GENETIC TEST FOR LIVER COPPER ACCUMULATION IN DOGS AND LOW COPPER PET DIET

Abstract

The present invention provides a method of testing a dog to determine the likelihood that the dog is protected from liver copper accumulation, comprising detecting in a sample the presence or absence in the genome of the dog of one or more polymorphisms selected from (a) SNP ATP7a_Reg3_F_6 (SEQ ID NO:142) and (b) one or more polymorphisms in linkage disequilibrium with (a).

Description

FIELD OF THE INVENTION

The invention relates to a method of determining the likelihood that a dog is protected from liver copper accumulation and from copper-associated liver disease. The invention also relates to a foodstuff for dogs for use in preventing liver copper accumulation and copper-associated liver disease in a dog and a method of making the foodstuff.

BACKGROUND OF THE INVENTION

Although liver diseases are uncommon in dogs, one of its most common forms is chronic hepatitis (CH). CH is a histologic diagnosis, characterised by the presence of fibrosis, inflammation, and hepatocellular apoptosis and necrosis. Cirrhosis can result as the end stage of the disease. One of the causes of CH is hepatic copper accumulation. Hepatic copper accumulation can result from increased uptake of copper, a primary metabolic defect in hepatic copper metabolism, or from altered biliary excretion of copper. In the latter case, copper toxicity is secondary to hepatic inflammation, fibrosis, and cholestasis, although it is unclear to what extent this occurs in the dog. In secondary copper storage disease, copper accumulation is mainly restricted to periportal parenchyma and hepatic copper concentrations are lower than accumulation in familial storage diseases. Whilst, the nature of the initiating factor(s) and of the sensitizing antigen is unknown, immunological abnormalities and morphologic features observed in primary biliary cirrhosis are concurrent with an immune mediated mechanism.

The small intestine is recognized as the main site of dietary copper absorption in mammals. Transport from the intestinal lumen into intestinal mucosa is a carrier-mediated process involving a saturable transport component. Once in mucosal cells, approximately 80% of the newly absorbed copper is in the cytosol, mainly bound to metallothioneins (MT). These are low molecular weight inducible proteins with many functions including homeostasis, storage, transport and detoxification of metals. After passage through the enterocytes, copper enters the portal circulation where it is bound to carrier proteins peptides and amino acids and is transported to the liver with lesser amounts entering the kidney. In most mammals, copper is excreted easily, and the main route of excretion of copper is the bile.

The genetic basis for hepatic copper accumulation is unknown. This is made difficult by the fact that copper is involved in numerous different biological pathways, each of which is highly complex and involves a large number of genes. Dogs with excessive hepatic copper accumulation are typically treated with D-penicillamine, a potent copper chelator. Ultimately however, the most successful treatment available for dogs with CH is liver transplantation.

WO 2009/044152 A2 discloses a method of determining the susceptibility of a dog to liver copper accumulation comprising detecting the presence or absence of (a) a polymorphism in the GOLGA5, ATP7a or UBL5 gene of the dog that is indicative of susceptibility to copper accumulation and/or (b) a polymorphism in linkage disequilibrium with a said polymorphism (a), and thereby determining the susceptibility of the dog to liver copper accumulation. International application no. PCT/GB09/02355 (not yet published) discloses further polymorphisms for use in a method of determining the susceptibility of a dog to liver copper accumulation.

SUMMARY OF THE INVENTION

The inventors have discovered a coding mutation in the canine ATP7A gene that is associated with low levels of liver copper in dogs and therefore indicative of protection from liver copper accumulation. The mutation is a single nucleotide polymorphism (SNP) that causes an amino acid change in the protein. In a study described herein, the polymorphism has been shown to have a functional impact on copper transport in cells. The discovery of this polymorphism in the ATP7A gene provides the basis for a test to predict whether a dog is protected from liver copper accumulation by screening for this polymorphism and/or one or more polymorphisms in linkage disequilibrium with this polymorphism.

The inventors also recently discovered that polymorphisms in or in the region of the canine GOLGA5, ATP7A and UBL5 genes that are associated with high levels of liver copper in dogs and therefore indicative of susceptibility to liver copper accumulation (WO 2009/044152 A2 and unpublished International application no. PCT/GB09/02355). Therefore, a genetic test which combines the results of detecting one or more polymorphisms indicative of protection from liver copper accumulation with the results of detecting one or more polymorphisms indicative of susceptibility to liver copper accumulation in dogs would be particularly informative with regards to the likelihood that a dog is at risk of liver copper accumulation.

The accumulation of copper in the liver of a dog may lead to one or more diseases or conditions of the liver that are attributable to high liver copper. For example, high liver copper can lead to chronic hepatitis, liver cirrhosis and ultimately liver failure. The invention thus enables dogs to be identified which are not protected from, or are at risk of developing, such liver diseases or conditions that are associated with high copper. Once a dog has been identified has not having a mutation indicative of protection from liver copper accumulation, it is possible to identify suitable preventative measures for that dog, with the aim of maintaining the liver copper level at a low or normal level, such as by administering the foodstuff of the invention. Furthermore, dogs that are identified as having mutations associated with protection from liver copper accumulation are ideal for use in breeding programs with the aim of producing dogs that are less likely to suffer from liver disease or other conditions associated with high copper.

Thus, the invention provides a method of testing a dog to determine the likelihood that the dog is protected from liver copper accumulation, comprising detecting in a sample the presence or absence in the genome of the dog of one or more polymorphisms selected from (a) SNP ATP7a_Reg3_F_—6 (SEQ ID NO:142) and (b) one or more polymorphisms in linkage disequilibrium with (a).

The invention also provides:

a database comprising information relating to SNP ATP7a Reg3_F_—6 (SEQ ID NO:142) and/or one or more polymorphisms in linkage disequilibrium thereof and their association with the protection of a dog from liver copper accumulation;

a method of determining the likelihood that a dog is protected from liver copper accumulation, the method comprising:

• • (a) inputting to a computer system data concerning the presence or absence in the genome of the dog of a polymorphism as defined herein;
  • (b) comparing the data to a computer database, which database comprises information relating to said polymorphisms and their association with the protection of a dog from, or susceptibility of a dog to, liver copper accumulation; and
  • (c) determining on the basis of the comparison the likelihood that the dog is protected from liver copper accumulation;

a computer program comprising program code means that, when executed on a computer system, instruct the computer system to perform a method of the invention;

a computer storage medium comprising the computer program of the invention and the database of the invention;

a computer system arranged to perform a method of the invention comprising:

• • (a) means for receiving data concerning the presence or absence in the genome of the dog of a polymorphism as defined herein;
  • (b) a database comprising information relating to said polymorphisms and/or one or more polymorphisms in linkage disequilibrium thereof and their association with the protection of a dog from, or susceptibility of a dog to, liver copper accumulation;
  • (c) a module for comparing the data with the database; and means for determining on the basis of said comparison the likelihood that the dog is protected from liver copper accumulation;

a method of determining the likelihood that a dog is protected from liver copper accumulation, comprising detecting the presence or absence in the genome of the dog of one or more polymorphisms selected from (a) SNP ATP7a_Reg3_F_—6 (SEQ ID NO:142) and (b) one or more polymorphisms in linkage disequilibrium with (a);

use of a polymorphism as defined herein for determining the protection of a dog from liver copper accumulation; and

a method of selecting a dog for producing offspring likely to be protected from liver copper accumulation comprising:

• • determining whether the genome of a candidate first dog comprises one or more polymorphisms indicative of protection from liver copper accumulation according to the invention; and thereby determining whether the candidate first dog is suitable for producing offspring likely to be protected from liver copper accumulation;
  • optionally, determining whether the genome of a second dog of the opposite sex to the first dog comprises one or more polymorphisms indicative of protection from liver copper accumulation according to the invention; and

optionally, mating the first dog with the second dog in order to produce offspring likely to be protected from liver copper accumulation.

Further, and surprisingly, the inventors found a foodstuff which is more effective in reducing hepatic copper concentration in Labrador Retrievers than the use of the drug penicillamine. This foodstuff is therefore useful in preventing liver copper accumulation in dogs of the Labrador Retriever breed and can be used for preventing a disease or condition associated with high liver copper such as chronic hepatitis, cirrhosis and liver failure.

Accordingly, the present invention also provides a foodstuff comprising copper at a concentration of from 4.5 to 12 mg/kg dry matter for use in a method of preventing a disease attributable to liver copper accumulation in a dog having genetic inheritance of the Labrador Retriever breed, preferably wherein the likelihood that the dog is protected from liver copper accumulation has been determined by a method of the invention.

The present invention further provides:

a method of preventing a disease attributable to liver copper accumulation in a dog having genetic inheritance of the Labrador Retriever breed, preferably wherein the likelihood that the dog is protected from liver copper accumulation has been determined by a method of the invention, the method comprising feeding the dog a foodstuff of the invention;

use of copper in the manufacture of a foodstuff for a dog having genetic inheritance of the Labrador Retriever breed, preferably wherein the likelihood that the dog is protected from liver copper accumulation has been determined by a method of the invention, wherein the foodstuff comprises copper at a concentration of from 4.5 to 12 mg/kg dry matter and is for use in preventing a disease attributable to liver copper accumulation in said dog;

a pack comprising a foodstuff having copper at a concentration of from 4.5 to 12 mg/kg dry matter and a zinc supplement for providing a concentration of at least 120 mg/kg dry matter for simultaneous, separate or sequential use in preventing a disease attributable to liver copper accumulation in a dog having genetic inheritance of the Labrador Retriever breed, preferably wherein the likelihood that the dog is protected from liver copper accumulation has been determined by a method of the invention; and

a labelled foodstuff of the invention or labelled pack of the invention.

BRIEF DESCRIPTION OF THE FIGURES

FIG. 1 illustrates the progression of hepatic copper accumulation without treatment. The Figure shows hepatic copper concentrations (mg/kg dry weight) of 11 Labrador Retrievers at two examinations 8.7 months (range 6-15 months) apart, prior to any treatment. During this time all animals were fed their usual maintenance diet, which according to the manufacturers contained dietary copper concentrations between 12-25 mg/kg on a dry matter basis and zinc concentrations between 80-270 mg/kg on a dry matter basis. The diamond symbols represent outliers.

FIG. 2 illustrates hepatic copper concentrations (mg/kg dry weight) of 24 Labrador Retrievers at the beginning of the study and at 2 control examinations during dietary management. The dogs were divided into two groups as follows: group 1=diet+zinc gluconate tablets, group 2=diet+placebo. The key to the x-axis numbering is as follows: 1+2=before treatment, 3+4=recheck 1 (first control examination after 8 months (range 5-13 months)), 5+6=recheck 2 (second control examination after 16 months (range 12-25 months)). The numbers of dogs tested are as follows: 1: N=12 dogs in group 1, 2: N=12 dogs in group 2, 3: N=9 dogs in group 1, 4: N=12 dogs in group 2, 5: N=6 dogs in group 1, 6: N=10 dogs in group 2. The diamond symbols represent outliers. The dotted line represents the normal level of hepatic copper for adult dogs.

FIG. 3 illustrates the effectiveness of the diet of the invention on hepatic copper concentrations (mg/kg dry weight) in 18 Labrador Retrievers compared with the effect of penicillamine alone. The key to the x-axis is as follows: 1=pre-penicillamine, 2=post-penicillamine/pre-food, 3=post-food. The progression along the x-axis from 1 to 2 demonstrates the penicillamine effect, whilst the progression from 2 to 3 demonstrates the food effect. The dotted line represents the normal level of hepatic copper for adult dogs.

FIG. 4 illustrates schematically embodiments of functional components arranged to carry out the present invention.

FIG. 5 depicts the average copper levels by gender and ATP7A genotype in Labrador Retrievers (data of Table VII). The y-axis is dry liver weight copper (mg/kg). The x-axis is ATP7A genotype: from left to right, the first three are for the female dogs in the study and the last two are for the male dogs in the study. Error bars are standard error.

FIG. 6 is a box-plot of copper-histological scores by gender and ATP7A genotype in Labrador Retrievers (data of Table VII). The y-axis is the copper histological score values. The x-axis is ATP7A genotype: from left to right, the first three are for the female dogs in the study and the last two are for the male dogs in the study. The kruskal-walis p-value is 0.000396.

FIGS. 7A and 7B show copper isotope measurements in canine primary fibroblast cells. Copper isotope (64Cu) measurements in ATP7A^C/C, ATP7A^C/T and ATP7A^T/T cells after (A) 24 h or 48 h incubation with 10 μM, 50 μM and 100 μM 64Cu, or (B) 24 hrs incubation, followed by extensive washing and incubation in non copper isotope media for 2 h. Gamma-counts were corrected for cell culture conditions by means of a protein and MTS assay. Data points for 24 hr incubation represent the mean+/−SEM from two independent experiments performed in duplicate and expressed as counts per minute (cpm) of total cell protein. Other data points represent mean+/−SEM from one experiment in duplicate.

FIGS. 7C and 7D show copper isotope measurements in human primary fibroblast cells. Copper isotope (64Cu) measurements in primary fibroblast cells derived from a Menkes patient or a non Menkes patient (control), after (C) 24 h or 48 h incubation with 10 μM, 50 μM and 100 μM 64Cu, or (D) 24 hrs incubation, followed by extensive washing and incubation in non copper isotope media for 2 h. Gamma-counts were corrected for cell culture conditions by means of a protein assay. Data points are expressed as (A) and (B).

FIG. 8 shows gene expression levels of ATP7A in canine primary fibroblast cells. (A) ATP7A^C/C, ATP7A^C/T and ATP7A^T/T cells were untreated (top graph) or incubated in the presence of 100 μM copper for 24 h (bottom graph) prior to qPCR analysis of the 3′ (ATP7Aiii) region, 5′ (ATP7Aii) region or region overlapping the mutation (ATP7Ai). Data depicts mean+/−SD from two independent experiments performed in triplicate wells. (B) Western blot analysis of ATP7A expression. Cells were left untreated (-), incubated with 100 μM BCS, or 100 μM copper for 24 hrs. Samples were lysed and protein was subsequently resolved on a 12% SDS-PAGE gel and immunoblotted with chicken anti-ATP7A (1:2000 dilution) for 1 h. The membrane was then incubated with goat anti-chicken Ig HRP-conjugated antibody (1:10,000 dilution) for a further 1 h and then developed using ECL™ western blotting detection reagents. The membrane was stripped and re-probed with β-tubulin (1:20,000 dilution) to ensure equal loading. Arrows indicate expected full-length protein.

FIG. 9 provides the gene expression levels of metallothionein in canine primary fibroblast cells. ATP7A^C/C, ATP7A^C/T and ATP7A^T/T cells were incubated in the presence of 1, 10 or 100 μM copper or left untreated (UT) for 24 h and subjected to qPCR analysis of the metallothionein gene. FIG. 9(A) depicts fold change compared to UT ATP7A^C/C with 95% confidence interval (CI), (B) depicts fold change compared to UT ATP7Ag^genotype expression with 95% CI, and (C) depicts log 10 expression level with 95% confidence interval (CI). In (C), the top line in the graph is for genotype ATP7A^T/T, the middle line is for ATP7A^C/T, and the lower line is for ATP7A^C/C.

FIG. 10 illustrates gene expression levels of metallothionein in canine intestine and liver tissue. (A) Liver and (B) small intestine tissue was extracted from dogs expressing ATP7A^C/C, ATP7A^C/T or ATP7A^T/T ATP7A and subjected to qPCR analysis of the metallothionein gene. Data depicts mean of the log 10 expression level and 95% CI from 5 independent experiments (right panels) and fold change with 95% CI compared to ATP7A^C/C.

FIG. 11 is characterization of copper-mediated trafficking of ATP7A protein. ATP7A^C/C (left panel) and ATP7A^T/T (right panel) cells were grown on glass slides in the presence of 100 μM BCS for 18 h, prior to washing and incubation with 100 μM copper for 1, 2 or 3 h in the culture media. Cells were fixed, and stained with anti-ATP7A (first column in each panel) and anti-58K (second column in each panel) antibodies, and processed for triple label indirect microscopy prior to visualisation using epifluorescence microscopy. Images of ATP7A and 58K are merged to depict overlapping regions regions (third column in each panel).

BRIEF DESCRIPTION OF THE SEQUENCES

SEQ ID NOs: 1 to 143 show the polynucleotide sequences encompassing the SNPs of the invention.

SEQ ID NOs: 144 to 159 are primer sequences.

DETAILED DESCRIPTION OF THE INVENTION

Identifying Protection from or Susceptibility to Liver Copper Accumulation

Accumulation of copper in the liver leads to liver disease in a number of dog breeds, including the Labrador Retriever, Doberman Pinscher, German Shepherd, Keeshond, Cocker Spaniel, West Highland White Terrier, Bedlington Terrier, and Skye Terrier. The mean copper concentration in the liver of normal dogs of any breed is 200 to 400 mg/kg on a dry weight basis, although newborns generally have higher liver copper concentrations. The amount of copper in the liver of a dog may be measured by biopsy.

A dog that is protected from liver copper accumulation has a low risk or likelihood of accumulating liver copper such that its liver copper concentration is less likely to reach a level above 400 mg/kg on a dry weight basis. The liver copper concentration of a dog that is protected from liver copper accumulation will be below 600 mg/kg, for example below 500 mg/kg, below 400 mg/kg, or below 300 mg/kg. Determining the likelihood that a dog is protected from liver copper accumulation according to the invention involves determining the likelihood that the dog will accumulate liver copper to a level below 600 mg/kg, for example below 500 mg/kg, below 400 mg/kg, or below 300 mg/kg.

A dog that is susceptible to liver copper accumulation has a tendency to accumulate copper such that its liver copper concentration reaches a level above 400 mg/kg on a dry weight basis. Determining the risk or likelihood that a dog is susceptible to liver copper accumulation involves determining the risk or likelihood that the dog will accumulate liver copper to a level above 400 mg/kg, for example above above 600 mg/kg, above 800 mg/kg, above 1000 mg/kg, above 1500 mg/kg, above 2000 mg/kg, above 5000 mg/kg, or above 10000 mg/kg.

The accumulation of liver copper may be assessed by histochemistry. For example, liver copper concentration may be semiquantitatively assessed by histochemistry using the rubeanic acid staining technique for evaluation of copper distribution as previously described (Van den Ingh et al., (1988) Vet Q 10: 84-89). The concentration may be graded in a scale of 0 to 5 as follows: 0=no copper present; 1=solitary liver cells and/or reticulohistiocytic (RHS) cells containing some copper positive granules; 2=small groups of liver cells and/or RHS cells containing small to moderate numbers of copper positive granules; 3=larger groups or areas of liver cells and/or RHS cells containing moderate numbers of copper positive granules; 4=large areas of liver cells and/or RHS cells with many copper positive granules; and 5=diffuse presence of liver cells and/or RHS cells with many copper positive granules. According to this grading system, copper scores above 2 are abnormal.

Therefore determining the likelihood that a dog is protected from liver copper accumulation according to the invention can involve determining the likelihood that the dog would be given a score of less than or equal to 3, for example less than or equal to 2.5, 2, 1.5, or less than or equal to 1, using the grading system described in Van den Ingh et al. Determining the risk or likelihood that a dog is susceptible to liver copper accumulation can involve determining the risk or likelihood that the dog would be given a score of greater than or equal to 2, for example greater than or equal to 2.5, 3, 3.5, or greater than or equal to 4, using the grading system described in Van den Ingh et al.

The likelihood of protection or risk of susceptibility may for example be expressed as a risk factor, percentage or probability. It may be possible to determine whether or not a dog will accumulate copper to the levels described above. For example, the method of determining the likelihood of protection from liver copper accumulation may comprise determining whether or not a dog will accumulate copper to a level above 400 mg/kg.

Accumulation of liver copper to a level above 400 mg/kg is associated with liver disease and may ultimately lead to liver failure. Therefore, determining whether the genome of a dog comprises one or more polymorphisms indicative of protection from liver copper accumulation indicates that the dog is less likely to develop a disease or condition attributable to liver copper accumulation such as chronic hepatitis, cirrhosis and liver failure. Conversely, determining whether the genome of a dog comprises one or more polymorphisms indicative of susceptibility to liver copper accumulation indicates the susceptibility of the dog to such a disease or condition. Therefore, the invention provides a method of testing for the susceptibility of a dog to, or the likelihood of protection of a dog from, a disease associated with liver copper accumulation, such as chronic hepatitis, cirrhosis and liver failure.

Polymorphisms and Indication of Susceptibility to, or Protection from, Copper Accumulation

The inventors have surprisingly discovered a polymorphism affecting the protein sequence of ATP7A that is indicative of protection from liver copper accumulation, as opposed to being indicative of susceptibility to liver copper accumulation (Examples 2 to 5). The polymorphism changes the protein sequence at amino acid 328 of the ATP7A gene from a Threonine to an Isoleucine. In vitro experiments have determined that the mutation has a large functional effect on the protein (Example 5). The experiments have revealed that the rate of accumulation of copper is greater in cells expressing the mutated form of the protein; accumulation is greater during copper exposure and release is slower after copper exposure. In addition, intracellular ATP7A movement in response to copper exposure is altered in cells carrying the mutation. There is also increased expression of a copper transport protein in cells carrying the mutation. Expression levels of ATP7A are not altered between cells carrying the two forms. The ATP7A coding mutation therefore has a significant effect on the function of the protein.

The present invention therefore relates to a method of determining whether the genome of a dog comprises one or more polymorphisms indicative of protection from liver copper accumulation. In particular, the present invention provides a method of determining the likelihood that a dog is protected from liver copper accumulation comprising detecting the presence or absence in the genome of the dog of one or more polymorphisms selected from (a) SNP ATP7a_Reg3_F_—6 (position 102 of SEQ ID NO:142) and (b) one or more polymorphisms in linkage disequilibrium with (a).

The phrase “detecting the presence or absence of a polymorphism” typically means determining whether a polymorphism is present in the genome of the dog. Polymorphisms include Single Nucleotide Polymorphisms (SNP), microsatellite polymorphisms, insertion polymorphisms and deletion polymorphisms. Preferably the polymorphism is a SNP. Detecting the presence or absence of a SNP means genotyping the SNP or typing the nucleotide(s) present in the genome of the dog for the SNP. Typically, the nucleotide present at the same position on both homologous chromosomes will be determined. A dog may therefore be determined to be homozygous for a first allele, heterozygous or homozygous for a second allele of the SNP.

Determining a phenotype of an individual, such as the susceptibility of the individual to, or the protection of the individual from, a disease or condition, is not limited to the detection of a polymorphism that is causal for the disease or condition. In genetic mapping studies, genetic variation at a set of marker loci in a sample of individuals is tested for association with a given phenotype. If such an association is found between a particular marker locus and the phenotype, it suggests that either the variation at that marker locus affects the phenotype of interest, or that the variation at that marker locus is in linkage disequilibrium with the true phenotype-related locus, which was not genotyped. In the case of a group of polymorphisms that are in linkage disequilibrium with each other, knowledge of the existence of all such polymorphisms in a particular individual generally provides redundant information. Thus, when determining whether the genome of a dog comprises one or more polymorphisms indicative of susceptibility to, or protection from, liver copper accumulation or to copper-associated liver disease, it is necessary to detect only one polymorphism of such a group of polymorphisms.

As a result of linkage disequilibrium, a polymorphism that is not a functional susceptibility/protective polymorphism, but is in linkage disequilibrium with a functional polymorphism, may act as a marker indicating the presence of the functional polymorphism. A polymorphism that is in linkage disequilibrium with a polymorphism of the invention is indicative of susceptibility to, or protection from, liver copper accumulation.

Accordingly, any one of the polymorphic positions as defined herein may be typed directly, in other words by determining the nucleotide present at that position, or indirectly, for example by determining the nucleotide present at another polymorphic position that is in linkage disequilibrium with said polymorphic position.

Linkage disequilibrium is the non-random gametic association of alleles at different loci in a population. Polymorphisms that have a tendency to be inherited together instead of being inherited independently by random assortment are in linkage disequilibrium. Polymorphisms are randomly assorted or inherited independently of each other if the frequency of the two polymorphisms together is the product of the frequencies of the two polymorphisms individually. For example, if two polymorphisms at different polymorphic sites are present in 50% of the chromosomes in a population, then they would be said to assort randomly if the two alleles are present together on 25% of the chromosomes in the population. A higher percentage would mean that the two alleles are linked. It follows that a first polymorphism is in linkage disequilibrium with a second polymorphism if the frequency of the two polymorphisms together is greater than the product of the frequencies of the two polymorphisms individually in a population. Preferably, a first polymorphism is in linkage disequilibrium with a second polymorphism if the frequency of the two polymorphisms together is more that 10% greater, for example more than 30%, more than 50% or more than 70% greater, than the product of the frequencies of the two polymorphisms individually.

Research has shown that linkage disequilibrium is extensive in dogs (Extensive and breed-specific linkage disequilibrium in Canis familiaris, Sutter et al., Genome Research 14: 2388-2396). Polymorphisms which are in linkage disequilibrium are often in close physical proximity, which is why they are co-inherited. Polymorphisms which are in linkage disequilibrium with the polymorphisms mentioned herein are located on the same chromosome. Polymorphisms which are in linkage disequilibrium in dogs are typically within 5 mb, preferably within 2 mb, within 1 mb, within 700 kb, within 600 kb, within 500 kb, within 400 kb, within 200 kb, within 100 kb, within 50 kb, within 10 kb, within 5 kb, within 1 kb, within 500 bp, within 100 bp, within 50 bp or within 10 bp of the polymorphism.

It would be within the capability of the skilled person to use routine techniques to identify polymorphisms that are in linkage disequilibrium with any one of the polymorphic positions as defined herein. Once a potential polymorphism has been selected, the skilled person can readily determine whether this polymorphism, and what version or allele of the polymorphism, is significantly correlated with any of the polymorphisms defined herein.

In more detail, to determine whether a polymorphism is in linkage disequilibrium with any one of the polymorphisms defined herein, the skilled person should genotype the candidate polymorphism and one or more of the polymorphisms defined herein in a panel of dogs. The size of the panel should be adequate enough to achieve a statistically significant result. Typically, samples from at least 100, preferably at least 150 or at least 200, different dogs should be genotyped. The dogs in the panel may be of any breed, but typically will have the same or similar genetic breed background. Once the polymorphisms have been genotyped in the panel of dogs, linkage disequilibrium between one or more pairs of polymorphisms can be measured using any one of a number of readily available statistical packages. An example of a free software package is Haploview (Haploview: analysis and visualisation of LD and haplotype maps, Barrett et al, 2005, Bioinformatics, 21(2): 263-265), downloadable at http://www.broadinstitute.org/haploview/haploview.

A measure of linkage disequilibrium is D′. A range of 0.5 to 1 for D′ is indicative of a pair of polymorphisms being in linkage disequilibrium, with 1 indicating the most significant linkage disequilibrium. Therefore if D′ is found to be from 0.5 to 1, preferably from 0.6 to 1, 0.7 to 1, from 0.8 to 1, from 0.85 to 1, from 0.9 to 1, from 0.95 to 1 or most preferably 1, for a candidate polymorphism and a specific polymorphism defined herein, the candidate polymorphism may be said to be predictive of the polymorphism defined herein and will thus indicate susceptibility to or protection from liver copper accumulation. In a preferred method of the invention, a polymorphism that is in linkage disequilibrium with a polymorphism defined herein is within 680 kb and on the same chromosome as the polymorphism defined herein and the calculated measure of linkage disequilibrium between the pair of polymorphisms, D′, is greater than or equal to 0.9.

Another measure of linkage disequilibrium is R-squared, where R is the correlation coefficient. R-squared, which is also known as the ‘Coefficient of determination’, is the fraction of the variance in the genotypes of the first polymorphism which is accounted for in the genotypes of the second polymorphism. Therefore an R-squared of 0.5 for a candidate polymorphism and a specific polymorphism defined herein would mean that the candidate polymorphism accounts for 50% of the variance in the specific polymorphism. R-squared is producible from standard statistical packages such as Haploview. Typically, an R-squared of 0.25 or greater (R of >0.5 or <−0.5) is considered a large correlation. Therefore if R-squared is found to be 0.5 or more, preferably 0.75 or more, 0.8 or more, 0.85 or more, 0.9 or more, or 0.95 or more for a candidate polymorphism and a specific polymorphism defined herein, the candidate polymorphism may be said to be predictive of the polymorphism defined herein and will thus indicate susceptibility to or protection from liver copper accumulation. In a preferred method of the invention, a polymorphism that is in linkage disequilibrium with a polymorphism defined herein is within 680 kb and on the same chromosome as the polymorphism defined herein and the calculated measure of linkage disequilibrium between the pair of polymorphisms, R-squared, is greater than or equal to 0.85.

Once a polymorphism has been identified as being in linkage disequilibrium and therefore correlated with a polymorphism defined herein, the skilled person can readily determine which version of the polymorphism, i.e. which allele, is associated with susceptibility to or protection from liver copper accumulation. This could be achieved by phenotyping a panel of dogs for liver copper accumulation and classifying the dogs in terms of the level of liver copper accumulation. The panel of dogs are then genotyped for the polymorphism of interest. The genotypes are then correlated with the level of liver copper in order to determine the association of the genotypes with liver copper level and thereby determine which allele is associated with susceptibility to or protection from liver copper accumulation.

The polymorphisms of the invention that are indicative of protection from liver copper accumulation are the SNP identified in Table VI (ATP7a_Reg3_F_—6 (position 102 of SEQ ID NO:142)) and one or more polymorphisms in linkage disequilibrium with this SNP. Therefore, the method of the invention comprises detecting the presence or absence of one or more polymorphisms selected from (a) SNP ATP7a_Reg3_F_—6 (SEQ ID NO:142) and (b) one or more polymorphisms in linkage disequilibrium with (a). Preferably, the method comprises determining the presence or absence of the SNP identified in Table VI (ATP7a_Reg3_F_—6 (SEQ ID NO: 142)), i.e. polymorphism (a).

Any number and any combination of polymorphisms may be detected to carry out the invention. Preferably at least 2 polymorphisms are detected. Preferably 2 to 5, 3 to 8 or 5 to 10 polymorphisms are detected.

The DNA of a dog may be typed at the respective positions of:

(i) a polymorphism (a);

(ii) one or more polymorphisms (b); or

(iii) a polymorphism (a) and one or more polymorphisms (b).

A preferred method comprises detecting the presence or absence of (a) SNP ATP7a_Reg3_F_—6 (SEQ ID NO:142) and at least one polymorphism (b) in linkage disequilibrium with said polymorphism (a).

In a preferred method of the invention, the polymorphism in linkage disequilibrium with said polymorphism (a) is a SNP. Preferably the polymorphism is any polymorphism in or in the region of the ATP7A gene of the dog that is indicative of protection from liver copper accumulation. An example of a SNP in linkage disequilibrium with polymorphism (a) is SNP ATP7a_Reg16_F_—42 (position 68 of SEQ ID NO:143). This SNP was found to be in linkage disequilibrium with SNP ATP7a_Reg3_F_—6 (SEQ ID NO:142) and indicative of protection from liver copper accumulation (Example 4). Therefore this SNP can either be used on its own, or in combination with polymorphism (a), to determine the likelihood that a dog is protected from liver copper accumulation. Accordingly, the method of determining the likelihood that a dog is protected from liver copper accumulation may comprise detecting the presence or absence in the genome of the dog of one or more polymorphisms selected from (a) SNP ATP7a_Reg3_F_—6 (SEQ ID NO:142), (b) SNP ATP7a_Reg16_F_—42 (SEQ ID NO:143) and one or more polymorphisms in linkage disequilibrium with (a) and/or (b). A preferred method comprises detecting the presence or absence (a) SNP ATP7a Reg3_F_—6 (SEQ ID NO:142) and (b) SNP ATP7a_Reg16_F_—42 (SEQ ID NO:143).

The T allele for the ATP7A SNP identified in Table VI (ATP7a_Reg3_F_—6 (SEQ ID NO: 142) has been determined by the inventors to be indicative of protection from copper accumulation. This SNP is located on the X chromosome. Dogs that are homozygous (in the case of female dogs) or hemizygous (in the case of male dogs) for the T allele are protected from copper accumulation. Dogs that have the C allele appear to not be protected from copper accumulation. Therefore, a preferred method of the invention comprises determining the presence or absence of the T allele for the SNP identified in Table VI (ATP7a_Reg3_F_—6 (SEQ ID NO: 142)). Accordingly, a preferred method of the invention comprises detecting the presence or absence of a TT or TC genotype at ATP7a Reg3_F_—6 (SNP 142) and thereby determining whether the genome of the dog comprises a polymorphism indicative of protection from liver copper accumulation.

In view of the fact that the ATP7A SNP identified in Table VI is located on the X chromosome and the protective effect is recessive, male dogs are more likely to have the protective phenotype. The method of the invention may therefore comprise determining the sex of the dog. Given that male dogs in general are less susceptible to copper accumulation compared with female dogs, the ATP7A SNP ((ATP7a_Reg3_F_—6 (SEQ ID NO: 142)) is particularly useful for dogs of all breeds including dogs of unknown breed or mixed breed (mongrel). Example 3 also provides evidence that the method of the invention is applicable for dogs of all breeds and in all geographical locations. The method of the invention may therefore comprise determining whether the genome of a mixed or crossbred dog, or a mongrel or out-bred dog comprises one or more polymorphisms in the ATP7A gene that are indicative of protection from liver copper accumulation or one or more polymorphisms in linkage disequilibrium therewith.

For SNP ATP7a_Reg16_F_—42 (SEQ ID NO: 143), which has been found to be in linkage disequilibrium with SNP ATP7a_Reg3_F_—6 (SEQ ID NO: 142), the T allele has been determined by the inventors to be indicative of protection from copper accumulation. As explained above, the ATP7A gene and therefore this SNP is located on the X chromosome. Dogs that are homozygous (in the case of female dogs) or hemizygous (in the case of male dogs) for the T allele are protected from copper accumulation. Dogs that have the C allele appear to not be protected from copper accumulation. Therefore, a preferred method of the invention comprises determining the presence or absence of the T allele for the SNP identified in Table X (ATP7a_Reg16_F_—42 (SEQ ID NO: 143). Accordingly, a preferred method of the invention comprises detecting the presence or absence of a TT or TC genotype at (ATP7a_Reg16_F_—42 (SEQ ID NO: 143) and thereby determining whether the genome of the dog comprises a polymorphism indicative of protection from liver copper accumulation.

The inventors have previously discovered that polymorphisms in or in the region of the canine GOLGAS, ATP7A and UBL5 genes are indicative of susceptibility to liver copper accumulation in dogs (Examples 1 to 2). Therefore these polymorphisms could be used in combination with the polymorphisms of the invention to provide an enhanced genetic test for determining the risk or likelihood that a dog is susceptible to or protected from liver copper accumulation. The method of the invention may therefore comprise determining the presence or absence of a combination of SNPs that are indicative of susceptibility to, and protection from, liver copper accumulation. DNA from the dog may be typed at one or more SNPs indicative of susceptibility to liver copper accumulation and typed at one or more SNPs indicative of protection from liver copper accumulation. The presence of one or more “susceptibility” SNPs in combination with the absence of one or more “protective” SNPs indicates that the dog is susceptible to liver copper accumulation. The presence of one or more “protective” SNPs in combination with the absence of one or more “susceptibility” SNPs indicates that the dog is protected from liver copper accumulation.

A polymorphism of the invention that is indicative of susceptibility to liver copper accumulation may be present in any one of the GOLGA5, ATP7A or UBL5 genes or may not be present within any one of those genes but is in linkage disequilibrium with a polymorphism in any one of those genes. The invention may therefore further comprise detecting the presence or absence of (c) a polymorphism in the GOLGA5, ATP7A or UBL5 gene of the dog that is indicative of susceptibility to liver copper accumulation and/or (d) a polymorphism in linkage disequilibrium with a said polymorphism (c). Any number and any combination of polymorphisms may be detected to carry out the invention. Preferably at least 2 polymorphisms are detected. Preferably 2 to 5, 3 to 8 or 5 to 10 polymorphisms are detected.

Therefore, the DNA of a dog may be typed at the respective positions of (i) polymorphism (a) and/or (ii) one or more polymorphisms (b). Additionally, the DNA of the dog may be typed at the respective positions of:

(iii) two or more polymorphisms (c);

(iv) two or more polymorphisms (d); or

(v) one or more polymorphisms (c) and one or more polymorphisms (d).

When there are two polymorphisms (c), each polymorphism may be in a separate one of the GOLGA5, ATP7A and UBL5 genes or in just one of those genes.

When there are three or more polymorphisms (c), for example 3 to 10 such polymorphisms, the polymorphisms may be in the same gene, in two of the genes or in all three genes.

Similarly when there are two polymorphisms (d), each polymorphism may be in linkage disequilibrium with a polymorphism in a separate one of the GOLGA5, ATP7A and UBL5 genes or in just one of those genes. When there are three or more polymorphisms (d), for example 3 to 10 such polymorphisms, the polymorphisms may be in linkage disequilibrium with a polymorphism in the same gene, in two of the genes or in all three genes. A preferred method comprises detecting the presence or absence of at least one polymorphism (c) in the GOLGA5, ATP7A or UBL5 gene of the dog that is indicative of susceptibility to liver copper accumulation and at least one polymorphism (d) in linkage disequilibrium with a said polymorphism (c).

In a preferred method of the invention, the polymorphism indicative of susceptibility is a SNP. The SNP may be any SNP in or in the region of the GOLGA5, ATP7A or UBL5 gene of the dog that is indicative of susceptibility to liver copper accumulation and/or a SNP that is in linkage disequilibrium thereof

When the method comprises determining whether the genome of a dog comprises one or more polymorphisms indicative of susceptibility to liver copper accumulation, preferably the SNP is selected from a SNP identified in Table III, Table IV and Table V. In Tables III and IV each SNP is located at position 61 in the sequence. The first and second alleles are provided for each SNP at that location ([first/second]). In Table V, the first and second alleles for each SNP are also indicated. Any number of the SNPs may be used from Tables III, IV and V and in any combination. The SNPs may be combined with a different type of polymorphism.

Preferably, when the method comprises determining whether the genome of a dog comprises one or more polymorphisms indicative of susceptibility to liver copper accumulation, the method comprises detecting the presence or absence of one or more

SNPs selected from the SNPs in Table III and Table V and/or one or more SNPs in linkage disequilibrium thereof Therefore preferably the one or more SNPs are selected from BICF2P506595 (position 61 of SEQ ID NO:1), BICF2P772765 (position 61 of SEQ ID NO:2), BICF2S2333187 (position 61 of SEQ ID NO:3), BICF2P1324008 (position 61 of SEQ ID NO:4), BICF2P591872 (position 61 of SEQ ID NO:5), ATP7a_Reg4_F_—9 (position 164 of SEQ ID NO: 131), UBL5_Reg1F_—16 (position 97 of SEQ ID NO: 132), golga5_Reg1_—24 (position 70 of SEQ ID NO: 133), golga5_—26 (position 88 of SEQ ID NO: 134), golga5_—27 (position 104 of SEQ ID NO: 135), golga5_—28 (position 139 of SEQ ID NO: 136), golga5_—29 (position 128 of SEQ ID NO: 137), golga5_—30 (position 95 of SEQ ID NO: 138), golga5_—31 (position 106 of SEQ ID NO: 139), atp7areg17_—32 (position 95 of SEQ ID NO: 140), atp7areg17_—33 (position 90 of SEQ ID NO: 141) and one or more SNPs in linkage disequilibrium thereof. Accordingly, any of these 16 SNPs or any SNPs that are in linkage disequilibrium with any if these 16 SNPs may be typed. Preferably at least 2 of these 16 SNPs or SNPs in linkage disequilibrium are typed.

More preferably, when the method comprises determining whether the genome of a dog comprises one or more polymorphisms indicative of susceptibility to liver copper accumulation, the method comprises detecting the presence or absence of one or more SNPs selected from the SNPs in Table III. Accordingly, any of these 5 SNPs or any SNPs that are in linkage disequilibrium with any of these 5 SNPs may be typed. Preferably at least 2 of these 5 SNPs or SNPs in linkage disequilibrium are typed. More preferably all 5 positions are typed. Preferably therefore, the nucleotide(s) that are typed are selected from positions equivalent to:

• • position 61 of SEQ ID NO: 1 (BICF2P506595, SNP1);
  • position 61 of SEQ ID NO: 2 (BICF2P772765, SNP 2);
  • position 61 of SEQ ID NO: 3 (BICF2S2333187, SNP 3);
  • position 61 of SEQ ID NO: 4 (BICF2P1324008, SNP 4);
  • position 61 of SEQ ID NO: 5 (BICF2P591872, SNP 5); or any positions which are in linkage disequilibrium with any one of these positions. Preferably, the method comprises detecting the presence or absence of the SNPs BICF2P506595 (SEQ ID NO:1), BICF2P772765 (SEQ ID NO:2), BICF2S2333187 (SEQ ID NO:3), BICF2P1324008 (SEQ ID NO:4), and BICF2P591872 (SEQ ID NO:5).

SNP 1 is located within an intron of the GOLGA5 gene. SNPs 2, 3 and 4 are located in the region of the UBL5 gene. SNP 5 is located in the region of the ATP7A gene. The detection method of the invention therefore relates to any SNP that lies within or in the region of one or more of these genes (in coding regions or otherwise), or any other SNP that is in linkage disequilibrium.

Example 1 demonstrates the use of these SNPs to establish a Boolean model of susceptibility to copper accumulation. Table I represents the binary conditions of alleles at three genomic locations. The binary values are indicative of a dog having alleles that are indicative of susceptibility to copper accumulation (“bad” alleles). For instance 000 represents not having any of the three bad alleles. 111 represents having all three bad alleles. The Xs are unused alleles at that gene. The lines 1xx and 0xx show the power that a one gene test only using the SNP in the GOLGA5 gene would have.

The A allele for SNP BICF2P506595 (SNP 1) has been determined by the inventors to be indicative of susceptibility to liver copper accumulation. Dogs that are homozygous for the A allele are susceptible to liver copper accumulation. Therefore, a preferred method of the invention comprises determining the presence or absence of the A allele for SNP BICF2P506595 and thereby determining whether the genome of the dog comprises a polymorphism indicative of susceptibility to liver copper accumulation. A more preferred method comprises detecting the presence or absence of the AA genotype for SNP BICF2P506595.

The G allele for SNP BICF2P772765 (SNP 2) has been determined by the inventors to be indicative of susceptibility to liver copper accumulation. Dogs that are homozygous for the G allele are susceptible to liver copper accumulation. Therefore, a preferred method of the invention comprises determining the presence or absence of the G allele for SNP BICF2P772765 and thereby determining whether the genome of the dog comprises a polymorphism indicative of susceptibility to liver copper accumulation. A more preferred method comprises detecting the presence or absence of the GG genotype for SNP BICF2P772765.

The C allele for SNP BICF2S2333187 (SNP 3) has been determined by the inventors to be indicative of susceptibility to liver copper accumulation. Dogs that are homozygous for the C allele are susceptible to liver copper accumulation. Therefore, a preferred method of the invention comprises determining the presence or absence of the C allele for SNP BICF2S2333187 and thereby determining whether the genome of the dog comprises a polymorphism indicative of susceptibility to liver copper accumulation. A more preferred method comprises detecting the presence or absence of the CC genotype for SNP BICF2S2333187.

The G allele for SNP BICF2P 1324008 (SNP 4) has been determined by the inventors to be indicative of susceptibility to liver copper accumulation. Dogs that are homozygous for the G allele are susceptible to liver copper accumulation. Therefore, a preferred method of the invention comprises determining the presence or absence of the G allele for SNP BICF2P 1324008 and thereby determining whether the genome of the dog comprises a polymorphism indicative of susceptibility to liver copper accumulation. A more preferred method comprises detecting the presence or absence of the GG genotype for SNP BICF2P 1324008.

The A allele for SNP BICF2P591872 (SNP 5) has been determined by the inventors to be indicative of susceptibility to liver copper accumulation. Dogs that are homozygous or heterozygous for the A allele are susceptible to liver copper accumulation. Therefore, a preferred method of the invention comprises determining the presence or absence of the A allele for SNP BICF2P591872 and thereby determining whether the genome of the dog comprises a polymorphism indicative of susceptibility to liver copper accumulation. A more preferred method comprises detecting the presence or absence of the AA or AG genotype for SNP BICF2P591872.

Therefore, a more preferred method of the invention comprises detecting the presence or absence of (i) a TT or TC genotype at ATP7a_Reg3_F_—6 (SNP 142); and/or (ii) a TT or TC genotype at ATP7aReg16_F_—42 (SNP 143); and may further comprise detecting the presence or absence of:

• • (iii) an AA genotype for SNP BICF2P506595 (SNP 1);
  • (iv) a GG genotype for SNP BICF2P772765 (SNP 2);
  • (v) a CC genotype for SNP BICF2S2333187 (SNP 3);
  • (vi) a GG genotype for SNP BICF2P1324008 (SNP 4); and/or
  • (vii) an AA or AG genotype for SNP BICF2P591872 (SNP 5);
    and thereby determining whether the genome of the dog comprises one or more polymorphisms indicative of protection from and/or susceptibility to liver copper accumulation. A more preferred method comprises detecting the presence or absence of a genotype (iiii); a genotype (iv), (v) and (vi); or a genotype (vii). An even more preferable method comprises detecting the presence or absence of all 5 genotypes (iii) to (vii).

DNA from the dog may be typed at:

• • (i) one or more SNPs selected from (a) the SNP identified in Table VI (ATP7a Reg3_F_—6 (SNP 142)) and (b) one or more SNPs in linkage disequilibrium with said SNP (a), such as the SNP identified in Table X (ATP7a_Reg16_F_—42 (SNP 143)); and
  • (ii) one or more SNPs selected from (a) the SNPs identified in Table III, IV and V and (b) one or more SNPs in linkage disequilibrium with a said SNP (a).

Typing the nucleotide(s) present in the genome of the dog at a position identified in any of Tables III, IV, V, VI or X may mean that the nucleotide present at this position in a sequence corresponding exactly with the sequence identified in Table III, IV, V, VI or X is typed. However, it will be understood that the exact sequences presented in SEQ ID NOs: 1 to 5 identified in Table III, SEQ ID NO: 6 to 130 in Table IV, SEQ ID NO: 131 to 141 in Table V, SEQ ID NO: 142 in Table VI and SEQ ID NO: 143 in Table X will not necessarily be present in the dog to be tested. Typing the nucleotide present may therefore be at a position identified in Table III, IV, V, VI or X or at an equivalent or corresponding position in the sequence. The term equivalent as used herein therefore means at or at a position corresponding to that identified in Table III, IV, V, VI or X. The sequence and thus the position of the SNP could for example vary because of deletions or additions of nucleotides in the genome of the dog. Those skilled in the art will be able to determine a position that corresponds to or is equivalent to the relevant position in each of SEQ ID NOs: 1 to 143, using for example a computer program such as GAP, BESTFIT, COMPARE, ALIGN, PILEUP or BLAST. The UWGCG Package provides programs including GAP, BESTFIT, COMPARE, ALIGN and PILEUP that can be used to calculate homology or line up sequences (for example used on their default settings). The BLAST algorithm can also be used to compare or line up two sequences, typically on its default settings. Software for performing a BLAST comparison of two sequences is publicly available through the National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov/). This algorithm is further described below. Similar publicly available tools for the alignment and comparison of sequences may be found on the European Bioinformatics Institute website (http://www.ebi.ac.uk), for example the ALIGN and CLUSTALW programs.

There are a variety of different methods that can be used to determine whether a polymorphism is indicative of either susceptibility to or protection from liver copper accumulation. Typically, the candidate polymorphism is compared to a database of polymorphisms and their association with susceptibility to or protection from liver copper accumulation. Such a database is generated by phenotyping a panel of dogs for liver copper accumulation, for example by liver biopsy, and classifying the dogs in terms of the level of copper accumulation. The dogs in the panel are also genotyped for a panel of polymorphisms. It is then possible to determine the association of each genotype with the level of liver copper. Determining whether a polymorphism is indicative of either susceptibility to or protection from liver copper is therefore achieved by locating the polymorphism in the database.

If a polymorphism of interest is not located in a database as described above, it is still possible to determine whether the polymorphism is indicative of either susceptibility to or protection from liver copper accumulation. This could be achieved by phenotyping a panel of dogs for liver copper accumulation and classifying the dogs in terms of the level of liver copper accumulation. The panel of dogs are then genotyped for the polymorphism of interest. The genotypes are then correlated with the level of liver copper in order to determine the association of the genotypes with liver copper level.

Once the presence or absence of the one or more polymorphisms of the invention have been detected in the genome of the dog, whether the dog is protected from, or susceptible to, liver copper accumulation is thereby determined. The genotype of each polymorphism alone or in combination with other polymorphisms is indicative of the protection from, or susceptibility of the dog to, liver copper accumulation.

To determine whether a dog is protected from liver copper accumulation one may genotype the SNP identified in Table VI in the genome of the dog using a DNA sample from the dog. This functional mutation is located in ATP7A (on the X chromosome) and appears to be protective when homozygous (TT). This may explain the female bias of chronic hepatitis as males only have one copy of the X chromosome and so are hemizygous at the ATP7A locus. An X-linked recessive gene-effect is more likely to be seen in males than females because of the hemizygous state of the male X chromosome. The protective effect here is recessive so we see more cases in the female population (See Example 2, Table VII and FIG. 5). Once the genotype of the SNP has been determined it is possible to determine whether the dog is protected from liver copper accumulation. The presence of the alternative allele (T) is indicative of protection from liver copper accumulation. A dog that is homozygous for the alternative allele (TT) is most likely to be protected from liver copper accumulation. A preferred method of the invention therefore comprises determining the presence or absence of a T allele of the ATP7A SNP in the genome of the dog. The method may comprise determining whether the dog is homozygous (in the case of female dogs) or hemizygous (in the case of male dogs) for the T allele of the ATP7A SNP.

If the method further comprises testing for the presence or absence of SNPs indicative of susceptibility to liver copper accumulation, a model may be used that combines the results to provide an overall assessment of the risk or likelihood that the dog will be susceptible to, or protected from, liver copper accumulation. As an example, Table I sets out the different possible genotypes of the combination of 5 SNPs in the region of the GOLGA5, UBL5 and ATP7A genes and the percentage of dogs with those genotypes that have high copper (liver levels of above 600 mg/kg). In this example, to determine the susceptibility of a dog to liver copper accumulation one may genotype the 5 SNPs in the genome of the dog using a DNA sample from the dog. Once the genotypes of the SNPs have been determined, these can be converted into binary values based on the key provided in Example 1, i.e. based on the degree of association of the genotype with high copper. Then, Table I is used to convert the binary values into a risk factor based on the percentage of dogs that have that genotype pattern and high copper. These results could therefore be combined with the results for the protective polymorphism(s).

A dog may be tested by a method of the invention at any age, for example from 0 to 12, 0 to 6, 0 to 5, 0 to 4, 0 to 3, 0 to 2 or 0 to 1 years old. Preferably the dog is tested at as young an age as possible, for example within the first year, first 6 months or first 3 months of its life. The dog is preferably tested before copper accumulation occurs. The history of the dog may or may not be known. For example, the dog may be a pup of known parents and the history of the parents with respect to copper accumulation may be known. Alternatively, the dog may be a stray or a rescued dog with unknown parentage and history.

The dog to be tested by any method of the present invention may be of any breed. The invention provides a method of determining whether the genome of a mixed or crossbred dog, or a mongrel or out-bred dog comprises one or more polymorphisms indicative of protection from, or susceptibility to, liver copper accumulation.

In the method of determining whether the genome of the dog comprises one or more polymorphisms indicative of protection from liver copper accumulation of the invention, the dog may be one that is suspected of being protected from liver copper accumulation. Alternatively, the dog may be suspected of being susceptible to liver copper accumulation. In a preferred method of the invention, the dog has genetic breed inheritance of Labrador Retriever, Golden Retriever or Miniature Poodle. The dog may be a mixed or crossbred dog, or a mongrel or out-bred dog. The dog may have at least 25%, at least 50%, or at least 100% of its genome inherited from any pure breed or more preferably from any breed selected from Labrador Retriever, Golden Retriever or Miniature Poodle. The dog may be a pure-bred. In one embodiment of the invention, one or both parents of the dog to be tested are or were pure-bred dogs. In another embodiment, one or more grandparents are or were pure-bred dogs. One, two, three or all four of the grandparents of the dog that is tested may be or may have been pure-bred dogs.

Preferably, the dog has genetic breed inheritance of Labrador Retriever. The dog may be a purebred Labrador Retriever. Alternatively, the dog may be a mixed or crossbred dog, or an outbred dog (mongrel). One or both of the parents of the dog may be a pure-bred Labrador Retriever dog. One, two, three or four of the grandparents of the dog may be a pure-bred Labrador Retriever dog. The dog may have at least 50% or at least 75% of the Labrador Retriever breed in its genetic background. Thus, at least 50% or at least 75% of the dog's genome may be derived from the Labrador Retriever breed.

The genetic breed background of a dog may be determined by assessing the allelic frequencies of genetic markers, for example SNPs or microsatellites. The combinations of allelic frequencies of different SNPs or microsatellites in a dog provide a signature that allows the breed of a dog or the breeds that make up a mixed breed dog to be determined. Such a genetic test may be a commercially available test. Alternatively, the dog may not need to be tested for the genetic inheritance of a particular breed because it is suspected of having a particular breed inheritance for example by the dog owner or veterinarian. This could be for example because of knowledge of the dog's ancestry or because of its appearance.

The predictive test of the invention may be carried out in conjunction with one or more other predictive or diagnostic tests such as determining the genetic breed background/inheritance of the dog or susceptibility to one or more other diseases.

Detection of Polymorphisms

The detection of polymorphisms according to the invention may comprise contacting a polynucleotide or protein in a sample from the dog with a specific binding agent for a polymorphism and determining whether the agent binds to the polynucleotide or protein, wherein binding of the agent indicates the presence of the polymorphism, and lack of binding of the agent indicates the absence of the polymorphism.

The method is generally carried out in vitro on a sample from the dog, where the sample contains DNA from the dog. The sample typically comprises a body fluid and/or cells of the dog and may, for example, be obtained using a swab, such as a mouth swab. The sample may be a blood, urine, saliva, skin, cheek cell or hair root sample. The sample is typically processed before the method is carried out, for example DNA extraction may be carried out. The polynucleotide or protein in the sample may be cleaved either physically or chemically, for example using a suitable enzyme. In one embodiment the part of polynucleotide in the sample is copied or amplified, for example by cloning or using a PCR based method prior to detecting the polymorphism.

In the present invention, any one or more methods may comprise determining the presence or absence of one or more polymorphisms in the dog. The polymorphism is typically detected by directly determining the presence of the polymorphic sequence in a polynucleotide or protein of the dog. Such a polynucleotide is typically genomic DNA, mRNA or cDNA. The polymorphism may be detected by any suitable method such as those mentioned below.

A specific binding agent is an agent that binds with preferential or high affinity to the protein or polypeptide having the polymorphism but does not bind or binds with only low affinity to other polypeptides or proteins. The specific binding agent may be a probe or primer. The probe may be a protein (such as an antibody) or an oligonucleotide. The probe may be labelled or may be capable of being labelled indirectly. The binding of the probe to the polynucleotide or protein may be used to immobilise either the probe or the polynucleotide or protein.

Generally in the method, a polymorphism can be detected by determining the binding of the agent to the polymorphic polynucleotide or protein of the dog. However in one embodiment the agent is also able to bind the corresponding wild-type sequence, for example by binding the nucleotides or amino acids which flank the variant position, although the manner of binding to the wild-type sequence will be detectably different to the binding of a polynucleotide or protein containing the polymorphism.

The method may be based on an oligonucleotide ligation assay in which two oligonucleotide probes are used. These probes bind to adjacent areas on the polynucleotide that contains the polymorphism, allowing after binding the two probes to be ligated together by an appropriate ligase enzyme. However the presence of a single mismatch within one of the probes may disrupt binding and ligation. Thus ligated probes will only occur with a polynucleotide that contains the polymorphism, and therefore the detection of the ligated product may be used to determine the presence of the polymorphism.

In one embodiment the probe is used in a heteroduplex analysis based system. In such a system when the probe is bound to a polynucleotide sequence containing the polymorphism it forms a heteroduplex at the site where the polymorphism occurs and hence does not form a double strand structure. Such a heteroduplex structure can be detected by the use of a single or double strand specific enzyme. Typically the probe is an RNA probe, the heteroduplex region is cleaved using RNAase H and the polymorphism is detected by detecting the cleavage products.

The method may be based on fluorescent chemical cleavage mismatch analysis which is described for example in PCR Methods and Applications 3, 268-71 (1994) and Proc. Natl. Acad. Sci. 85, 4397-4401 (1998).

In one embodiment a PCR primer is used that primes a PCR reaction only if it binds a polynucleotide containing the polymorphism, for example a sequence-specific

PCR system, and the presence of the polymorphism may be determined by detecting the PCR product. Preferably the region of the primer that is complementary to the polymorphism is at or near the 3′ end of the primer. The presence of the polymorphism may be determined using a fluorescent dye and quenching agent-based PCR assay such as the Taqman PCR detection system.

The specific binding agent may be capable of specifically binding the amino acid sequence encoded by a polymorphic sequence. For example, the agent may be an antibody or antibody fragment. The detection method may be based on an ELISA system. The method may be an RFLP based system. This can be used if the presence of the polymorphism in the polynucleotide creates or destroys a restriction site that is recognised by a restriction enzyme.

The presence of the polymorphism may be determined based on the change that the presence of the polymorphism makes to the mobility of the polynucleotide or protein during gel electrophoresis. In the case of a polynucleotide, single-stranded conformation polymorphism (SSCP) or denaturing gradient gel electrophoresis (DDGE) analysis may be used. In another method of detecting the polymorphism, a polynucleotide comprising the polymorphic region is sequenced across the region that contains the polymorphism to determine the presence of the polymorphism.

The presence of the polymorphism may be detected by means of fluorescence resonance energy transfer (FRET). In particular, the polymorphism may be detected by means of a dual hybridisation probe system. This method involves the use of two oligonucleotide probes that are located close to each other and that are complementary to an internal segment of a target polynucleotide of interest, where each of the two probes is labelled with a fluorophore. Any suitable fluorescent label or dye may be used as the fluorophore, such that the emission wavelength of the fluorophore on one probe (the donor) overlaps the excitation wavelength of the fluorophore on the second probe (the acceptor). A typical donor fluorophore is fluorescein (FAM), and typical acceptor fluorophores include Texas red, rhodamine, LC-640, LC-705 and cyanine 5 (Cy5).

In order for fluorescence resonance energy transfer to take place, the two fluorophores need to come into close proximity on hybridisation of both probes to the target. When the donor fluorophore is excited with an appropriate wavelength of light, the emission spectrum energy is transferred to the fluorophore on the acceptor probe resulting in its fluorescence. Therefore, detection of this wavelength of light, during excitation at the wavelength appropriate for the donor fluorophore, indicates hybridisation and close association of the fluorophores on the two probes. Each probe may be labelled with a fluorophore at one end such that the probe located upstream (5′) is labelled at its 3′ end, and the probe located downstream (3′) is labelled at its 5′ end. The gap between the two probes when bound to the target sequence may be from 1 to 20 nucleotides, preferably from 1 to 17 nucleotides, more preferably from 1 to 10 nucleotides, such as a gap of 1, 2, 4, 6, 8 or 10 nucleotides.

The first of the two probes may be designed to bind to a conserved sequence of the gene adjacent to a polymorphism and the second probe may be designed to bind to a region including one or more polymorphisms. Polymorphisms within the sequence of the gene targeted by the second probe can be detected by measuring the change in melting temperature caused by the resulting base mismatches. The extent of the change in the melting temperature will be dependent on the number and base types involved in the nucleotide polymorphisms.

Polymorphism typing may also be performed using a primer extension technique. In this technique, the target region surrounding the polymorphic site is copied or amplified for example using PCR. A single base sequencing reaction is then performed using a primer that anneals one base away from the polymorphic site (allele-specific nucleotide incorporation). The primer extension product is then detected to determine the nucleotide present at the polymorphic site. There are several ways in which the extension product can be detected. In one detection method for example, fluorescently labelled dideoxynucleotide terminators are used to stop the extension reaction at the polymorphic site. Alternatively, mass-modified dideoxynucleotide terminators are used and the primer extension products are detected using mass spectrometry. By specifically labelling one or more of the terminators, the sequence of the extended primer, and hence the nucleotide present at the polymorphic site can be deduced. More than one reaction product can be analysed per reaction and consequently the nucleotide present on both homologous chromosomes can be determined if more than one terminator is specifically labelled.

The invention further provides primers or probes that may be used in the detection of any of the SNPs defined herein for use in the prediction of susceptibility to copper accumulation. Polynucleotides of the invention may also be used as primers for primer extension reactions to detect the SNPs defined herein.

Such primers, probes and other polynucleotide fragments will preferably be at least 10, preferably at least 15 or at least 20, for example at least 25, at least 30 or at least 40 nucleotides in length. They will typically be up to 40, 50, 60, 70, 100 or 150 nucleotides in length. Probes and fragments can be longer than 150 nucleotides in length, for example up to 200, 300, 400, 500, 600, 700 nucleotides in length, or even up to a few nucleotides, such as five or ten nucleotides, short of a full length polynucleotide sequence of the invention.

Primers and probes for genotyping the SNPs of the invention may be designed using any suitable design software known in the art using the SNP sequences in Tables III, IV, V, VI or X. Homologues of these polynucleotide sequences would also be suitable for designing primers and probes. Such homologues typically have at least 70% homology, preferably at least 80, 90%, 95%, 97% or 99% homology, for example over a region of at least 15, 20, 30, 100 more contiguous nucleotides. The homology may be calculated on the basis of nucleotide identity (sometimes referred to as “hard homology”).

For example the UWGCG Package provides the BESTFIT program that can be used to calculate homology (for example used on its default settings) (Devereux et al (1984) Nucleic Acids Research 12, p387-395). The PILEUP and BLAST algorithms can be used to calculate homology or line up sequences (such as identifying equivalent or corresponding sequences (typically on their default settings), for example as described in Altschul S. F. (1993) J Mol Evol 36:290-300; Altschul, S, F et al (1990) J Mol Biol 215:403-10.

Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov/). This algorithm involves first identifying high scoring sequence pairs (HSPS) by identifying short words of length W in the query sequence that either match or satisfy some positive-valued threshold score T when aligned with a word of the same length in a database sequence. T is referred to as the neighbourhood word score threshold (Altschul et al, supra). These initial neighbourhood word hits act as seeds for initiating searches to find HSPs containing them. The word hits are extended in both directions along each sequence for as far as the cumulative alignment score can be increased. Extensions for the word hits in each direction are halted when: the cumulative alignment score falls off by the quantity X from its maximum achieved value; the cumulative score goes to zero or below, due to the accumulation of one or more negative-scoring residue alignments; or the end of either sequence is reached. The BLAST algorithm parameters W, T and X determine the sensitivity and speed of the alignment. The BLAST program uses as default a word length (W) of 11, the BLOSUM62 scoring matrix (see Henikoff and Henikoff (1992) Proc. Natl. Acad. Sci. USA 89: 10915-10919) alignments (B) of 50, expectation (E) of 10, M=5, N=4, and a comparison of both strands.

The BLAST algorithm performs a statistical analysis of the similarity between two sequences; see e.g., Karlin and Altschul (1993) Proc. Natl. Acad. Sci. USA 90:

5873-5787. One measure of similarity provided by the BLAST algorithm is the smallest sum probability (P(N)), which provides an indication of the probability by which a match between two polynucleotide sequences would occur by chance. For example, a sequence is considered similar to another sequence if the smallest sum probability in comparison of the first sequence to the second sequence is less than about 1, preferably less than about 0.1, more preferably less than about 0.01, and most preferably less than about 0.001.

The homologous sequence typically differs by at least 1, 2, 5, 10, 20 or more mutations, which may be substitutions, deletions or insertions of nucleotides

The polynucleotides of the invention such as primers or probes may be present in an isolated or substantially purified form. They may be mixed with carriers or diluents that will not interfere with their intended use and still be regarded as substantially isolated. They may also be in a substantially purified form, in which case they will generally comprise at least 90%, e.g. at least 95%, 98% or 99%, of polynucleotides of the preparation.

Detector Antibodies

A detector antibody is an antibody that is specific for one polymorphism but does not bind to any other polymorphism as described herein. Detector antibodies are for example useful in purification, isolation or screening methods involving immunoprecipitation techniques.

Antibodies may be raised against specific epitopes of the polypeptides of the invention. An antibody, or other compound, “specifically binds” to a polypeptide when it binds with preferential or high affinity to the protein for which it is specific but does substantially bind not bind or binds with only low affinity to other polypeptides. A variety of protocols for competitive binding or immunoradiometric assays to determine the specific binding capability of an antibody are well known in the art (see for example Maddox et al, J. Exp. Med. 158, 1211-1226, 1993). Such immunoassays typically involve the formation of complexes between the specific protein and its antibody and the measurement of complex formation.

For the purposes of this invention, the term “antibody”, unless specified to the contrary, includes fragments that bind a polypeptide of the invention. Such fragments include Fv, F(ab′) and F(ab′)₂ fragments, as well as single chain antibodies. Furthermore, the antibodies and fragment thereof may be chimeric antibodies, CDR-grafted antibodies or humanised antibodies.

Antibodies may be used in a method for detecting polypeptides of the invention in a biological sample (such as any such sample mentioned herein), which method comprises:

• I providing an antibody of the invention;
• II incubating a biological sample with said antibody under conditions which allow for the formation of an antibody-antigen complex; and
• III determining whether antibody-antigen complex comprising said antibody is formed.

Antibodies of the invention can be produced by any suitable method. Means for preparing and characterising antibodies are well known in the art, see for example Harlow and Lane (1988) “Antibodies: A Laboratory Manual”, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. For example, an antibody may be produced by raising an antibody in a host animal against the whole polypeptide or a fragment thereof, for example an antigenic epitope thereof, hereinafter the “immunogen”. The fragment may be any of the fragments mentioned herein (typically at least 10 or at least 15 amino acids long).

A method for producing a polyclonal antibody comprises immunising a suitable host animal, for example an experimental animal, with the immunogen and isolating immunoglobulins from the animal's serum. The animal may therefore be inoculated with the immunogen, blood subsequently removed from the animal and the IgG fraction purified. A method for producing a monoclonal antibody comprises immortalising cells which produce the desired antibody. Hybridoma cells may be produced by fusing spleen cells from an inoculated experimental animal with tumour cells (Kohler and Milstein (1975) Nature 256, 495-497).

An immortalized cell producing the desired antibody may be selected by a conventional procedure. The hybridomas may be grown in culture or injected intraperitoneally for formation of ascites fluid or into the blood stream of an allogenic host or immunocompromised host. Human antibody may be prepared by in vitro immunisation of human lymphocytes, followed by transformation of the lymphocytes with Epstein-Barr virus.

For the production of both monoclonal and polyclonal antibodies, the experimental animal is suitably a goat, rabbit, rat, mouse, guinea pig, chicken, sheep or horse. If desired, the immunogen may be administered as a conjugate in which the immunogen is coupled, for example via a side chain of one of the amino acid residues, to a suitable carrier. The carrier molecule is typically a physiologically acceptable carrier. The antibody obtained may be isolated and, if desired, purified.

Detection Kit

The invention also provides a kit that comprises means for typing one or more of the polymorphisms defined herein. In particular, such means may include a specific binding agent, probe, primer, pair or combination of primers, or antibody, including an antibody fragment, as defined herein which is capable of detecting or aiding detection of the polymorphisms defined herein. The primer or pair or combination of primers may be sequence specific primers that only cause PCR amplification of a polynucleotide sequence comprising the polymorphism to be detected, as discussed herein. The primer or pair of primers may alternatively not be specific for the polymorphic nucleotide, but may be specific for the region upstream (5′) and/or downstream (3′). These primers allow the region encompassing the polymorphic nucleotide to be copied. A kit suitable for use in the primer-extension technique may specifically include labelled dideoxynucleotide triphosphates (ddNTPs). These may for example be fluorescently labelled or mass modified to enable detection of the extension product and consequently determination of the nucleotide present at the polymorphic position.

The kit may also comprise a specific binding agent, probe, primer, pair or combination of primers, or antibody that is capable of detecting the absence of the polymorphism. The kit may further comprise buffers or aqueous solutions.

The kit may additionally comprise one or more other reagents or instruments that enable any of the embodiments of the method mentioned above to be carried out. Such reagents or instruments may include one or more of the following: a means to detect the binding of the agent to the polymorphism, a detectable label such as a fluorescent label, an enzyme able to act on a polynucleotide, typically a polymerase, restriction enzyme, ligase, RNAse H or an enzyme which can attach a label to a polynucleotide, suitable buffer(s) or aqueous solutions for enzyme reagents, PCR primers which bind to regions flanking the polymorphism as discussed herein, a positive and/or negative control, a gel electrophoresis apparatus, a means to isolate DNA from sample, a means to obtain a sample from the individual, such as swab or an instrument comprising a needle, or a support comprising wells on which detection reactions can be carried out. The kit may be, or include, an array such as a polynucleotide array comprising the specific binding agent, preferably a probe, of the invention. The kit typically includes a set of instructions for using the kit.

Bioinformatics

The sequences of the polymorphisms may be stored in an electronic format, for example in a computer database. Accordingly, the invention provides a database comprising information relating to SNP ATP7a_Reg3_F_—6 (SEQ ID NO:142) and/or one or more polymorphisms in linkage disequilibrium thereof and their association with the protection of a dog from liver copper accumulation. The database may also comprise information relating to one or more polymorphisms in the GOLGA5, ATP7A or UBL5 genes and/or one or more polymorphisms in linkage disequilibrium thereof and their association with the susceptibility of a dog to liver copper accumulation. The database may include further information about the polymorphism, for example the degree of association of the polymorphism with the protection from, or susceptibility to, liver copper accumulation.

A database as described herein may be used to determine whether the genome of a dog comprises one or more polymorphisms indicative of protection from, or susceptibility to, liver copper accumulation. Such a determination may be carried out by electronic means, for example by using a computer system (such as a PC).

Typically, the determination of whether the genome of a dog comprises one or more polymorphisms indicative of protection from liver copper accumulation will be carried out by inputting to a computer system genetic data from the dog to a computer system; comparing the genetic data to a database comprising information relating to SNP ATP7a_Reg3_F_—6 (SEQ ID NO:142) and/or one or more polymorphisms in linkage disequilibrium thereof and their association with the protection of a dog from liver copper accumulation, and optionally comprising information relating to one or more polymorphisms in the GOLGA5, ATP7a or UBL5 genes and/or one or more polymorphisms in linkage disequilibrium thereof and their association with the susceptibility of a dog to liver copper accumulation; and on the basis of this comparison, determining whether the genome of a dog comprises one or more polymorphisms indicative of protection from liver copper accumulation. This information can then be used to guide the management of the liver copper levels of the dog.

The invention also provides a computer program comprising program code means for performing all the steps of a method of the invention when said program is run on a computer. Also provided is a computer program product comprising program code means stored on a computer readable medium for performing a method of the invention when said program is run on a computer. A computer program product comprising program code means on a carrier wave that, when executed on a computer system, instruct the computer system to perform a method of the invention is additionally provided.

As illustrated in FIG. 4, the invention also provides an apparatus arranged to perform a method according to the invention. The apparatus typically comprises a computer system, such as a PC. In one embodiment, the computer system comprises: means 20 for receiving genetic data from the dog; a module 30 for comparing the data with a database 10 comprising information relating to polymorphisms; and means 40 for determining on the basis of said comparison whether the genome of a dog comprises one or more polymorphisms indicative of protection of a dog from, or susceptibility of a dog to, liver copper accumulation.

Breeding Tool

Breeding value is defined as the value of an individual as a parent and is commonly used for improving desirable traits of life-stock in the farming industry. In order to improve the overall copper handling ability of dogs and to reduce the incidence of copper associated diseases, such as chronic hepatitis, it would be advantageous to select dogs for breeding that are protected from liver copper accumulation. This problem is solved by the use of polymorphisms that can be used to determine whether a dog is protected from liver copper accumulation in order to inform breeding.

For example, the copper handling ability of the offspring of two dogs may be influenced by the genotype of the parents at the ATP7A locus. The transfer of a particular variant at this locus could be beneficial to the offspring. By determining the genotype at this locus it will be possible to assess the breeding value of a prospective parent and thereby make decisions as to whether a given breeding pair are appropriate.

Accordingly, the invention provides a method of selecting a dog for producing offspring protected from liver copper accumulation comprising determining whether the genome of a dog comprises one or more polymorphisms indicative of protection from liver copper accumulation by a method of the invention in a candidate first dog; and thereby determining whether the candidate first dog is suitable for producing offspring protected from liver copper accumulation. The method may further comprise determining whether the genome of a dog comprises one or more polymorphisms indicative of protection from liver copper accumulation by a method of the invention in a second dog of the opposite sex to the first dog. If the results are that the first and/or second dog has a genotype indicative of protection from liver copper accumulation, the first dog may then be mated with the second dog in order to produce offspring protected from liver copper accumulation.

For example, the method may comprise determining the presence or absence of one or more polymorphisms selected from SNP ATP7a_Reg3_F_—6 (SEQ ID NO:142) and one or more polymorphisms in linkage disequilibrium thereof in the genome of the candidate first dog. More preferably the method comprises determining the presence or absence of the ATP7a_Reg3_F_—6 SNP (SEQ ID NO:142) and/or the ATP7a Reg16_F_—42 SNP (SEQ ID NO:143). The method of the invention may comprise determining the presence or absence of the T allele of ATP7a_Reg3_F_—6 (SEQ ID NO:142) and/or the T allele of ATP7a_Reg16_F_—42 SNP (SEQ ID NO:143). More preferably still, the method may comprise determining whether the dog is homozygous (in the case of female dogs) or hemizygous (in the case of male dogs) for the T allele of SNP ATP7a_Reg3_F_—6 and/or SNP ATP7a Reg16_F_—42 (SEQ ID NO:143). The presence of the SNP indicates that the first dog is protected from liver copper accumulation and is therefore a good candidate to be mated with a second dog. Preferably the first and second dog is homozygous or hemizygous for the T allele of the SNP. Homozygosity in either the first and/or second dog is most preferable as this increases the likelihood that the offspring will be homozygous and thereby protected from liver copper accumulation.

The invention also provides a method of selecting a dog for producing offspring protected from liver copper accumulation by making use of the polymorphisms of the invention that are indicative of susceptibility to copper accumulation. The absence of such polymorphisms in the genome of the dog indicates that the dog is a good candidate for mating. The method of the invention may therefore further comprise determining whether the genome of the candidate first dog comprises one or more polymorphisms indicative of susceptibility to liver copper accumulation; and thereby determining whether the candidate first dog is suitable for producing offspring protected from liver copper accumulation.

The method may comprise detecting the presence or absence in the genome of the candidate first dog of (c) a polymorphism in the GOLGA5, ATP7a or UBL5 gene that is indicative of susceptibility to liver copper accumulation and/or (d) a polymorphism in linkage disequilibrium with a said polymorphism (c). The method may further comprise determining whether the genome of a second dog of the opposite sex to the first dog comprises one or more polymorphisms indicative of susceptibility to liver copper accumulation. The method may therefore comprise detecting the presence or absence in the genome of a second dog of (c) a polymorphism in the GOLGA5, ATP7a or UBL5 gene that is indicative of susceptibility to liver copper accumulation and/or (d) a polymorphism in linkage disequilibrium with a said polymorphism (c). If the results are that the genome of the first and/or second dog does not have a genotype indicative of susceptibility to liver copper accumulation, the first dog may then be mated with the second dog in order to produce offspring that is not susceptible to liver copper accumulation.

The method may comprise determining the presence or absence of one or more polymorphisms selected from the SNPs identified in Table III, IV and V and one or more polymorphisms in linkage disequilibrium thereof in the genome of the candidate first dog. The presence of one or more of these polymorphisms indicates that the first dog is susceptible to liver copper accumulation and is therefore not a good candidate to be mated with a second dog to produce offspring protected from liver copper accumulation.

The candidate first dog and/or second dog may be of any breed. Preferably the candidate first dog and/or second dog has genetic breed inheritance of a breed selected from Labrador Retriever, Golden Retriever or Miniature Poodle. More preferably, the candidate first dog and/or second dog has genetic inheritance of the Labrador Retriever breed. The dog may be a purebred Labrador Retriever. Alternatively, the dog may be a mixed or crossbred dog, or an outbred dog (mongrel). One or both of the parents of the dog may be a pure-bred Labrador Retriever dog. One, two, three or four of the grandparents of the dog may be a pure-bred Labrador Retriever dog. The dog may have at least 50% or at least 75% of the Labrador Retriever breed in its genetic background. Thus, at least 50% or at least 75% of the dog's genome may be derived from the Labrador Retriever breed.

The genetic breed inheritance of a dog may be determined by assessing the allelic frequencies of genetic markers, for example SNPs or microsatellites. The combinations of allelic frequencies of different SNPs or microsatellites in a dog provide a signature that allows the breed of a dog or the breeds that make up a mixed breed dog to be determined. Such a genetic test may be a commercially available test. Alternatively, the dog may not need to be tested for a particular breed inheritance because it is suspected of having a particular breed inheritance for example by the dog owner or veterinarian. This could be for example because of knowledge of the dog's ancestry or because of its appearance.

Most purebred dogs of breeds recognized by all-breed club registries are controlled by “closed studbooks”. A studbook is typically the official registry of approved dogs of a given breed kept by, for example, a breed association or kennel club. It is generally termed a “closed” studbook if dogs can only be added if their parents were both registered. Most breeds have closed studbooks, resulting in inbreeding, as genetic diversity cannot be introduced from outside the existing population. In a number of breeds recognized by kennel clubs this has resulted in high incidences of genetic diseases or disorders and other problems such as reduced litter sizes, reduced lifespan and inability to conceive naturally.

In order to avoid the problems associated with inbreeding, it would be advantageous to select dogs for breeding within a particular breed that are more distantly related to each other compared to dogs that are more closely related.

Therefore in one aspect of the invention, the genetic breed inheritance of the candidate first dog and of the candidate second dog is determined in order to determine the degree of relatedness of the two dogs. In this aspect of the invention, the term “genetic breed inheritance” relates to the dog's genetic ancestry within a particular breed. The dog's genetic breed inheritance may be determined as described herein. By determining the dogs' genetic inheritance, it is possible to distinguish between dogs within a single breed in order to determine how closely related they are.

Therefore, in one aspect of the invention the degree of relatedness of the candidate first dog and the candidate second dog is determined, which comprises comparing the genetic breed inheritance of the candidate first dog with the candidate second dog of the same breed. Preferably the dogs are purebred dogs. The genetic breed inheritance of each dog may for example be determined by identifying the presence or absence of one or more breed-specific polymorphisms in said dog.

The degree of relatedness may be determined from the number of breed-specific polymorphisms that the dogs have in common. For example, two dogs of the same breed may have from 0 to 100% of the breed-specific polymorphisms tested in common, for example from 10 to 90%, from 20 to 80%, from 30 to 70% or from 40 to 60%. Therefore two dogs may have at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80% or 90% of the breed-specific polymorphisms tested in common. The percentage of tested breed-specific polymorphisms in common between two dogs may be used as a measure of their degree of relatedness. In this aspect of the invention, the two dogs would only be mated together if they are sufficiently genetically unrelated. For example, they may only be mated together if they have less than 60%, 50%, 40%, 30% or less than 20% of the breed-specific polymorphisms tested in common.

The invention also provides a method of selecting one or more dogs for breeding with a subject dog, the method comprising:

• • (a) determining for a subject dog and for each dog in a test group of two or more dogs of the opposite sex to the subject dog whether the genome comprises one or more polymorphisms indicative of protection from, and optionally one or more polymorphisms indicative of susceptibility to, liver copper accumulation; and
  • (b) selecting one or more dogs from the test group for breeding with the subject dog.

The test group may consist of at least 2, 3, 4, 5, 10, 15, 20, 25, 30, 50, 75, 100 or 200 different dogs, for example from 2 to 100, from 5 to 70 or from 10 to 50 dogs. The dogs are typically selected from the test group on the basis of being protected from liver copper accumulation. The dog or dogs selected from the test group may have the same or similar genetic breed inheritance as the subject dog.

The subject dog and each dog in the test group may be of any breed. Preferably the subject dog and/or each dog in the test group has genetic breed inheritance of a breed selected from Labrador Retriever, Golden Retriever or Miniature Poodle. More preferably the dog has genetic breed inheritance of the Labrador Retriever breed. The dog may be a purebred Labrador Retriever. Alternatively, the dog may be a mixed or crossbred dog, or an outbred dog (mongrel). One or both of the parents of the dog may be a pure-bred Labrador Retriever dog. One, two, three or four of the grandparents of the dog may be a pure-bred Labrador Retriever dog. The dog may have at least 50% or at least 75% of the Labrador Retriever breed in its genetic background. Thus, at least 50% or at least 75% of the dog's genome may be derived from the Labrador Retriever breed. In one embodiment of the invention, the dog within the test group that is most likely to be protected from liver copper accumulation, based on the presence or absence of polymorphisms associated with protection from or susceptibility to liver copper accumulation, is selected for breeding with the subject dog. In another embodiment, a number of the dogs within the test group that are likely to be protected from liver copper accumulation are selected for breeding with the subject dog. For example, at least 2, 3, 4, 5, 10, 15 or 20 dogs in the test group may be selected. A further selection may then be made from the group of selected dogs based on other factors, for example geographical location, age, breeding status, medical history, disease susceptibility or physical characteristics.

As explained above, it is desirable to mate dogs within the same breed that are most genetically unrelated. This is in order to increase or maintain genetic diversity within the breed, and to reduce the likelihood of problems relating to inbreeding arising within the offspring. A further selection of the dogs from the test group may therefore be based on the genetic relatedness of the dogs with the subject dog. Accordingly, in one aspect of the invention, the method may further comprise:

• • (a) comparing the genetic breed inheritance of the subject dog with the genetic breed inheritance of each dog in a test group of two or more dogs of the same breed and of the opposite sex to the subject dog;
  • (b) determining from the comparison the degree of relatedness between the subject dog and each dog in the test group; and
  • (c) selecting one or more dogs from the test group for breeding with the subject dog.

The dogs may be selected from the test group on the basis of their relatedness to the subject dog (i.e. the dog to be bred from). Preferably the dog or dogs selected from the test group are the most distantly related (i.e. have the lowest degree of relatedness) within the test group of dogs. The genetic breed inheritance of the subject dog and the dogs in the test group may be already known or may be determined e.g. by a commercially available breed test.

The invention thus provides a method of recommending one or more suitable dogs for breeding with a subject dog. The recommendation may be made to the subject dog's owner or carer, a veterinarian, dog breeder, kennel club or breed registry.

The invention also relates to a method of breeding dogs, wherein the protection from, or susceptibility to, liver copper accumulation of at least two dogs of the opposite sex is determined, optionally within the same breed, before breeding them together.

The protection from, or susceptibility to, liver copper accumulation of a dog may be stored in an electronic format, for example in a computer database. Accordingly, the invention provides a database comprising information relating to the susceptibility to, or protection from, liver copper accumulation and sex of one or more dogs. The database may include further information about the dog, for example the dog's genetic breed inheritance, breeding status, age, geographical location, medical history, disease susceptibility or physical characteristics. The database will typically further comprise a unique identifier for each dog, for example the dog's registered name. The database may be accessed remotely, for example using the internet.

Foodstuff of the Invention

The present invention is concerned with a foodstuff for dogs having the genetic inheritance of the Labrador Retriever breed. The inventors found that the level of copper found in commercial diets is associated with liver copper accumulation in Labrador Retrievers and that reducing the level of copper in the diet surprisingly allows the liver copper level to be brought to a normal level more efficiently than the drug penicillamine. The foodstuff of the invention has a low copper concentration, specifically a copper concentration of less than 21 mg/kg dry matter. The foodstuff is used to prevent the accumulation of copper in the livers of Labrador Retrievers. It is therefore useful for preventing a disease or condition attributable to liver copper accumulation. Thus, the foodstuff of the invention can be given to a dog wherein the genome of the dog has been determined to comprise one or more polymorphisms indicative of susceptibility to liver copper accumulation by a method of the invention. The term “foodstuff” as used herein covers foodstuff, diet, comestible or supplement. Any of these forms may be solid, semi-solid or liquid.

In more detail, the foodstuff of the invention comprises copper at a concentration of less than 21 mg/kg dry matter. Preferably, the copper concentration is less than 20, less than 17, less than 15, less than 12, less than 10 or less than 8 mg/kg dry matter. Preferably, the copper concentration is at least 3, at least 3.5, at least 4, at least 4.5, at least 4.75, at least 5 or at least 8 mg/kg dry matter. Typically, the copper concentration is in the range of 3 to 21 mg/kg, preferably 4 to 12 mg/kg, 4.5 to 12 mg/kg, 4 to 11 mg/kg, 4.5 to 11 mg/kg, 4 to 10 mg/kg, 4.5 to 10 mg/kg, 4 to 9 mg/kg, 4.5 to 9 mg/kg, 4 to 8 mg/kg, or 4.5 to 8 mg/kg dry matter. The copper may be present in the foodstuff in any physiologically acceptable form. Thus the copper may be provided in any physiologically acceptable salt such as copper sulphate.

The foodstuff may further comprise zinc at a concentration of at least 120 mg/kg dry matter. Preferably the zinc concentration is at least 150, at least 180 or at least 200 mg/kg dry matter. Preferably the zinc concentration does not exceed the maximum allowed by food regulatory authorities. Typically, the zinc concentration is less than 250, less than 240, less than 230 or less than 220 mg/kg dry matter. Typically, the zinc concentration will be in the range of 120 to 250, 150 to 250 or 200 to 250 mg/kg dry matter.

Preferably the amount of zinc in the foodstuff exceeds the amount of copper. It will be appreciated that the effective concentration of zinc and/or copper in the foodstuff that is ingested by the dog is affected by the presence or absence of non-digestible matter. Preferably the ratio of zinc to copper in the foodstuff is 5 or more, for example 6, 7, 8, 9, 10 or more, by mass of the foodstuff.

The zinc may be provided in the same foodstuff providing the level of copper of the invention. Alternatively, zinc may be provided in the form of a supplement, which can be added to a foodstuff of the invention. A supplement can be in the form of a tablet, powder or liquid formulation. The Zinc may be present in the foodstuff or provided as a supplement in any physiologically acceptable form. Thus the zinc may be in any physiologically acceptable salt such as zinc acetate, zinc sulphate, zinc gluconate, zinc carbonate, zinc chloride or zinc oxide.

The concentration of copper or zinc in the foodstuff is described herein on a dry matter basis, i.e. on the basis of the foodstuff without water, to enable direct comparison between different foodstuffs that may have different moisture content. To measure the concentration of copper or zinc in a wet or semi-wet foodstuff, a sample of the foodstuff is first dried, for example using an oven, to remove water. Thereafter, any suitable technique may be used to measure the concentration of copper or zinc in the sample of the dried foodstuff. An example of such a technique that is well known in the art is flame atomic absorption spectrophotometry.

The foodstuff of the invention may be in the form of, for example, a wet pet food, a semi-moist pet food or a dry pet food. Wet pet food generally has a moisture content above 65% by weight. Semi-moist pet food typically has a moisture content between 20-65% by weight and can include humectants and other ingredients to prevent microbial growth. Dry pet food, also called kibble, generally has a moisture content below 20% by weight and its processing typically includes extruding, drying and/or baking in heat.

The foodstuff may be provided as a mixture of wet and dry food. Such a combination may be provided premixed or may by provided as two or more separate foodstuffs, which are provided to the dog separately, simultaneously or sequentially.

The foodstuff encompasses any product that the dog consumes in its diet. The invention covers standard food products as well as pet food snacks. The foodstuff is preferably a cooked product. It may incorporate meat or animal-derived material (such as beef, chicken, turkey, lamb, fish etc). The product may alternatively be meat-free (preferably including a meat substitute such as soya, maize gluten or a soya product in order to provide a protein source). The product may also contain a starch source such as one or more grains (e.g. corn, rice, oats, barley etc), or may be starch free.

The ingredients of a dry pet food may be selected from cereal, grain, meat, poultry, fat, vitamin and mineral. The ingredients are typically mixed and put through an extruder/cooker. The product is then typically shaped and dried, and after drying, flavours and fats may be coated or sprayed onto the dry product.

All pet food is required to provide a certain level of nutrients. For example, the Association of American Feed Control Officials (AAFCO) and the Pet Food Institute have established nutrient profiles for dog foods, based on commonly used ingredients. These established profiles are called the “AAFCO dog food nutrient profiles”. Under these regulations, dog foods must be formulated to contain concentrations of nutrients that meet all minimum levels and not to exceed the maximum levels as determined by AAFCO.

The dog food formulation may be customised according to the caloric, protein, fat, carbohydrate, fibre, vitamin or mineral requirements of the dog. For example, the dog food formulation may be customised to provide the correct amounts or ratio of essential fatty acids such as omega-6 and omega-3 fatty acids. The main sources of omega-6 fatty acids are plants such as sunflower, soyabean oil, safflower and evening primrose oil, whereas omega-3 fatty acids are mainly found in linseed and marine sources. Food ingredients that are high in copper and may be avoided in the production of the foodstuff include shellfish, liver, kidney, heart, meat, nuts, mushrooms, cereals, cocoa, legumes and soft water (copper pipes). Food ingredients that are rich in zinc and may be included in the formulation include milk, gelatin, egg yolks, rice and potatoes.

The foodstuff is preferably packaged. The packaging may be metal (usually in the form of a tin or flexifoil), plastic (usually in the form of a pouch or bottle), paper or card. The amount of moisture in any product may influence the type of packaging, which can be used or is required.

The foodstuff of the invention may be packaged together with a source of zinc. Zinc may be provided in any form. Zinc may be provided within one or more foodstuffs or in the form of a separate supplement that is packaged with the foodstuff comprising the maximum level of copper of the invention. When the zinc is provided in a foodstuff, it may be provided within the same foodstuff containing the particular level of copper of the invention or it may be provided in one or more separate foodstuffs or both. The invention therefore provides a pack comprising a foodstuff having copper at a concentration of less than 21 mg/kg dry matter and a zinc supplement. The zinc supplement provides a concentration of at least 120 mg/kg dry matter when added to the foodstuff. The foodstuff and zinc supplement are for simultaneous, separate or sequential use in preventing a disease attributable to liver copper accumulation in a dog having genetic inheritance of the Labrador Retriever breed.

The invention also provides a labelled foodstuff as discussed herein. The label may for example indicate that the foodstuff is suitable for a dog of the Labrador

Retriever breed. Other indications or instructions could be provided. For example, the amount of copper and/or zinc that the diet or foodstuff contains, in addition to other ingredients, may be stated. Furthermore, feeding instructions could be provided.

Labrador Retriever

The foodstuff of the invention is suitable for preventing liver copper accumulation in a dog having genetic inheritance of the Labrador Retriever breed. The dog is typically a companion dog or pet. The dog may be a purebred Labrador Retriever. Alternatively, the dog may be a mixed or crossbred dog, or an outbred dog (mongrel). One or both of the parents of the dog may be a pure-bred Labrador Retriever dog. One, two, three or four of the grandparents of the dog may be a pure-bred Labrador Retriever dog. The dog may have at least 50% or at least 75% of the Labrador Retriever breed in its genetic background. Thus, at least 50% or at least 75% of the dog's genome may be derived from the Labrador Retriever breed.

The genetic breed background of a dog may be determined by assessing the allelic frequencies of genetic markers, for example SNPs or microsatellites. The combinations of allelic frequencies of different SNPs or microsatellites in a dog provide a signature that allows the breed of a dog or the breeds that make up a mixed breed dog to be determined. Such a genetic test may be a commercially available test. Alternatively, the dog may not need to be tested for Labrador Retriever breed inheritance because it is suspected of having a Labrador Retriever breed inheritance for example by the dog owner or veterinarian. This could be for example because of knowledge of the dog's ancestry or because of its appearance.

The food is suitable for a dog of any age. The food may be suitable for a dog that has an age of from 0 to 12 years old, for example from 1 to 5 years old, from 2 to 7 years old or from 3 to 9 years old.

Generally, the foodstuff is suitable for a healthy dog. It is suitable for a dog that does not have a detectable accumulation of hepatic copper. The foodstuff is intended for prophylactic use, i.e. to prevent the accumulation of copper in the liver of a dog. The foodstuff is intended for minimising the risk of copper accumulation and thereby reducing the probability of the dog from developing a disease or condition attributable to liver copper accumulation such as chronic hepatitis, cirrhosis or liver failure. Typically, the foodstuff is for use in preventing copper accumulation in a dog that does not have an abnormal hepatic copper concentration and is therefore not likely to be at risk of suffering from copper-associated hepatitis. The dog may also have no history of accumulating copper. The dog therefore preferably has a normal level of hepatic copper in the range of less than about 400 mg/kg of dry liver weight. However, in newborn dogs the normal level of hepatic copper may be considered to be less than about 600 mg/kg dry liver weight. The aim of providing the foodstuff to the dog is to prevent the hepatic copper concentration from reaching levels significantly higher than the normal level. Methods that can be used to determine the concentration of copper in the liver of a dog are well known in the art. A suitable method is described in Example 4.

The foodstuff can be used for preventing copper-associated chronic hepatitis. The foodstuff is preferably for use in preventing copper accumulation in a dog that does not have detectable liver disease, with the aim of preventing such liver disease. The foodstuff could also be used to treat a disease or condition attributable to liver copper accumulation, such as chronic hepatitis, cirrhosis or liver failure. Evidence or symptoms of liver disease include clinical indications such as lethargy, diarrhoea and icterus. Biochemical indications of liver disease include abnormally increased serum bilirubin and serum liver enzyme activities such as alkaline phosphatase (ALP), alanine aminotransferase (ALT), aspartate aminotransferase (AST) and gamma-glutamyl transpeptidase. The biochemical measurement of such liver disease indicators is well known in the art.

Preferably the dog that the food is intended for does not have any clinical problems.

Food Manufacturing

The foodstuff of the invention can be made by mixing together suitable ingredients. The manufacture is controlled so that the foodstuff has the required copper concentration. The concentration of copper may be monitored during the foodstuff production process. The invention therefore provides a method of making the foodstuff of the invention comprising mixing together the ingredients for the foodstuff so that the foodstuff has a copper concentration of less than 21 mg/kg dry matter. One or more of the components to be incorporated into the foodstuff may provide a source of copper. However it is important to avoid the use of components that are likely to be rich in copper. Food ingredients that are high in copper and may be avoided in the production of the foodstuff include shellfish, liver, kidney, heart, meat, nuts, mushrooms, cereals, cocoa, legumes and soft water (copper pipes). Optionally, one or more of the components will provide a source of zinc for the foodstuff of invention. Food ingredients that are rich in zinc and may be included in the formulation include milk, gelatin, egg yolks, rice and potatoes. The components/ingredients may be added at any time during the manufacture/processing of the foodstuff.

It is important to measure the concentration of copper that is present in the foodstuff to determine that the concentration is below the limit according to the invention. The concentration of zinc could also be measured to check that it is above the minimum level that is preferred according to the invention. One of the steps in the method of manufacture of the foodstuff may comprise measuring the copper concentration in a sample of the foodstuff At least one measurement of the copper concentration may be made from a sample of the foodstuff after the foodstuff has been prepared. Measurements could also be made during the preparation of the foodstuff in order to monitor the levels of copper and/or zinc that are accumulating by the addition of further ingredients. For example, a measurement could be made on a sample after the addition of one or more ingredients. Measurements of copper, zinc and other elements can be made on a sample using any suitable method known in the art such as flame atomic absorption spectrophotometry.

Typically, the method of making the foodstuff of the invention comprises the steps of mixing together the ingredients with optional cooking of any raw ingredients; measuring the concentration of copper, and optionally zinc, in a sample of the foodstuff; and packaging the foodstuff. The method of making the foodstuff may further comprise providing the dog's owner, the person responsible for feeding the dog or a vet with the foodstuff and/or providing the foodstuff to the dog.

Whilst it would be unusual for a foodstuff not to contain any copper, copper could be added as a supplement to the foodstuff in order to achieve the minimum daily requirement of copper in the dog's diet (for example as recommended by the American Feed Control Official (AAFCO)) whilst still maintaining the copper concentration at a level below that required by the invention. The invention therefore also provides the use of copper in the manufacture of a foodstuff for a dog having genetic inheritance of the Labrador Retriever breed, wherein the foodstuff comprises copper at a concentration of less than 21 mg/kg and is for use in preventing copper accumulation in said dog. The copper may be added to the foodstuff in any suitable form. Examples of copper supplements include cupric chloride and cupric sulphate pentahydrate. The food product manufacturing apparatus used in the present invention typically comprises one or more of the following components: container for dry pet food ingredients; container for liquids; mixer; former and/or extruder; cut-off device; cooking means (e.g. oven); cooler; packaging means; and labelling means. A dry ingredient container typically has an opening at the bottom. This opening may be covered by a volume-regulating element, such as a rotary lock. The volume-regulating element may be opened and closed according to the electronic manufacturing instructions to regulate the addition of dry ingredients to the pet food. Dry ingredients typically used in the manufacture of pet food include corn, wheat, meat and/or poultry meal. Liquid ingredients typically used in the manufacture of pet food include fat, tallow and water. A liquid container may contain a pump that can be controlled, for example by the electronic manufacturing instructions, to add a measured amount of liquid to the pet food.

In one embodiment, the dry ingredient container(s) and the liquid container(s) are coupled to a mixer and deliver the specified amounts of dry ingredients and liquids to the mixer. The mixer may be controlled by the electronic manufacturing instructions. For example, the duration or speed of mixing may be controlled. The mixed ingredients are typically then delivered to a former or extruder. The former/extruder may be any former or extruder known in the art that can be used to shape the mixed ingredients into the required shape. Typically, the mixed ingredients are forced through a restricted opening under pressure to form a continuous strand. As the strand is extruded, it may be cut into pieces (kibbles) by a cut-off device, such as a knife. The kibbles are typically cooked, for example in an oven. The cooking time and temperature may be controlled by the electronic manufacturing instructions. The cooking time may be altered in order to produce the desired moisture content for the food. The cooked kibbles may then be transferred to a cooler, for example a chamber containing one or more fans.

The pet food manufacturing apparatus may comprise a packaging apparatus. The packaging apparatus typically packages the pet food into a container such as a plastic or paper bag or box. The apparatus may also comprise means for labelling the pet food, typically after the food has been packaged. The label may indicate the type of dog that the foodstuff is suitable for (i.e. Labrador Retriever), and/or the ingredients of the food.

Use of the Foodstuff

The foodstuff of the invention may be used in a method of preventing liver copper accumulation in a dog. Therefore, it may be used for preventing a disease or condition associated with high liver copper such as copper-associated chronic hepatitis, cirrhosis or liver failure. Accordingly, the invention provides a method of preventing liver copper accumulation and a disease attributable to liver copper accumulation in a dog having genetic inheritance of the Labrador Retriever breed, comprising feeding the dog the foodstuff as described herein. The invention also provides a method of preventing copper-associated chronic hepatitis in a dog having genetic inheritance of the Labrador Retriever breed comprising providing the foodstuff of the invention to the dog. The foodstuff of the invention is typically for prophylactic use in preventing the accumulation or copper in Labrador Retrievers. It is also typically for preventing copper-associated chronic hepatitis in Labrador Retrievers.

The foodstuff of the invention is preferably for use in a method of preventing the accumulation of liver copper in a dog, the genome of which dog has been determined to not comprise one or more polymorphisms indicative of protection from liver copper accumulation, and optionally has been determined to comprise one or more polymorphisms indicative of susceptibility to liver copper accumulation, by the genetic test described herein.

Therefore the invention provides a method of preventing a disease attributable to liver copper accumulation in a dog having genetic inheritance of the Labrador Retriever breed, comprising (i) determining the likelihood that a dog is protected from liver copper accumulation comprising detecting the presence or absence in the genome of the dog of one or more polymorphisms selected from (a) SNP ATP7a_Reg3_F_—6 (SEQ ID NO:142) and (b) one or more polymorphisms in linkage disequilibrium with (a); and (ii) prescribing, providing or feeding the dog with a foodstuff comprising copper at a concentration of at least 4.5 to less than 12 mg/kg dry matter. The foodstuff may be provided to the dog's owner, carer or vet. The invention also provides a foodstuff for use in said method.

The use of the foodstuff of the invention may comprise providing a source of zinc to the dog. As described herein, zinc may be provided in any suitable form to the dog. The foodstuff containing the low level of copper of the invention may further comprise zinc, for example at a concentration of at least 120 mg/kg dry matter. Alternatively, zinc may be provided in the form of one or more separate foodstuffs or supplements. The use of the foodstuff of the invention may comprise providing a zinc supplement to the dog. A zinc supplement could be provided at any time, i.e. separately, simultaneously or sequentially to the foodstuff of the invention. The zinc supplement could for example be mixed with the foodstuff of the invention before it is provided to the dog, or it could be put into the dog's drinking water.

The foodstuff of the invention may be provided to the dog one or more times per day. The foodstuff is preferably provided in place of the dog's conventional food. The method of preventing copper accumulation or preventing chronic hepatitis may be used for an indefinite period of time, i.e. throughout the dog's life.

The invention is illustrated by the following Examples:

EXAMPLE 1

Elucidation of SNPs Associated with Susceptibility to Copper Accumulation

120 Labrador DNA samples were genotyped across more than 22000 SNPs. There were 72 dog samples from high copper dogs (liver levels of copper above 600 mg/kg) and 48 dog samples from normal copper liver levels (below 400 mg/kg). The data was analysed using pairwise comparison between every possible pair of dogs. Data was ordered according to support of a disease informative locus. Data from the best three genomic locations was used using Boolean operators to find the best fitting markers linked to high copper levels. Results of a simple Boolean model using the three locations are given below:

TABLE I
Results of simple Boolean model using the genomic locations CFA8,
CFA32 and CFAX
CFA8	CFA32	CFAX	% of dogs with
(GOLGA5	(UBL5	(ATP7A	this pattern of
gene	gene	gene	alleles that have
region)	region)	region)	high copper
1	x	x	69.0%
1	1	x	72.3%
1	1	1	81.5%	Of the 27 dogs
				with all three
				alleles, 22 (81.5%)
				have high copper
1	1	0	60.0%
1	0	x	64.9%
1	0	1	77.8%
1	0	0	60.7%
0	x	x	36.1%
0	1	x	55.6%
0	1	1	42.9%
0	1	0	63.6%
0	0	x	16.7%
0	0	1	50.0%
0	0	0	7.1%	Of the 14 dogs
				with none of the
				three alleles, 1 has
				high copper
The key to the binary values in Table I is as follows:
Genomic location CFA8 (GOLGA5 gene)
1 = if there is an AA genotype at SNP BICF2P506595
0 = if there is any other genotype at SNP BICF2P506595
Genomic location CFA32 (UBL5 gene region)
1 = if there is a GG at BICF2P772765, a CC at BICF2S2333187 and a GG at BICF2P1324008
0 = if any of those SNPs show a different genotype
Genomic location CFAX (ATP7A gene region)
1 = if there is an AA or an AG at BICF2P591872
0 = if there is a GG at BICF2P591872
In all locations, X = unused alleles.

Table I represents the binary conditions of alleles at three genomic locations. At genomic location CFA8, one SNP was used (SNP 1). At genomic location CFA32 three SNPs were used (SNPs 2, 3 and 4). At genomic location CFAX one SNP was used (SNP 5). The binary values are indicative of a dog having alleles that are indicative of susceptibility to copper accumulation (“bad” alleles). For instance 000 represents not having any of the three bad alleles. 111 represents having all three bad alleles. The Xs are unused alleles at that gene. The lines 1xx and 0xx show the power that a one gene test only using the SNP in the GOLGA5 gene would have.

Table II shows that dogs with more of the indicative alleles have higher copper concentration on average. We can also see the number dogs with each pattern:

TABLE II
	Average	% of dogs with this	Number
Gene	amount of	pattern of alleles that	of dogs with
Combination	Cu2 (mg/kg)	have high copper	pattern
111	1253.09	81.5%	27
110	733.40	60.0%	20
101	1138.90	77.8%	9
100	737.84	60.7%	28
011	502.27	42.9%	7
010	670.83	63.6%	11
001	450.00	50.0%	4
000	332.47	7.1%	14

Table III shows the position and sequence of the SNPs used for the results in Tables I and II.

The results implicated three genomic locations (in and around the GOLGA5, UBL5 and ATP7A genes) associated with susceptibility to copper accumulation. Further SNPs in these regions that are indicative of susceptibility to copper accumulation are provided in Table IV.

TABLE III
Position and sequence of SNPs used for results in Table I and II
				Gene containing
SNP name	SEQ ID	Chromosome	Location in	or close to	SNP Sequence
(SNP no.)	NO:	in canfam 2	canfam 2	mutation	SNP = [first allele/second allele]
BICF2P506595	1	8	4886813	GOLGA5	CTCAGAACTAGATAGGCTAATAAGTGATAGGCCTTGTGTTTTC
(SNP 1)					CTAGAGTGTGCTTTAAA[A/G]GTTTCTTAAGCTAAAAAATTA
					CATTCGTGAGAAAATTGAAATAAAAGGAAAACAGTCATG
BICF2P772765	2	32	39278300	UBL5	TCTCAGATACTTGATAGCCAGCATTTCCCCCCATTTTCTTCCA
(SNP 2)					AGAGCACGAAAGCATAG[A/G]AATGATATTACATCTCGTATG
					GTGAATGTGACACAGCCGTCAGTTGCGTTAGCTCTGCTT
BICF2S2333187	3	32	39390236	UBL5	TATTACCCTGCTCTCCAGCCACTCCTTTACCTTCCATTAGCCC
(SNP 3)					ACACCTGCTCTACACAC[T/C]ATTGCTCATGGAAGCCTTGCC
					ACGTCCAGTCGCCACTCTGAAATGCCAGCATCCCTCCCA
BICF2P1324008	4	32	40043909	UBL5	GACCTGACAGATTATGTAGACTTTGTTTTCAAAGGGAGCACCT
(SNP 4)					GCTGGATATACAACATG[A/G]CACTAAATTGTGCTCCACATC
					CTTGGCAGAGGTGGGGGGCGGGGCACAAAGGAAGAAACC
BICF2P591872	5	X	62989720	ATP7A	GGGCCCAGCAAGTGGCAGAACTGGGAAGACCCCCTCTTCTTCC
(NP5)					GCCTGGAGCAGTGGTGT[A/G]GCAGCACACCACAGGAGTCTG
					AAAGGGTGGGGAGTCCAAACGGGAACATATACCTGAGAT

TABLE IV
Position and sequence of further SNPs indicative of susceptibility to liver copper accumulation
		Chromo-
		some
	SEQ	in	Location		Minor
SNP name	ID	canfam	in	Allele	Allele	SNP Sequence
(SNP no.)	NO:	2	canfam 2	Frequency	Frequency	SNP = [first allele/second allele]
BICF2P1246154	6	X	47335181	0.999507	0.000493	GGCAACAGGGACAGGCTGCTGGGCCACACACTCACCCACACT
(SNP 6)						AGGAGACAAGATCCTCCA[T/C]ATCCTGGGTCTCTATCAGT
						CAATCACCTAGACCAGTGGGCCAGAGGACAGGGTCCAGCTG
BICF2P463335	7	X	44401786	0.000493	0.000493	GTTGAGAGAGATCATACAGATTCATGTGGCAGGTGCACACTT
(SNP 7)						TTTCTACCTCTTACAACG[T/C]ATTCTCTCTGGCCATTCCT
						TCTCCTGGGTCCCAAAGTCGGAGAGCTTAGCGGGAGCCTAG
BICF2P1246989	8	8	4149835	0.999506	0.000494	ataagttcacattttgGTGTTTCAAGTGGACATGAATGGAGG
(SNP 8)						GGAGGGCCCTGTTCAATC[T/C]ACTAAAGTGTTTTTTCATC
						TTGTTTTTGTGGAAATCAAATCAAGAAGCAGAGTTTTATGT
BICF2P723557	9	8	3406227	0.999014	0.000986	ACTCTCCCGATGTGGGCACCATATGGTGGACCACTTTCTGTG
(SNP 9)						TGAGATGCCTGCTCTTAT[T/C]GCCATGTCCTGTGAAGACA
						CCATGCTGGTGGAAGCATTTGCCTTTGCCCTGGGTGTTGCC
BICF2S23427298	10	8	5393517	0.999014	0.000986	AATCTAAGTAGACTGAGTGGTCACCTTCAGCGCTCAGACCTG
(SNP 10)						AGCATACAAAGCATGGAA[A/G]GTTACTGTGATTCAGCTGA
						TGTAATGGAATGAAATAAATATAAGAGTTTGGTAACCTAAT
BICF2P312189	11	8	5773958	0.999014	0.000986	TGGAGAGTGCTGGCAGGCAGGGGCAGGCAAACAACAATAGCA
(SNP 11)						AAGATCTCTTCCACGCTT[T/C]TACTTCCTCAAAAGTCCAA
						GCCCTCTTAAGATCGCATTTTCTTAGTGACCTTCACTCTAA
BICF2S24321583	12	X	56410647	0.999014	0.000986	TTCTTTGCTAGGCCAAGGGCAGAGAATGCATGCCCCCCCTTA
(SNP 12)						CCTCCCAGGGCCCAAGAG[C/G]CATCCTGAGCTGAGTCTAT
						GGCTCCTGGTGGGGGGCGGCTGTGGGTTGGGGGGGCACAGA
BICF2P1273450	13	8	3160594	0.999013	0.000987	ggtgtcaccaatgccagcgagcaccagctggagggaacagga
(SNP 13)						cacaggtcctccgtcCTG[T/C]GACACTCGGATCTGGGGCT
						TTGCCTCCAAAACGGAGACCATGCCTGTCCATGGTTCTACG
BICF2P1439540	14	8	3771142	0.998521	0.001479	CTCTAGAACCCTTCAGGTAGACTACATTCACTTTCTACTACA
(SNP 14)						ACTTCATCACCACAACCA[A/T]CTCCCAGTAACCCCCtttt
						tttcttctcctttttttattttttccttctttttgctcgtc
BICF2P506204	15	8	4191144	0.998521	0.001479	TCCCATGGGTTGAAGGATATCTGGCAGACGGCTCCAACTCCA
(SNP 15)						GTAAAGCCTCAGGCCTCA[A/G]CCAGGAGTTCCCCGGGGCT
						TCATTCCCATCCCAGACTTTGCCCAGGGCTGATTTGAAAGT
BICF2P380732	16	8	3299879	0.998519	0.001481	TCTTCCTTGCAGATTGGATGGCTGTAGCCTCACCTCACACTG
(SNP 16)						TTGCTGGGATCTGTCCAC[A/G]CTTCTGACCTCCAGCAAGA
						GCCTCCGGGAGCTAAGCCTGGGCAGCAATGACCTGGGAGAT
BICF2G63016020	17	X	73980557	0.004955	0.004955	TATTGCTAGTAAAGCCAAACTTTCTATTCCACAATTATAAAC
(SNP 17)						TCATGGAGATGGTAATTA[T/C]AGTGCATTATTTGTCAAAT
						TTTATTATTTTTTCAAATCCCAAAGAAAATGTGATATTCTA
BICF2S23623569	18	32	38362784	0.994576	0.005424	AAGAACAAGGATACAATCTAAGTGATAATCATCCAGCATGTA
(SNP18)						CTTGTCCTGTTTTCAGAT[T/G]ATCAGCTTAAGTCAAGAGG
						AATTTTTAGTGCTTACAAATATTTCAAGTGATTTTTCCAGA
BICF2P216837	19	8	7474389	0.012327	0.012327	TGAAGGGGTGCTACTCAGGGCTCTTCATTTAACCTTCCAGGA
(SNP 19)						TGTTTTCCTATGTACTCA[T/C]TCTTCCTTTTGGTTGCTCC
						TTCTTCTTGCATTTCTTTATCTCTTTACAGAATCATCCAGG
BICF2S22922146	20	X	75388683	0.986193	0.013807	acaaccctaaaatttcagtgattcagtacaacaaaggtttat
(SNP 20)						tATAACCATTCAGGGATC[C/G]AAGTTGGTAGAAACTTCAC
						TACAATACCTGCTTCCAGTCAACAAGACAGAAAAAGAAAAA
BICF2G63015714	21	X	74415223	0.01382	0.01382	GCAGGGTTGATATATAACTAGTATGCATTAGGTAGACACCTA
(SNP 21)						TTTTGATTACTCACTATT[T/G]TAATATCAGCCTGGTAGTA
						AGAACCAAATCTATTATGTAAAGTGCATAGAGAATTGaaag
BICF2G63015674	22	X	74439123	0.0143	0.0143	CTAGCTAGCCACCCAACTCCCCACATGCCCAGAGTCATCGTT
(SNP 22)						TATCTTTTCACATCAGCA[T/C]TACATTTTGGCTTGCATTC
						AAACATTAGCCCATTTTTTTTCCTTTTGTTTTATTTATAGA
BICF2P426463	23	8	5833993	0.015286	0.015286	TTTTCTCTTTTTCCATAAATGCTCTGGGCTTATTTTCATTAT
(SNP 23)						CTAGTATTTCTCTTCTGA[A/G]GCTAACTCCCAAAGAGTTT
						TGTGCATCCTTATTTCCATCACAAGGTCAATGTACGAGTTA
BICF2S22926688	24	8	7502279	0.015779	0.015779	GGGCCCAAGGGCTGAGGATCTCTGTACCTTCTGCTTCTTGGC
(SNP 24)						AGCCCAGGCTGGGTAGCA[T/G]TTCTTGGAAGAGGATTTCC
						CATGAGTTGTTAACAGAAGGGCGGGCTTCCAGGCGCTGCTT
BICF2P1113947	25	32	38074100	0.981169	0.018831	CATCTTTGCTTGGGGCCTGGGGTTTTTATTGAGGATTGTGAT
(SNP 25)						CTGGTGTATGTGTCTCCT[T/C]AGGCATCCAGAAACCATTC
						AGAACAAGAACAAGCGTCCAGGTATCCTCTGTAAGTCACTT
BICF2P342874	26	X	44861101	0.020217	0.020217	ACAAACCCTCAGACCCAGATACACAGTATCATGTGGACACAG
(SNP 26)						ACATGTAACACCAAAATG[A/C]CCAACATCATGTGACTACA
						GGCCCTAAGCAACTAGGTGTAACATCACTTGGGTATGGGCC
BICF2P1171925	27	32	36457625	0.022189	0.022189	AATGCAGTAATACATGTAGCTAAACCTAACCATCAGAGTCTG
(SNP 27)						TTCTATCCTTCTACAAAA[A/G]TAGGGTTGGAGCTGAGCAC
						ATAGGTAGCATACATCTAGCAAAAGTTTTTGCCTTCAgatt
BICF2G63017200	28	X	71984532	0.025641	0.025641	ttgtggggtcaggtgagttatggacccctccctactcttctg
(SNP 28)						ctatcttgccccCTACAG[T/G]GGTTGCTATTTTGATGTAA
						TCACAAAACGACCTGGCAATAAAACCTTTTTCTAATTAggg
BICF2P1286548	29	X	57448138	0.026423	0.026423	GATGCAAGCTGGGACAGAATAAGGTACTGGGCTGTGTCAAGC
(SNP 29)						CCCAGTAAGAGAGGAGCA[T/C]TGTAGGGTAGTTAGGATGG
						ACTTAATGGAGATGAGTCCTAGGGAGCCACACTCAGAGTTA
BICF2P790089	30	32	38885957	0.0286	0.0286	TAAACACCCCCAATCACTACCATCCTCACACCTAAGGATACA
(SNP 30)						CAATGTGTCTACTTTATG[A/G]TATGTCTTTACTATTCGTT
						GCTTATGAAATTTTATTCATTAWCTAAAACAGGGAAAAAAG
BICF2G63016713	31	X	72619011	0.9714	0.0286	TATAGYTGGSCAATTAAATCTCCTATTCTTTTGTCTCAAAGG
(SNP 31)						ATATTTGAAATTACATAG[T/C]TCTTTTCTCATATAAAACC
						TACCATACAATCATTAGATGATCCTTCTTAGTTAATTTTTT
BICF2P276536	32	8	3149437	0.966436	0.033564	GATGCTGTGGGCCAGTCCAGAACCCACCTGAGAGAAACAAAC
(SNP 32)						AGGCCTCTTTGCCAGCAG[A/G]GCAGCGTCAGTGTCACCCC
						TGTGACATGTCAGAACCTCCCTGAAAGTTCATCTAACCTCT
BICF2G63015658	33	X	74531965	0.963018	0.036982	GGCTCAGAAGAAAAATCAGCCCAGTTCACATCCAATGTTTCC
(SNP 33)						ACACATCTAATCGTCTTG[A/G]GTTCAGAGGTAGATGTGGT
						ATCACTTAYATGGACACATATAACAGCTGGCCCCCACCTCT
BICF2P308749	34	8	7325380	0.962032	0.037968	gtttcagttaattatagtccttactggatccgattgctgtgg
(SNP 34)						cgctaaaatgaAAGAAGG[T/C]Agggtacctgggtggctca
						ggggttgagaatctgcttttgactcaggtcatgatcccagg
BICF2P872820	35	8	6388554	0.956114	0.043886	CAGAGTAGCATTATTTTCTGCTGTATGAGGACACTTTTGTTA
(SNP 35)						TATCCACAGTGGACAGAA[A/G]ACTGGGTTTTAGAACATGC
						TCAATTGAAACAAGACTGAGGGCTCACAAATTCCTGCTCCA
BICF2G63016210	36	X	73592920	0.955084	0.044916	TTACTTATTCATCTGAGACCAAGGCCACTGTGGTGAACCTAC
(SNP 36)					AAAGCCTTACAAAGCAGG[A/G]CCAGAAGGGCACATAAATC
						ACTTGACTAACATTTGGTCAAAATAGCTCTTGGGCTCTTTT
BICF2G63016209	37	X	73593955	0.049456	0.049456	ATAAAAATAAAAGAGCTATTAATAAGAACTCATAAAATCTAC
(SNP 37)						ATAAATATAGTAACAGGT[TIC]AATATTCCCAGCATATTTT
						TACAAATCATCTATAAAGAGCATGAGAGCATATAGGGATTA
BICF2P1149405	38	32	41212550	0.941321	0.058679	GCAACAACCTGGTTTGTGTGTGGGAAGCTAATGCCTCCCCAA
(SNP 38)						ATGCAGCAAACTCTCCTC[T/C]TGATTTTAGAAAAGCAGTT
						TAGTTACAGGCAAATGCATACATGCATGATAAATACTACTC
BICF2G63016173	39	X	73672050	0.940828	0.059172	GATTTTATAAAACATGATGACCTTGGCATTTATATAGTAGAT
(SNP 39)						ATTACTACTCTGAAATTC[C/G]AGGAAGTATGATCATAAAC
						TCACACTTAATCTGGTAGAAGTATGGACAATGTATCAAAGG
BICF2P401962	40	8	4495597	0.935897	0.064103	CTTGGTTGAGTTAAAACATTTGCCCATGCAATTTAATGCATG
(SNP 40)						TCCCTGTGGGGTTGGAAC[T/C]GACGTACACCCGAGCCAAC
						AGCCTTTCATGGCAGACGCCATCAGGCAGGTGACCCCCACC
BICF2P991264	41	8	3165755	0.071992	0.071992	CCTTCCACACGCTCAGGTTGGCACGGAGGGGGTGTCCTTGCC
(SNP 41)						TGAGGGGTCCTGGCACAG[T/C]CATCAGGGCACACAGCTGA
						TAACCCAAGGGAGCAGTAGGCAAGACCTCATGGGCGCCGGG
BICF2S23230847	42	X	58531292	0.079389	0.079389	ATTCTCTTTGCTGTCTCCTGTATACAGAGATAAAAGCAAGAG
(SNP 42)						TTTTCCCCTTCAGGTTTC[T/C]GAAACCCAGCTTCCTTTAG
						ATTTTAAGGGGTATTCTGTGTACCCATTTCCCACCTTCTGC
BICF2P1252842	43	8	4618608	0.919132	0.080868	GCGGGTTGGGACCCCCCCTTCTGCTGCTCCCACTTCAGAGTT
(SNP 43)						GTGGCGTCACTAAGATGA[C/G]ACCTCATGTCGGGAACCTG
						AGAGTCCCTCGGGAGTTGTGcagggactgtagccgacctat
BICF2G63017198	44	X	71984983	0.913947	0.086053	ACATATGCACAGTGAATCGTGGATTGTTGTGTTTGATTTCTT
(SNP 44)						ACATGATACAATAAAAGG[A/G]AAGTAGTTGAAGCAAAACT
						TTAGTTTAAAGGAAACAATTTCTCTATCATAATGTTCAGTG
BICF2P1364202	45	8	3175135	0.910256	0.089744	CCCACAGACCCCAGGTGCTGACCACAGCAGCCACTTGGGCCC
(SNP 45)						CCAATGCAGGAGACACCT[T/C]GGGAATGAAGGGGACAAGG
						CCAGCTCAGGCACATCGTCAGTGCACCTGATGGGAAGGCCG
BICF2P963708	46	8	5472668	0.095945	0.095945	ATCTGATCCTAGCCAATGGAAAGCAATTTGAGATAGGAATCA
(SNP 46)						TATCTTGTTTTGGTTTAT[A/G]TGCTTTCTTTGGAGTTTTG
						CACATCATAGATAACTGTAAATTTGTAGAATAAATGTTTGA
BICF2S22939481	47	8	7696228	0.098619	0.098619	GTCAATGCCATTAACCTGGCGAAGCTGCTCGAGCATCCACTG
(SNP 47)						CGATCTCCGCACGAACGA[T/C]GTGGAGCCTTCAAACTGTT
						TGACCTTCGTGATGGATGCTTGTGTGGGTTTCTTGTTTGTC
BICF2P1028186	48	32	40758922	0.107495	0.107495	ACTGGTTAATAAGACTTCACAGATTTTATCCATCATGTTGAT
(SNP 48)						TATCTGTATATGTATTTT[T/C]TACCACTTAGGATAAAGTT
						CTGTTATCTGTAATTGATTCCAACCAGCATGTTTGCTCCAA
BICF2P19238	49	32	40849057	0.892012	0.107988	CTTCTTCTTTCCCATTGGATTCTTTCATCAATCGTAGGTAGT
(SNP 49)						TCTTAATGAAGATCTGTG[A/G]TAAAGCCATTCATCTATTC
						ATTCAACAAATGGCATCACAGAAAAGAAAAATAACCTTTAT
BICF2P247312	50	8	7825200	0.112426	0.112426	GGGACACATTTCTGGACAGACCTCTGATCACACTCACAGGAC
(SNP 50)						AGCAAGAGGAAGCTCTGG[A/G]TACAAGTACAGGGAAAAAA
						GAAAGAAATGGTCACAGGGAAGCTGCCGCAGGAAAAAGGTA
BICF2S23017118	51	8	7615543	0.881164	0.118836	GGGCAGATCCTCAGTGAGTATTGGCTCATGTTCTCCGAGGGA
(SNP 51)						AGTAGAGTCCCAGAAGAA[A/G]GATGCTAAGGTGCCAAGAT
						TCCTGAGCCTGTGTGTGGTACAGTCACAGCAGTACTCCTGA
BICF2P132419	52	32	35699747	0.874506	0.125494	TCATCTCCATTTGTAATAGAAACCACATATATAGAGAGATTG
(SNP 52)						GATTATTAACCACTAAAA[T/C]GTAGCCACTCAAGGGGAGG
						GGGGGAATGCATTTGGTTTATTTCCCATGTCAAAACAGAAT
BICF2S23115911	53	32	40712955	0.873393	0.126607	AACACTGCTAATAAATATTTATAATGGTTTGAGGAAAATATC
(SNP 53)						AGGTGTGAGATGTCTTCA[T/C]ATCATATAATATATCATAA
						TATCCTCTAAAAAAGCTCTAAGCATAGGTCTATGGAACTCA
BICF2G630531773	54	X	43502595	0.127219	0.127219	AAGCAATCCAGGAGTCTTTCTCCGGGTAGCAGGCTCGCTTTA
(SNP 54)						CAGGTTAAGGCTGGATGA[A/G]AAGGAAGAACCTGAGCTTC
						AAATTATCATCTGAGTAGAGCTGATACCCATGGTTACATTA
BICF2G630587826	55	32	38771348	0.127838	0.127838	GATTTTATTCTTTACTTTGATTTTTTTTAAGTTTTACTATGA
(SNP 55)						TATTCAATATGATTGTGG[T/C]TCATGAGATTCCTCTTTTT
						AGCTGTATCATTAACTACAGAGCGTTCTCAAATATTTTTCT
BICF2P1007047	56	8	4812890	0.87092	0.12908	GTGGCCGGAGGGGGTGGGCCCTACTGTGGCCCAGCTTCACGT
(SNP 56)						CCCACTGGCCAAACATCA[A/G]GATGCAGACACCCAGGTCC
						CTTGTGCTGCCTGCTGAGGCTAGGAGCAGCGACTGGAAATG
BICF2G630531804	57	X	43317321	0.869329	0.130671	GATGGGAGACCTCATACACATGCAAAGATCACTATTAAAGAC
(SNP 57)						TCTCGAGCAAAGATCGAA[T/C]GGACTGTGGCAAGCTGCCG
						CGCATGCCAATCAACAAATGCCTCCGACCATGGATCTAACC
BICF2S23632876	58	8	5656863	0.866371	0.133629	CAACAAGGTTTTTAAGGTTCTTTTCACTACCTTCTTCTTTTT
(SNP 58)						GTACTTGCTTAGGACACC[T/C]GTATGTCTTCACAATATCA
						CCTGAAAGTCCTTTAGGAGATATACTCAAAAAATAAATAAA
BICF2G63015587	59	7	5321307	0.865385	0.134615	caacctgagctgaaggcagacactcaactgttgagctaccca
(SNP 59)						ggtgtaccAAACACATCT[A/G]CTCTTAACCAAGCTTATTC
						TTTGCTATATTTGGCAAATTGTGGCATGTCTACAGTACTCA
BICF2P482693	60	X	43587959	0.864892	0.135108	ATTCCCCATGTTTGAGGAAATCACAGGAGCCACTAGGAAATC
(SNP 60)						AACCATTTCCCAACCAAC[T/C]TGATGATTTCCTGATCCAA
						AGGTTCTCCCAGGACAAATATGAGGTAGCCTTTCACACTCT
BICF2P940430	61	32	40921126	0.136364	0.136364	CAGTCTTGTAGGAGAGTAGATTGACTCACAGAACTGGCAAGA
(SNP 61)						TTGGGAATCTGAGCATTG[T/C]CACTTGAGTCTTAAAACGT
						TTACGATTTTATTTCTAGTATTTCAATAAGAAACACATTCT
BICF2P786384	62	32	36389913	0.136723	0.136723	GAATACATTGCCAGAATAATTTCAAGTTCTCAAATCTCAACT
(SNP 62)						AATAAGATTTTCGTTAAA[T/G]AAGGCATTCAATCATCACT
						TACTGACAACCCACAAAATTAGGCACTGATGAAAAATTAGC
BICF2P1340243	63	32	41050914	0.150394	0.150394	AAGTTAAGATATTCAAGAAAGAGAAGAGAGTGACTGAGCTAA
(SNP 63)						AAAGAAAATCAGATCTCT[T/C]CCAGGCTTTAAAATAATCT
						CCACAATACTGGGCAATCCATGTAGTCTCCCCAGTTCCATT
BICF2S23626445	64	32	36617978	0.153846	0.153846	CTCAAAAGGAAAAGCCTGTGGAAAGGCAAAGAGGTATGTGAA
(SNP 64)						AGAGGTAAGTTCAAAATG[C/G]TGACATGACCAGTGTACAT
						AGATTACAGGGTACTTGGAGGAGCAGTGAGAAAGGAGTCCA
BICF2P161586	65	32	37795702	0.156312	0.156312	TTCTATGAAATAGCTACCATTCTGGTTGGTATCTTCTGTTGA
(SNP 65)						TTTAGATGATGAAGGAAG[T/C]ATAAGAAGTAAGGCTTATG
						AGTTTATAAAGCTTTAGTTAAAGCTTTGATTGTGACAAAGC
BICF2P579617	66	32	36631235	0.162389	0.162389	AGAGGAGAAAACACAGCTAAAAACTTTTTTACAGACTGGACA
(SNP 66)						AAGGTGCTTACACTTTTC[A/G]TATTgggcagaatgagggg
						atgaaaacaccagtggtctttttgaagccacacaaattcag
BICF2G63016280	67	X	73386098	0.835968	0.164032	AGGATGAATATTTATTAACAGTAAATATACATTTTTATTGTT
(SNP 67)						CTATATACTCTAAAGACA[A/G]TTGTAGACAGTAAGATATA
						TCAATTTTAGAAACAGAAATAATGTTAATTGTATAATATGG
BICF2P721687	68	32	40771787	0.829389	0.170611	CAGGGATTCCTAAAGGGTGACATGGTATGGTCTAACACTTCC
(SNP 68)						TCACTGTCCTTTTCCCAG[A/C]TGATATAAGAGGAGGACCA
						GAGAGACACATAAACTGTCTGAGTCTTTAGCATTGTGATAA
BICF2P504739	69	32	37328946	0.827909	0.172091	ACACTAATGGGTAGAGAATACACGTCCATCAGTCATCAATGT
(SNP 69)						AATCTACTAACAGCCTCA[C/G]AGTCTGGCAGTTTTCAGTG
						AAAAGAGGAGTCATCTCCATTTATTCGAtcaatcagttgac
BICF2S23331874	70	32	39390236	0.825444	0.174556	TATTACCCTGCTCTCCAGCCACTCCTTTACCTTCCATTAGCC
(SNP 70)						CACACCTGCTCTACACAC[T/C]ATTGCTCATGGAAGCCTTG
						CCACGTCCAGTCGCCACTCTGAAATGCCAGCATCCCTCCCA
BICF2P772765	71	32	39278300	0.816075	0.183925	TCTCAGATACTTGATAGCCAGCATTTCCCCCCATTTTCTTCC
(SNP 71)						AAGAGCACGAAAGCATAG[A/G]AATGATATTACATCTCGTA
						TGGTGAATGTGACACAGCCGTCAGTTGCGTTAGCTCTGCTT
BICF2S2318354	72	32	35849858	0.18787	0.18787	ACAGGAAGGAGAACTGAGCATCAAGAGAGTTCAGAACATGAT
(SNP 72)						CATTGGGTCAGTTTGTGG[C/G]TGCATTAACTTTTCCCCAA
						AACAGAAAGCAACAGAGACTTCTGTAGGTCAGTCAACAGTG
BICF2G630588054	73	32	38521693	0.810052	0.189948	TTACCATTACTATAACCCAAGTTATAGTATACTATAACCAAG
(SNP 73)						TCCTTAATTGACTTGATG[T/C]TTGTGCAGCTGATTTTAAA
						TCTATTTAGAATAATAGTTTACTTGTGACAATTCATATTAA
BICF2S23313445	74	8	6343006	0.809665	0.190335	TTGGTCGACTGACTGATTGGTTTTACTGTGGAGGAAAGAAAA
(SNP 74)						GGGAATTTTCCCAAAGAG[A/G]ACAGAGAGAAAACATGGAA
						TTGAGCAAAGGGAGAATAGAGAGACAGGGCAGCCACTGAAG
BICF2P675334	75	8	4477476	0.19428	0.19428	TGCCTTATCCTCCAGCTCCTCCCTCACCATCTTGGAAACTAG
(SNP 75)						CTCAAATGTCACTGGTAC[T/G]TGTCTTTCTTTTGATCTTT
						CTGAAAGACAAACATGATCCCATCACCTCTGCCTTTAGAAC
BICF2G63017409	76	X	71722644	0.804241	0.195759	ACTCCTAAGTAAAAGTTAAATTAACAGATTTGCCATCAAGTA
(SNP 76)						CCTTGCCCATTTTTCCTA[T/C]AGATCGACTTTTTACTGGA
						TGATCCCCTTGATAATAATCTTGATCTATGTTTTAATTCCA
BICF2P798346	77	8	4651519	0.195759	0.195759	ctggtgggcttgtcaggggcaggatgttgtgtggtgagcaca
(SNP 77)						gaattaaaactaggaGCT[T/C]gaagcgcctggggggctca
						gttggttgacggactgccttcatctcaggtcatgatccctg
BICF2P1150684	78	8	7652070	0.802761	0.197239	CATACAGCGAAGAGATAAAAACACAGGATGCTGGGCTCACGA
(SNP 78)						CCATGACCGGAAAAGGAC[A/G]GCGAGGAAAAGCAAGTATG
						AGCAGCCCAAAGTCCTTTTTCCAGCACTGGCCATAGGAGGA
BICF2P1348758	79	32	36083895	0.801579	0.198421	CAGAGATGAGGAATCAGACTCCTCGTCCTCTGCTTCTCTACA
(SNP 79)						ATGGCTCATGTTCTCCTT[T/C]CCCCTCAGCTGTTGCATTA
						ACAGAGGTCAACCCATTCTTCTAAATTTAAATCTCCCAGAA
BICF2G63017599	80	X	71555277	0.198617	0.198617	AATCAAACAAGTGCTAGAACATAGAACAAGTGGCTCATCTTT
(SNP 80)						TCCCCAAATGTCTGGATA[A/G]GAAAAAAAAAATCTAAACA
						AATGCTAGATGTTAAGTATCTGAAATGATCAGCCCATGAAA
BICF2G63016090	81	X	73800072	0.200197	0.200197	TCCATACCAGTCCTTGTTGTCTACCCCGAACTTCACCTCTCT
(SNP 81)						AGGCACAGACAGCTCTAA[A/C]TTTCACTCATAGGTATCTT
						ATGCTGACCTGGCCTGCCTCCtgttttgttttgttttgttt
BICF2S23524027	82	X	64785623	0.79931	0.20069	CAAAAAATTCCCTGAGCCCAGCATCAAGGTACCTGGTTTGGA
(SNP 82)						GTGGGTGGGTCCTCAGAA[A/C]GAATGGGTGTGGTGTACAT
						TTAGCAAGTTATGTAGCATGTGTCTGTGTAGTCTCACCTCT
BICF2P591872	83	X	62989720	0.795252	0.204748	GGGCCCAGCAAGTGGCAGAACTGGGAAGACCCCCTCTTCTTC
(SNP 83)						CGCCTGGAGCAGTGGTGT[A/G]GCAGCACACCACAGGAGTC
						TGAAAGGGTGGGGAGTCCAAACGGGAACATATACCTGAGAT
BICF2G630587712	84	32	38968302	0.794379	0.205621	atataatataacttatttaaaatatttGAAGATATTTCTATA
(SNP 84)						GTTATGCTCTACCATTTG[T/C]TATTATAAGATTTCCAACA
						GCTTACTTCTTGTATGAAATTAATTTACCAGCCCCTCACCT
BICF2G630587722	85	32	38964413	0.792899	0.207101	CCCTATTCTATAAACATTCCCTCTCTGGCCATCCTGTCAAGT
(SNP 85)						GGGCCCTGACAGTGTGCC[C/G]CAGAAGCTCCCTAGCCTTT
						GCCCATTCCAGCTATGGCTAGCCTGCCACCAGCCATACACA
BICF2G63018557	86	X	66396513	0.218164	0.218164	CACTGTGAGGTCTGAATGGAGACATTCATGATAGACTCCAGG
(SNP 86)						ATTTTCCCAGCTATTAAG[T/C]CATGGGCCATAAACTGGAA
						CACTTGGAAACAGTCCATAGGTTCATATTAAAGAATATGTT
BICF2P652606	87	32	37855796	0.776134	0.223866	GCAAAAGGAACATGAGTTCTGATCTTCTGTAAAGGAGGCTAA
(SNP 87)						TTTACTAATGGTCATAAC[T/C]GTGGcctgagggtcaagtt
						tctaattaaacgtgcatcttggggYggactagaatactttc
BICF2S23312799	88	32	36791310	0.224852	0.224852	CAAGGSCCAGGTACCCTGAAGGAGTCCGCTTCACCCAGGCAT
(SNP 88)						GATGTGTTTGACAGTCTT[T/C]GTAATTGATACAGCCATTG
						GCATCCTCTTGCGGCCAAYATCAGCTCCACTTCAACCTCGG
BICF2S2303948	89	8	5896281	0.773669	0.226331	TGCAATGGGTTTTGAAATTAGAGGACATCACAGCAGAGTAGA
(SNP 89)						ATGGTTTGGAACAGGGGA[A/G]TATGATTAGGATTAATGAG
						ATGAAAGAAAATTCTGGCTAGAGGGCTAGAAGAGCCATGGA
BICF2P506595	90	8	4886813	0.228304	0.228304	CTCAGAACTAGATAGGCTAATAAGTGATAGGCCTTGTGTTTT
(SNP 90)						CCTAGAGTGTGCTTTAAA[A/G]GTTTCTTAAGCTAAAAAAT
						TACATTCGTGAGAAAATTGAAATAAAAGGAAAACAGTCATG
BICF2S23130600	91	8	5180802	0.228304	0.228304	GATACTTTGGGCTCTGGGTGGGAGCCAGCAGTGGTGGGGCAG
(SNP 91)						GGCAGGAGTCCAGCAAGG[T/C]GTCTGGGCATACATGTCTG
						AGAGTAGGAAAACCACACCATTGCACCTTGCCTTTGACTTC
BICF2P1270451	92	8	5580117	0.229783	0.229783	TCAAGGATCAGAAAAATAAAAGCAAAGAAAGAGGCAAAGAAA
(SNP 92)						GAAGAAATGAAATACCTA[A/G]TGGCAGAAGTAGGCAGAGA
						AATAAAGGCTAAAAGAAAATGGCAGAGGATTGTTTGAAAGG
BICF2G630588267	93	32	37876000	0.23001	0.23001	TATGTTATACTATTTTAGTATCTTAATAAATATGATTAGCCA
(SNP 93)						AAATAGTTTTATCATCCT[C/G]AAAAGTGCAGCATATATTA
						TTTTCTATTAAATTCAGAATAGGTATAAACTAGAAAGCATT
BICF2S23122074	94	8	4965974	0.76999	0.23001	ACAGCAGTTCTGAGGATGGACTCGCAGAGGCTCCTGACAAGC
(SNP 94)						AGAATGACCAGGCCGAGC[A/G]GAAAGGTCAGTGCTGCCAG
						TCTAGCCAGAAGTGGGGGAGAGAGGATGTAGGAGCAGTACT
BICF2P555643	95	32	40258722	0.230769	0.230769	ACTGTACTCAAAAAAGTTCTGTTTGCCTAAATGGGATCAGCC
(SNP 95)						TCTAATGGATGCCAGTGA[T/C]GGGAGGCTGTTCATCATCC
						CTTCGGGATAATTCAGAGCCTAGGCAGAGGCCCAGCGTTCA
BICF2S23259999	96	8	4990277	0.231732	0.231732	TACAGGCCCCAGGAAGGAGCCACCAGATGCCCAGGACTGGGC
(SNP 96)						CCAGGAATGATGGAGGCT[A/G]TACAGCTGGCTGCCTGCAC
						TGGCTGCCGCCCCTGTCATCCAGTGTCACAGAGCAGCACCT
BICF2G63016525	97	X	72989415	0.251482	0.251482	AGACATTGCCAAGAAGTATCCACAATGAACAGTTTGAAGGGG
(SNP 97)						ATCCAGAAAAGCACAGGG[T/C]CTACTTCCGCTGGATGAGC
						AGCAGTGAGAACCACAGTCAGGTAGGTCTTAAAGCAAAGTT
BICF2G63019552	98	X	60108249	0.737179	0.262821	GCTTTGAAAACCAACAGGAAATACATCCAGGAAAGCTATACA
(SNP 98)						ACTGTGGTGAAAGGAAAG[A/G]AAAATCTGCTCTTAAAAGG
						TTGTGTGCAGACTCACTTGCCCCAGAAACCAGTGCGAAAAC
BICF2G63017884	99	X	70145192	0.271019	0.271019	GAGATGTGTAAAATTTAATAGAAATGAAACTTGCCAAAACAG
(SNP 99)						ACCTCTGTACTCGTCAGC[A/G]TTCTAAGTCCATCTTTCTG
						TAGCATGTAAGTAGAATAATGTTCTATTAATTTCCTCTATG
BICF2G630587598	100	32	39023585	0.706931	0.293069	GTTCTTTCTATTCTATCACACATACCACCCCCCTGCCCACAG
(SNP 100)						TACCCCTTTCTGCCATGT[T/C]TCAGACTCCTACACAAGAG
						GTTCTCTCTCCTGGCTTCCAGTTAGACAGGCAGGTAAAGCT
BICF2P285901	101	8	6743491	0.70069	0.29931	TAAAAAAATACAACAGTAGCATTAGAAGACATGCTAAGCGGC
(SNP 101)						TGTATTAGAGAAGGTTAG[T/C]GCTGGCCTGAAGTTTAGAA
						ACCTTCCCTTCTCTTTTTTTTTTTCCTTCCCTTCTCTTTAA
BICF2P811511	102	32	36167454	0.30583	0.30583	TCAAGAGTACTAGAGCATCTATAATCAATGGTAAATTGGGGA
(SNP 102)						ACTAGTGAAACAAGTTTA[T/C]AGGACAAATAACATAAATA
						AGGATTTTTTTTTAAATTTGGAAAATTGTGGAATAATGATA
BICF2P1146265	103	X	63433179	0.693725	0.306275	AGAATTCAATTTTGGGGAGCCAGGAAACCAGATTAGTTTTCC
(SNP 103)						AAAGGGAAGTGCCATTTG[T/C]ATCTATCCCGGTGGGGCTG
						CCAAGAATTCCCTGGGGTGGGAGACGGCGCTTCTGTGGATT
BICF2P243607	104	X	57821508	0.690523	0.309477	CACCAGAGAGCCCCGCAAGATCATACTGCACAAGGGCTCCAC
(SNP 104)						TGGCCTGGGCTTCAACAT[T/C]GTAGGAGGAGAGGATGGAG
						AAGGCATTTTTGTTTCCTTCATCCTGGCAGGAGGCCCAGCT
BICF2P382932	105	X	64010327	0.690335	0.309665	TGGTGATGATTTATCCCCCATGTTCAAGATTTATCCTCCCTG
(SNP 105)						TCTCAAGAAATCATGTCA[T/C]TACAGGCATCCTTAAAGTC
						ACAAGACTGGGAAGTAAATACTGATGAGGTCCAAGACCTGG
BICF2P1061734	106	X	57654632	0.69003	0.30997	AGCATAGTGTACCCACATATAAGGTCACATCTGAGGCCAGGG
(SNP 106)						AGTCGGGGTCTTGAAGAT[T/G]ATGACTGATCATGTGCTTG
						AGGATGATGATGATCATGTGCTTTTCCTGGCTGTGCAGTTG
BICF2S22937235	107	X	57492668	0.310158	0.310158	gtgtgtgtgtgtgtgtgtgtgtgtTTAATTCTTTGTGAGAAG
(SNP 107)						CCCCTCATTTTGACCTAA[A/G]TTTGGTAGAGGCCCCAGGG
						GATCTGAGAGGAGAACAAAAGGATAAACCATTTGCTGTTCA
BICF2S22937489	108	X	73723672	0.687068	0.312932	CCAACTTTCACTAGCATCACAGCCCCTATCAATCTCTGTTCT
(SNP 108)						TTTTTCTGTCAGTACCAT[A/G]TTTGCTCCTACTACATCYA
						ATCTGTGAGCTCACAGGATGAGGACCAACAGCTGCCCTGAG
BICF2P903726	109	32	40883681	0.329389	0.329389	TGTCTTACCTCTCTCTATTCCCTTGTCCATAGTAGTATTAAA
(SNP 109)						TATATCTTCCTGAACACA[A/G]ATCTGATCCAGTCTCTTTT
						TGTAATTAAAAGCCTTTGCTAGCTTTGGTGATCACCTCCAG
BICF2P1324008	110	32	40043909	0.664179	0.335821	GACCTGACAGATTATGTAGACTTTGTTTTCAAAGGGAGCACC
(SNP 110)						TGCTGGATATACAACATG[A/G]CACTAAATTGTGCTCCACA
						TCCTTGGCAGAGGTGGGGGGCGGGGCACAAAGGAAGAAACC
BICF2P320425	111	8	7105593	0.336283	0.336283	CAGAGGAAAAGGAGAAGGTCCCACTTAGGGGACTGGAGAGGA
(SNP 111)						GTGGGGGAACATCACCAG[A/C]GCCTTCCTGAGCCAGGCCC
						CCTGTGGGGAGAAGCTCTCCCCAGGACTGGGTGCCTTTGAA
BICF2S23210713	112	8	6397309	0.634615	0.365385	tcctccctctccccatccccattctcatgcaagtgtgctctc
(SNP 112)						tctctAAAACACCCCCCC[A/C]CACACACACACACAGACAC
						AACCAAAtttgggtctcaatgtcttgaccaaggaaaaggca
BICF2G63018424	113	X	66756995	0.367793	0.367793	gagaagaaggaggagaaagaggaaaagTATATTTGATGGAAT
(SNP 113)						GAAAAACAAGAGTTCAAT[T/C]TCACTCTGGTCTGGGGTGA
						CCACTATTAGTCCTTCAACATCTTCCTTGAAGGAATTTTAA
BICF2G63015897	114	X	74179959	0.631164	0.368836	CTGGAATTCTGTCAGATCAACATTCAGAGCTCCATCAAATCT
(SNP114)						GAGGGAAGCAGTGATAGA[A/G]GATACAATTTGACCTTTCA
						GTCTATTCAGGTTCATGTAGGTTAGGCATTCAATATCAAAG
BICF2P305287	115	8	3258209	0.371175	0.371175	CCACATGTGGTTACACCACTGTGTTATCCTTCCACCTGTCCC
(SNP 115)						ATCAACCCACCCGCACAT[A/G]TCACAGTGCCTCTGTCCTC
						AAAGAACACTGTATCCAACACCTCCACATCCTCTCAGCATG
BICF2G63016662	116	X	72647220	0.615878	0.384122	ATTCCTATGGTGGGCGCTGCACATTTCCTCCCAGGGGAAGGG
(SNP 116)						CAAGGGTCCTGCATTTCT[A/G]TGCTTTCCAGGGCCTCCGC
						ACCAAGAGCAATTGCTAGGTCACGCATGCCCCTGCACTTCC
BICF2G63017854	117	X	70302610	0.606541	0.393459	CATGTCATCACTAACTAATTTATTAACAAGAGTTTTATTCTT
(SNP 117)						TGAAAAACAAAATCACTC[A/G]CATTACTCAGTTGCTTATT
						CCTTGATTCATATACAAATGACTGATAACATGAGATAAAAA
BICF2P170917	118	32	38039478	0.600592	0.399408	GATGATTTAGTTGTTTGAATGATCTGGCATATAAATCTTCCA
(SNP 118)						AATCTGTGTCCATTGGAT[T/C]GCTTACAGTTTAATCTTTT
						TATTTCTTCCCAGAATCACATTTTTTCATTATTTATCTTTG
BICF2G630588207	119	32	38333881	0.425201	0.425201	AGTTAAATTCTGTGAATAACTAGAATCCGTTATACTTTTTCT
(SNP 119)						GAAATGAAGTCTGTAGGC[A/T]TTTCAACAGCAAAAGGAAT
						TCTGWTTTTYAAAACTATACATAATGCTTCTTAAAAGCCCT
BICF2P702899	120	32	39207136	0.428854	0.428854	AATGCCAACTTTAAAAACGCATTCAAGGTTTTCCTCTGTAAA
(SNP 120)						TGCATTCCTCATTTTGGA[T/C]GTGATGTAAAATCTTATTC
						AGTGTTTTGTTTTTTTTTCCCCCCACAGGTCTCAACAATTA
BICF2P1388432	121	8	7178740	0.446203	0.446203	GGTGGGACCGGCCATCAGCAGGCGGGCCAGCGCCCCACAGAT
(SNP 121)						GTTGTCACGGACCCGATC[A/G]TGGCGCTCCCGTGCCAGGA
						GGGGCAACAGAAGCCCCAGCAGCTTGGGGAAGTATCTGGTT
BICF2P588571	122	32	37214320	0.454635	0.454635	AGGGGACTTGTGCTAATCACTGGGCAAATTTTATGAACTTCT
(SNP 122)						GAATTTTAAAGCAAAAGA[A/G]AAGGTGAAAGAATGGAAAG
						AAGGTGTGAGTGTTTGAGGAAAACTTCTTCTTTGGGGTTGA
BICF2S22912518	123	8	6934693	0.544872	0.455128	TACACAAGCAAGGCAGTATGCCCTGTCTCCTTCCCTTGGGCC
(SNP 123)						ACCTGCACTTAGACATGG[T/C]AGGTTCCAGTGATGTGTCT
						AGTCTCTAGCAAGCAGGGCTTGCTTCTGCTCTATCCATCCA
BICF2P223099	124	8	7427438	0.530602	0.469398	CTGTCCTTGGTCTGGACCTGCTGTGAAGACCAAGTGCTTCCT
(SNP 124)						GAGATCTCTCTGAGTCTA[A/G]TTTCCAGAGCAGTGAGTGA
						GAAATGAAATGAGCCGAGGATTGCCCTCCCTCCTATGGACT
BICF2P568891	125	8	7938712	0.475321	0.475321	TAAGCCATCAGCATGGGCTCCTAGGGGTCTGTTCAACTCCCT
(SNP 125)						TGTGGTGTCTTACTGCTC[A/G]AGCAAAGGAACAGTCTGGT
						ACAGTGGGAGCAAGAGCTGAGGTTGGAGAGTGGGGACACAG
BICF2G63019507	126	X	60714796	0.521308	0.478692	GAGGAGGTGGAAGTGATTAAGTTTAAAATTTCTGGGGTGGTT
(SNP 126)						TCTGGCGACATGAAGCTG[A/C]GAGCTAGAATGCCTTTCAA
						TCTCATAATTTCTTTAATTTGGTGATTATACCAGAGCCACA
BICF2P814468	127	32	37551101	0.517787	0.482213	CCTGACAAACACTACCTCTGCTCTTCAAAAGCAATAAGCATT
(SNP 127)						TATTCTGTGACACATTTA[A/G]ATACAAAGTCAATTACAAT
						AGAGTATAAGTACAATACTAGGGAAAGTACAAAGTCATAYG
BICF2P948321	128	32	37526448	0.511834	0.488166	GCATGATGAAATCAGAAAAAGTATGTAAGTTTCTAGAAGAAG
(SNP 128)						CTAGATATATGGTAACTT[A/T]GGTCAAATAGAACCATGTA
						GTGAAAAGAATATGAGTTTTCAAGTTCAATAAAAAACAAAA
BICF2P807378	129	32	37648000	0.510848	0.489152	ATGCATAAGTTTCCAAAAGAGTTCAGGATTCCAAAATAAAAG
(SNP 129)						CTTCACTAAAAGATTCAT[A/C]GCAAAAGAGTAATGAACAA
						TTAAAGTCATAGGATATCTAAAATGAAAAACTGTTAGACTG
BICF2P175415	130	8	6494289	0.489645	0.489645	AGATGGCTTAGTTGTTTCTCTTTCCTCCTGAAGTCCACAGCT
(SNP 130)						TAGTTACTTGGACTCTCC[A/G]AAATaggatcgttggacat
						ttgaggaaagctctagcatgaaagccatagactaaaaaaca

EXAMPLE 2

Identification of Further SNPs Associated with Susceptibility to Liver Copper Accumulation and a Protective SNP

The three genes identified in Example 1 were investigated to identify further SNPs associated with susceptibility to liver copper accumulation. Thirty-three amplicons covering every exon of the three identified genes were chosen. These were amplified in 72 samples of genomic DNA from dogs of the Labrador Retriever breed. The samples were taken from dogs with either high copper (liver levels of copper above 600 mg/kg) or normal copper liver levels (below 400 mg/kg). The amplified product was sequenced in both directions by the Sanger method. The software ‘Seqman 4.0’ supplied by DNASTAR was used to assemble the sequence in each amplicon. The assembly was then examined to find single base variations (SNPs). These variations were then genotyped by examining the base-intensity at the SNP in the sequence from both directions. If the genotypes of a SNP from the two directions disagreed in more than 10 samples the SNP was classed as an artefact and ignored. The identified susceptibility SNPs are set out in Table V.

Surprisingly, a protective SNP was also discovered. This is provided in Table VI. This SNP is in the coding region of the ATP7A gene (an X chromosome-linked gene) and results in a change in the coding sequence. A study of average liver copper levels by gender and ATP7A genotype was conducted (Table VII). FIG. 5 illustrates the data from Table VII graphically. FIG. 6 illustrates the same data as copper-histological scores. The p-value (0.000396) was determined from a Kruskal-Wallis test on the histological score with gender-genotype as the groups. It is clear from the data that the presence of the T allele is indicative of a dog being protected from high liver copper.

The results may explain the female bias of chronic hepatitis. Male dogs have only one copy of the X chromosome and so are hemizygous at the ATP7A locus. An X-linked recessive gene-effect is more likely to be seen in males than females because of the hemizygous state of the male X chromosome. The protective effect here is recessive so we see more cases in the female population.

The protective SNP results in a change of a Threonine to Isoleucine at amino acid 328 of ATP7A leading to a decrease in the number of potential hydrogen bonds from 3 to 0 and an increase in hydrophobicity, potentially altering the shape of the protein. The Threonine at this position is conserved across many mammals, including horse, human, chimpanzee and dolphin, indicating the importance of this amino acid in the function of the protein.

EXAMPLE 3

Investigation Into Breed and Geographic Diversity of the ATP7A Protective SNP

The ATP7A SNP in Table VI was genotyped in samples of DNA from dogs of other breeds in addition to Labrador Retriever to determine whether the SNP is present in other breeds. Table VIII show the results, with the number of dogs of each genotype. The ‘T’ column refers to homozygote females (TT) and hemizygote males (T). The results demonstrate that the SNP is present in diverse dog breeds and therefore may be used as in indicator of protection from copper accumulation in a wide variety of different breeds, mixed bred dogs and mongrels. The T allele of the SNP has also been found in US and Japanese Labrador populations, demonstrating that geographical location of the dog is not a hindrance to the utility of the SNP.

TABLE V
Sequence of further SNPs indicative of susceptibility to liver copper accumulation.
	SEQ
SNP name	ID		First	Second
(SNP no.)	NO:	Sequence to the Left of the SNP	Allele	Allele	Sequence to Right of the SNP
ATP7a_Reg4_F_9	131	CTCTCATTTTGTGTATTGATTTGAG	A	C	CCTTAGTTCCCAAGTTCCTATCTTG
(SNP 131)		GACTCTGTCCTTTTTGTTCTCTTAG			TTTACCTCATGATCACATTTTAATA
		GTGTTTTGTAACCATTTTTGTGGTT			TCAATGAAATTTGTAGGAAAACAGC
		CTTGCCACAAAAGGCCTTATGAAGT			AGAAGGAAAGATATAAGGTTACTAT
		CCTGCATATGAGTGATGTGCAGGAC			TCTCTATGGACCTTGGTTG
		AACTTTGACTTTCTGACAGCCAGTT
		TTTGTGTTTTGTT
UBL5_Reg1F_16	132	TTGCAGATTATATGATAAATATAGT	T	C	ACTTAACTAGGTAGGCCACAGAGTA
(SNP 132)		TGTAGCTTCAAAAATGACTATAACG			TGATAGTATGCAAGTTATTAAAATC
		AACAGAAAAAAATTAACTTATCAAA			TGTTAGCAAGGCATAACACATATAT
		AACTTTTCAAATTTCCCCATA			TTCTACTTAATGAGGTTTCTATAAT
					CAAGGCTTGTCAAGTCCATTATGTT
					C
golga5_Reg1_24	133	TCAGACTGAATCTAAAGCCACATAT	C	T	TTAGCTGGCACCGCAAATGTAAAAG
(SNP 133)		ATTTCCTCAGCAGCTGATAACATTA			TAGGCTCTAGGACGCCAGTGGAGGC
		GAAATCAGAAAGCCACTAT			TTCCCATCCTATTGAAAATGCATCT
					GTTCCTAGGCCA
golga5_26	134	TCTTGTGCTTGTTCTTTATCACCAT	G	A	ATTTCATCAAAAGGAAATATTTTGA
(SNP 134)		TCATTCAGTACATCCAAATTTTGAA			GAATTTAAGTGATTTTTTTATGATA
		ATCCTTAGAGCTCTATAGCCTCTAT			TTTTAGCTATAGCAGTCACCTTGAG
		GTAGGAGAATGA			CCAAAAGACATTCTAC
golga5_27	135	AAAAATATACTCTCTTTCTTACAGA	T	C	ACTGACCACAACCCAACACCTACTC
(SNP 135)		AACCTCTAATAATTCAGATTCTGGC			ATGATGGCAAATCMCMTRAACTGTY
		CATGAAGTTCAGGAGGATTCTTCAA			TAWTYTCSGATTGGRRAWTMAAYKG
		AGGAAAATGTATCATCAAGTGCTGC			TTRAGGAATGAA
		CTC
golga5_28	136	TTTGCCCAAGAAAAATGAAGACCTA	T	G	TGTGTCAGGAACTGTTTTAGGTATT
(SNP 136)		TGACCATGGAAAGACTTGATACATA			GGGGATGAAGTAGGGAACACTGATT
		ATGCTGGAGTACTAGTAGTCAGACC			TAGSTTCTGTTTATTCATGTCTCAC
		CACCCAAGTCTTTTCACGTGTTCAT			TTTGTAGGAATTYCMHTAMATAGAA
		TCAGTATAGATGCGGCACACGTTGG			RAADA
		CTGAGTCCCTCCG
golga5_29	137	TCTCAGTACTCACAGGTACTTACAA	C	T	TGCCAAKTTGATTCTCTGGCCCATT
(SNP 137)		ATACAACACTAAGAGGTTTCACAAA			AATAGTTTGAAAATCTCTTCTGTAG
		ACAGTACTCTTACATAGCACATGCT			GAGTATAGGAATTACCACAGAGTTT
		GTACTCTCTGTTCCATTCTATTTTA			TGAGAAATTGATGAATGCCACGCTT
		TTACTATTTTAAAATATGGATTGTG			TACCTGTGGGAACGTAGATTCTA
		AT
golga5_30	138	CAGATGATGAGTCTGGAGCTGGTGA	T	A	GCACAGAAAGAAAGTGCTCATTAGT
(SNP 138)		TCTGGGCTGGAGATAATGAACCTGG			GTCAACTCTCAGCAACACTTGGTAT
		GAGTCATCAGCTTTGGAGA-			TTGTAAACTTTAATTTTTGCTGACT
		AAGGGTGTCTGGCCTCACTCTTGCT			TCATGGAGAAATAATGTTTTT
golga5_31	139	TAATGATACAGAAATGAATTTGGCA	G	T	GCATCGGCTCCTTCTGTGCTATTTT
(SNP 139)		GGAATGTATGGAAAAGTCCGAAAAG			CCGGTGGCTCCAGTCACAGCCCCAT
		CTGCTAGTTCAATTGACCAGTTTAG			CAAGCAGAGCTGATACCTAAAGTGA
		GTAAGCAAGTGCAGTACTGGTGAGG			CATTTACCCTACTTCCTCTCTCAAT
		AATGG
atp7areg17_32	140	CATCACTTAAAATCATCTCAGCAAG	T	C	ATTTGCTTTGCTGGATTGAAAAAGT
(SNP 140)		TGTTGTTGAAGATGATTTTTTATAA			CTGGAAGTAATTAGAATGACTTCTC
		AGTATATTCCAATCTTATTCTATAC			ATACTCCCACCTTGAATTCTCCTAA
		TTCAGAAGCTTGGAATTCT			TATCAAAGGCTGGGAG
atp7areg17_33	141	ATATGGAGAAATGAGCTCTTATACA	G	A	CACACATCATTTGATTGAGCAATTC
(SNP 141)		CTTTCAGTGGACATGTAAACTGTTA			CACTTCCAGCCATATTCTGGACATA
		TTGTCTTTTTGGAGAGCATTTGGCA			ATTTACAAGTATAAAAAGATGCATG
		GGATCTATCAAAGT			TTT-GA

TABLE VI
Sequence of SNP indicative of protection from liver copper accumulation.
	SEQ			Wild
SNP name	ID			type	Alternative
(SNP no.)	NO:	Comment	Sequence to the Left of the SNP	Allele	Allele	Sequence to Right of the SNP
ATP7a_	142	coding	AAATATTGAAAGTGCTTTATCTACA	C	T	TCCAGAAACCCTGAGAAAAGCAATA
Reg3_F6		change,	CTCCAATATGTAAGCAGCATAGTAG			GAGGCCATATCACCAGGACAATACA
(SNP 142)		protective	TTTCTTTAGAGAATAGATCTGCCAT			GAGTTAGTATTGCTAGTGAAGTTGA
		T	AGTAAAGTACAATGCAAGCTTAGTC			GAGTACCTCAAACTCTCCCTCCAGC
			A			TCACCTCTTCA

	TABLE VII
			Average Copper
	Gender	Genotype	Level	Count
	Females	TT	323.3	3
		CT	818.3	22
		CC	1041.3	45
	Males	T	437.5	13
		C	905.8	34

	TABLE VIII
				T (Mutant
				associated
				with low copper
	Breed	C	CT	levels)
	Labrador	31	13	28
	Retriever
	Miniature	3	2	8
	Poodle
	Golden	0	0	1
	Retriever

EXAMPLE 4

Discovery of a Further Protective, But Non-Coding SNP.

Sequencing the ATP7A gene revealed an intronic SNP that is almost in complete linkage disequilibrium with coding SNP ATP7a_Reg3_F_—6. Like the coding SNP, the intronic SNP (ATP7a_Reg 16_F42) is significantly associated with protection from liver copper accumulation (Table IX). The significance of both was measured using a chi-squared with two degrees of freedom on the independence of genotype and disease status. Disease status was positive for >600 mg/kg dry liver weight copper quantification and >=2.5 histology score; negative for <400 mg/kg dry liver weight copper quantification and <2.5 histology score. The expected table was based upon a Bayesian estimate of genotype frequencies and disease frequency within the sample assuming independence of the two variables.

The calculated measures of linkage disequilibrium between the non-coding SNP and the coding SNP are: D′=0.93 and R-squared=0.86. The SNPs are therefore almost in complete disequilibrium.

The sequence surrounding ATP7a_Reg 16_F42 is shown in Table X.

TABLE IX
							Amino	Amino
Amplicon	SNP	Exonic or	Coding	Amino acid	Base in	Base	Acid in	Acid	Association with
name	position	intronic	change	number	Genbank	change to	Genbank	change to	phenotype
ATP7A Reg 3	ATP7A	Exonic	Yes	328	C	T	T	I	0.001669996
	30,374
ATP7A Reg 16	ATP7A	Intronic	No	NA	C	T	NA	NA	0.001796187
	89,705

TABLE X
Sequence of SNP indicative of protection from liver copper accumulation.
	SEQ			Wild
SNP name	ID			type	Alternative
(SNP no.)	NO:	Comment	Sequence to the Left of the SNP	Allele	Allele	Sequence to Right of the SNP
ATP7a_Reg	143	Intronic,	TTAAAATAACTACTTGCAGTGATTT	C	T	CTTCACCTTAAAAAGAAAAAGAAAG
16_F_42		protective	CTTTCCCCCAGTATAAAATGTCAGT			TATTAGTTTTCAGTGTCATTTGCCT
(SNP 143)		T	TTTGTCTCAATCCACCC			TAAAATG

EXAMPLE 5

In Vitro Experiments Conducted to Determine the Functional Effect of the Coding Mutation (“ATP7A SNP”).

Materials and Methods

Cell Lines

The canine dermal fibroblast cells CDFIB44, CDFIB62 and CDFIB 111 were isolated from euthanized female Labradors. Blood samples, taken prior to euthanizing were subject to the genetic test of the invention to ascertain increased risk to the disease. CDFIB 111 was homozygous for the ATP7A SNP and CDFIB62 was heterozygote. CDFIB42 was used as a control. These cells are referred to as ATP7A^C/C, ATP7A^C/T or ATP7A^T/T corresponding to canine dermal fibroblasts expressing wildtype, heterozygote or variant forms of ATP7A. The human dermal fibroblast cells HB156 were obtained from a clinical Menkes patient (ATAC). H8881 cells were used as a control. ATP7A has not been presently sequenced in these cells. No information regarding ATP7A sequence is available regarding these cells.

Fibroblast cultures were routinely maintained in Dulbecco's modified Eagle's media (Invitrogen) supplemented with L glutamine (2 mM), 10% FBS, MEM non essential amino acids (100 μM) and penicillin/streptomycin at 37° C. in a humidified atmosphere of 5% CO2 in air. Low serum media contained identical components with 2% FBS. For the experiments, canine cells were used between passage 4 and 9. Tissue from the small intestine and liver was isolated and stored in RNA later at 20° C. until needed.

Immunofluorescence

For immunofluorescence, microscopy cells grown on glass coverslips were incubated in low serum media with 200 mM bathocuproine disulfonic acid (BCS; Sigma) for 24 hr. The cells were fixed in freshly prepared 4% paraformaldehyde in PBS for 20 min, washed and permeabilized in 0.2% Triton-X100 in PBS. Nonspecific signals were blocked with 3% BSA in PBS containing 0.2% Triton-X100 for 1 hr, followed by incubations in the same blocking media containing chicken anti ATP7A (1:50; ab13995 (Abcam), against the amino acids 1407-1500)+mouse anti 58k (1:50; Abeam) for 2 hr. Texas red-conjugated goat anti-chicken (1:100) and FITC-conjugated donkey anti-mouse (1:100) antibodies (Abcam) were used to detect the primary antibodies (1 hr). Texas red conjugated rabbit anti-goat antibodies (1:1000; Abcam) were subsequently used to amplify the signal from the goat anti-chicken secondary antibodies (1 hr). The coverslips were finally mounted in Prolong Anti-fade gold (Sigma) and viewed via epifluorescence.

Radio Isotope Experiments

The 64Copper isotope was made using metallic copper wire (3.3 mg) that was irradiated over night in a reactor providing an induced activity of approximately 170 MBq.mg⁻¹. Upon arrival, approximately four hours after irradiation and 30 minutes prior to the start of the study, the copper wire was dissolved in 50 μl concentrated HNO3 (10.3 M) and neutralized with 1.3 ml 0.5 M NaOH. DMEM media was added to a final concentration of 4.7 mM copper. Fibroblast cells were plated in duplicate in 6 well plates in 5% FBS supplemented DMEM media plus additives.

For copper treatment, cells were incubated in 10, 50, and 100 μM copper for 24 or 48 h. After treatment, media was removed and cells were washed four times with Hanks supplemented with an equal amount of cold CuCl₂. After washing, 325 μl of 0.2% SDS was added to lyse the cells and cell lysates were pipetted into counting tubes. Emission was measured in individual tubes containing media, washing steps, or lysate in a Packard B5003 gamma counter (Packard BioScience Benelux, Groningen, the Netherlands) between 450 and 800 keV for 2 minutes. For efflux studies, after copper treatment for 24 h, cells were washed four times with Hanks prior to incubation in fresh warm media containing no additional copper for 2 h. Cells were then analysed for copper as described above. Copper accumulation was normalized to the protein concentration of the cell lysate (quantified using a Bio Rad Protein Assay Kit, Bio Rad) and an MTS colorimetric assay (3-[4,5-dimethylthiazol-2-yl]-5-[3-carboxymethoxyphenyl]-2-[4-sulfophenyl]-2H-tetrazolium) (Promega) was run in parallel. This quantitative assay detects living but not dead cells. The absorbance at 490 nm (test wavelength) and at 650 nm (reference wavelength) was measured using an enzyme-linked immunosorbent assay microplate reader (Bio-Rad); wells containing culture medium but no cells served as blanks. In this experiment, 104 cells in 100 μL, of culture medium were seeded into each well of a 96-well plate. After achieving 70% confluence, the cells were treated with 10, 50 or 100 μM copper. After incubation for 24 and 48 h, the wells were washed, and 100 μL of culture medium and 20 μL of MTS were added to each well. After a 2 hr incubation at 37° C., the absorbance at 490 nm was measured.

RNA Isolation

Total RNA was isolated from tissue fibroblasts in triplicate using phenol chloroform extraction prior to clean-up using Qiagen RNeasy Tissue Kit (Qiagen) according to the manufacturer's instructions. Briefly, approximately 75 mg of tissue was isolated and added to 1 ml of Tri Reagent and a 5 mm Qiagen steel ball bearing. The tissue was homogenized via a TissueLyser (Qiagen) for 3 times 2 min at 20 30 Hz. 100 μl of 1 bromo 3 chloropropane was added, vortexed briefly and allowed to stand for 5 min at room temperature prior to centrifugation for 15 min at 4° C. in a bench top centrifuge. The clear aqueous phase was removed and added to 0.5 ml of isopropanol, allowed to settle and respun for 10 min at 4° C. The pellet was washed in 70% ethanol, air dried at room temperature and resuspended in 300 μl of water. The RNA was further cleaned with gDNA eliminator columns and purified using Qiagen RNeasy plus kit. Total RNA was isolated from cells using Qiagen RNeasy plus kit.

In total 2 μg of RNA was reverse transcribed using High Capacity RNA to cDNA (ABI) Kit as per manufactures instructions in a 20 μl reaction volume. The cDNA derived from tissue was diluted 1in 20 prior to examination via qPCR. cDNA derived from cells was diluted 1 in 100 for ATP7A analysis or 1 in 10 for MT1A analysis.

The RNA samples were treated with DNase I (Qiagen RNase free DNase kit). In total 3 μg of RNA was incubated with poly(dT) primers at 42° C. for 45 min, in a 60 μl reaction volume, using the Reverse Transcription System from Promega (Promega Benelux, Leiden, The Netherlands).

Real Time Quantitative PCR (qPCR)

Q-PCR was performed as described by Spee et al (J Vet Intern Med 2006: 20:1085-1092). Real-time PCR was based on the high affinity double-stranded DNA-binding dye SYBR green I and was performed in triplicate in a spectrofluoro-metric thermal cycler. For each PCR reaction, 8.7 μl (of the diluted stock) of cDNA was used in a reaction volume of 20 μl containing 1×Power SYBR® Green PCR Master Mix, 40 pmol of both primers, on 384 well plates. Primer pairs (except those for ATP7A), depicted in Table XI, were taken from Spee et al. All PCR protocols included a 5-minute polymerase activation step and continued with for 40 cycles (denaturation) at 95° C. for 20 sec, annealing for 30 sec, and elongation at 72° C. for 30 sec with a final extension for 5 min at 72° C. Annealing temperatures ranged from 50° C. till 67° C. (Table XI). Dissociation curves, Bioanalyser (Agilent 2100) and sequencing (MWG) were used to examine each sample for purity and specificity. Efficiency curves constructed by plotting the relative starting amount versus threshold cycles were generated using serial 10-fold dilutions of cDNA. The amplification efficiency, E(%)=(10(1/s)1)·100 (s=slope), of each standard curve was determined and appeared to be >95%, and <105%, over a wide dynamic range. Each experimental sample was normalised to the endogenous references hypoxanthine phosphoribosyl transferase (HPRT), RPL8, RPS5 and RPS19 with appropriate propagation of error.

Western Blotting

Cells were washed 3 times with PBS and lysed in 200 μl freshly made boiling lysis buffer (Tris-buffered saline (TBS) containing 1% SDS) using a rubber policeman to scrape off cells. Samples were homogenised by passing through a 25 gauge needle several times and then heated to 70° C. for 5 min before storing at −20° C. pending analysis. Cell lysates were thawed, boiled for 5 min loading buffer (50 mM Tris.HCl, pH 6.8, 2% SDS, 0.1% bromophenol blue, 10% glycerol, 40 mM DTT) and loaded onto preassembled SDS-PAGE. The membranes were blocked in 5% milk/PBS-T for 1-2 h before incubation for 1 h at RT with the primary antibody. The membranes were washed 3 times for 10 min with blocking buffer prior to 1 h incubation at room temperature with rabbit anti-chicken Ig HRP antibody at a dilution of 1:10,000 in blocking buffer. Membranes were washed 3 times with blocking buffer for 10 min followed by 1 wash with PBS-T. Membranes were briefly washed in PBS to remove detergent and were developed using the ECL western blotting detection reagents system according to the manufacturer's instructions. Membranes were subsequently exposed to SuperRX Fuji X-ray film (Tokyo, Japan) and developed in a Kodak automated processor (Eastman Kodak Company, Japan).

In order to show equal protein loading, membranes were stripped and re-probed. The membrane was Western blotted with mouse anti-tubulin (10,000 dilution, 5% BSA/TBS-T/T, for 1 h at RT, followed by goat anti-mouse HRP (1:10,000) 1% BSA/PBS-T/T, 1 h at RT) and visualised with ECL Western blotting detection reagents as previously described.

Stripping Membranes

Membranes were stripped of bound antibody prior to re-probing. Membranes were incubated at 55° C. for 30 min in stripping buffer (100 mM 2-mercaptoethanol, 2% SDS, 62.5 mM Tris-HCl, pH 6.7) and then washed extensively in PBS before further Western blotting.

Statistics

qPCR data was log 10 transformed prior to analyses, to ensure homogeneity of variance (an assumption of parametric analyses). The log 10(expression) values were then analysed by ANOVA, weighted for the standard error of the expression values. Pairwise comparisons were made to the ATP7A^C/C genotype and fold changes with 95% confidence intervals were calculated.

TABLE XI
Nucleotide Sequences of Dog-Specific Primers for Quantitative Real-Time PCR
					SEQ
			Tm	Accession	ID
Gene	Primer	Sequence (5′-3′)	(° C.)	number	NO:
Hypoxanthine	Forward	AGCTTGCTGGTGAAAAG	56	L77488/	144
phosphoribosyl-		GAC		L77489
transferase (HPRT)	Reversed	TTATAGTCAAGGGCATA			145
		TCC
Metallothionein	Forward	AGCTGCTGTGCCTGATG	61	D84397	146
(MT1A)		TG
	Reversed	TATACAAACGGGAATGT			147
		AGAAAAC
Ribosomal protein	Forward	TCACTGGTGAGAACCCC	62.5	XM_533568	148
S5 (RPS5)		CT
	Reversed	CCTGATTCACACGGCGT			149
		AG
Ribosomal protein	Forward	CCTTCCTCAAAAA/GTC	61	XM_533657	150
S19 (RPS19)		TGGG
S19 (RPS19)	Reversed	GTTCTCATCGTAGGGAG			151
		CAAG
Ribosomal protein	Forward	CCATGAATCCTGTGGAG	55	XM_532360	152
L8 (RPL8)		C
	Reversed	GTAGAGGGTTTGCCGAT			153
		G
ATPase, Cu++	Forward	CTACACTCCAATATGTA	60	AY603040	154
transporting, alpha		AGCAGC
polypeptide	Reversed	AGGTACTCTCAACTTCA			155
(ATP7Ai)		CTAGC
ATPase, Cu++	Forward	AAACATCAAAGGCTCCT	57	AY603040	156
transporting, alpha		ATCC
polypeptide	Reversed	GGAAAGCAAAGCGTATT			157
(ATP7Aii)		ATCG
ATPase, Cu++	Forward	AGTATGAGTGTGGATTC	60	AY603040	158
transporting, alpha		GGT
polypeptide	Reversed	TTTGGAGTCTGTAGTTT			159
(ATP7Aiii)		AGGGT

Results

Canine Dermal Mutant Fibroblasts Incorporate more Copper 64 and Efflux at a Slower Rate than Wildtype or Heterozygote Cells.

Henceforth wildtype, heterozygote and mutant cells are refered to as ATP7A^C/C, ATP7A^C/T or ATP7A^T/T respectively. Incubation of fibroblasts with supraphysiological concentrations of the isotope copper-64 (Cu64) (100 μM) shows an approximately two-fold increase in incorporation of copper after 24 h and 48 h in ATP7A^T/T cells and ATP7A^C/T cells compared to ATP7AC^C/C cells (FIG. 7A). At a lower concentration (50 μM) ATP7A^T/T cells incorporated a higher amount of copper compared to the other genotype cells. Incubation at physiological concentrations shows no difference in incorporation between the cell types. To determine whether the increase in Cu64 levels in the ATP7A^T/T cells was due to abrogated efflux, we next measured the level of efflux from the cells via a washout method (FIG. 7B) After the addition of high amounts of Cu64 (100 μM) and 2 h of washout, the ATP7A^C/C cells had retained approximately 45% of the isotope, whereas the ATP7A^T/T cells had retained almost 90%. The ATP7A^C/T cells which had incorporated a similar amount of copper as the ATP7A^T/T cells showed similar rate of efflux as the ATP7A^C/C cells. Concomitant to the higher amounts of copper incorporation, cell viability was found to be lower in the ATP7A^T/T cells under high copper loading (data not shown).

As a control the experiment was performed in parallel using human wildtype cells and cells derived from a Menkes patient. As expected Menkes cells showed higher incorporation at all Cu64 concentrations used (FIG. 7C), and effluxed Cu64 at a reduced rate compared to wildtype cells (FIG. 7D). Interestingly, incorporation of Cu64 at 24 and 48 h was higher in both wildtype and Menkes cells compared to the canine cells. It remains to be seen what the steady state levels of copper under basal conditions are in human and canine cells.

ATP7A Gene Expression is Unaltered in ATP7A^T/T Cells

To establish whether the reduction in efflux was due to the expression levels of ATP7A, we analyzed ATP7A transcript levels using qPCR. ATP7A isoforms have not been described for dog, so 3 primer sets were designed as follows: ATP7Ai amplified a region overlapping the mutation, and ATP7Aiii and ATP7Aii were designed to amplify regions in the 3′ and 5′ ends of the transcript, in order to account for splice variants. Under basal conditions or incubation with copper no change was found in ATP7A expression levels between the genotypes (FIG. 8A). However when ATP7A protein levels were measured, ATP7A expression was found to be copper-dependent in all 3 of the canine cell lines, with the highest expression in the ATP7A^T/T cells (FIG. 8B), which was not reversible with the addition of the copper chelator BCS in the timepoint measured. Interestingly, under basal conditions there was higher ATP7A expression in ATP7A^T/T cells compared to ATP7A^C/C cells. A number of bands were present on the membrane, presumably corresponding to different isoforms. These bands however did not change and are not shown for simplicity. Further work using siRNA and overexpression constructs will be used to identify ATP7A specific bands.

ATP7A^T/T Cells have Increased MT1A Gene Expression.

To determine whether the higher levels of copper incorporation in ATP7A^T/T cells leads to higher expression of copper responsive genes, we performed qPCR analysis on metallothionein 1A (MT1A) expression in ATP7A^C/C, ATP7A^C/T and ATP7A^T/T cells (FIG. 9). Analysis of MT1A expression in untreated cells shows both ATP7A^C/T and ATP7A^T/T cells have significantly higher expression of MT1A compared to ATP7A^C/C cells (FIG. 9A). ATP7A^C/T and ATP7A^T/T have significantly unregulated MT1A expression in response to 1-100 μM copper, whereas ATP7A^C/C was significant above 10 μM copper addition (FIG. 9B). Additionally comparison of upregulation of MT1A expression in response to copper within the genotypes was not significant when compared between the genotypes except for ATP7A^T/T in response to 1 μM copper ATP7A^C/C_{UT vs Cu1} vs ATP7A^T/T_{UT vs Cu1}; (p=0.014). Thus ATP7A^T/T cells are more sensitive to copper (FIG. 9C).

Copper Dependent Metallothionein Gene Expression is Higher in ATP7A^T/T Cells Compared to ATP7A^C/C

The increased retention of copper and corresponding increased copper dependent MT1A expression in ATP7A^T/T fibroblasts, led us to investigate whether the corresponding Menkes phenotype would be observed in intestine and liver biopsies. Thus, qPCR analysis was performed on MT1A expression on frozen samples of liver and small intestine tissue biopsied from the 3 individuals the fibroblasts were explanted from (FIG. 10). The expression of MT1A was significantly lower in ATP7A^T/T liver tissue, and significantly higher in small intestine tissue, compared to ATP7A^C/C.

Canine Dermal ATP7A^T/T Fibroblasts Have Reduced ATP7A Trafficking

To determine whether the increase in copper in the ATP7A^T/T cells was due to reduction in ATP7A trafficking we used immunocytochemistry to localize ATP7A in response to copper in the different cells types. We used BCS to chelate extracellular copper to ‘stage’ ATP7A in the TGN (top panel). As expected, ATP7A in both ATP7A^C/C and ATP7A^T/T cells was found predominately in the TGN (marked by anti-58K, middle panel). Following washout, and subsequent incubation with 100 μM copper for 1 to 3 hrs, ATP7A in ATP7A^C/C cells translocated from the TGN to the cell periphery in order to export copper from the cell. The ATP7A^T/T cells showed a marked abrogation of ATP7A translocation, as ATP7A was found predominantly in TGN after exposure to copper. The cell density shown in the panels are not indicative of growth rates. Both cell types were found to grow with a similar morphology and density.

Conclusion

The studies have indicated that the rate of accumulation of copper is greater in cells expressing the mutated form of the protein; accumulation is greater during copper exposure and release is slower after copper exposure. In addition, intracellular ATP7A movement in response to copper exposure is altered in cells carrying the mutation. There is also increased expression of a copper transport protein in cells carrying the mutation. Expression levels of ATP7A are not altered between cells carrying the two forms.

The results from this study suggest that there are significant differences in the transport and handling of copper between cells carrying the normal and the mutated forms of ATP7A. These differences, could start to explain the mechanism underlying the apparent differential susceptibility of Labradors to copper accumulation as a factor in CACH.

EXAMPLE 6

Summary

The aim of the study was to investigate whether dietary management is effective to influence hepatic copper concentrations in Labradors after treatment with penicillamine, and whether additional treatment with zinc is useful.

The study was conducted on a group of 24 dogs consisting of 12 female and 12 male pure-bred Labradors. The dogs were family members of former patients with copper-associated chronic hepatitis. At the start of the diet trial dogs were clinically healthy but hepatic copper concentrations of 20 dogs were above the reference range of 400 mg/kg dry weight (mean: 894, range: 70-2810 mg/kg dry weight). These concentrations were measured after completion of treatment with penicillamine.

All dogs were fed the same diet. Additional treatment consisted of zinc gluconate (7.5 mg/kg PO BID, group 1) or a placebo (group 2). The pharmacist was the only person aware of group allocations until completion of the study. Hepatic copper concentrations and histopathology were assessed along with clinical examinations and blood-work before and after treatment for a mean of 8 months (range 5-13), and 16 months (range 12-25). Plasma zinc concentrations were measured at additional time points during treatment.

Twenty-one Labrador dogs completed the study. At the start of the study the mean age of dogs in group 1 was 4.1 years (range 2.7-8.3). Six dogs were females (5 spayed, 1 intact), and six were male (2 neutered, 4 intact). The mean age of dogs in group 2 was 4.8 years (range 3.6-11.2). Six dogs were female (4 spayed, 2 intact), and 6 dogs were male (2 neutered, 4 intact). Vomiting, anorexia, and diarrhea were observed as adverse effects in 3 dogs of the zinc gluconate supplemented group.

There was a significant difference of hepatic copper concentrations in both groups with dietary management over time (8 months: group 1 p<0.001, group 2 p=0.001, and 16 months: group 1 p=0.03, group 2 p=0.04). However, there was no difference in hepatic copper concentrations between groups, prior to treatment (p=0.65), at recheck-1 (p=0.52), and at recheck-2 (p=0.79), suggesting that there is no benefit of further zinc supplementation on hepatic copper accumulation.

The results of this study show that dietary management can be effective to decrease hepatic copper concentrations in Labradors. Adjunctive treatment with zinc did not amplify the de-coppering effect.

The study will now be described in more detail.

Materials and Methods

Labrador Retrievers

The study population consisted of 24 pure-bred Labrador Retrievers that were family members of dogs previously described with CACH. All dogs were registered at the Dutch Labrador Retriever breed club.

All dogs had completed their treatment with penicillamine prior to the start of this study. A medical history was obtained from all dogs and a physical examination was performed. Na-citrated blood samples were taken for analysis of a coagulation profile, including prothrombin time (PT), activated partial thromboplastin time (aPTT) and fibrinogen. Heparin- and EDTA-blood was sampled for analysis of the hepatobiliary enzymes alkaline phosphatase (ALP), alanine aminotransferase (ALT), of bile acids (BA), and for measurement of the platelet count, and plasma zinc concentrations. Liver biopsies were taken according to the Menghini technique given by Rothuizen (Rothuizen J, I. T. (1998) Tijdschr Diergeneeskd 123: 246-252). At least three liver biopsies were taken from each dog. Two biopsies were fixed in 10 percent neutral buffered formalin, and one biopsy was stored in a copper-free container for quantitative copper determination.

All biopsies were histologically assessed. Hepatic tissue was stained with rubeanic acid stain for evaluation of copper distribution and semiquantitation as previously described (Van den Ingh T.S.G.A.M., R. J., Cupery R. (1988) Vet Q 10: 84-89). According to the applied grading system copper scores above 2 are abnormal (0: no copper, 1: solitary liver cells and/or reticulohistiocytic (RHS) cells containing some copper positive granules, 2: small groups of liver cells and/or RHS cells containing small to moderate amounts of copper positive granules, 3: larger groups or areas of liver cells and/or RHS cells containing moderate amounts of copper positive granules, 4: large areas of liver cells and/or RHS cells with many copper positive granules, 5: diffuse presence of liver cells and/or RHS cells with many copper positive granules).

A quantitative assay for copper in liver tissue was performed by neutron activation analysis, according to a protocol described by Teske et al, using the facilities described by Bode (Bode, P. (1990) Journal of Trace and Microprobe Techniques 8: 139; Teske et al. (1992) Vet Rec 131: 30-32). Quantitative copper concentrations were measured in lyophilised liver biopsies and reported in mg/kg dry weight liver.

Apart from the copper content, further histological changes were graded on a scale between 0 and 5 in order to allow statistical testing (0=no histologic signs of inflammation, 1=reactive hepatitis, 2=mild chronic hepatitis, 3=moderate chronic hepatitis, 4=severe chronic hepatitis, 5=cirrhosis).

The study was approved by the Utrecht University Institutional Animal Care and Use Committee. Informed owner consent was obtained for all dogs.

Progression of Hepatic Copper Accumulation Without Treatment

In eleven dogs measurement of hepatic copper concentrations was repeated after a mean of 8.7 months (range 6-15 months), prior to any treatment. During this time all animals were fed their usual maintenance diet, which contained dietary copper concentrations between 12-25 mg/kg dry matter and zinc concentrations between 80-270 mg/kg dry matter according to the manufacturers.

Diet

All dog owners were provided with the same specially manufactured diet. Approximate analysis of the diet as fed: moisture 57.9%, crude protein 6.1%, crude fat 5.9%, minerals 1.7%. Metabolizable energy (measured according to Association of American Feed Control Officials protocol): 1650 kcal/kg as fed). The diet contained copper at a concentration of 4.75 mg/kg dry matter, and zinc at a concentration of 102 mg/kg dry matter. The dogs were fed the diet without further dietary supplements and treats. The Labradors of this study received between 420 and 840 g diet/day.

Pharmacokinetic Study

Two unrelated nine-year old, healthy Labrador Retrievers (1 female and 1 male) were used in a pharmacokinetic study. Food was withheld for a 12-hour period prior to oral administration of zinc, and during the initial 6-hour testing period. Water was freely available. Oral zinc gluconate was administered at a dose of 10 mg/kg in dog 1, and at a dose of 5 mg/kg in dog 2. Heparinized blood samples (4 ml) were collected from the jugular vein before dosing (time 0) and 15, 30, 45, 60, 90, 120 minutes, and 4, 8, 12 and 24 hours after application of the drug. Plasma was stored at −20° C. until analysis for zinc using atomic absorption spectrometry.

Drug Preparation, Randomization, and Blinding

The choice for zinc-gluconate was made based on our clinical observation that the drug has fewer side effects than the other salts, like acetate or sulphate. The tablets were provided by the Veterinary Pharmacy of the Faculty of Veterinary Medicine, University of Utrecht. Zinc tablets contained 25 mg elemental zinc as zinc-gluconate salt (Toppharm Zink 25 gluconaat, Parmalux BV, Uitgeest, NL). Placebo tablets contained 160 mg lactose (Albochin, Pharmachemie BV, Haarlem, NL). Tablets from both groups had an identical appearance.

The Pharmacist randomized group allocations prospectively for sets of six dogs by flipping a coin. Three dogs received the placebo, and three dogs were treated with zinc. On prescription of the clinician, tablets (placebo or zinc) were dispensed according to a randomisation table.

Dosage of the prescription was according to the following scheme:

Bodyweight:

	<28 kg (<61.6 lbs):	8 tablets BID	(200 mg BID)
	28-35 kg (61.6-77 lbs):	9 tablets BID	(225 mg BID)
	above 35 (>77 lbs):	10 tablets BID	(250 mg BID)

Owners were instructed to give the tablets mixed with small amounts of their diet 30 minutes before feeding. Neither the owner nor the clinician was informed about which treatment each dog received. The randomization table remained in possession of the Pharmacy during the trial and was only revealed upon completion of the trial.

Statistical Analysis

Pharmacokinetic parameters (WinNonlin 4.0.1. (Pharsight Corporation, 800 West El Camino Real, Mountain View, Calif., USA) and statistical analysis (SPSS 11.0 for windows, 2001, SPSS Inc., Chicago, Ill., USA) were calculated by use of commercially available software packages. Due to small group sizes a non-parametric statistical test was used for comparison between groups. A Mann-Whitney test was used to detect a difference between hepatic copper concentrations before and after treatment with diet and zinc-gluconate (group-1) at two control examinations (recheck-1 and recheck-2), and after treatment with diet and placebo (group-2) at both control examinations. In addition the test was used to detect a difference between group-1 and group-2 before the study, at recheck-1, and at recheck-2 (significance level p<0.05).

Results

Progression of Hepatic Copper Accumulation without Treatment

In eleven Labrador dogs measurement of hepatic copper concentrations was repeated before any treatment was given, and while the dogs were fed their usual maintenance diet. In all but one dog hepatic copper concentrations increased during the time interval of 8.7 months between both measurements from a mean of 1000 mg/kg dry weight (range 290-2370) to a mean of 1626 mg/kg dry weight (range 630-3610). Related to the bodyweight of the patients (mean: 33.9 kg, range 25-39.5 kg) this was an increase of 18 mg copper per kg bodyweight during 8.7 months. The results are shown in FIG. 1.

Pharmacokinetic Study

Pharmacokinetic parameters calculated from plasma zinc concentrations measured in two dogs after oral application of 10 mg/kg (dog 1) and 5 mg/kg (dog 2) elemental zinc were:

• Dog 1 (10 mg/kg): V_F: volume of distribution=2937.872 ml/kg bodyweight, K01: absorption rate constant=0.567212 1/hour, K10: elimination rate constant=0.053728 1/hour, AUC: area under the curve=63.35272 hr*μg/ml, Cl_F: clearance in relation to the bioavailability=157.8464 ml/hr/kg, Tmax: time of maximum concentration=4.589813 hours, Cmax: maximal clearance=2.659924 μg/ml).
• Dog 2 (5 mg/kg): V_F: volume of distribution=2538.689 ml/kg bodyweight, K01: absorption rate constant=1.160647 1/hour, K10: elimination rate constant=0.037886 1/hour, AUC: area under the curve=51.98513 hr*μg/ml, Cl_F: clearance in relation to the bioavailability=96.18135 ml/hr/kg, Tmax: time of maximum concentration=3.047974 hours, Cmax: maximal clearance=1.754728 μg/ml).
• The calculated half-life of zinc was t½=15.1 hours.
• The calculated accumulation rate R was 1.52, from R=1/(1−exp(−k10*24). The dose interval was chosen to be 12 hours. A dose estimate was 127.0139 ml/hr/kg, calculated from the mean of CL_F from both dogs.
• An estimate of the appropriate dosage was based on an intended maximum zinc plasma concentration of 5 μg/ml. Dosage=Cl_F×intended blood concentration×dose interval=7.62 mg/kg q 12 hours

Diet Trial and Randomized, Placebo-Controlled Zinc Application

At the start of the diet trial hepatic copper concentrations of 20 dogs were above the reference range of 400 mg/kg dry weight (mean: 894, range: 70-2810 mg/kg dry weight). Results from semiquantitative assessment of copper ranged from 0 to 4.5. Histopathological examination of liver biopsies from 17 dogs revealed an elevated hepatic copper content (above 2), which was localized to centrolobular hepatocytes. Staining for copper was normal in 5 dogs, and high normal staining results were obtained from biopsies of 2 dogs with elevated hepatic copper from quantitative analysis. In seven dogs chronic hepatitis was present. CH was characterized by varying degree of hepatocellular apoptosis and necrosis, mononuclear inflammation, regeneration and fibrosis. The activity of the hepatic inflammation was determined by the quantity of inflammation and extent of hepatocellular apoptosis and necrosis. The stage of the disease was determined by the extent and pattern of fibrosis and the presence of cirrhosis Hepatitis was mild in 4 patients, moderate in 2 dogs, and cirrhosis was diagnosed in 1 dog. In thirteen dogs there were no histological signs of inflammation present in the liver, and in biopsies of 4 dogs histopathology revealed reactive changes.

At the start of the study the mean age of dogs in group 1 was 4.1 years (range 2.7-8.3). Six dogs were spayed females, and six were male (2 neutered, 4 intact). The average bodyweight was 33 kg (range 26.2-37.5). The mean hepatic copper concentration of the dogs in group 1 was 961 mg/kg dry weight (range 340-2810). The mean semiquantitative assessment of copper from histological staining was 2-3+(range 0-4.5).

The mean age of dogs in group 2 was 4.8 years (range 3.6-11.2). Six dogs were female (4 spayed, 2 intact), and 6 dogs were male (2 neutered, 4 intact). The average bodyweight was 32.3 kg (range 25-41.9). The mean hepatic copper concentration of dogs in group 2 was 861 mg/kg dry weight (range 70-1680). There was no difference in hepatic copper concentrations between both groups prior to treatment (p =0.73). The mean semiquantitative assessment of copper from histological staining was 2-3+(range 0.5-3).

Three dogs of group-1 did not complete the study. The reason for discontinuation was unrelated to the treatment in all three dogs (one owner felt his dog was getting too old, one owner had personal reasons, and one dog developed a mast cell tumor). Twenty-one dogs completed the study, with at least one control examination (recheck-1). In sixteen dogs liver biopsies were obtained at an additional later time point (recheck-2).

Vomiting, and anorexia were observed adverse effects in 3 dogs of group 1. One of these dogs also had transient small bowel diarrhea. The adverse effects occurred immediately after application of the tablets, and resolved when the tablets were mixed with the diet.

Blood Examinations

The concentration of bile acids decreased from a mean of 14 μmol/l (range: 3-101), to a mean of 7.8 (range: 1-39) at recheck-1 and 7.1 (range: 0-21) at recheck-2. The mean concentration of alkaline phosphatase (ALP), and alanine aminotransferase (ALT) remained within the normal range at all examinations. The mean ALP concentration before treatment was 41 U/l (range: 8-111), at recheck-1: mean ALP=37 U/l (range 12-143), at recheck-2: mean ALP=37 U/l (range:19-152). The mean ALT concentration before treatment was 28 U/l (range: 10-234), at recheck-1: mean ALT=47 U/l (range: 11-78), at recheck-2: mean ALT=51 U/l (26-68).

At the beginning of the study the mean plasma concentrations of zinc were 95 μg/dl and 96 μg/dl in group-1 and group-2 respectively. There was no difference in plasma zinc concentrations of either group at recheck-1 and recheck-2 (p values between 0.11 and 0.79). No difference in plasma zinc concentration was found between group 1 and group 2 at any of the three examinations (p values between 0.34 and 0.5). The only time-point at which a difference in plasma zinc concentrations could be found was a blood examination after the initial month of treatment with zinc in group 1. Blood sampling was performed 2-6 hours after zinc application. At this control examination the mean plasma zinc concentration had increased to 165 μg/dl (range 117-249, p=0.02).

Hepatic Copper Measurements

Quantitative measurement of hepatic copper improved during treatment in both groups. At recheck-1, and at recheck-2, hepatic copper concentrations had decreased significantly in both groups of dogs, compared to the starting point (group-1 at recheck-1: mean 286 mg/kg, range 84-700, p<0.001; group-1 at recheck-2: mean 421 mg/kg, range 220-790, p=0.03, group-2 at recheck-1: mean 277 mg/kg, range 80-450, p=0.001, group-2 at recheck-2: mean 401 mg/kg, range 118-850, p=0.04). There was no difference in hepatic copper concentrations between both groups at recheck-1 (p=0.52), and there was no difference between groups at recheck-2 (p=0.79). In addition there was no further decrease of hepatic copper concentrations between recheck-1, and recheck-2 (group-1 p=0.44, group-2 p=0.25). The results are shown in FIG. 2.

Histology

Histological staining for copper improved with treatment. Histological scores for semi-quantitative assessment of copper decreased in group 1 and group 2 at recheck-1 and recheck-2 compared to the starting point (group 1 at recheck-1: p=0.031, group 1 at recheck-2: p=0.01, group 2 at recheck-1: p=0.01, group 2 at recheck-2: p=0.001). There was no difference between both groups at any time-point (p=0.16-0.75).

Histological scoring for severity of inflammation of the liver remained unchanged throughout all examinations of the dogs from both groups (p=0.25-0.45).

Conclusion

In order to provide patients with CACH with a more balanced long term control of hepatic copper concentrations the aim of this study was to investigate whether dietary management is effective to influence hepatic copper concentrations in Labradors after treatment with penicillamine, and whether additional treatment with zinc is useful. The results of this study show that dietary management can be effective to decrease hepatic copper concentrations. Adjunctive treatment with zinc did not amplify the de-coppering effect.

EXAMPLE 7

During an investigation of the effect of zinc on hepatic copper concentration, hepatic copper concentration was measured in 18 pure-bred Labrador Retrievers. Half of the dogs were provided with a supplement of zinc and the other half were provided with a placebo. All of the dogs were fed the diet of Example 2. Hepatic copper concentration was measured using the method of Example 2 at 3 time points: (1) before treatment with penicillamine; (2) after treatment with penicillamine but before treatment with the diet of Example 2; and (3) after the diet treatment. As in Example 2, there was no significant difference between copper levels in dogs treated with zinc and with the placebo (data not shown). However, the use of the diet did have a significant effect on the copper levels. The combined results for dogs treated with zinc and with the placebo are shown in FIG. 3 and demonstrate that the low copper diet has a more significant effect on reducing liver copper levels than penicillamine alone.

EXAMPLE 8

An example of a foodstuff of the invention is set out below:

Ingredient (%)              100
Water                       47.4
Cereals                     28.5
Vegetable by-products       1.7
Egg and egg by-products     1.5
Meat and animal by-products 17
Oil and fat                 2
Minerals and vitamins       1.9

A typical analysis of the amounts of minerals and trace elements in this foodstuff, together with the method used, is provided as follows:

	Result
	(% weight as
	fed or mg/kg
Analysis	dry matter)	Notes
Moisture	63%	Loss by drying at 105° C. for 5 hours
Protein	6.5%	Protein by Kjeldahl using nitrogen
		factor 6.25
Fat	4.2%	Acid hydrolysis and petroleum ether
		extraction
Ash	2.2%	16 hr ramp temperature programme, final ash
		at 550° C. for 5 hr
Crude fibre	1.4%	EC method OJ L344 26/11/92 P35, Directive
		92/89
Copper	5.4 mg/kg	By flame atomic absorption
		spectrophotometry
Zinc	229 mg/kg	By flame atomic absorption
		spectrophotometry
Iron	62 mg/kg	By flame atomic absorption
		spectrophotometry
Calcium	9 460 mg/kg	By flame atomic absorption
		spectrophotometry
Phosphorus	5 405 mg/kg	By colorimetric reaction

EXAMPLE 9

A further example of a foodstuff of the invention is as follows:

Ingredient (%)              100
Cereals                     39.7
Vegetable by-products       8.0
Vegetable protein extract   5.0
Meat and animal by-products 35.6
Oil and fat                 7.5
Minerals and vitamins       4.2

A typical analysis of the amounts of minerals and trace elements in this foodstuff, together with the method used, is provided as follows:

	Result (% weight as
	fed or mg/kg dry
Analysis	matter)	Notes
Moisture	8.0%	Loss by drying at 105° C. for 5 hours
Protein	30.0%	Protein by Dumas using nitrogen
		factor 6.25
Fat	13.0%	Acid hydrolysis and petroleum ether
		extraction
Ash	6.3%	16 hr ramp temperature programme,
		final ash at 550° C. for 5 hr
Crude fibre	4.1%	EC method OJ L344 26/11/92 P35,
		Directive 92/89
Copper	10.9 mg/kg	By flame atomic absorption
		spectrophotometry
Zinc	245 mg/kg	By flame atomic absorption
		spectrophotometry
Iron	217 mg/kg	By flame atomic absorption
		spectrophotometry
Calcium	1 087 mg/kg	By flame atomic absorption
		spectrophotometry
Phosphorus	760 mg/kg	By colorimetric reaction

Claims

1. A method of testing a dog to determine the likelihood that the dog is protected from liver copper accumulation, comprising detecting in a sample the presence or absence in the genome of the dog of one or more polymorphisms selected from (a) SNP ATP7a_Reg3_F—6 (SEQ ID NO:142) and (b) one or more polymorphisms in linkage disequilibrium with (a).

2. The method according to claim 1, comprising detecting the presence or absence of (a) SNP ATP7a_Reg3_F—6 (SEQ ID NO:142) or (b) SNP ATP7a_Reg16_F—42 (SEQ ID NO: 143).

3. The method according to claim 1, wherein the dog is in the first year of its life.

4. The method according to claim 1, wherein the dog has genetic inheritance of the Labrador Retriever, Golden Retriever or Miniature Poodle breed.

5. The method according to claim 4, wherein the dog has genetic inheritance of the Labrador Retriever breed.

6. The method according to claim 1, further comprising detecting the presence or absence in the genome of the dog of (c) a polymorphism in the GOLGA5, ATP7A or UBL5 gene that is indicative of susceptibility to liver copper accumulation and/or (d) a polymorphism in linkage disequilibrium with a said polymorphism (c).

7. The method according to claim 6, comprising detecting the presence or absence of one or more SNPs selected from BICF2P506595 (SEQ ID NO:1), BICF2P772765 (SEQ ID NO:2), BICF2S2333187 (SEQ ID NO:3), BICF2P1324008 (SEQ ID NO:4), BICF2P591872 (SEQ ID NO:5), ATP7a_Reg4_F—9 (SEQ ID NO: 131), UBL5_Reg1F—16 (SEQ ID NO: 132), golga5_Reg1—24 (SEQ ID NO: 133), golga5—26 (SEQ ID NO: 134), golga5—27 (SEQ ID NO: 135), golga5—28 (SEQ ID NO: 136), golga5—29 (SEQ ID NO: 137), golga5—30 (SEQ ID NO: 138), golga5—31 (SEQ ID NO: 139), atp7areg17—32 (SEQ ID NO: 140), atp7areg17—33 (SEQ ID NO: 141) and one or more SNPs in linkage disequilibrium thereof.

8. The method according to claim 7, comprising detecting the presence or absence of the SNPs BICF2P506595 (SEQ ID NO:1), BICF2P772765 (SEQ ID NO:2), BICF2S2333187 (SEQ ID NO:3), BICF2P1324008 (SEQ ID NO:4), and BICF2P591872 (SEQ ID NO:5).

9. The method according to claim 1, wherein a polymorphism that is in linkage disequilibrium with a polymorphism (a) or (c) is within 680 kb of and on the same chromosome as polymorphism (a) or (c) and the calculated measure of linkage disequilibrium between the pair of polymorphisms, D′, is greater than or equal to 0.9.

10. A database comprising information relating to SNP ATP7a_Reg3_F—6 (SEQ ID NO:142) and/or one or more polymorphisms in linkage disequilibrium thereof and their association with the protection of a dog from liver copper accumulation.

11. A method of determining the likelihood that a dog is protected from liver copper accumulation, the method comprising:

(a) inputting to a computer system data concerning the presence or absence in the genome of the dog of a polymorphism as defined in claim 1;

(b) comparing the data to a computer database, which database comprises information relating to said polymorphisms and their association with the protection of a dog from, or susceptibility of a dog to, liver copper accumulation; and

(c) determining on the basis of the comparison the likelihood that the dog is protected from liver copper accumulation.

12. A computer program comprising program code means that, when executed on a computer system, instruct the computer system to perform all the steps of claim 11.

13. A computer storage medium comprising the computer program according to claim 12 and the database according to claim 10.

14. A computer system arranged to perform a method according to claim 11 comprising:

(a) means for receiving data concerning the presence or absence in the genome of the dog of a polymorphism as defined in claim 1;

(b) a database comprising information relating to said polymorphisms and their association with the protection of a dog from, or susceptibility of a dog to, liver copper accumulation;

(c) a module for comparing the data with the database; and

(d) means for determining on the basis of said comparison the likelihood that the dog is protected from liver copper accumulation.

15. A method of determining the likelihood that a dog is protected from liver copper accumulation, comprising detecting the presence or absence in the genome of the dog of one or more polymorphisms selected from (a) SNP ATP7a_Reg3_F—6 (SEQ ID NO:142) and (b) one or more polymorphisms in linkage disequilibrium with (a).

16. Use of a polymorphism as defined in claim 1 for determining the likelihood that a dog is protected from liver copper accumulation.

17. A method of selecting a dog for producing offspring likely to be protected from liver copper accumulation comprising:

determining whether the genome of a candidate first dog comprises one or more polymorphisms indicative of protection from liver copper accumulation according to the method of claim 1 and thereby determining whether the candidate first dog is suitable for producing offspring likely to be protected from liver copper accumulation;

optionally, determining whether the genome of a second dog of the opposite sex to the first dog comprises one or more polymorphisms indicative of protection from liver copper accumulation according to claim 1; and

optionally, mating the first dog with the second dog in order to produce offspring likely to be protected from liver copper accumulation.

18. The method according to claim 17, wherein the dog has genetic inheritance of the Labrador Retriever, Golden Retriever or Miniature Poodle breed.

19. The method of claim 18, wherein the dog has genetic inheritance of the Labrador Retriever breed.

20. A method of preventing a disease attributable to liver copper accumulation in a dog having genetic inheritance of the Labrador Retriever breed, wherein the likelihood that the dog is protected from liver copper accumulation has been determined by a method according to claim 1, the method comprising feeding the dog a foodstuff comprising copper at a concentration of from 4.5 to 12 mg/kg dry matter.

21. The method according to claim 20, wherein the foodstuff further comprises zinc at a concentration of at least 120 mg/kg dry matter.

22. The method according to claim 20, wherein the foodstuff comprises copper at a concentration of 4.5 to 10 mg/kg or 4.5 to 8 mg; and/or comprises zinc at a concentration of 120 to 250 mg/kg or 150 to 250 mg/kg dry matter.

23. The method according to claim 20, for preventing a disease attributable to liver copper accumulation in a dog:

(i) having at least one parent that is a pure-bred Labrador Retriever;

(ii) that has no clinical symptoms associated with liver copper accumulation;

(iii) that has a liver copper concentration of less than 400 mg/kg of dry weight liver; and/or

(iv) that does not have detectable liver disease.

24. The method according to claim 20, which is for preventing copper-associated chronic hepatitis.

25. (canceled)

26. The method according to claim 20, further comprising feeding the dog a foodstuff or supplement comprising zinc at a concentration of at least 120 mg/kg.

27. (canceled)

28. (canceled)

29. (canceled)

30. (canceled)