NADP+:


malate+NADP+→pyruvate+CO2+NADPH

In C4-plants the released CO2 can be fixed by ribulose-1,5-bisphosphate carboxylase/oxygenase (RubisCO) and NADPH can be used for CO2-fixation in the Calvin-cycle. The enzymatic activity or affinity of RubisCO can be enhanced in a first genetic modification in order to increase the CO2-fixation and direct more carbon towards ethanol formation. This can be done for example by overexpressing only the small and the large subunits of RubisCO or a complete RubisCO operon also including a RubisCO Chaperonin in the photoautotrophic host cells such as prokaryotic cells. The RubisCO Chaperonin can assist in the folding of the RubisCO enzyme, which is a complex of eight large and eight small subunits in cyanobacteria and algae. The binding sites for the substrate ribulose 1,5-bisphosphate are located on the large subunits, whereas the small subunits have regulatory functions. RubisCO catalyzes bifunctional the initial step in the carbon dioxide assimilatory pathway and photorespiratory pathway in photosynthetic organisms. The enzyme catalyzes the carboxylation of ribulose-1,5-bisphosphate into two molecules of 3-phosphoglycerate (3-PGA) in the carbon dioxide assimilatory pathway, but also the oxygenation of ribulose-1,5-bisphosphate resulting in 3-PGA and 2-Phosphoglycolate (2-PG) in the photorespiratory pathway. In order to direct the carbon provided by the CO2-fixation into ethanol formation, the carbon dioxide assimilatory pathway has to be enhanced and the activity of the photorespiratory pathway has to be reduced. Some photoautotrophic cells such as cyanobacteria have mechanisms to actively uptake CO2 and HCO3 and to raise the CO2-concentration in the proximity of RubisCO (Badger M. R., and Price, G. D. (2003) J. Exp. Bot. 54, 609-622). This reduces the oxygenase activity of the enzyme. Nevertheless the cyanobacterial photosynthesis is not efficient enough to completely abolish the formation of 2-PG. Cyanobacteria produce significant amounts of 2-PG, particularly at elevated oxygen concentrations or after a change to low CO2-concentrations.

In order to enhance the carbon dioxide fixating activity of RubisCO random or side directed mutagenesis can be performed to achieve higher CO2 fixation according to some embodiments of the invention. Efforts to select RubisCO enzymes with improved activity using random mutagenesis were successful when the large subunit of RubisCO from Synechococcus PCC 7942 was mutagenized and co-expressed with the small subunit of RubisCO and phosphoribulokinase (prkA) in E. coli (Directed evolution of RubisCO hypermorphs through genetic selection in engineered E. coli, Parikh et al, Protein Engineering, Design & Selection vol. 19 no. 3 pp. 113-119, 2006). This strategy was also successful in the case of the similar enzymes from Synechococcus PCC 6301 in E. coli (Artificially evolved Synechococcus PCC 6301 RubisCO variants exhibit improvements in folding and catalytic efficiency, Greene et al., Biochem J. 404 (3): 517-24, 2007).

Another way of increasing the enzymatic activity of RubisCO according to the invention involves overexpressing heterologous RubisCO in order to increase the CO2 fixation as it was shown in case of the heterologous expression of RubisCO from Allochromatium vinosum in Synechococcus PCC 7942 (Expression of foreign type I ribulose-1,5-bisphosphate carboxylase/oxygenase (EC 4.1.1.39) stimulates photosynthesis in cyanobacterium Synechococcus PCC 7942 cells, Iwaki et al, Photosynthesis Research 88: 287-297, 2006).

Overexpression of RubisCO in photoautotrophic host cells such as cyanobacteria also harboring at least one overexpressed enzyme for the formation of ethanol surprisingly not just results in an increased activity of RubisCO, but also leads to an increased biomass of the cells and a higher growth rate accompanied by a slight increase in the rate of ethanol production.

In addition the photorespiration activity of RubisCO can be reduced or eliminated by random or side directed mutagenesis. Certain embodiments of the invention relate to the overexpression of at least one enzyme from the glycolysis pathway. Non-limiting examples are phosphoglycerate mutase, enolase and pyruvate kinase.

Phosphoglycerate mutase catalyzes the reversible reaction leading from 3-phosphoglycerate formed in the Calvin-cycle to 2-phosphoglycerate. 2-phosphoglycerate in turn can then, in a reversible reaction catalyzed by the enzyme enolase, be converted to phosphoenolpyruvate. Phosphoenolpyruvate can further be converted to pyruvate via the enzymatic action of pyruvate kinase. Therefore, enhancing the activity of any or all of these enzymes enhances the pyruvate pool in the host cell by enhancing the conversion of 3-phosphoglycerate formed in the Calvin-cycle to pyruvate. Pyruvate itself can then either be a direct substrate for the at least one overexpressed enzyme for ethanol formation or it can further be converted into another intermediate, which then can be further metabolized by the enzyme for ethanol formation in order to form high amounts of ethanol.

An enzyme of the fermentation pathway, which can be overexpressed is for example the acetaldehyde dehydrogenase enzyme, which can convert acetyl-CoA to acetaldehyde, thereby increasing the level of biosynthesis of acetaldehyde in the host cell. Alternatively other aldehyde dehydrogenases enzymes could be expressed in order to increase the level of biosynthesis of acetaldehyde in the host cell.

Enzymes of the intermediate steps of metabolism, which can be overexpressed are for example pyruvate dehydrogenase enzyme converting pyruvate into acetyl-CoA, increasing the level of biosynthesis of acetyl-CoA in the host cell. In addition or alternatively phosphotransacetylase converting acetyl-CoA to acetylphosphate can be overexpressed in the host cell, thereby increasing the level of biosynthesis of acetaldehyde in the host cell.

Another non-limiting example of an enzyme, whose activity or affinity can be increased is the enzyme PEP-carboxylase (phosphoenolpyruvate carboxylase). This enzyme catalyzes the addition of CO2 to phosphoenolpyruvate (PEP) to form the four-carbon compound oxaloacetate (OAA). This PEP-carboxylase catalyzed reaction is used for CO2 fixation and can enhance the photosynthetic activity leading to higher CO2 fixation, which can be used for ethanol formation.

In particular the enzymatic activity or affinity of PEP-carboxylase, malate dehydrogenase and malic enzyme can be enhanced concomitantly. This leads to a higher CO2 fixation and an enhanced level of biosynthesis of pyruvate. In addition the decarboxylation of malate to pyruvate catalyzed by the enzyme malic enzyme, enhances the CO2 partial pressure leading to an increased efficiency of the Calvin cycle. PEP-carboxylase is used for CO2 fixation in C4-plants and can also be found in cyanobacteria.

Furthermore it is possible to overexpress enzymes of the amino acid metabolism of the host cell, which for example convert certain amino acids into pyruvate leading to an enhanced biosynthesis of pyruvate in the host cell. For example serine can directly be converted to pyruvate in the cyanobacterium Synechocystis PCC 6803. The open reading frame slr 2072, which is annotated as ilvA (threonine dehydratase), EC 4.3.1.19, can catalyze the deamination of serine to pyruvate.

According to a further aspect of the invention the enzymatic activity or affinity of the enzyme phosphoketolase (EC 4.1.2.-, putative phosphoketolase in Synechocystis PCC 6803 slr 0453) is enhanced in a first genetic modification in order to increase the level of biosynthesis of precursor molecules for the generation of acetyl-CoA and acetaldehyde. Phosphoketolase catalyses the formation of acetyl phosphate and glyceraldehyde 3-phosphate, a precursor of 3-phosphoglycerate from xylulose-5-phosphate which is an intermediate of the Calvin cycle.

According to another embodiment of the invention in combination with enhancing the enzymatic activity or affinity of phosphoketolase enzyme, the polyhydroxybutyrate (PHB) pathway is knocked out in order to avoid PHB accumulation due to an increased level of acetyl-CoA biosynthesis (Control of Poly-β-Hydroxybutyrate Synthase Mediated by Acetyl Phosphate in Cyanobacteria, Miyake et al., Journal of Bacteriology, p. 5009-5013, 1997). Additionally AdhE can be overexpressed at the same time to convert the acetyl-CoA to ethanol.

Endogenous host enzymes of the glycolysis pathway, the Calvin-cycle, the intermediate steps of metabolism, the amino acid metabolism pathways, the fermentation pathways or the citric acid cycle, can be dependent upon a cofactor. The invention also provides an enhanced level of biosynthesis of this cofactor compared to the respective wild type host cell, thereby increasing the activity of these enzymes. Such an enhanced level of biosynthesis of this cofactor can be provided in a first genetic modification.

An enhanced level of the cofactor biosynthesis also results in an enhanced enzymatic activity or affinity of these above mentioned enzymes and therefore in an enhanced level of biosynthesis of pyruvate, acetyl-CoA, acetaldehyde or their precursors in the cell.

For example, alcohol dehydrogenase enzymes are often NAD+/NADH cofactor dependent enzymes. In this case, their enzymatic activity can be enhanced by raising the level of NADH biosynthesis in the host cell. This can, for example, be done by overexpressing NAD(P)+ transhydrogenases, which transfer reduction equivalents between NADP(H) to NAD(H). These NAD(P)+ transhydrogenases are oxidoreductases.

Furthermore the host cell can comprise a host NADH dehydrogenase converting NADH to NAD+ wherein the activity of the NADH dehydrogenase is reduced compared to the wild type host cell.

For example, point mutations can be introduced into the gene encoding the NADH dehydrogenase in order to reduce the activity or affinity of this enzyme or alternatively the gene encoding the NADH dehydrogenase can be knocked-out by inserting for example heterologous nucleic acid sequences into the gene, thereby disrupting it.

Alternatively, in order to enhance the enzymatic activity of an enzyme, which is NADP+/NADPH cofactor dependent as, for example the malic enzyme, the level of NADP+/NADPH in the host cell also can be increased.

In many of photoautotrophic cells the level of NAD+ plus NADH to NADP+ plus NADPH is around 1:10. Due to this high imbalance of NADH to NADPH, the conversion of an NAD+/NADH cofactor specific enzyme via site directed mutagenesis or random mutagenesis of the enzyme into an NADP+/NADPH dependent enzyme can increase its activity. The changing of the cofactor specificity of alcohol dehydrogenase via in vitro random mutagenesis is for example described in the publication “Alteration of Substrate Specificity of Zymomonas mobilis Alcohol Dehydrogenase-2 Using in Vitro Random Mutagenesis” (Protein Expression and Purification Volume 9, Issue 1, February 1997, Pages 83-90).

A further embodiment of the invention provides a genetically modified host cell

    • wherein the at least one endogenous host cell enzyme is for the conversion of pyruvate or acetyl-CoA or for the formation of reserve compounds, wherein its activity or affinity is reduced.

Alternatively or in addition to enhancing the activity of enzymes forming pyruvate, acetaldehyde, acetyl-CoA or precursors thereof, the activity of the enzymes converting the above-mentioned important intermediate metabolic compounds into other compounds can be reduced by the way of the first genetic modification. The inventors found out that by reducing the activity of at least one of these enzymes the level of biosynthesis of pyruvate, acetyl-CoA, acetaldehyde or their precursors can be risen compared to a wild type host cell. In addition, the inventors made the observation that by reducing the activity of host enzymes forming reserve compounds, for example glycogen, more carbohydrates formed via photosynthesis in the photoautotrophic host cells are shuffled into the glycolysis pathway and the citric acid cycle, thereby enhancing the level of biosynthesis of pyruvate, acetaldehyde, acetyl-CoA or their precursors. Due to the fact that these metabolic intermediates are used by at least one overexpressed enzyme for the formation of ethanol, a higher ethanol production of such a genetically modified host cell can be observed.

The enzymatic activity of at least one of these enzymes can be reduced, for example by introducing point mutations into the genes encoding these enzymes, thereby reducing the activity of these enzymes. Alternatively or in addition, the promoter regions controlling the transcriptional activity of these genes can be mutated, resulting in a lower transcriptional activity and therefore a reduced level of protein translation in the genetically modified host cell.

A point mutation, or single base substitution, is a type of mutation that causes the replacement of a single base nucleotide with another nucleotide.

A “promoter” is an array of nucleic acid control sequences that direct transcription of an associated nucleic acid sequence, which may be a heterologous or endogenous nucleic acid sequence. A promoter includes nucleic acid sequences near the start site of transcription, such as a polymerase binding site for a RNA polymerase used for the synthesis of messenger RNA. The promoter also optionally includes distal enhancer or repressor elements which can be located as much as several thousand base pairs from the start site of transcription.

Furthermore, it is possible that the host cell comprises disruptions in the host gene encoding at least one of the enzymes of the host cell converting pyruvate, acetyl-CoA, the precursors thereof or for forming reserve compounds. In this case, the enzymatic activity of the enzymes can be eliminated to a full extent due to the fact that the disrupted gene does not encode for a functional protein anymore.

The disruption of the gene can be furthermore caused by an insertion of a biocide resistance gene into the respective gene. This has the advantage that so-called “knockout mutants” containing the insertions in the respective genes can easily be selected by culturing the genetically modified host cells in selective medium containing the biocide to which the genetically modified host cell is resistant.

The term “biocide” refers to a chemical substance, which is able to inhibit the growth of cells or even kill cells, which are not resistant to this biocide. Biocides can include herbicides, algaecides and antibiotics, which can inhibit the growth of plants, algae or microorganisms such as bacteria, for example cyanobacteria.

Alternatively or in addition for disrupting the gene encoding one of the enzymes converting pyruvate, acetyl-CoA or acetaldehyde or forming reserve compounds, the enzymatic activity of one of these enzymes can also be reduced by using the antisense messenger RNA concept.

A wild type cell normally comprises at least one host gene encoding for the host enzyme or protein, wherein transcription of this gene results in a sense messenger RNA (mRNA), which codes for the functional protein and is translated into the protein via translation mediated by the ribosomes, ribonucleoprotein complexes present in cells. The messenger RNA is normally a single stranded RNA molecule encoding the amino acid sequence of the enzyme in the form of the genetic code. Specifically, the genetic code defines a mapping between tri-nucleotide sequences called codons in the messenger RNA and the amino acids of the amino acid sequence; every triplet of nucleotides in a nucleic acid sequence of the mRNA specifies a single amino acid. This messenger RNA molecule is normally called sense RNA. In order to reduce or even eliminate the enzymatic activity of the enzyme encoded by this gene a nucleic acid sequence can be introduced into the host cell, which upon transcription results in a RNA strand complementary to the sense messenger RNA strand, the so-called antisense RNA. This antisense RNA can then interact with the sense RNA, forming a double-stranded RNA species which cannot be translated by the ribosomes into a functional protein anymore. Depending on the ratio of the sense RNA to the antisense RNA in the host cell, the level of enzymatic activity of the enzyme can be reduced or even eliminated. Different antisense RNA approaches for the regulation of gene expression are described in the following publications:

    • Dühring U, Axmann I M, Hess W R, Wilde A. “An internal antisense RNA regulates expression of the photosynthesis gene isiA” (Proc Natl Acad Sci USA. 2006 May 2; 103(18):7054-8).
    • Udekwu K I, Darfeuille F, Vogel J, Reimegård J, Holmqvist E, Wagner E G. “Hfq-dependent regulation of OmpA synthesis is mediated by an antisense RNA” (Genes Dev. 2005 Oct. 1; 19(19):2355-66)

Prime enzyme targets for down regulation of enzymatic activity or for elimination of enzymatic activity are ADP-glucose-pyrophosphorylase, glycogen synthase, alanine dehydrogenase, lactate dehydrogenase, pyruvate water dikinase, phosphotransacetylase, and acetate kinase as well as pyruvate dehydrogenase.

ADP-glucose-pyrophosphorylase catalyzes the conversion of glucose-1-phosphate into ADP-glucose, which is a precursor for the reserve polysaccharide glycogen in many photoautotrophic host cells. The enzyme glycogen synthase catalyzes the addition of further glucose monomers donated by ADP glucose to the ends of glycogen primers.

The inventors found out that by reducing or even eliminating the formation of reserve carbohydrates such as starch or glycogen, the level of biosynthesis of pyruvate, acetyl-CoA or acetaldehyde can be raised compared to the level of biosynthesis a wild type host cell. This finding was particularly true for the reduction of the enzymatic affinity and activity of glycogen synthase and ADP-glucose-pyrophosphorylase. A knock out of both enzymes in photoautotrophic host cells lacking at least one overexpressed enzyme for ethanol production as a second genetic modification resulted in a big increase of pyruvate secreted into the growth medium. Further introducing a second genetic modification into these photoautotrophic host cells resulted in an increased fraction of fixed carbon being diverted to ethanol production.

Alanine dehydrogenase catalyzes the reversible reductive amination of pyruvate to alanine using NADH as a reductant. A reduction of activity of alanine dehydrogenase can result in a higher level of pyruvate.

The enzyme lactate dehydrogenase catalyzes the inter-conversion of pyruvate to the fermentative end product lactate using NADH as a reductant. Reducing or inhibiting the enzymatic action of lactate dehydrogenase can result in an increase of the level of biosynthesis of pyruvate in the genetically modified host cell.

The enzyme pyruvate water dikinase catalyzes the ATP-dependent conversion of pyruvate, ATP and water to adenosine monophosphate (AMP), phosphoenolpyruvate and phosphate. Due to that a reduction of the enzymatic activity of pyruvate water dikinase can also result in an increased level of pyruvate in the host cell.

The enzyme phosphotransacetylase catalyzes the reversible transfer of an acetyl group from acetyl-CoA to a phosphate thereby forming acetylphosphate. A reduction of the enzymatic activity of this enzyme can also result in an increased level of acetyl-CoA as well as of its precursor pyruvate.

The enzyme acetate kinase catalyzes the conversion of acetylphosphate to the fermentative end product acetate whereas the phosphate group is transferred from acetylphosphate to adenosine diphosphate (ADP) so adenosine triphosphate (ATP) is formed. An inactivation or a reduction of the enzymatic activity of this enzyme can therefore result in a higher level of acetylphosphate and maybe acetyl-CoA in the cell.

Reducing the enzymatic activity or knocking out of the gene encoding phosphotransacetylase (PTA) can be important, since this enzyme is at the branch point of acetate generation via acetylphosphate. Acetylphosphate itself is an important intermediate, because it is needed for ADP regeneration to ATP and it stimulates the activity of polyhydroxybutyrate (PHB) synthase. Knock out of the PTA therefore can avoid loss of acetyl-CoA into the acetate branch and additionally can minimize PHB generation. Thus acetyl-CoA can be channeled to the ethanol generating branch.

The inventors found out that a reduction in the enzymatic affinity or activity of the enzymes of the complete acetate fermentation pathway, in particular phosphotransacetylase and acetate kinase can lead to an increase in the ethanol production rate without reducing the photosynthetic capacity of the photoautotrophic host cells. For example a knock out of both genes coding for phosphotransacetylase and acetate kinase can enhance the ethanol production rate compared to a photoautotrophic host cell harboring only at least one overexpressed enzyme for ethanol formation as a second genetic modification but lacking the first genetic modification, the knock out mutations of both enzymes.

On the other hand acetylphosphate is the natural precursor of fermentative EtOH synthesis via acetaldehyde and therefore overexpressing the phosphotransacetylase together with the acetaldehyde forming enzyme and knocking-out or reducing the enzymatic activity of the PHB synthase can also increase the level of biosynthesis of acetaldehyde in the genetically modified host cell.

In some bacterial cells both enzymes phosphotransacetylase and acetate kinase can also catalyze the reverse reaction from acetate to acetylphosphate and from acetylphosphate to acetyl-CoA. In the case that the level of biosynthesis of acetyl-CoA should be raised compared to the wild type cells the activity or affinity of both enzymes can be enhanced for example via overexpression in different first genetic modifications. Alternatively only acetate kinase can be overexpressed in a first genetic modification in the case that the second genetic modification comprises at least acetaldehyde dehydrogenase converting the acetylphosphate to acetaldehyde and further Adh, such as AdhI and/or AdhII converting the acetaldehyde into ethanol.

Another possible target enzyme for down-regulation to increase the level of biosynthesis of pyruvate is pyruvate dehydrogenase, which catalyzes the thiamine pyrophosphate (TPP) cofactor dependent decarboxylation of pyruvate resulting in acetyl-CoA, NADH and CO2.

With regard to the enzymes forming reserve compounds for the cell, the gene for glycogen synthase can be disrupted, for example by inserting a heterologous nucleic acid sequence encoding for a biocide resistance cassette into the gene. The inventors found out that such a knockout of both glycogen synthase genes glgA1 and glgA2 in the phototropic genetically modified host cell of the genera Synechocystis results in an enhanced pyruvate level of up to 50-fold compared to the unmodified wild type host cell.

In particular, the enzymes forming one of the following reserve compounds can be a prime target for a reduction of their enzymatic activity of even for knockout: Glycogen, polyhydroxyalkanoates like, for example poly-3-hydroxybutyrate or poly-4-hydroxybutyrate, polyhydroxyvalerate, polyhydroxyhexanoate, polyhydroxy-octanoate, amylopectin, starch, cyanophycin and their copolymers, glucosyl glycerol and bacterial extracellular polymeric substances such as extracellular polysaccharides. Enzymes which are involved in the synthesis of these reserve compounds are for example beta-ketothiolase, acetoacetyl-CoA reductase, polyhydroxybutyrate synthase, glucosylglycerolphosphate synthase.

Polyhydroxybutyrate is synthesized from acetyl-CoA via three enzymatic reactions: 3-thiolase (EC 2.3.1.9) converts two acetyl-CoA molecules to an acetoacetyl-CoA molecule, NADPH-dependent acetoacetyl-CoA reductase (EC 1.1.1.36) converts acetoacetyl-CoA to D-3-hydroxybutyryl-CoA with NADPH oxidation, and the last enzyme, PHB synthase, catalyzes the linkage of the D-3-hydroxybutyryl moiety to an existing PHB molecule by an ester bond.

The biosynthetic pathway of glucosyl glycerol begins with ADP-glucose and glycerol-3-phosphate (G3P), which are used by the GG-phosphate synthase(GGPS), and proceeds via the intermediate GG-phosphate(GGP), which is dephosphorylated to GG by the GGphosphate phosphatase (GGPP).

Hydrolyzed EPSs (bacterial extracellular polymeric substances) showed the compositional involvement of four sugar moieties viz. mannose, glucose, xylose and ribose in varying combinations. Chemical analysis of EPS revealed a heteropolysaccharidic nature, with xylose, glucose, galactose, and mannose the main neutral sugars found.

In the case that a genetically modified host cell exhibits a reduced enzymatic activity for the formation of any of the above-mentioned reserve compounds, it is expected that the precursors for these reserve compounds are fed into the glycolysis pathway or the citric acid cycle, thereby resulting in an enhanced level of, pyruvate, acetyl-CoA, acetaldehyde or their precursors. This in turn can result in a higher ethanol production in the case that pyruvate, acetyl-CoA or acetaldehyde are used by the at least one overexpressed enzyme for ethanol formation in order to produce ethanol.

In yet a further embodiment of the host cell of the invention, the at least one overexpressed enzyme for the formation of ethanol is an alcohol dehydrogenase.

An alcohol dehydrogenase catalyzes the reduction of a substrate to ethanol. This reaction is normally dependent on the cofactor NADH. Alternatively there are be alcohol dehydrogenases which are NADPH-dependent.

Furthermore, the alcohol dehydrogenase can be a thermophilic alcohol dehydrogenase. Thermophilic alcohol dehydrogenase can, for example, be obtained from a host cell which can normally grow well at temperatures above 45° C. Thermophilic alcohol dehydrogenases can be more stable and probably more active than alcohol dehydrogenases obtained from mesophilic host cells, which normally grow at temperatures below 45° C. One possible example for such a thermophilic alcohol dehydrogenase is the alcohol dehydrogenase AdhE obtained from the thermophilic cyanobacterium Thermosynechococcus sp. or from E. coli.

One possible substrate for alcohol dehydrogenase can be acetyl-CoA, which for example can be directly converted to ethanol by the above-mentioned alcohol dehydrogenase AdhE from Thermosynechococcus or E. coli. Overexpressing such an alcohol dehydrogenase in a genetically modified host cell has the advantage that only one enzyme has to be overexpressed in order to enhance the level of ethanol production. In the case that the level of biosynthesis of acetyl-CoA of the host cell is increased due to overexpression of acetyl-coenzyme A forming enzymes and due to the reduction of enzymatic activity of acetyl-CoA converting enzymes, a high level of ethanol formation can result.

In addition the enzymatic activity or affinity of AdhE can be increased by introducing mutations, in particular point mutations into the protein via site directed or random mutagenesis. The AdhE is an iron-dependent, bifunctional enzyme containing a CoA-depending aldehyde dehydrogenase and an alcohol dehydrogenase activity. One characteristic of iron-dependent alcohol dehydrogenases (AdhII) is the sensitivity to oxygen. In the case of the AdhE from E. coli a mutant was described that shows in contrast to the wildtype also Adh activity under aerobic conditions. The site of the mutation was determined in the coding region at the codon position 568. The G to A nucleotide transition in this codon results in an amino acid exchange from glutamate to lysine (E568K). The E568K derivate of the E. coli AdhE is active both aerobically and anaerobically. This mutation is therefore a solution for the use of this oxygen-sensitive enzyme in an oxygen-producing photosynthetic host cell.

[Holland-Staley et al., Aerobic activity of Escherichia coli alcohol dehydrogenase is determined by a single amino acid, J. Bacteriol. 2000 November; 182(21):6049-54].

In a further embodiment of the invention, a genetically modified host cell can be provided, which further comprises:

    • pyruvate decarboxylase converting pyruvate to acetaldehyde, wherein
      the alcohol dehydrogenase converts the acetaldehyde to ethanol.

In this case, the substrate for the alcohol dehydrogenase is provided by a further overexpressed enzyme, for example pyruvate decarboxylase, which is introduced into the host cell via a further second genetic modification. Due to the fact that the level of biosynthesis of pyruvate of the host cell is increased due to the above-mentioned modifications of the pyruvate forming and converting enzymatic activities by way of the first genetic modification, more acetaldehyde is formed via the enzymatic activity of pyruvate decarboxylase. Therefore there is an increased synthesis of acetaldehyde, which is then further converted by alcohol dehydrogenase to ethanol resulting in a higher intracellular or extracellular ethanol level in the host cell. The alcohol dehydrogenase, as well as the pyruvate decarboxylase can be obtained from alcohol-fermenting organisms such as Zymomonas mobilis, Zymobacter palmae or the yeast Saccharomyces cerevisiae.

In another embodiment of the invention the genetically modified host cell comprises two second genetic modifications, one comprising alcohol dehydrogenases Adh converting acetaldehyde into ethanol and another second genetic modification comprising a CoA-dependent acetaldehyde dehydrogenase converting acetyl-CoA into acetaldehyde. One example of such an acetylating CoA-dependent acetaldehyde dehydrogenase is mhpF from E. coli.

In yet a further embodiment of the invention the genetically modified host cell harbors a pyruvate decarboxylase enzyme as the only second genetic modification. Such a single second genetic modification is particularly advantageous in genetically modified host cells, which already have an endogenous alcohol dehydrogenase enzyme. The inventors surprisingly found that the activity of such an endogenous alcohol dehydrogenase enzyme can be high enough in order to convert all or almost all of the acetaldehyde formed by the overexpressed pyruvate decarboxylase enzyme into ethanol.

For example all cyanobacterial host cells harbor at least one endogenous alcohol dehydrogenase enzyme. A preferred example is the cyanobacterium Synechocystis in particular Synechocystis PCC6803 or nitrogen fixing cyanobacteria such as Nostoc/Anabaena spec. PCC7120 and Anabaena variabilis ATCC 29413.

The alcohol dehydrogenase can be a zinc-dependent dehydrogenase. In comparison to iron-dependent dehydrogenases, a zinc-dependent dehydrogenase is less oxygen-sensitive and therefore can exhibit a higher enzymatic activity in a photoautotrophic host cell compared to an iron-dependent alcohol dehydrogenase. For example, the alcohol dehydrogenase AdhI obtained from Zymomonas mobilis is a zinc-dependent alcohol dehydrogenase, which can convert acetaldehyde to ethanol by using NADH as a reductant. Alternatively a zinc-dependent alcohol dehydrogenase can be obtained from the cyanobacterium Synechocystis, which also depends on the cofactor NADH.

Alternatively or additionally the alcohol dehydrogenase can comprise AdhII for example from Zymomonas mobilis, which is a Fe2+ dependent alcohol dehydrogenase converting acetaldehyde into ethanol.

In one embodiment, the photoautotrophic ethanol producing host cell comprises at least three second genetic modifications, wherein the at least three overexpressed enzymes for ethanol production have at least three different substrate specificities.

In one embodiment thereof, the three substrate specificities are for the substrates pyruvate, acetaldehyde and acetyl-CoA. For example the three different overexpressed enzymes for ethanol formation can be AdhE converting acetyl-CoA to ethanol, Pdc converting pyruvate to acetaldehyde and AdhI or AdhII converting the acetaldehyde to ethanol. In another embodiment the three different overexpressed enzymes for ethanol formation can be a CoA-dependent acetaldehyde dehydrogenase converting acetyl-CoA to acetaldehyde and Pdc converting pyruvate to acetaldehyde and AdhI or AdhII converting the acetaldehyde to ethanol.

In a further embodiment thereof, the three substrate specificities are for the substrates pyruvate, acetaldehyde and acetylphosphate. In this case the three different overexpressed enzymes for ethanol formation can be acetaldehyde dehydrogenase converting acetylphosphate to acetaldehyde, Pdc converting pyruvate to acetaldehyde and AdhI or AdhII converting the acetaldehyde to ethanol.

In another embodiment, the photoautotrophic ethanol producing host cell comprises at least four second genetic modifications, wherein the at least four overexpressed enzymes for ethanol production have at least four different substrate specificities. In one embodiment thereof, the four substrate specificities are for the substrates pyruvate, acetaldehyde and acetyl-CoA and acetylphosphate.

A further embodiment of the invention provides a genetically modified host cell further comprising:

    • a host cell genome, wherein
    • a gene encoding the at least overexpressed enzyme for the formation of ethanol is integrated into the host cell genome.

The host cell genome can be arranged in at least one chromosome containing coding as well as non-coding sequences. The coding sequences of the genome encode all the proteins and nucleic acids present in a wild type host cell. The gene encoding the at least one overexpressed enzyme for the formation of ethanol can be integrated into the host cell genome, for example via homologous recombination. Integration of the gene coding for the at least one overexpressed enzyme for ethanol formation into the host cell genome can be advantageous for host cells, which exhibit a natural competence for homologous recombination, for example the cyanobacterium Synechocystis sp.

Yet another embodiment of the invention provides a genetically modified host cell further comprising:

    • at least one host gene encoding the enzyme converting pyruvate or acetyl-CoA or acetaldehyde or forming reserve compounds,
    • wherein a heterologous or endogenous gene encoding the at least one overexpressed enzyme for the formation of ethanol is integrated into that host gene thereby disrupting the host gene.

Such a genetically modified host cell can be produced in just one genetic engineering step, by simply inserting the heterologous or endogenous gene, encoding the at least one overexpressed enzyme for ethanol formation into the host genome into a gene encoding an enzyme converting pyruvate or Acetyl-CoA or forming reserve compounds. Such a procedure knocks out the gene for the enzyme with the undesired activity and at the same time provides a genetic modification introducing an ethanol producing enzyme into a host cell. These genetically modified host cells are therefore easier to obtain than other genetically modified host cells wherein the reduction of enzymatic activity of the enzymes converting pyruvate, acetyl-CoA or acetaldehyde and the introduction of a gene encoding the overexpressed enzyme for ethanol formation is done in two separate steps.

Furthermore, the gene encoding the heterologously or endogenously expressed enzyme can be under the transcriptional control of a promoter endogenous to the host cell. This have the advantage that no exogenous promoter has to be introduced into the host cell. In the case that an exogenous promoter is introduced into a genetically modified host cell a further heterologous gene encoding a transcription factor which recognizes the heterologous promoter, can be introduced into the host cell as well, which complicates the genetic engineering step. Therefore, the introduction of an endogenous promoter, which is also present in an genetically unmodified wild type host cell, has the advantage that this promoter is easily recognized by the genetically modified host cell without the need to introduce further genetic modifications. For example, an inducible promoter such as isiA, which can be induced under iron starvation and stationary growth phase conditions for the host cells can be introduced into Synechocystis PCC 6803 as an endogenous promoter. Further non-limiting examples for suitable promoters will be explained later on.

The gene encoding the heterologously or endogenously expressed enzyme for ethanol formation can also be under the transcriptional control of a heterologous promoter, which is not present in a wild type host cell. For example, heat inducible promoters such as the CI-PL promoter from the bacteriophage lambda can be used to control the transcription of genes.

According to another embodiment of the invention the gene encoding the heterologously or endogenously expressed enzyme for ethanol formation is under the transcriptional control of an inducible promoter.

Such a genetically modified host cell can accumulate large amounts of acetyl-CoA, pyruvate, acetaldehyde or their precursors in the uninduced state due to the above-mentioned modifications and can then, after induction of the promoter, produce high amounts of ethanol via the enzymatic action of the enzyme for ethanol formation, which is now induced. Ethanol can be harmful to the cell. Therefore, larger amounts of ethanol can be produced by first accumulating the substrate necessary for ethanol formation without producing ethanol (uninduced state of the host cell) and then after induction directly converting these substrates into large amounts of ethanol. Therefore inducible promoters can be a good genetic tool in order to decouple the accumulation of acetyl-CoA, pyruvate, acetaldehyde or their precursors in host cells from the ethanol production.

Inducible promoters can be induced for example by nutrient starvation of the host cell, by stationary phase growth of the host cell culture or by subjecting the host cell to stressful conditions.

These kind of promoters are useful, because a genetically modified host cell culture can grow and reach a certain density, thereby leading to a nutrient starvation of the host cell and also increasing the stress for the host cell culture in the case that the growth medium is not continuously supplemented with nutrients. In this case a genetically modified cell culture can accumulate for example acetyl-CoA, pyruvate or their precursors in the exponential growth phase in the non-induced state without producing ethanol, and upon having reached the stationary growth phase can convert these metabolic products into ethanol due to induction of the promoters. For example, the inducible promoters can be inducible by nitrogen starvation or by trace element starvation, such as iron or copper. Examples of such kinds of promoters are the ntcA promoter, the nblA promoter as well as the sigB promoter from Synechocystis, which are inducible by nitrogen starvation and the isiA promoter which is inducible upon iron starvation. The petJ promoter is inducible by copper starvation. In addition, the isiA or sigB promoter can be also inducible by stationary growth phase of the host cell culture. The sigB promoter can also be induced by subjecting the host cell culture to darkness. Further stressful conditions can be heat shock for induction (sigB hspA, htpG, hliB or clpB1-promoter) and cold shock, which induces for example the crhC promoter. Heat shock can be induced, for example by raising the growth temperature of the host cell culture from 30° C. to 40° C. In contrast to that, a cold shock can be induced by reducing the growth temperature of the cell culture from 30° C. to 20° C. A further example of an inducible promoter is the nirA promoter, which can be repressed by ammonia and induced if nitrate is the sole nitrogen source.

Further relevant promoters are a promoter of a gene encoding light repressed protein A homolog (1rtA promoter), which can be induced by a transition from light to dark conditions. In addition the promoter of gene of P700 apoprotein subunit Ia (psaA promoter), which can be induced under low white light and orange light and repressed in darkness. Furthermore the petE promoter (promoter of the plastocyanin gene) is inducible by addition of traces of copper.

Alternatively the gene encoding the heterologously or endogenously expressed enzyme for ethanol formation can be under the transcriptional control of a constitutive promoter, which allows a certain level of transcription and therefore enzymatic activity of the overexpressed enzyme for ethanol formation during the whole period of cultivation even without induction. This can be advantageous in the case that the metabolic intermediate converted by the overexpressed enzyme for ethanol formation is harmful to the cell, as for example acetaldehyde. In this case the acetaldehyde is continuously converted to ethanol and is not present in the genetically modified host cell in high amounts.

A further embodiment of the invention provides a genetically modified photoautotrophic, ethanol producing host cell comprising:

    • at least one first genetic modification changing the enzymatic activity or affinity of an endogenous host enzyme of the host cell,
    • the first genetic modification resulting in a level of biosynthesis of a first metabolic intermediate for energy production of the host cell, which is enhanced compared to the level of biosynthesis in the respective wild type host cell,
    • at least one second genetic modification different from the first genetic modification comprising an overexpressed first enzyme for the formation of ethanol from the first metabolic intermediate.

The first metabolic intermediate can be any metabolic intermediate involved in the energy production of the host cell or in the formation of reserve compounds in the claim, for example starch, glycogen or polyhydroxybutyrate. This first metabolic intermediate can, for example, be formed during the Calvin-cycle, the light-independent part of photosynthesis, the glycolysis, the fermentation pathway, the amino acid metabolism or the citric acid cycle. Some non-limiting examples for the first metabolic intermediate are pyruvate, acetyl-CoA or acetaldehyde.

Due to the fact that the level of biosynthesis of this first metabolic intermediate is enhanced compared to the wild type host cell and due to the fact that this first intermediate is used by the first enzyme for ethanol formation in order to produce ethanol, these genetically modified photoautotrophic host cells can produce a high amount of ethanol.

For example, the first metabolic intermediate can comprise acetyl-CoA and the at least one overexpressed first enzyme can comprise the alcohol dehydrogenase AdhE directly converting acetyl-CoA to ethanol. In this case only one overexpressed enzyme is necessary in order to produce a increased amount of ethanol.

It is also possible that the genetically modified host cell further comprises:

    • at least one overexpressed second enzyme, converting the first metabolic intermediate into a second metabolic intermediate, wherein
    • the at least one overexpressed first enzyme converts the second metabolic intermediate into ethanol.

In this case, the first enzyme uses another metabolic intermediate provided by a second overexpressed enzyme in order to produce ethanol.

For example, the first metabolic intermediate can comprise pyruvate and the second metabolic intermediate can comprise acetaldehyde and the at least one overexpressed second enzyme can comprise pyruvate decarboxylase converting pyruvate into acetaldehyde and the at least one overexpressed first enzyme can comprise alcohol dehydrogenase Adh, converting acetaldehyde into ethanol.

Some host cells, for example, cyanobacteria, normally do not have a pyruvate decarboxylase. Therefore, the transformation of cyanobacteria with a pyruvate decarboxylase and in addition the overexpression of an alcohol dehydrogenase which already can be present in the wild type cyanobacterial cell can result in increased amounts of ethanol.

Another embodiment of the invention provides a genetically modified host cell, which further comprises:

    • at least one host enzyme for conversion of the first metabolic intermediate, wherein
    • the activity of said host enzyme is reduced compared to the respective wild type host cell by genetic engineering.

As mentioned above, the activity of host enzymes can be reduced, for example by site directed mutagenesis or random mutagenesis of the gene encoding the host enzyme, which results in a protein with a lower activity.

Alternatively or additionally the promoter sequences controlling the transcriptional activity of the genes encoding this host enzyme also can be genetically modified in order to reduce the transcriptional activity. Another example is to disrupt the gene encoding the host enzyme for conversion of the first metabolic intermediate with a heterologous nucleic acid sequence. The host enzyme, for example, can be any enzyme of the Calvin-cycle, the glycolysis pathway, the intermediate steps of metabolism, the amino acid metabolism or the citric acid cycle converting the first metabolic intermediate, which for example, can be pyruvate. In this case the host enzymes whose activity is reduced can, for example, be selected from a group consisting of pyruvate water dikinase, pyruvate dehydrogenase, phosphotransacetylase, acetate kinase, lactate dehydrogenase or alanine dehydrogenase.

In addition or alternatively the genetically modified host cell can further comprise:

    • at least one host enzyme for forming the first metabolic intermediate, wherein
    • the activity of said host enzyme is enhanced compared to the respective wild type host cell by genetic engineering.

In the case that the first metabolic intermediate is, for example, pyruvate the at least one host enzyme can be selected from the above-mentioned enzymes, which are: malate dehydrogenase, malic enzyme, pyruvate kinase, enolase, and phosphoglycerate mutase.

In the case that the first metabolic intermediate is, for example, acetyl-CoA the at least one host enzyme in addition to the above latter mentioned enzymes also can be selected from pyruvate dehydrogenase.

In yet another embodiment of the invention a genetically modified photoautotrophic, ethanol producing host cell is provided, comprising:

    • at least one first genetic modification changing the enzymatic activity or affinity of an endogenous host cell enzyme,
    • at least one second genetic modification different from the first genetic modification comprising an overexpressed enzyme for the formation of ethanol,
    • the first and second genetic modification resulting in an increased rate of ethanol production compared to the respective photoautotrophic, ethanol producing host cell harboring the second genetic modification but lacking the first genetic modification.

This genetically modified photoautotrophic, ethanol producing host can comprise any of the above mentioned genetic modifications.

There are several methods for genetic engineering, which are useful in enhancing the enzymatic activity or affinity of an enzyme, for example introducing point mutations (site directed mutagenesis or random mutagenesis) into a gene encoding the host enzyme for forming the first metabolic intermediate in order to enhance the enzymatic activity of this enzyme. Furthermore, additional gene copies encoding the host enzyme can be introduced into the host cell therefore enhancing the amount of protein in the host cell. Alternatively or in addition, the promoter region controlling the transcriptional activity of the gene encoding the enzyme can be mutated in order to enhance the transcriptional activity of the gene. Overexpression can also be achieved by introducing a heterologous enzyme into the host cell, which exhibits the same enzymatic activity as the host cell enzyme, which should be overexpressed. For example if PGA mutase should be overexpressed in the cyanobacterium Synechocystis a plasmid comprising a heterologous gene encoding PGA mutase from Zymomonas mobilis can be introduced into the host cell. Another non-limiting example is the overexpression of pyruvate kinase from E. coli in Synechocystis, thereby raising the enzymatic activity of the endogenous host cell enzyme pyruvate kinase in Synechocystis. In addition homologous genes from other cyanobacterial sources such as Synechocystis can be overexpressed in photoautotrophic host cells. Non-limiting examples for overexpression are: PGA mutase genes slr1124, slr1945, sll0395 and slr1748 and the enolase homolog slr0752 from Synechocystis PCC 6803.

Yet another embodiment of the invention provides a construct for the transformation of a photoautotrophic host cell by disrupting a host gene sequence encoding a host enzyme in order to increase the biosynthetic level of pyruvate, acetyl-CoA, acetaldehyde or precursors thereof in the host cell comprising:

    • a heterologous nucleic acid sequence comprising a promoter and a biocide resistance conferring gene under the transcriptional control of the promoter, wherein
    • the heterologous nucleic sequence is flanked at its 5′ and 3′ end by nucleic acid sequences that bind to the host gene sequence encoding a host enzyme.

Such a construct can, for example, be used in order to knock out unwanted host enzymes which convert an important first metabolic intermediate into another metabolic compound. Due to the biocide resistance conferring gene, genetically modified host cells resulting from the transformation with such a construct can be selected by exposing the transformed host cells to a growth medium containing the biocide. The 5′ and 3′ flanking nucleic acid sequences are preferably homologous to the nucleic acid sequence of the host gene encoding the host enzyme for conversion of the first metabolic intermediate.

The term “binds to” is used herein to refer to the annealing or hydrogen bonding of one nucleic acid (polynucleotide) to another nucleic acid (polynucleotide) In a particularly preferred embodiment, binding occurs in vivo or within a cell between a heterologous nucleic acid sequence and a genomic or chromosomal nucleic acid sequence. This is particularly useful in promoting homologous recombination. In other circumstances, the term may refer to hybridization in a non-natural environment, particularly under stringent conditions in the laboratory. “Hybridization stringency” is a term well understood to those of ordinary skill in the art. A particular, non-limiting example of stringent (e.g. high stringency) hybridization conditions are hybridization in 6× sodium chloride/sodium citrate (SSC) buffer at about 45 degrees Celsius, followed by one or more washes in 0.2×SSC, 0.1% SDS at 50-65 degrees Celsius. Hybridization stringency may also be varied and used to identify and isolate nucleic acid sequences having different percent identity with the probe sequence.

In various embodiments of the invention, 5′ and 3′ flanking sequences of the invention are selected from a host cell enzyme gene sequence described herein. Moreover, in the Examples section provided herewith, the construction of various nucleic acid constructs is provided. As one of ordinary skill in the art would recognize, the invention is not limited to only those sequences disclosed herein because these examples provide ample teaching to select similar 5′ and 3′ sequences from host cell enzyme identified in sequence databases.

These sequences can, for example, have an identity at least 80%, 85%, 90%, 95% and 100% to the corresponding nucleic acid sequences of the host cell enzyme gene.

Another embodiment of the invention provides a construct for the transformation of a photoautotrophic host cell by disrupting a host cell gene sequence encoding a host cell enzyme in order to increase the biosynthetic level of pyruvate, acetyl-CoA, acetaldehyde or precursors thereof in the host cell, comprising:

    • a heterologous nucleic acid sequence comprising a promoter and a first gene encoding at least one overexpressed first enzyme for the formation of ethanol from the first metabolic intermediate under the transcriptional control of the promoter, wherein
    • the heterologous nucleic acid sequence is flanked at its 5′ and 3′ end by nucleic acid sequences that bind to said host gene.

Such a construct can, for example, be used in order to knock out a gene encoding a host enzyme for conversion of a first metabolic intermediate, which can be pyruvate, acetyl-CoA, acetaldehyde or precursors thereof and at the same time, introduce via genetic engineering a gene encoding a first enzyme for the formation of ethanol. Such a construct can therefore be used in order to enhance the level of a first metabolic intermediate in a genetically modified host cell and at the same time use this first metabolic intermediate as a substrate for ethanol production.

The 5′ and 3′ flanking nucleic acid sequences are preferably highly identical, more preferably completely identical, to the corresponding parts of the host cell gene encoding the host cell enzyme. Such a construct is integrated into the host genome of a host cell via homologous recombination.

Homologous recombination involves the alignment of similar sequences, preferably homologous nucleic acid sequences located in different nucleic acid strands, for example a recombinant integrative plasmid and the chromosome of a host cell. After a crossover between the aligned nucleic acid strands, the nucleic acid strands are broken and repaired in order to produce an exchange of nucleic acid material between the chromosome and the recombinant integrative plasmid. The process of homologous recombination naturally occurs in many host cells, for example cyanobacteria such as Synechocystis and can be utilized as a molecular biology technique for genetically engineering organisms and introducing genetic changes into the organisms. The 5′ and 3′ flanking nucleic acid sequences each can have a length of a few hundred base pairs, preferably at least around 500 base pairs or more, in order to enable homologous recombination. The length can be up to 1.5 kilobases or even 2 kilobases.

In various embodiments of the invention, the heterologous nucleic acid sequence further comprises a second gene encoding at least one overexpressed second enzyme converting the first metabolic intermediate into a second metabolic intermediate, wherein the at least one overexpressed first enzyme converts the second metabolic intermediate into ethanol.

In such a case the first metabolic intermediate can comprise pyruvate and the second metabolic intermediate can comprise acetaldehyde and the second gene can encode pyruvate decarboxylase converting pyruvate into acetaldehyde, and the first gene can encode alcohol dehydrogenase converting acetaldehyde into ethanol.

Alternatively, the first metabolic intermediate can comprise pyruvate and the second metabolic intermediate can, for example, comprise acetyl-CoA. In this case the first gene can encode pyruvate dehydrogenase, pyruvate formate lyase or pyruvate-ferredoxin-oxidoreductase which can convert pyruvate to acetyl-CoA. The second gene then can encode a coenzyme A dependent aldehyde dehydrogenase which can convert acetyl-CoA to acetaldehyde. In this case a third gene can be introduced into the construct which encodes alcohol dehydrogenase which can convert acetaldehyde to ethanol. Therefore, constructs according to certain embodiments of the inventions can comprise more than two or even more than three genes encoding more than two or three enzymes involved in ethanol formation.

Alternatively the first metabolic intermediate can comprise acetyl-CoA and the first gene can be alcohol dehydrogenase AdhE directly converting acetyl-CoA into ethanol. In this case one enzyme can be sufficient to trigger ethanol formation in a genetically modified host cell.

Furthermore a co-expression of the enzymes AdhE, Adh and Pdc in parallel is also able to convert acetyl-CoA into ethanol (e.g. in combination with a blocked or reduced acetate and lactate pathway) and to convert pyruvate into ethanol in parallel. This could avoid that pathways are shifted to acetyl-CoA in case of Pdc and Adh expression or to pyruvate in case of AdhE expression.

A further embodiment of the invention is directed to a genetically modified photoautotrophic, ethanol producing host cell comprising:

    • a first genetic modification comprising at least one genetic modification of at least one host cell enzyme that is not pyruvate decarboxylase or alcohol dehydrogenase, wherein the first genetic modification results in an enhanced level of biosynthesis of acetaldehyde, pyruvate, acetyl-CoA or precursors thereof compared to the respective wild type host cell, and
    • a second genetic modification comprising at least one overexpressed enzyme for the formation of ethanol.

The subject matter of a further embodiment of the invention is a construct for the transformation of a host cell by disrupting a host gene encoding a host enzyme for conversion of a first metabolic intermediate for energy production of the host cell or forming reserve compounds, comprising:

    • a heterologous nucleic acid sequence comprising an inducible promoter and a gene encoding the host enzyme for conversion of the first metabolic intermediate for energy production of the host cell or forming the reserve compounds under the transcriptional control of the inducible promoter, wherein
    • the heterologous nucleic acid sequence is flanked at its 5′ and 3′ end by nucleic acid sequences which are able to bind to at least parts of said host gene.

As mentioned above, the 5′ and 3′ flanking nucleic acid sequences are necessary in order to ensure the insertion of this construct into the host cell genome, for example via homologous recombination. Such a construct can be useful in the case that the host enzyme for conversion of the first metabolic intermediate or for forming reserve compounds is a very crucial enzyme for the metabolism of the host cell so that it might not be possible to completely knock out this enzyme without killing the host cells during this process. Such a construct can be used in order to replace the uncontrollable wild type host gene by a copy of the gene which is under the control of an inducible promoter. Such a construct enables the controlling of the enzymatic activity of an important metabolic enzyme of the host cell without completely knocking out the enzymatic activity of this enzyme.

The host gene, for example, can encode glycogen synthase. Due to the fact that two copies are sometimes present in the genome of a host cell, two different constructs have to be designed in order to knock out both glycogen synthase coding genes.

The above-mentioned constructs can be part of a recombinant plasmid which further can comprise other genes, which for example encode biocide resistance conferring genes.

Subject matter of a further embodiment of the invention is a method for producing genetically modified host cells comprising the method steps:

A) Providing a wild type host cell showing a wild type level of biosynthesis of a first metabolic intermediate for energy production of the host cell,
B) enhancing the level of biosynthesis of the first metabolic intermediate in comparison to the wild type level by genetic engineering,
C) introducing a first heterologous or endogenous gene into the host cell, the first gene encoding at least one overexpressed first enzyme for the formation of ethanol from the first metabolic intermediate.

Such a method enhances in method step B) the level of biosynthesis of a useful first metabolic intermediate and then introduces in method step C) a gene into the host cell encoding a protein which can use the first metabolic intermediate for ethanol synthesis.

Alternatively first method step C) then method step B) can be carried out. Such a method, can be healthier for the cell due to the fact that the metabolic intermediate, which can be harmful would not accumulate in the cells, e.g. in case of acetaldehyde.

According to a further embodiment of the method of the invention in step C) a second heterologous or endogenous gene can be introduced into the host cell, the second heterologous or endogenous gene encoding at least one overexpressed second enzyme converting the first metabolic intermediate into a second metabolic intermediate, wherein the at least overexpressed first enzyme converts the second metabolic intermediate into ethanol.

As mentioned above, the first metabolic intermediate can comprise pyruvate and the second metabolic intermediate can comprise acetaldehyde so that the second gene can encode pyruvate decarboxylase converting pyruvate into acetaldehyde and the first gene can encode alcohol dehydrogenase converting acetaldehyde into ethanol.

Alternatively the first metabolic intermediate can comprise acetyl-CoA and the first gene can encode the alcohol dehydrogenase AdhE, which directly converts acetyl-CoA into ethanol.

In a further modification of the method of the invention in step A) a wild type host cell can be provided which further comprises a first host gene encoding at least one first host enzyme for conversion of the first metabolic intermediate or for forming reserve compounds, the first host gene is under the transcriptional control of a first host promoter. Then in step B) the activity of the at least one first host enzyme can be reduced by genetic engineering.

In particular, in step B) the activity of the at least one host enzyme can be reduced by mutating either the first host promoter or the first host gene or by disrupting the first host gene by introducing a heterologous nucleic acid sequence into the first host gene.

According to a further embodiment of the method of the invention, in step A) a wild type host cell can be provided which further comprises a second host gene encoding at least one second host enzyme for forming the first metabolic intermediates or precursors thereof, the second host gene is under the transcriptional control of a second host promoter, and then in step B) the activity of the at least one second host enzyme is enhanced by genetic engineering. The activity of the at least one second host gene can be enhanced by mutating either the second host promoter or the second host gene or by overexpressing the second host enzyme.

Another embodiment of the invention furthermore provides a genetically modified photoautotrophic, ethanol producing host cell comprising:

    • an overexpressed pyruvate decarboxylase converting pyruvate to acetaldehyde, and
    • an overexpressed zinc-dependent alcohol dehydrogenase, converting acetaldehyde to ethanol.

As already mentioned above, the pyruvate decarboxylase as well as the alcohol dehydrogenase can be heterologously or endogenously overexpressed which means that they can already be present in an unmodified wild type host cell or be introduced as a heterologous enzyme which naturally only occurs in a different host cell into the genetically modified host cell of this embodiment of the invention. Zinc-dependent alcohol dehydrogenases are much more oxygen-insensitive than iron-dependent alcohol dehydrogenases which can result in a higher activity of Zinc-dependent alcohol dehydrogenases.

Furthermore experimental data show that the Adh enzyme from Synechocystis is a member of the Zn2+-binding GroES-like domain alcohol dehydrogenase phylogenetic family and does not catalyze the disadvantageous back-reaction, the oxidation of the formed ethanol back into acetaldehyde or only catalyzes this reaction to a very small extent. This results in a higher ethanol production rate and in addition in a higher growth rate of the genetically modified cells compared to genetically modified cells containing an Adh enzyme, which also catalyzes the oxidation of ethanol back to acetaldehyde, such as AdhI or Adh II from Zymomonas mobilis. These enzymes are also not cyanobacterial enzymes.

In a further embodiment of this invention the Zn2+ dependent alcohol dehydrogenase enzyme is therefore selected from a group consisting of the sub-clades A, sub-clades B and sub-clades C of the Zinc-binding GroES-like domain alcohol dehydrogenases as determined by the phylogenetic analysis mentioned below. In particular the Adh enzyme from Synechocystis is a member of the sub-Glade B of the GroES-like domain alcohol dehydrogenases Glade (see FIG. 47A). The Zn2+ dependent alcohol dehydrogenase enzyme can furthermore be selected from a cyanobacterial Zn2+ dependent alcohol dehydrogenase enzyme. In yet another embodiment of the invention the Zn2+ dependent alcohol dehydrogenase enzyme has at least 60%, preferred at least 70% or 80% or most preferred 90% sequence identity to the amino acid sequence of Synechocystis Adh.

Genetically modified photoautotrophic, ethanol producing host cells comprising an overexpressed pyruvate decarboxylase converting pyruvate to acetaldehyde, and an overexpressed zinc-dependent alcohol dehydrogenase, converting acetaldehyde to ethanol can reach the following high ethanol production rates under continuous exposure to light for 24 hours a day (rates in % EtOH (v/v)):

Over a period of 10 days a daily production of 0.005 can be reached, more preferred 0.01% per day and most preferred 0.02% per day. One example is a photoautotrophic cyanobacterial host cell such as Synechocystis, which is transformed with the integrative construct pSK10-PisiA-PDC-ADHII. If normalized to OD750 nm 1, a rate of 0.0032% EtOH (v/v) per OD1 and day can be reached.

Over a period of 25 days a daily production of 0.005 can be reached, more preferred 0.01% per day and most preferred 0.015% per day by using a photoautotrophic cyanobacterial host cell such as Synechocystis transformed with the self-replicating construct pVZ-PnirA-PDC-SynAdh. If normalized to OD750 nm 1, a rate of 0.0018% EtOH (v/v) per OD1 and day can be achieved.

Over a period of 40 day a daily production of 0.004 can be reached, more preferred 0.008% per day and most preferred 0.012% per day for a photoautotrophic cyanobacterial host cell transformed with the self-replicating construct pVZ-PpetJ-PDC-SynAdh). If normalized to OD750 nm 1, a rate of 0.0013% EtOH (v/v) per OD1 and day can be reached.

The following ethanol production rates can be reached for photoautotrophic cyanobacterial host cells under 12 hours light/12 hours dark cycle (day/night cycle) in % EtOH (v/v):

Over a period of few hours (3-4 hours) a daily production of 0.008 is reached, more preferred 0.016% per day and most preferred 0.024% per day. These ethanol production rates can be achieved by using for example a cyanobacterium such as Synechocystis transformed with the integrative construct pSK10-PisiA-PDC-ADHII. If normalized to OD750 nm 1, a rate of 0.0048% EtOH (v/v) per OD1 and day can be measured.

Over a period of 10 days a daily production of 0.004 is reached, more preferred 0.009% per day and most preferred 0.014% per day by using the integrative construct pSK10-PisiA-PDC-ADHII in a cyanobacterial host cell such as Synechocystis. If normalized to OD750 nm 1, a rate of 0.0035% EtOH (v/v) per OD1 and day can be reached.

Over a period of 20 days a daily production of 0.004, more preferred 0.008% per day and most preferred 0.01% per day is reached by using the self-replicating construct pVZ-PnirA-PDC-SynAdh or using the self-replicating construct pVZ-PhspA-Pdc-SynAdh in a for example a cyanobacterial host cell. If normalized to OD750 nm 1, a rate of 0.0017% EtOH (v/v) per OD1 and day can be achieved.

Over a period of 50 days a daily production of 0.003 is reached, more preferred 0.005% per day and most preferred 0.008% per day by using the self-replicating construct pVZ-PnirA-PDC-SynAdh or the self-replicating construct pVZ-PhspA-PDC-SynADH. If normalized to OD750 nm 1, a rate of 0.0010% EtOH (v/v) per OD1 and day can be reached.

All maximal given rates were obtained and measured only in the culture. Losses of ethanol by evaporation are not considered. A person of ordinary skill in the art can calculate a loss of 1% of present ethanol in the culture per day, resulting in a loss of 14% after 30 days and 22% after 50 days.

In general, short term experiments as well as continuous illumination result in higher rates. Different Adh enzyme types differ not significantly in their maximal rates but in the duration of ethanol synthesis and SynAdh experiments result in a longer production caused by a better longevity of the cells because of the missing back reaction from ethanol to acetaldehyde.

In one further embodiment, the invention provides a genetically modified photoautotrophic, ethanol producing host cell comprising:

    • (a) an overexpressed pyruvate decarboxylase enzyme converting pyruvate to acetaldehyde,
    • (b) an overexpressed Zn2+ dependent alcohol dehydrogenase enzyme, converting acetaldehyde to ethanol; and
    • (c) at least one overexpressed ethanol producing enzyme having a different substrate specificity than (a) or (b).

In a further embodiment thereof, (c) comprises an overexpressed ethanol producing enzyme with a substrate specificity for acetyl-CoA or acetylphosphate. In a further embodiment thereof, (c) comprises AdhE converting acetyl-CoA into ethanol, or acetaldehyde dehydrogenase converting acetylphosphate into acetaldehyde, or a CoA-dependent acetaldehyde dehydrogenase converting acetyl-CoA into acetaldehyde.

Another embodiment of this invention also provides a construct for the transformation of a photoautotrophic host cell, the photoautotrophic host cell comprising a host genome, the construct comprising:

    • a coding nucleic acid sequence comprising a first gene encoding a Zinc-dependent alcohol dehydrogenase, wherein
    • the coding nucleic acid sequence is flanked at its 5′ and 3′ end by nucleic acid sequences which are able to bind at least parts of that host genome for integration of the coding nucleic acid sequence into the host genome.

Such a construct can be used, for example, in an integrative plasmid in order to introduce a gene encoding a Zinc-dependent alcohol dehydrogenase into the genome of a host cell, for example the cyanobacterium Synechocystis via homologous recombination.

The construct furthermore can comprise a heterologous or endogenous promoter controlling the transcription of the first gene. This embodiment of the invention also provides a construct for the transformation of a photoautotrophic host cell, comprising:

    • a coding nucleic acid sequence comprising a promoter and a first gene encoding a Zink-dependent alcohol dehydrogenase wherein the first gene is under the transcriptional control of the promoter.

The above-mentioned constructs can be part of a recombinant circular plasmid.

Another embodiment of the invention provides a genetically modified photoautotrophic ethanol producing host cell comprising:

    • an overexpressed alcohol dehydrogenase directly converting acetyl-CoA to ethanol.

Such a genetically modified photoautotrophic host cell only requires one overexpressed alcohol dehydrogenase enzyme, for example AdhE which can be a thermophilic alcohol dehydrogenase, for example obtained from the cyanobacterium Thermosynechococcus in order to produce ethanol from the metabolic products naturally occurring in this host cell or which can be from E. coli.

In addition the enzymatic activity or affinity of AdhE can be increased by introducing mutations, in particular point mutations into the protein via site directed or random mutagenesis. The AdhE is an iron-dependent, bifunctional enzyme containing a CoA-depending aldehyde dehydrogenase and an alcohol dehydrogenase activity. One characteristic of iron-dependent alcohol dehydrogenases (AdhII) is the sensitivity to oxygen. In the case of the AdhE from E. coli a mutant was described that shows in contrast to the wildtype also Adh activity under aerobic conditions. The site of the mutation was determined in the coding region at the codon position 568. The G to A nucleotide transition in this codon results in an amino acid exchange from glutamate to lysine (E568K). The E568K derivate of the E. coli AdhE is active both aerobically and anaerobically. This mutation is therefore a solution for the use of this oxygen-sensitive enzyme in an oxygen-producing photosynthetic host cell. [Holland-Staley et al., Aerobic activity of Escherichia coli alcohol dehydrogenase is determined by a single amino acid, J. Bacteriol. 2000 November; 182(21):6049-54].

In one embodiment, the invention provides a genetically modified photoautotrophic, ethanol producing host cell comprising:

    • (a) an overexpressed alcohol dehydrogenase enzyme, directly converting acetyl-CoA to ethanol;
    • (b) at least one overexpressed ethanol producing enzyme having a different substrate specificity than (a).

In one embodiment thereof, the at least one an overexpressed ethanol producing enzyme of (b) has a substrate specificity for acetaldehyde or acetylphosphate. In a further embodiment thereof, (b) comprises Adh or acetaldehyde dehydrogenase.

Another embodiment of the invention provides a construct for the transformation of a photoautotrophic host cell, the photoautotrophic host cell comprising a host genome, the construct comprising:

    • a coding nucleic acid sequence comprising a gene encoding an alcohol dehydrogenase, directly converting acetyl-CoA to ethanol, wherein
    • the coding nucleic acid sequence is flanked at its 5′ and 3′ end by nucleic acid sequences which are able to bind to at least parts of said host genome for integration of the coding nucleic acid sequence into the host genome.

Such a construct is be useful in order to introduce a nucleic acid sequence encoding for an alcohol dehydrogenase such as AdhE directly converting Acetyl-CoA to ethanol into a host genome, for example via homologous recombination.

Such a construct furthermore can comprise a heterologous or endogenous promoter controlling the transcription of the gene.

In one embodiment, the invention provides a genetically modified photoautotrophic, ethanol producing host cell comprising at least two overexpressed enzymes for ethanol production comprising at least two substrate specificities. In a further embodiment thereof, the at least two substrate specificities are selected from a group consisting of acetyl-CoA, acetaldehyde and acetylphosphate. In yet a further embodiment thereof, the at least two overexpressed enzymes for ethanol production are selected from a group consisting of Adh, AdhE, a CoA-dependent acetaldehyde dehydrogenase and an acetaldehyde dehydrogenase converting acetylphosphate into acetaldehyde.

Another embodiment of the invention provides a genetically modified photoautotrophic, ethanol producing host cell comprising an overexpressed NAD+/NADH cofactor specific alcohol dehydrogenase, wherein the host cell comprises an enhanced level of NAD+/NADH biosynthesis compared to the respective wild type host cell.

Such a host cell exhibits an enhanced level of ethanol formation due to the fact that the alcohol dehydrogenase is overexpressed and its activity is enhanced due to the enhanced intracellular level of NAD+/NADH biosynthesis.

For example, such a genetically modified host cell can comprise a host NADH dehydrogenase converting NADH to NAD+ wherein the activity of the NADH dehydrogenase is reduced compared to the wild type host cell by genetic engineering.

Such genetic engineering can, for example, be done by introducing point mutations into the NADH dehydrogenase reducing its enzymatic activity, by mutating the promoter region of the gene encoding the NADH dehydrogenase which can result in a reduced transcriptional activity or by disrupting the gene encoding the NADH dehydrogenase.

Alternatively or in addition the genetically modified host cell furthermore can comprise a NAD(P)+ transhydrogenase converting NADPH to NADH (electrons are transferred from NADPH to NAD+, so NADP+ and NADH are generated) wherein the activity of this NAD(P)+ transhydrogenase is enhanced compared to the activity of the enzyme in a wild type host cell. This can, for example, be done by overexpressing the NAD(P)+ transhydrogenase.

A further embodiment of the invention provides a genetically modified photoautotrophic ethanol-producing host cell comprising:

    • a heterologous or endogenous nucleic acid sequence comprising a promoter and a gene encoding at least one overexpressed enzyme for the formation of ethanol under the transcriptional control of the promoter, wherein
    • the promoter can be induced by nutrient starvation, oxidative stress, light, darkness, heat shock, cold shock, salt stress, by a change of the nutrient source, by an increase in the concentration of one nutrient or stationary growth of the host cell.

The nutrient can be a metal such as a trace metal for example iron or cooper. Furthermore the nutrient can comprise non-metals such as nitrogen or phosphorus. One example for a nitrogen source is ammonium NH4+ or nitrate NO3. The nirA promoter for example can be induced by a switch from NH4+ to NO3 as a nitrogen source.

Such a genetically modified photoautotrophic host cell can be produced, for example, by introducing a heterologous gene encoding the at least one overexpressed enzyme into the host cell or by introducing an endogenous gene encoding an enzyme, which is already present in the wild type host cell, into the host cell, in order to ensure that a higher level of this enzyme is produced in the genetically modified host cell compared to the wild type host cell.

In the case that the promoter can be induced by nutrient starvation, by a change of the nutrient source or stationary growth of the host cell, these host cells can simply grow into a condition of nutrient starvation or stationary growth in the case that no new growth medium or nutrients is/are added while culturing these host cells. In the case of for example nirA, the preferred nitrogen source ammonium is first used by the cells and then the transcription is induced or increased by changing to the less preferred nitrogen source nitrate. This can, for example, be done by batch culturing these host cells. In this case the host cells are automatically induced when reaching the condition of nutrient starvation or stationary growth and the additional method step of providing an exogenous stimulus for induction of the host cells can be omitted, thereby simplifying the culturing of these host cells.

The inducible promoters can furthermore be selected from a group of promoters consisting of: ntcA, nblA, isiA, petJ, petE, sigB, lrtA, htpG, ggpS, psaA, psbA2, nirA, hspA, clpB1, hliB and crhC.

The promoters hspA, clpB1, and hliB can be induced by heat shock (raising the growth temperature of the host cell culture from 30° C. to 40° C.), cold shock (reducing the growth temperature of the cell culture from 30° C. to 20° C.), oxidative stress (for example by adding oxidants such as hydrogen peroxide to the culture), or osmotic stress (for example by increasing the salinity). The promoter sigB can be induced by stationary growth, heat shock, and osmotic stress.

The promoters ntcA and nblA can be induced by decreasing the concentration of nitrogen in the growth medium and the promoters psaA and psbA2 can be induced by low light or high light conditions. The promoter htpG can be induced by osmotic stress and heat shock. The promoter crhC can be induced by cold shock. An increase in copper concentration can be used in order to induce the promoter petE, whereas the promoter petJ is induced by decreasing the copper concentration. A further embodiment of the invention provides a method for producing ethanol, comprising the method steps of:

    • A) providing and culturing any of the genetically modified host cells as described above in a growth medium under the exposure of light and CO2, the host cells accumulating ethanol while being cultured,
    • B) isolating the ethanol from the host cells and/or the growth medium.

The method step A) of this method can comprise the step of providing host cells, which comprise a genetically modified gene encoding at least one enzyme for the formation of ethanol under the transcriptional control of an inducible promoter, which can be induced by exposure to an exogenous stimulus. In this case the method step A) can further comprise the sub-steps:

    • A1) culturing the host cells under the absence of the exogenous stimulus or under a low presence of the exogenous stimulus, and thereafter
    • A2) providing or enhancing the exogenous stimulus, thereby inducing or enhancing ethanol production.

In particular inducible promoters can be used, which show a small level of basal transcription even in the absence of the exogenous stimulus or which are active at least to a certain degree even if the nutrient is present in the growth medium. Such examples are the nirA or the petJ promoter. Furthermore someone can let the photoautotrophic cells grow into a condition of nutrient starvation by not supplying a desired nutrient to the cells. The cells then consume the nutrient and gradually grow into a condition of nutrient starvation. If these promoters are used the ethanol production rate can gradually increase during cultivation rather than be turned on immediately after induction.

In the above described methods for producing ethanol, the exogenous stimulus can be provided by changing the environmental conditions of the host cells. This can be done for example by changing the growth medium via centrifugation of the cells and re-suspending the cells in a growth medium, which lacks the nutrient (for promoters, which are induced by nutrient starvation) or which contains a different source for the nutrient. Furthermore the cells might simply grow into the condition of nutrient starvation.

A further variant of the method for producing ethanol is described, wherein

    • the exogenous stimulus comprises nutrient starvation, and
    • method step A2) comprises letting the host cell culture grow into a condition of nutrient starvation by consuming the nutrient while growing, and
    • after method step A2) the nutrient is added in order to reduce or abolish the exogenous stimulus, thereby leading to method step A1).

The nutrient starvation can also lead to a reduction in the photosynthetic activity of the photoautotrophic cells, if for example iron and nitrogen starvation are used for induction. In these cases it is possible to supply the nutrient to the photoautotrophic cells again after a certain period of time of induction and ethanol production in order to allow the cells to recover their photosynthetic activity in an uninduced state. Furthermore by periodically supplying the nutrient to the photoautotrophic cells a “biphasic” long term culture can be maintained, wherein an uninduced state (method step A1) alternates with an induced state (method step A2). The promoters, which are inducible by nutrient starvation or by a change of the nutrient source are preferably selected from a group consisting of: isiA, nblA, ntcA, nirA, and petJ.

Furthermore the impact of nitrogen starvation on the photosynthetic activity also can be reduced if the host cell culture comprises nitrogen (N2) fixing so called diazotrophic host strains. Upon reaching the condition of nitrogen starvation, these strains can switch to nitrogen fixation. The reduction of N2 to ammonia is catalyzed by the nitrogenase, an enzyme complex, which is irreversibly inactivated by O2. Therefore photosynthetic N2-fixing organisms have two conflicting metabolic systems in one cell: oxygen evolving photosynthesis and oxygen-sensitive nitrogen fixation. Among cyanobacteria many unicellular and filamentous strains are able to fix nitrogen and have evolved various strategies to protect the nitrogenase from oxygen. For example, certain strains of Gloeothece and Synechococcus evolved a temporal separation of oxygenic photosynthesis and nitrogen fixation, while other (filamentous) strains developed specialized cells, called heterocysts, for N2-fixation. These heterocysts are able to supply the fixed nitrogen to the so-called vegetative cells of the filament, which cannot fix nitrogen, but maintain photosynthesis instead. Examples for nitrogen fixing cyanobacteria are filamentous cyanobacteria from the genus Anabaena such as Nostoc/Anabaena spec. PCC7120 and Anabaena variabilis ATCC 29413.

Nitrogen fixing photoautotrophic host cells such as cyanobacteria can also be transformed with constructs containing genes encoding ethanologenic enzymes under the control of inducible promoters, which can be induced by other conditions than nitrogen starvation, for example iron starvation (isiA promoter) or even by an increase in the copper concentration (petE promoter).

The construct used for transforming and manufacturing these genetically modified host cells can, for example, be a construct for the transformation of photoautotrophic host cell, comprising:

    • a heterologous or endogenous nucleic acid sequence comprising a promoter, which can be induced by nutrient starvation of the host cell, and
    • a gene encoding at least overexpressed enzyme for the formation of ethanol under the transcriptional control of the promoter.

This constructs can be introduced into the host cell, for example via electroporation, conjugation, by using natural competence for DNA uptake or any other method for genetic transformation known in the art.

In a further embodiment of this invention, the construct for the transformation of the photoautotrophic host cell furthermore comprises flanking 5′ and 3′ nucleic acid sequences for the heterologous or endogenous nucleic acid sequences, which are able to bind to at least parts of the host genome of the host cell to be transformed for integration of the heterologous nucleic acid sequence into the host genome. The integration can, for example, be done by homologous recombination.

Embodiment of Screening Strains

A further embodiment of the invention provides a method for testing a photoautotrophic strain for a desired growth property selected from a group of properties consisting of ethanol tolerance, salt tolerance, above neutral pH tolerance, mechanical stress tolerance, temperature tolerance and light tolerance, comprising the method steps of:

a) providing a photoautotrophic strain to be tested,
b) cultivating the photoautotrophic strain to be tested in a liquid growth medium and subjecting the photoautotrophic strain to a condition selected from a group of conditions of:

    • adding ethanol to the growth medium,
    • adding salt to the growth medium,
    • increasing the pH of the growth medium,
    • agitating the growing culture,
    • increasing the temperature of the growing culture,
    • subjecting the photoautotrophic strain to light,
      c) determining the viability of the cells of the photoautotrophic strain cultivated in the step b).

Such a method can be used in order to identify photoautotrophic strains tolerant to certain growth conditions to which they are subjected during the cultivation and production of, for example, ethanol.

Ethanol can be harmful to cells. Therefore, searching for and identifying ethanol-tolerant strains improves the ethanol production, because these cells can produce a high amount of ethanol without being affected too much by the produced ethanol.

In addition, salt-tolerant strains can also be cultured in brackish or even sea water, which is easier to obtain and cheaper than fresh water. The inventors made the observation that fresh water photoautotrophic cells, in particular fresh water cyanobacterial cells often have a higher photosynthesis rate than comparable marine species. Due to that it can be advantageous trying to culture fresh water species, having a high tolerance to salt water in brackish water or even in sea water. In this case the higher photosynthesis rate of the fresh water species can also result in a higher ethanol production rate of a genetically modified fresh water species, because the carbohydrates and other metabolic products produced by the photosynthesis can serve as substrates for the overexpressed enzymes for ethanol formation.

A tolerance to above neutral pH conditions in the growth medium can also have a positive effect on the rate of photo-synthesis. This can be due to the fact that at pH values above neutral (in the range pH 8) hydrogencarbonate (HCO3, bicarbonate) has a higher mole fraction in a liquid aqueous growth medium than at a lower pH. Therefore, more hydrogencarbonate can be used by the genetically modified cells having a high pH tolerance for carbon fixation. Although cyanobacteria fix carbon as CO2 by the enzyme RubisCO most of the carbon that is taken up by the cell can be HCO3, which is than converted into CO2 by the enzyme carbonic anhydrase before its fixation as CO2 by the RubisCO. In cyanobacterial cells the enzymes RubisCO (ribulose-1,5-bisphosphate carboxylase/oxygenase) and carbonic anhydrase are both arranged in the so called carboxysomes, an intracellular CO2-concentrating structure (microcompartment). Carboxysomes are mainly found in all cyanobacterial species and some other bacteria, for example nitrifying bacteria. Due to the complexation of RubisCO with the enzyme carbonic anhydrase, which catalyzes the following reaction:


HCO3+H+→H2CO3→CO2+H2O

The hydrogencarbonate taken into the cell from the liquid growth medium around the cell can be converted back to carbon dioxide, which then in turn can be used by RubisCO in order to transfer carbon dioxide to ribulose-1,5-bisphosphate thereby producing two molecules of 3-phosphoglycerate. As a result high alkaline pH of the growth medium, which favors formation of hydrogencarbonate greatly enhances the carbon fixation of the cells cultured in this growth medium. Therefore, if more carbon is fixed by the cell as a precursor of pyruvate, acetyl-CoA, or acetaldehyde, then there may be more substrate for the overexpressed enzyme for production of ethanol and ethanol production of these genetically modified cells is increased. In particular, some photoautotrophic strains, for example some cyanobacterial strains can be adapted to grow in alkaline growth media having a pH of >8, preferably 9, some preferred 11 to 12.

Screening for and identifying photoautotrophic strains having a high mechanical stress tolerance can improve the culturing of these cells. During culturing the growth medium containing the cells can be stirred or the growth medium containing the cells can be pumped from one location to another location thereby subjecting the cells to a high mechanical stress.

Furthermore, the photoautotrophic cells can be cultivated in regions having a high daytime temperature and high solar radiation. As a result, identifying photoautotrophic strains, which are tolerant to a high temperature in the growth medium and to a high amount of solar light can improve the cultivation of these cells in, for example, sunny and dry or even desert landscapes.

Determining the viability of the screened photoautotrophic strains can comprise determining at least one parameter selected from a group of parameters consisting of:

    • growth rate of the photoautotrophic strain,
    • ratio of living to dead cells,
    • ability to be recultivable in a liquid growth medium in the absence of the stressful conditions,
    • microscopic analysis of the photoautotrophic strain.

Any of these methods and parameters can be suitable to determine whether a strain subjected to any of the above-mentioned stressful growth conditions is still viable or not. The growth rate of the photoautotrophic strains can, for example, be determined by measuring the optical density of the cells, for example at a wavelength of 750 nm in a photometer. The optical density can be measured before subjecting the photoautotrophic strain to a stressful condition and can also be taken at certain points of time while cultivating the photoautotrophic strain under the stressful condition. For example the optical density of a 0.1-1 ml aliquot taken from the cell culture can always easily be determined in a photometer at a wavelength of 750 nm for cyanobacterial cells, especially in case of non-filamentous cyanobacterial strains. Further possible methods are cell counting or determination of the biovolume of the cells.

The ratio of living to dead cells in a cell culture can, for example, be determined by detecting the presence of a photopigment in the photoautotrophic cells. The photopigment can be a chemical entity that undergoes a physical or chemical change when subjected to light, for example chlorophyll, carotenoids and phycobilins. These photopigments are normally excited to a high energy state upon absorbing a photon. The photopigments can relax from this excited high energy state by converting the energy into chemical energy and, for example, induce light-driven pumping of ions across biological membranes, as is the case, for example for bacteriorodopsin or via excitation and transfer of electrons released by photolysis. This reaction can lead to a light-driven electron transfer chain pumping protons across the membranes of the cells.

The presence of the photopigment can, for example, be detected by measuring the fluorescence of the photopigment, for example the red auto fluorescence of chlorophyll. The maximum of the fluorescence emission spectrum is at approx. 700 nm.

The ability to be recultivable in a liquid growth medium without the stressful condition to which the photoautotrophic strain was subjected beforehand can also be an indication of the viability of the strain. For example a recultivation is considered to be successful in the case that within, for example 72 hours after starting with the recultivation the recultivated culture is growing again and e.g. an increase in the optical density of the cell culture can be observed.

Microscopic analysis can be an easy to handle tool to assess the amount of cell debris and of bleached photoautotrophic cells, which do not contain photopigments any more. For example an initial ethanol tolerance can be conducted, subjecting the strain to a stepwise increased ethanol concentration (for example 5 vol % to 20 vol % of ethanol increased in 5 vol % steps) and a photoautotrophic strain can be considered as an ethanol tolerant strain in the case that at least 50% of the cells can survive a concentration of around 10 vol % of ethanol in the growth medium. Living cells can be distinguished from dead and often lysed cells for example under a microscope.

A further embodiment of this method of the invention comprises the modification that steps b) and c) are repeated alternatively and in a subsequent step b2) after a first step b1) the conditions are changed in comparison to the foregoing step b1) by at least one of:

    • increasing the amount of ethanol in the growth medium,
    • increasing the amount of salt in the growth medium,
    • increasing the pH in the growth medium,
    • increasing the rate of agitation during cultivation, and
    • increasing the temperature during cultivation.

In this embodiment of the method, a first step b1) is performed in which a stressful condition is introduced for the host cells, for example adding ethanol, adding salt, increasing the pH of the growth medium or increasing the rate of agitation in the growth medium or raising the temperature of the growth medium for the first time. In a subsequent step c1) the viability of the cells subjected to the stressful conditions in step b1) is analyzed and then, in a further subsequent step b2) the already present stressful conditions are increased by increasing, for example, the amount of ethanol, the amount of salt, the pH of the growth medium or the rate of agitation and the temperature of the growth medium during cultivation in comparison to the condition present in step b1).

Such a method is a good evaluation tool in order to find out how a photoautotrophic strain can react to an increasing stress condition and up to which levels a certain stress condition is tolerated by a photoautotrophic strain.

In particular, the amount of ethanol in the growth medium can be increased stepwise between successive steps b1), b2) and even further steps b3) and so on. For example, the amount of ethanol in the growth medium of the photoautotrophic strain can be increased starting with 5 volume percent of ethanol and increasing the amount of ethanol in the growth medium in 5 volume percent steps up to a concentration of 20 volume percent ethanol in the growth medium. Such an administration scheme of ethanol can be suitable for a so called “initial ethanol tolerance test” in order to evaluate whether a photoautotrophic strain has a certain degree of tolerance to ethanol or not.

For example, a 5 volume percent concentration of ethanol in the growth medium can be introduced into the growth medium for at least 10 minutes and then an aliquot of the photoautotrophic strain culture, for example a 1 ml aliquot can be taken in order to determine the optical density (OD) of the cell culture, for example at a wavelength of 750 nm.

This cell density can then be compared to an OD measurement taken before the addition of ethanol to the culture. Such a 10 minute 5 volume percent concentration test of ethanol can be sufficient in order to determine whether a photoautotrophic strain has some degree of tolerance to ethanol or not. In the case that a microscopical observation of the culture shows that there is no change, that means there is still about the same amount of living cells in the culture, the ethanol concentration can then be increased in 5 volume percent steps. For example, it is possible to subject the strain to a concentration of 10 volume percent of ethanol for 24 hours and after that determine the optical density again and also perform the microscopic check of the culture. After that the concentration of ethanol can be raised again to 15 volume percent for at least 24 hours and then maybe, after having taken another aliquot for OD measurement, the culture can be subjected to a concentration of 20 volume percent of ethanol for two hours.

The recultivation of the culture subjected to high ethanol concentrations can be done, for example by centrifuging the photoautotrophic cell cultures in a centrifuge, for example for 10 minutes at 3,000 rounds per minute (about 3,000 to 4,000 g) in the case of cyanobacterial cells. The pellet can then be resuspended in fresh media without ethanol and then again this culture can be cultivated for at least, for example 72 hours, and the optical density can, for example, be measured again after 24, 48 and 72 hours and also at the starting point of the culture in order to determine the growth rate of the recultivated culture.

Beside varying the end concentrations or values of ethanol, salt, pH, temperature, rate of agitation and so on, also the increments of increasing steps of stresses (e.g. 2.5% or 7.5% steps of ethanol increase) as well as the time period of stress treatment (e.g. 12 hours or 48 hours at 10% ethanol) can be varied. The general principle of screening allows for an adaptation of the detailed screening parameter subject to the results and the experiences collected.

Alternatively the amount of ethanol can be continuously increased during step b). For example it is possible that during step b) the ethanol is added to the growth medium with a certain flow rate, for example by using a pump such as an liquid chromatography (LC) pump and the flow rate is increased between successive steps b) until a maximum flow rate is reached and then the flow rate is reduced between the further successive steps b) again. Such an adding scheme of ethanol results in a sigmoid curve of the concentration of ethanol in the growth medium. Such a sigmoidal curve, for example, can mimic the ethanol production by a genetically altered photoautotrophic ethanol producing cell (see publication “Ethanol production by genetic engineering in Cyanobacteria” from Deng and Coleman, 1999; Applied and Environmental Microbiology, February 1999, pages 523-528). This was also observed by the inventors. Therefore such an administration scheme can be particularly valuable in order to determine whether a certain photoautotrophic strain is tolerant to a rising ethanol concentration produced by overexpressed enzymes in the cell. Such a test which is also called a “exact ethanol tolerance test” can also be used in order to assess the exact ethanol concentration tolerated by a certain photoautotrophic strain.

It is also possible to conduct a so-called “long term ethanol tolerance test” by testing for a long time, for example for weeks or months, whether a certain photoautotrophic strain can tolerate relatively low ethanol concentrations of, example given, 0.2, 1 or 5 volume percent in the growth medium. Depending on the growth rate of the strain this test can also be carried out for a period of time corresponding to a certain number of cell divisions for example up to 30 or 40 cell divisions.

Ethanol tolerant strains, which can tolerate a high amount of ethanol for a short time, can be tolerant to between 13 to 17 or more volume percent of ethanol for a short term of around 24 to 26 hours, whereas photoautotrophic strains tolerant to a small amount of ethanol for a long period of time can tolerate 0.2 to 5 volume percent of ethanol for weeks or around 30 to 40 cell divisions.

Another method of the invention furthermore can comprise that

    • method step b) comprises the sub steps b1) and b2) and method step c) comprises the sub steps c1) and c2)
    • a plurality of different photoautotrophic strains to be tested are first subjected to a first condition including adding a first amount of ethanol to the growth medium in the method step b1) and
    • cultivating the different photoautotrophic strains for a first period of time during method step b1) and identifying the photoautotrophic strains found to be tolerant to the first condition in method step c1) and thereafter
    • subjecting the photoautotrophic strains identified in method step c1) to a second amount of ethanol for a second period of time in a subsequent step b2), and
    • identifying the photoautotrophic strains tolerant to the second condition in a method step c2),
    • the first amount of ethanol being higher than the second amount of ethanol, and
    • the first period of time being smaller than the second period of time.

Such an embodiment of the method of the invention is able to identify photoautotrophic strains which can tolerate a high amount of ethanol for a small time in the method steps b1) and c1) and also can tolerate small amounts of ethanol for a relative long time in the method steps b2) and c2).

The tests whether the photoautotrophic strain can tolerate a high amount of ethanol for a small time can be used to mimic the ethanol production when using genetically modified photoautotrophic host cells with enzymes for ethanol production under the transcriptional control of inducible promoters. In such a case the cells can be first grown to a very high cell density in an uninduced state without the production of ethanol and then, after induction, a high amount of ethanol can be produced in a short period of time.

In contrast, the test for ethanol tolerance of relatively small amounts of ethanol for a long time can mimic the ethanol production using long cultivation times with constitutive promoters, which are active without induction. In such a case the cells always produce relatively small amounts of ethanol during the whole period of cultivation.

Furthermore during method step b) salt can be added to the growth medium by adding for example brackish water, salt water or so-called “artificial sea water”.

In a further modification of the method of the invention, during method step b) the growth medium is stirred during the cultivation in order to mimic mechanical stress conditions. This can be done, for example by using a magnetic stirrer at a velocity of 5,000 rounds per minute and the optical density of such a cell culture can be checked before applying the mechanical stress and after 48 hours and 96 hours of the cultivation with the mechanical stress. A photoautotrophic strain found to be tolerant to such a mechanical stress situation preferably should still grow so that an increase in the optical density can be observed.

In particular a stress tolerant photoautotrophic strain can be distinguishable from a photoautotrophic strain, which is not stress tolerant by its ability to grow in moved and pumped water in comparison to a non-mechanical stress tolerant strain, which can only grow in relatively still water.

In order to assess the tolerance for high temperature conditions during method step b), the photoautotrophic strain is cultivated in a growth medium at elevated temperatures of at least 42° C. or even at 45° C. for more than 48 or 96 hours. Again the optical density can be measured before increasing the temperature of the growth medium and also after 48 and 96 hours in order to determine the growth rate of the photoautotrophic strain under high temperature conditions. A photoautotrophic strain which is high temperature tolerant still has to grow under these conditions whereas a photoautotrophic strain which is not tolerant to these conditions cannot grow anymore.

If someone wants to determine, what growth speed and which maximal optical density can be reached by certain strains and whether a certain photoautotrophic strain can tolerate relatively low ethanol concentrations of, e.g., 0.2, 1 or 5 volume percent in the growth medium during method step b), the photoautotrophic strain can be subjected to a first light intensity and a first CO2 concentration in the lag phase and in the exponential growth phase and after having reached a stationary phase the light intensity and the carbon dioxide concentration can be increased to a second light intensity and to a second carbon dioxide concentration.

In addition, samples of the strain can be taken at different growth phases (lag, log, stationary phase and stationary phase after addition of ethanol) for later analysis of the intracellular metabolites.

Such a test can determine the growth behavior of the photoautotrophic strain to be cultured under high light conditions and high carbon dioxide concentrations. The light intensity and the carbon dioxide concentrations can be increased when the photoautotrophic strain has reached stationary growth in order to test whether the light intensity and the carbon dioxide concentrations are limiting factors for the growth of the cells. If this is the case the cells can start growing again after having reached stationary phase when exposed to higher light intensity and higher carbon dioxide concentrations. For example, the first light intensity can be 40 μE/m2·s per day and then it can be increased to 120 μE/m2·s and further to 220 μE/m2·s once the stationary phase is reached. In general the light intensity can vary between 40 μE/m2·s and 100 μE/m2·s. The carbon dioxide concentration can be increased from 0.5 vol % to 5 vol % or can vary between 2 vol % and 5 vol %.

For the determination of light tolerance strains with defined cell densities at the beginning of the experiment should be cultivated under certain light intensities (e.g. 100, 250, or 500 μE/m2·s) for at least 5 days and growth rates should be measured as it was done in the other tests.

In addition to testing the ability of a photoautotrophic strain to be tolerant to certain stressful growth conditions, it also can be useful to test the presence and the amount of toxins produced by the photoautotrophic strain. This, for example, can be done by high performance liquid chromatography (HPLC) and/or mass spectrometry(MS). Using analytical standards both methods can identify and quantify a toxin. In case of the HPLC the quantification is usually more exact by using toxin-specific absorption maxima for the quantification whereas in case of MS the identification is more exact by detecting the molecular mass of a toxin. Toxins produced by the photoautotrophic strains can also be released into the environment during cultivation and can pose harm to any people involved in the cultivation of these strains or to the environment. Therefore these strains have to be filtered out from the above screening procedures and normally cannot be used for ethanol production. Or the genes responsible for the toxin producing enzymes have to be knocked out by genetic engineering.

Furthermore, the photoautotrophic strains identified to be tolerant to certain stressful cultivation conditions also should be genetically transformable. This is due to the fact, that enzymes for ethanol production might have to be introduced into these photoautotrophic cells in order to obtain a sufficient ethanol production rate. Due to that an above-mentioned screening method also can comprise the method step of:

    • subjecting the photoautotrophic strain to a transforming factor, conferring a marker property,
    • detecting the presence of a marker property in the strain.

The marker property can be any easily detectable marker property, for example an antibiotic resistance or for example fluorescence. The transforming factor can be a plasmid, which can be introduced into the photoautotrophic cell for genetic modification. The plasmid can be an extra chromosomal, self-replicative plasmid, which is introduced into the cell without being integrated into the genome of the host cell. Additionally or alternatively an integrative plasmid can be used, which can be integrated into the genome of the host cell, for example via homologous recombination. Tests for genetic transformability can, for example, include a test for conjugation or a test for the natural competence of a strain to take up DNA. In addition, electroporation tests can also be performed. In order to identify transformable photoautotrophic strains the strains can be cultivated on agar plates or liquid cultures including the corresponding antibiotic after transformation. False positive strains due to naturally occurring resistances of cells can be eliminated by performing a polymerase chain reaction (PCR) in order to detect the plasmid in the transformed cells.

Another reporter for a transformation event could be the green fluorescence protein (GFP) allowing for the detection of an transformed plasmid under the microscope. The expression of gene encoding for the green fluorescence protein (GFP) on a plasmid leads to autofluorescence after a successful transformation after UV excitation of the cell.

In addition the method for screening the photoautotrophic strains also can comprise the further step of determining the photosynthetic activity of the photoautotrophic strain to be tested. The rationale behind this additional testing step can be that, on the one hand someone can screen for photoautotrophic strains having a high tolerance for stressful cultivation conditions, but on the other hand someone also wants to identify a photoautotrophic strain having a high photosynthetic activity. Such a method step can be useful in order to further distinguish high stress tolerant photoautotrophic strains with a low photosynthesis rate from other high stress tolerant photoautotrophic strains with a high photosynthesis rate. The photosynthesis rate, for example, can be measured by the oxygen generation of the photoautotrophic strain in different growth phases using an oxygen electrode.

A minimum rate that should be observed in the test should be 150 μMol O2/h·mg chlorophyll (180 μMol O2/h·mg chlorophyll e.g. corresponds to the Model organism Synechocystis PCC6803).

In particular a photoautotrophic strain with a high oxygen production is desirable because high oxygen production correlates with a high CO2 fixation, which result in high levels of ethanol formation. Also a strain can be subjected to certain growth conditions (e.g. marine media, higher pH, higher temperature, higher bicarbonate content etc.) and then be checked for the photosynthesis rate under these conditions.

A so-called “initial growth test” can be carried out in order to get a good hint of the photosynthetic activity of the photoautotrophic strains by a more or less simple comparison of growth speed of strains allowing for an easier test and a higher throughput of strains. Beside the optical density or biovolume also the dry weight production should be determined as a growth parameter, that also corresponds to the carbon fixation in the same way as the generation of oxygen.

A further embodiment of the above-mentioned screening method can include a method for identifying a photoautotrophic strain with a tolerance for at least a first and a second growth condition selected from the above-mentioned growth conditions from a plurality of different photoautotrophic strains, comprising:

    • culturing the plurality of different photoautotrophic strains under a first growth condition in method step b1),
    • identifying the photoautotrophic strains tolerant to the first growth condition in method step c1) and thereafter
    • culturing the photoautotrophic strains identified in method step c1) under a second growth condition in a further step b2), the second growth condition being different from the first growth condition,
    • identifying the photoautotrophic strains tolerant to the second growth condition in method step c2).

During such a screening method photoautotrophic strains found to be tolerant to a first stressful condition are then selected for screening for a second, different stressful growth condition. Such a screening method is useful in order to identify photoautotrophic strains having multiple tolerances for different stressful growth conditions.

For example the stressful growth conditions can be high light intensity as well as high concentrations of ethanol, or other stressful growth conditions, such as above neutral pH growth media and high salinity growth media. Such a method can also be used in order to identify photoautotrophic strains having a tolerance to more than two stressful growth conditions. This can simply be done by extending the above-described method by further method steps for example b3) and c3) using the photoautotrophic strains found to be tolerant to the second stressful growth condition for further screening.

In a further embodiment of the method of the invention, the method can be used to identify a photoautotrophic strain with a tolerance for at least the first an the second stressful condition and additionally at least one desired property selected from a group consisting of:

    • high photosynthetic activity, lack of ability to produce toxins and ability to be genetically transformable
      from the plurality of different photoautotrophic strains, comprising at least one further method step d) selected from a group of method steps consisting of:
    • determining the photosynthetic activity of the photoautotrophic strain,
    • subjecting the photoautotrophic strain to a transforming factor, conferring a marker property, and detecting the presence of the marker property in the strain, and
    • determining the presence and amount of toxins produced by the photoautotrophic strain, and
    • identifying the photoautotrophic strain having any of the above abilities in a further method step d),
    • wherein the method steps d) and e) can be performed before or after the method steps b1) and c1) or b2) and c2).

Such a method can be used in order to additionally screen for photoautotrophic strains which have a high photosynthetic activity, a lack of ability to produce toxins and the ability to be genetically transformable. These further tests can be done before or after the screening tests for stressful growth conditions.

In a further variant of the method of the invention the method steps d) and e) are performed before method steps b1) and c1) or b2) and c2).

In particular in one embodiment of the method of the invention the first method step d) of the screening method comprises determining the photosynthetic activity of the photoautotrophic strain. This can for example be done by carrying out the “test for photosynthetic activity” as later described therein. Photoautotrophic strains are identified as being positive in this test if they show a minimum photosynthetic activity of at least 150 μMol O2/h·mg chlorophyll, more preferred 200 μMol, most preferred at least 250 μMol O2/h·mg chlorophyll.

An evaluation of around 180 photoautotrophic strains tested in the screening method of the invention shows that only roughly 30% of the tested strains exhibit photosynthetic rates, which satisfy these above values. In contrast to that, most of the tested photoautotrophic strains would pass the test for short term and long term ethanol tolerance (roughly 75% and 65%, respectively). Further roughly 75% of the tested photoautotrophic strains passed the salt tolerance test, the test for the ability to grow in brackish or salt water such as marine media. Only about 25% of the tested photoautotrophic strains passed the test for thermo-tolerance. However this test is strongly dependent on the ambient temperature of each intended production site and therefore has to be adapted on a case by case basis.

These data therefore show that by first conducting the test for the photosynthetic activity or capacity most of the tested photoautotrophic strains can be discarded in the first test step, which makes it easier to further process the few remaining photoautotrophic strains, which have passed this test, through the other tests.

After having carried out the first test for photosynthetic activity method step b1) can for example be conducted, comprising the step (i) of adding ethanol to the growth medium.

In particular the “short term ethanol tolerance test”, which can be carried out quickly can be performed wherein during step b1) the photoautotrophic strains are subjected to at least between 13 to 17 vol % of ethanol for around 24 to 26 hours, preferably to at least 10 vol %, more preferred to at least 15 vol % most preferred to at least 20 vol % of ethanol for at least 52 hours as a first growth condition.

The photoautotrophic strains tolerant to these ethanol conditions can then be identified in method step c1) via microscopic analysis and/or their ability to be recultivable.

The strains, which fail this “short term ethanol tolerance test” are discarded and the other photoautotrophic strains which passed this test are in a further method step b2) subjected to 0.2 to 5 vol % of ethanol for around 30 to 40 cell divisions, preferably to around 1 vol % of ethanol for around 5 weeks, more preferred for around 10 weeks most preferred for at least 15 weeks as a second growth condition. This test is the so-called “long term ethanol tolerance test” intended to test the long term ability of the photoautotrophic strains to withstand relatively small amounts of ethanol for a longer period of time.

After this method step b2), the photoautotrophic strains tolerant to the growth conditions of method step b2) are identified via microscopic analysis and/or their ability to be recultivable in a further method step c2).

After that, an additional method step b3) can be carried out by culturing the photoautotrophic strains, which passed the second growth test under a third growth condition, such as a salt tolerance test and further conducting the method step c3) of identifying the photoautotrophic strains tolerant to the third growth condition.

Subsequently further testing steps b4), b5), b6) and their respective analysis steps c4), c5, c6) can be carried out to test for even more growth conditions and/or desired properties of the photoautotrophic strains.

For example the fourth growth condition to be tested in the method steps b4) and c4) respectively can be the ability of the photoautotrophic strains to tolerate an increase in the temperature to 45° C., the so-called “thermo tolerance test”. Afterwards the photoautotrophic strains having passed these four growth conditions can be subjected to further growth conditions and additionally can be tested for at least one desired property, selected from a group consisting of:

    • lack of ability to produce toxins, ability to be genetically transformable, increasing the pH of the growth medium, agitating the growing culture, the maximal optical density or dry weight per volume, pool size of intracellular metabolites in different growth phases in the absence or presence of EtOH, and light tolerance of a strain.

The further tests for these growth conditions and the at least one desired property can be tested sequentially or in parallel. These tests can be used in order to further characterize the photoautotrophic strains without discarding strains, which do not perform well in one of these tests.

Summing it up, one preferred embodiment of the screening method of the invention comprises the following method steps:

    • a) providing various photoautotrophic strains to be tested for example by obtaining photoautotrophic strains from public depositories or by picking photoautotrophic strains from natural habitats.
    • d) Test for photosynthetic activity or capacity,
    • e) Identifying the photoautotrophic strains having a desired value of photosynthetic activity,
    • b1) short term ethanol tolerance test,
    • c1) identifying the photoautotrophic strains being tolerant to the short term ethanol tolerance test,
    • b2) long term ethanol tolerance test,
    • c2) identifying the photoautotrophic strains being tolerant to the long term ethanol tolerance test,
    • b3) salt tolerance test,
    • c3) identifying the photoautotrophic strains being tolerant to the salt tolerance test,
    • b4) thermo-tolerance test,
    • c4) identifying the photoautotrophic strains being tolerant to the thermo-tolerance test,
      • Then further test being carried out sequentially or in parallel consisting of a group of:
      • lack of ability to produce toxins, ability to be genetically transformable, increasing the pH of the growth medium, agitating the growing culture, the maximal optical density or dry weight per volume, pool size of intracellular metabolites in different growth phases in the absence or presence of EtOH, and light tolerance of a strain

In an alternative embodiment of the screening method of the invention, the method steps d) and e) are performed after the method steps b1) and c1). In this case the method step b1) can for example comprise the step (i) of adding ethanol to the growth medium. In particular during the method steps b1) and c1) can comprise the short term ethanol tolerance test and identifying the strains being tolerant to this short term ethanol tolerance test.

Such as screening method has the advantage that the short term ethanol tolerance test is not so laborious as the determination of the photosynthetic activity so that a large number of photoautotrophic strains can be tested in a relative small period of time.

The further method steps b2) and c2) can then comprise the long term ethanol tolerance test and identifying the strains being tolerant to this long term ethanol tolerance test. Afterwards further tests b3) and c3) related to photosynthetic activity and method steps b4) c4) directed to the evaluation of salt stress tolerance can be conducted.

In another concrete example of the screening method of the invention, it is possible to first conduct the above-mentioned “initial ethanol tolerance test”, followed by a test of the photosynthesis rate of the strain and an “initial growth test”. Then the so-called “exact ethanol tolerance test” can be performed in order to find out the exact amounts of ethanol to which a certain strain is tolerant. In a subsequent test the photoautotrophic strain can be subjected to a so-called “long term ethanol tolerance test” in order to find out whether this strain can tolerate small amounts of ethanol for a long period of time. After that the so-called “thermo-tolerance” and “mechanical stress tolerance test” can be conducted with the strains, which were found to be highly tolerant to ethanol and were found to have a high photosynthetic activity. Afterwards an HPLC and/or MS analysis of the content of the natural products of the photoautotrophic strains, which tolerate any of the above stressful conditions can be performed in order to find out whether any of the highly ethanol tolerant strains produces natural toxins. Subsequently, an alkaline media test can be conducted in order to test for the above neutral pH tolerance of the strains identified so far. One of the last tests can be a test for the ability to grow the selected fresh water strains in marine media or brackish media. There is the possibility to transform a strain in order to increase the salt resistance, if necessary. The last test then can be the so-called “exact growth test” in order to determine the growth behavior under high light conditions.

By carrying out the above mentioned different embodiments of the screening method of the invention, photoautotrophic strains can be identified, which passed all high priority tests, namely the test for photosynthetic activity, the long and short term ethanol tolerance test and the salt and thermo tolerance test as shown in FIG. 50-13. For example Synechocystis PCC 6803 passed all four of these tests whereas Nostoc sp. PCC 7120 did not pass at least the thermo tolerance test.

The photoautotrophic strains to be tested can, for example, be selected or picked from a collection of different photoautotrophic strains, for example obtained from publicly available strain databases, for example the PCC-Pasteur Culture Collection found under http://www.pasteur.fr/recherche/banques/PCC or the SAG, the so-called “Algensammlung aus Göttingen” algal collection of the university of Göttingen found under http://www.epsag.uni-goettingen.de.

In particular it is advantageous to pre-select the strains found in publicly available strain databases for strains known to be fast-growing strains, dominant strains with high photosynthetic activity and strains known to be able to produce mass populations in nature. For example it is useful to select Synechocystis, Synechococcus, Spirulina, Arthrospira, Nostoc, Anabaena, Trichodesmium, Leptolyngbya, Plectonema, Myxosarcina, Pleurocapsa, Oscillatoria, Phormidium, Anabena, Pseudanabena or comparable genera, because these strains are for example known to produce algal blooms, which are a sign of cyanobacterial mass populations in nature (e.g. Trichodesmium) or are known from industrial large scale-processes (e.g. Spirulina).

The photoautotrophic strains, in particular the algal and cyanobacterial strains selected in any of the above screening methods can then be used for genetic transformation in order to produce any of the photoautotrophic genetically modified ethanol producing host cells already mentioned above in this patent application. In particular enzymes for the formation of ethanol can be introduced into these selected photoautotrophic strains. These enzymes for the formation of ethanol can be selected from a group consisting of: Adh, Pdc, CoA-dependent acetaldehyde dehydrogenase, AdhE, and an acetaldehyde dehydrogenase converting acetylphosphate into acetaldehyde.

Further at least one genetic modification can be introduced into these selected photoautotrophic strains,

    • this genetic modification changing the enzymatic activity or affinity of an endogenous host cell enzyme of the photoautotrophic strains,
      the genetic modification resulting in an enhanced level of biosynthesis of acetaldehyde, pyruvate, acetyl-CoA or precursors thereof compared to the respective wild type host cell.

Embodiments of Algae and Bacteria

In a further embodiment of the invention the genetically modified photoautotrophic ethanol producing host cell is an aquatic organism. This aquatic organism can, for example, be a fresh water species living in lakes, rivers, streams or wetlands. Alternatively the aquatic organism can be a marine organism, which lives in salty water, for example oceans. The aquatic organism also can be a fresh water species, which shows a high tolerance for brackish water or even salt water. The inventors also found fresh water strains that can grow in marine media with the same growth rate as in fresh water media, which were selected from a large variety of different cyanobacterial strains by using the method for testing a photoautotrophic strain for a desired growth property disclosed in this patent application.

In a further embodiment the genetically modified host cell is selected from a group consisting of: algae and bacteria.

Algae are a diverse group of simple plant-like organisms which include unicellular or multicellular forms. Algae are photosynthetically active organisms, in particular photoautotrophs, which produce organic compounds from inorganic molecules such as CO2 and water using light as an external source of energy.

Algae are considered to be eukaryotic organisms in particular protists. Protists are relatively simple eukaryotic organisms which are unicellular or multicellular without highly specialized tissues.

In particular, protist algae can include Chlorophytes, which are green algae, such as Ulva chlatrata, Rhodophytes, red algae or heterokontophytes, which are brown algae. A preferred green algal species is Chlorella. One example of a green algae is Chlamydomonas, which are unicellular flagellates. A particular well known example of Chlamydomonas is Chlamydomonas reinhardtii, which is a motile single-celled green algae found in, for example, fresh water. Chlamydomonas reinhardtii is also known to produce minor amounts of ethanol via fermentation under dark conditions (Gfeller and Gibbs, Fermentative Metabolism of Chlamydomonas reinhardtii, Plant Psychology (1984) 75, pages 212 to 218).

Various methods for transformation of eukaryotic algae are known. For example the Chlamydomonas reinhardtii chloroplast genome was transformed by using microprojectile particle bombardment. This method involves introducing gold or tungsten particles into the cell, which are coated with DNA for transformation. These particles are accelerated into the target cells by helium-driven particle guns. This technique can be used in order to transform undifferentiated plant cells, which for example grow on a gel medium in a Petri dish and which are subjected to a nanoparticle beam of the DNA-coated gold or tungsten particles. This technique has been successfully used in order to transform Chlamydomonas reinhardtii. References describing the particle gun method are for example: Boynton, J. E., Gillham, N. W., Harris, E. H., Hosler, J. P., et al (1988) “Chloroplast transformation in Chlamydomonas with high velocity microprojectiles”. Science 240: 1534-1538; Debuchy, R., Purton, S, and Rochaix, J. D. (1989) “The argininosuccinate lyase gene of Chlamydomonas reinhardtii: an important tool for nuclear transformation and for correlating the genetic and molecular maps of the ARG7 locus”. EMBO J. 8: 2803-2809; Kindle, K. L., Schnell, R. A., Fernandez, E. and Lefebvre, P (1989) “Stable nuclear transformation of Chlamydomonas using the Chlamydomonas gene for nitrate reductase”. J Cell Biol 109: 2589-2601; Dunahay, T. G., Jarvis, E. E., Davis, S. S, and Roessler, P. G. (1995) “Genetic transformation of the diatoms Cyclotella cryptica and Navicula saprophila”. J Phycol 31: 1004-1012; Apt, K. E., Kroth-Pancic, P. and Grossman, A. R. (1996) “Stable nuclear transformation of the diatom Phaeodactylum tricornutum”. Mol Gen Gent 252: 572-579; Falciatore, A. et al. (1999) “Transformation of nonselectable reporter genes in marine diatoms”. Mar Biotechnol 1: 239-251; Zaslayskaia, L. A., Lippmeier, J. C., Kroth, P., Grossman, A. and Apt, K. E. (2000) “Transformation of the diatom Phaeodactylum tricornutum (Bacillariophyceae) with a variety of selectable marker and reporter genes”. J. Phycol. 36: 379-386.

Another method of transforming eukaryotic or prokaryotic algae is, for example, the introduction of genes into host cells by electroporation. This method involves applying an external electric field to a probe containing the eukaryotic or prokaryotic cells to be transformed. This electrical field leads to a significant increase of the electrical conductivity and permeability of the cell plasma membranes of the cells to be transformed. Therefore, DNA can be taken up by cells subjected to such an external electrical field.

A further method of genetic transformation of eukaryotic algae is the glass bead agitation. This method involves vortexing the algal cells to be transformed with glass beads in the presence of DNA and, for example, polyethylene glycol. This method can be used in order to transform cell wall deficient mutants of microalgal species, for example Chlamydomonas. An overview of different methods of genetic transformation of microalgae is presented in the review article of Banares et al. (Banares et al.: Transgenic Microalgae as Green Cell Factories, Trends in Biotechnology, vol. 22, no. 1 (2004), pages 45 to 52).

In a further embodiment of the invention the genetically modified host cell comprises a cyanobacterium. Cyanobacteria are also known as Cyanophyta or blue green algae and are prokaryotic bacteria, which are photosynthetically active. Cyanobacteria include unicellular or multicellular species. Cyanobacteria include fresh water species or marine species. In addition, cyanobacterial species also can be found in brackish water. In contrast to eukaryotic algae cyanobacteria lack a nucleus, mitochondria or chloroplasts. Examples of cyanobacterial species include Synechococcus, Synechocystis and Phormidium.

A genetically modified cyanobacterial cell according to the invention can be derived from cyanobacteria, which perform ethanol fermentation even in the genetically unmodified wild-type state. Examples of ethanol fermenting wild type cyanobacterial species are, for example, Oscillatoria limosa (Stal L.; Heyer H.; Bekker S.; Villbrandt M.; Krumbein W. E. 1989. Aerobic-anaerobic metabolism in the cyanobacterium Oscillatoria limosa. In: Cohen, Y., and Rosenberg, E. (ed.), Microbial mat: Physiological ecology of benthic microbial communities. American Society for Microbiology Washington, D.C.). Another example of an ethanol-fermenting cyanobacterial species is the cyanobacterium Microcystis PCC7806 (Moezelraar et al., A Comparison of Fermentation in the Cyano Bacterium Microcystis PCC7806 grown under a Light/Dark Cycle and continuous Light, European Journal of Phycology (1997), 32, pages 373 to 378). Further examples of ethanol fermenting cyanobacteria are Cyanothece PCC 7822, Microcystis aeruginosa PCC 7806, Oscillatoria sp., and Spirulina platensis (“The ecology of cyanobacteria, Their Diversity in Time and Space, Edited by Brian A. Whitton and Malcolm Potts, Kluwer Academic Publishers, Chapter 4 by L. J. Stal Cyanobacterial Mats and Stromatolites”).

In another aspect the invention provides a method for the production of ethanol comprising the method steps of:

    • A. Providing and culturing any of the above-mentioned genetically modified host cells in a growth medium under the exposure of light and carbon dioxide, the host cells accumulating ethanol while being cultured, and
    • B. Isolating the ethanol from the host cells and/or the growth medium.

As discussed above, the genetically modified host cells can comprise cyanobacteria, algal cells or other phototropic organisms. The photoautotrophic genetically modified host cell can produce the ethanol intercellularily from sunlight, carbon dioxide and water and then excrete the ethanol into the growth medium. The growth medium can, for example, be sea water in the case of marine strains, or fresh water in the case of freshwater strains or brackish water, which can be supplemented with trace elements for example a fertilizer liquid. The ethanol can then be separated from the liquid growth medium, for example by distillation.

During method step A host cells can be provided which comprise a genetically modified gene encoding at least one enzyme for the formation of ethanol under the transcriptional control of an inducible promoter, which can be induced by exposure to an exogenous stimulus, wherein the method step A further comprises:

A1. Culturing the host cells under the absence of the exogenic stimulus, and thereafter
A2. Providing the exogenic stimulus, thereby inducing ethanol production.

During such a variant of the method of the invention the host cells can grow without producing ethanol in the un-induced state. Due to the fact that ethanol can be harmful to the host cells, the host cells can reach a higher cell density when cultured in an un-induced state compared to a situation where the host cells continuously produce ethanol. This variant of the method of the invention can, for example, be used in the case that the substrate for the at least one enzyme for the formation of ethanol is not harmful to the host cells and is, for example, pyruvate or acetyl-CoA. These compounds can easily be further metabolized even by an uninduced host cell.

The exogenic stimulus can, for example, be provided by changing the environmental conditions of the host cells depending on the inducible promoter. For example, the stimulus can be provided by subjecting the cell culture to darkness, for example in the case that the inducible promoter is the sigB promoter or the lrtA promoter. The exogenic stimulus can also be provided by a nutrient starvation in the case that the inducible promoter is, for example, the ntcA promoter, the nblA promoter, the isiA promoter, the petJ promoter, or the sigB promoter. One way of subjecting a growing cell culture to nutrient starvation can be that the cell culture consumes the nutrients in the growth medium while growing and therefore automatically reaches a state of nutrient starvation in the case that no new nutrients are supplemented into the growth medium. The nutrients required for the growth of the host cells can, for example, be trace elements such as phosphorous, nitrogen or iron.

The exogenic stimulus can furthermore be provided by subjecting the growing cell culture to oxidative stress, for example by adding oxidants such as hydrogen peroxide to the culture. Inducible promoters which can be induced by oxidative stress are, for example the isiA promoter. Further examples of exogenic stimuli are, for example, heat shock or cold shock which can be induced by raising the temperature of a growing culture from 30° C. to, for example, 40° C. or by reducing the temperature of a growing culture from 30° C. to 20° C. An example of a heat shock inducible promoter are the htpG, hspA, clpB1, hliB and sigB promoter and an example of a cold shock inducible promoter is the crhC promoter. A further example of an exogenic stimulus can be stationary growth which automatically is reached by a growing culture in the case that the culture is not diluted and no new nutrients are added. Examples of stationary growth inducible promoters are the isiA promoter or the sigB promoter. Furthermore the exogenic stimulus can be provided by addition of a nutrient, for example by adding copper in the case of copper inducible petE promoter.

Alternatively the at least one enzyme for ethanol production can be under the transcriptional control of a constitutive promoter, for example the rbcLS promoter. Such a culture produces ethanol during all phases of the cell growth, in particular during the lag phase, during the exponential growth phase and even after having reached the stationary phase. Such a method of producing ethanol can be particularly valuable in the case that the genetically modified host cells comprise a first genetic modification which results in an increased affinity or activity of a host metabolic enzyme, which produces metabolic intermediates harmful to the cell, for example acetaldehyde. In such a case the genetically modified host cells normally also comprise a second genetic modification resulting in an overexpression of an enzyme for ethanol formation from the harmful metabolic intermediate. Due to the fact that the second enzyme for the formation of ethanol is under the transcriptional control of a constitutive promoter and therefore is expressed during all stages of the growth, the harmful metabolic intermediate can quickly be further converted by this enzyme for ethanol formation into ethanol. Therefore, the metabolic intermediate which is harmful for the cell normally cannot accumulate in high amounts in the cell or in the growth medium of the cells.

According to another aspect of the invention the method step A further comprises the method step:

A3. Adding a substrate to the growth medium, the substrate used by the at least one overexpressed enzyme for ethanol formation to produce ethanol.

The substrate, for example, can be acetaldehyde. The inventors experienced that often the availability of a substrate is limiting for ethanol production in the case that genetically modified host cells with at least one overexpressed enzyme for ethanol formation are used to produce ethanol. In such a case the further addition of the substrate of the overexpressed enzyme for ethanol formation can greatly enhance the ethanol production.

In a further embodiment the method comprises determining an optimum concentration range for the substrate used by the at least one overexpressed enzyme for ethanol formation in the growth medium. The substrate can then be added in an amount within this optimum concentration range. The inventors determined that an optimum concentration range for a substrate like acetaldehyde is between 150 μM and 200 μM.

According to a further aspect of the method of the invention, the method can comprise the additional method step C of using the host cells after having isolated the ethanol in method step B as a substrate for a heterotrophic fermentative organism. The heterotrophic organism can ferment the biomass provided by the host cells for ethanol production in order to produce different fermentative products, depending on the fermentation mechanism.

For example the heterotrophic organism can comprise ethanol-fermenting organisms, such as yeast, which can produce ethanol from fermentation of the host cell biomass. In another embodiment of the method of the invention methane can be produced by methanogenic microorganisms while fermenting the host cell biomass. These methanogens, for example can produce methane from acetic acid, which is produced by other fermentative microorganisms from the biomass provided by the host cells.

According to another embodiment of the method of the invention during method step A, the genetically modified host cells produce a first metabolic intermediate and at least partially secret the first metabolic intermediate into the growth medium, and during method step A a microorganism is added to the growth medium, the microorganism converting the first metabolic intermediate into ethanol.

Especially in the case that the genetically modified host cells comprise a first genetic modification changing the affinity or activity of a host cell enzyme leading to a higher production of a first metabolic intermediate, the first metabolic intermediate is often excreted from the host cells into the growth medium. In such a case ethanol formation can be enhanced by adding a microorganism, for example a fungus which can metabolize the excreted metabolic intermediate into ethanol.

More detailed description of the embodiments with reference to the figures

In the following the inventions will be explained in more detail with reference to figures and certain embodiments:

FIGS. 1A to C depict general schemes of metabolic pathways in Cyanobacteria with marked enzymes for overexpression and down-regulation or knock-out for the increase of biosynthesis of different metabolic intermediates.

FIG. 2 shows a flow chart including some ethanologenic enzymes for ethanol production.

FIG. 1A shows some general metabolic pathways in cyano-bacteria as a non-limiting example. In particular the Calvin cycle as the light independent part of the photosynthesis is shown starting with the carbon dioxide fixation reaction catalyzed by the enzyme RubisCO. Further the glycolysis pathway, the pentose phosphate pathway and the citric acid cycle are shown. The general metabolic pathways depict boxed and circled enzymes, whose activity or affinity can be changed as part of at least one first genetic modification of an endogenous host enzyme of the cyanobacterial host cell. Boxed enzymes either have been overexpressed compared to the respective wild type cyanobacterial cells or are prime candidates for overexpression. Circled enzymes either have been knocked out or down regulated or are prime targets for knock-out or down-regulation. The main reason for the knock-out or overexpression is to enhance the level of pyruvate biosynthesis in the genetically modified cell by knocking-out or reducing the activity or affinity of enzymes consuming pyruvate or its metabolites and to enhance the enzymatic activity of enzymes producing pyruvate or its precursors such as phosphoenolpyruvate (PEP). The cyanobacterial host cell can comprise more than one first genetic modification. For example enzymes enhancing the level of pyruvate biosynthesis such as enolase or malic enzyme can be overexpressed and the activity or affinity of enzymes consuming pyruvate, such as lactate dehydrogenase or alanine dehydrogenase can be reduced or abolished by knock-out of the respective genes in one cyanobacterial host cell.

In addition two second genetic modifications resulting in an overexpression of enzymes for ethanol formation have been introduced into the metabolic cyanobacterial pathways shown in FIG. 1A. These enzymes are indicated by the thickly framed boxes denoted with the reference sign “A”. In particular these enzymes are alcohol dehydrogenase (abbreviated as Adh) and pyruvate decarboxylase (abbreviated as Pdc), which also have to be introduced into most cyanobacteria via genetic engineering.

FIG. 1B shows the same general metabolic pathways in cyano-bacteria as already presented in FIG. 1A for the case that the level of biosynthesis of acetyl-CoA is raised compared to a wildtype cyanobacterial cell. The enzymes, which are part of the first and second genetic modification are marked in the same way as in FIG. 1A. In addition the direct conversion of acetyl-CoA to ethanol catalyzed by the enzyme aldehyde-alcohol dehydrogenase AdhE, which has to be introduced into most cyanobacteria via a second genetic modification is denoted. AdhE is for example an endogenous enzyme in the cyanobacterium Thermosynechococcus or an heterologous enzyme from E. coli. In this case the expression of AdhE can be enhanced in a second genetic modification in Thermosynechococcus, for example by introducing additional gene copies into the cell or by mutating the promoter of the wildtype gene encoding AdhE in order to enhance transcription and translation. In the case of overexpression of AdhE the enzyme pyruvate dehydrogenase can be overexpressed (shown as a boxed enzyme). In addition to overexpression of AdhE it is still possible to overexpress Pdc and Adh simultaneously. Alternatively only AdhE can be overexpressed.

FIG. 1C gives an overview of metabolic enzymes in cyanobacteria, which can be overexpressed (boxed enzymes) or knocked out or downregulated (circled enzymes) in the case that the level of biosynthesis of acetaldehyde is to be increased in the cell. In this case the enzymes phosphotransacetylase and acetaldehyde dehydrogenase are overexpressed in comparison to the situation shown in FIG. 1B. The enzyme acetaldehyde dehydrogenase converting acetylphosphate to acetaldehyde is for example disclosed in the publication Stal (Stal, Moezelaar, “Fermentation in cyanobacteria”, FEMS Microbiology Reviews 21, (1997), pages 179-211). The enzymes, which are part of the first and second genetic modification are marked in the same way as in FIGS. 1A and 1B.

FIG. 1D depicts the exemplary metabolic pathway of other bacteria. In contrast to the metabolic pathways shown in the FIGS. 1A to 1C, the enzyme acetate kinase in addition also catalyzes the reaction in the other direction from acetate to acetylphosphate. In the case that the enzyme acetaldehyde dehydrogenase is overexpressed or its affinity or activity is enhanced in other ways described in this patent application, Overexpression of acetate kinase enzyme can enhance the level of biosynthesis of acetylphosphate, thereby enhancing ethanol formation by Adh. In addition the other ethanol forming enzyme AdhE can also be overexpressed.

FIG. 1E shows the same metabolic pathway as depicted in FIG. 1D with the exception that in addition to the acetate kinase enzyme the phosphotransacetylase enzyme also catalyzes the reverse reaction from acetylphosphate to acetyl-CoA. In this case phosphotransacetylase can be overexpressed in addition to acetate kinase enzyme in order to enhance the level of biosynthesis of acetyl-CoA in a first genetic modification. The second genetic modification comprises overexpression of AdhE, which converts the acetyl-CoA into ethanol. In addition the second genetic modification also can comprise overexpression of Adh and Pdc.

FIG. 1F shows some relevant metabolic pathways of cyanobacteria with different overexpressed enzymes for ethanol formation, which can be introduced into a photoautotrophic cyanobacterial host cell by second genetic modifications. In one aspect of the invention a CoA-dependent acetaldehyde dehydrogenase can be overexpressed in the host cell, which converts acetyl-CoA into acetaldehyde. The acetaldehyde can then further be converted to ethanol by a further enzyme for ethanol formation Adh, which can be AdhI enzyme or AdhII enzyme or a combination of both enzymes.

In addition or alternatively Pdc enzyme can be present in the host cell as a further overexpressed enzyme for ethanol formation introduced via a second genetic modification, which can convert pyruvate into acetaldehyde.

FIG. 2 shows in a more detailed way the last steps of ethanol synthesis in genetically modified cyanobacteria.

FIG. 3 depicts a further non-limiting representation of metabolic pathways of a cyanobacterium. In contrast to the FIGS. 1A to 1F a NAD dependent acetaldehyde dehydrogenase is shown, which can convert acetate into acetaldehyde, which then can be converted into ethanol by Adh enzyme.

Working Example of Genetic Knockout

In the following one embodiment of the invention, in particular a genetically modified host cell comprising a host enzyme forming reserve compounds, wherein the gene encoding this enzyme is disrupted by genetic engineering, is explained in more detail with reference to a working example. The host enzyme is glycogen synthase, which is encoded by two genes in the host cell Synechocystis sp. PCC 6803. In order to knock-out both genes a double knock-out mutant has to be generated.

Laboratory Protocols

Protocols for the Generation of a Glycogen Synthase Double Mutant of Synechocystis sp. PCC 6803

In the genome database of Synechocystis sp. PCC 6803 two genes encoding glycogen synthases are annotated (http://bacteria.kazusa.or.jp/cyano).

One glycogen synthase of Synechocystis sp. PCC 6803 is encoded by the gene sll0945 (glgA1), annotated as glycogen synthase 1 (GlgA1). The Accession number of the protein is P74521 (EC 2.4.1.21), its amino acid sequence is presented in FIG. 4A.

A second glycogen synthase of Synechocystis sp. PCC 6803 is encoded by the gene sll1393 (glgA2), annotated as glycogen (starch) synthase 2 (GlgA2). The Accession number of the protein is P72623 (EC 2.4.1.21), its amino acid sequence is presented in FIG. 4B.

Construction of DNA-vectors (knock-out-constructs) for the two glycogen synthase encoding genes (glgA1 and glgA2) of Synechocystis sp. PCC 6803

In general:

DNA sequences encoding genes of interest are amplified by polymerase chain reaction (PCR) using specific primers. When the genomic sequence does not contain appropriate restriction sites for cloning, primers are designed containing restriction sites. Genomic DNA from Synechocystis sp. PCC 6803 are used as template. The amplified PCR fragments are digested with the appropriate restriction enzymes and ligated into a cloning vector.

An antibiotic resistance cassette is then inserted into selected sites of the cloned genes. Upstream and downstream on each site of the antibiotic resistance cassette at least 500 bps remain for homologous recombination.

Genetic engineering of constructs as well as PCRs, ligations into cloning vectors, insertions of antibiotic resistance cassettes and transformations into E. coli are done using standard procedures (state of the art) or according to the manufacturers instructions.

To generate a glycogen deficient mutant in Synechocystis sp. PCC 6803, constructs were created for inactivation both glycogen synthase genes. The resulting glycogen deficient mutant described below is named mutant M8.

For creating a knock-out construct to inactivate glgA1, a 1341 by fragment containing the major part of the coding sequence from glycogen synthase 1 (sll0945) was amplified by PCR using the following primers:

(SEQ ID NO: 140) #glgA-1fw: 5′-CGACGGTATGAAGCTTTTATTTG-3′, primer contains a HindIII restriction site for cloning (marked in bold letters). (SEQ ID NO: 141) #glgA-1rv: 5′-CCGGCGGAACGGTACCAAC-3′, primer contains a KpnI restriction site for cloning (marked in bold letters).

The PCR fragment was digested with HindIII and KpnI and cloned into plasmid pUC19 (Ac.No M77789). A single BstXI site present in the middle of glgA1 gene was used to insert a chloramphenicol resistance cassette (named Cm). The chloramphenicol resistance cassette, encoding a chloramphenicolacetyltransferase (cat) gene, was cut out of plasmid pACYC184 (Ac.No X06403) using BsaAI and BsaBI. The orientation of the antibiotic cassette was analyzed by digestion with HindIII and EcoRI; a restriction map is presented in FIG. 4C.

A knock-out-construct, named pUC-glgA1-Cm, has the structure presented in FIG. 4D, and the nucleotide sequence of the construct pUC-glgA1-Cm is presented in FIG. 4E.

For creating a knock-out construct to inactivate glgA2, a 1673 by fragment containing the entire coding sequence from glycogen synthase 2 (sll1393) was amplified by PCR using the following primers:

(SEQ ID NO: 142) #glgA-2fw: 5′-GGCCAGGGGAATTCTCCTCCAG-3′, primer contains an EcoRI restriction site for cloning (marked in bold letters). (SEQ ID NO: 143) #glgA-2rv: 5′-GCGGATAATACTGAACGAAGCTTTG-3′, primer contains a HindIII restriction site for cloning (marked in bold letters).

The PCR fragment was digested with EcoRI and HindIII and cloned into plasmid pUC19. A single HincII site present in the middle of glgA2 gene was used to insert a kanamycin resistance cassette (named Kan). The kanamycin resistance cassette, encoding an aminoglycoside 3″-phosphotransferase (aph) gene, was cut out of plasmid pUC4K (Ac.No X06404) using HincII. The orientation of antibiotic cassette was analyzed with the restriction enzyme HindIII. A restriction map of this clone is presented schematically in FIG. 4G.

The knock-out-construct used, named pUC-glgA2-Kan, has the structure presented in FIG. 4G and the nucleotide sequence presented in FIG. 4H.

Mutagenesis by transformation of the DNA-vectors (knock-out-constructs) using the natural competence of Synechocystis sp. PCC 6803 for DNA uptake and its system for homologous recombination.

The transformation was done in two steps. The first transformation knocks out gene sll0945 (glgA1) in the wild type of Synechocystis, and the corresponding mutant ΔglgA1 was selected. In a second step, gene sll1393 (glgA2) was knocked out in the ΔglgA1 mutant and the double mutant ΔglgA1/ΔglgA2 was selected.

General transformation protocol:

    • Spin down 10 ml of exponentially growing culture of Synechocystis sp. at room temperature (RT) and remove the supernatant
    • Resuspend the pellet in 0.5-1.0 ml of BG11 medium (media recipe:
    • NaNO3: 1.5 g
    • K2HPO4: 0.04 g
    • MgSO4.7H2O: 0.075 g
    • CaCl2.2H2O: 0.036 g
    • Citric acid: 0.006 g
    • Ferric ammonium citrate: 0.006 g
    • EDTA (disodium salt): 0.001 g
    • NaCO3: 0.02 g
    • Trace metal mix A51.0 ml
    • Agar (if needed): 10.0 g
    • Distilled water: 1.0 L
    • The pH should be 7.1 after sterilization
    • Trace metal mix A5:
    • H3BO3: 2.86 g
    • MnCl2.4H2O: 1.81 g
    • ZnSO4.7H2O: 0.222 g
    • NaMoO4.2H2O: 0.39 g
    • CuSO4.5H2O: 0.079 g
    • Co(NO3)2.6H2O: 49.4 mg
    • Distilled water: 1.0 L)
    • Add 1-10 μg plasmid DNA (knock-out-construct carrying gene of interest and an antibiotic cassette for screening for homologous recombination)
    • Incubate on a table top shaker for 5-6 hours in the light at RT
    • Plate 500 μl of a 1/100 dilution of the transformation mixture on a BG11 agar plate. Plate the remainder of the cell suspension on another plate. Include control plate (transformation mixture with water instead of plasmid DNA).
    • Incubate 48 h in the light at room temperature (RT) when chloramphenicol is used for selection or over night when kanamycin is used for selection.
    • Pipet 500 μl of the corresponding antibiotic in a suitable concentration under the agar for the selection of mutant clones (initial concentration for chloramphenicol: 1 μg/ml BG11 agar; initial concentration for kanamycin: 5 μg/ml)
    • Incubate for approx. 2 weeks in the light at RT
    • Transfer individual colonies to plates containing the corresponding antibiotic
    • Thereafter, the concentrations of antibiotics were increased stepwise when the cells were transferred onto another agar plate or into liquid culture (for kanamycin from initially 5 to 150 μg/ml BG11, for chloramphenicol from initially 1 to 15 μg/ml BG11 medium) in order to get fully segregated (homozygous) mutants. Transfers were done every 2 weeks. In case of kanamycin, the concentration in the range from 50 to 150 μg/ml agar was increased gradually over the course of 4 weeks.

Cultivation of Cyanobacterial Wild Type and Mutant Strains

Wild type and mutant strains of Synechocystis PCC 6803 were grown as batch cultures in BG11 medium at 29° C. under continuous illumination with white light (intensity: 40 μm−2 s−1) and aeration with air. For cultivation of mutants, the appropriate antibiotics were added to the medium (kanamycin 75 mg/l; chloramphenicol 15 mg/l).

Samples were analyzed briefly before the nitrogen step down (“+N”), directly after resuspension of the cells in BG11 medium lacking a nitrogen source (“—N”, 0 h) and after 3, 6 and 24 hours.

Generation of Knock-Out Mutants of Synechocystis sp. PCC 6803 and Other Cyanobacteria Affecting the Following Genes:
a) alanine dehydrogenase (ald)
b) ADP-glucose pyrophosphorylase (glgC)
c) pyruvate water dikinase (ppsA)
d) lactate dehydrogenase (ldh)
e) acetate kinase (ack)
f) phosphoacetyltransacetylase (pta)
g) PHB knockout mutant (AphaC)
h) knockout mutant of ADP-glucose-pyrophosphorylase, agp, glgC in the filamentous, diazotrophic cyanobacteria Nostoc/Anabaena spec. PCC7120 and Anabaena variabilis ATCC 29413
Protocols for Generation of Knock-Down Mutants of Synechocystis sp. PCC 6803 and Other Cyanobacteria Affecting the Following Gene:
a) pyruvate dehydrogenase (pdhB)

    • Protocols for the generation of knock-out mutants of Synechocystis sp. PCC 6803 and other cyanobacteria

Construction of DNA-Vectors for Generation of Knock-Out Mutants

In general:

DNA sequences encoding genes of interest were amplified by polymerase chain reaction (PCR) using specific primers. When the genomic sequence did not contain appropriate restriction sites for cloning, primers were designed containing restriction sites. Genomic DNA from Synechocystis sp. PCC 6803 was used as template. The amplified PCR fragments were digested with the appropriate restriction enzymes and ligated into a cloning vector.

An antibiotic resistance cassette was then inserted into selected sites of the cloned genes. Upstream and downstream on each site of the antibiotic resistance cassette at least 500 bps remained for homologous recombination. The following antibiotic resistance cartridges were used: kanamycin resistance cassette (named Kan) from pUC4K vector (Ac.No X06404) from the NCBI database under: http://www.ncbi.nlm.nih.gov/sites/entrez?term=X06404&cmd=Search&db=nuccore&QueryKey=1 encoding aminoglycoside 3′-phosphotransferase (aph) gene or chloramphenicol resistance cartridge (named Cm) from pACYC184 vector (Biolabs, Ac No. X06403) encoding chloramphenicolacyltransferase (cat) gene. Genetic engineering of constructs as well as PCRs, ligations into cloning vectors, insertions of antibiotic resistance cassettes and transformations into E. coli were done using standard procedures (state of the art) or according to the manufacturer instructions.

Sequences and structures of the used cloning and expression plasmids are described below (see 3.). Knock-outs were generated via homologous recombination of the wild type gene with the mutant genes. The method of transformation of the DNA-vectors (knock-out-constructs) using the natural competence of Synechocystis sp. PCC 6803 for DNA uptake was already described in detail for the generation of the glycogen deficient mutant.

a) Construction of a DNA-Vector for Generation of an Alanine Dehydrogenase Knock-Out Mutant (Aald)

The open reading frame (ORF) sll1682 encodes alanine dehydrogenase (EC 1.4.1.1), Ac. No BAA16790. The amino acid sequence of this protein is presented in FIG. 5A.

Two constructs were generated for knock-out of alanine dehydrogenase differing in orientation of the inserted kanamycin resistance cartridge (in sense and in antisense orientation to the ald ORF) using the following primers:

(SEQ ID NO: 144) #Ald50.fw: 5′-GGCTGACCCCCAGTAGTGTA-3 (SEQ ID NO: 1454) #Ald1042.rv: 5′-ATTTTCCGGCTTGAACATTG-3′

A 993 by ald PCR fragment was amplified by a BIOTAQ™ DNA Polymerase (BIOLINE), cloned into the pGEM-T vector (Promega) and restricted with SmaI (blunt ends; Fermentas). The kanamycin cartridge was remained by a restriction of the pUC4K vector with EcoRI (5′ overhangs; Fermentas) and a following “fill in reaction” via the T4 DNA Polymerase (Promega). Plasmids were analyzed by restriction digest in order to select constructs with both orientations of the inserted kanamycin cartridge.

A construct designated as pGEM-T/Δald-antisense has the structure presented schematically in FIG. 5B.

The sequence of the insert for this construct (pGEM-T/Δald-antisense) is presented in FIG. 5C.

In the other construct, designated as pGEM-T/Δald-sense the kanamycin resistance cartridge is inserted in the other direction.

b) Construction of DNA-Vector for Generation of an ADP-Glucose Pyrophosphorylase Knock-Out Mutant (ΔglgC)

The open reading frame (ORF) slr1176 encodes ADP-glucose pyrophosphorylase (EC 2.7.7.27), Ac. No BAA18822. The amino acid sequence of this protein is presented in FIG. 6A.

Four constructs were generated for knock out of ADP-glucose pyrophosphorylase differing in the locus of insertion (EcoRI, BsaBI) and in orientation of the resistance (kanamycin-Km, chloramphenicol-Cm) cartridge (in sense and in antisense orientation to the glgC gene). Both insertion sites were tested because of a putative small non-coding RNA at the 5′-terminus of the glgC gene (in antisense orientation). Therefore, the insertion of the chloramphenicol cartridge at the BsaBI-site might affect the expression of the putative small non-coding RNA.

The following primers were used for PCR

EcoRI: G↓AATTC (SEQ ID NO: 146) #GlgC5.fw: 5′-GTTGTTGGCAATCGAGAGGT-3′ (SEQ ID NO: 147) #GlgCiR.rv: 5′-GTCTGCCGGTTTGAAACAAT-3′ (SEQ ID NO: 148) BsaBI: GATNN↓NNATC (SEQ ID NO: 149) #GlgCiR.fw: 5′-ACCCCATCATCATACGAAGC-3′ (SEQ ID NO: 150) #GlgC1233.rv: 5′-AGCCTCCTGGACATTTTCCT-3′

The first 1579 by glgC PCR fragment was amplified by a BIOTAQ™ DNA Polymerase (BIOLINE), cloned into the pGEM-T vector (Promega) and restricted with EcoRI (5′ overhangs; Fermentas). The kanamycin cartridge was remained by a restriction of the pUC4K vector with EcoRI (5′ overhangs; Fermentas).

Plasmids were analyzed by restriction digest in order to select constructs with both orientations of the inserted kanamycin cartridge, respectively.

The construct pGEM-T/ΔglgC-KMantisense has the structure shown in FIG. 6B, and its insert the nucleotide sequence presented in FIG. 6C.

In the other construct, designated as pGEM-T/ΔglgC-KMsense the kanamycin resistance cartridge is inserted in the other direction.

The second 1453 by glgC PCR fragment was amplified by a BIOTAQ™ DNA Polymerase (BIOLINE), cloned into the pDrive vector (Qiagen) and restricted with BsaBI (blunt ends; Biolabs). The chloramphenicol cartridge was remained by restriction of the pACYC184 vector (Biolabs, Ac No. X06403) with BsaAI (blunt ends; Biolabs).

Plasmids were analyzed by restriction digest in order to select constructs with both orientations of the inserted chloramphenicol resistance (Cm) cartridge, respectively.

A construct designated as pDrive/ΔglgC-CMantisense was selected; its structure is presented schematically in FIG. 6D and the nucleotide sequence of the insert is presented in FIG. 6E.

In the other construct, designated as pDrive/ΔglgC-CMsense the chloramphenicol resistance cartridge is inserted in the other direction.

c) Construction of DNA-Vector for Generation of a Pyruvate Water Dikinase Knock-Out Mutant (ΔppsA)

The open reading frame (ORF) slr0301 encodes pyruvate water dikinase/PEP synthase (EC 2.7.9.2), Ac. No BAA10558. This protein has the amino acid sequence that is presented in FIG. 7A.

Two constructs were generated for knock-out of pyruvate water dikinase differing in orientation of the inserted kanamycin resistance cartridge (in sense and in antisense orientation to the ppsA ORF) using the following primers:

(SEQ ID NO: 151) #PpsA547.fw: 5′-TTCACTGACCGGGCTATTTC-3′ (SEQ ID NO: 152) #PpsA2329.rv: 5′-CTTGGCCACAGATACCGATT-3′

A 1783 by ppsA PCR fragment was amplified by a BIOTAQ™ DNA Polymerase (BIOLINE), cloned into the pGEM-T vector (Promega) and restricted with SmaI (blunt ends; Fermentas). The kanamycin cartridge was remained by a restriction of the pUC4K vector with EcoRI (5′ overhangs; Fermentas) and a following “fill in reaction” via the T4 DNA Polymerase (Promega). Plasmids were analyzed by restriction digest in order to select constructs with both orientations of the inserted kanamycin cartridge.

The construct used, designated as pGEM-T/ΔppsA-antisense, has the structure presented in FIG. 7B. The nucleotide sequence of it insert is presented in FIG. 7C.

In the other construct, designated as pGEM-T/ΔppsA-sense the kanamycin resistance cartridge is inserted in the other direction.

d) Construction of a DNA-Vector for Generation of a Lactate Dehydrogenase Knock-Out Mutant (Δldh)

The open reading frame (ORF) slr 1556 encodes a putative lactate dehydrogenase (EC 1.1.1.28), annotated as 2-hydroxyaciddehydrogenase homolog (P74586). This amino acid sequence for this protein is presented in FIG. 8A.

A 1931 by fragment containing the entire coding sequence from lactate dehydrogenase (slr1556) was amplified by PCR using the following primer:

(SEQ ID NO: 153) #ldh-1fw: 5′-GCGAACTACCCAACGCTGACCGG-3′ (SEQ ID NO: 154) #ldh-2rv: 5′-GCATCAAGTGTTGGGGGATATCCCTG-3′, primer contains a EcoRV restriction site (GATATC) for cloning (marked in bold letters).

The PCR fragment was digested with NheI/EcoRV (NheI site is present in the genomic sequence) and cloned into pBluescript SK+ vector using XbaI/EcoRV. The kanamycin resistance cassette was used from the DNA vector pUC4K and ligated into the BglII/BclI restriction sites of slr1556. A restriction map of this is presented in FIG. 8B.

The knock-out-construct used, named pBlue ldh-Kan-a, has the structure presented in FIG. 8C, and the nucleotide sequence for its insert is presented in FIG. 8D.

e) Construction of a DNA-Vector for Generation of an Acetate Kinase Knock-Out Mutant (Rack)

The open reading frame (ORF) sll 1299 encodes a putative acetate kinase (EC 2.7.2.1), Ac No. P73162. The amino acid sequence for this protein is presented in FIG. 9A.

A 2316 by fragment containing the entire coding sequence from acetate kinase (sll1299) was amplified by PCR using the following primer:

(SEQ ID NO: 155) #ack-1 fw: 5′-CCGGGACGTGACAGAACGGGTGG-3′ (SEQ ID NO: 156) #ack-2 rv: 5′-GCGTTGGCGATCGCCGTCACTAG-3′

The PCR fragment was digested with SpeI (both sites are located in the genomic sequence) and cloned into pBluescript SK+ vector. The kanamycin resistance cassette was used from the DNA vector pUC4K and ligated into the HpaI restriction sites of slr1299. A restriction enzyme map of this region is presented in FIG. 9B.

The orientation of the kanamycin resistance cassette was either in the same direction as sll1299 (designed “a”) or in the opposite direction (designed “b”).

The knock-out-construct used, named pBlue ack-Kan-b, has the structure presented in FIG. 9C, and the nucleotide sequence of its insert is presented in FIG. 9D.

f) Construction of a DNA-Vector for Generation of a Phosphoacetyltransacetylase (Phosphoacyltransferase) Knock-Out Mutant (Δpta)

The open reading frame (ORF) slr2132 encodes a phosphoacetyltransacetylase (EC 2.3.1.8), Ac No. P73662. The amino acid sequence for this protein is presented in FIG. 10A.

A 2869 by fragment containing the entire coding sequence from phosphoacetyl-transacetylase (slr2132) was amplified by PCR using the following primer:

(SEQ ID NO: 157) #pta-1fw: 5′-GCCATTGTGGGGGTGGGTCAG-3′ (SEQ ID NO: 158) #pta-2rv: 5′-CAGTTTATGCCCCGCTACCGGG-3′,

The PCR fragment was digested with MfeI/HindIII (both sites present in the genomic sequence) and cloned into pUC19 (EcoRI/HindIII) vector. The chloramphenicol resistance cassette was used from plasmid pACYC184 and ligated into the ClaI/PstI restriction sites of slr2132. A restriction map of this region is presented in FIG. 10B.

The knock-out-construct selected is named pUC pta-Cm. It's structure is presented schematically in FIG. 10C, and the nucleotide sequence of the insert for this clone is presented in FIG. 10D.

g) Construction of DNA-Vector for Generation of PHB Knockout Mutant (ΔphaC)

The open reading frame (ORF) slr1830 encodes poly(3-hydroxyalkanoate) synthase [EC:2.3.1.], Ac. No BAA17430. The amino acid sequence for this protein is presented in FIG. 11A.

One construct was generated for knock out of poly(3-hydroxyalkanoate) synthase by deletion/insertion (resistance cartridge: kanamycin) mutagenesis.

(SEQ ID NO: 159) # phaC-25_XbaI.fw: 5′-CCGATGtcTAGaTAATTCACCATC-3′ (SEQ ID NO: 160) # phaC404_BamHI.rv: 5′-TCTAGGGggAtCCAACGATCG-3′ (SEQ ID NO: 161) # phaC711_BamHI.fw: 5′-CCAGGGGATccTCTTAACCTAG-3′ (SEQ ID NO: 162) # phaC1133_ClaI.rv: 5′-TGTCGTatCGATAGCCAATGG-3′

Two PCR products (pos. 24 to pos. 404; pos. 711 to pos. 1133) of the phaC fragment were amplified by a BIOTAQ™ DNA Polymerase (BIOLINE), ligated via BamHI sites and cloned into the pIC20H vector. The kanamycin cartridge was remained by a restriction of the pUC vector (http://seq.yeastgenome.org/vectordb/vector_descrip/COMPLETE/PUC4K. SEQ.html) with BamHI (Fermentas). Plasmids were analyzed by restriction digest. Knockouts were generated via homologous recombination of the wild type gene with the mutant genes.

The construct selected is pIC2OH/ΔphaC-KM and has the structure presented schematically in FIG. 11B. The nucleotide sequence for the insert of this clone is presented in FIG. 11C.

h) Construction of DNA-Vectors for Generation of Knockout Mutants of ADP-Glucose-Pyrophosphorylase, agp (glgC) in in the Filamentous, Diazotrophic Cyanobacteria Nostoc/Anabaena spec. PCC7120 and Anabaena Variabilis ATCC 29413

In order to generate ethanol producing Anabaena strains, different constructs were created for conjugation into Anabaena PCC7120 and Anabaena variabilis ATCC29413. Constructs for genome integration of ethanologenic genes were created for both Anabaena strains. As integration site into the genome the glucose-1-phosphate adenylyltransferase gene (ADP-glucose-pyrophosphorylase, agp, glgC) was chosen. Thus, by integration of the ethanologenic genes simultaneously an agp knock-out mutant was created.

Glucose-1-phosphate adenylyltransferase (ADP-glucose-pyrophosphorylase, agp, glgC), EC 2.7.7.27, of Anabaena spec. PCC7120 is encoded by ORF a114645, Ac. No. P30521. The amino acid sequence of ORF a114645 is shown in FIG. 11D.

Constructs for conjugation into Anabaena PCC7120 were cloned as followed:

Two fragments representing the 5′ and 3′ part of the ADP-glucose-pyrophosphorylase (agp) gene, ORF all4645, were amplified by PCR using the following primers:

(SEQ ID NO: 163) #agp1.1 5′-CATCCATCATGAGCTCTGTTAAC-3′ (SacI site inserted) (SEQ ID NO: 164) #agp2.1 5′-GTATCTCGAGCGATGCCTACAGG-3′ (XhoI site inserted) (SEQ ID NO: 165) #agp3.1 5′-CGCATTGGTTTCTAGATGGCGC-3′ (XbaI site inserted) (SEQ ID NO: 166) #agp4.1 5′-CGATAACTCTAGACGAGTCATTG-3′ (XbaI site inserted)

Inserted restriction sites in primer sequences are marked in bold letters

As indicated in FIG. 11E, in between these agp fragments a C.K3 cassette (coding for kanamycin/neomycin resistance) was ligated into the XbaI site. [C.K3 cassette is described in Elhai, J. & Wolk, C. P. (1988) Gene, 68, 119-138.]

The entire “agp knock-out” fragment was cloned into suicide vector pRL271 (Ac.No. L05081). The pdc/adh genes, or only pdc, were cloned downstream of the inducible promoter PpetE and integrated into the “agp-C.K3” construct.

The following constructs have been generated:

pRL271 agp (a114645)::C.K3
pRL271 agp (a114645)::C.K3-PpetE-pdc-AdhII
pRL271 agp (a114645)::C.K3-PpetE-pdc

The structures of the constructs are depicted in FIG. 11-2.

The sequence of the insert of pRL271 agp (all4645)::C.K3-PpetE-pdc-AdhII is shown in FIG. 11F.

The same strategy was used to create constructs for expression in Anabaena variabilis ATCC29413. The nucleotide sequences of the agp genes from both strains are 97%, their protein sequences are 99.3% identical.

Glucose-1-phosphate adenylyltransferase (ADP-glucose-pyrophosphorylase, agp, glgC), EC 2.7.7.27, of Anabaena variabilis ATCC29314 is encoded by ORF Ava2020, Ac. No. Q3 MBJ4, and has the amino acid sequence as shown in FIG. 11G.

For PCR amplification of the genomic fragments of Anabaena variabilis the following primers were used:

(SEQ ID NO: 167) #agp1.2 5′-GAGGCAATGAGCTCCACTGGACG-3′ (SacI site inserted) (SEQ ID NO: 168) #agp2.2 5′-CTGGCGTTCCACTCGAGCTTGG-3′ (XhoI site inserted) (SEQ ID NO: 169) #agp3.1 5′-CGCATTGGTTTCTAGATGGCGC-3′ (XbaI site inserted) (SEQ ID NO: 170) #agp4.2 5′-CGATAACTCTAGACGAGTCATCG-3′ (XbaI site inserted)

Inserted restriction sites in primer sequences are marked in bold letters.

Generation of the constructs was exactly as described for the constructs of Anabaena PCC7120.

The following constructs have been generated:

pRL271 agp::C.K3
pRL271 agp::C.K3-PpetE-pdc-AdhII
pRL271 agp::C.K3-PpetE-pdc

All described plasmids were conjugated into Anabaena strains according the following method:

Conjugation of Nostoc spec. PCC7120/Anabaena variabilis

Cargoplasmids

Cargoplasmids (pRL593, pRL1049 or pRL271) were transformed into competent E. coli HB101 (pRL528helperplasmid)

In Preparation for Conjugation

E. coli Cultures:

    • inoculation of overnight cultures in LB with the appropriate antibiotics from
      • Cargoplasmid in E. coli HB101 (pRL528helperplasmid)
      • Helperstrain E. coli J53 (RP4)
    • preparation of well growing culture (for each conjugation/plate 10 ml of HB101 (pRL528+cargo plasmid) and 10 ml of J53 (RP4) is needed): inoculate 0.25 ml overnight culture in 10 ml LB+antibiotic, grow for 2.5 h/37° C.
    • spin down the well grown E. coli cultures in “Falcons” 10 min 4800 rpm.
      • (for J53 culture: take 2 Falcons).
    • “wash”/resuspend cells in equal volume of LB without antibiotics.
    • for each conjugation spin 10 ml of resuspended HB101 (culture carrying pRL528+cargo plasmid) in 15 ml Falcon tube, remover supernatant
    • add on the cell pellets 10 ml resuspended J53 (RP4) culture, spin down, remove supernatant and resuspend combined cells in 1 ml LB, transfer cells in Eppi tubes, resuspend again in 100 μl LB and incubate for 2 h at 30° C.

Cyanos

    • determine the chlorophyll concentration of well grown Anabaena cultures
    • for each conjugation, culture corresponding to about 10 μg Chlorophyll is needed.
    • spin down the equivalent volume of Anabaena culture and resuspend to a volume corresponding to 10 μg Chlorphyll/100 μl BG11 medium.

Conjugation

    • for each conjugation place one HATF filter on a plate (BG11)
    • mix 100 μl E. coli suspension=100 μl Anabaena culture and plate on filter
    • incubate plates at 30° C. overnight wrapped in paper
    • next day remove paper
    • after one day transfer filter on plates containing antibiotics.

Construction of DNA-Vectors for Generation of Knock-Down Mutants

a) Construction of a DNA-Vector for Generation of a Pyruvate Dehydrogenase (pdhB) Knock-Down Mutant

The open reading frame (ORF) sll1721 encodes the β-subunit of the E1 component of the pyruvate dehydrogenase, (EC 1.2.4.1), Ac. No BAA17445. This protein has the amino acid sequence presented in FIG. 12A.

Two strategies were considered for knock-down of the pyruvate dehydrogenase. A knock-down could be achieved by regulation of the expression of the adequate antisense RNA (i) or by insertion of a controllable wild type gene copy accompanied by a knock-out of the original wild type gene (ii). Therefore, four constructs were generated to knock-down the pyruvate dehydrogenase.

The PCR fragments for the expression of the adequate antisense RNA as well as for the controllable wild type gene copy were amplified by a High-Fidelity DNA Polymerase (Phusion™; Finnzymes), adenylated (BIOTAQ™ DNA Polymerase; BIOLINE), cloned into the pDrive vector (Qiagen) and restricted with ClaI/BglII (i) or NdeI/BglII1 (ii) (Fermentas). These fragments were cloned into the pSK9 vector, digested with ClaI/BglII (i) or NdeI/BglII (ii). The non-public pSK9 vector was generated in the lab of V.V. Zinchenko (Moscow, Russia). The gene is incorporated into a non-coding genome region via the integrated platform. The expression of the enzyme and the antisense RNA is under the control of the copper inducible promoter petJ. The termination of transcription is achieved either by the gene-specific terminator loop (ii) or by the loop-terminator of the lambda phage (i) (Topp is part of the reverse-Primer), both amplified by PCR reaction. 1 BglII was used instead of ClaI because this inserted ClaI cleavage side was affected by Dam-methylation. The BglII cleavage side is part of the 3′ end of the amplified PCR product and do not affect the translation termination loop.

(SEQ ID NO: 171) #PdhBantiClaI.fw: 5′-ATCGATATAATTTCCGGGTCGTAGCC- 3′, this primer contains a ClaI restriction site for cloning (marked in bold letters) (SEQ ID NO: 172) #PdhBantioopBglII.rv: 5′GATCTGGAATAAAAAACGCCCGGCGGCAACCGAGCGGCAGCC ATTCGGGATAATAA-3′, this primer contains a BglII restriction site for cloning (marked in bold letters) and the oop terminator region of the lambda phage (underlined) (SEQ ID NO: 173) #PdhBNdeI.fw: 5′-CATATGGCTGAGACCCTACTGTTT-3′, this primer contains a NdeI restriction site for cloning (marked in bold letters) (SEQ ID NO: 174) #PdhB1061ClaI.rv: 5′-ATCGATCTTACAAGCTCCCGGACAAA- 3′, this primer contains a ClaI restriction site for cloning (marked in bold letters)

The 1142 by pdhB PCR fragment for the knock-out of the original wild type gene was amplified by a BIOTAQ™ DNA Polymerase (BIOLINE), cloned into the pGEM-T vector (Promega) and restricted with Eco147I (blunt ends; Fermentas). The kanamycin cartridge was remained by a restriction of the pUC4K vector with EcoRI (5′ overhangs; Fermentas) and a following “fill in reaction” via the T4 DNA Polymerase (Promega) and ligated into the Eco147I site. Resulting plasmids were analyzed by restriction digest in order to select constructs with both orientations of the inserted kanamycin cartridge. Knock-outs were generated via homologous recombination of the wild type gene with the mutant genes. The following primers were used for PCR:

(SEQ ID NO: 175) # PdhB.fw: 5′-AATCGACATCCACCCTTGTC-3′ (SEQ ID NO: 176) # PdhB.rv: 5′-GCCTTAACTGCGTCCACAAT-3′

(i) Knock-Down by Regulation of the Expression of the Adequate Antisense RNA

The construct used, designated as pSK9/pdhBanti, has the structure presented in FIG. 12B, and the nucleotide sequence of its insert is presented in FIG. 12C.

(ii) Knock-Down by Insertion of a Controllable Wild Type Gene Copy Accompanied by a Knock-Out of the Original Wild Type Gene

The construct used, designated as pSK9/pdhB, has the structure presented in FIG. 12D, and the nucleotide sequence of the insert for this clone is presented in FIG. 12E.

The knock-out construct used, designated as pGEM-T/ΔpdhB-KMantisense, has the structure presented in FIG. 12F. The sequence for the insert in this clone is presented in FIG. 12G.

In the other construct, designated as pGEM-T/ΔpdhB-KMsense the kanamycin resistance cartridge is inserted in the other direction.

In the following the cloning vectors, which were used are described.

a) Cloning Vector pGEM®-T Structure and Sequence

PCR cloning vector pGEM®-T was from Promega corp., Madison Wis., USA. The structure of the plasmid is presented in FIG. 13A, and its nucleotide sequence is presented in FIG. 13B.

b) Cloning Vector pDrive Structure and Sequence

Cloning vector pDrive was from Qiagen, Hilden, Germany. The structure of this plasmid is presented in FIG. 14A and its nucleotide sequence in FIG. 14B.

c) Cloning Vector pBlueSK+ Structure and Sequence

Cloning vector pBluescript II® SK+ (Ac. No X52328) was from Stratagene, La Jolla, Calif., USA.

The structure of this plasmid is presented in FIG. 15A and, its nucleotide sequence is presented in FIG. 15B.

d) Cloning Vector pUC19Structure and Sequence

Cloning vector pUC19 (Ac. No M7779) is presented schematically in FIG. 16A, and its nucleotide sequence is presented in FIG. 16B.

e) Plasmid pSK9 Structure and Sequence

The non-public pSK9 vector was generated in the lab of V.V. Zinchenko (Moscow, Russia). A schematic of pSK9 structure is presented in FIG. 17A, and its nucleotide sequence is presented in FIG. 17B.

Protocols for Generation of Synechocystis sp. PCC 6803 Mutants Overexpressing the Following Genes:
a) malic enzyme
b) malate dehydrogenase
c) malic enzyme and malate dehydrogenase
d) pyruvate kinase 1
e) pyruvate kinase 2
f) pyruvate kinase, enolase and phosphoglycerate mutase
g) enolase
h) phosphoglycerate mutase
i) pyruvate kinase (1 or 2)/enolase/phosphoglycerate mutase
j) phosphoketolase
k) phosphoacetyltransacetylase
l) phosphoketolase/phosphoacetyltransacetylase
m) acetaldehyde dehydrogenase
n) PEP carboxylase
o) ribulose-1,5-bisphosphate carboxylase/oxygenase (RubisCO)

Construction of DNA-Vectors for Overexpression

In general:

DNA sequences encoding genes of interest were amplified by polymerase chain reaction (PCR) using specific primers. When the genomic sequence did not contain appropriate restriction sites for cloning, primers were designed containing restriction sites. Genomic DNA from Synechocystis sp. PCC 6803 was used as template. The amplified PCR fragments were digested with the appropriate restriction enzymes and cloned into either a self replicating plasmid (pVZ series) or an integrative plasmid (pSK series). As promoters either the genomic 5′ region of the specific gene itself was used or alternative an inducible promoter like PpetJ. (PpetJ, pVZ, pSK, for description see below mentioned adh/pdc constructs). An antibiotic resistance cassette for selection of positive clones is present on the appropriate plasmid. The structures and sequences of all used DNA-vectors are described below (see 2.).

Genetic engineering of constructs as well as PCRs, ligations into cloning vectors, insertions of antibiotic resistance cassettes and transformations into E. coli were done using standard procedures (state of the art) or according to the manufacturer instructions.

All pVZ plasmids were transferred to Synechocystis sp. PCC 6803 by conjugation. This method is described for the below mentioned adh/pdc constructs. The pSK constructs were transferred to Synechocystis sp. PCC 6803 by transformation. The method of transformation using the natural competence of Synechocystis sp. PCC 6803 for DNA uptake was already described in detail for the generation of the glycogen synthase mutant.

a) Construction of DNA-Vectors for Overexpression of Malic Enzyme

The open reading frame (ORF) slr0721 encodes malic enzyme 1 (EC 1.1.1.38), Ac. No P72661. The amino acid sequence for this protein is presented in FIG. 18A.

For overexpression of malic enzyme, the encoding me gene together with its gene-specific terminator region was PCR-amplified using the following primer:

(SEQ ID NO: 177) Mae-NdeI.fw: 5′-CATATGGTTAGCCTCACCCCCAAT-3′, primer contains a NdeI restriction site for cloning (marked in bold letters) (SEQ ID NO: 178) MeLongClaI.rv: 5′-ATCGATCGGGATGGCCTATTTATGG-3′, primer contains a ClaI restriction site for cloning (marked in bold letters)

The PCR fragment was amplified by a High-Fidelity DNA Polymerase (Phusion™; Finnzymes), adenylated (BIOTAQ™ DNA-Polymerase; BIOLINE), cloned into the pDrive vector (Qiagen) and restricted with NdeI/ClaI (Fermentas). This fragment was cloned into the pSK9 vector, digested with NdeI/ClaI. The gene is incorporated into a non-coding genome region of Synechocystis sp. PCC 6803 via the integrated platform. The expression of the enzyme is under control of the copper dependent promoter PpetJ.

The construct used, designated as pSK9/me-long, has the structure presented in FIG. 18B. The insert for this clone has the nucleotide sequence presented in FIG. 18C

b) Construction of DNA-Vector for Overexpression of Malate Dehydrogenase

An open reading frame (ORF) sll0891 encodes malate dehydrogenase (EC 1.1.1.37), Ac. No Q55383. The amino acid sequence for this protein is presented in FIG. 19A.

For overexpression of malate dehydrogenase a construct was generated including start-codon and the gene specific termination loop of the mdh gene using the following primers:

(SEQ ID NO: 179) Mdh-NdeI.fw: 5′-CATATGAATATTTTGGAGTATGCTCC-3′, primer contains a NdeI restriction site for cloning (marked in bold letters) (SEQ ID NO: 180) Mdh-ClaI.rv: 5′-ATCGATAAGCCCTAACCTCGGTG-3′, primer contains a ClaI restriction site for cloning (marked in bold letters)

The PCR fragment was amplified by a High-Fidelity DNA Polymerase (Phusion™; Finnzymes), adenylated (BIOTAQ™ DNA-Polymerase; BIOLINE), cloned into the pDrive vector (Qiagen) and restricted with NdeI/ClaI (Fermentas). This fragment was cloned into the pSK9 vector, digested with NdeI/ClaI. The expression of the enzyme is under the control of the copper dependent promoter PpetJ.

The construct used, designated as pSK9/mdh, has the structure presented in FIG. 19B; the nucleotide sequence for the insert of this clone is presented in 19C.

c) Construction of DNA-Vector for Co-Overexpression of Malic Enzyme and Malate Dehydrogenase

This construct was generated for co-overexpression of malic enzyme and malate dehydrogenase. These genes were amplified by PCR using primers including the start and stop-codon of the me gene (PCR fragment I) and including the ribosome binding site (RBS) and termination loop of the mdh gene (PCR fragment II). The co-expression of the enzymes is under the control of the copper dependent promoter PpetJ.

The following primers were used for amplification

    • PCR fragment I:

(SEQ ID NO: 181) Mae-NdeI.fw: 5′-CATATGGTTAGCCTCACCCCCAAT-3′, primer contains a ′NdeI restriction site for cloning (marked in bold letters) (SEQ ID NO: 182) MeShortClaI.rv: 5′-ATCGATACAATTCCCGATTAACTATTGACC- 3′, primer contains a ClaI restriction site for cloning (marked in bold letters)
    • PCR fragment II:

(SEQ ID NO: 183) MdhRBSClaI.fw: 5′-ATCGATTTTTCTCCACCATCAACACC-3′, primer contains a ClaI restriction site for cloning (marked in bold letters) (SEQ ID NO: 184) MdhBglII.rv: 5′-AGATCTAAGCCCTAACCTCGGTG-3′, primer contains a BglII restriction site for cloning (marked in bold letters)

The PCR fragments were amplified by a High-Fidelity DNA Polymerase (Phusion™; Finnzymes), adenylated (BIOTAQ™ DNA-Polymerase, BIOLINE), cloned into the pDrive vector (Qiagen) and restricted with NdeI/ClaI and ClaI/BglII (Fermentas), respectively. These fragments were cloned into the pSK9 vector, first digested with NdeI/ClaI for integration of malic enzyme and secondly with ClaI/BglII for integration of malate dehydrogenase.

The construct used, designated as pSK9/me-mdh, has the structure presented in FIG. 19D, and the nucleotide sequence of its insert is presented in FIG. 19E.

d) Construction of DNA-Vectors for Overexpression of Pyruvate Kinase 1

The open reading frame (ORF) sll0587 encodes a pyruvate kinase 1 (EC 2.7.1.40 (PK1)), Ac. No Q55863. The amino acid sequence of this protein is presented in FIG. 20A. Two constructs were generated in order to overexpress pyruvate kinase 1. One, harboring the own pyruvate kinase promoter region, and another construct on which pyruvate kinase 1 is under control of the inducible promoter PpetJ.

For the construct with the genomic 5′-region of the pyruvate kinase gene itself serving as promoter, a 2376 by fragment containing the entire coding sequence from pyruvate kinase 1 (sll 0587) plus 770 by upstream of the gene (promoter region) and 320 by downstream of the gene (terminator region) was amplified by PCR using the following primer:

(SEQ ID NO: 185) #pykA-5fw: 5′-CCTGTTATTGGCCACGGGCAGTA-3′ (SEQ ID NO: 186) #pykA-2rv: 5′-GGTTTACCCTGGGCTCGAGAATTTAGG-3′, primer contains a XhoI restriction site (CTCGAG) for cloning (marked in bold letters).

The PCR fragment was digested with MfeI/XhoI (MfeI site was present in the genomic sequence; MfeI shares compatible cohesive ends with EcoRI), subcloned into pIC20H (using EcoRI/XhoI), cut out of this plasmid with SalI/XhoI and ligated into the E. coli-Synechocystis shuttle vector pVZ321 (self replicating plasmid).

The construct used, named pVZ321-pyk1, has the structure presented in FIG. 20B, and its insert nucleotide sequence is presented in FIG. 20C.

For the construct on which pyruvate kinase 1 is under control of the inducible promoter PpetJ, a 1763 by fragment containing the entire coding sequence from pyruvate kinase 1 (sll 0587) plus 320 by downstream of the gene (terminator region) was amplified by PCR using the following primer:

(SEQ ID NO: 187) #pykA-3fw: 5′-CCCGGTGAAGCATATGAGACCCCT-3′, primer contains a NdeI restriction site (CATATG) for cloning (marked in bold letters). ATG in the restriction site represents the start codon of the gene. (SEQ ID NO: 188) #pykA-2rv: 5′-GGTTTACCCTGGGCTCGAGAATTTAGG-3′, primer contains a XhoI restriction site (CTCGAG) for cloning (marked in bold letters).

The PCR fragment was digested with NdeI/XhoI, ligated to PpetJ (SalI/NdeI) and cloned into the E. coli-Synechocystis shuttle vector pVZ321 (self replicating plasmid).

The construct used, named pVZ321-PpetJ-pyk1, has the structure presented in FIG. 20D, and the nucleotide sequence of its insert is presented in FIG. 20E.

e) Construction of DNA-Vectors for Overexpression of Pyruvate Kinase 2

The open reading frame (ORF) sll1275 encodes pyruvate kinase 2 (EC 2.7.1.40 (PK2)), Ac. No P73534. The amino acid sequence for this protein is presented in FIG. 21A. Two constructs were generated in order to overexpress pyruvate kinase 2. One, harboring the own pyruvate kinase promoter region, and another construct on which pyruvate kinase 2 is under control of the inducible promoter PpetJ.

For the construct with the genomic 5′ region of the pyk2 gene itself serving as promoter, a 2647 by fragment containing the entire coding sequence from pyk 2 (sll 1275) plus 600 by upstream of the gene (promoter region) and 280 by downstream of the gene (terminator region) was amplified by PCR using the following primer:

(SEQ ID NO: 189) #pykB-1fw: 5′-CCTAAATTCAGGTCGACCGGCAAAC-3′, primer contains a SalI restriction site (GTCGAC) for cloning (marked in bold letters). (SEQ ID NO: 190) #pykB-2rv: 5′-CACCAACCAGGCTCGAGTGGG-3′, primer contains a XhoI restriction site (CTCGAG) for cloning (marked in bold letters).

The PCR fragment was digested with SalI/XhoI and ligated into the E. coli-Synechocystis shuttle vector pVZ321 (self replicating plasmid).

The construct used, named pVZ321-pyk2, has the structure presented in FIG. 21B, and the nucleotide sequence of its insert is presented in FIG. 21C.

For the construct on which pyruvate kinase 2 is under control of the inducible promoter PpetJ, a 2057 by fragment containing the entire coding sequence from pyruvate kinase 2 (sll 1275) plus 280 by downstream of the gene (terminator region) was amplified by PCR using the following primer:

(SEQ ID NO: 191) #pykB-3fw: 5′-CCTAATTTCAGCCCCATATGCAAACG-3′, primer contains a NdeI restriction site (CATATG) for cloning (marked in bold letters). ATG in the restriction site represents the start codon of the gene. (SEQ ID NO: 192) #pykB-2rv: 5′-CACCAACCAGGCTCGAGTGGG-3′, primer contains a XhoI restriction site (CTCGAG) for cloning (marked in bold letters).

The PCR fragment was digested with NdeI/XhoI, ligated to PpetJ (SalI/NdeI) and cloned into the E. coli-Synechocystis shuttle vector pVZ321 (self replicating plasmid).

The resulting construct, pVZ321-PpetJ-pyk2, has the structure presented in FIG. 21D, and the nucleotide sequence of its insert is presented in FIG. 21E.

f) Construction of DNA-Vector for Overexpression Of Pyruvate Kinase, Enolase and Phosphoglycerate Mutase

A DNA-vector was constructed in order to express additional genes coding for pyruvate kinase, phosphoglycerate mutase and enolase. A DNA fragment encoding these genes was cut out of plasmid #67. This plasmid was constructed by Dr. John Coleman, University of Toronto, Toronto, Canada.

The insert of plasmid #67 has the structure presented in FIG. 22A.

The insert of plasmid #67 contains a 357 bases long cyanobacterial ribulose-1,5-bisphosphate carboxylase/oxygenase (RubisCO) promoter (Prbc) from Synechococcus PCC 7942. Downstream of this promoter there are three inserted open reading frames, the first is pyruvate kinase I from E. coli, the second enolase and the third phosphoglycerate mutase both from Zymomonas mobilis. The pyruvate kinase region differs from E. coli K-12 pyruvate kinase 1 (Ac. No AAC74746) by 3 nucleotides and one amino acid. (G to D mutation, underlined in the sequence below). The enolase gene from Zymomonas mobilis (Ac. No YP163343) is a 100% amino acid match. The nucleotide sequence differs by two synonymous substitutions in the enolase region. The phosphoglycerate mutase gene is one amino acid different from Zymomonas (Ac. No YP162975), from G to D at 118th amino acid (underlined in the sequence below). A HindIII site links the E. coli pyruvate kinase and the Zymomonas enolase genes.

The amino acid sequences of the enzymes encoded by the described insert are presented in FIG. 22B for pyruvate kinase I (E. coli K12); in FIG. 22C for enolase (Zymomonas mobilis); and in FIG. 22D for phosphoglycerate mutase (Zymomonas mobilis).

The nucleotide sequence of the described insert of plasmid #67 is presented in FIG. 22E.

The insert of plasmid #67 was cut out the vector using restriction enzymes XmaI and SpeI and cloned into the E. coli-Synechocystis shuttle vector pVZ321 and pVZ322 (self replicating plasmids)(XmaI/XbaI); XbaI and SpeI share compatible cohesive ends.

Plasmid pVZ321-p67 has the structure presented in FIG. 22F, and plasmid pVZ322-p67 has the structure presented in FIG. 22G.

g) Construction of DNA-Vectors for Overexpression of Enolase

The open reading frame (ORF) sir 752 encodes the enclase (eno, 2-phosphoglycerate dehydratase) (EC 4.2.1.11), Ac. No BAA18749. The amino acid sequence for this protein is presented in FIG. 23A.

A construct was generated for overexpression of enolase under control of the inducible promoter PpetJ.

The construct includes the petJ promoter, the 1299 by coding sequence for enolase (slr0752) and 214 by downstream of the gene (terminator region). The enolase gene was amplified by PCR using the following primer:

(SEQ ID NO: 193) #Eno-SacI-ATG 5′-TAGAGCTCTTAAGTAAAGTCCCCGCCAC CAT-3′, (SEQ ID NO: 194) #Eno-XhoI-rev 5′-TACTCGAGGTCATTGCTTCCTTGGCTTA GAAC-3′,

Primers contain a Sad or XhoI restriction site, respectively, for cloning (marked in bold letters).

The PCR fragment was digested with SacI/XhoI and ligated downstream of the PpetJ promoter into pJet-PpetJ. The entire PpetJ-enolase fragment was cut out of this plasmid with SalI/XhoI and ligated into the E. coli-Synechocystis shuttle vector pVZ321 (self replicating plasmid).

The construct used, named pVZ321-PpetJ-eno, has the structure presented in 23B, and the nucleotide sequence of its insert is presented in 23C.

h) Construction of DNA-Vectors for Overexpression of Phosphoglycerate Mutase

The open reading frame (ORF) slr1124 encodes the phosphoglycerate mutase (EC 5.4.2.1), Ac. No BAA16651. The amino acid sequence for this protein is presented in FIG. 24A.

A construct was generated for overexpression of phosphoglycerate mutase under control of the inducible promoter PpetJ.

The construct includes the petJ promoter, the 1047 by coding sequence for phosphoglycerate mutase (slr1124) and 143 by downstream of the gene (terminator region). The phosphoglycerate mutase gene was amplified by PCR using the following primer:

(SEQ ID NO: 195) #Pgm-SacI-ATG 5′-TAGAGCTCACCAAAGACGATGTGGCCC ACCAA-3′ (SEQ ID NO: 196) #Pgm-XhoI-rev 5′-TACTCGAGTATGACCCCGCTGTTGCAG TTC-3′

Primers contain a SacI or XhoI restriction site, respectively, for cloning (marked in bold letters).

The PCR fragment was digested with SacI/XhoI and ligated downstream of the PpetJ promoter into pJet-PpetJ. The entire phosphoglycerate mutase fragment was cut out of this plasmid with SalI/XhoI and ligated into the E. coli-Synechocystis shuttle vector pVZ321 (self replicating plasmid).

The construct used, named pVZ321-PpetJ-pgm, has the structure presented in FIG. 24B, the nucleotide sequence of its insert is presented in FIG. 24C.

i) Construction of DNA-Vectors for Co-Overexpression of Pyruvate Kinase 1 or 2, Enolase and Phosphoglycerate Mutase

Further plasmids were generated in order to overexpress the three glycolytic enzymes pyruvate kinase 1 or 2, enolase and phosphoglycerate mutase from one transcript.

One construct was generated for overexpression of pyruvate kinase 1 (ORF sll0587), enolase (ORF slr0752) and phosphoglycerate mutase (ORF slr1124); the second construct encodes pyruvate kinase 2 (ORF sll1275), enolase (ORF slr0752) and phosphoglycerate mutase (ORF slr1124). The protein sequences, EC and Accession numbers of the enzymes are already described herein.

In both constructs the overexpression of the three genes is under control of the inducible promoter PpetJ.

The glycolytic genes were amplified by PCR using the following primers:

pyruvate kinase 1 (pyk1): (SEQ ID NO: 197) #pykA-3fw 5′-CCCGGTGAAGCATATGAGACCCCT-3′ (NdeI-site inserted) (SEQ ID NO: 198) #Pyk1-SacI-rev 5′-TAGAGCTCTTAAGAAATACGGTGAATCTTG- 3′ pyruvate kinase 2 (pyk2): (SEQ ID NO: 199) #pykB-3fw: 5′-CCTAATTTCAGCCCCATATGCAAACG-3′ (NdeI-site inserted) (SEQ ID NO: 200) #Pyk2-SacI-rev 5′-TAGAGCTCCCTATCCTTTGGACACC-3′ enolase (eno): (SEQ ID NO: 201) #Eno-SacI-fw 5′-TAGAGCTCGTGTTTGGAGCATTACACACCGATG- 3′ (SEQ ID NO: 202) #Eno-BglII-rev 5′-TAAGATCTTTTTAAGAATGTTTGGGACCCAG- 3′ phospgoglycerate mutase (pgm): (SEQ ID NO: 203) #Pgm-BglII-fw 5′-TCAGATCTGCCCCTCTGGGAAAAAATGACCA- 3′ (SEQ ID NO: 204) #Pgm-XhoI-rev 5′-TACTCGAGTATGACCCCGCTGTTGCAGTTC-3′

All primers contain restriction sites for cloning (marked in bold letters).

PCR fragments were subcloned into PCR cloning plasmid pJet1.2 blunt. The genes were cut out of these plasmids with the appropriate restriction enzymes and ligated downstream of the PpetJ promoter into pIC-PpetJ as followed:

5′-XhoI-pIC-PpetJ-NdeI-3′ 5′-NdeI-pyk1-SacI-3′ 5′-SacI-eno-BglII-3′ 5′-BglII-pgm-XhoI-3′

The same construct was generated using fragment 5′-NdeI-pyk2-SacI-3′ instead of 5′-NdeI-pyk1-SacI-3′.

The entire PpetJ-pyk1-eno-pgm or PpetJ-pyk2-eno-pgm fragments were cut out of the cloning plasmid with PstI/XhoI and ligated into the E. coli-Synechocystis shuttle vector pVZ322 (self replicating plasmid).

The construct named pVZ322-PpetJ-pyk1-eno-pgm has the structure presented in FIG. 24D and the construct pVZ322-PpetJ-pyk2-eno-pgm has the structure presented in FIG. 24E. The sequence of the insert of pVZ322-PpetJ-pyk1-eno-pgm is presented in the FIG. 24F and the sequence of the insert of pVZ322-PpetJ-pyk2-eno-pgm is presented in FIG. 24G.

j) Construction of DNA-Vector for Overexpression of Phosphoketolase

The open reading frame (ORF) slr0453 encodes the probable phosphoketolase (phk), (EC 4.1.2-), Ac. No P74690. The amino acid sequence of the protein is presented in FIG. 25A.

A construct was generated for overexpression of phosphoketolase under control of the inducible promoter PpetJ.

The construct includes the petJ promoter, the 2418 by coding sequence for phosphoketolase (slr0453) and 307 by downstream of the gene (terminator region). The phosphoketolase gene was amplified by PCR using the following primer:

(SEQ ID NO: 205) #phk1-NdeI 5′-GTGTCTCATATGGTTACATCCCCCTTTTCCCTT-3′ (SEQ ID NO: 206) #phk2-XhoI 5′-CGAGCCCTGCTCGAGCAGGC-3′

Primers contain a NdeI or XhoI restriction site, respectively, for cloning (marked in bold letters).

The PCR fragment was digested with NdeI/XhoI and ligated downstream of the PpetJ promoter into pIC-PpetJ. The entire PpetJ-phosphoketolase fragment was cut out of this plasmid with PstI/XhoI and ligated into the E. coli-Synechocystis shuttle vector pVZ322 (self replicating plasmid).

The construct used, named pVZ321-PpetJ-phk, has the structure presented in FIG. 25B, and the nucleotide sequence of its insert is presented in FIG. 25C.

k) Construction of DNA-Vector for Overexpression of Phosphoacetyltransacetylase

The open reading frame (ORF) slr2132 encodes a phosphoacetyltransacetylase (pta), EC 2.3.1.8, Ac No. P73662. The amino acid sequence of this protein is presented in FIG. 26A.

A construct was generated for overexpression of phosphoacetyltransacetylase under control of the inducible promoter PpetJ.

The construct includes the petJ promoter, the 2094 by coding sequence from ORF slr2132 and 258 by downstream of the gene (terminator region). The phosphoacetyltransacetylase gene was amplified by PCR using the following primer:

(SEQ ID NO: 207) #pta_pPETJ1-NdeI 5′-GTGCCTCATATGACGAGTTCCCTTTATTTA AGCAC-3′ (SEQ ID NO: 208) #pta_pPETJ2-XhoI 5′-CGGTTGCTCGAGCATCTGGAACGGTTGGGT AAAT-3′

Primers contain a NdeI or XhoI restriction site, respectively, for cloning (marked in bold letters).

The PCR fragment was digested with NdeI/XhoI and ligated downstream of the PpetJ promoter into pIC-PpetJ. The entire PpetJ-phosphoacetyltransacetylase fragment was cut out of this plasmid with PstI/XhoI and ligated into the E. coli-Synechocystis shuttle vector pVZ322 (self replicating plasmid).

The construct used, named pVZ322-PpetJ-pta, has the structure presented in FIG. 26B, and the nucleotide sequence of the insert for construct pVZ322-PpetJ-pta is presented in FIG. 26C.

l) Construction of DNA-Vector for Co-Overexpression of Phosphoketolase and Phosphoacetyltransacetylase

One further construct was created in order to co-overexpress the phosphoketolase and phosphoacetyltransacetylase from one transcript. The protein sequences, EC and Accession numbers of the enzymes are already described above. The expression of the genes is under control of the inducible promoter PpetJ. The phosphoketolase and phosphoacetyltransacetylase genes were amplified by PCR using the following primers:

phosphoketolase (phk) (SEQ ID NO: 209) #phk1 5′-GTGTCTCATATGGTTACATCCCCCTTTTCCCTT-3′ (NdeI site inserted) (SEQ ID NO: 210) #phk-BglII-rev 5′-GGTCACAGATCTGTTGTCCCCCATGGCCTA GCTA-3′ phosphoacetyltransacetylase (pta) (SEQ ID NO: 211) #pta-BglII-fw 5′-CCTTGCAGATCTGGATACGTTGAGGTTATTTAA ATTATGA-3′ (SEQ ID NO: 212) #pta_pPETJ2-XhoI 5′-CGGTTGCTCGAGCATCTGGAACGGTTGG GTAAAT-3′

All primers contain restriction sites for cloning (marked in bold letters).

PCR fragments were cut with the appropriate restriction enzymes and ligated downstream of the PpetJ promoter into pIC-PpetJ as followed:

5′-XhoI-pIC-PpetJ-NdeI-3′ 5′-NdeI-phk-BglII-3′ 5′-BglII-pta-XhoI-3′

The entire PpetJ-phk pta fragment was cut out of the cloning plasmid pIC20H with SmaI/NruI and ligated into SmaI site of the E. coli-Synechocystis shuttle vector pVZ322 (self replicating plasmid).

The construct named pVZ322-PpetJ-phk-pta has the structure presented in FIG. 26D, and the nucleotide sequence of the insert of pVZ322-PpetJ-phk-pta is presented in FIG. 26E.

m) Construction of DNA-Vector for Overexpression of Aldehyde Dehydrogenase

The open reading frame (ORF) slr0091 encodes a aldehyde dehydrogenase (aldh), EC 1.2.1.3, Ac No. BAA10564 Q55811. The amino acid sequence for the protein is presented in FIG. 27A.

A construct was generated for overexpression of aldehyde dehydrogenase under control of the inducible promoter PpetJ. The construct includes the petJ promoter, the 1369 by aldehyde dehydrogenase fragment containing the entire coding sequence from ORF slr0091 and 205 by downstream of the gene (terminator region). The aldehyde dehydrogenase (aldh) gene was amplified by PCR using the following primer:

(SEQ ID NO: 213) #aldh1-NdeI-fw 5′-GTGCCTCATATGAATACTGCTAAAACTGTTGT TGC-3′ (SEQ ID NO: 214) #aldh2-XhoI-rev 5′-GATCTCCTCGAGGTAAAGAATCAGCATAGGT CTGG-3′

Primers contain a NdeI or XhoI restriction site, respectively, for cloning (marked in bold letters).

The PCR fragment was digested with NdeI/XhoI and ligated downstream of the PpetJ promoter into pIC-PpetJ. The entire PpetJ-aldehyde dehydrogenase fragment was cut out of this plasmid with PstI/XhoI and ligated into the E. coli-Synechocystis shuttle vector pVZ322 (self replicating plasmid).

The construct used, named pVZ322-PpetJ-aldh, has the structure presented in FIG. 27B, and the nucleotide sequence of the insert of construct pVZ322-PpetJ-aldh is presented in FIG. 27C.

n) Construction of DNA-Vectors for Overexpression of PEP Carboxylase

The open reading frame (ORF) sll0920 encodes the phosphoenolpyruvate carboxylase (EC 4.1.1.31), BAA18393. The amino acid sequence for this protein is presented in FIG. 28A.

One construct was generated for overexpression of phosphoenolpyruvate carboxylase under control of the inducible promoter PpetJ.

The construct includes the petJ promoter, the 3105 by ppc-fragment containing the entire coding sequence from phosphoenolpyruvate carboxylase (sll 0920) and 59 by downstream of the gene (terminator region) was amplified by PCR using the following primer:

(SEQ ID NO: 215) # ppc.NdeI.fw: 5′-CTAGAGGTTCATATGAACTTGGC-3′, this primer contains a NdeI restriction site (CATATG) for cloning (marked in bold letters) (SEQ ID NO: 216) # ppc.XhoI.rv: 5′-GTAAGCAGGCTCGAGGCAAG-3′, this primer contains a XhoI restriction site (CTCGAG) for cloning (marked in bold letters).

The PCR fragment was digested with NdeI/XhoI, subcloned into K8 (using NdeI/XhoI), cut out of this plasmid with SalI/XhoI and ligated into the E. coli/Synechocystis shuttle vector pVZ321 (self replicating plasmid). The pVZ321vector has the GenBank accession number AF100176.

The construct used, named pVZ321-PpetJ-ppc, has the structure presented in FIG. 28B, and the nucleotide sequence for the pVZ321-PpetJ-ppc insert is presented in FIG. 28C.

o) Construction of DNA-Vectors for Overexpression of Ribulose-1,5-Bisphosphate Carboxylase/Oxygenase (RubisCO)

Overexpression of the Synechocystis RuBisCO was reached by integration of a conjugative, self-replicating pVZ plasmid into Synechocystis containing either the rbcLXS operon alone or the rbcLXS operon as transcriptional fusion together with the pyruvate decarboxylase from Zymomonas mobilis.

The entire rbc operon from Synechocystis sp. PCC6803 was amplified by PCR using the primer pairs:

    • SynRbc-BglII-fw and SynRbc-PstI-rev for the over-expression from the rbcL-promoter, which are shown in FIGS. 28D and 28E, respectively.
    • SynRbc-SacI-fw and SynRbc-PstI-rev for the over-expression as transcriptional fusion with the Pdc from Zymomonas mobilis. The sequence of SynRbc-SacI-fw is shown in FIG. 28F.

The database entry numbers for the CyanoBase, the genome database for cyanobacteria (http://bacteria.kazusa.or.jp/cyanobase/index.html) for the Synechocystis rbcL-rbcX-rbcS coding sequences are slr0009 for the ribulose bisphosphate carboxylase large subunit (rbcL), slr0011 for the possible Rubisco chaperonin (rbcX) and slr0012 for the ribulose bisphosphate carboxylase small subunit (rbcS). The DNA sequence coding for the rbcLXS operon is depicted in FIG. 28G. The protein sequence obtained by translation of the protein coding DNA sequence is depicted in FIG. 28H for the rbcL large subunit; the rbcX Rubisco chaperonin protein sequence is shown in FIG. 28I and the protein sequence of the ribulose bisphosphate carboxylase small subunit (rbcS) is shown in FIG. 28J.

Mutants were selected on streptomycin plates and grown in BG11 medium containing the appropriate antibiotics (kanamycin 100 mg/l; streptomycin 10 mg/l).

In Synechocystis sp.PCC6803 mutants were generated by transforming the cells with the plasmid pVZ321b-Prbc-SynRbcLXS (FIG. 28K).

In the following the vectors, which were used are described.

a) Plasmid pSK9 Structure and Sequence

The non-public pSK9 vector was generated in the lab of V.V. Zinchenko (Moscow, Russia). The structure of this plasmid is schematically represented in FIG. 29A, and its nucleotide sequence is presented in FIG. 29B.

b) Self-Replicating Synechocystis Plasmid pVZ321 Structure and Sequence

The pVZ321vector has the GenBank accession number AF100176. This vector is presented schematically in FIG. 30A, and the pVZ321 nucleotide sequence is presented in FIG. 30B.

c) Self-Replicating Synechocystis Plasmid pVZ322 Structure and Sequence

The pVZ322 vector has the GenBank accession number AF100175. FIG. 31A presents a schematic of its structure, and FIG. 31B presents its nucleotide sequence.

d) Construction of the Cloning Vector pIC20H

For cloning procedures a plasmid was constructed harboring promoter PpetJ in the multi-cloning site of cloning vector pIC20H, Ac. No. L08912, (Marsh J. L., Erfle M., Wykes E. J.; “The pIC plasmid and phage vectors with versatile cloning sites for recombinant selection by insertional inactivation”; Gene 32:481-485 (1984)). Promoter PpetJ was cut out of the herein described pSK9 plasmid with ClaI and KpnI and ligated into pIC20H (ClaI/KpnI), resulting in plasmid pIC-PeptJ.

The plasmid pIC-PpetJ has the structure presented schematically in FIG. 32A, and the nucleotide sequence of pIC PpetJ is presented in FIG. 32B.

Generation of Additional Knock-Out/Knock-Down Mutants of Synechocystis Sp. PCC 6803: Methods and Results

The following Knock-Out construct sequences have been conveniently described and provided herein: (a) alanine dehydrogenase (ald), (b) ADP-glucose pyrophosphorylase (glgC), (c) pyruvate water dikinase (ppsA), (d) lactate dehyrogenase (ldh), (e) acetate kinase (ack) and (f) phosphoacetyltransacetylase (pta). The following Knock-Down construct sequence is described and provided pyruvate dehydrogenase (pdhB). These constructs may be used singly or sequentially in order to provide one or more mutations.

Mutagenesis

Host cells are mutagenized by transformation of the DNA-vectors (knock-out-constructs) using the natural competence of Synechocystis sp. PCC 6803 for DNA uptake and its system for homologous recombination as previously described herein. The transformation may comprise one or more steps in order to create mutant cells having a single, double, triple, etc. knockout and/or knockdown mutations. Additionally, knockdown/knockout mutants may additionally be mutagenized by introducing one or more overexpressing DNA constructs as described herein. As noted previously herein, the concentration of the appropriate antibiotic(s) is increased stepwise when the cells are transferred onto another agar plate or into liquid culture (for kanamycin from initially 5 to 150 μg/ml BG11, for chloramphenicol from initially 1 to 15 μg/ml BG11 medium) in order to get fully segregated (homozygous) mutants. Transfers are done every 2 weeks. In case of kanamycin, the concentration in the range from 50 to 150 μg/ml agar is increased gradually over the course of 4 weeks.

Molecular Analysis of Mutant Host Cells

In order to clearly demonstrate that a targeted homologous recombination event occurred in the selected mutant(s) cell, a variety of methods well known to one of ordinary skill in the art may be utilized. A test for successful knockout mutagenesis will be done initially by PCR amplifying a DNA fragment from the inserted antibiotic resistance cassette into the gene that should be knocked out. In addition, knockout mutants as well as knock-down mutants will be also checked by the detection and non-detection respectively of the target enzyme mRNA level in the mutant and wild type cells by using different techniques known in the art, e.g. RT-PCR, Northern blot or RNase protection assays. These recombinant DNA/molecular biology methods are well known to one of ordinary skill in the art; For example see: Methods in Enzymology, Vol. 167, (L. Packer, A. N. Glazer, eds); For extraction of genomic DNA: Franche C, Damerval T. in Methods of Enzymology, Vol. 167 p. 803-808; for extraction of total RNA: David 1. Lane, Katherine G. Field, Gary J. Olsen, and Norman R. Pace in Methods of Enzymology, Vol. 167 p. 138-144; for Extraction of plasmid DNA: Grant R. Lambert and Noel G. Carr, Rapid Small-Scale Plasmid Isolation by Several Methods from Filamentous Cyanobacteria, Arch Microbiol (1982) 133: 122-125; for Northern Blots: Axmann, I. M., Kensche, P., Vogel, J., Kohl, S., Herzel, H. & Hess, W. R. (2005) Genome Biol 6, R73; for RT-PCR: Emanuel C, von Groll U, Müller M, Börner T, Weihe A. Development- and tissue-specific expression of the RpoT gene family of Arabidopsis encoding mitochondrial and plastid RNA polymerases. Planta. 2006 April; 223(5):998-1009; for RNase protection assay: W. R. Hess, B. Hoch, P. Zeltz, T. Hübschmann, H. Kössel and T. Börner. Plant Cell 6 (1994), pp. 1455-1465. Academic Press, Inc., 1988), which are incorporated herein by reference.

Also, sufficient nucleotide sequence information for all enzymes is provided herein or available from known nucleotide sequence databases for the selection of the appropriate probes/primers for these analyses. With Northern Blot analysis, the abundance and relative amount of a mRNA will be detected. The same would be the case using a RNase protection assay but with a much higher sensitivity. The abundance and also the absolute amount of a mRNA can be determined with a high sensitivity using the RT-PCR.

With the PCR analysis, one forward primer is derived from the genetic sequence of the targeted enzyme and one reverse primer is derived from the biocide gene sequence; the amplified hybrid DNA fragment will be characterized and analyzed for predicted size and/or nucleotide sequence content. Mutant(s) cells found not to be expressing wildtype mRNA and found to have the above noted characteristics will be selected for further analysis.

Characterization of Knock-Out/Knock-Down Mutants Cultivation of Cyanobacterial Wild Type and Mutant Strains

For a knock-out or knock-down mutant(s) related to the formation of reserve compounds such as glycogen, e.g., mutants of further reserve metabolites syntheses as PHB or cyanophycin, wild type and mutant strains of Synechocystis PCC 6803 are grown as batch cultures in BG11 medium at 29° C. under continuous illumination with white light (intensity: 40 μE m−2 s−1) and aeration with air. For cultivation of mutants, the appropriate antibiotics are added to the medium (kanamycin 75 mg/l; chloramphenicol 15 mg/l). Samples are analyzed briefly before the nitrogen step down (“+N”), directly after resuspension of the cells in BG11 medium lacking a nitrogen source (“—N”, 0 h) and after 3, 6 and 24 hours.

All other knock-out or knock-down mutants will be grown under standard culture conditions known in the art.

As provided below, mutants and wild type cells will be characterized regarding their intra- and extracellular pyruvate content using optical enzymatic tests and their profile of all relevant metabolites respectively. (incl. 3-PGA, PEP, pyruvate, acetyl-CoA, glycogen, PHB, cyanophycin, malate, oxaloacetate, 2-oxoglutarate, acetate, lactate, etc.) using appropriate techniques for example, spectroscopic methods, chromatographic methods such ion chromatography or optical or enzymatic methods or combinations thereof. The analysis will always be done in comparison to the wild type.

Also the growth and pigmentation properties of mutant(s) will be compared to the wild type cell using standard protocols well known in the art.

The example presented here will provide a graphic depiction of growth properties for wild type and mutant cells as change in X vs. time, wherein X is ideally dry weight or biovolume. Alternatively, optical density, cell count and chlorophyll could be used as reference parameters. Alternatively, pigmentation could be quantified spectrophotometrically as another parameter.

Protocol for Characterization of Metabolic Mutants Containing At Least One First and/or One First and One Second Genetic Modification

Generation of knock-out and over-expression mutants with single, double, triple, etc. knock-out and/or knock-down and/or over-expression mutations as a first genetic modification and the molecular analysis of such mutant cells in general is already described above.

Characterization of Metabolic Mutants

Metabolic mutant strains having a first genetic modification were characterized regarding their growth properties and certain extra- and intracellular metabolites in comparison to wild type strains. In addition the afore described metabolic mutants were also transformed with PDC and ADH as a second genetic modification and were characterized regarding growth properties, extra- and intracellular metabolites and ethanol production rates in comparison to the appropriate reference strain(s) expressing PDC and ADH, but lacking the metabolic mutation (first genetic modification).

Cultivation of Cyanobacterial Wild Type and Mutant Strains

Wild type and mutant strains of Synechocystis PCC 6803 were grown as batch cultures in BG11 medium at 28-29° C. For cultivation of mutants the appropriate antibiotics were added to the medium (kanamycin 75 mg/l; chloramphenicol 10 mg/l; gentamycin 3 mg/l or streptomycin 10 mg/l). In order to avoid premature induction of gene expression in mutants having constructs with PpetJ or PisiA promoter, these mutants were grown in culture medium supplemented with excess copper or iron (5×Cu for PpetJ; 3×Fe for PisiA).

Prior to characterization experiments, pre-cultures were grown in BG11 medium (no excess of Cu or Fe) and aeration with 0.5% CO2 in air.

For characterization experiments, wild type and mutant strains were grown in BG11 medium. Mutants having constructs with PpetJ or PisiA (overexpression, knock-down mutants or mutants expressing PDC and ADH) were transferred to BG11 lacking Cu (PpetJ) or Fe (PisiA), respectively, in order to induce gene expression (described in detail for PDC/ADH expressing mutants).

The total culture volume in characterization experiments was 300 mL in a 500 mL Schott-Flask; the initial OD750 was 1. Cultures were aerated with 0.5% CO2 in air.

All mutants were characterized under constant light conditions (75-100 μE m−2 s−1). In fast growing cultures, the light intensity was increased during the growth experiment (75-100 μE m−2 s−1 up to OD5; then light intensity was increased to 200 μE m−2 s−1).

Knock-out mutants related to fermentative pathways such as lactate dehydrogenase, acetate kinase or phosphoacetyltransacetylase were additionally characterized under day/night conditions (12 h 100 μE m−2 s−1/12 h dark). Knock-out mutants related to the formation of reserve compounds such as glycogen or PHB were additionally examined after transferring the cells in BG11 medium lacking a nitrogen source (nitrogen starvation conditions) as previously described herein.

Principle of Ethanol Quantification:

Ethanol is oxidized by nicotinamide-adenine dinucleotide (NAD+) to acetaldehyde in a reaction, which is catalyzed by the enzyme alcohol dehydrogenase (ADH) (reaction 1). The acetaldehyde, which is formed in the reaction, is quantitatively oxidized to acetic acid by the enzyme aldehyde dehydrogenase (Al-DH) (reaction 2).

In reactions (1) and (2) reduced nicotinamide-adenine dinucleotide (NADH) is formed. The amount of NADH formed is proportionate to the amount of ethanol in the sample. NADH is easily quantified by means of its light absorbance. The absorbance is usually measured at 340 nm, Hg 365 nm or Hg 334 nm.

Procedure:

Preparation of solutions: Solution 1: 1.3 mg/ml NAD and 0.27 U aldehyde dehydrogenase in potassium diphosphate buffer, pH 9.0. Solution 2: Suspension of alcohol dehydrogenase (ADH) with approx. 4000 U/ml. Alternatively, the chemicals and solutions of the ethanol determination kit of Boehringer Mannheim/R-Biopharm (Cat. No. 10 176 290 035) can be used. Sample and solution 1 are mixed in a ratio of 3 ml solution 1 and 0.1 ml sample (if necessary the sample is diluted with water). After approx. 3 min the absorbance is measured (A1). The reaction is then started by the addition of ADH suspension (solution 2, 0.050 ml for 3 ml solution 1 and 0.1 ml sample). After completion of the reaction (approx. 5 to 10 min) the absorbance is measured again (A2). The absorption measurements can be performed using a photometer or a microplate reader. For plate reader measurements all volumes are downscaled.

From the measured absorbance difference ΔA=(A2-A1) the ethanol concentration in the sample is calculated with the equation:

c = V × MG ɛ × d × v × 2 × 1000 × Δ A

c, ethanol concentration [g/L]; V, total volume [mL]; MG, molecular weight of ethanol (46.07 g/mol); e, extinction coefficient (6.3 L×mmol−1×cm−1 at 340 nm); d, light path [cm]; v, sample volume [mL]

Literature:

Protocol of the kit Ethanol, UV method for the determination of ethanol in in foodstuff and other materials, Cat. No. 10176290035, R-Biopharm AG, Darmstadt, Germany.

H.-O. Beutler (1984) in: Methods in Enzymatic Analysis (Bergmeyer, H. U. ed.) 3rd ed. Vol. VI, pp. 598-606, Verlag Chemie, Weinheim, Germany.

Growth Properties

For characterization experiments, metabolic mutant and the appropriate reference strains were cultured as described. Growth was followed for about 14 days by measuring optical density (daily) and chlorophyll (every second day). Photosynthetic O2 production was determined several times during exponential growth phase using a Clark electrode as followed:

Measurement of Photosynthetic Oxygen Evolution

Cell are washed 2× with fresh growth medium by centrifugation (3000×g, 10 min, room temperature) and resuspension. The cells are finally resuspended in growth medium to a chlorophyll concentration of 10 to 15 μg chlorophyll/ml. Chlorophyll is measured as described by [N. Tandeau De Marsac and J. Houmard]. The cells are filled into the chamber of a Rank Brothers oxygen electrode (Digital Model 10, Rank Brothers, Cambridge, England) and sodium bicarbonate is added to a final concentration of 25 mM.

The excitation light for photosynthesis experiments is provided by a slide projector with a 150-watt lamp (Osram, Xenophot HLX Germany).

The oxygen concentration in the chamber is recorded continuously with chart recorder (REC 112, Amersham Pharmacia Biotech) connected to the electrode. The chamber of the oxygen electrode is maintained at 25° C. with a circulating, temperature-controlled water bath (RM6, Lauda Brinkmann). For the calibration of the electrode the signal difference of air-saturated water (100% saturation) and oxygen free water (zero point) is measured. Oxygen free water is obtained by adding sodium dithionite (approximately 1 mg/ml). The measured amplitude is equated with the solubility of oxygen in water at 25° C. and a pressure of 1 bar (8.11 mg oxygen/L). Literature: N. Tandeau De Marsac and J. Houmard in: Methods in Enzymology, Vol. 169, 318-328. L. Packer, ed., Academic Press, 1988

Determination of Ethanol Production

For characterization of mutants expressing PDC and ADH or only PDC or other ethanologenic enzymes as a second genetic modification, ethanol was measured daily during the growth experiment according to the afore described optical enzymatic method (“Ethanol UV method” test kit by Boehringer Mannheim/R-Biopharm, Darmstadt, Germany). Ethanol production of metabolic mutants expressing PDC and ADH were compared to the appropriate reference strain expressing PDC and ADH as a second genetic modification, but lacking the respective metabolic mutation, the first genetic modification.

The cells were cultured over a period of time of 14 days. These cell cultures were further characterized during their logarithmic growth phase at certain time points with regard to their ethanol production rate, their chlorophyll content and photosynthetic capacity (oxygen evolution in μmol O2/mg Ch1*h). These three values were measured in a period of time of approximately 2 hours as described below. In the following these measurements are referred to as “short term measurements” or “short term experiments”.

Simultaneous Measurement of Photosynthetic Oxygen Evolution and Ethanol Production (Short Term Experiment)

For the comparison of ethanol production and photosynthesis, ethanol production rates and rates of photosynthetic oxygen evolution are measured simultaneous in a single assay.

Cells are washed 2× with fresh growth medium by centrifugation (3000×g, 10 min, room temperature) and resuspension. Cells are resuspended in growth medium to a chlorophyll concentration of 10 to 15 μg chlorophyll/mL. Chlorophyll is measured as described in [N. Tandeau De Marsac and J. Houmard in: Methods in Enzymology, Vol. 169, 318-328. L. Packer, ed., Academic Press, 1988]. 1.9 mL of the cells and 0.1 mL of 500 mM sodium bicarbonate for carbon dioxide supply are filled into the chamber of the oxygen electrode (Digital Model 10, Rank Brothers, Cambridge, England), and the rate of the photosynthetic oxygen evolution is measured as described herein (Measurement of photosynthetic oxygen evolution). (for example with a chart recorder REC 112, Amersham Pharmacia Biotech connected to the electrode). The chamber of the oxygen electrode is maintained at a constant temperature (in most cases 25° C.) with a circulating, temperature-controlled water bath (RM6, Lauda Brinkmann). The chamber is translucent and illuminated from the outside. The excitation light for photosynthesis experiments is provided by a slide projector with a 150-watt lamp (Osram, Xenophot HLX Germany). For measurements under standard conditions the light intensity was adjusted to 300 μm−2 s−1. Light intensities at the oxygen electrode were determined and the distance between light source and the chamber of the oxygen electrode were adjusted accordingly in order to obtain the desired light intensity of 300 μm−2 s−1 at the oxygen electrode. When the illumination is switched on, photosynthesis starts and an increase of oxygen concentration in the chamber can be observed. After a short period of time the plotted curve is linear. From the linear part of the plotted curve the rate (=photosynthetic oxygen evolution vs. time) is determined. The entire measurement of oxygen is finished after not more than 10 minutes. After completion of this measurement illumination of the sample in the chamber is continued under unchanged conditions. Over a period of one hour samples of 0.15 ml are taken in defined intervals (in most cases every 10 minutes). Immediately after removal samples are centrifuged (14,000×g, 10 min, 4° C.) and the supernatant is stored on ice. After completion of the sampling, the ethanol concentration in the supernatants is measured as described herein. The ethanol concentration versus time is plotted. Using the linear equation the rate of the increase of the ethanol content in v/v in the assay per hour is calculated. The rate of ethanol production is usually given in the dimension μmol ethanol*h−1*mg chlorophyll−1, the chlorophyll content measured at the beginning of the experiment is then used.

Determination of Intra- and Extracellular Metabolites

Two different methods were used for the extraction of cells to determine the level of intracellular metabolites. They are described here as “Protocol for extraction of intracellular metabolites” and “Extraction of metabolites using a Retsch mill”. The method “Extraction of metabolites using ice cold methanol (snap shot extraction)” extracts the intracellular metabolites but seizes also the metabolites in the medium. For the determination of extracellular metabolites an extraction of the cells is not necessary. Those metabolites were measured directly in the media.

Protocol for Extraction of Intracellular Metabolites

    • use 5 ml culture.
    • Centrifuge for 10 min, 4500 rpm.
    • Resuspend the pellet in 1 ml dd water.
    • Centrifuge 5 min with 14000 rpm. Discard the supernatant.
    • Resuspend the pellet in 1 ml double distilled water.
    • Centrifuge 5 min, 14000 rpm, 4° C. Discard the complete supernatant.

Continue or store the pellet by −20° C. under Argon atmosphere.

    • Add 600 ml of extraction buffer.
      • Extraction buffer: 10:3:1-methanol:chloroform:water
    • Vortex briefly.
    • Shake at 4 degrees for 10 min.
    • Centrifuge 5 min with 14000 rpm.
    • Transfer 500 μl to a new tube.
    • Add 200 μl chloroform and 200 μl water.
    • Centrifuge 5 min with 14000 rpm.
    • Transfer 500 μl of the upper phase to a new tube and speed vac to dry.
    • Resuspend the pellet in 100 μl double distilled water.
    • Shake at 4 degrees for 20 min. Centrifuge 5 min with 14000 rpm.
    • Transfer 95 μl to a vial for IC.

Extraction of Metabolites Using a Retsch Mill:

The protocol for extraction of intracellular metabolites was designed by Dr. M. Gründel.

Protocol:

Cells (150 ml cell culture) are harvested by centrifugation and resuspended in 400 μl buffer (100 mM Tris/HCl, pH 7.5) to which 200 μl of glass beads (0.1 mm diameter) are added. Cell lysis is performed using a Retsch mill model MM 301 (treatment for 10 minutes, 4° C.). After removal of glass beads, remaining intact cells and cell debris was removed by centrifugation (10 minutes, 4° C.). The whole procedure is repeated once. Proteins in the combined supernatants are precipitated by deoxycholate/trichloroacetic acid treatment (Bensadoun and Weinstein. 1976. Anal. Biochem. 70:241-250) and removed by centrifugation. The supernatant, containing the soluble metabolites, is neutralized with 2 M K2CO3 and adjusted to a volume of 1.5 ml with 100 mM Tris/HCl buffer, pH 7.5. In order to determine the concentration of metabolites, aliquots of 100-500 μl are used in the optical tests.

Extraction of Metabolites Using Ice Cold Methanol (Snap Shot Extraction): Literature Describing the Method:

According to R. P. Maharjan, T. Ferenci. 2002. Global metabolite analysis: the influence of extraction methodology on metabolome profiles of Escherichia coli. Anal. Biochem. 313:145-154.

This method allows for the immediate freezing of intracellular metabolite pools and the extraction of numerous intra- and extracellular metabolites at the same time.

Protocol:

Batches of cyanobacterial cultures are dropped into an equal volume of methanol, cooled by dry ice, and incubated on dry ice until completely frozen. After thawing in ice/water (10 min) the samples are centrifuged for 5 min (>=17.000×g, temperature as low as possible). The pellet is extracted a second time with cold 50% methanol (−20° C.). Supernatants are combined. Methanol is removed by evaporation at 35° C. under vacuum using a rotavapor apparatus. The remaining solution is lyophilized, the residue is resuspended in a minimal volume of water.

The efficiency of extraction of bacterial cells with cold methanol is similar to that with hot ethanol or hot methanol. But the method is very simple, rapid and changes in the stability and reactivity in metabolites are minimized.

When extracellular pyruvate and oxoglutarate are assayed, an extraction is not necessary since both metabolites are detectable directly in the media. Quantification of intracellular and extracellular pyruvate and oxoglutarate levels before and after nitrogen deprivation is done as previously described herein.

Pyruvate and phosphoenolpyruvate are quantified using an optic enzymatic test of Häusler et al. (2000), Anal. Biochem, 281:1-8. This method allows for the quantification of pyruvate and phosphoenolpyruvate in one test.

Protocol:

The quantifications are based on the reduction of pyruvate to lactate by lactate dehydrogenase (LDH) at the expense of NADH which is oxidized to NAD+. In the first step, pyruvate was assayed. After completion of this reaction, pyruvate kinase is added. Pyruvate kinase converts phosphoenolpyruvate to pyruvate and thus allows for determination of phosphoenolpyruvate.

To 450 μl master mix (9 μl 20 mM NADH, 12 μl 1 M MgCl2, 46 μl 1 M KCl, 12 μl 100 mM ADP, 360 μl 100 mM HEPES, 10 μl H2O) 520 μl sample (if necessary diluted with H2O) are added. Add 2 μl LDH to start the reaction. The oxidation of NADH is observed as decrease of absorbance at 340 nm. Either the difference of the absorbances at 340 nm minus 380 nm is measured by difference spectroscopy (turbid or colored samples; E340-380=4.83 l×cm×mmol-1) or the absorbance at 340 nm is measured against water (ε340=6.28 l×cm×mmol-1). After complete reaction of pyruvate, 2 μl pyruvate kinase are added to the assay. NADH oxidation is measured as before. From the differences of the absorbances at the start and the end of the reactions, the amount of oxidized NADH (=amount of pyruvate, and phosphoenolpyruvate, respectively) is calculated.

Chemicals and Solutions:

1. Lactate dehydrogenase suspension from bovine heart (L-LDH, Sigma L2625-2.5KU, suspension with 5629.5 U/ml), diluted 1:10
2. Pyruvate Kinase from rabbit muscle (P K, Serva 34085, suspension with 4000 U/ml), diluted 1:20

3. 100 mM HEPES/NaOH (pH 7.5) 4. 1 M MgCl2 5. 100 mM ADP 6. NADH (Sigma, N6005) 20 mM in H2O 7. 1 M KCl

Photometric Quantification of Pyruvate (and/or Lactate) in an Enzymatic Cycling System

Method:

According to E. Valero & F. Garcia-Carmona. 1996. Optimizing Enzymatic Cycling Assays: Spectrophotometric Determination of Low Levels of Pyruvate and L-Lactate. Anal. Biochem. 239:47-52

This method allows for the quantification of pyruvate (and/or lactate) with a 10-fold higher sensitivity than the pyruvate quantification method described before.

Protocol:

In a cyclic reaction pyruvate is reduced to lactate under consumption of NADH, the lactate is oxidized by lactate oxidase to pyruvate. The rate of NADH consumption, monitored spectrophotometrically at 340 nm is proportional to the amount of pyruvate (plus lactate if present) in the sample. For calibration curves, different amounts of pyruvate are added to the master mix (end volume 1000 μl) consisting of 50 mM TRIS-buffer, pH 7.5, 256 μM NADH, 1.8 μg lactate dehydrogenase and 60 μg lactate oxidase. The reaction is started by addition of lactate dehydrogenase and the time course of the reaction at 340 nm is followed for some minutes. Samples with unknown amounts of pyruvate and lactate are treated identically and quantified using the calibration curve. Detection limit is about 1 nmol pyruvate and/or lactate.

Chemicals and Solutions: 1. 50 mM TRIS/HCl (pH 7.5) 2. 20 mM NADH in H2O

3. 0.25 mg/ml lactate dehydrogenase in 50 mM TRIS/HCl (pH 7.5)
4. 2.6 mg/ml lactate oxidase in 50 mM TRIS/HCl (pH 7.5).

Spectrophotometric Quantification of 2-Oxoglutarate Using an Enzymatic Test Method:

The method used is an adaptation of a fluorimetric method (P. J. Senior. (1975). J. Bacteriol. 123:407-418) for spectrophotometry. The oxidation of NADH, followed by the absorption change at 340 nm, is proportional to the concentration of 2-oxoglutarate.

Protocol:

Cuvettes contained a final volume of 1000 μl: 100-500 μl sample; 10 μl ammonium sulfate; 10 μl NADH; 10 μl ADP; 10 μl glutamate dehydrogenase solution; TRIS buffer added to a final volume of 1000 μl. The reaction is started by the addition of glutamate dehydrogenase.

Chemicals and Solutions:

1. 1 M ammonium sulfate

2. 20 mM NADH 3. 0.1 M ADP

4. 2.6 enzyme units per ml glutamate dehydrogenase (from bovine liver; 104

    • enzyme units per mg; Serva lot no. 22904)

5. 0.1 M TRIS/HCl pH 8.0

Acetaldehyde was quantified by a modification of the protocol of a kit for ethanol quantification (Ethanol kit, R-Biopharm AG). Acetaldehyde is converted by aldehyde dehydrogenase under formation of NADH, which is quantified by its absorption at 340 nm. The amount is proportionate to the acetaldehyde content of the sample.

All mutant strains were characterized regarding their profile of relevant intracellular metabolites using ion chromatography always in comparison to the wild type or appropriate reference strain, respectively.

Short description of the UV-method for the determination of acetic acid in foodstuff and other materials from Boehringer Mannheim/R-Biopharm, Darmstadt, Germany

Principle: Acetic acid (acetate) is converted to acetyl-CoA in the presence of the acetyl-CoA synthetase (ACS), adenosine-5′-triphosphate (ATP) and coenzyme A (CoA) (1).


Acetate+ATP+CoA ACS acetyl-CoA+AMP+PP  (1)

Acetyl-CoA reacts with oxaloacetate to citrate in the presence of citrate synthase (CS) (2).


Acetyl-CoA+oxaloacetate+H2O CS citrate+CoA  (2)

The oxaloacetate required for reaction (2) is formed from L-malate and nicotineamide-adenine dinucleotide (NAD) in the presence of L-malate dehydrogenase (L-MDH) (3). In this reaction NAD is reduced to NADH.


L-malate+NAD+L-MDH oxaloacetate+NADH+H+  (3)

The determination is based on the formation of NADH measured by the increase in light absorbance at 340, 334 or 365 nm. Because of the equilibrium of the preceding indicator reaction, the amount of NADH formed is not linearly (directly) proportional to the acetic acid concentration (this fact is been taken into consideration in the calculation of acetic acid concentrations).

The above described methods for the quantification of acetate, pyruvate, acetaldehyde and 2-oxoglutarate can detect changes in the static steady state levels of these metabolic intermediates. As mentioned above the first genetic modification can result in a change of the metabolic flux of these metabolic intermediates, which is hard to detect by assays, which are able to detect the steady state level of a metabolite, but not the changes in the flux of the metabolite. In particular, these enzymatic assays might not properly show the changes in the metabolic activity of a photoautotrophic host cell, induced by the first genetic modification.

An overview of alternative assay methods, which can be used to detect the change in the metabolic activity of a photoautotrophic host cell of this invention is shown in the Review of Shimizu, “Metabolic Engineering-Integrating Methodologies of Molecular Breeding and Bioprocess Systems Engineering”, Journal of Bioscience and Bioengineering, Vol. 94, No. 6: 563-573 (2002), which is hereby incorporated by reference. These methods are more time-consuming and complex than the above described enzymatic assays and are for example metabolic flux analysis (MFA), cell capability analysis, metabolic control analysis (MCA) or 13C-NMR and gas chromatography. Mass spectroscopy (GCMS) measurements.

Wild type (WT) and mutant metabolite (pyruvate, acetaldehyde or acetyl-CoA or precursors thereof) measurements will be obtained as previously described herein and presented in the tables below.

Metabolite Metabolite Intracellular Extracellular level in mmol level in mmol per liter per liter OD750 wt mutant wt mutant 1.0 +N A A + Δ F F + Δ −N, B B + Δ G G + Δ 0 h −N, C C + Δ H H + Δ 3.5 h −N, D D + Δ I I + Δ 6 h −N, E E + Δ J J + Δ 24 h Data will be verified by repetitions. A-J represent wild type values for the indicated conditions Δ represents an increment relative to the wt measurement

The table shows an example for such an experiment. In other experiments the optical density (OD750) at the beginning of the experiment and the time points can be different

Metabolite Intracellular Metabolite level in mmol Extracellular per liter level in mmol (calculated per per liter Time packed cell culture of volume1) volume cultivation wt mutant wt Mutant T1 A A + Δ E E + Δ T2 B B + Δ F F + Δ T3 C C + Δ G G + Δ T4 D D + Δ H H + Δ Data will be verified by repetitions. A-H represent wild type values Δ represents an increment relative to the wt measurement

Parameters such as OD750nm, Chlorophyll content, protein content and cell number will also be measured in standardizing and evaluating metabolite values at different time points.

In addition, measurements can be obtained for variations in culture conditions such as light intensity, growth in darkness and in day/night cycles respectively, CO2 supplementation and temperature. Also, further variations might concern the composition of the growth medium (e.g. concentration of nitrate, ammonium, phosphate, sulfate or microelements (e.g. Cu, Fe)). All these variations in culture conditions are known to one of ordinary skill in the art.

The data will be analyzed and presented graphically as previously described herein.

Analysis of Ethanol Production

In order to discover whether the enhanced level of biosynthesis of pyruvate, acetaldehyde or acetyl-CoA in the mutant(s) cells also leads to a higher production of ethanol, Synechocystis sp. PCC 6803, both wildtype as well as the mutant(s) cells are transformed with the plasmid pVZ containing the Zymomonas mobilis Pdc and AdhII enzymes or other plasmids encoding ethanologenic genes under the control of the iron dependent isiA promoter or other promoters.

Analysis of ethanol production is done as previously described herein. Synechocystis sp. PCC 6803 with and without Pdc and Adh and Synechocystis sp. PCC 6803 mutant(s) cells with and without Pdc and Adh will be compared. This example will present a graphic depiction of these results that clearly demonstrate that increased ethanol production is provided by the mutant(s) cells when compared to the wild type cell.

Generation of Overexpression Mutants of Synechocystis Sp. PCC 6803: Methods and Results

The following overexpression construct sequences have been conveniently described and provided herein: (a) malic enzyme, (b) malate dehydrogenase, (c) pyruvate kinase 1, (d) pyruvate kinase 2, and (e) pyruvate kinase, enolase and phosphoglycerate mutase. These constructs may be used singly or sequentially in order to provide one or more mutations. Also, constructs contain either the natural promoter for the enzyme gene of interest or an inducible promoter.

Mutagenesis

Host cells are mutagenized by transformation of the overexpression DNA-vectors using the natural competence of Synechocystis sp. PCC 6803 for DNA uptake. In case of integrative overexpression mutants, the system of Synechocystis sp. PCC 6803 for homologous recombination as previously described herein is used. In addition, self-replicating constructs may also be used. The transformation may comprise one or more steps in order to create mutant cells having a single, double, triple, etc. overexpression mutations. Additionally, one or more knockdown/knockout mutations (as described herein) may be introduced. As noted previously herein, the concentration of the appropriate antibiotic(s) is increased stepwise when the cells are transferred onto another agar plate or into liquid culture (for kanamycin from initially 5 to 150 μg/ml Bg11, for chloramphenicol from initially 1 to 15 μg/ml BG11 medium) in order to get fully segregated (homozygous) mutants. Transfers are done every 2 weeks. In case of kanamycin, the concentration in the range from 50 to 150 μg/ml agar is increased gradually over the course of 4 weeks.

Molecular Analysis of Mutant Host Cell

In order to establish that the selected mutant(s) cell is overexpressing the target enzyme, RNA will be extracted from wild type and mutant cells and will be examined by using different techniques known in the art, e.g. RT-PCR, Northern blot or RNase protection assays. These recombinant DNA/molecular biology methods are well known to one of ordinary skill in the art; For example see: Methods in Enzymology, Vol. 167, (L. Packer, A. N. Glazer, eds) Academic Press, Inc., 1988); For extraction of genomic DNA: Franche C, Damerval T. in Methods of Enzymology, Vol. 167 p. 803-808; for extraction of total RNA: David 1. Lane, Katherine G. Field, Gary J. Olsen, and Norman R. Pace in Methods of Enzymology, Vol. 167 p. 138-144; for Extraction of plasmid DNA: Grant R. Lambert and Noel G. Carr, Rapid Small-Scale Plasmid Isolation by Several Methods from Filamentous Cyanobacteria, Arch Microbiol (1982) 133: 122-125; for Northern Blots: Axmann, I. M., Kensche, P., Vogel, J., Kohl, S., Herzel, H. & Hess, W. R. (2005) Genome Biol 6, R73; for RT-PCR: Emanuel C, von Groll U, Müller M, Börner T, Weihe A. Development- and tissue-specific expression of the RpoT gene family of Arabidopsis encoding mitochondrial and plastid RNA polymerases. Planta. 2006 April; 223(5):998-1009; for RNase protection assay: W.R. Hess, B. Hoch, P. Zeltz, T. Hübschmann, H. Kössel and T. Borner. Plant Cell 6 (1994), pp. 1455-1465., which are incorporated herein by reference.

Also, sufficient nucleotide sequence information for all enzymes is provided herein or available from known nucleotide sequence databases for the selection of the appropriate probes/primers for these analyses. With Northern Blot analysis, the abundance and relative amount of a mRNA will be detected. The same would be the case using a RNase protection assay but with a much higher sensitivity. The abundance and also the absolute amount of a mRNA can be determined with a high sensitivity using the RT-PCR. Mutant(s) cells found to be overexpressing the target mRNA will be selected for further analysis.

Characterization of Overexpression Mutants Cultivation of Cyanobacterial Wild Type and Mutant Strains

wild type (WT) and mutant strains will be grown under standard culture conditions.

Nitrogen step-down conditions will be as previously described herein.

Conditions for the induction of inducible promoters is provided herein through the teachings of the specification and by way of reference to specific publications. See also D. A. Los, M. K. Ray and M. Murata, Differences in the control of the temperature-dependent expression of four genes for desaturases in Synechocystis sp. PCC 6803, Mol. Microbiol. 25 (1997), pp. 1167-1175.

As provided below, mutants and wild type cells will be characterized regarding their intra- and extracellular pyruvate content using optical enzymatic tests and their profile of all relevant metabolites respectively. (incl. 3-PGA, PEP, pyruvate, acetyl-CoA, glycogen, PHB, cyanophycin, malate, oxaloacetate, 2-oxoglutarate, acetate, lactate, etc.) using ion chromatography always in comparison to the wild type.

Also the growth and pigmentation properties of mutant(s) will be compared to the wild type cell using standard protocols well known in the art.

The example presented here will provide a graphic depiction of growth properties for wild type and mutant cells as change in X vs. time, wherein X is ideally dry weight or biovolume. Alternatively, optical density, cell count and chlorophyll could be used as reference parameters. Alternatively, pigmentation could be quantified spectrophotometrically as another parameter.

Wild type (WT) and mutant metabolite (pyruvate, acetaldehyde or acetyl-CoA or precursors thereof) measurements will be obtained as previously described herein and presented in the table below.

Metabolite Metabolite Intracellular Extracellular level in mmol level in mmol per liter per liter OD750 wt mutant wt mutant 1.0 +N A A + Δ F F + Δ −N, B B + Δ G G + Δ 0 h −N, C C + Δ H H + Δ 3.5 h −N, D D + Δ I I + Δ 6 h −N, E E + Δ J J + Δ 24 h Data will be verified by repetitions. A-J represent wild type values for the indicated conditions Δ represents an increment relative to the wt measurement

The table shows an example for such an experiment. In other experiments the optical density (OD750) at the beginning of the experiment and the time points can be different

Metabolite Intracellular Metabolite level in mmol Extracellular per liter level in (calculated per mmol per liter Time packed cell culture of volume1) volume cultivation wt mutant wt mutant T1 A A + Δ E E + Δ T2 B B + Δ F F + Δ T3 C C + Δ G G + Δ T4 D D + Δ H H + Δ Data will be verified by repetitions. A-H represent wild type values Δ represents an increment relative to the wt measurement

Parameters such as OD750nm, Chlorophyll content, protein content and cell number will also be measured in standardizing and evaluating metabolite values at different time points.

In addition, measurements can be obtained for variations in culture conditions such as light intensity, growth in darkness and in day/night cycles respectively, CO2 supplementation and temperature. Also, further variations might concern the composition of the growth medium (e.g. concentration of nitrate, ammonium, phosphate, sulfate or microelements (e.g. Cu, Fe)). All these variations in culture conditions are known to one of ordinary skill in the art.

The data will be analyzed and presented graphically as previously described herein.

Analysis of Ethanol Production

In order to discover whether the enhanced level of biosynthesis of pyruvate, acetaldehyde or acetyl-CoA in the mutant(s) cells also leads to a higher production of ethanol, Synechocystis sp. PCC 6803, both wildtype as well as the mutant(s) cells are transformed with the plasmid pVZ containing the Zymomonas mobilis Pdc and AdhII enzymes or other plasmids encoding ethanologenic genes under the control of the iron dependent isiA promoter or other promoters.

Analysis of ethanol production is done as previously described herein. Synechocystis sp. PCC 6803 with and without Pdc and Adh and Synechocystis sp. PCC 6803 mutant(s) cells with and without Pdc and Adh will be compared. This example will present a graphic depiction of these results that clearly demonstrate that increased ethanol production is provided by the mutant(s) cells when compared to the wild type cell.

X. Experimental Data for Characterization of Metabolic Mutants Containing at Least One First or One First and One Second Genetic Modification

In the following available experimental data regarding pyruvate secretion are discussed for photoautotrophic cells harboring at least one first genetic modification. Furthermore ethanol production rate, if available, are also discussed for photoautotrophic cells containing in addition to the at least one first genetic modification at least one second genetic modification.

X.1 Metabolic Mutant Harbouring a Glycogen Synthase Double Knock Out Mutation as a First Genetic Modification

Characterization of the glycogen deficient glycogen synthase double knock out mutants of Synechocystis PCC 6803:

Nomenclature:

Enzyme: Glycogen Glycogen (starch) synthase 1 synthase 2 EC no.: EC 2.4.1.21 EC 2.4.1.21 Gene name: glgA1 glgA2 Gene in sll0945 sll1393 Synechocystis PCC 6803:
  • Theoretical background: Diverting the production of storage reserves into an enhanced production of pyruvate/ethanol
  • Genetic Manipulation: double knockout by insertion of a chloramphenicol cassette (ΔglgA1) and kanamycin cassette (ΔglgA2) M8-mutant: Cm, Km Complete segregation: yes

Characterization of the Mutants Harboring the Glycogen Synthase Double Knock Out Mutation as a the First Genetic Modification, But Lacking the Second Genetic Modification (Ethanologenic Enzymes).

Determination of intracellular Glycogen before and after a N step down

The procedure is an adaptation of the method described by Ernst et al. (A. Ernst, H. Kirschenloher, J. Diez, P. Boger. 1984. Arch. Microbiol. 140:120-125). Glycogen is isolated by alkaline hydrolysis of cells followed by precipitation of glycogen with ethanol. Isolated glycogen is digested with amylolytic enzymes to glucose, which is quantified in a standard optical test.

Protocol:

    • Spin down 1-4 ml of Synechocystis culture before and after N step down resp. at RT and remove the supernatant
    • Add 200 μl KOH (30% w/v) to the pellet and incubate 90 minutes at 95° C. in a heating block
    • Add 600 μl cold ethanol (96%) and incubate 90 min on ice
    • Spin down and discard the supernatant
    • Wash once with ethanol (70%) and once with ethanol (96%)
    • Dry the pellet in a vacuum centrifuge
    • Dissolve the pellet in 45-90 μl acetate buffer
    • Add 5-10 μl enzyme mix (amyloglucosidase+alpha-amylase from Bacillus amyloliquefaciens, purchased from Roche) and incubate 90 min at 45° C.
    • Use 10-40 μl of the resulting sample for the determination of glucose after manufacturer's instruction (Infinity glucose hexokinase liquid stable reagent for optical test at 340 nm; Cat No. TR15421Thermo Electron Corporation)

Reaction:

Chemicals and solutions:
1. aqueous solution of KOH (30% w/v)
2. ethanol 96% v/v
3. 100 mM acetate buffer, adjusted to pH 5.0 with NaOH
4. enzyme mixture of amylo glucosidase (26.7 mg/ml; Boehringer, lot 1490306) plus alpha-amylase (1.0 mg/ml; Boehringer, lot 84874220-34) in 100 mM acetate buffer pH 5.0)

Quantification of intracellular and extracellular pyruvate and oxoglutarate levels before and after nitrogen deprivation (“N step down”)

Explanation for “N Step Down”:

This means sedimentation of cyanobacterial cells by centrifugation, decantation of the nitrate-containing (+N) medium and resuspension of the culture in nitrate-free (—N) medium.

Cultivation Under Continuous Light (40 μE m−2 s−1), BG11, 29° C.:

  • Growth properties: no difference between wild type (wt) and mutant (M8) (the growth of M8 is impaired under High Light conditions [130 μE m−2 s−1] and low inoculi [initial OD750<0.1])
  • Pigmentation: no difference between wt and mutant
  • Storage substances: no glycogen production by the mutants in contrast to the wt
    Continuous Light (40 μEm−2s−1), BG11 without nitrogen (24 h, 48 h), 29° C.:(N starvation)
  • Growth properties: wt and mutant stopped growing. After passage to BG11 medium containing nitrogen, wt started to grow again whereas the mutant M8 gradually lost the ability to grow, depending on duration of nitrogen depletion.
  • Pigmentation: After withdrawal of nitrogen, wt started to degrade phycobilisomes (measured as absorbance at 625 nm): yellow color; M8-mutant did not degrade phycobilisomes: still blue-green color; unchanged chlorophyll levels (absorbance at 681 nm) in both wt and mutant M8
    Pyruvate level:

Intracellular level in mmol per Extracellular liter level in mmol (calculated per liter per packed culture cell volume1) volume OD750 wt M8 wt M8 1.0 +N 0.8 0.8 0.007 0.018 −N, nd nd 0 h −N, 0.005 0.038 3.5 h −N, 0.004 0.08 6 h −N, 0.9 1.6 0.007 0.470 24 h Data were verified by repetitions. nd, not detectable The packed cell volume is less than 1% of the culture volume

Growth properties and extracellular pyruvate levels of the ΔglgA1/ΔglgA2 double mutant (M8) under nitrogen replete and nitrogen starved conditions are presented in FIG. 32C.

The glycogen deficient mutant M8 was grown up to an OD750 of 0.6. After a centrifugation step, the cells were washed twice with nitrogen deficient BG11 medium and transferred to medium with nitrogen (+N, control) and without nitrogen (−N), respectively. After 24 h incubation, nitrogen was added to the nitrogen deficient cultures (black arrow). The growth of the cultures was estimated by measurement of chlorophyll. Abbreviations: Chl, chlorophyll a; Pyr, pyruvate

Oxoglutarate Level:

Intracellular level in mmol Hours per liter Extracellular after (calculated per level in mmol nitrogen packed cell per liter step volume1) culture volume down wt M8 wt M8 0.5 0.036 0.038 nd nd 2 0.17 0.22 nd nd 5 0.18 0.26 nd 0.01 24 0.22 0.53 nd 0.14 1The packed cell volume is less than 1% of the culture volume nd, not detectable

Light/Dark Cycle (16 h/8 h), BG11, 29° C.:

Growth properties: no difference between wt and mutants M1 and M8

Further mutant characterization of the glycogen deficient mutant M8 in comparison with the wild type strain of Synechocystis sp. PCC6803

Culture Conditions:

  • Continuous light (150 μE m−2 s−1), 28° C.:
  • Aeration with air (no additional CO2 supplementation)
  • Culturing in glass flasks with 5 cm diameter, 400 ml culture volume
  • Media: BG11 buffered with TES buffer (Sigma-Aldrich Inc.) at pH 8

Storage Substances:

  • No glycogen production by the mutants in contrast to the wild type.
  • Pyruvate concentrations in the media determined by using an optical enzymatic test:

Pyr- Pyr- Pyr- uvate uvate Pyruvate uvate 0 h 3.5 h 6 h 24 h after after after after N step N step N step N step OD750 Chlorophyll down down down down WT 1.2 6.18 μg/ml 0 μM 5.1 μM 4.0 μM  2.5 μM M8 1.1 3.60 μg/ml 0 μM  37 μM  79 μM 473 μM mutant
  • Pyruvate concentrations in the media determined by ion chromatography:

Pyruvate Pyruvate 0 h after 24 h after N step N step OD750 Chlorophyll down down WT 1.2 6.18 μg/ml 0 μM 13.4 μM M8 mutant 1.1 3.60 μg/ml 0 μM  511 μM

Pyruvate Concentrations in the Media Plus Cells (Snap Shot Extraction) Determined by Ion Chromatography:

Pyruvate Pyruvate 0 h 24 h after after N step N step OD750 Chlorophyll down down WT 1.2 6.18 μg/ml 0 μM 6.12 μM M8 1.1 3.60 μg/ml 0 μM  523 μM mutant

Wildtype and mutant were transferred into a medium without combined nitrogen and grown for 24 hours. Subsequently the amount of pyruvate in the culture medium was determined in with an optical enzymatic method and by ion chromatography. The sum of intra- and extracellular pyruvate was determined by ion chromatography after snapshot extraction

Shown is the conductimetric detection of pyruvate in methanol extracts (snapshot) of cultures of wildtype and a glycogen synthase deficient mutant after 24 h under N-deficient conditions. The area of the pyruvate peak corresponds to 523 pmoles.

Data results are presented graphically in FIGS. 32D and 32E.

Summary Pertaining to Ethanol Production:

The loss of the two functional glycogen synthases in Synechocystis PCC 6803 mutant M8 resulted in a two-times increased intracellular pyruvate level and an at least 10-times increased extracellular pyruvate level after nitrogen depletion (24 h). In dense cultures (OD750 1.0), the extracellular pyruvate level is actually increased up to 500 times. In the wild type, these concentrations remained unchanged and much lower. The enhanced pyruvate level is used for ethanol production.

Glycogen is made during the day and would therefore compete with ethanol production in the light. It is degraded during the night and may thus support ethanol production by a quasi continuous production.

Possible Advantages of Glycogen Deficiency:

Glycogen synthesis requires energy (ATP):

    • Photosynthesis→glucose phosphate
    • glucose phosphate+ATP→ADP-glucose+pyrophosphate
    • n ADP-glucose→glycogen+n ADP

During the night, glycogen will be degraded:

    • glycogen+n phosphate→n glucose phosphate
    • glucose phosphate→→pentose phosphate+CO2↑
    • pentose phosphate→→pyruvate pyruvate ethanol+CO2↑

Conclusions:

    • Ethanol production via glycogen requires more energy and releases 50% more CO2 than direct production.
    • A further advantage may be that glycogen-deficient mutants degrade photosynthetic pigments at a much lower rate than the wild type under conditions of nitrogen deficiency. Thus, growth could be retarded during ethanol production by lowering nitrogen supply.

In order to find out whether the pyruvate produced by the glycogen synthase double knock out mutant in Synechocystis can be used for ethanol production, the glycogen synthase double knock out mutant cells (denoted as M8 in the below two graphs) were transformed with the plasmid pVZ321b-PnblA-pdc/adh containing the alcohol dehydrogenase and pyruvate decarboxylase genes under the transcriptional control of the nblA promoter inducible by nitrogen starvation (denoted as M8 PnblA in the below two graphs). The concentration of pyruvate in the growth medium was determined for the M8 mutant without the pVZ321b-PnblA-pdc/adh plasmid after having induced pyruvate secretion into the medium by nitrogen starvation (indicated by M8-N in the below graphs). In addition the concentration of pyruvate and ethanol in the growth medium was also determined for the M8 mutant including the pVZ321b-PnblA-pdc/adh plasmid after having induced pyruvate production by nitrogen starvation (indicated by M8 PnblA-N in the below graphs). For the reason of comparison the respective pyruvate concentrations are also shown for the uninduced cells (denoted with M8 PnblA+N and M8+N, respectively).

Both graphs depict on the Y-axis the concentrations of pyruvate and ethanol in μM normalized to the cell density measured at 750 nm (OD750nm). The x-axes denote the course of the experiments in hours.

As can be seen in FIG. 32F the graph shows the pyruvate concentrations. It can clearly be seen that the pyruvate concentration in the growth medium is higher for the M8 mutant without Adh and Pdc enzymes than for the M8 mutant including both ethanol forming enzymes under the conditions of nitrogen starvation. In the case that the cells are not subjected to nitrogen starvation pyruvate could not be detected in the growth medium.

FIG. 32G depicts the ethanol concentration determined in the growth medium for the M8 mutant with the Adh and Pdc enzymes under the conditions of nitrogen starvation and without nitrogen starvation. The graph shows that the ethanol concentration is higher for the M8 mutant under the conditions of nitrogen starvation than without nitrogen starvation. By comparing both graphs it can be observed that nearly all pyruvate produced by the M8 mutant can be converted into ethanol by the Adh and Pdc enzymes: The M8 mutant without the Adh and Pdc enzymes secretes high amounts of pyruvate into the growth medium, but the M8 including both enzymes only excretes small amounts of pyruvate but a high amount of ethanol into the growth medium.

Furthermore the glycogen deficient glycogen synthase double knock out mutants of Synechocystis PCC 6803 were transformed with the plasmid pVZ containing ZmPdc and ADHII under the control of the iron starvation inducible promoter isiA using the standard protocols described above. Ethanol production rates and the OD750nm were determined over the course of 15 days. Results are depicted graphically in FIG. 32H.

Further, short term measurements of ethanol production rates were carried out for the glycogen synthase double knock out mutant in Synechocystis PCC 6803 with and without a second genetic modification of at least one overexpressed enzyme for ethanol formation and these production rates were compared to the ethanol production rates of the corresponding Synechocystis cells only harboring the second genetic modification.

ΔglgA1/ΔglgA2 mutant μmol μmol % of μmol O2/ EtOH/ EtOH/ theoretical mg Chl * h mg Chl * h μmol O2 fixed CO2 S. PCC6803 98.3 5.0 0.051 15.4 pVZ321b-PisiA- PDC-ADHII ΔglgA1/A2 34.8 5.4 0.154 46.2 pVZ321b-PisiA- PDC-ADHII

The above table shows the ethanol production rates normalized either to the chlorophyll content, the maximal photosynthetic capacity as determined by the oxygen evolution and the percentage of theoretical fixed CO2 which is diverted to ethanol production for a Synechocystis strain without the glycogen synthase double knock out mutation, the first genetic modification (S. PCC6803 pVZ321b-PisiA-PDC-ADHII), and for Synechocystis strains having both the first and second genetic modification (ΔglgA1/A2 pVZ321b-PisiA-PDC-ADHII). The data show that the overall photosynthetic capacity of the cells harboring the double knock out mutation is reduced. The results also indicate that a higher percentage of carbon fixed via photosynthesis can be diverted to ethanol production via a reduction of the enzymatic affinity or activity of glycogen synthase for example by introducing a knock out mutation of both genes glgA1/glgA2 coding for glycogen synthase into cyanobacteria) cells such as Synechocystis.

X.2 Metabolic Mutant Harbouring a Knock Out of ADP-Glucose-Pyrophosphorylase (ΔGLGC) as a First Genetic Modification

Construction of the DNA-vector pGEM-T/ΔglgC-KM, which was used for generation of ΔglgC mutant, was already described herein. The obtained ΔglgC mutant was partially segregated and was grown in BG11 medium containing 75 mg/l kanamycin. The segregation status was checked by southern blot analysis using a radio-labeled glgC probe. Approximately 80% of the wild-type gene copies were replaced by the introduced mutant gene copy.

The partially segregated mutant ΔglgC was examined in comparison to Synechocystis wild-type strain under constant light conditions as described herein.

Growth Characteristics Under Constant Light Conditions

The ΔglgC mutant is generally more sensitive to light at low concentrated inoculi than the wild type strain (Synechocystis PCC6803). During further batch culturing no significant differences were detected in cell growth and chlorophyll content between the mutant and the Synechocystis PCC6803 wild type. However, the photosynthetic capacity of the ΔglgC mutant was about 35% lower compared to the Synechocystis PCC6803 wild type. This finding is consistent with data reported by Miao et al., 2003 (Miao, X., Wu, Q., Wu, G. & Zhao, N. (2003) Changes in photosynthesis and pigmentation in an agp deletion mutant of the cyanobacterium Synechocystis sp.; Biotechnol Lett. 25, 391-396).

Like in the ΔglgA mutant described above, in the ΔglgC mutant the extracellular pyruvate level is strongly increased. Data from one representative experiment are shown in the following table:

7 days 4 days pyr- 9 days pyruvate uvate pyruvate OD750 [mM] OD750 [mM] OD750 [mM] PCC6803 Wt 1.7 0.009 2.0 0.001 2.4 0.003 ΔglgC 1.1 0.087 2.0 0.093 2.2 0.199

In wild type cells glycogen synthesis is increased during nitrogen starvation. Therefore, in the ΔglgC mutant, that is not able to produce glycogen, an additional increase of the pyruvate level was achieved by a nitrogen step down.

After 9 days of culturing under standard conditions, the culture was split into two parts. With one half of the culture a nitrogen step down was performed (as described for the ΔglgA mutant) and cells were grown on BG11 lacking combined nitrogen (−N) for two days. The second half of the culture was grown in full BG11 medium (+N) as a control. Two days after the nitrogen step-down, the excretion of pyruvate into the medium was measured.

+N −N OD750 pyruvate [mM] OD750 pyruvate [mM] PCC 6803 Wt 1.7 0.012 1.2 0.010 ΔglgC 1.3 0.295 1.2 0.361

ADP Glucose Pyrophosphorylase (GlgC) Knock-Out Mutant Expressing PDC and ADH

The DNA-vector pGEM-T/ΔglgC-KM was transformed into the PDC-ADHII expressing mutant Synechocystis PCC6803 pSK10-PpetJ-PDC-ADHII. The obtained mutant ΔglgC pSK10-PpetJ-PDC-ADHII was fully segregated and was grown in BG11 medium containing 100 mg/l kanamycin and 10 mg/l streptomycin.

Ethanol production was induced by copper starvation and compared to that of Synechocystis wild-type pSK10-PpetJ-PDC-ADHII.

In short term experiments under optimal conditions (light, CO2) the overall as well as the relative (to photosynthetic activity) ethanol production rate of the ΔglgC pSK-PpetJ-PDC-ADHII mutant was higher compared to that of the reference strain S. PCC6803 pSK-PpetJ-PDC-ADHII. Therefore the short term experiments performed at the beginning of the log phase (day 5 and 6 during the growth experiment) indicate a higher potential for ethanol production for the ΔglgC pSK-PpetJ-PDC-ADHII mutant. (Data are the mean of 2 measurements)

ΔglgC mutant μmol μmol % of μmol O2/ EtOH/ EtOH/ theoretical mg Chl * h mg Chl * h μmol O2 fixed CO2 S. PCC6803 pSK- 250 4 0.016 4.8 PpetJ-PDC-ADHII ΔglgC pSK-PpetJ- 125 9 0.072 21.6 PDC-ADHII

Similar to the glycogen synthase double knock out mutation, these results indicate that by reducing the enzymatic affinity or activity of ADP-glucose-pyrophosphorylase for example by a knock out mutation of the gene encoding ADP-glucose-pyrophosphorylase a higher percentage of carbon fixed via photosynthesis can be redirected to ethanol production. In the case that the photoautotrophic host cells do not have a second genetic modification, a drastic increase of pyruvate secretion into the growth medium can be detected.

X.3 Metabolic Mutant Harbouring a Knock Out of Pyruvate Water Dikinase (ΔPPSA) as a First Genetic Modification

Knock out of phosphoenolpyruvate synthase or pyruvate water-dikinase (PpsA) was accomplished by insertion of a kanamycin resistance cassette into gene slr0301. Construction of the DNA-vector pGEM-T/ΔppsA, which was used for generation of the ppsA knock-out mutant, was already described herein. The obtained ppsA knock-out mutant was fully segregated and cultivated in BG11 medium containing 75 mg/l kanamycin.

The mutant ΔppsA was characterized in comparison to the Synechocystis wild-type strain under constant light conditions as described herein.

No significant differences could be detected in cell growth, chlorophyll content and photosynthetic oxygen production between Synechocystis PCC6803 wild-type and the ΔppsA mutant. However, in several independent growth experiments the extracellular pyruvate level of the ΔppsA mutant was increased at the end of the log-phase. Data from one representative experiment are shown in the following table:

10 days 4 days pyr- 14 days pyruvate uvate pyruvate OD750 [mM] OD750 [mM] OD750 [mM] PCC6803 Wt 2.0 0 12.8 0.009 13.3 0.010 ΔppsA 1.8 0.014 8 0.010 10.8 0.073

X.4 Metabolic Mutant Harbouring a Knock Out of Either Acetatekinase (ΔACK) or a Double Knock Out of Acetatekinase and Phosphoacetyltransacetylase (RACK/PTA) as a First Genetic Modification

The following knock-out mutants were generated: the single-mutants Δack and Δpta and the double mutant Δack/Δpta. Knock-out of acetatekinase (ack) was accomplished by replacement of a 0.65 kb fragment of slr1299 (ack gene) by a kanamycin resistance cassette. As described herein, plasmid pBlue-ack-Kan was used to generate the Δack mutant. Knock-out of phosphoacetyltransacetylase (pta) was accomplished by replacement of a 0.45 kb fragment of slr2132 (pta gene) by a chloramphenicol resistance cassette. The construction of plasmid pUC-pta-Cm, which was used for generation of Δpta mutant is described above. The double knock-out mutant Δack/Δpta was generated by transformation of pBlue-ack-Kan into the Δpta mutant.

All mutants were fully segregated. Mutants were grown in BG11 medium containing the appropriate antibiotics (kanamycin 75 mg/l; chloramphenicol 10 mg/l).

Mutants Δack, Δpta, Δack/pta and Synechocystis wild-type strains were examined under constant light conditions as described.

Results:

No significant differences could be detected in cell growth, chlorophyll content and photosynthetic oxygen production between the Synechocystis PCC6803 wild type and mutants Δack, Δpta and double mutant Δack/Δpta.

Excretion of pyruvate into the medium could be detected at the end of the log phase and was increased in the mutants compared to the wild type. Data from representative experiments are shown in the following tables. The optical density at 750 nm (OD750nm) and the concentration of pyruvate in the medium are given at two time points at the end of the log phase.

10 days 14 days OD750 nm pyruvate [mM] OD750 nm pyruvate [mM] PCC6803 wt 4.6 0.006 6.2 0.012 Δack 6.6 0.009 7.0 0.025 Δpta 6.7 0.010 6.3 0.019

10 days 12 days OD750 nm pyruvate [mM] OD750 nm pyruvate [mM] PCC6803 wt 8 0.003 8 0.011 Δack/Δpta 6 0.004 7 0.026

Acetatekinase (ack) and Acetatekinase (ack)/Phosphoacetyltransacetylase (pta) Knock-Out Mutants Expressing PDC and ADH

The self-replicating plasmid pVZ321b-PpetJ-PDC-ADHII was conjugated into each of the mutants: Δack, and double mutant Δack/pta, resulting in mutants Δack pVZ321b-PpetJ-PDC-ADHII, and Δack/pta pVZ321b-PpetJ-PDC-ADHII. Mutants were grown in BG11 medium containing the appropriate antibiotics (kanamycin 75 mg/l; chloramphenicol 10 mg/l; streptomycin 10 mg/l). Ethanol production was induced by copper starvation under constant light and compared to Synechocystis wild-type harboring pVZ321b-PpetJ-PDC-ADHII as described above.

Results:

In several independent growth experiments, the double mutant Δack/pta, harboring pVZ321b-PpetJ-PDC-ADHII, exhibited significantly higher ethanol production rates compared to the reference strain S. PCC6803 pVZ321b-PpetJ-PDC-ADHII. In the single mutant Δack, harboring pVZ321b-PpetJ-PDC-ADHII, ethanol production was increased compared to the reference strain S. PCC6803 pVZ321b-PpetJ-PDC-ADHII. However, this effect was not apparent, when given relative to cell growth.

Data from one representative experiment are shown in the following table. FIGS. 32I and 32J depict a graphical presentation of these data.

time [days] 0 6 d 11 d 13 d PCC6803 pVZ321b- OD750 nm 1.2 2.5 3.2 3.9 PpetJ-PDC-ADHII EtOH [%] 0.000 0.030 0.060 0.072 Δack/pta pVZ321b- OD750 nm 1.2 2.3 2.6 2.7 PpetJ-PDC-ADHII EtOH [%] 0.000 0.044 0.098 0.121 Δack pVZ321b-PpetJ- OD750 nm 1.3 2.8 3.9 4.8 PDC-ADHII EtOH [%] 0.000 0.034 0.082 0.094

The following table shows the ethanol concentration in the medium at the end of a growth experiment and the ethanol production rate relative to cell growth (given as the slope of ethanol production [%] per OD750nm and day.

EtOH [%] after 13 EtOH production days of growth rate [%/OD750nm * d] PCC6803 pVZ321b- 0.072 0.001 PpetJ-PDC-ADHII Δack/pta pVZ321b- 0.121 0.0039 PpetJ-PDC-ADHII Δack pVZ321b- 0.094 0.001 PpetJ-PDC-ADHII

When mutants Δack pVZ321b-PpetJ-PDC-ADHII, and Δack/pta pVZ321b-PpetJ-PDC-ADHII and the reference strain S. PCC6803 pVZ321b-PpetJ-PDC-ADHII were grown under day/night cycle conditions, similar results were obtained. After induction of PDC and ADHII by copper starvation, strains Δack/pta pVZ321b-PpetJ-PDC-ADHII and Δack pVZ321b-PpetJ-PDC-ADHII showed higher ethanol production rates compared to the reference strain S. PCC6803 pVZ321b-PpetJ-PDC.

At three consecutive days during the logarithmic growth phase, photosynthetic capacity and ethanol production was measured in the oxygen electrode as described.

In these short-term measurements photosynthetic activity is measured under optimized conditions (saturating light and carbon supply). Results represent the maximal photosynthetic capacity of cells rather than the real photosynthetic activity during cultivation.

Following the reaction equation of photosynthesis 6 CO2+12H2O→C6H12O6+6 O2+6H2O, the photosynthetic capacity [μmol O2/mg Chl*h] is equivalent to the maximal carbon fixation [μmol CO2/mg Chl*h]. Therefore the factor (μmol EtOH per/μmol O2) given in the following table puts EtOH production into perspective of carbon fixation/photosynthesis.

Values are the mean of three consecutive measurements.

EtOH PS capacity production [μmol O2/ [μmol EtOH/ μmol EtOH/ mg Chl * h] mg Chl * h] μmol O2 PCC6803 pVZ321b- 221 3.6 0.016 PpetJ-PDC-ADHII Δack/pta pVZ321b- 241 6.1 0.025 PpetJ-PDC-ADHII Δack pVZ321b- 301 7.2 0.024 PpetJ-PDC-ADHII

Conclusions:

Ethanol production in the double mutant Δack/pta, harboring pVZ321b-PpetJ-PDC-ADHII, was significantly enhanced compared to the reference strain (wt) and also in comparison to the single mutant Δack pVZ321b-PpetJ-PDC-ADHII. For the single mutant Δack pVZ321b-PpetJ-PDC-ADHII, high ethanol production rates were obtained in short term experiments.

X.5 Metabolic Mutant Harbouring a Knock Down of Pyruvate Dehydrogenase E1 Component (Beta Subunit) (PDHBANTI) as a First Genetic Modification

Knock-down of Pyruvate dehydrogenase (PdhB) was accomplished by regulated expression (PpetJ) of the corresponding antisense RNA (sll1721-pdhB). Construction of the DNA-vector pSK9/PpetJ-pdhBanti, which was used for the generation of a pdhB knock down mutant, was already described herein. The obtained pdhB knock-down mutant was fully segregated and was grown in BG11 medium containing 14 mg/l chloramphenicol. The mutant pdhBanti was characterized in comparison to the Synechocystis wild-type strain under constant light conditions as described herein. Expression of anti-sense RNA was induced by copper starvation as described for induction experiments with the promoter PpetJ. Expression of anti-sense RNA was verified by northern blot analysis.

Results:

No significant differences could be detected in cell growth, chlorophyll content and photosynthetic oxygen production between Synechocystis PCC6803 wild type and pdhBanti mutant. After induction of the petJ promoter, the level of extracellular pyruvate was slightly increased in the pdhBanti mutant compared to the wild-type. This effect was verified in three independent growth experiments, data from one representative experiment are shown.

7 days 9 days OD750 pyruvate [mM] OD750 pyruvate [mM] PCC6803 wt 3.6 0 5.3 0.004 pdhBanti 3.9 0.004 6.1 0.015

X.6 Metabolic Mutant Harbouring an Overexpressed Ribulose-1,5-Bisphosphate Carboxylase/Oxygenase (Rubisco) as a First Genetic Modification

Mutant and Synechocystis wild-type strains were grown at 28° C., under constant light (70 μE m−2 s−1) and aerated with CO2-enriched air (0.5% CO2). The initial OD250 was about 1 in a total culture volume of 200 ml in a 250 ml Schott-flask. For comparison of the ethanol production an integrative ethanol producing mutant (6803 pSK10-PisiA-PDC/ADHII) was compared to the isogenic, ethanologenic mutant containing moreover the RubisCO overexpressing plasmid (pVZ321b-Prbc-SynRbc).

Methods:

The rate of oxygen evolution was measured with a Clark-type oxygen electrode (Rank Brothers, UK). Prior to the measurement cells were washed 2× and resuspended in BG-11 medium supplemented with 25 mM NaHCO3. Light intensity was saturating with approx. 500 μE/s*m2.

For preparation of cell extracts, cells were pelleted, washed two times with 20 mM HEPES/KOH, pH 7.5, 5 mM EDTA, 2 mM DTT, dissolved in this buffer and broken with a beadbeater (2×10 min). The supernatant of a centrifugation (15 min, 14000 rpm, 4° C., Micro 200R, Hettich) was used for the experiments. The protein content of cell extracts was measured with the method of Lowry.

RuBisCO activity was measured similar as described in Iwaki et al. (2006) Photosynth Res. 2006 June; 88(3):287-97. Epub 2006 May 12. Expression of foreign type I ribulose-1,5-bisphosphate carboxylase/oxygenase stimulates photosynthesis in cyanobacterium Synechococcus PCC7942 cells:

5 μl to 15 μl of cell extracts were mixed with 750 μl of 50 mM HEPES/KOH, pH 7.5, 20 mM MgCl2, 50 mM KHCO3, 0.15 mM NADH, 5 mM ATP, 2.5 mM Phosphocreatine, 1.5 μl carbonic anhydrase (10 U/μl in 50 mM HEPES, pH 7.5), 7.5 μl creatine kinase (0.5 U/μl) 3.75 μl of glyceraldehyde-3-phosphate dehydrogenase (12.5 mg/ml), phosphoglycerate kinase (suspension with 10 mg/ml). The assay was incubated at 30° C. for 10 min. Then the reaction was started by the addition of 7.5 μl of 250 mM ribulose-1,5-bisphosphate and the absorption of 340 nm was monitored.

Results and Conclusions:

The mutant with RuBisCO over-expression (6803 pVZ321b-Prbc-SynRbcLXS) grows as fast as the Synechocystis wild type and shows no phenotypical differences except for the chlorophyll content that is reduced by 20-30% compared to wild type (see FIG. 32K). Interestingly, at the same time the mutant produces significant more biomass observed by dry weight determination at several time points during the cultivation experiment (Tab.1). At the end point the difference in dry weight accounts to about 30%. This means although both cultures are indistinguishable by the optical density the mutant seems to build up more biomass. Either the cells are larger in size or the cells are denser packed by biomass (eg. with carbohydrates like glycogen or fatty acids).

FIG. 32L shows the growth parameter (OD at 750 nm and Chlorophyll content) of Synechocystis wild type and a mutant that over-express the endogenous RuBisCO operon.

TABLE 1 Biomass (dry weight, mean value of triplicates) during the (in FIG. 50-1A shown) cultivation experiment of Synechocystis wild type cells and cells overexpressing RuBisCO. Prbc-SynRbcLXS WT 6803 time Chl a Dryweight Chl a Dryweight [d] OD750 nm [mg/l] [g/l] OD750 nm [mg/l] [g/l] 0 0.96 3.82 0.23 0.91 3.69 0.18 7 6.09 22.60 1.01 6.36 29.07 1.02 11 8.14 21.22 1.51 7.99 33.89 1.30 16 10.17 18.30 1.70 10.01 24.97 1.32

Measurements of the RuBisCO activity from the mutant with RuBisCO over-expression revealed an about 2-fold increase in the activity compared to the wild type (see Tab.2). This was confirmed by semi-quantitative Western blot analyses, too (data not shown). Furthermore for this mutant and the wild type the oxygen evolution was determined. Based on the wild-type level a slight increase (about 15%) in the oxygen evolution was detectable for the cells overexpressing the Synechocystis RuBisCO.

TABLE 2 RuBisCO activity and photosynthetic oxygen evolution of Synechocystis wild type and a mutant overexpressing the endogenous RuBisCO operon. oxygen RuBisCO activity evolution [μmol RBP/min * mg [μmol O2/h * protein] mg chl] PCC6803 wild type 0.23 (100%) 107.8 (100%) pVZ321b-Prbc- 0.48 (209%) 124.6 (115%) SynRbcLXS

In a further experiment the potential positive effect of the detected increased RubisCO activity for the ethanol production was analyzed. For this purpose growth and ethanol production of an integrative ethanol producing mutant (6803 pSK10-PisiA-PDC/ADHII) was compared to the isogenic, ethanologenic mutant containing moreover the RubisCO overexpressing plasmid (pVZ321b-Prbc-SynRbc).

FIGS. 32L, 32M and 32N, respectively show the OD750, the ethanol production and the ethanol production normalized to the OD750 for the mutant Synechocystis PCC6803 harboring the pSK10-PisiA-PDC/ADHII plasmid and the mutant additionally containing the vector pVZ321b-Prbc-SynRbc.

Both ethanologenic Synechocystis mutants exhibit a similar ethanol production rate of about 0.017% (v/v) per day for 14 days under continuous light illumination (see FIG. 32-4C). Over the whole time-scale the mutant with the RubisCO over-expression produces a bit more ethanol (about 8% compared to the reference). Also when the ethanol production is normalized to the cell density (OD at 750 nm as indicator for the growth) this difference in the ethanol production remains. This indicates that an elevated RubisCO activity can lead to an increased ethanol formation. The potential to direct additional carbon fixed via photosynthesis into ethanol production might be further improvable by optimization of the RubisCO expression level as well as by combination with other metabolic mutations, enhancing the level of substrates for the ethanologenic enzymes.

X.7 Metabolic Mutant Harbouring an Overexpressed Pyruvate Kinase 2 as a First Genetic Modification

Construction of the DNA-vector pVZ321-PpetJ-pyk2, which was used for the generation of a pyk2 overexpression mutant, was already described herein.

The obtained mutant Synechocystis PCC6803 pVZ321-PpetJ-pyk2 was cultivated in BG11 medium containing 14 mg/l chloramphenicol and characterized in comparison to the Synechocystis wild-type strain under constant light conditions as described herein. Expression of pyruvate kinase gene was induced by copper starvation.

Results:

No significant differences could be detected in cell growth, chlorophyll content and photosynthetic oxygen production between Synechocystis PCC6803 wild type and mutant PCC6803 PpetJ-pyk2.

After induction of the petJ promoter, the level of extracellular pyruvate was slightly increased in the PCC6803 PpetJ-pyk2 mutant compared to the wild-type.

9 days 6 days pyr- 14 days pyruvate uvate pyruvate OD750 [mM] OD750 [mM] OD750 [mM] PCC6803 Wt 1.3 0.018 1.9 0.005 2.5 0.009 PpetJ-pyk2 0.8 0.016 1.3 0.051 1.9 0.064

Pyruvatekinase 2 Overexpression Mutant Expressing PDC and ADH

Pyruvate kinase 2 was also expressed from self-replicating plasmid pVZ321 under control of its endogeneous promoter Ppyk2 in the ethanol producing strain S. PCC6803 pSK-PisiA-PDC-ADHII. Generation of plasmid pVZ-Ppyk2-pyk2, which was conjugated into Synechocystis pSK-PisiA-PDC-ADHII, was already described herein.

The ethanol production rates and the oxygen evolution for the photosynthetic capacity of Synechocystis strains S. PCC6803 pSK-PisiA-PDC-ADHII harboring plasmid pVZ-Ppyk2-pyk2 and reference strain S. PCC6803 pSK-PisiA-PDC-ADHII were determined as mentioned above.

(data are mean of two measurements) μmol μmol μmol O2/ EtOH/mg EtOH/ mg Chl * h Chl* h μmol O2 S. PCC6803 pSK- 164.5 9.5 0.058 PisiA-PDC-ADHII Ppyk2-pyk2 pSK- 134.3 10.0 0.074 PisiA-PDC-ADHII

X.8 Metabolic Mutant Photoautotrophic Cells Harbouring an Overexpressed Pyruvate Kinase (PYK) Enolase (ENO) and Phosphoglycerate Mutase (PGM) as First Genetic Modifications

Two mutants have been created for overexpression of the three glycolytic genes pyruvate kinase (pyk), enolase (eno) and phosphoglycerate mutase (pgm).

In one mutant expression of pyruvate kinase 1 (from E. coli), enolase and phosphoglycerate mutase (both from Zymomonas mobilis) is controlled by the ribulose-1,5-bisphosphate carboxylase/oxygenase (RubisCO) promoter (Prbc) from Synechococcus PCC7942. Construction of the DNA-vector pVZ321-p67, which was conjugated into Synechocystis PCC6803 to generate mutant PCC6803 Prbc-pyk-eno-pgm, was already described herein.

In the other mutant the expression of additional copies of the endogenous genes pyruvate kinase 2, enolase and phosphoglycerate mutase from Synechocystis PCC6803 is controlled by the PpetJ promoter. DNA-vector pVZ322-PpetJ-pyk2-eno-pgm, which was conjugated into Synechocystis PCC6803 to generate mutant PCC6803 PpetJ-pyk2-eno-pgm, was already described herein.

The obtained mutants PCC6803 pVZ321-Prbc-pyk-eno-pgm and PCC6803 pVZ322-PpetJ-pyk2-eno-pgm were cultivated in BG11 medium containing 14 mg/l chloramphenicol or 3 mg/l gentamycin, respectively, and characterized in comparison to the Synechocystis wild-type strain under constant light conditions as described herein.

Results:

No significant differences could be detected in cell growth, chlorophyll content and photosynthetic oxygen production between Synechocystis PCC6803 wild type and mutants PCC6803 Prbc-pyk-eno-pgm and PCC6803 PpetJ-pyk2-eno-pgm.

Excretion of pyruvate was increased in mutant PCC6803 Prbc-pyk-eno-pgm compared to wild-type, as shown in the following table:

10 days 14 days pyruvate pyruvate OD750 [mM] OD750 [mM] PCC6803 (BG11) 4.6 0.006 6.2 0.012 PCC6803 Prbc-pyk- 3.0 0.017 6.1 0.032 eno-pgm

In mutant PCC6803 PpetJ-pyk2-eno-pgm the level of extracellular pyruvate was increased after induction of the glycolytic genes by copper starvation.

7 days 14 days pyruvate pyruvate OD750 [mM] OD750 [mM] PCC6803 (BG11-Cu) 1.6 0 3 0.006 PCC6803 PpetJ- 3.1 0.013 3.7 0.024 pyk2-eno-pgm

Expression of Pyruvate Kinase, Enolase and Phospho-Glycerate Mutase in Synechocystis Strains Expressing Pdc Enzyme Alone as a Second Genetic Modification.

Plasmids pVZ321-p67 and pVZ322-PpetJ-pyk2-eno-pgm were each conjugated into the ethanol producing strain Synechocystis PCC6803 pSK10-PpetJ-pdc expressing only PDC. (Construct pSK10-PpetJ-pdc is a derivate of pSK10-PpetJ-pdc-adhII, from that the adhII gene was cut out with Sad and PstI.) The resulting mutants were cultured in BG11 containing 10 mg/l streptomycin and 7 mg/l chloramphenicol or 2 mg/l gentamycin, respectively. Expression of pdc (and in mutant PpetJ-pyk2-eno-pgm also of the glycolytic genes) was induced by copper starvation (PpetJ).

In short term measurements both mutants expressing the glycolytic enzymes showed a better ethanol production rate (relative to photosynthetic activity) than the reference strains. Data in the following table are means of two consecutive measurements within one cultivation.

μmol O2/ μmol EtOH/ μmol EtOH/ mg Chl * h mg Chl * h μmol O2 PCC6803 pSK-PpetJ-PDC 130 1.8 0.014 PCC6803 pSK-PpetJ-PDC 148 3.2 0.022 pVZ-Prbc-pyk-eno-pgm PCC6803 pSK-PpetJ-PDC 197 2.5 0.012 PCC6803 pSK-PpetJ-PDC 104 2.8 0.028 pVZ-PpetJ-pyk2-eno-pgm

Conclusions

These data suggest that overexpression of the glycolytic enzymes pyruvate kinase, enolase and phosphoglycerate mutase leads to a higher flux from CO2 towards pyruvate which results in a higher ethanol production rate, relative to the photosynthetic capacity.

X.9 Metabolic Mutant Photoautotrophic Cells Harbouring an Overexpressed Malic Enzyme (Me) and Malate Dehydrogenase (MDH) as First Genetic Modifications

Overexpression of malic enzyme (Me) and malate dehydrogenase (Mdh) were accomplished by regulated expression of the corresponding genes (slr0721-me; sll0891-mdh) via the PpetJ promoter. Construction of DNA-vectors pSK9/PpetJ-me and pSK9/PpetJ-me-mdh, which were used for generation of me- and me/mdh-overexpression mutants, was already described herein. The obtained overexpression mutants were fully segregated and were grown in BG11 medium containing 14 mg/l chloramphenicol. Mutants PpetJ-me and PpetJ-me/mdh were examined in comparison to the Synechocystis wild-type strain under constant light conditions as described herein. Expression of me and mdh genes was induced by copper starvation and successfully proven by northern blot analysis via a radio-labeled me- and mdh-probe, respectively (data not shown).

Results:

No significant differences could be detected in cell growth, chlorophyll content and photosynthetic oxygen production between Synechocystis PCC6803 wild type and PpetJ-me and PpetJ-me/mdh mutant, respectively.

An enhanced extracellular pyruvate level was detected in the medium of the PpetJ-me and the PpetJ-me/mdh mutants after induction by copper starvation. The following table shows the extracellular pyruvate concentrations measured 10 days after induction in comparison with values measured in medium from non-induced cells.

Not induced (BG11) Induced (BG11-Cu) 10 days 10 days OD750 pyruvate [mM] OD750 pyruvate [mM] PCC6803 Wt 8.3 0.010 9.3 0.011 PpetJ-me 10.1 0.005 8.3 0.032 PpetJ-me-mdh 7.8 0.005 8.5 0.024

The higher extracellular pyruvate levels measured in the induced PpetJ-me and PpetJ-me/mdh mutants (compared to wildtype and non-induced cells) suggest, that overexpression of malic enzyme or malic enzyme in combination with malate dehydrogenase leads to a higher pyruvate level within the cyanobacterial cells.

X.10 Metabolic Mutant Cells of Nostoc/Anabaena PCC7120 and Anabaena Variabilis ATCC 29413 Harbouring a Knockout of the ADP-Glucose-Pyrophosphorylase as a First Genetic Modification

In the following the EtOH production in Anabaena PCC7120 transformed with the integrative PpetE-PDC-ADHII and PpetE-PDC constructs will be discussed.

In a first test experiment EtOH production in Anabaena PCC7120 with PpetE-pdc-adhll or PpetE-pdc inserted in ADP-glucose-pyrophosphorylase gene, agp, was measured of the following mutants: A.7120 Δagp (a114645)::C.K3-PpetE-pdc-adhII, named “PpetE-pdc-adhII” and A.7120 Δagp (a114645)::C.K3-PpetE-pdc, named “PpetE-pdc”. Mutant A.7120 Δagp (a114645)::C.K3, named Δagp, served as control.

Cultures of all mutants were grown at 28° C., under continuous light conditions (40 μE/m2 s1) in batches of 50 ml in 100 ml Erlenmeyer flasks with shaking. Precultures were grown in BG11 medium lacking copper sulfate (BG11-Cu), supplemented with neomycin (100 μg/ml). It should be noted here, that the petE promoter might not be fully repressed under this BG11-Cu conditions, as the glassware was not treated to remove trace amounts of copper from it. The petE promoter seems to be smoothly regulated in Anabaena PCC7120 [Buikema, W. J., and R. Haselkorn. 2001. Expression of the Anabaena hetR gene from a copper-regulated promoter leads to heterocyst differentiation under repressing conditions. PNAS USA 98:2729-2734], therefore trace amounts of copper coming from the glassware might be sufficient to induce expression.

Expression of the ethanologenic genes was induced by addition of 1× copper (0.32 μM CuSO4). This corresponds to the copper concentration present in BG11 medium.

As a measure of growth, chlorophyll was determined at several time points and ethanol was measured using the already described enzymatic method.

TABLE 1 Growth and ethanol production of Anabaena mutants expressing ethanologenic genes under control of petE promoter. Chl, chlorophyll in [μg/ml] and EtOH [%]. time 0 (start) 5 days 9 days 14 days Chl EtOH Chl EtOH Chl EtOH Chl EtOH “PpetE- 1 0.002 3 0.014 6 0.022 8 0.037 pdc- adhII” “PpetE- 3 0.006 5 0.015 6 0.028 8 0.044 pdc” Δagp 8 0 16 0.0001 20 0.0001 25 0.0001 (con- trol)

Ethanol was produced by both integrative mutants, while in the control strain (mutant Δagp) no ethanol production was detected. The similar ethanol production rates obtained in mutants “PpetE-pdc-adhII” and “PpetE-pdc” clearly indicate that also in Anabaena PCC7120 expression of PDC alone is sufficient for ethanol production. Thus it appears that this strain constitutively expresses an endogenous ADH enzyme converting acetaldehyde into ethanol. Several open reading frames are annotated as alcohol dehydrogenases in Anabaena PCC7120 (http://bacteria.kazusa.or.jp/cyanobase/), however all genes show only little similarity (less than 30% identical amino acids) to SynADH.

Detailed Discussion of the Embodiments Involving Overexpressed Zn2+ Dependent Alcohol Dehydrogenase and PDC and/or ADH Enzymes Under the Control of Various Inducible Promoters

In the following further embodiments of the invention related to for example an overexpressed Zn2+ dependent alcohol dehydrogenase, an overexpressed alcohol dehydrogenase, directly converting acetyl-CoA to ethanol, or promoters that can be induced by nutrient starvation, cold shock, heat shock, salt stress, light exposure or stationary growth of the host cell will be explained in more detail.

Construction of selfreplicating (extrachromosomal) and chromosome-integrative vectors for the inducible overexpression of ethanologenic enzymes in cyanobacteria

  • Construction of extrachromosomal pVZ-vectors for inducible overexpression of pyruvate decarboxylase (ZmPdc) and alcohol dehydrogenase (ZmAdhII) from Zymomonas mobilis

The construction of the certain vectors including the different promoters were done by using the following general protocol:

    • EcoRI/BamHI restriction of the pCB4-LR(TF)pa shuttle vector in order to cut off the pdc and adh genes. This shuttle vector was constructed by Dr. John Coleman, University of Toronto, Toronto, Canada.
    • ligation of the pdc/adh containing EcoRI/BamHI fragment into the cloning vector pDrive (EcoRI/BamHI). The pDrive vector (Qiagen, Hilden, Germany, GenBank no.: DQ996013) was already described above.
    • amplification of the isiA-, nblA- and ntcA-promoter using chromosomal DNA from Synechocystis sp. PCC 6803 and the following primers (all amplified promoters have a length of about 600 by and include the ribosome binding site of the corresponding genes):

(SEQ ID NO: 217) isiA-fw-SalI 5′-GTCGACCTTCCAGCACCACGTCAAC-3′ (SEQ ID NO: 218) isiA-rev-EcoRI 5′-GAATTCACAGAATTGCCTCCTTAATTGAG-3′ (SEQ ID NO: 219) nblA-fw-SalI 5′-ACGCGTCGACTTATGGTTGATTCGCATTG-3′ (SEQ ID NO: 220) nblA-rev-EcoRI 5′-CGGAATTCATAGCTGTTGCCCTCCAAG-3′ (SEQ ID NO: 221) ntcA-fw-SalI 5′-GTCGACAACGACGGAGGTTTAAGGG-3′ (SEQ ID NO: 222) ntcA-rev-EcoRI 5′-GAATTCATGCACGTTCACGGTAATGG-3′
    • All forward primer included the SalI restriction site, all reverse primer included a EcoRI restriction site for cloning (marked bold).
    • ligation of the SalI/EcoRI cut promoter fragments into the pDrive-pdc/adh (SalI/EcoRI) generating the constructs pDrive-PisiA-pdc/adh, pDrive-PnblA-pdc/adh and pDrive-PntcA-pdc/adh
    • SalI/PstI restriction of pDrive-PisiA-pdc/adh, pDrive-PnblA-pdc/adh and pDrive-PntcA-pdc/adh and ligation of the corresponding promoter-pdc/adh fusions into the self replicating broad-host range vector pVZ321b (SalI/PstI), a derivate of the pVZ321 (constructed by V.V. Zinchenko Moscow, Russia; described above) with an additional streptomycin resistance cassette/cartridge introduced into the XbaI site of pVZ321. The pVZ321b vector was constructed by Anne Karradt, Humboldt-Universitaet Berlin, Plant Biochemistry Department (Prof. Lockau) and was used as a cargo plasmid for conjugation. pVZ321 Gen Bank no.: AF100176 available in the NCBI data base(http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?db=nuccore&id=4323382)
    • End products of the cloning procedure are the pVZ-vectors: FIG. 33A presents a schematic diagram of pVZ-PisiA-pdc/adh; FIG. 33B presents a schematic diagram of pVZ-PnblA-pdc/adh; and FIG. 33C presents a schematic diagram of pVZ-PntcA-pdc/.

FIG. 33D presents the nucleotide sequence of adhII and pdc genes from Zymomonas mobilis. The source of this polynucleotide is the shuttle vector pCB4-LR(TF)pa, a kind gift from John Coleman. FIG. 33E presents a schematic diagram of some restriction sites occurring within the adhII and pdc gene sequences. FIGS. 33F and 33G presents the amino acid sequence of ZmPdc and ZmAdhII, respectively.

Various gene promoter elements were utilized to control constitutive and/or induced gene expression. Sequences for these elements are presented herein. As known to those skilled in the art, other genetic elements may serve the same purpose.

Remark: In all following nucleotide sequences of promoters restriction sites for clonings are marked (colored).

The isiA promoter (Synechocystis sp. PCC6803) element nucleotide sequence is presented in FIG. 34A. This genetic element induces gene expression under conditions of iron starvation.

The nblA promoter (Synechocystis sp. PCC6803) element nucleotide sequence is presented in FIG. 34B. This genetic element induces gene expression under conditions of nitrogen starvation.

The ntcA promoter (Synechocystis sp. PCC6803) element nucleotide sequence is presented in FIG. 34C. This genetic element induces gene expression under conditions of nitrogen starvation.

The pVZ321b cloning vector (derivate of pVZ321) was constructed by Anne Karradt, Humboldt-Universitaet Berlin, Plant Biochemistry Department (Prof. Lockau), Berlin. The nucleotide sequence for pVZ321b is presented in FIG. 35A, and the structure of this plasmid is presented schematically in FIG. 35B.

Introduction of further well suited inducible promoters into the existing pVZ-expression constructs (point 1).

In order to create expression constructs as described above (point 1) but under control of a different promoter, the promoter sequence was cut out by SalI/EcoRI digestion of the corresponding pVZ-Pxxx-pdc/adh construct (xxx for isiA, ntcA, nblA). The new promoter sequence containing the restriction sites SalI/EcoRI as described for the isiA-, nblA- and ntcA-promoter was ligated into the “promoter free” pVZ construct resulting in a pdc/adh expression construct under control of the new promoter.

Representative new promoters include, but are not limited to, the following:

(1) FIG. 36A depicts the nucleotide sequence of the petJ promoter (Synechocystis sp. PCC 6803) (petJ gene: sll1796 (encoding for cytochrome c553; induced expression under copper starvation);

REFERENCES

  • Biol. Chem. 2004 Feb. 20; 279(8):7229-33. Epub 2003 December. The efficient functioning of photosynthesis and respiration in Synechocystis sp. PCC 6803 strictly requires the presence of either cytochrome c6 or plastocyanin.
  • Durán R V, Hervás M, De La Rosa M A, Navarro J A.

A plasmid created with this promoter element is presented schematically in FIG. 36B.

(2) FIG. 36 C depicts the nucleotide sequence of the sigB promoter (Synechocystis sp. PCC 6803) sigB gene: sll0306 (encoding for RNA polymerase group 2 sigma factor) induced expression after heat shock, in stationary growth phase/nitrogen starvation and darkness)

REFERENCES

  • Arch Microbial, 2006 October; 186(4):273-86. Epub 2006 Jul. 26. The heat shock response in the cyanobacterium Synechocystis sp. Strain PCC 6803 and regulation of gene expression by HrcA and SigB.
  • Singh A K, Summerfield I C, Li H, Sherman L A FEBS, Lett. 2003 Nov. 20; 554(3):357-62. Antagonistic dark/light-induced SigB/SigD, group 2 sigma factors, expression through redox potential and their roles in cyanobacteria.
  • Imamura S, Asayama M, Takahashi H, Tanaka K, Takahashi H, Shirai M J Biol Chem. 2006 Feb. 3; 281(5):2668-75. Epub 2005 Nov. 21. Growth phase-dependent activation of nitrogen-related genes by a control network of group 1 and group 2 sigma factors in a cyanobacterium.
  • Imamura S, Tanaka K, Shira M, Asayama M. A plasmid created with this promoter element is presented schematically in FIG. 36D.

(3) FIG. 36 E depicts the nucleotide sequence of the htpG promoter (Synechocystis sp. PCC 6803) htpG gene: sll0430: (encoding for heat shock protein 90, molecular chaperone) induced expression after heat shock

REFERENCES

  • Plant Physiol. 1998 May; 117(1):225-34. Transcriptional and posttranscriptional control of mRNA from lrtA, a light-repressed transcript in Synechococcus sp. PCC 7002.
  • Samartzidou H, Widger W R

A plasmid created with this promoter element is presented schematically in FIG. 36F.

(4) FIG. 36 G shows the nucleotide sequence of the lrtA promoter (Synechocystis sp. PCC 6803) lrtA gene:sll0947 (encoding the light repressed protein A homolog induced expression after light to dark transition)

REFERENCES

  • Plant Physiol. 1998 May; 117(1):225-34. Transcriptional and posttranscriptional control of mRNA from lrtA, a light-repressed transcript in Synechococcus sp. PCC 7002.
  • Samartzidou H, Widger W R

A plasmid created with this promoter element is presented schematically in FIG. 36H.

(5) the nucleotide sequence of the psbA2 promoter (Synechocystis sp. PCC 6803) (FIG. 36I) psbA2 gene: slr1311 (encoding the photosystem II D1 protein) induced expression after dark to light transition

REFERENCES

  • Biochem Biophys Res Commun. 1999 Feb. 5; 255(1):47-53. Light-dependent and rhythmic psbA transcripts in homologous/heterologous cyanobacterial cells.
  • Agrawal G K, Asayama M, Shirai M.

A plasmid created with this promoter element is presented schematically in FIG. 36J.

(6) FIG. 36K shows the nucleotide sequence of the rbcL promoter (Synechocystis sp. PCC 6803) rbcL gene: slr0009 (encoding the ribulose biphosphate carboxylase/oxygenase large subunit constitutive strong expression under continuous light conditions

REFERENCES

  • Plant Mol. Biol. 1989 December; 13(6):693-700 Influence of light on accumulation of photosynthesis-specific transcripts in the cyanobacterium Synechocystis 6803.
  • Mohamed A, Jansson c.

A plasmid created with this promoter element is presented schematically in FIG. 36L.

(7) FIG. 36M depicts the nucleotide sequence of the psaA promoter (Synechocystis sp. PCC6803); PsaA gene: slr134 (encoding P700 apoprotein subunit Ia) induced expression under low white light and orange light, low expression level under high light and red light, repressed in darkness

REFERENCES

Plant Cell Physiol. 2005 September; 46(9):1484-93. Epub 2005 Jun. 24. Regulation of photosystem I reaction center genes in Synechocystis sp. strain PCC 6803 during Light acclimation.

  • Herranen M, Tyystjärvi T, Aro E M.
  • Plant Cell Phys. 2006 July; 47(7):878-90. Epub 2006 May 16. Characterization of high-light-responsive promoters of the psaAB genes in Synechocystis sp. PCC 6803.
  • Muramatsu M, Hihara Y.

A plasmid created with this promoter element is presented schematically in FIG. 36N.

(8) FIG. 36O shows the nucleotide sequence of the ggpS promoter (Synechocystis sp. PCC6803); ggpS gene: sll1566 (encoding glucosylglycerolphosphate synthase) induced expression after salt stress

REFERENCES

  • Plant Physiol. 2004 October; 136(2):3290-300. Epub 2004 Sep. 10. Gene expression profiling reflects physiological processes in salt acclimation of Synechocystis sp. strain PCC 6803.
  • Marin K, Kanesaki Y, Los D A, Murata N, Suzuki I, Hagemann M.
  • J. Bacteriol, 2002 June; 184(11):2870-7. Salt-dependent expression of glucosylglycerol-phosphate synthase, involved in osmolyte synthesis in the cyanobacterium Synechocystis sp. strain PCC 6803.
  • Marin K, Huckauf J, Fulda S, Hagemann M.

A plasmid created with this promoter element is presented schematically in FIG. 36P.

(9) FIG. 36Q depicts the nucleotide sequence of the nirA promoter (Synechocystis sp. PCC6803); nirA gene: sir0898 (encoding ferredoxin-nitrite reductase) induced expression after transition from ammonia to nitrate

REFERENCES

  • Appl Environ Microbiol. 2005 October; 71(10):5678-84. Application of the Synechococcus nirA promoter to establish an inducible expression system for engineering the Synechocystis tocopherol pathway.
  • Qi Q, Hao M, Ng W O, Slater S C, Baszis S R, Weiss J D, Valentin H E.
  • J. Bacterial. 1998 August; 180(16):4080-8 cis-acting sequences required for NtcB-dependent, nitrite-responsive positive regulation of the nitrate assimilation operon in the cyanobacterium Synechococcus sp. strain PCC 7942.
  • Maeda S, Kawaguchi Y, Ohe T A, Omata T.

A plasmid created with this promoter element is presented schematically in FIG. 36R.

(10) FIG. 36S depicts the nucleotide sequence of the petE promoter (Anabaena sp. PCC7120); petE gene: all0258 (encoding plastocyanin precursor) induced expression at elevated copper concentrations

REFERENCES

  • Microbiology, 1994 May; 140 (Pt 5):1151-9. Cloning, sequencing and transcriptional studies of the genes for cytochrome c-553 and plastocyanin from Anabaena sp. PCC 7120.
  • Ghassemian M, Wong B, Ferreira F, Markley J L, Straus N A.
  • Proc Natl Acad Sci USA. 2001 Feb. 27; 98(5):2729-34. Epub 2001 Feb. 20. Expression of the Anabaena hetR gene from a copper-regulated promoter leads to heterocyst differentiation under repressing conditions.
  • Buikema W J, Haselkorn R.

A plasmid created with this promoter element is presented schematically in FIG. 36T

(11) FIG. 36U shows the nucleotide sequence of the hspA promoter (Synechocystis sp. PCC6803); hspA gene: sll1514 16.6 kDa small heat shock protein, molecular chaperone multi-stress responsible promoter (heat, cold, salt and oxidative stress)

REFERENCES

  • Curr Microbial, 2004 September; 49(3):192-8. Expression of the heat shock gene hsp16.6 and promoter analysis in the cyanobacterium, Synechocystis sp. PCC 6803.
  • Fang F, Barnum S R.
  • J. Exp Bot, 2006; 57(7):1573-8. Epub 2006 Mar. 30. The heat shock response of Synechocystis sp. PCC 6803 analyzed by transcriptomics and proteomics.
  • Suzuki I, Simon W J, Slabas A R.

A plasmid created with this promoter element is presented schematically in FIG. 36V.

(12) FIG. 36W depicts the nucleotide sequence of the hliB promoter (Synechocystis sp. PCC6803); hliB gene: ssr2595: high light-inducible polypeptide HliB, CAB/ELIP/HLIP superfamily multi-stress responsible promoter (heat, cold, salt and oxidative stress)

REFERENCES

  • J Biol Chem. 2001 Jan. 5; 276(1):306-14. The high light-inducible polypeptides in Synechocystis PCC6803. Expression and function in high light.
  • He Q, Dolganov N, Bjorkman O, Grossman A R.
  • Arch. Microbiol, 2007 April; 187(4):337-42. Epub 2007 Feb. 10. The response regulator RpaB binds the high light regulatory 1 sequence upstream of the high-light-inducible hliB gene from the cyanobacterium Synechocystis PCC 6803.
  • Kappell A D, van Waasbergen L G.

A plasmid created with this promoter element is presented schematically in FIG. 36X

(13) FIG. 36Y shows the nucleotide sequence of the clpB1 promoter (Synechocystis sp. PCC6803); clpB1 gene: slr1641: ATP-dependent Clp protease, Hsp 100, ATP-binding subunit ClpB multi-stress responsible promoter (heat, cold, salt and oxidative stress)

REFERENCES

  • Microbiology, 2004 May; 150(Pt 5):1271-81. Effects of high light on transcripts of stress-associated genes for the cyanobacteria Synechocystis sp. PCC 6803 and Prochlorococcus MED4 and MIT9313.
  • Mary I, Tu C J, Grossman A, Vaulot D.
  • J Exp Bot. 2006; 57(7):1573-8. Epub 2006 Mar. 30. The heat shock response of Synechocystis sp. PCC 6803 analysed by transcriptomics and proteomics.
  • Suzuki I, Simon W J, Slabas A R.

A plasmid created with this promoter element is presented schematically in FIG. 36Z.

Introduction of Alternative Ethanologenic Genes to ZmPdc and ZmAdhII into the Existing pVZ-Expression Constructs (Point 1)

In order to create expression constructs as described above (point 1) but with different alcohol dehydrogenases, the adh encoding sequence was cut out by SacI/PstI digestion of the corresponding pVZ-Pxxx-pdc/adh construct (xxx for isiA, nblA, ntcA). The new adh sequence containing the restriction sites SacI/PstI (introduced by used primer) was ligated into the “adh free” pVZ construct resulting in a construct that expresses the ZmPdc together with new Adh.

Remark: In all following nt sequences of genes restriction sites (marked in yellow or blue) for clonings as well as translation starts (start codons, marked in green) and translation stops (stop codons, marked in red) are color coded.

In this context, new alcohol dehydrogenases include the following:

(1) FIG. 37A presents the nucleotide sequence for ZmADHI (adhA gene from Zymomonas mobilis ZM4) and FIG. 37B presents the amino acid sequence for ZmAdhI AAV8960 FIG. 37C presents a schematic representation of the plasmid pVZ321b-PisiA-PDC-ZmADH1. FIG. 37D presents a schematic representation of the plasmid pVZ321b-PntcA-PDC-ZmAH1. FIG. 37E presents a schematic representation of the plasmid pVZ321b-PnblA-PDC-ZmADH1.

(2) The nucleotide sequence of SynAdh (adh gene (slr1192) Synechocystis sp. PCC 6803) is presented in FIG. 38A. The amino acid sequence of this protein (SynAdh protein sequence BAA18840) is presented in FIG. 38B.

FIG. 38C presents a schematic representation of the plasmid pVZ321b-PisiA-PDC-SynADH. FIG. 38D presents a schematic representation of the plasmid pVZ321b-PntcA-PDC-SynADH. FIG. 38E presents a schematic representation of the plasmid pVZ321b-PnblA-PDC-SynADH.

In order to create expression constructs as described above (point 1) but with AdhE-type alcohol dehydrogenases, the pdc/adh encoding sequence was cut out by EcoRI/BamHI and EcoRI/PstI digestion resp. of the corresponding pVZ-Pxxx-pdc/adh construct (xxx for isiA, ntcA, nblA). The adhE sequence of E. coli and Thermosynechococcus elongates resp. containing the restriction sites EcoRI/BamHI and EcoRI/PstI resp. (introduced by used primer) were ligated into the “pdc/adh free” pVZ construct resulting in constructs that express the AdhE-type alcohol dehydrogenases.

(3) The nucleotide sequence for EcAdhE (adhE gene from E. coli K12) is presented in FIG. 39A. The amino acid sequence for this protein (EcAdhE protein sequence NP415757) is presented in FIG. 39B.

FIG. 39C presents a schematic representation of the plasmid pVZ321b-PisiA-PDC-EcAdhE. FIG. 39D depicts a schematic representation of the plasmid pVZ321b-PntcA-PDC-EcAdhE. FIG. 39E presents a schematic representation of the plasmid pVZ321b-PnblA-PDC-EcAdhE.

(4) The nucleotide sequence for the ThAdhE gene (adhE gene (tlr0227) from Thermosynechococcus elongatus BP-1) is presented in FIG. 40A, and the amino acid sequence for this protein (ThAdhE protein sequence BAC07780) is presented in FIG. 40B.

FIG. 40C presents a schematic representation of the plasmid pVZ321b-PisiA-PDC-ThAdhE. FIG. 40D presents a schematic representation of the plasmid pVZ321b-PntcA-PDC-ThAdhE. FIG. 40E presents a schematic representation of the plasmid pVZ321b-PnblA-PDC-ThAdhE.

In order to create expression constructs as described above (point 1) but with an alternative pyruvate decarboxylase to the Zymomonas mobilis enzyme, the Pdc encoding sequence was cut out by EcoRI/SacI digestion of the corresponding pVZ-Pxxx-pdc/adh construct (xxx for isiA, ntcA, nblA). The pdc sequence from Zymobacter palmae containing the restriction sites EcoRI/SacI (introduced by used primer) was ligated into the “pdc free” pVZ construct resulting in a construct that express the Pdc from Zymobacter palmae together with the preexisting Adh.

FIG. 41A presents the nucleotide sequence for ZpPdc (pdc gene from Zymobacter palmae ATCC 51623), and the amino acid sequence for this protein (ZpPdc protein sequence AAM4956) is presented in FIG. 41B.

Construction of Chromosome Integrative pSK-Vectors

In order to create plasmids for stable chromosome integration in cyanobacteria the whole inserts from the described pVZ constructs (point 1 and 3) containing the promoter sequence and the coding region of the ethanologenic enzymes (Pdc and Adh) were cut out by SalI/PstI digestion. The resulting inserts were ligated into the pSK10, a derivate of the pSK9 (a kind gift of V. V. Zinchenko and described in Sobotka et al., 2008, JBC) using the SalI/PstI restriction sites. In some cases other restriction sites were used, e.g. in case of pVZ321b-Pxxx-pdc-adh/the restriction sites XbaI/PstI were used, in case of pVZ321b-Pxxx-Ecdhe the restriction sites XbaI/BamHI were used.

FIG. 42A presents the nucleotide sequence of the pSK10 cloning vector (derivate of pSK9 [V. V. Zinchenko, Moscow, Russia; unpublished]). FIG. 42B presents a schematic representation of this plasmid.

Several pSK10 constructs with ZmPdc/ZmAdhII were obtained.

FIG. 42C presents a schematic diagram of pSK10-PisiA-PDC-ADHII.

FIG. 42D presents a schematic diagram of pSK10-PnblA-PDC-ADHII.

FIG. 42E presents a schematic diagram of pSK10-PntcA-PDC-ADHII.

Several pSK10 constructs with ZmPdc/ZmAdhI were obtained.

FIG. 42F presents a schematic diagram of pSK10-PisiA-PDC-ADHI.

FIG. 42G presents a schematic diagram of pSK10-PnblA-PDC-ADHI.

FIG. 42H presents a schematic diagram of pSK10-PntcA-PDC-ADHI.

Several pSK10 constructs with ZmPdc/SynAdh were obtained.

FIG. 42I presents a schematic diagram of pSK10-PisiA-PDC-SynADH.

FIG. 42J presents a schematic diagram of pSK10-PnblA-PDC-SynADH.

FIG. 42K presents a schematic diagram of pSK10-PntcA-PDC-SynADH.

Several pSK10 constructs with EcAdhE were obtained.

FIG. 42L presents a schematic diagram of pSK10-PisiA-PDC-EcAdhE.

FIG. 42M presents a schematic diagram of pSK10-PnblA-PDC-EcAdhE.

FIG. 42N presents a schematic diagram of pSK10-PntcA-PDC-EcAdhE.

Several pSK10 constructs with ThAdhE were obtained.

FIG. 42O presents a schematic diagram of pSK10-PisiA-PDC-ThAdhE.

FIG. 42P presents a schematic diagram of pSK10-PnblA-PDC-ThAdhE.

FIG. 42Q presents a schematic diagram of pSK10-PntcA-PDC-ThAdhE.

Expression of PDC and ADH in the Filamentous; Diazotropic Cyanobacteria Nostoc/Anabaena Spec. PCC7120 and Anabaena Variabilis ATCC 29413

In order to generate ethanol producing Anabaena strains, different constructs were created for conjugation into Anabaena PCC7120 and Anabaena variabilis ATCC29413.

Nostoc/Anabaena spec. PCC7120 and Anabaena variabilis ATCC 29413 were transformed using Self-replicating plasmids.

The ethanologenic genes were cloned into self-replicating plasmids for conjugation into Anabaena PCC7120. In these constructs different promoters were used to control expression of pdc and adhII.

pRL1049 Constructs

Genes encoding pdc and adhII from Zymomonas mobilis were cloned into the self-replicating plasmid pRL1049, which is known to replicate in Nostoc strains. Nucleotide and amino acid sequences of adhII and pdc genes from Zymomonas mobilis are already described herein.

The promoter-pdc-adhII fragment was cut out of the herein described pSK10-PpetJ-pdc-adhII plasmid with ClaI and BamHI and ligated into pRL1049. Promoter sequences were exchanged via EcoRI and SalI. Different promoters were used: promoters originating from PCC 6803: PisiA, PpetJ and PrbcL (nucleotide sequences are already described herein) and promoters originating from PCC 7120: PcrhC and PpetE.

Promoter sequences of PcrhC and PpetE are shown in FIGS. 42R and 42S, respectively (SalI and EcoRI restriction sites for cloning are marked in bold letters):

FIG. 42R depicts the crhC promoter (Anabaena sp. PCC7120) (crhC gene: a1r4718, RNA helicase crhC cold shock inducible)

FIG. 42S shows the petE promoter (Anabaena sp. PCC7120) petE gene: a110258, plastocyanin precursor (petE) induced by addition of Cu

The structure of plasmid pRL1049-PpetE-PDC-ADHII is shown in FIG. 42T.

The sequence of the plasmid pRL1049-PpetE-PDC-ADHII is shown in FIG. 42U.

pRL593 Construct

In addition to pRL1049 the broad range plasmid pRL593 was used for expression of pdc and adhII in Anabaena PCC7120. The structure of plasmid pRL593-PisiA-PDC-ADHII is presented in FIG. 42V and the DNA sequence is depicted in FIG. 42W.

EtOH Production in Anabaena PCC7120 Harboring Self-Replicating Plasmid pRL593-PisiA-PDC-ADHII

EtOH production in Anabaena PCC7120 harboring pRL593-PisiA-PDC-ADHII following induction by iron starvation was measured in BG11 medium (+N) and in medium lacking combined nitrogen (−N) in day (12 h)/night (12 h) cycle. The results of this measurement is presented in FIGS. 42X and 42Y.

Ethanol production in medium +N appeared higher than under condition lacking combined nitrogen (−N); but this effect was not very pronounced when calculated per OD750 nm. The best EtOH production rate in Anabaena PCC7120/pRL593-PisiA-pdc-adhII achieved was 0.0076% EtOH per day, constant for 19 days. This rate is lower compared to Synechocystis strains expressing pdc-adhII under control of PisiA, but continues for a longer time.

Characterization of Generated Ethanologenic Synechocystis Cyanobacteria P.1 Experimental Data for Characterization of Genetically Modified Photoautotrophic Host Cells Containing at Least One Second Genetic Modification Expression Levels of ZmPdc/ZmAdhII in Generated Synechocystis Cyanobacterial Mutants:

In order to quantify the induction rate of the used promoters, Pdc/AdhII protein levels in cultures with and without nutrient starvation were estimated by Western blot analysis.

In the case of the mutant with the isiA-promoter cultures were grown with and without addition of iron for about 48 hours. In the case of the mutants with the ntcA- and nblA-promoter cultures were grown with and without addition of nitrogen to the media. To get more comparable signals in the immunodetection, from the cultures under induced conditions, different dilutions of the prepared crude extracts were used.

Activities of ZmPdc/ZmAdhII in Cyanobacterial Mutants:

In order to compare the enzymatic activities of Pdc/AdhII with the estimated expression level, activities of Adh and Pdc were measured in crude extracts of the corresponding cultures.

In the case of the mutant with the isiA-promoter, cultures were grown with and without addition of iron for about 48 hours. The mutant with the ntcA-promoter was grown in standard BG11. Estimated activities were calculated on the corresponding protein concentration of the used crude extracts. It should be noted that Pdc activities were estimated in the presence of added thiamine pyrophosphate (cofactor for Pdc enzyme).

Results are presented in FIGS. 43A and 43B.

Ethanol Generation Rates in Cyanobacterial Mutants:

In general the inducible promoters used therein can be induced by medium exchange or by letting the cyanobacterial mutants grow into starvation conditions in the case of promoters which are inducible by nutrient starvation for example iron or copper starvation.

The use of inducible promoters for the over-expression of ethanologenic enzymes in cyanobacteria allow for switch on or switch off ethanol production on demand. Several promoters that are used for this purpose are inducible by the nutrient status, e.g. iron or copper availability. To reach these inducible conditions either a medium exchange or growth into these starvation conditions are possible.

Induction by Medium Exchange:

Mutants and Synechocystis wild-type strains were grown at 28° C., under constant light (50 μE m-2 s-1) either on a shaker (100 rpm) or in aerated culture vessels, bubbled with CO2-enriched air (0.5% CO2). The initial OD750 was between 2 and 3 in a total culture volume of 50 ml in Erlenmeyer flasks or 100 ml in the aerated culture vessels.

When an optical density of 2-3 was reached the culture was harvested by centrifugation and the supernatant was discarded. The cell pellet was washed with the new medium (e.g. without iron, without copper, without nitrate and thereafter resuspended in the respective medium for promoter induction. If iron starvation is needed (isiA-promoter) the ferric ammonium citrate in the BG11 was omitted, in the case of copper starvation (petJ-promoter) the trace metal mix used was prepared without addition of copper sulfate, for nitrogen starvation the sodium nitrate in the BG11 was omitted.

Induction by Letting the Cultures Grow into Starvation Conditions:

Promoter induction by growing into starvation is based on the consumption of nutrients due to the nutrient demand of a culture. After nutrients are consumed the culture enters the starvation condition which leads to the induction of the appropriate promoter. The duration to reach such a starvation condition can be influenced/limited by reduction of the amount of the respective nutrient in the BG11 medium, e.g. ⅓ of the Ferric ammonium citrate or copper sulfate concentration.

Furthermore, for repression of the nirA-promoter ammonia (0.265 g/l corresponds to 5 mM NH4Cl) was added to the BG11 medium, which already contains nitrate. The culture induces itself by consuming the ammonia as a preferred nitrogen source at first (nirA promoter not induced) and upon complete consumption of ammonia starts consuming the nitrate accompanied with induction of the nirA-promoter.

BG11 Media Recipe: NaNO3: 1.5 g K2HPO4: 0.04 g MgSO4.7H2O: 0.075 g CaCl2.2H2O: 0.036 g

Citric acid: 0.006 g
Ferric ammonium citrate: 0.006 g
EDTA (disodium salt): 0.001 g

NaCO3: 0.02 g

Trace metal mix A5 1.0 ml (see below)
Distilled water: 1.0 L

Trace Metal Mix A5: H3BO3: 2.86 g MnCl2.4H2O: 1.81 g ZnSO4.7H2O: 0.222 g NaMoO4.2H2O: 0.39 g CuSO4.5H2O: 0.079 g Co(NO3)2.6H2O: 49.4 mg

Distilled water: 1.0 L

P.2 Ethanol Production Rates of Genetically Modified Photoautotrophic Host Cells Containing Zymomonas Mobilis PDC and ADHII as a Second Genetic Modification

Ethanol production rates and OD750nm values were determined as described above and are shown in FIGS. 44A, 44B and 44C.

The concentration of ethanol in the growth medium was determined using a standard UV-ethanol assay purchased from R-Biopharm AG. In particular the assay is based on the UV detection of NADH at 340 nm. It is based on the detection of generated NADH according to the following enzymatic reaction catalyzed by alcohol dehydrogenase and aldehyde dehydrogenase:


Ethanol+NAD+→acetaldehyde+NADH+H+acetaldehyde+NAD++H2O→acetic acid+NADH+H+

P.3 Ethanol Production Rates of Genetically Modified Photoautotrophic Host Cells Containing Zymomonas Mobilis PDC And Synechocystis ADH as a Second Genetic Modification

Further the ethanol production rates of Synechocystis cultures transformed with Zymomonas mobilis Pdc and an endogenous Synechocystis Adh were also determined as described above. Results are presented in FIG. 44D.

P.4 Ethanol Production Rates of Genetically Modified Photoautotrophic Host Cells Containing Zymomonas Mobilis PDC and Various Wildtype as Well as Mutant ADHE Enzymes as a Second Genetic Modification Background:

The use of so called AdhE-type alcohol dehydrogenases (Adh), which contain two enzymatic activities, namely a CoA-dependent aldehyde dehydrogenase and an iron-dependent alcohol dehydrogenase activity would allow the production of ethanol in genetically modified cyanobacteria without requirement of a pyruvate decarboxylase (Pdc). The substrate for this dual enzyme is acetylCoA that is converted via two steps (by forming acetaldehyde as transient intermediate) into ethanol. AcetylCoA is similar to pyruvate a central metabolite in the cell which might be a well convertible precursor for the ethanol production, too. Interestingly, besides the group of enterobacteria where an AdhE is very common, also some cyanobacteria contain such an AdhE enzyme, e.g. Thermosynechococcus elongates BP-1, Microcystis aeruginosa and some Aponinum species.

Therefore, besides the approach to use the Pdc together with a conventional Adh, the over-expression of AdhE could also be convenient for ethanol production in cyanobacteria. For this purpose, the well characterized AdhE from E. coli and the corresponding enzyme from Thermosynechococcus were chosen.

Mutant Generation:

Several plasmids to over-express both AdhE's were constructed and respective mutants in Synechocystis 6803 were created (see above described plasmid maps). Furthermore specific activity-enhancing point-mutations were created in the adhE-gene from E. coli K12 wild-type strain, which lead to specific amino acid exchanges.

The AdhEs were over-expressed on a self-replicating extra-chromosomal plasmid, pVZ321b, under control of the copper-dependent petJ-promoter. Mutants were selected on streptomycin plates and grown in BG11 medium containing the appropriate antibiotics (kanamycin 100 mg/l and streptomycin 10 mg/l).

The following pVZ321b mutants were generated:

6803 pVZ321b-PpetJ-EcAdhE (wt)
6803 pVZ321b-PpetJ-EcAdhE (E568K, exchange from glutamic acid at position 568 to lysine)
6803 pVZ321b-PpetJ-EcAdhE (A267T/E568K, exchange of alanine at position 267 to threonine and in addition E568K)
6803 pVZ321b-PpetJ-ThAdhE (AdhE from Thermosynechococcus)

Growth Conditions:

Mutants and Synechocystis wild-type strains were grown at 28° C., under constant light (50 μE m-2 s-1) on a shaker (100 rpm). The initial OD750 was about 3 in a total culture volume of 50 ml in a 100 ml Erlenmeyer flask. The ethanol concentration was determined as described.

Results are presented in FIG. 45, wherein ethanol production of Synechocystis mutants that express AdhE of E. coli (3 different variants) are compared to Synechocystis wild type.

Results and Conclusions:

Exemplarily shown are ethanol production rates of the AdhEs of E. coli. Compared to the wild type over the cultivation time of about 5 weeks significant amounts of ethanol were produced by the mutants. All over-expression mutants showed a significant ethanol production. The exchange from glutamic acid at position 568 to lysine (E568K), which shall reduce the oxygen sensitivity seems to enhance the efficiency of the E. coli AdhE (EcAdhE) in Synechocystis compared to the E. coli wild-type enzyme. The further exchange of alanine at position 267 to threonine (A267T) did not lead to an additional improvement of the first point mutation (E568K), although it is might increase the acetaldehyde dehydrogenase activity of the E. coli enzyme. But for both modified EcAdhE variants an about 3-fold increase in ethanol accumulation was observed. Therefore, it is possible to improve the AdhE enzyme by site-directed mutations in order to reach better production rates in cyanobacteria.

Synechocystis mutants that express the cyanobacterial thermophilic AdhE (ThAdhE) from Thermosynechococcus show a similar ethanol production rate to the mutants, which express the improved variants of the EcAdhE (data not shown). Thus, if this enzyme can be optimized in the same way, it might be even better than the E. coli enzyme. In general the application of AdhE-type alcohol dehydrogenases to produce ethanol in cyanobacteria is possible. The potential to improve this kind of enzymes as shown for the E. coli enzyme may allow for a large scale application for future ethanol production processes.

P.5 Characterization of Genetically Modified Photoautotrophic Host Cells Containing Zymomonas Mobilis PDC and Different ADH Enzymes as a Second Genetic Modification Background:

The introduction of a pyruvate decarboxylase (Pdc) and an alcohol dehydrogenase (Adh) into cyanobacteria enables a light driven production of ethanol in these phototrophic bacteria by directing carbon fixed via photosynthesis into ethanol production. The substrate for the Pdc enzyme is pyruvate that is converted by decarboxylation into acetaldehyde and CO2. The generated acetaldehyde is then converted by an Adh enzyme into the end-product ethanol. In contrast to the Pdc almost all organisms contain Adhs leading a huge number of Adh enzymes with quite different characteristics. Interestingly, in Zymomonas mobilis two different Adhs are present, which are not related TO each other and originate from different ancestors. The AdhI from Zymomonas mobilis is a so-called Zn-dependent, oxygen insensitive alcohol dehydrogenase, whereas the AdhII is Fe-dependent and oxygen-sensitive. Both are quite effective with high affinities for their substrates, acetaldehyde and NADH and outstanding due to their high maximum velocities. Therefore both Adhs from Zymomonas seem to be well suited, however the AdhI exhibits substrate inhibition at elevated ethanol concentrations and the AdhII might be partially inactive in cyanobacteria, since they produce large amounts of oxygen by photosynthesis.

Therefore three different Adhs were analyzed for their suitability for the ethanol production in cyanobacteria. Besides the well characterized Zymomonas Adhs, a Zn-dependent Adh from Synechocystis PCC6803 (SynAdh), which is not yet characterized in the literature, but which was characterized by the inventors for the first time, was chosen, since this enzyme should be also oxygen-insensitive and therefore active in cyanobacteria.

Mutant Generation:

Several plasmids to overexpress all three Adhs together with the Pdc from Zymomonas mobilis (Zm) were constructed and the respective mutants were created in Synechocystis 6803 (see above described plasmid maps).

To over-express each Pdc/Adh combination a self-replicating extra-chromosomal plasmid, the pVZ321b, was used on which the regarding pdc/adh-genes are expressed under control of the copper-dependent petJ-promoter. Mutants were selected on streptomycin plates and grown in BG11 medium containing the appropriate antibiotics (kanamycin 100 mg/l and streptomycin 10 mg/l).

The following pVZ321b mutants were generated:

6803 pVZ321b-PpetJ-ZmPdc/ZmAdhI
6803 pVZ321b-PpetJ-ZmPdc/ZmAdhII
6803 pVZ321b-PpetJ-ZmPdc/SynAdh

Growth Conditions:

Mutants were grown in BG11 medium without copper at 28° C. and constant light conditions (100 μE m-2 s-1). The initial OD250 was about 1.5 in a total culture volume of about 150 ml in a culture vessel aerated with CO2-enriched air (0.5% CO2). The ethanol concentration was determined as described above and the growth was determined by measurements of the optical density at 750 nm. At the 11th day the cultures were diluted by addition of 1 volume of new BG11 medium without copper.

FIGS. 46A, 46B and 46C present results of growth, ethanol accumulation and ethanol production per growth of Synechocystis mutants that express ZmPdc/ZmAdhI (sqares), ZmPdc/ZmAdhII(diamonds) and ZmPdc/SynAdh (triangles), respectively.

Results and Conclusions:

All three PDC/ADH expressing Synechocystis mutants were able to produce ethanol efficiently with similar production rates (FIGS. 46A, 46B and 46C). Thus, all three Adh enzymes seem to convert the generated acetaldehyde, produced by the PDC into ethanol. In general each of the three Adhs can be used for the ethanol production in cyanobacteria.

Interestingly, the growth rate of the different mutants is very similar at least for the first 10 days of cultivation, then after addition of new BG11-medium the mutant expressing Pdc/SynAdh looks more healthy and seems to grow faster than the mutants expressing the Zymomonas mobilis Adhs, which rather have stopped growing (although new nutrients were added). This is probably due to the decreased vitality of respective ethanol producing cells (visible by yellow pigmentation and bleaching as well as by the reduced oxygen evolution), since a small amount of the generated ethanol is reconverted to acetaldehyde by both Zymomonas Adhs. This back-reaction decreased the yield of ethanol on one hand and on the other hand is harmful for the cells, because of the toxicity of the accumulating acetaldehyde. The Adh of Synechocystis does not exhibit this back-reaction (at least under the tested growth conditions), since in contrast to mutants expressing ZmAdhI or ZmAdhII no acetaldehyde was detectable in the gas-phase of a SynAdh expressing mutant culture (determined by gas chromatography, see FIG. 46D). FIG. 46D presents measurements for outgas samples of Synechocystis mutants that express ZmPdc/ZmAdhI (dashed line), ZmPdc/ZmAdhII (solid line) and ZmPdc/SynAdh (dotted line) analyzed by gas chromatography. The grey arrow indicates the acetaldehyde, the black arrow the ethanol peak. This finding makes the ZmPdc/SynAdh expressing mutant a more efficient ethanol producer, because this mutant is healthier during the period of ethanol production and is able to maintain the initial ethanol production rate over a longer time scale as visible in FIGS. 46A, 46B and 46C.

Due to the fact that the ZmPdc/SynAdh expressing mutants do not convert the produced ethanol back into acetaldehyde, there is no loss in the production process. This is clearly visible in the increased ethanol accumulation of these mutants. Both mutants expressing the respective Zymomonas Adhs exhibit a lower ethanol yield. Already after 10 days of cultivation there is a significant difference in the ethanol content of the cultures, which indicates that the loss by the back-reaction is not marginal.

Taken together, each of the three Adhs is applicable for the ethanol production in cyanobacteria, in particular the Synechocystis Adh enzyme. But with the aim of long-term ethanol production with maximal yields it can be summarized the Adh of Synechocystis is obviously advantageous and well suited for the production process because of the lack of the observed disadvantageous back-reaction.

Further experiments were prepared in which the acetaldehyde formation in presence of different amounts of ethanol was monitored. These experiments showed that cells expressing Pdc and Adh I of Zymomonas mobilis produced more acetaldehyde when more ethanol was added to the growth medium. It is therefore concluded, that the acetaldehyde is formed by a back reaction from ethanol and is not formed by a Pdc enzyme, which produces too much acetaldehyde to be completely further converted into ethanol by the Adh enzyme.

Analysis of ethanol and acetaldehyde by gas chromatography (GC) was performed under following conditions. Gas chromatograph: Shimadzu GC-2014; column: SGE ID-BP634 3.0, 30m×0.53 mm; carrier gas: helium; temperature: 40° C. constant. An acetaldehyde standard eluted under this conditions at 3.2 min. For the standard, acetaldehyde (Carl Roth) was diluted to 1 mg/ml in water, 25 μl were injected into a 250 ml gas sampling tube, the acetaldehyde was vaporized (30 min, 60° C.). After cooling different volumes were analyzed by GC. A calibration curve was obtained by plotting the integrated peak area against the amount of acetaldehyde.

The gas phase over the cultures was sampled with a gas tight syringe pierced into the tubing at the outlet and 250 μl were injected into the GC.

For measurement of the acetaldehyde production from ethanol Synechocystis cells were pelleted, repeatedly washed with BG-11 and dissolved to 10 μg Chl/ml in BG-11 medium. 2 ml of the cultures were mixed with ethanol in clear gas vials (4 ml total volume) closed with rubber seals. The samples were incubated at room temperature for defined time periods in the light (approx. 1000 μE/s*m2). 250 μl of the gas phase were sampled with a gas tight syringe and analyzed. Chlorophyll was determined as in described in Tandeau De Marsac, N. and Houmard, J. in: Methods in Enzymology, Vol. 169, 318-328. L. Packer, ed., Academic Press, 198.

TABLE 1 Ethanol and acetaldehyde in the gas phase above ethanol producing strains. acetaldehyde ethanol ethanol gas phase gas phase medium [μmol/L] [μmol/L] [μmol/L] PCC6803 wild n.d. n.d. n.d. type ZmPdc/ZmADH I 0.70 4.5 8670 ZmPdc/ZmADH II 0.62 3.5 5134 ZpPdc/ZmADH II 0.33 3.3 ZmPdc/native ADH n.d. 4.0 7777 ZpPdc/native ADH n.d. 2.8 Pdc/SynADH n.d. 5.1 9767 The gas phase above transgenic strains of Synechocystis PCC6803 expressing different Pdcs and Adhs using the plasmid pVZ323 PpetJ was analyzed for ethanol and acetaldehyde content. As a control the ethanol was also quantified in the culture medium. ZmPdc, Pdc of Zymomonas mobilis; ZpPdc, Pdc of Zymobacter palmae; ZmAdh I, Adh I of Zymomonas mobilis; ZmAdh II, Adh II of Zymomonas mobilis; native Adh, no expression of an heterologous Adh, the native Adh of Synechocystis is present; SynAdh, Adh of Synechocystis is overexpressed; n.d. not detectable; —, not measured

FIG. 46E shows the acetaldehyde production after addition of ethanol in different concentrations. Wild type and ethanol producing transgenic cells Synechocystis PCC6803, overexpressing different Pdc and Adh enzymes (see text) were incubated for 30 min under illumination with 0.05% to 0.4% (v/v) of ethanol. The y-axis of FIG. 46E denotes the acetaldehyde concentration in the gas phase (in μmol/l) and the x-axis shows the ethanol concentration in % (v/v).

FIG. 46E shows that only for the Synechocystis strain transformed with pVZ323 PpetJ Pdc/ZmADH I, the amount of acetaldehyde in the gas phase could be increased by adding more ethanol to the growth medium. For the Synechocystis PCC6803 strains transformed with pVZ323 PpetJ Pdc/SynAdh no increase in acetaldehyde could be detected upon addition of ethanol.

The Adh enzyme from Synechocystis was further characterized by preparing crude cell extracts from Synechocystis PCC6803 overexpressing SynAdh. For the reason of comparison crude cell extracts from Synechocystis cells overexpressing Zymomonas mobilis Adh II were prepared as well.

For preparation of crude extracts, cells were pelleted, dissolved in buffer supplemented with 1 mM DTT and broken (beadbeater, 2×10 min, glass beads with 100 μm diameter). The supernatant of a centrifugation (15 min, 14000 rpm, 4° C., Micro 200R, Hettich) was used for the experiments.

Synechocystis or Zymomonas mobilis Adh enzyme activity was measured either as ethanol oxidation or as acetaldehyde reduction, i.e. in the direction of ethanol formation. The assays for ethanol oxidation contained in a total volume of 800 μl 30 mM Tris/HCl (pH 8.5), 1 mM NAD+ or 1 mM NADP+, 1 M ethanol and the crude extract. The Adh activity was measured as rate of the increase of the absorbance at 340 nm. For measurement of the acetaldehyde reduction, the assays contained 30 mM MES/KOH (pH 6.2), 0.3 mM NADH or 0.3 mM NADPH, and crude extracts. The reaction was started by addition of an acetaldehyde solution to a final concentration of 0.125 M and the rate of decrease of the absorbance at 340 nm was measured. For the measurements of the pH-dependency of the Adh 40 mM MES adjusted with Tris base (pH 6.5 to 8.0) and with NH3 (pH 8.5 and 9.0) was used as buffer. Protein was determined by the method of Lowry.

TABLE 2 ADH activities measured as ethanol oxidation. with Adh II with Adh Wild type Z. mobilis Synechocystis   1 mM NAD+ 0.4 85.2 1.4   1 mM NADP+ 1.6 3.3 6.8 0.1 mM NADP+ 2.4 3.4 8.9   1 mM NAD+ + 0.1 mM 2.2 65.7 8.7 NADP+   1 mM NAD+ + 1 mM 1.3 25.5 6.4 NADP+ Crude extracts of Synechocystis wild type, Synechocystis cells expressing Adh II of Zymomonas mobilis, or the AHD of Synechocystis were analyzed. The assays contained NAD+ and/or NADP+ in the given concentrations. Shown are specific activities in nMol min−1 mg−1 of total protein.

This table 2 shows that Adh II from Zymomonas mobilis has a higher enzymatic activity than Synechocystis Adh enzyme for the unwanted backreaction, the oxidation of ethanol back to acetaldehyde if NAD+ or mixtures of NAD+ and NADP+ are used as a cosubstrates.

TABLE 3 ADH activities measured in the direction of ethanol production. with ADH II with ADH Wild type Z. mobilis Synechocystis 0.3 mM NADH 13.7 62.8 53.3 0.3 mM NADPH 9.0 71.4 55.4 0.3 mM 2.9 3.7 2.8 NADH + 1 mM NADP+ The assays contained NADH or NADPH or a combination of NADH and NADP+. Shown are the specific activities in nMol min−1 mg−1 of total protein.

The pH-dependency of the acetaldehyde reduction by crude extracts containing the Synechocystis Adh is shown in the next FIG. 46F. Surprisingly very different results were found for NADH and NADPH. With NADH as cosubstrate a steady decrease of activity at higher pH values was measured (maximum activity at pH 6.1), whereas the NADPH dependent reduction had a broad pH optimum. This FIG. 46F shows the acetaldehyde reduction rates of a crude extract containing Synechocystis Adh enzyme with NADH and NADPH, respectively (0.15 nM final concentration) at different pH-values. The activities are given in dE/min.

This finding is particularly interesting because according to literature the amount of NADPH in Synechocystis exceeds the amount of NADH approximately 10 times. Therefore Synechocystis Adh enzyme is expected to have a broad pH-optimum in transformed Synechocystis cells or other cyanobacterial strains.

The Adh enzyme of Synechocystis also has different kinetic constants for NADH and NADPH. FIG. 46G summarizes the acetaldehyde reduction rates at different cosubstrate concentrations. Measurements were performed at pH 6.1. Using Lineweaver-Burk plots, which depict the reciprocal of the rate of acetaldehyde reduction versus the reciprocal of the concentration of NADH (squares) or NADPH (rhombi), respectively (FIG. 46H) Km and vmax for NADH were calculated with 1 mM and 1.6 μMol min−1 ml−1 crude extract. For NADPH Km and vmax were 15 μM and 0.4 μMol min−1 ml−1 for the crude extract. The Km for the NADH-dependent reaction of the Synechocystis Adh enzyme was calculated to be approximately 1 mM.

Further Characterization of the Purified SynAdh Enzyme

In order to study the properties of the SynADH in more detail, a number of different measurements with the purified enzyme were performed. Experiments with cell extracts can be problematic in some circumstances, e.g. they could contain inhibiting substances or enzymes competing for the substrates.

Methods

SynADH was overexpressed as fusion protein with glutathione S-transferase (GST) in E. coli. The fusion protein was purified by affinity chromatography (Glutathione Sepharose™ 4, GE Healthcare). The GST part of the fusion protein was then removed by proteolytic digestion with PreScission Protease (GE Healthcare).

Heterologous Expression and Purification of the SynAdh

ORF slr1192 from Synechocystis was amplified by PCR using the primers:

(SEQ ID NO: 223) 5′ CTCTAGGATCCATGATTAAAGCCTACG 3′ and (SEQ ID NO: 224) 5′ CACGGACCCAGCGGCCGCCTTTGCAGAG 3′.

The primers contain nucleotide exchanges, which were introduced into the primers to obtain a BamHI and a NotI restriction site (the restriction sites are underlined in the sequences). Phusion High fidelity DNA polymerase was used for the PCR, which was performed according to the protocol of the manufacturer (New England BioLabs Inc.). The PCR resulted in an DNA fragment of 1010 bps, which was ligated into the PCR cloning vector pJET1.2 blunt (GeneJETT™ PCR Cloning Kit, Fermentas) and E. coli cells (α-Select Chemical Competent Cells, Bioline) were transformed with the ligation assay. Plasmidic DNA was isolated (GeneJET™ Plasmid. Miniprep Kit, Fermentas) from positive clones, the DNA. was digested with BamHI and NotI and the 1010 bps fragment containing slr1192 was recovered. The fragment was ligated into pGEX-6P-1 (GE Healthcare) which had been digested with BamHI and NotI. E. coli was transformed and plasmidic DNA was prepared as before. The correctness of the construct was verified by digestion with different restriction enzymes and by complete sequencing of the 1010 bps insert.

For the expression of the fusion protein chemical competent BL21 E. coli cells were transformed with the construct. A single colony was cultured in LB-medium complemented with ampicillin (125 μg/ml) and glucose (1% w/v). The culture volume was stepwise increased to 200 ml. Cells were finally harvested by centrifugation (4500 rpm, 10 min, Rt, Rotina 420R Hettich) resuspended in 200 ml LB-medium with ampicillin (125 μg/ml) and IPTG (isopropyl thiogalactoside, 0.5 mM) and cultured under shaking at 20° C. over night. Cells were then harvested, washed with buffer A (20 mM Tris/HCl, pH 7.5, 150 mM KCl, 1 mM Dithiotreitol) and resuspended in this buffer. Cells were disrupted by sonication (UW 2070, Bandelin) under ice cooling and the lysate was cleared by centrifugation (15 min, 14,000 rpm, 4° C., Micro 200R Hettich). 4 ml column material Glutathione Sepharose™ 4 Fast Flow (GE Healthcare) was washed 5 times with buffer A and added to the cell lysate. After incubation. (2 hours at Rt under shaking) the material was packed in a disposable plastic column (12 cm length, 1 cm diameter). The column material was washed with 5 column volumes (20 ml) buffer A and subsequently resuspended in 1.5 ml buffer A supplemented with 80 μl PreScission Protease (2 units/μl). After incubation at 4° C. over night, the column was eluted with buffer A. Fractions of 1.5 ml or 1 ml were collected.

SDS Polyacrylamide gel electrophoresis was performed with standard methods using 15% polyacrylamide gels. Page Ruler™ unstained protein ladder (Fermentas) was the molecular weight standard.

Alcohol dehydrogenase activity was measured in the direction of acetaldehyde reduction. The assay contained in a total volume of 1000 μl 30 mM MES/KOH, pH 6.0, 1 mM DTT, 0.3 mM NADPH and different volumes of samples. The reaction was started by addition of acetaldehyde to a final concentration of 100 mM, the rate of the decrease of the absorbance at 340 nm was measured.

Results and Discussion

The success of the purification was verified by SDS Polyacrylamide gel electrophoresis (SDS/PAGE) analysis and by measurement of the alcohol dehydrogenase activity. As shown in FIG. 46I the main protein in the eluate has a molecular weight of approx. 36 kDa. This corresponds to the molecular weight of the SynADH, which was calculated from the amino acid sequence with 35.9 kDa. The PreScission protease has a molecular weight of 46 kDa. The GST-tag, if expressed alone, has a molecular weight of 29 kDa. The SDS/PAGE analysis shows that SynADH was enriched, but not purified to homogeneity.

The results for the measurement of the alcohol dehydrogenase activity are given in table 1, wherein the activity of the cell lysate was defined as 100% yield. As shown therein only 50% of the SynADH in the cell lysate was bound to the column material. In the finally obtained fractions of the eluate the enzyme was enriched approximately 16-fold. This purification factor is not high but for a one step purification this is not unexpected. Approx. 35% of the activity was finally recovered in fractions 1 to 5 of the eluate.

Fraction 2 of the purification was used for the measurement of the kinetic parameters of the SynAdh as described in the following.

activity/ activity/ protein vol. protein total volume conc. [μmol/min * [μmol/min * Purification activity yield sample [ml] [mg/ml] ml] mg] [-fold] [μmol/min] [%] cell 15 14.3 7.86 0.55 1 117.9 100 lysate flow 15 11.7 3.86 0.33 57.9 49 through wash 20 1.5 0.37 0.25 7.3 6 solution fraction 1 1.5 1.25 10.92 8.7 15.8 16.4 fraction 2 1 1.25 10.92 8.7 15.8 10.9 fraction 3 1 0.91 9.60 10.5 19.1 9.6 fraction 4 1 0.35 3.60 10.3 18.7 3.6 fraction 5 1 0.11 1.10 10.0 18.2 1.1 fractions 41.6 35 1-5 computed value

Adh enzyme activity was measured either as ethanol oxidation (back reaction) or as acetaldehyde reduction (in the direction of ethanol formation, forward reaction). The ethanol oxidation and acetaldehyde reduction were measured at room temperature as rate of change of absorbance at 340 nm. Both ethanol oxidation and acetaldehyde reduction were analyzed at different pH values. Experiments were made at pH 7.5 in presence of high concentrations of KCl in order to mimic the intracellular conditions. In addition ethanol oxidation rates were assayed at pH 8.5 and acetaldehyde reduction rates at pH 6.0. This pH values were taken from the literature, they account for the different pH-optima of forward and backward reaction of ADH II of Zymomonas mobilis.

Ethanol Oxidation:

The assays for the determination of the Km values for NAD+ and NADP+ contained in a total volume of 1000 μl 30 mM HEPES/KOH (pH 7.5), 150 mM KCl, 1 mM DTT, 1.5 M ethanol, purified enzyme and NAD+ or NADP+ in different concentrations. For measurements at pH 8.5 HEPES/KOH was substituted by 30 mM Tris/HCl (pH 8.5), KCl was omitted. The assays for the determination of the Km value for ethanol contained in a total volume of 1000 μl 30 mM HEPES/KOH (pH 7.5), 150 mM KCl, 1 mM DTT, 1 mM NADP+, purified enzyme and ethanol in different concentrations. For measurements at pH 8.5 HEPES/KOH was substituted by 30 mM Tris/HCl (pH 8.5), KCl was omitted.

Acetaldehyde Reduction:

The assays for the determination of the Km values for NADH and NADPH contained in a total volume of 1000 μl 30 mM HEPES/KOH (pH 7.5), 150 mM KCl, 1 mM DTT, 2 mM acetaldehyde, purified enzyme and NADH or NADPH in different concentrations. For measurements at pH 6.0 HEPES/KOH was substituted by 30 mM MES/KOH (pH 6.0), KCl was omitted. The assays for the determination of the Km value for acetaldehyde contained in a total volume of 1000 μl 30 mM HEPES/KOH (pH 7.5), 150 mM KCl, 1 mM DTT, 0.32 mM NADPH, purified enzyme and acetaldehyde in different concentrations. For measurements at pH 6.0 HEPES/KOH was substituted by 30 mM MES/KOH (pH 6.0), KCl was omitted.

Results

The Km and vmax values of SynAdh for the different substrates were determined with Lineweaver-Burk plots. The Km values are summarized in table 1 and table 2.

TABLE 1 Km values of SynAdh for the different substrates of the acetaldehyde reduction. pH 7.5, 150 mM KCl pH 6.0 NADH 1000 μM  NADPH  15 μM  20 μM acetaldehyde 180 μM 200 μM Shown are the Km values for NADH, NADPH and acetaldehyde at two different conditions (see Methods); —, not measured.

TABLE 2 Km values of SynAdh for the different substrates of the ethanol oxidation. pH 7.5, 150 mM KCl pH 8.5 NAD+ 10 mM 10 mM NADP+ 15 μM 15 μM ethanol 23 mM 59 mM Shown are the Km values for NAD+, NADP+ and ethanol at two different conditions (see Methods).

Discussion

The Km value is an inherent property of an enzyme. It is defined as the substrate concentration necessary to obtain half-maximal velocity of the enzymatic reaction. The lower the Km value, the higher the “affinity” of the enzyme to the substrate.

The Km values of SynAdh for the substrates of the acetaldehyde reduction were determined in earlier experiments with cell extracts. The results for the purified enzyme presented here are nearly identical to those results. The affinity of the enzyme for NADPH is relatively high (Km approx. 15 μM), but the affinity for NADH is very low (Km for NADH approx. 1000 μM). This means, that the reaction is much more effectively catalyzed with NADPH than with NADH, and NADPH will be the cosubstrate preferred by SynADH, all the more as in cyanobacteria, as in other photosynthetic organisms NADPH exceeds NADH by far. In Synechocystis PCC 6803 the pool of NADPtotal (NADP++NADPH) is approx. 10 fold higher than the pool of NADtotal (NAD++NADH) as described in Cooley & Vermaas, J. Bacteriol. 183(14) (2001) 4251-42589. The Km value of SynAdh for acetaldehyde was determined with approx. 200 μM. As a comparison the Km value of ADH I and ADH II of Zymomonas mobilis given in the literature are between 8 and 21 μM for acetaldehyde and 12 to 27 μM for NADH as described in Hoppner & Doelle, Eur. J. Appl. Microbiol. Biotechnol. 17, (1983), 152-157 and Kinoshita et al., Appl. Microbiol. Biotechnol. 22, (1985), 249-254, respectively.

The affinities of SynAdh to the substrates of the acetaldehyde reduction are more or less similar to those of ADH I and ADH II of Zymomonas mobilis, but the properties of the back reaction are totally different. The Km value of ADH I and ADH II of Z. mobilis for ethanol are given in the literature with 24 μM (ADH I) and 140 μM (ADH II), the Km for NAD+ with 73 μM (ADH I) and 110 μM (ADH II) [6]. The affinity of SynAdh to ethanol is by far lower, the Km value for ethanol was determined with approx. 23 mM to 59 mM. This means that ADH I and ADH II will catalyze the formation of acetaldehyde already at low ethanol concentrations, while effective acetaldehyde formation with SynAdh requires much higher ethanol concentrations. As for the forward reaction the two co-substrates behave totally different in the back reaction. The Km for NAD+ was determined with 10 mM, the Km for NADP+ with 15 μM.

The finding that SynAdh has a very low affinity towards ethanol is an explanation for the ineffectivity of the back reaction. The missing or relatively small formation of acetaldehyde may be the explanation for the increased vitality of cell strains containing the SynAdh when compared to ethanol producing strains with other Adhs, as acetaldehyde is toxic to cells.

Phylogenetic Analysis of the SynAdh Enzyme

Phylogenetic analysis shows that Adh is a member of the family of Zinc-binding GroES-like domain alcohol dehydrogenases, which is phylogenetically different from the family of short chain Rossmann fold like Adh enzymes or the family of Fe-containing Fe-Adh enzymes.

The FIG. 47A shows a in-depth phylogenetic analysis of different alcohol dehydrogenase families. Within the Glade of Zinc-binding GroES-like domain alcohol dehydrogenases three sub-clades denoted A to C can be found and furthermore a Zymomonas Adh enzyme, which is only distantly related to the other members of the Zinc-binding GroES-like domain alcohol dehydrogenases. The values in parentheses indicate the average percentage of protein sequence identity of the members of one respective sub-Glade to Synechocystis Adh enzyme NP 443028. It can clearly be seen that for example the members of the sub-Glade B including Synechocystis Adh enzyme share an average sequence identity with SynAdh of 61.77%. Each of the different families contain a number of representative members, which are denoted by their respective National Center for Biotechnology Information (NCBI) database entry numbers (www.ncbi.nlm.nih.gov/). In particular the phylogenetic tree was constructed with protein sequences of different Adh enzymes using Neighbor-joining method. Distinct clades includes Adh enzymes with different metal-binding domains. The table of FIG. 47B shows the annotations, the organisms and the database accession codes for the protein sequences of the different sub-clades A to C in the Glade of Zinc-binding GroES-like domain alcohol dehydrogenases shown in FIG. 47A.

Genes encoding the alcohol dehydrogenase (Adh) from Synechocystis sp. PCC 6803 were compared to all proteins from the NCBI non-redundant database (http://www.ncbi.nlm.nih.gov) with BLAST (1) to retrieve top bacterial sequence matches, including 40 from extant cyanobacteria. Protein sequences of these adh genes were aligned with ClustalW (2). Phylogenetic tree was constructed with MEGA version 3.1 (3) using the neighbor-joining method with Poisson correction substitution model and 100 bootstrap replicates assuming uniform heterogeneity among sites. The detailed options are as following:

    • Method: Neighbor-Joining
    • Phylogeny Test and options: Bootstrap (100 replicates; seed=64238)

Include Sites: ==============================

    • Gaps/Missing Data: Pairwise Deletion
    • Substitution Model: ==============================
    • Model: Amino: Poisson correction
    • Substitutions to Include: All
    • Pattern among Lineages: Same (Homogeneous)
    • Rates among sites: Uniform rates

No. of Sites: 315 No Of Bootstrap Reps=100

The above phylogenetic analysis revealed three clades of structurally and catalytically different types of alcohol dehydrogenases: 1) Zn-containing ‘long-chain’ ADH with a GroES-like (ADH-N) domain at the N′ terminal end; 2) Insect-type, or ‘short-chain’ ADH; and 3) Fe-containing ADH (FIG. 47). The Zn-containing ADHs (4, 5) are dimeric or tetrameric enzymes that bind two atoms of zinc per subunit. Both zinc atoms are coordinated by either cysteine or histidine residues; the catalytic zinc is coordinated by two cysteines and one histidine. The Zn-containing ADH contains a GroES-like (ADH-N) domain at N′ terminal and a Rossmann-fold NAD(P)+-binding (NADB_Rossmann) domain at C′ terminal. A number of other Zn-dependent dehydrogenases, including the glutathione dependent formaldehyde dehydrogenase (homologous to gene adhC in Zymomonas mobilis) and the NADP-dependent quinone oxidoreductase (qor) are closely related to Zn-ADH (6) and are included in this family.

The short-chain Adh's belong to the short-chain dehydrogenases/reductases family (SDR) (7), most of which are proteins of about 250 to 300 amino acid residues with a Rossmann-fold NAD(P)+-binding domain. Little sequence similarity has been found in this family although there is a large degree of structural similarity.

The Fe-containing ADH's are distantly related to gene adhB from Z. mobilis. This group shares sequence homology with glycerol and butanol dehydrogenases.

REFERENCES

  • 1. S. F. Altschul et al., Nucleic Acids Res. 25, 3389 (1997).
  • 2. J. Thompson, D. Higgins, T. Gibson, Nucleic Acids Res. 22, 4673 (1994).
  • 3. S. Kumar, K. Tamura, M. Nei, Briefings in Bioinformatics 5, 150 (2004).
  • 4. H. Jornvall, B. Persson, J. Jeffery, Eur. J. Biochem. 167, 195 (1987).
  • 5. H. W. Sun, B. V. Plapp, J. Mol. Evol. 34, 522 (1992).
  • 6. B. Persson, J. Hallborn, M. Walfridsson, B. Hahn-Hagerdal, S. Keranen, M. Penttila, H. Jornvall, FEBS Lett. 324, 9 (1993).
  • 7. H. Jornvall, B. Persson, M. Krook, S. Atrian, R. Gonzalez-Duarte, J. Jeffery, D. Ghosh, Biochemistry 34, 6003 (1995).

The FIGS. 47C to 47I show the protein sequences of the Adh enzymes of sub-clade B, which also included the Zinc-dependent Synechocystis Adh enzyme. In particular, FIG. 47C presents the amino acid sequence of a zinc-containing alcohol dehydrogenase family protein of Synechocystis sp. PCC 6803, identified by Genbank Accession No. NP 443028.1.

FIG. 47D presents the amino acid sequence of a zinc-containing alcohol dehydrogenase family protein of Oceanobacter sp. RED65, identified by Genbank Accession No. ZP01306627.1.

FIG. 47E presents the amino acid sequence of an alcohol dehydrogenase, zinc-binding protein of Limnobacter sp. MED105, identified by Genbank Accession No. ZP01914609.1.

FIG. 47F presents the amino acid sequence of an alcohol dehydrogenase GroES-like protein of Psychrobacter cryohalolentis K5, identified by Genbank Accession No. YP581659.1.

FIG. 47G presents the amino acid sequence of an alcohol dehydrogenase GroES-like domain family of Verrucomicrobiae bacterium DG1235, identified by Genbank Accession No. EDY84203.1.

FIG. 47H presents the amino acid sequence of a zinc-containing alcohol dehydrogenase family protein of Saccharophagus degradans 2-40, identified by Genbank Accession No. YP529423.1.

FIG. 47I presents the amino acid sequence of a zinc-containing alcohol dehydrogenase family protein of Alteromonas macleodii ‘Deep ecotype’, identified by Genbank Accession No. YP002126870.1.

The FIGS. 47J to 47S represent the Adh protein sequences of sub-clade A of the above phylogenetic analysis.

In particular FIG. 47J presents the amino acid sequence of a zinc-containing alcohol dehydrogenase family protein of Acaryochloris marina MBIC11017, identified by Genbank Accession No. YP001519107.1.

FIG. 47K presents the amino acid sequence of an alcohol dehydrogenase GroES domain protein of Cyanothece sp. PCC 7424, identified by Genbank Accession No. YP002380432.1.

FIG. 47L presents the amino acid sequence of an alcohol dehydrogenase GroES domain protein of Cyanothece sp. PCC 7424, identified by Genbank Accession No. ZP02976085.1.

FIG. 47M presents the amino acid sequence of an alcohol dehydrogenase GroES domain protein of Cyanothece sp. PCC 7822, identified by Genbank Accession No. ZP03154326.1.

FIG. 47N presents the amino acid sequence of an alcohol dehydrogenase GroES domain protein of Cyanothece sp. PCC 8801, identified by Genbank Accession No. YP002371662.1.

FIG. 47O presents the amino acid sequence of an alcohol dehydrogenase GroES domain protein of Cyanothece sp. PCC 8801, identified by Genbank Accession No. ZP02941996.1.

FIG. 47P presents the amino acid sequence of an alcohol dehydrogenase GroES domain protein of Cyanothece sp. PCC 8802, identified by Genbank Accession No. ZP03143898.1.

FIG. 47Q presents the amino acid sequence of an alcohol dehydrogenase GroES-like domain family of Microcoleus chthonoplastes PCC 7420, identified by Genbank Accession No. EDX77810.1.

FIG. 47R presents the amino acid sequence of an uncharacterized zinc-type alcohol dehydrogenase-like protein of Microcystis aeruginosa NIES-843, identified by Genbank Accession No. YP001659961.1.

FIG. 47S presents the amino acid sequence of an unnamed protein product of Microcystis aeruginosa PCC 7806, identified by Genbank Accession No. CA090817.1.

The FIG. 47T to 47X show the amino acid sequences of the Adh enzymes of the sub-clade C of the above phylogenetic analysis.

In particular FIG. 47T presents the amino acid sequence of a zinc-containing alcohol dehydrogenase superfamily protein of Synechococcus sp. WH 5701, identified by Genbank Accession No. ZP01085101.1.

FIG. 47U presents the amino acid sequence of a zinc-containing alcohol dehydrogenase superfamily protein of Synechococcus sp. RS9917, identified by Genbank Accession No. ZP01079933.1.

FIG. 47V presents the amino acid sequence of a zinc-containing alcohol dehydrogenase superfamily protein of Synechococcus sp. WH 5701, identified by Genbank Accession No. ZP01085101.1.

FIG. 47W presents the amino acid sequence of a zn-dependent alcohol dehydrogenase of Synechococcus sp. WH 7803, identified by Genbank Accession No. YP001224538.1.

FIG. 47X presents the amino acid sequence of a zinc-containing alcohol dehydrogenase superfamily protein of Synechococcus sp. WH 7805, identified by Genbank Accession No. ZP01125148.1.

P.6 Ethanol Production Rates of Genetically Modified Photoautotrophic Host Cells Containing Zymomonas Mobilis PDC as the Only Second Genetic Modification

Almost all organisms including photoautotrophic organisms contain in their genomes genes coding for alcohol dehydrogenases (Adh). Also the cyanobacterium Synechocystis PCC6803 exhibit Adh activity in crude cell extracts and contains a corresponding adh gene in the genome. However it is questionable whether this endogenous Adh enzyme is active enough in order to ensure a high level ethanol production in conjunction with an overexpressed Pdc enzyme.

In order to test if this endogenous Adh enzyme is able to convert efficiently the generated acetaldehyde produced by the over-expressed Pdc enzyme, mutants were generated that express only the Pdc enzyme without additional Adh enzyme. This mutant was compared to an isogenic ethanol producing mutant of Synechocystis that over-express Pdc enzyme together with an additional Adh enzyme from Zymomonas mobilis.

Mutant Generation:

From a preexisting pVZ plasmid (pVZ321b-PisiA-Pdc/AdhII) containing respective Pdc/Adh genes from Zymomonas mobilis the coding region of AdhII was cut out by SacI/PstI digestion and subsequent religation of the residual plasmid lead to pVZ321b-PisiA-PDC (without AdhII). Mutants were selected on streptomycin plates and grown in BG11 medium containing the appropriate antibiotics (kanamycin 100 mg/l; streptomycin 10 mg/l).

Growth Conditions:

Mutant and Synechocystis wild-type strains were grown in BG11 without iron, at 28° C., under constant light (100 μE m−2 s−1), aerated with CO2-enriched air (0.5% CO2). The initial OD750 was 1.3 in a total culture volume of 300 ml in a 500 ml Schott-flask.

The FIGS. 48A and 48B show the growth as determined by measurement of the OD250 and ethanol production of Synechocystis wild type and mutants that express Pdc/Adh enzyme and Pdc enzyme alone, respectively over the time course of 15 days.

Results and Conclusions:

Both ethanol producing mutants, the mutant overexpressing Pdc enzyme alone and the mutant overexpressing Pdc/AdhII grow very similar but show a reduced growth rate when compared to the wild type.

Surprisingly, the mutant that expresses the Pdc enzyme alone exhibit about the same ethanol production rate compared to the mutant that co-expresses an additional Adh enzyme with the Pdc enzyme. Thus, the endogenous Adh of Synechocystis is able to convert efficiently the generated acetaldehyde produced by the overexpressed Pdc enzyme into ethanol. Under the conditions tested here it seems that no additional Adh enzyme is necessary to produce ethanol in Synechocystis. These results further show that the reaction catalyzed by the Pdc enzyme is the rate limiting step in the ethanol production process.

P.7 Comparison of Ethanol Production Rates of Genetically Modified Photoautotrophic Host Cells Containing Zymomonas Mobilis PDC as the Only Second Genetic Modification with Photoautotrophic Host Cell Harboring PDC Enzyme in Conjunction with Various ADH Enzymes

Synechocystis PCC 6803 transformed with various plasmids harboring either the Zymomonas mobilis Pdc enzyme alone or combination with Zymomonas mobilis AdhII enzyme or the Synechocystis Adh enzyme was cultivated under conditions of CO2 limitation or with sufficient CO2 supply.

The condition of CO2 limitation was created by shaking 50 ml cyanobacterial cultures in 100 ml Erlenmeyer flasks at 28° C. at a rate of 100 rpm. The light intensity was set to 40 μE m−2 s−1.

The condition of sufficient CO2 supply was created by cultivating cyanobacteria in aerated 200 ml flasks and subjecting the cultures to a constant gas flow of 0.5% (v/v) of CO2 with a rate of 10 ml/min. The temperature was at 28° C. and the light intensity was set at 100 μm−2 s−1.

The graphical representations in the FIGS. 48C and 48D, depict the time course of the ethanol concentration in % (v/v) as determined with the enzymatic ethanol quantification methods as described above for various Synechocystis cultures transformed with the indicated plasmids and cultured under a condition of CO2 limitation.

These data show that under conditions of CO2 limitation photoautotrophic cyanobacterial host cells transformed with Pdc enzyme only exhibit about the same ethanol production rates as photoautotrophic cells transformed with Pdc in combination with Synechocystis Adh enzyme. In contrast to that, photoautotrophic cells transformed with Pdc enzyme in conjunction with Zymomonas mobilis AdhII enzyme showed lower ethanol production rates.

The graphical representations in the FIGS. 48E and 48F, depict the time course of the ethanol concentration in % (v/v) as determined with the enzymatic ethanol quantification methods as described above for various Synechocystis cultures transformed with the indicated plasmids and cultured under a condition of sufficient CO2 supply.

These data suggest that at conditions of sufficient CO2 supply photoautotrophic cyanobacterial host cells harboring Pdc only or harboring a combination of Pdc enzyme and Zymomonas mobilis AdhII enzyme show comparable ethanol production rates, which are lower than ethanol production rates for photoautotrophic host cells with Pdc enzyme and Synechocystis Adh enzyme.

P.8 Ethanol Production Rates of Genetically Modified Photoautotrophic Host Cells Containing Ethanologenic Enzymes Under the Transcriptional Control of Various Inducible Promoters

In this section several natural occurring promoters from Synechocystis were analyzed for their suitability to express the Pdc enzyme in Synechocystis. In Tab.1 an overview of the chosen promoters with their characteristics is shown. For all these promoters corresponding mutants in Synechocystis PCC6803 were already created and characterized. This section reports only a summary of the best embodiments.

FIG. 49A shows a summary of the cyanobacterial promoters used to express ethanologenic enzymes in Synechocystis 6803. Characteristics were taken from the literature, mainly analyzed and described for the cyanobacterium Synechocystis 6803.

Mutant Generation:

From a preexisting pVZ plasmid (pVZ321b-PisiA-PDC/ADHII) containing Pdc/Adh genes from Zymomonas mobilis the respective promoter fragment (PisiA) was cut out by SalI/EcoRI digestion and subsequent ligation of a new promoter fragment into the residual plasmid leading to a new pVZ321b-Pxxx-PDC/ADHII derivate with exchanged promoter xxx. Mutants were selected on streptomycin plates and grown in BG11 medium containing the appropriate antibiotics (kanamycin 100 mg/l; streptomycin 10 mg/l).

Growth Conditions:

Cultures were grown in BG11 in continuous light (50-100pE) either on a shaker in 100 ml Erlenmeyer flasks (100 rpm) or in bubbling flasks (200 ml) aerated with CO2-enriched air (0.5%). Depending on the current promoter BG11 without iron or copper was used as well as BG11 without nitrogen or supplemented with 5 mM NH4Cl. Pre-cultures were harvested by centrifugation, the supernatant discarded and the cell pellet resuspended in new medium with or without the specific nutrient, needed for the regarding promoter mutant. The growth of the cultures was monitored by photodensitometrical measurements at 750 nm. The ethanol production was determined in the culture supernatant by an optical enzymatic test (Boehringer Mannheim).

Results and Conclusions:

Transconjugants with the isiA-promoter are well growing and as pigmented in the same way as the wild type. Growth experiments reveal that the ethanol formation in the culture strongly depends on the availability of iron (FIG. 1). If iron is present the ethanol production is lower and time-shifted compared to the sub-culture without iron. As described in the literature iron starvation leads to very strong induction of the isiA-promoter. After transition of the cells to iron-free BG11 it needs usual 3-5 days until ethanol formation starts. Western blot analyses revealed that Pdc accumulates within 48 hours past iron depletion (up to 50-fold), but it strongly depends on the growth phase and the iron availability of the pre-culture. By supplementation the growth medium with additional iron (3×Fe) the ethanol production can be disabled for long time and starts very late with a low rate as depicted in FIG. 49C. FIG. 49B shows the growth of the same culture monitored by determining the OD750. Thus, ethanol production in Synechocystis is excellent adjustable by using the iron depending isiA-promoter.

Until now best production rates were observed for the isiA-promoter. In continuous light about 0.02% (v/v) ethanol and in day/night cycle about 0.014% (v/v) ethanol was produced per day, respectively (for at least 10 days). Since longer iron deficiency limits the photosynthesis rate it is imaginable to use this promoter in a biphasic manner in which after a production period iron is added to regenerate the cells for the next production period. Furthermore auto-induction by stationary growth is a possibility for the application of the isiA-promoter, too.

Transconjugants with the nblA-promoter appear more slowly growing compared to transconjugants with the isiA-promoter and are also a bit more yellowish pigmented than the wild type. Growth experiments reveal that the ethanol formation in the culture depends on the availability of nitrogen as described in the literature for the nblA-promoter. If nitrogen is absent the ethanol production is significant higher compared to the control culture with nitrogen (FIG. 49D). Western blot analyses revealed a fast and strong induction of the Pdc expression after nitrogen starvation. Within 48 hours the Pdc accumulates up to 25-fold compared to control cells (with nitrogen). But the ethanol accumulation in the culture stops after 5-6 days (see FIG. 49D) most likely due to the nitrogen deficiency. Since Synechocystis is not able to fix nitrogen from the atmosphere, nitrogen deprivation leads to a reduction of photosynthesis because of the deficiency of amino acid biosynthesis in the absence of an utilizable nitrogen source. Within some days of nitrogen deprivation photosynthesis decreases significantly. But by using of nitrogen-fixing cyanobacterial species (e.g. Anabaena sp. PCC7120) the application of a nitrogen-dependent promoter like the nblA-promoter might be well suited.

FIG. 49D shows the ethanol production of Synechocystis 6803 pVZ321b-PnblA-PDC/ADH that express Pdc/Adh enzymes under the control of the nitrogen dependent nblA-promoter. Cultures were grown on a shaker in Erlenmeyer flasks in BG11 under continuous light. A pre-culture was divided into 2 sub-cultures (start OD750 nm=2), one with and the other without nitrate.

The next set of promoters consists of three promoters inducible by the nutrient status. Two of them, PpetJ and PpetE are inducible by the copper availability and the third one, PnirA, depending from the nitrogen source, ammonia or nitrate.

According to the literature the nirA-promoter is repressed if ammonia is present and turned on if nitrate is the sole nitrogen source. Furthermore this promoter is described as tight regulated and was already successful used for heterologous gene expression in Synechocystis PCC6803. Transconjugants with the nirA-promoter appear more yellowish compared to the wild type and grow very slowly, if grown on usual BG11 plates. This phenotype is common for strong ethanol producers and is not surprising since the sole nitrogen source of BG11 is nitrate, which switches the nirA-promoter on.

Growth experiments revealed that the ethanol accumulation depends from the nitrogen source (FIGS. 49F and 49G). Without supplementation of ammonia to the BG11, the culture grows more slowly as shown in FIG. 49E and produces at the same time more ethanol. If ammonia is present the ethanol production was significant lower. At the 8th day new ammonia was added to the culture to take care that enough ammonia is present for repression of the nirA-promoter. Due to this elevated ammonia availability the ethanol formation was transiently blocked whereas the reference culture (BG11 without ammonia) continues accumulating ethanol with a similar rate anymore. But already 5 days later most of the new supplemented ammonia is consumed by the cells and the promoter becomes activated and reaches ethanol production rates similar to the reference culture. If the produced ethanol in each sub-culture is normalized to the cell growth (optical density) a clear difference in the ethanol productivity is visible (FIGS. 49F and 49G). The reference culture without ammonia produces at least two times more ethanol per cell compared to the culture supplemented with ammonia.

FIGS. 49E to 49G depict the growth, ethanol production and productivity per growth of Synechocystis 6803 pVZ325PnirA-PDC. Cultures were grown in Erlenmeyer flasks with BG11 medium in continuous light. A pre-culture was divided into two sub-cultures (start OD750nm=3), one with and the other without ammonia supplementation. At the 8th day new ammonia (again 5 mM) was added to the subculture that already contained ammonia.

Thus, in general the nirA-promoter is applicable but in contrast to the literature no tight repression seems to be possible. If the leakiness of the nirA-promoter can be somehow reduced, it is imaginable that in the up-scaling process ammonia can be added to the BG11 to reach fast growth rates and reduced activity of the nirA-promoter. By consuming the ammonia over the time the culture induces itself, but can still grow by using the second nitrogen source, the nitrate that will stimulate the ethanol production. Thus, no medium exchange will be necessary.

Since copper is not essential for photosynthetic growth of Synechocystis (in contrast to iron) promoters of copper-responsible genes are very promising. Well described in the literature are the petJ- and the petE-promoter. The petJ-promoter is switched off if copper is present whereas the petE promoter is switched on. Both promoters have been already applied for heterologous expression in cyanobacteria, the petJ mainly in Synechocystis, whereas the petE was mainly used in Anabaena sp. PCC7120.

Transconjugants with the petJ-promoter show a reduced growth rate compared to wild type and appear also a bit yellowish. This is not surprising, since it is known that the limited copper availability in BG11 medium (0.3 μM) already activates the petJ-promoter to some extent. Growth experiments revealed that the ethanol formation in the culture with different concentrations of copper strongly depends on the availability of copper (see FIG. 49H to 49J). If copper is absent the ethanol production is significant higher compared to the control cultures with 0.3 μM (1×) or 1.5 μM copper (5×) but at the same time the culture without copper grows more slowly.

Between 1× and 5× copper also a significant difference in growth and ethanol accumulation is detectable. If copper is added to the culture the growth rate is increased depending on the amount. A control experiment with the wild type was performed in which the growth was documented in dependence of the copper availability. Neither growth improvement nor retardation was detectable for the wild type by various copper concentrations (data not shown). Therefore the faster growth of the mutant at elevated copper concentration is not due to a growth stimulating effect of copper, it is a consequence of the lower ethanol production. The higher the ethanol production rate the lower the growth rate of corresponding mutants. If the ethanol accumulation is calculated per cell (ethanol per OD750nm) strong differences in the productivity were obvious depending on the copper availability (see FIG. 47-6C). Thus, it is possible to adjust the ethanol production and the growth rate by copper supplementation. The petJ-promoter seems to be therefore well suited. Till now best production rates for this promoter are 0.014% (v/v) ethanol per day in continuous light (for about 4 weeks) and about 0.007% (v/v) ethanol in day/night cycles (for about 3 weeks).

FIG. 49H to 49J show the growth, ethanol production and productivity per growth of Synechocystis 6803 pVZ321b-PpetJ-PDC/ADH. Cultures were grown on a shaker in Erlenmeyer flasks in BG11 in continuous light. A pre-culture (1× copper) was divided into 3 sub-cultures (start OD750nm=3) and different concentrations of copper were added.

Since in contrast to Synechocystis PCC6803 for the nitrogen-fixing cyanobacterium Anabaena PCC7120 it was shown that the Anabaena petE-promoter responds to different copper concentrations. Therefore, instead of the Synechocystis promoter the petE-promoter from Anabaena PCC7120 was chosen for the over-expression of Pdc/Adh in Synechocystis. Transconjugants with the petE-promoter are well growing and as pigmented as the wild type when grown on copper-free BG11-plates. Growth experiments reveal that the ethanol formation in the culture depends on the availability of copper (FIG. 49L). If the copper concentration is elevated (5× copper corresponds 1.5 μM) the ethanol production is significant higher and the culture grows more slowly at the same time (compared to the reference culture in copper-free BG11). Thus, the petE-promoter from Anabaena works well for the over-expression of Pdc/Adh in Synechocystis.

FIGS. 49K and 49L show the growth, ethanol production of Synechocystis 6803 pVZ321b-PpetE-PDC/ADH. Cultures were grown on a shaker in Erlenmeyer flasks with BG11 in continuous light. A pre-culture (1× copper) was divided into 2 sub-cultures (start OD750nm=3) with different concentrations of copper (without and 5×Cu).

The crhC-promoter (cold shock induced RNA helicase) was amplified from the genome of Anabaena PCC7120, since the chrC-gene from Synechocystis seems to be not regulated by the temperature or alternatively exhibit no induction by cold-shock. The Pdc enzyme expression level of the corresponding mutants is relatively low, also when induced by cold-chock. But at least a 3-fold increase in Pdc expression, verified by Western blot analysis, and also an elevated ethanol formation was detectable if the culture was grown at 20° C. (compared to reference culture at 28° C.). Although the crhC-promoter works in general and seems to be adjustable by temperature, this promoter allows only low expression level of ethanologenic enzymes in Synechocystis. However for Anabaena it was shown that the crhC-promoter works well. Therefore it might be possible that the crhC-promoter works more efficient by using other cyanobacterial species.

FIG. 49M shows the ethanol production of Synechocystis 6803 pVZ321b-PcrhC-PDC/ADH. Cultures were grown on a shaker in Erlenmeyer flasks in BG11 under continuous light conditions at 20° C. and 28° C.

Further multi-stress responsible promoters, the htpG-promoter (heat shock protein 90), the hspA-promoter (small heat shock protein A), the clpB1-promoter (clp protease, HSP100) and the hliB-promoter (high-light inducible protein B, BLIP) were analyzed in order to test their suitability for over-expression of ethanologenic ORFs in Synechocystis 6803.

All four mutants showed different degrees in growth retardation and yellow pigmentation if grown on a plate. Strongest yellow pigmentation and most slowly growth were observed for the mutants with the hspA-promoter, followed by the htpG, the hliB and the clpB1-promoter.

The growth experiment revealed that the mutant with the hspA-promoter was most productive till the 10th day concerning the ethanol formation, but grows more slowly compared to the three other mutants (FIGS. 49N and 49O). But after 10 days of cultivation the ethanol accumulation decreases compared to mutants with the htpG- and the hliB-promoter which show a comparable ethanol accumulation.

FIGS. 49N and 49O show the growth, ethanol production and productivity per growth of Synechocystis 6803 pVZ321b-PhspA-PDC, pVZ321b-PhtpG-PDC, pVZ321b-PhliB-PDC and pVZ321b-PclpB1-PDC. Cultures were grown in a culture vessel in BG11 in continuous light, bubbled with CO2 enriched air (0.5%).

If for these four mutants the ethanol production is normalized to the culture growth the first observation or rather the first assumption about the strength of each promoter (different degree of yellow pigmentation and growth retardation indicates) can be clearly confirmed. The hspA-promoter seems to be most active in this set of multi-stress responsible promoters. The htpG- and the hliB-promoter exhibit a quite similar expression level, but the expression level of hliB-promoter can be additional elevated by increasing the light intensity. The clpB1-promoter exhibit the lowest expression in this selection of promoters, probably too low for commercial application. Further tests are necessary to elucidate the full performance of these kind of promoters, since no stress conditions were tested which might increase the observed expression level additionally. It is noteworthy that cultivation of the mutant with the hspA-promoter revealed production rates of about 0.015% (v/v) ethanol per day in continuous light and about 0.01% (v/v) ethanol in day/night cycles (both for about 2 weeks) that is comparable to the maximal expression level of mutants with the isiA- and petJ-promoter.

Multi-stress inducible promoters are especially of interest because of their potential to respond to ethanol or side effects the ethanol production (probably indirect). In this case some kind of auto-induction or self-enhancement is imaginable, which might be advantageous, e.g. in combination with other promoters.

It can be summarized that the genome of Synechocystis contains several promoters useful for the ethanol production process. Well working examples are the isiA-, petJ- and the petE-promoter as well as the nirA-promoter, which are all adjustable by the nutrient status. Furthermore the hspA and the htpG as well as the hliB-promoter appear to be suited for the production process.

P.9 Ethanol Production Rates of Genetically Modified Photoautotrophic Host Cells Containing Ethanologenic Enzymes Under Various Growth Conditions Background:

In order to get an idea about the potential of generated ethanologenic mutants, one ethanol producing mutant was cultivated over a longer time scale. Three different culture conditions were tested regarding the productivity and the duration of the ethanol formation using the cyanobacterium Synechocystis sp. PCC6803 that over-expresses the pyruvate decarboxylase from Zymomonas mobilis and the endogenous alcohol dehydrogenase (pVZ321b-PpetJ-PDC/SynADH).

Growth Conditions:

Synechocystis mutant was grown either at 28° C., in continuous light (150 μE m−2 s−1) and aerated with CO2-enriched air (0.5% CO2) or in day/night cycles (12 h/12 h) with a temperature cycle (25° C. night/35° C. day) and aerated with 5% CO2. The initial OD750 was 3-5 in a total culture volume of either 200 ml (continuous light) or 600 ml (day/night cycle) in bubbled glass vessels. For comparison of the ethanol production rates the mutant was cultivated in freshwater BG11 or in seawater BG11 (without copper). After two weeks of cultivation a nutrient-mix (100-fold BG11-concentrate) was weekly added to assure sufficient supply of nutrients for optimal growth conditions over longer periods of time.

Recipe for 11 Artificial Seawater (28 ppm):

NaCl 28.05 g  MgSO4 6.90 g MgCl2 5.49 g KCl 0.67 g CaCl2 1.47 g

Results and Conclusions:

Best ethanol production rates were observed for freshwater BG11 medium and continuous light. Cultivation of the mutant in seawater BG11 (mutant was pre-adapted in seawater) leads to a reduction of ethanol production of about 25%. This is probably due to the fact that the energy- and carbon-consuming synthesis of osmo-protectants (like glycosylglycerol), which allows the freshwater strain Synechocystis sp. PCC6803 to overcome higher salinities, decreases the availability of fixed carbon (carbohydrates) for the ethanol formation.

When the mutant was cultivated under day/night cycles with a temperature gradient that simulates the conditions of an outdoor production facility, the ethanol production and the growth rate was reduced compared to the continuous light conditions (FIGS. 49P, 49Q and 49R). That is not surprising because carbon fixation, that is necessary for growth and ethanol production occurs only during the light phase. Thus both, ethanol production and biomass production are reduced when cultivated in day/night cycles.

If the ethanol production is normalized to the optical density (as an indicator for growth) the productivity for each of the cultivation conditions appears relatively similar (FIG. 49R). That means the fraction of fixed carbon that flows into the ethanol branch is relatively constant despite the different growth conditions (see Tab.1).

TABLE 1 Ethanol production rates of Synechocystis sp. PCC6803 pVZ321b-PpetJ-PDC/SynADH at different growth conditions. pVZ321b-PpetJ- EtOH EtOH/ PDC/SynADH % EtOH/day OD750 nm EtOH/OD750 nm * day after 38 days (v/v) % (v/v) % (v/v) % (v/v) freshwater, 0.46 0.0126 0.0479 0.00126 contin. light seawater, 0.41 0.0108 0.0413 0.00109 contin. light seawater, 0.26 0.0068 0.0450 0.00118 day/night cycle

P.10 Ethanol Production Rates of Genetically Modified Photoautotrophic Eukaryotic Host Cells Containing Ethanologenic Enzymes as a Second Modification

Following the concept of direct ethanol production in cyanobacteria, the aim of this project was to express Pdc and Adh in the phototrophic microalga Chlamydomonas reinhardtii in order to generate ethanol (EtOH) in a eukaryotic system. C. reinhardtii (hereafter Chlamydomonas) was chosen, because this unicellular green alga is easy to cultivate up to high cell densities and well established for transformation. In general, however, the concept of EtOH production is applicable to all eukaryotic phototrophic algae as long as stable transformants can be generated. As gene source for PDC and Adh we chose Saccharomyces cerevisiae (Sc). This yeast has a very high fermentative activity; its genome is completely sequenced and well annotated (www.yeastgenome.org).

After cloning of ScPdc and ScAdh into eukaryotic expression vectors, Chlamydomonas was transformed [Kindle (1990) Proc Natl Acad Sci USA 87:1228]. After selection, transformation was confirmed via PCR. The expression of heterologous proteins was confirmed by immune staining (Western blotting). The production of EtOH was assayed via a coupled enzymatic test (as previously described for cyanobacteria).

Chlamydomonas Strains and Growth Conditions

Wild type Chlamydomonas strains (CC-1960, CC-620 and CC-621) were obtained from the Chlamydomonas Culture Collection at Duke University (www.chlamy.org). The cell wall deficient, arginine requiring strain (cw15 arg-) is a gift from Dr. Daniel Karcher, MPI-MP (Golm). Cells were grown at 25° C. in Tris-acetate-phosphate (TAP) medium [Harris (1989) The Chlamydomonas sourcebook: a comprehensive guide to biology and laboratory use. Academic Press, San Diego] on a rotary shaker (110 rpm) in continuous light (100 μE m−2 s−1). Arginine was added at 200 mg l−1 (TAP+R) when required. For solid media, 1.5% agar was used.

Pdc and Adh Genes

S. cerevisiae encodes three structural genes for Pdc of which Pdc1 is the most active [Hohmann and Cederberg (1990) Eur. J. Biochem. 188:615; Hohmann (1991) J. Bacteriol. 173:7963]. For Adh, there are four structural genes [Johnston and Carlson (1992) In: The molecular cell biology of the yeast Saccharomyces. Vol 2 pp. 193] of which Adh1 appears best suited for our purpose. It is Zn-dependent and catalyzes the forward reaction from acetaldehyde to EtOH with highest efficiency. Therefore, ScPDC1 and ScADH1 were chosen for expression in Chlamydomonas.

The nucleotide sequence of ScPDC1 is shown in FIG. 50A and the corresponding protein sequence in FIG. 50B. The nucleotide sequence of ScADH1 is depicted in FIG. 50C and the corresponding protein sequence in FIG. 50D.

Eukaryotic Promoter Systems (CYC6 and FEA1)

As eukaryotic promoters, inducible promoters were chosen in order to be able to control EtOH production and restrict production to specific growth phases.

Nucleotide Sequence of Pcyc6

The CYC6 gene of Chlamydomonas encodes cytochrome c6 (cyt c6). Gene expression is regulated by Pcyc6 (located upstream [−127 to −7] of the transcription start) and induced by copper starvation [Quinn and Merchant (1995) Plant Cell 7:623]. Pcyc6 (nucleotide sequence is shown in FIG. 50E) was obtained from the plasmid pXX311 (a gift from Prof. Peter Hegemann, Humboldt University Berlin).

Nucleotide Sequence of Pfea1

FEA1 and FEA2 encode two proteins which are secreted as an answer to iron deficiency by Chlamydomonas. They subsequently facilitate high affinity iron uptake [Merchant et al (2006) Biochin Biophys Acta 1763:578; Allen et al. (2007) Eukaryot Cell 6:1841]. The iron-responsive element, Pfea1 was obtained from the plasmid p5′FEA1-ARS2 [Allen et al. (2007) Eukaryot Cell 6:1841], purchased from the Chlamydomonas Center www.chlamy.org). The nucleotide sequence of FEA1 is shown in FIG. 50F.

Selectable Markers (ble and ARG7)

As selectable markers the introduction of antibiotic resistance as well as the recovery of auxotrophy for essential nutrients in metabolic mutants were used.

Nucleotide Sequence of the ble Marker

For selection on antibiotics the synthetic ble gene was used, which confers resistance against the antibiotics bleomycin/zeocin. (TAP agar supplemented with 5, 10, 15 or 20 μg zeocin ml−1 were used.) The marker gene ble was obtained from the plasmid pSP124S [Lumbreras et al. (1998) Plant J 14:441], purchased from the Chlamydomonas Center: www.chlamy.org). Capital letters in FIG. 50G represent the coding sequence.

Nucleotide Sequence of the ARG7 Marker

The ARG7 gene of Chlamydomonas encodes argininosuccinate lyase, the last enzyme in arginine biosynthetic pathway. For selection on nutrient-deficient plates, we used arg7 mutants that require exogenous arginine (gifts from Dr. Daniel Karcher, MPI-MP). Prior to transformation, cells were grown in TAP medium supplemented with arginine (TAP+R). The cells were transformed with a plasmid carrying the ARG7 gene and selected on TAP plates lacking exogenous arginine (for preparation of plates Sigma agar was used, because Bacto agar may contain traces of arginine).The ARG7 marker gene was obtained from the plasmid pXX311 (a gift from Prof. Peter Hegemann, Humboldt University Berlin). ARG7 was subcloned into the NotI/XbaI site of pBluescript II KS+ (pKS) to give ARG7_pKS, which was subsequently used for expression (see below). Capital letters in FIG. 50H represent the coding sequence.

Expression Plasmids (pSP124S, pXX311 and ARG7_pKS)
pSP124S

The plasmid pSP124S was purchased from the Chlamydomonas Center (www.chlamy.org). It contains the AmpR marker (bla) for selection in E. coli and the ble gene (see 1.5.1.) for selection in Chlamydomonas. The Chlamydomonas RbcS2 promoter and 3′ UTR (“untranslated region”) sequence were used as promoter and 3′UTR for BLE expression (shaded in grey in the nucleotide sequence below).

pSP124S was used for expression of ScPDC1 and ScADH1 and is schematically shown in FIG. 50I. The nucleotide sequence of pSP124S is depicted in FIG. 50-5B.

pXX311

The plasmid pXX311 was a gift from Prof. Peter Hegemann (Humboldt University Berlin). It contains an AmpR (bla) and a KmR marker for selection in E. coli and the ARG7 gene for selection in Chlamydomonas (arg mutants). The coding sequence of ARG7 is given above, 5′ regulatory (incl. promoter) and 3′ UTR sequences are shaded in grey in the pXX311 nucleotide sequence shown in FIG. 50L.

The original pXX311 plasmid contains luciferase as a reporter gene. This gene was deleted and ScPDC1 and ScADH1 were cloned behind the CYC6 promoter. A graphical representation of pXX311 is shown in FIG. 50K.

ARG7pKS

The commercial cloning vector pBluescript II contains the AmpR marker (bla) for selection in E. coli. For selection in Chlamydomonas, the ARG7 marker (derived from pXX311) was inserted between NotI and XbaI sites. Subsequently, ARG7_pKS was used for cloning of the double expression cassette containing ScPDC1 and ScADH1. A graphical representation of ARG7_pKS is shown in FIG. 50M.

Cloning Strategy

ScPDC1 and ScADH1 genes were PCR-amplified from yeast genomic DNA. For subsequent cloning steps, the forward primer carried a restriction site for XhoI, the reverse primer for BamHI.

(SEQ ID NO: 225) ScPDC1-XhoI-F catg ATGTCTGAAATTACTTTGGGTAA (SEQ ID NO: 226) ScPDC1-BamHI-R catg TTATTGCTTAGCGTTGGTAG (SEQ ID NO: 227) ScADH1-XhoI-F catg ATGTCTATCCCAGAAACTCAAA (SEQ ID NO: 228) ScADH1-BamHI-R catg TTATTTAGAAGTGTCAACAACGT

The promoters Pcyc6 and Pfea1 were PCR-amplified from the plasmids pXX311 and p5′FEA1-ARS2, respectively. For subsequent cloning steps, two PCRs were run for each construct: In the primary PCR, the forward primers carried a NotI restriction site. In the second PCR, the forward primers carried an additional SpeI restriction site. In both the first and second PCR, the same reverse primers, which carried an (endogenous) XhoI site, were used.

(SEQ ID NO: 229) Pcyc6-NotI-F CACTGAAGACTGGGATGAGC (SEQ ID NO: 230) Pcyc6-NotI-SpeI-F CACTGAAGACTGGGATG AGC (SEQ ID NO: 231) Pcyc6-XhoI-R CATGTTTATGGAGTAGG (SEQ ID NO: 232) Pfea1-NotI-F AGGACAGAGTGCGTGTGG (SEQ ID NO: 233) Pfea1-NotI-SpeI-F AGGACAGAGTGCGTGTGG (SEQ ID NO: 234) Pfea1-XhoI-R CATGGTTAACTGTG

The 3′UTR sequence (required for correct translation and protein assembly in eukaryotes) was PCR-amplified from the pXX311 plasmid. For subsequent cloning steps, the forward primer carried an (endogenous) BamHI restriction site. The reverse primer carried two restriction sites in tandem: XbaI and KpnI.

(SEQ ID NO: 235) 3′UTR-BamHI-F catg CCGCTCCGTGTA (SEQ ID NO: 236) 3′UTR-XbaI-KpnI-R catg CGCTTCAAATACGCCCAG

For intermediate cloning, the 3′UTR sequence was cloned into pBluescript II SK+ (pSK; BamHI/KpnI). All other PCR products were cloned into pJET1.2/blunt (Fermentas).

After cloning of ScPDC1 and ScADH1, they were subcloned in front of the 3′UTR sequence in pSK via NotI/BamHI (NotI sites derived from multi cloning sites of cloning vectors). For the sake of briefness, only one construct is illustrated in FIG. 50N. Other constructs were generated accordingly.

Afterwards, the respective promoter (with NotI/XhoI sites) was connected to the ScPDC13′UTR construct via NotI/XhoI restriction as shown in FIG. 50O. Similarly, the respective promoter (with NotI, SpeI/XhoI sites) was connected to the ScADH13′UTR construct. [Note: The gene of interest (ScPDC1) which will later be the first of two in a double expression cassette has to be linked with a promoter carrying NotI/XhoI sites, while the second (ScADH1) has to be linked with a promoter carrying NotI, SpeI/XhoI sites. The internal SpeI site will be lost during ligation of the two constructs.]

In order to have a double expression-construct for Pdc and Adh, the promoter-ScADH1-3′UTR cassette was excised via SpeI/XbaI and ligated into the XbaI site of the promoter-ScPDC-3′UTR construct as shown in FIG. 50P. SpeI and XbaI generate compatible ends, and, after ligation, both the SpeI and XbaI sites are lost. This way, the double expression-cassette could be excised by NotI/XbaI for the final cloning step. The correct orientation of the double expression cassette was verified by sequencing.

For the final cloning step, the double expression cassette was excised by NotI/XbaI and ligated into the NotI/SpeI site of the expression plasmid pSP124S (containing the ble gene) or into the NotI/SpeI site of ARG7_pKS.

In addition to the PDC-ADH double expression constructs the Pcyc6 ScPDC1 single construct was also cloned into pXX311. This was done to examine the effect of heterologous ScPDC in concert with endogenous CrADH. As described herein, results with cyanobacteria have shown that cells expressing only a foreign PDC and relying on their own ADH activity can generate significant amounts of EtOH.

The resulting expression plasmids are depicted in FIGS. 50Q, 50R, 50S, 50T and 50U respectively.

Transformation of Chlamydomonas

For transformation of Chlamydomonas, the glass bead method was used [Kindle (1990) Proc Natl Acad Sci USA 87:1228]. This method can only be applied to cells with a degenerated cell wall. This can either be achieved by a mutation (we used the cw15 mutants) or by treatment of wild type cells with autolysin. Prior to gene transfer, expression plasmids were linearized (XmnI).

Protocol for Transformation

1. Transformation of cw15 arg-cells with ARG7

    • 1) Inoculate 25 ml TAP+R with a loopful of cells and grow for 3 days
    • 2) Transfer 2 ml of the preculture to 150 ml fresh TAP+R, and grow the cells for 2 days (OD750=0.3 to 0.5)
    • 3) Collect cells by centrifugation
    • 4) Wash and resuspend cells in TAP, incubate for 2 h with gentle shaking.
    • 5) Collect the cells by centrifugation
    • 6) Resuspend the cells in 3 ml of TAP
    • 7) Glass beads transformation:
      • i. In a 1.5 ml tube that contains 4 ug of linearized DNA, add 300 ul of the cell suspension and 100 ul of 20% PEG8000
      • ii. Transfer the mixture into a glass tube that contains sterile 300 mg glass beads (0.5 um)
      • iii. Vortex at the top speed for 15 s
    • 8) Spread the cell suspension on 2 plates of TAP agar (1.5% sigma agar)

2. Transformation of cw15 arg-cells with ble

Steps 1)-3): same as 1

    • 4) Wash and resuspend cells in 3 ml of TAP+R
    • 5) Glass beads transformation
    • 6) Transfer the cells in a flask, add 10 ml of TAP+R, and shake for 1 day under the growth conditions
    • 7) Collect the cells by centrifugation
    • 8) Resuspend the cells in 1 ml of TAP+R
    • 9) Spread the cells on 4 plates of TAP+R agar (1.5% Bacto-Agar) that contain 5-20 μg/ml zeocin

3. Transformation of CC-1960 cells with ble

    • 1) Inoculate 25 ml TAP with a loopful of cells and grow for 3 days
    • 2) Transfer 2 ml of the preculture to 150 ml fresh TAP, and grow the cells for 2 days
    • 3) Collect the cells by centrifugation
    • 4) Wash and resuspend the cells in 25 ml of autolysin preparation (see below). Incubate for 1 h with gentle shaking.
    • 5) Wash and resuspend the cells in 3 ml TAP
    • 6) Glass beads transformation
    • 7) Transfer the cells in a flask, add 10 ml of TAP, and shake for 1 day under the growth conditions
    • 8) Centrifuge and resuspend the cells in 1 ml of TAP
    • 9) Spread the cells on 4 plates of TAP agar (1.5% Bacto-Agar) that contain 5-20 μg/ml zeocin

4. Preparation of Autolysin

    • 1) Cultivate the two different mating types of Chlamydomonas (CC-620 & CC-621) into early exponential phase (3×106 cells ml−1) (use 250 ml TAP medium in a 1 L flask)
    • 2) Collect cells and resuspend in TAP-N(NH4Cl was replaced with the same concentration of KCl) (use 1 L TAP-N in a 2 L flask)
    • 3) Shake gently under light for 24 h (induction of gamete formation)
    • 4) Harvest cells and resuspend each culture in 200 ml TAP-N
    • 5) Mix both cultures in a 2 L flask
    • 6) Keep the flask in the light without shaking for 1-2 h (mating)
    • 7) Remove the cells by centrifugation
    • 8) Freeze the supernatant (clued extract of autolysin) and store at −80° C.

Transformation of the Chlamydomonas wild type (strain CC-1960) and mutant strain cw15 arg (defective in cell wall and arginine biosynthesis) was carried out with the expression constructs listed below.

Expressed Selectable C. reinhardtii gene(s) Promoter marker Plasmid strain(s) ScPDC1 CYC6 ARG pKS cw15 arg ScADH1 (pXX311) ScPDC1 FEA1 ARG pKS cw15 arg ScADH1 (pXX311) ScPDC1 CYC6 BLE pSP124S CC-1960 & ScADH1 cw15 arg ScPDC1 FEA1 BLE pSP124S CC-1960 & ScADH1 cw15 arg ScPDC1 CYC6 ARG pXX311 cw15 arg

For all transformations, PCR positive colonies were obtained. The rate of positives, however, was significantly higher for the ARG marker (90% positives) than for the BLE marker (10% positives).

EtOH Production

EtOH production was assayed by an optic enzymatic test (as described herein). Cells were grown in TAP medium at 25° C. on a rotary shaker in continuous light. For transformants carrying the synthetic ble gene as a marker, zeocine (3 μg ml−1) was added to the medium. EtOH production was triggered by a transfer of cultures to TAP-Cu (for transformants carrying the CYC6 promoter) and TAP-Fe (for transformants carrying the FEA1 promoter), respectively.

The following table gives representative values for EtOH production in Chlamydomonas. These data are also depicted in the graph below. Non-induced transformants as well as non-transformed cells were run as control. A graphical representation of these data is given in FIG. 50V.

EtOH content [μM] of the cell-free medium 0 6 13 20 24 Time (d) Non-transformed wild type (CC1960) 0 30 10 25 20 [mean of 6 independent cultures] Non-transformed background strain 0 20 45 45 43 (cw15 arg) [mean of 4 independent cultures] Non-induced transformant (cw15 arg) 0 20 30 45 90 [pKS ARG Pcyc6 PDC ADH] [mean of 5 independent cultures] Time(d) after induction Induced transformant (cw15 arg) 0 40 80 150 225 [pKS ARG Pcyc6 PDC ADH] [mean of 6 independent cultures] Induced transformant (cw15 arg) 0 20 110 170 240 [pKS ARG Pfeal PDC ADH] [mean of 4 independent cultures]

The Chlamydomonas transformants pKS_ARG_Pcyc6_PDC_ADH and pKS_ARG_Pfea1_PDC_ADH, both generated in the cw15 arg background, produced significant amounts of extracellular ethanol after induction (i.e. copper depletion for pKS_ARG_Pcyc6_PDC_ADH transformants and iron depletion for pKS_ARG_Pfea1_PDC_ADH transformants). After 24 d, final concentrations of 225 and 240 μM ethanol were reached in the medium. The non-transformed control strains (wild type strain CC1960 as well as background strain cw15 arg) did not produce significant amounts of extracellular ethanol during the same time span. The level of extracellular ethanol in non-induced transformants remained on a baseline level for about 20 d, but started to increase after that. This is most likely due to self-induction of the culture after the onset of copper-/iron-depletion.

Compared to ethanol production in cyanobacteria, ethanol levels reached with Chlamydomonas transformants were rather low. This is most likely due to differences in the codon-usage of Chlamydomonas and Saccharomyces cerevisiae (donor organism for Pdc and Adh genes), resulting in a low expression of ScPDC and ScADH. While the green alga has a strong G/C-bias [Goldschmidt-Clermont (1991) Nucleic Acids Res 19: 4083-4089; Kindle and Sodeinde (1994) J. Appl. Phycol 6:231-238] the yeast genes exhibit only an average G/C-content. This would clearly impair expression of heterologous proteins in Chlamydomonas as also reported in other instances [Fuhrmann et al (1999) Plant J. 19: 353-361; Fuhrmann et al (2004) Plant Mol Biol 55: 869-881]. However, the use of endogenous Chlamydomonas promoters (CYC6 and FEA1) apparently supported protein expression to such a degree that ethanol production in transformants was clearly detectable. In the future, a focus will be on codon optimization of Pdc and Adh in order to promote protein expression in Chlamydomonas and thereby reach higher ethanol production in the green alga.

Detailed Description of Various Embodiments for Testing a Photoautotrophic Strain for a Desired Growth Property

In the following various detailed protocols for different tests to identify a photoautotrophic strain with a desired growth property we be explained:

Initial Ethanol Tolerance Test (Also Called Short Term Ethanol Tolerance Test) Method

    • testing of all strains for tolerance against ethanol by stepwise increasing of ethanol concentration in 5% steps up to an concentration of 20%
    • measurement of optical densities at certain points as well as microscopic analyses using a light/fluorescence microscope containing percentage estimation of ratio of living to death cells (using the red auto fluorescence of chlorophyll and actual conditions of cells like e.g. green colored or bleached). A photoautotrophic strain has passed this test if less than 50% of the cells were found to be bleached or lysed.
    • end concentrations of ethanol in the test can vary from 0.5 up to 20 percent (v/v), time of experiment can vary from 1 day up to 2 weeks

Protocol 1st Day:

    • 20 ml of culture are transferred into 100 ml Erlenmeyer flask
    • taking 1 ml culture for measuring start —OD (photometer by 750 nm)
    • adding 1 ml ethanol up to an end concentration of 5% ethanol in the culture
    • after 10 minutes at 5% ethanol end concentration taking 1 ml culture for measuring of OD
    • macroscopic observation of the culture by eyes as well as microscopic analysis (as described above)
    • adding 1 ml ethanol up to an end concentration of 10% ethanol in the culture.

2nd Day:

    • after 24 hours at 10% ethanol taking 1 ml culture for measuring of OD and microscopic analysis
    • adding 1 ml ethanol up to an end concentration of 15% ethanol in the culture

3rd Day:

    • after another 24 hours at 15% ethanol taking 1 ml culture for measuring of OD and microscopic analysis
    • adding 1 ml ethanol up to an end concentration of 20% ethanol in the culture
    • after 2 hours at 20% ethanol taking 1 ml culture for measuring of OD and microscopic analysis

If the OD750 was reduced >50% or if >50% of cells bleached or lysed (LM-microscope) at a certain ethanol concentration, the culture has failed the respective ethanol concentration. The result is given as the highest EtOH concentration that was passed by the strain.

Recultivation:

    • 20% ethanol cultures are transferred into a 50 ml Falcon-tube and harvested by centrifugation for 10 minutes at 3.000 rpm (about 3.000 to 4.000 g)
    • if strains are self-sedimenting, ethanol containing media is removed after self-sedimentation of cells
    • cell pellets are resuspended in 20 ml fresh media and transferred into 100 ml flasks
    • 1 ml is taken for measuring OD
    • cultures are cultivated for 72 hours and OD was measured again after 24, 48 and 72 hours respectively.

A photoautotrophic strains was found to be recultivable in the case that the optical density is rising in the 72 h after the cells were resuspended in fresh medium without ethanol after the short term ethanol test.

Exact Ethanol Tolerance Test Method

    • testing of all strains for tolerance against ethanol by continuous and fast increasing of ethanol concentration up to a concentration of 20% (v/v)
    • measurement of optical densities at certain points as well as microscopic analyses using a light/fluorescence microscope containing percentage estimation of ratio of living to death cells (using the red auto fluorescence of chlorophyll and actual conditions of cells like e.g. green colored or bleached)
    • end concentrations of ethanol in the test can vary from 2 up to 20 percent, time of experiment can vary from 6 hours up to 2 days
      Mic=abbreviation for microscopic analysis

1st Day:

    • 650 ml of culture were transferred into a 2 l Erlenmeyer flask
    • taking 1 ml culture for measuring of start —OD (photometer at 750 nm) and Mic as well as 50 ml for pyruvate determination and 50 ml for recultivation at the end of experiment
    • start of adding ethanol with MS-pumps to an end concentration of 10% ethanol in the culture after 18 h

2nd Day:

    • after 18 h when 10% were reached, taking 1 ml culture for measuring of OD and Mic, 50 ml for recultivation after 2 h and 50 ml for recultivation at the end of experiment
    • after 20 h recultivation of the 50 ml sample taken at 10% EtOH concentration
    • after 20.5 h when 15% were reached, taking 1 ml culture for measuring of OD and Mic, 50 ml for recultivation after 2 h and 50 ml for recultivation at the end of experiment
    • after 22.5 h recultivation of the 50 ml sample taken at 15% EtOH concentration
    • after 24 h when 20% are reached, taking 1 ml culture for measuring of OD and Mic, 50 ml for recultivation after 2 h and 50 ml for pyruvate determination
    • after 26 h recultivation of the 50 ml sample taken at 20% EtOH concentration

Long Term Ethanol Tolerance Test Method

    • testing of all strains for tolerance against ethanol in a long term test whereas the ethanol concentration is 0.2%, 0.5%, 1% or 5%
    • measurement of optical densities at certain points as well as microscopic analyses using a light/fluorescence microscope containing percentage estimation of ratio of living to death cells (using the red auto fluorescence of chlorophyll and actual conditions of cells like e.g. green colored or bleached).

Protocol

    • 20 ml of culture are transferred into two 100 ml Erlenmeyer flasks,
    • taking 1 ml culture for measuring start —OD (Spectrophotometer at 750 nm)
    • adding ethanol up to an end concentration of e.g. 1% and 5% ethanol in the culture
    • daily taking 1 ml culture for measuring of OD and analysis of the cells under fluorescence microscope
    • to keep the ethanol concentration constant, twice a week the ethanol concentration is analyzed and evaporation of ethanol is compensated by adding ethanol in appropriate volume
    • the evaporation of water is compensated by adding corresponding amounts of sterile water whenever necessary
    • The experiment is running as long as the culture is alive or growing and the result is documented in a growth curve (optical density versus time). Microscopic observations are noted.
    • A growth rate as well as the highest possible cell density can be determined also via determination of dry cell mass, determination of biovolume, counting of cell numbers beside the determination of optical density.

The long term ethanol tolerance experiment is ended when more than 50% of the cells as determined by light microscopy are bleached or lysed. A particular photoautotrophic strain is considered to have passed the long term ethanol tolerance test if it survived at least for 5 weeks with an ethanol concentration of 1% (v/v) in the growth medium.

Thermo Tolerance and Mechanical Stress Tolerance Test

Method

    • testing of all strains against higher temperature and mechanical stress tolerance

Protocol

    • 40 ml of culture are transferred into 100 ml Erlenmeyer flasks
    • for every culture 3 parallels at the same light conditions e.g. of 40 μE/m2*s are observed
      • Blind culture: 28° C. on shaker
      • Thermo stress: 45° C. on shaker
      • Mechanical stress: magnetic stirrer in culture flask under highest rotations (5.000 rpm; max. speed)
    • 1 ml sample is taken after 48 and 96 hours for measuring OD
    • these samples are also microscopically checked and observations are noticed
    • at the end of experiment macroscopic photos were taken
    • in case of non-unicellular cultures also microscopic photos were taken
      take samples after 48 and 96 h for OD750 nm and LM-microscopic analysis
    • compare growth of control culture to that of stressed cultures and evaluate the results as follows:
    • positive=same or faster growth of the stressed culture than growth of the control culture;
    • positive/negative results or indefinite results=slower growth of the stressed culture than control
    • negative result=death of the stressed culture (within these 4 days).

Test for Growth in Salty Medium

Freshwater strains are investigated for their ability to grow in marine medium.

    • dilute 25 ml BG11-grown cultures with 25 ml salty medium, resulting in a 0.5× salty medium for an initial adaptation of cells to increased salt levels
    • grow cells in 0.5× salty medium for one week
    • wash and cultivate cells in 1× salty medium (start—OD750 nm e.g. Synechocystis 1, 5-2)
    • parallel growth of the same culture in freshwater medium (same start—OD750 nm) for control
    • cultivate cells for 4 weeks; sampling two times a week: OD750 nm and chlorophyll content of cells
    • comparison of both growth curves of the stressed culture in salty medium and the control culture for analysis
      compare growth of control culture to that of stressed cultures and evaluate the results as follows:
    • positive=same or faster growth of the stressed culture than growth of the control culture;
    • positive/negative results or indefinite results=slower growth of the stressed culture than control
    • negative result=death of the stressed culture.

Salty medium can be prepared by mixing half of the ingredients of the BG-11 medium (see above) with 1 liter of artificial seawater and adding the trace element mix for BG-11 (see above).

Recipe for 1 l of artificial seawater:

Recipe for 1 l artificial seawater (28 ppm):

NaCl 28.05 g  MgSO4 6.90 g MgCl2 5.49 g KCl 0.67 g CaCl2 1.47 g

HPLC Analysis for Natural Product Content Protocol for Natural Product Extraction and Sample Preparation for HPLC/MS Analysis

    • 50 ml of cell culture (optical density around 1) is centrifuged, supernatant is discarded
    • cell pellet is resuspended in 2 ml 50% methanol and cells are broken by ultrasonic bar (ultrasonic treatment for 30 seconds at max. intensity, three times repeated)
    • extract is centrifuged (6000 rpm=about 6.000 g, 10 min, 4° C.), supernatant is transferred into a new tube
    • cell pellet is resuspended in 2 ml 50% methanol and cells are broken by ultrasonic bar as before
    • extract is centrifuged (6000 rpm, 10 min, 4° C.), supernatant is united with the first one
    • cell pellet is resuspended in 2 ml 80% methanol and cells are broken by ultrasonic bar as before
    • extract is centrifuged (6000 rpm, 10 min, 4° C.), supernatant united with the other ones
    • cell pellet is resuspended in 2 ml 80% methanol and cells are broken by ultrasonic bar as before
    • extract is centrifuged (6000 rpm, 10 min, 4° C.), supernatant united with the other ones
    • drying the supernatant in a vacuum rotator until pellet is dry
    • the pellet is resuspend in 1.6 ml 20% methanol, centrifuged at 4° C., 13000 rpm (about 15.000 g) and filtered (0.45 μm CA membrane)
    • HPLC/MS analysis (Detector: ELSD, PDA, MS)

Exact Growth Test Method

    • determination of growth speed and max. optical density
    • stepwise increase of light intensity and CO2 supplementation
    • samples are taken for analysis of metabolites at certain growth phases

Protocol

    • 500 ml of culture in 11 culture vessel:

height about 9 cm diameter about 11 cm volume of vessel  1 l used volume 500 ml
    • light conditions starts with 40pE/m2*s; culture conditions of 30° C. or 21° C. respectively. CO2 concentration starts with 2%
    • when growth becomes stationary light conditions are increased in 2 steps (120pE/m2*s and 220pE/m2*s)
    • daily taking samples of 1 ml for OD and microscopic observations, the evaporation is compensated by adding sterile water whenever necessary
    • a growth curve is drawn and the growth rate can be calculated (optical density versus time)
    • start optical density is about 0.2.
    • a growth rate as well as the highest possible cell density can be determined also via determination of dry cell mass, determination of biovolume, counting of cell numbers beside the determination of optical density.

Initial Growth Test Method/Protocol

    • Testing of all strains for growth in microtiter plates on a rotary shaker (between 6 or 96 well plates, preferred are 6 to 24 well plates due to the larger volume)
    • Measurement of optical density using a photometer plate reader at 750 nm.
    • growth rate can be determined also via determination of dry cell mass (only for 6 and 12 well plates), determination of biovolume, counting of cell numbers beside the determination of optical density.
    • strains which need more than 48 hours for doubling fail, others go to the next test.

Test for Photosynthetic Activity Measurement of Oxygen Generation of Strains in Different Growth Phases (Lag Phase, Log Phase, Stationary Phase) Using an Oxygen Electrode (Clark-Type Electrode):

Measurement of chlorophyll content of the cyanobacterial culture according to N. Tandeau De Marsac and J. Houmard (in: Methods in Enzymology, Vol. 169, 318-328. L. Packer, ed., Academic Press, 1988)

Centrifugation of the culture and resuspension of the cells in fresh BG11-Medium adjusting a chlorophyll concentration of about 10 μg/ml

Addition of 25 mM NaHCO3 as carbon source

Cultures are then filled into a 2.5 ml cuvette with an integrated Clark-electrode (oxygen electrode).

Measurement of oxygen generation using light saturated conditions (about 500 μE/m2×s) at 25° C. over the time and record of data using a chart recorder.

Calculation of oxygen generation using the following formula: oxygen rate in μmol O2 per h and μg chlorophyll=Δunits of measurement×0.253 μmol per ml×60/chlorophyll concentration in μg per ml×Δunits of calibration×Δt of measurement in min.

The Δunits are recorded by the chart recorder. The Δunits of calibration are determined by measuring the amplitude of difference of a O2 saturated water solution and a water solution without any O2 after adding of Sodium dithionite(zero point). That means Δunits of calibration correspond directly to the oxygen concentration of air-saturated water at 25° C. of 0.253 μmol per ml.

A photoautotrophic strain passes this test if a photosynthetic oxygen evolution of at least 150 μmol O2/h*mg chl can be detected.

Photometric Quantification of Chlorophyll in Cyanobacterial Cultures Chemicals and Solutions:

100% methanol (4° C.)

Principle of the Method:

Cyanobacterial cells are extracted with methanol (90%, v/v). The chlorophyll content in the extract is measured spectrophotometrically.

Method:

Batches of cyanobacteria cultures are centrifuged. The pellets are resuspended in 90% methanol, for example by leaving 100 μl of the supernatant and addition of 900 μl of 100% methanol. After resuspension and incubation (at 4° C., dim light, at least 1 hour) the sample is centrifuged and the absorbance of the supernatant is measured at 665 nm against methanol. The chlorophyll content of the methanol extract is calculated using equation:


A665×13.9=chlorophyll [μg/ml]

For the calculation of the chlorophyll content of the cyanobacteria culture the dilution factor has to be considered.

Using the above mentioned methods for testing the photoautotrophic strains, inter alia the following strains from the public databases Pasteur culture collection (PCC) or the Göttinger Algensammlung (SAG) have been identified, which are prime candidates for genetic modification due to their positive behavior during the above screening procedures:

SAG 37.79, PCC 7715, Calothrix thermalis

PCC 8937, Lyngbya sp.

SAG 12.89, Phormidium africanum

PCC 7321, Pleurocapsa sp.

PCC 6715, Synechococcus sp.

In particular these strains performed during the screening procedures as indicated in the below table:

Initial Exact Mechanical ethanol ethanol- Thermo stress tolerance tolerance Recul- tolerance tolerance Strain test test tivation test test SAG 12.89 up to up to up to pos. pos. 20% 20% 15% PCC 8937 up to up to pos. pos. 20% 20% PCC 7321 up to up to up to pos./neg. pos. 20% 20% 10% (2 h) SAG 37.79 up to neg. pos. 20% PCC 6715 up to up to up to pos. pos. 20% 20% 0%

Further examples of photoautotrophic strains which passed and failed the screening test are shown in FIG. 50-13.

Detailed description of embodiments related to adding a substrate to the growth medium of a growing culture, which is used by the at least one overexpressed enzyme for ethanol formation to produce ethanol:

Effect of Acetaldehyde on Ethanol Production by Cyanobacteria

Background: The bottle neck of the ethanol formation in the metabolism of our transgenic cyanobacteria has not been detected. Addition of pyruvate and 3-PGA to cyanobacteria expressing Pdc and Adh did not result in an increased ethanol production, but according to our experiments this metabolites of glycolysis were not absorbed by the cells. We now performed feeding experiments with acetaldehyde. The goal was to elucidate whether the ethanol production is limited solely by this immediate ethanol precursor, or by other factors, i.e. the availability of reduced co-substrates (NADH and/or NADPH).

Methods: Synechocystis PCC 6803 wild type and the transgenic strain “6803-pVZ-PisiA”, corresponding to the above described Synechocystis pVZ-PisiA-Pdc-AdhII, were washed twice with BG11 (centrifugation 15 min, 4500 rpm, 4° C.; Rotina 420R, Hettich) and re-dissolved in BG11. Aliquots of 2 ml were spiked with acetaldehyde. The assays were incubated at room temperature under illumination. Samples of 250 μl were removed in defined time intervals (5 min or 10 min) and centrifuged (3 min, 14000 rpm, room temperature, Micro 200R, Hettich). The supernatants were stored at −70° C., subsequently the ethanol content was measured.

Ethanol was quantified with a described protocol. The method is based on oxidation of ethanol catalyzed by alcohol dehydrogenase (Sigma, Adh of S. cerevisiae). NADH formed in this reaction, reacts with the PMS/MTT reagent to a dye. Its absorption (measured at 580 nm) is proportionate to the ethanol content of a sample.

Principle of Ethanol Quantification:

Ethanol is oxidized by nicotinamide-adenine dinucleotide (NAD+) to acetaldehyde in a reaction, which is catalyzed by the enzyme alcohol dehydrogenase (ADH) (reaction 1). The acetaldehyde, which is formed in the reaction, is quantitatively oxidized to acetic acid by the enzyme aldehyde dehydrogenase (Al-DH) (reaction 2).

In reactions (1) and (2) reduced nicotinamide-adenine dinucleotide (NADH) is formed. The amount of NADH formed is proportionate to the amount of ethanol in the sample. NADH is easily quantified by means of its light absorbance. The absorbance is usually measured at 340 nm, Hg 365 nm or Hg 334 nm.

Procedure:

Preparation of solutions: Solution 1: 1.3 mg/ml NAD and 0.27 U aldehyde dehydrogenase in potassium diphosphate buffer, pH 9.0. Solution 2: Suspension of alcohol dehydrogenase (ADH) with approx. 4000 U/ml. Alternatively, the chemicals and solutions of the ethanol determination kit of Boehringer Mannheim/R-Biopharm (Cat. No. 10 176 290 035) can be used. Sample and solution 1 are mixed in a ratio of 3 ml solution 1 and 0.1 ml sample (if necessary the sample is diluted with water). After approx. 3 min the absorbance is measured (A1). The reaction is then started by the addition of ADH suspension (solution 2, 0.050 ml for 3 ml solution 1 and 0.1 ml sample). After completion of the reaction (approx. 5 to 10 min) the absorbance is measured again (A2). The absorption measurements can be performed using a photometer or a microplate reader. For plate reader measurements all volumes are downscaled.

From the measured absorbance difference ΔA=(A2−A1) the ethanol concentration in the sample is calculated with the equation:

c = V × MG ɛ × d × v × 2 × 1000 × Δ A

c, ethanol concentration [g/L]; V, total volume [mL]; MG, molecular weight of ethanol (46.07 g/mol); e, extinction coefficient (6.3 L×mmol−1×cm−1 at 340 nm); d, light path [cm]; v, sample volume [mL]

Literature:

Protocol of the kit Ethanol, UV method for the determination of ethanol in foodstuff and other materials, Cat. No. 10176290035, R-Biopharm AG, Darmstadt, Germany.

H.-O. Beutler (1984) in: Methods in Enzymatic Analysis (Bergmeyer, H. U. ed.) 3rd ed. Vol. VI, pp. 598-606, Verlag Chemie, Weinheim, Germany.

Acetaldehyde was quantified by a modification of the protocol of a kit for ethanol quantification (Ethanol kit, R-Biopharm AG). Acetaldehyde is converted by aldehyde dehydrogenase under formation of NADH, which is quantified by its absorption at 340 nm. The amount is proportionate to the acetaldehyde content of the sample.

For preparation of crude extracts, cells were harvested, washed with 40 mM MES/Tris (pH 6.5), 1 mM DTT and broken (beadbeater, 2×10 min). The supernatant of a centrifugation (15 min, 14000 rpm, 4° C., Micro 200R, Hettich) was used for the determination of Adh activity in cells.

Assays for measurement of the Adh activity in the direction of ethanol formation contained in a total volume of 800 μl 40 mM MES adjusted with Tris base to pH 6.5, 1 mM DTT, different concentrations of acetaldehyde, 50 μl crude extract and 0.3 M NADH. The initial velocity was calculated from the dE/min at 340 nm.

Results: Addition of acetaldehyde to final concentrations in the range of 6.6 μM to 200 μM resulted in an increase of ethanol in the medium of cultures of the transgenic strain 6803-pVZ-PisiA. The rates of ethanol production per minute were linear at the beginning of the experiment (for at least 30 min), but finally decelerated, obviously because of the expiration of the supply of acetaldehyde (FIG. 51A).

In FIG. 51A, ethanol production is measured after addition of acetaldehyde. Different concentrations were added to a culture of strain 6803pVZPisiA and the ethanol content in the medium was measured for 60 minutes.

A plot of the initial velocity of the ethanol production versus the substrate concentration resulted in a graph similar to the substrate saturation curves of enzymes with Michaelis-Menten kinetics (FIG. 51B). Km and Vmax were calculated from a “Lineweaver-Burk” plot (1/v versus 1/[S]; FIG. 6) with Km for acetaldehyde=18 μM and Vmax=3.2 μMol L−1 min−1. OD750 of the culture was 0.56.

FIG. 51B presents a correlation of ethanol production rate and acetaldehyde concentration. Given are the initial ethanol rates (calculated with FIG. 4) in correlation to the initial acetaldehyde concentrations.

FIG. 51C presents a Lineweaver-Burk-Plot. Reciprocal of the initial velocity versus the reciprocal of the acetaldehyde concentration. Intact cells were used.

This experiment was repeated with a different culture of strain 6803-pVZ-PisiA-PDC/ADHII of OD750 of 1.353 and a chlorophyll concentration of 4.6 μg/ml. Similar results were obtained. The Km for acetaldehyde was calculated with 25 μM (FIG. 51D). Vmax was 4.35 μMol L−1 min−1, or 0.95 μMol L−1 mg−1 using chlorophyll as reference.

FIG. 51D presents a Lineweaver-Burk-Plot in which the reciprocal of the initial velocity versus the reciprocal of the acetaldehyde concentration. The results shown are from a repeat of the experiment with intact cells summarized in FIG. 51A to 51C.

In order to compare the dates acquired with intact cells, the kinetic constants of alcohol dehydrogenase in crude extracts of strain 6803-pVZ-PisiA-PDC/ADHII were measured. The measurements were carried out in the direction of ethanol formation at pH 6.5, following a protocol in the literature. A graphical representation of the results obtained is given in form of a “Lineweaver-Burk” plot (FIG. 8). The Km for acetaldehyde was calculated with 45 μM and Vmax was 7.2 μMol L−1 mg−1 chlorophyll.

In a second experiment the Adh activity was measured at pH 7.5. NADH and NADPH were used as co-substrates. Activity was not significantly different for NADH and NADPH in the concentrations used (NADH 0.25 M, NADPH 0.21 M final concentration). The Vmax was calculated with 0.89 μMol L−1 mg−1 chlorophyll, the Km for acetaldehyde was determined in this experiment with 100 μM (FIG. 9).

FIG. 51E presents a Lineweaver-Burk-Plot In which Adh activities of a crude extract of strain 6803pVZ-PisiA-PDC/ADHII were measured in presence of different concentration of acetaldehyde. In contrast to the experiments with intact cells in this experiment NADH was added in excess. Shown is the reciprocal of the initial velocity versus reciprocal of the concentration of acetaldehyde.

FIG. 51F is a Lineweaver-Burk-Plot. Similar to the experiment summarized in FIG. 51E Adh activities of a crude extract of strain 6803PVZPisiA were measured in the presence of different concentrations of acetaldehyde. The assays contained an over excess either of NADH or of NADPH. Substantial differences between NADH (squares) and NADPH (diamonds) were not observed.

Summary: Acetaldehyde added to the medium is absorbed and converted into ethanol by intact cells. The Km for acetaldehyde of the entire process of uptake and ethanol formation was determined with approx. 20 to 25 μM. This value is similar to the Km for acetaldehyde of the purified AHDII of Z. mobilis, measured at pH 6.5. The correlation of the rate of ethanol formation and the acetaldehyde concentration clearly shows that the ethanol formation is to a larger extent limited by the availability acetaldehyde. Maximum ethanol formation rates were obtained with 200 μM acetaldehyde. When acetaldehyde was added in significant higher concentration, we tested the range of 1 mM to 10 mM, a decrease of ethanol formation was observed. It is assumed, that the acetaldehyde, which is very reactive, is in higher concentrations rapidly poisoning the cells.

The scope of protection of the invention is not limited to the examples given hereinabove. The invention is embodied in each novel characteristic and each combination of characteristics, which particularly includes every combination of any features which are stated in the claims, even if this feature or this combination of features is not explicitly stated in the claims or in the examples.

Claims

1. A genetically modified photoautotrophic, ethanol producing host cell comprising:

a coding nucleic acid sequence comprising a promoter and a gene encoding at least one overexpressed enzyme for the formation of ethanol under the transcriptional control of the promoter, wherein
the promoter can be induced by nutrient starvation, oxidative stress, darkness, heat shock, cold shock, salt stress or stationary growth of the host cell.

2. The genetically modified host cell according to claim 1, wherein

the promoter is selected from a group of promoters consisting of:
ntcA, nblA, isiA, petJ, petE, sigB, lrtA, htpG, ggpS, psaA, psbA2, hspA, clpB1, hliB and crhC, psbA.

3. The genetically modified host cell according to claim 1, wherein the promoter is a heterologous promoter.

4. The genetically modified host cell according to claim 1, wherein the promoter is an endogenous promoter.

5. The genetically modified host cell according to claim 1, wherein the promoter is synechocystis PpetJ.

6. The genetically modified host cell according to claim 1, wherein the promoter is Anabena PpetE.

7. The genetically modified host cell according to claim 1, wherein the promoter is a heterologous promoter and one overexpressed enzyme for the formation of ethanol is a gene encoding an alcohol dehydrogenase, which directly converts acetyl-CoA to ethanol, wherein the gene is under the transcriptional control of the heterologous promoter.

8. The genetically modified host cell according to claim 1, wherein the promoter is PpetJ and induction occurs at night time.

9. A construct for the transformation of a photoautotrophic host cell, comprising:

a coding nucleic acid sequence comprising a promoter, which can be induced by nutrient starvation of the host cell, and
a gene encoding at least one overexpressed enzyme for the formation of ethanol under the transcriptional control of the promoter.

10. The construct according to claim 8, wherein

the coding nucleic acid sequence is flanked at its 5′ and 3′ end by nucleic acid sequences, which are able to bind to at least parts of said host genome for integration of the coding sequence into the host genome.
Patent History
Publication number: 20100297736
Type: Application
Filed: Aug 6, 2010
Publication Date: Nov 25, 2010
Applicant: ALGENOL BIOFUELS, INC. (Bonita Springs, FL)
Inventors: ULF DUHRING (FREDERSDORF), HEIKE ENKE (BERLIN), DAN KRAMER (BERLIN), CRAIG R. SMITH (NAPLES, FL), R. PAUL WOODS (NAPLES, FL), KERSTIN BAIER (KLEINMACHNOW), CHRISTINE OESTERHELT (BERLIN)
Application Number: 12/851,712