OLIGONUCLEOTIDES FOR DETECTING LISTERIA SPP. AND USE THEREOF

- Samsung Electronics

Oligonucleotides specifically binding to Listeria spp., and a kit and a method of efficiently detecting Listeria spp. in a sample by using the oligonucleotides are provided.

Skip to: Description  ·  Claims  · Patent History  ·  Patent History
Description
CROSS-REFERENCE TO RELATED APPLICATIONS

This application claims benefits from U.S. Provisional Patent Application No. 61/378,100, filed on Aug. 30, 2010, the content of which is hereby incorporated by reference in its entirety.

FIELD

An oligonucleotide set and a kit for detecting Listeria spp. and a method of detecting

Listeria spp. in a sample by using the same are disclosed.

RELATED ART

Listeria spp. bacteria are gram-positive, non-spore forming and motile bacilli and can grow in a wide temperature range of about −4° C. to about 45° C. and a wide pH range of about ≦5.5 to about 9.5. The Listeria genus contains six species, including Listeria monocytogenes, L. innocua, L. welshimeri, L. seeligeri, L. ivanovii, and L. grayi. Among these species of Listeria, L. monocytogenes is the cause of most human listeriosis cases. The immunocompromised, pregnant women, elderly, and neonates are susceptible to infection caused by this species. Typical symptoms of listeriosis include septicemia, meningitis and miscarriage.

Consumption of contaminated foods is the major cause of Listeria infection. There have been epidemics of various Listeria-induced infections caused by the consumption of contaminated foods, such as unpasteurized milk, contaminated cheese, coleslaw, and the like. Therefore, there is an increasing demand for a method of rapid, sensitive, and accurate detection of Listeria in a sample, such as in a food, a surface wipe, or medical sample.

SUMMARY

A composition, which is suitable for a rapid, sensitive and accurate detection of Listeria spp. is disclosed. The composition includes a first oligonucleotide including the sequence of SEQ ID NO. 1 (TTGCGAAAGAAGTAGGTATTGAG), and a second oligonucleotide including the sequence of SEQ ID NO. 2 (CAGGATTACTCGTTGATTGAATAAC) or SEQ ID No. 3 (GTTCCATTAAATTCTGGTTTACAGG).

According an embodiment, the composition may further contain a probe oligonucleotide which includes a DNA sequence and an RNA sequence, and is substantially complementary to respective opposite strands of a target nucleic acid, and may define a target nucleic acid of 3000 bp in length. The primer pair is complementary to the prs gene in the virulence gene cluster of Listeria spp. and thus is available to specifically amplify the target nucleic acid of the prs gene. The prs gene is an open reading frame (ORF) including 954 bp and ending at 48 bp upstream from prfA. The ORF encodes 318 amino acid residues, and amino acid sequences derived therefrom are homologous to the sequences of phosphoribosyl pyrophosphate (PRPP) synthetase of Bacillus subtilis, Escherichia coli, Salmonella typhimurium, and human and rat. By carefully designing a primer pair, a combination of the probe and primer oligonucleotides can amplify and detect target nucleic acid sequences of any Listeria species, but not the target nucleic acid sequences of non-Listeria microorganisms. The combination of the primer pair and the probe according to an embodiment can highly specifically amplify and detect target nucleic acids of Listeria spp. at a high sensitivity.

In an embodiment, the probe includes the sequence of SEQ ID NO: 10: ACAACCACGG AX1ACTTTCTTATACTTTCTTCAATG, wherein X1 at position 12 is T or U, and wherein at least one of nucleotides at positions 8-13 is a ribonucleotide. The probe includes the sequence of SEQ ID NO: 6 or 7. In one embodiment, the probe oligonucleotide has a DNA sequence and an RNA sequence, and is one or more selected from the group consisting of oligonucleotides of SEQ ID NOs: 4-8: ACAACCArCrGrGrATACTTTCTTCAATG (SEQ ID NO. 4), wherein “rC,” “rG,” r”G,” and “rA” at positions 8, 9, 10 and 11, respectively are ribonucleotides, ACAACCACGrGATACTTTCTTCAATG (SEQ ID NO. 5), wherein “rG” at position 10 is a ribonucleotide, CATTGAArGrArArAGTATCCGTGGTTGT (SEQ ID NO. 6), wherein “rG,” “rA,” “rA”, and “rA” at positions 8, 9, 10, and 11, respectively are ribonucleotides. GAAGAAAGTATCCrGrUrGrGTTGTCATG (SEQ ID NO. 7), wherein “rG,” “rU,” “rG”, and “rG” at positions 14, 15, 16, and 17, respectively are ribonucleotides, and ACAACCACGrGrArUrACTTTCTTCAATG (SEQ ID NO. 8), wherein “rG,” “rA,” “rU”, and “rA” at positions 10, 11, 12, and 13, respectively are ribonucleotides.

The probe oligonucleotide is labeled with a detectable marker, for example, a fluorescence resonance energy transfer (FRET) pair.

In still another embodiment, a kit for detecting Listeria spp. in a sample, the kit containing the above composition is provided. The kit may further include an amplifying activity and an RNase H activity. In an embodiment, the kit may further include a reverse transcriptase activity for reverse transcription of a target Listeria spp. RNA sequence.

In another embodiment, a method of detecting Listeria spp. in a sample is provided. The method includes (a) amplifying a target nucleic acid of Listeria spp. in the sample to produce an increased number of copies of the target nucleic acid, the amplification including hybridizing a first primer of SEQ ID NO: 1 and a second primer of SEQ ID NO: 2 or 3 to the target nucleic acid in the sample to obtain a hybridized product of the target nucleic acid and the primers, and extending the first and the second primers of the hybridized product using a template-dependent nucleic acid polymerase to produce an extended primer product; (b) hybridizing the target nucleic acid to at least one probe oligonucleotide which is capable of being hybridized to the target nucleic acid to obtain a hybridized product of the target nucleic acid: probe oligonucleotide, the probe include a DNA sequence and an RNA sequence and being coupled to a detectable marker; (c) contacting the hybridized product of the target nucleic acid: probe with an RNase H activity to cleave the probe, resulting in a probe fragment dissociation from the target nucleic acid; and (d) detecting the detectable marker.

In another embodiment, a method of detecting a target RNA sequence of Listeria spp. in a sample is provided. The method includes(a) reverse transcribing the Listeria spp. target RNA in the presence of a reverse transcriptase activity and the reverse amplification primer to produce a target cDNA of the target RNA; (b) amplifying the target cDNA sequence to produce an increased number of copies of the target cDNA nucleic acid, the amplification including hybridizing a first primer of SEQ ID NO: 1 and a second primer of SEQ ID NO: 2 or 3 to the target cDNA to obtain a hybridized product of the target nucleic acid and the primers, and extending the first and the second primers of the hybridized product using a template-dependent nucleic acid polymerase to produce an extended primer product; (c) hybridizing the target nucleic acid to at least one probe oligonucleotide which is substantially complimentary to the target cDNA to obtain a hybridized product of the target nucleic acid: probe oligonucleotide, wherein the probe includes a DNA sequence and an RNA sequence and is coupled to a detectable marker; (d) contacting the hybridized product of the target nucleic acid: probe oligonucleotide with an RNase H to cleave the probes; and (e) detecting an increase in the emission of a signal from the detectable label on the probe, wherein the increase in signal indicates the presence of the Listeria spp. target RNA in the sample.

The probe oligonucleotide which may be used in the above methods may be the oligonucleotide of SEQ ID NO: 10. The probe oligonucleotide may be one of oligonucleotides of SEQ ID NOs: 4-8. The probe oligonucleotide may be labeled with a detectable marker, for example a fluorescence resonance energy transfer pair.

Amplification of a target sequence in a sample may be performed by using any nucleic acid amplification method, such as the Polymerase Chain Reaction (U.S. Pat. Nos. 4,683,195, 4,683,202, and 4,800,159) or by using amplification reactions such as Ligase Chain Reaction (Proc. Natl. Acad. Sci. USA 88:189-193), Self-Sustained Sequence Replication (Guatelli et al., 1990, Proc. Natl. Acad. Sci. USA 87:1874-1878), Strand Displacement Amplification (U.S. Pat. Nos. 5,270,184, en 5,455,166), Transcriptional Amplification System (Kwoh et al., Proc. Natl. Acad. Sci. USA 86:1173-1177), Q-Beta Replicase (Lizardi et al., 1988, Bio/Technology 6:1197), Nucleic Acid Sequence Based Amplification (NASBA), Cleavage Fragment Length Polymorphism (U.S. Pat. No. 5,719,028), Isothermal and Chimeric Primer-initiated Amplification of Nucleic Acid (U.S. Pat. No. 6,951,722), Ramification-extension Amplification Method (U.S. Pat. Nos. 5,719,028 and 5,942,391) or other suitable methods for amplification of nucleic acid.

The amplification, hybridization, and contacting steps may be performed simultaneously or sequentially.

In an embodiment, the sample containing Listeria spp. may be cultured in an enrichment medium before the amplification, to enhance growth of the Listeria spp. Such enrichment medium may contain about 10 to about 40 g/L of tryptic soy broth, about 1 to about 10 g/L of yeast extract, and about 1 to about 10 g/L of lithium chloride. The enrichment medium may further contain at least one component selected from the group consisting of about 1 to about 10 g/L of beef extract, and/or a vitamin mix containing about 0.01 to about 0.5 mg/L of riboflavin, about 0.5 to about 1.5 mg/L of thiamine and about 0.01 to about 1.5 mg/L of biotin; about 1 to about 5 g/L of pyruvate or a salt thereof; and about 0.01 to about 1 g/L of ferric ammonium citrate. The enrichment medium may further comprise a buffer compound, for example 3-(N-morpholino)propanesulfonic acid (MOPS) and a sodium salt thereof.

In another embodiment, the enrichment medium may contain about 1 to about 10 mg/L of acriflavine, about 5 to about 15 mg/L of polymyxin B, and about 10 to about 30 mg/L of ceftazidime. For example, the enrichment medium may contain about 10 to about 40 g/L of tryptic soy broth, about 1 to about 10 g/L of yeast extract, about 1 to about 10 g/L of lithium chloride; about 1 to about 10 g/L of beef extract and/or a vitamin mix containing about 0.01 to about 0.5 mg/L of riboflavin, about 0.5 to about 1.5 mg/L of thiamine, and about 0.01 to about 1.5 mg/L of biotin; about 1 to about 5 g/L of pyruvate or a salt thereof; about 0.1 to about 1 g/L of ferric ammonium citrate; about 4 g/L of 3-(N-morpholino)propanesulfonic acid (MOPS) and about 7.1 g/L of sodium MOPS; and about 1 to about 10 mg/L of acriflavine, about 5 to about 15 mg/L of polymyxin B, and about 10 to about 30 mg/L of ceftazidime. In an embodiment, the enrichment medium does not contain one or both of esculin and peptone.

In still another embodiment, the enriched medium contains, about 30 g/L of tryptic soy broth, about 6 g/L of yeast extract, about 1 to about 10 g/L of lithium chloride; about 5 g/L of beef extract and/or a vitamin mix containing about 0.1 mg/L of riboflavin, about 1.0 mg/L of thiamine, and about 1.0 mg/L of biotin; about 2 g/L of sodium pyruvate; about 0.2 g/L of ferric ammonium citrate; about 4 g/L of 3-(N-morpholino)propanesulfonic acid (MOPS) and about 7.1 g/L of sodium MOPS; and about 5 mg/L of acriflavine, about 10 mg/L of polymyxin B, and about 20 mg/L of ceftazidime.

In another embodiment, the enrichment medium may be brain-heart infusion broth or tryptic soy broth containing 0.6% yeast extract.

The above discussed enrichment medium may be based on an aqueous medium, for example water.

The sample which may be tested for the detection of Listeria spp. may be a food, a medical sample, or a surface wipe.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1 is a graph illustrating the inclusivity test results wherein 95 Listeria strains were tested by real-time polymerase chain reaction (PCR);

FIG. 2 is a graph illustrating the exclusivity test results wherein 23 non-Listeria strains were tested by real-time PCR; and

FIG. 3 is a graph illustrating the real-time PCR results with respect to the number of copies of plasmid containing the target sequences of the Listeria prs gene.

FIG. 4 is a graph illustrating the real-time PCR results with respect to the copy number of the RNA product of the prs gene.

 DETAILED DESCRIPTION

The practice of the embodiments described herein employs, unless otherwise indicated, conventional molecular biological techniques within the skill of the art. Such techniques are well known to the skilled worker, and are explained fully in the literature. See, e.g., Ausubel, et al., ed., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., N.Y. (1987-2008), including all supplements; Sambrook, et al., Molecular Cloning: A Laboratory Manual, 2nd Edition, Cold Spring Harbor, N.Y. (1989).

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as is commonly understood by one of skill in the art. The specification also provides definitions of terms to help interpret the disclosure and claims of this application. In the event a definition is not consistent with definitions elsewhere, the definition set forth in this application will control.

The term “amplification” used herein refers to any process for increasing the number of copies of nucleotide sequences. Nucleic acid amplification describes a process whereby nucleotides are incorporated into nucleic acids, for example, DNA or RNA.

The term “nucleotide” used herein refers to a base-sugar-phosphate combination. Nucleotides are the monomeric units of nucleic acids, for example, DNA or RNA. The term “nucleotide” includes ribonucleoside triphosphates, such as rATP, rCTP, rGTP, or rUTP, and deoxy-ribonucleotide triphosphates, such as dATP, dCTP, dGTP, or dTTP.

The term “nucleoside” used herein refers to a base-sugar combination, i.e., a nucleotide lacking phosphate moieties. The terms “nucleoside” and “nucleotide” are used interchangeably in the field. For example, the nucleotide deoxyuridine, dUTP, is a deoxynucleoside triphosphate. It serves as a DNA monomer, for example, being dUMP or deoxyuridine monophosphate, after being inserted into DNA. In this regard, even though no dUTP moiety is present in the result DNA, dUTP may be considered as having been inserted.

The term “polymerase chain reaction (PCR)” generally refers to an amplification method for increasing the number of copies of a target nucleic acid(s) in a sample. The procedure is described in detail in U.S. Pat. Nos. 4,683,202, 4,683,195, 4,800,159, and 4,965,188, the contents of which are hereby incorporated herein in their entirety. The sample may include a single nucleic acid or multiple nucleic acids. In general, PCR involves incorporating at least two extendible primer nucleic acids into a reaction mixture containing a target nucleic acid(s). The primers are complementary to opposite strands of a double-stranded target sequence. The reaction mixture is subjected to thermal cycling in the presence of a nucleic acid polymerase and a nucleic acid monomer, for example, in the presence of dNTP's and/or rNTP's, to amplify the target nucleic acid by extension of the primers. In general, the thermal cycling may involve: annealing to hybridize the primer and the target nucleic acid; extending the primers using a nucleic acid polymerase; and denaturating the hybridized primer extension product and the target nucleic acid. The term “reverse transcriptase-PCR (RT-PCR)” is a PCR that uses an RNA template and a reverse transcriptase, or an enzyme having reverse transcriptase activity, to first generate a single stranded DNA molecule prior to the multiple cycles of DNA-dependent DNA polymerase primer extension. The term “multiplex PCR” refers to PCRs that produce more than two amplified target products in a single reaction, typically by the inclusion of more than two primers in a single reaction.

The term “nucleic acid” used herein refers to a polymer including more than two nucleotides. The term “nucleic acid” is used interchangeably with “polynucleotide” or “oligonucleotide”. Nucleic acids include DNA and RNA. The structure of nucleic acids may be double-stranded and/or single-stranded.

The term “nucleic acid analog” used herein refers to a nucleic acid that contains at least one nucleotide analog and/or at least one phosphate ester analog and/or at least one pentose sugar analog. Examples of nucleic acid analogues include nucleic acids in which the phosphate ester and/or sugar phosphate ester linkages are replaced with other types of linkages, such as N-(2-aminoethyl)-glycine amides and other amides Nucleic acid analogs refer to a nucleic acid that contains at least one nucleotide analog and/or at least one phosphate ester analog and/or at least one pentose sugar analog and may form a double helix by hybridization.

The terms “annealing” and “hybridization” used herein are interchangeable and refer to the base-pairing interaction of one nucleic acid with another nucleic acid that results in formation of a duplex, triplex, or other higher-ordered structure. In certain embodiments, the primary interaction is base specific, e.g., A/T and G/C, by Watson/Crick and Hoogsteen-type hydrogen bonding. In certain embodiments, base-stacking and hydrophobic interactions may also contribute to duplex stability.

The term “probe” used herein refers to a nucleic acid having a sequence complementary to a target nucleic acid sequence and capable of hybridizing to the target nucleic acid to form a duplex. The sequence of the probe may be fully or completely complementary to the target nucleic acid sequence. The probe may be labeled so that the target nucleic acid may be detected simultaneously with PCR.

The terms “target nucleic acid” or “target sequence” used herein includes a full length or a fragment of a target nucleic acid that may be amplified and/or detected. A target nucleic acid may be present between two primers that are used for amplification.

The term “hybrid oligonucleotide” used herein with regard to an oligonucleotide means an oligonucleotide molecule which contains a DNA and an RNA portion within a single molecule. The hybrid oligonucleotide may contain more than one DNA portions and one RNA portion, for example a DNA-RNA, RNA-DNA, or DNA-RNA-DNA oligonucleotide.

In an embodiment, an oligonucleotide set for detecting Listeria spp. includes a first primer including the sequence of SEQ ID NO: 1; at least one second primer including the sequence of SEQ ID NO: 2 or 3; and a probe including the sequence of SEQ ID NO: 10. In another embodiment, the probe may include the sequence of SEQ ID NO: 6 or 7. The sequence of SEQ ID NO: 10 may include the sequnece selected from the group consisting of oligonucleotides of SEQ ID NOs. 4, 5, and 8.

A primer pair including a forward primer and a reverse primer have sequences substantially complementary to the respective opposite strands of a target nucleic acid, and may define the target nucleic acid. The primer pair is substantially complementary to the prs gene of Listeria spp., and may be used to specifically amplify the target nucleic acid in the prs gene. The prs gene is an open reading frame (ORF) including 954 bp and ending at 48 bp upstream from the prfA gene.

A probe, according to an embodiment, may include a sequence that is perfectly complementary to a target nucleic acid and a substantially complementary sequence that does not inhibit specific hybridization. Conditions suitable for the hybridization are described below.

As used herein, the term “substantially complementary” refers to two nucleic acid strands that are sufficiently complimentary in sequence to hybridize and form a stable duplex. The complementarity does not need to be perfect, e.g., there may be any number of base pair mismatches between the two nucleic acids. However, if the number of mismatches is so great that no hybridization can occur under even the least stringent hybridization conditions, the sequence is not a substantially complementary sequence. When two sequences are referred to as “substantially complementary” herein, it means that the sequences are sufficiently complementary to each other to hybridize under the selected reaction conditions. The relationship of nucleic acid complementarity and stringency of hybridization sufficient to achieve specificity is well known in the art. Two substantially complementary strands can be, for example, perfectly complementary can contain from 0 to many mismatches so long as the hybridization conditions are sufficient to allow, for example, discrimination between a specific pairing sequence and a non-specific pairing sequence. Accordingly, “substantially complementary” sequences can refer to sequences with base-pair complementarity of 100, 95, 90, 80, 75, 70, 60, 50 percent or less, or any number in between, in a double-stranded pairing region.

The “substantially complementary sequence” used herein is a sequence that may be hybridized with the template polynucleotide under stringent conditions that are known in the art. The “stringent conditions” used herein are disclosed in Joseph Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (2001) and Haymes, B. D., et al., Nucleic Acid Hybridization, A Practical Approach, IRL Press, Washington, D.C. (1985), and may be determined by controlling temperature, ionic strength (concentration of a buffer solution), and the existence of a compound such as an organic solvent. For example, the stringent conditions may be obtained by a) incubation in the presence of a 0.015 M sodium chloride/0.0015 M sodium citrate/0.1% sodium dodecyl sulfate solution at 50° C., or b) hybridizing in a hybridization buffer solution including 50% formamide, 2×SSC and 10% dextran sulfate at 55° C. and washing with EDTA-containing 0.1×SSC at 55° C.

In one embodiment, the probe may have a DNA-RNA-DNA hybrid structure. The probe may be a nucleic acid or a nucleic acid analog. The probe also may be a protected nucleic acid. For example, a DNA or RNA portion of the probe may be partially methylated to be resistant to degradation by an RNA-specific breakdown enzyme, for example, an RNase H.

The probe may be modified. For example, the base portion of the probe may be partially or fully methylated. Such modifications may inhibit enzymatic or chemical degradation. The 5′ end or 3′ end —OH group of the nucleic acid probe may be blocked. The 3′ end OH group of the nucleic acid probe may be blocked, thus being rendered incapable of primer extension by a template-dependant nucleic acid polymerase.

The probe may have a detectable label. The detectable label may be any chemical moiety detectable by any method known in the field. Examples of detectable labels include any moiety detectable by spectroscopy, photochemistry, or by biochemical, immunochemical or chemical means. A suitable method of labeling the nucleic acid probe may be selected according to the type of the label and the positions of the label and probe. Examples of labels include enzymes, enzyme substrates, radioactive substance, fluorescent dyes, chromophore, chemiluminescent labels, electrochemical luminescent label, ligands having specific binding partners, and other labels that interact with each other to increase, vary or reduce the intensity of a detection signal. These labels are durable throughout the thermal cycling for PCR.

The detectable label may be a fluorescence resonance energy transfer (FRET) pair. The detectable label is a FRET pair including a fluorescent donor and a fluorescent acceptor separated by an appropriate distance, and in which donor fluorescence emission is quenched by the acceptor. However, when the donor-acceptor pair is dissociated by cleavage, donor fluorescence emission is enhanced. The probes are generally designed so that donor emission is quenched by acceptor chromophores when no cleavage occurs by fluorescence resonance energy transfer (FRET) between two chromophores. A donor chromophore, in its excited state, may transfer energy to an acceptor chromophore when the pair is in close proximity. This transfer is always non-radiative and occurs through dipole-dipole coupling. Any process that sufficiently increases the distance between the chromophores will decrease FRET efficiency such that the donor chromophore emission can be detected radiatively. Examples of donor chromophores include FAM, TAMRA, VIC, JOE, Cy3, Cy5, and Texas Red. Acceptor chromophores are chosen so that their excitation spectra overlap with the emission spectrum of the donor. An example of such a pair is FAM-TAMRA. In addition, an example of the detectable label is a non-fluorescent acceptor that will quench a wide range of donors. Other examples of appropriate donor-acceptor FRET pairs will be known to those of skill in the art.

In one embodiment of the invention, the oligonucleotide may be present in a free form in a solution. In other embodiment, the oligonucleotide probe can be attached to a solid support. Different probes may be attached to the solid support and may be used to simultaneously detect different target sequences in a sample. Reporter molecules having different fluorescence wavelengths can be used on the different probes, thus enabling hybridization to the different probes to be separately detected.

Examples of preferred types of solid supports for immobilization of the oligonucleotide probe include polystyrene, avidin coated polystyrene beads cellulose, nylon, acrylamide gel and activated dextran, controlled pore glass (CPG), glass plates and highly cross-linked polystyrene. These solid supports are preferred for hybridization and diagnostic studies because of their chemical stability, ease of functionalization and well defined surface area. Solid supports such as controlled pore glass (500 Å, 1000 Å) and non-swelling high cross-linked polystyrene (1000 Å) are particularly preferred in view of their compatibility with oligonucleotide synthesis.

The oligonucleotide probe may be attached to the solid support in a variety of manners. For example, the probe may be attached to the solid support by attachment of the 3′ or 5′ terminal nucleotide of the probe to the solid support. However, the probe may be attached to the solid support by a linker which serves to separate the probe from the solid support. The linker is most preferably at least 30 atoms in length, more preferably at least 50 atoms in length.

Hybridization of a probe immobilized to a solid support generally requires that the probe be separated from the solid support by at least 30 atoms, more-preferably at least 50 atoms. In order to achieve this separation, the linker generally includes a spacer positioned between the linker and the 3′ nucleoside. For oligonucleotide synthesis, the linker arm is usually attached to the 3′-OH of the 3′ nucleoside by an ester linkage which can be cleaved with basic reagents to free the oligonucleotide from the solid support.

A wide variety of linkers are known in the art which may be used to attach the oligonucleotide probe to the solid support. The linker may be formed of any compound which does not significantly interfere with the hybridization of the target sequence to the probe attached to the solid support. The linker may be formed of a homopolymeric oligonucleotide which can be readily added on to the linker by automated synthesis. Alternatively, polymers such as functionalized polyethylene glycol can be used as the linker. Such polymers are preferred over homopolymeric oligonucleotides because they do not significantly interfere with the hybridization of probe to the target oligonucleotide. Polyethylene glycol is particularly preferred because it is commercially available, soluble in both organic and aqueous media, easy to functionalize, and is completely stable under oligonucleotide synthesis and post-synthesis conditions.

The linkages between the solid support, the linker and the probe are preferably not cleaved during removal of base protecting groups under basic conditions at high temperature. Examples of preferred linkages include carbamate and amide linkages. Immobilization of a probe is well known in the art and one skilled in the art may determine the immobilization conditions.

According to one embodiment of the method, the hybridization probe is immobilized on a solid support. The oligonucleotide probe is contacted with a sample of nucleic acids under conditions favorable for hybridization. In an unhybridized state, the fluorescent label is quenched by the acceptor. Upon hybridization to the target, the fluorescent label is separated from the quencher and the fluorescence emission is enhanced.

Immobilization of the hybridization probe to the solid support also enables the target sequence hybridized to the probe to be readily isolated from the sample. In later steps, the isolated target sequence may be separated from the solid support and processed (e.g., purified, amplified) according to methods well known in the art depending on the particular needs of the researcher.

In an embodiment, the oligonucleoride set suitable for detecting Listeria spp. may include a first primer of SEQ ID NO. 1; a second primer of SEQ ID NO. 2; and a probe of SEQ ID NO. 5.

The oligonucleotide set may be used for amplification and detection of target nucleic acids. The amplification may include extending the primers using a template-dependent polymerase, which results in the formation of PCR fragment or amplicon. The amplification can be accomplished by any method selected from the group consisting of Polymerase Chain Reaction or by using amplification reactions such as Ligase Chain Reaction, Self-Sustained Sequence Replication, Strand Displacement Amplification, Transcriptional Amplification System, Q-Beta Replicase, Nucleic Acid Sequence Based Amplification (NASBA), Cleavage Fragment Length Polymorphism, Isothermal and Chimeric Primer-initiated Amplification of Nucleic Acid, Ramification-extension Amplification Method or other suitable methods for amplification of nucleic acid. The amplification may include simultaneous real-time detection of target nucleic acids

The term “PCR fragment” or “amplicon” refers to a polynucleotide molecule (or collectively the plurality of molecules) produced following the amplification of a particular target nucleic acid. A PCR fragment is typically, but not exclusively, a DNA PCR fragment. A PCR fragment can be single-stranded or double-stranded, or in a mixture thereof in any concentration ratio. A PCR fragment can be 100-500 nucleotides or more in length.

An amplification “buffer” is a compound added to an amplification reaction which modifies the stability and/or activity of one or more components of the amplification reaction by regulating the amplification reaction. The buffering agents of the invention are compatible with PCR amplification and RNase H cleavage activity. Examples of buffers include, but are not limited to, HEPES ((4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid), MOPS (3-(N-morpholino)-propanesulfonic acid), and acetate or phosphate containing buffers and the like. In addition, PCR buffers may generally contain up to about 70 mM KCl and about 1.5 mM or higher MgCl2, and about 50-200 μM each of dATP, dCTP, dGTP and dTTP. The buffers of the invention may contain additives to optimize efficient reverse transcriptase-PCR or PCR reactions.

An additive is a compound added to a composition which modifies the stability and/or activity, and/or longevity of one or more components of the composition. In certain embodiments, the composition is an amplification reaction composition. In certain embodiments, an additive inactivates contaminant enzymes, stabilizes protein folding, and/or decreases aggregation. Exemplary additives that may be included in an amplification reaction include, but are not limited to, betaine, formamide, KCl, CaCl2, MgOAc, MgCl2, NaCl, NH4OAc, NaI, Na(CO3)2, LiCl, MnOAc, NMP, trehalose, demiethylsulfoxide (“DMSO”), glycerol, ethylene glycol, dithiothreitol (“DTT”), pyrophosphatase (including, but not limited to Thermoplasma acidophilum inorganic pyrophosphatase (“TAP”)), bovine serum albumin (“BSA”), propylene glycol, glycinamide, CHES, Percoll, aurintricarboxylic acid, Tween 20, Tween 21, Tween 40, Tween 60, Tween 85, Brij 30, NP-40, Triton X-100, CHAPS, CHAPSO, Mackernium, LDAO (N-dodecyl-N,N-dimethylamine-N-oxide), Zwittergent 3-10, Xwittergent 3-14, Xwittergent SB 3-16, Empigen, NDSB-20, T4G32, E. Coli SSB, RecA, nicking endonucleases, 7-deazaG, dUTP, anionic detergents, cationic detergents, non-ionic detergents, zwittergent, sterol, osmolytes, cations, and any other chemical, protein, or cofactor that may alter the efficiency of amplification. In certain embodiments, two or more additives are included in an amplification reaction. Additives may be optionally added to improve selectivity of primer annealing provided the additives do not interfere with the activity of RNase H.

As used herein, a “thermostable polymerase” is an enzyme that is relatively stable to heat and eliminates the need to add enzyme prior to each PCR cycle. Non-limiting examples of thermostable polymerases may include polymerases isolated from the thermophilic bacteria Thermus aquaticus (Taq polymerase), Thermus thermophilus (Tth polymerase), Thermococcus litoralis (Tli or VENT polymerase), Pyrococcus furiosus (Pfu or DEEPVENT polymerase), Pyrococcus woosii (Pwo polymerase) and other Pyrococcus species, Bacillus stearothermophilus (Bst polymerase), Sulfolobus acidocaldarius (Sac polymerase), Thermoplasma acidophilum (Tac polymerase), Thermus rubber (Tru polymerase), Thermus brockianus (DYNAZYME polymerase) Thermotoga neapolitana (Tne polymerase), Thermotoga maritime (Tma) and other species of the Thermotoga genus (Tsp polymerase), and Methanobacterium thermoautotrophicum (Mth polymerase). The PCR reaction may contain more than one thermostable polymerase enzyme with complementary properties leading to more efficient amplification of target sequences. For example, a nucleotide polymerase with high processivity (the ability to copy large nucleotide segments) may be complemented with another nucleotide polymerase with proofreading capabilities (the ability to correct mistakes during elongation of target nucleic acid sequence), thus creating a PCR reaction that can copy a long target sequence with high fidelity. The thermostable polymerase may be used in its wild type form. Alternatively, the polymerase may be modified to contain a fragment of the enzyme or to contain a mutation that provides beneficial properties to facilitate the PCR reaction. In one embodiment, the thermostable polymerase may be Taq polymerase. Many variants of Taq polymerase with enhanced properties are known and include AmpliTaq, AmpliTaq Stoffel fragment, SuperTaq, SuperTaq plus, LA Taq, LApro Taq, and EX Taq.

One of the most widely used techniques to study gene expression exploits first-strand cDNA for mRNA sequence(s) as template for amplification by the PCR. This method, often referred to as reverse transcriptase—PCR, exploits the high sensitivity and specificity of the PCR process and is widely used for detection and quantification of RNA.

The reverse transcriptase-PCR procedure, carried out as either an end-point or real-time assay, involves two separate molecular syntheses: (i) the synthesis of cDNA from an RNA template; and (ii) the replication of the newly synthesized cDNA through PCR amplification. To attempt to address the technical problems often associated with reverse transcriptase-PCR, a number of protocols have been developed taking into account the three basic steps of the procedure: (a) the denaturation of RNA and the hybridization of reverse primer; (b) the synthesis of cDNA; and (c) PCR amplification. In the so called “uncoupled” reverse transcriptase-PCR procedure (e.g., two step reverse transcriptase-PCR), reverse transcription is performed as an independent step using the optimal buffer condition for reverse transcriptase activity. Following cDNA synthesis, the reaction is diluted to decrease MgCl2, and deoxyribonucleoside triphosphate (dNTP) concentrations to conditions optimal for Taq DNA Polymerase activity, and PCR is carried out according to standard conditions (see U.S. Pat. Nos. 4,683,195 and 4,683,202). By contrast, “coupled” reverse transcriptase PCR methods use a common buffer for reverse transcriptase and Taq DNA Polymerase activities. In one version, the annealing of reverse primer is a separate step preceding the addition of enzymes, which are then added to the single reaction vessel. In another version, the reverse transcriptase activity is a component of the thermostable Tth DNA polymerase. Annealing and cDNA synthesis are performed in the presence of Mn2+ then PCR is carried out in the presence of Mg2+ after the removal of Mn2+ by a chelating agent. Finally, the “continuous” method (e.g., one step reverse transcriptase-PCR) integrates the three reverse transcriptase-PCR steps into a single continuous reaction that avoids the opening of the reaction tube for component or enzyme addition. Continuous reverse transcriptase-PCR has been described as a single enzyme system using the reverse transcriptase activity of thermostable Taq DNA Polymerase and Tth polymerase and as a two enzyme system using AMV reverse transcriptase and Taq DNA Polymerase wherein the initial 65° C. RNA denaturation step was omitted.

The first step in real-time, reverse-transcription PCR is to generate the complementary DNA strand using one of the template specific DNA primers. In traditional PCR reactions this product is denatured, the second template specific primer binds to the cDNA, and is extended to form duplex DNA. This product is amplified in subsequent rounds of temperature cycling. To maintain the highest sensitivity it is important that the RNA not be degraded prior to synthesis of cDNA. The presence of RNase H in the reaction buffer will cause unwanted degradation of the RNA:DNA hybrid formed in the first step of the process because it can serve as a substrate for the enzyme. There are two major methods to combat this issue. One is to physically separate the RNaseH from the rest of the reverse-transcription reaction using a barrier such as wax that will melt during the initial high temperature DNA denaturation step. A second method is to modify the RNase H such that it is inactive at the reverse-transcription temperature, typically 45-55° C. Several methods are known in the art, including reaction of RNase H with an antibody, or reversible chemical modification. For example, a hot start RNase H activity as used herein can be an RNase H with a reversible chemical modification produced after reaction of the RNAse H with cis-aconitic anhydride under alkaline conditions. When the modified enzyme is used in a reaction with a Tris based buffer and the temperature is raised to 95° C. the pH of the solution drops and RNase H activity is restored. This method allows for the inclusion of RNase H in the reaction mixture prior to the initiation of reverse transcription.

Additional examples of RNase H enzymes and hot start RNase H enzymes that can be employed in the invention are described in U.S. Patent Application No. 2009/0325169, the content of which is incorporated herein in its entirety.

One step reverse transcriptase-PCR provides several advantages over uncoupled reverse transcriptase-PCR. One step reverse transcriptase-PCR requires less handling of the reaction mixture reagents and nucleic acid products than uncoupled reverse transcriptase-PCR (e.g., opening of the reaction tube for component or enzyme addition in between the two reaction steps), and is therefore less labor intensive, reducing the required number of person hours. One step reverse transcriptase-PCR also reduces the risk of contamination. The sensitivity and specificity of one-step reverse transcriptase-PCR has proven well suited for studying expression levels of one to several genes in a given sample or the detection of pathogen RNA. Typically, this procedure has been limited to use of gene-specific primers to initiate cDNA synthesis.

The ability to measure the kinetics of a PCR reaction by real-time detection in combination with these reverse transcriptase-PCR techniques has enabled accurate and precise determination of RNA copy number with high sensitivity. This has become possible by detecting the reverse transcriptase-PCR product through fluorescence monitoring and measurement of PCR product during the amplification process by fluorescent dual-labeled hybridization probe technologies, such as the 5′ fluorogenic nuclease assay (“Taq-Man”) or endonuclease assay (sometimes referred to as, “CataCleave”), discussed below.

Post-amplification amplicon detection is both laborious and time consuming. Real-time methods have been developed to monitor amplification during the PCR process. These methods typically employ fluorescently labeled probes that bind to the newly synthesized DNA or dyes whose fluorescence emission is increased when intercalated into double stranded DNA.

The probes are generally designed so that donor emission is quenched in the absence of target by fluorescence resonance energy transfer (FRET) between two chromophores. The donor chromophore, in its excited state, may transfer energy to an acceptor chromophore when the pair is in close proximity. This transfer is always non-radiative and occurs through dipole-dipole coupling. Any process that sufficiently increases the distance between the chromophores will decrease FRET efficiency such that the donor chromophore emission can be detected radiatively. Common donor chromophores include FAM, TAMRA, VIC, JOE, Cy3, Cy5, and Texas Red. Acceptor chromophores are chosen so that their excitation spectra overlap with the emission spectrum of the donor. An example of such a pair is FAM-TAMRA. There are also non fluorescent acceptors that will quench a wide range of donors. Other examples of appropriate donor-acceptor FRET pairs will be known to those skilled in the art.

Common examples of FRET probes that can be used for real-time detection of PCR include molecular beacons (e.g., U.S. Pat. No. 5,925,517), TaqMan probes (e.g., U.S. Pat. Nos. 5,210,015 and 5,487,972), and CataCleave probes (e.g., U.S. Pat. No. 5,763,181). The molecular beacon is a single stranded oligonucleotide designed so that in the unbound state the probe forms a secondary structure where the donor and acceptor chromophores are in close proximity and donor emission is reduced. At the proper reaction temperature the beacon unfolds and specifically binds to the amplicon. Once unfolded the distance between the donor and acceptor chromophores increases such that FRET is reversed and donor emission can be monitored using specialized instrumentation. TaqMan and CataCleave technologies differ from the molecular beacon in that the FRET probes employed are cleaved such that the donor and acceptor chromophores become sufficiently separated to reverse FRET.

TaqMan technology employs a single stranded oligonucleotide probe that is labeled at the 5′ end with a donor chromophore and at the 3′ end with an acceptor chromophore. The DNA polymerase used for amplification must contain a 5→3′ exonuclease activity. The TaqMan probe binds to one strand of the amplicon at the same time that the primer binds. As the DNA polymerase extends the primer the polymerase will eventually encounter the bound TaqMan probe. At this time the exonuclease activity of the polymerase will sequentially degrade the TaqMan probe starting at the 5′ end. As the probe is digested the mononucleotides comprising the probe are released into the reaction buffer. The donor diffuses away from the acceptor and FRET is reversed. Emission from the donor is monitored to identify probe cleavage. Because of the way TaqMan works a specific amplicon can be detected only once for every cycle of PCR. Extension of the primer through the TaqMan target site generates a double stranded product that prevents further binding of TaqMan probes until the amplicon is denatured in the next PCR cycle.

U.S. Pat. No. 5,763,181, the content of which is incorporated herein by reference, describes another real-time detection method (referred to as “CataCleave”). CataCleave technology differs from TaqMan in that cleavage of the probe is accomplished by a second enzyme that does not have polymerase activity. The CataCleave probe has a sequence within the molecule which is a target of an endonuclease, such as a restriction enzyme or RNase. In one example, the CataCleave probe has a chimeric structure where the 5′ and 3′ ends of the probe are constructed of DNA and the cleavage site contains RNA. The DNA sequence portions of the probe are labeled with a FRET pair either at the ends or internally. The PCR reaction includes an RNase H enzyme that will specifically cleave the RNA sequence portion of a RNA-DNA duplex. After cleavage, the two halves of the probe dissociate from the target amplicon at the reaction temperature and diffuse into the reaction buffer. As the donor and acceptors separate FRET is reversed in the same way as the TaqMan probe and donor emission can be monitored. Cleavage and dissociation regenerates a site for further CataCleave binding. In this way it is possible for a single amplicon to serve as a target or multiple rounds of probe cleavage until the primer is extended through the CataCleave probe binding site.

In embodiments, the probe used in the method is an above-explained CataCleave probe. Examples of suitable CataCleave probes include oligonucleotides comprising the sequence of SEQ ID NO: 10. In embodiments, the CataCleave probes include, but are not limited to, the oligonucleotide of SEQ ID NOS: 4-8.

In embodiments, a kit for detecting Listeria spp. in a sample includes the oligonucleotides described above.

The kit may further include a reagent for nucleic acid amplification. The reagent may further include at least one selected from the group consisting of dNTP, rNTP, a nucleic acid polymerase, a uracil N-glycosylase (UNG) enzyme, a buffer, and a cofactor (for example, Mg2+). The nucleic acid polymerase may be selected from the group consisting of a DNA polymerase, a RNA polymerase, and a reverse transcriptase. The nucleic acid polymerase may be thermostable. The nucleic acid polymerase may retain its activity at elevated temperatures, for example, at 95° C. or higher. Thermostable DNA polymerases may be isolated from heat-resistant bacteria selected from the group consisting of Thermus aquaticus, Thermus flavus, Thermus ruber, Thermus thermophilus, Bacillus stearothermophilus, Thermus lacteus, Thermus rubens, Thermotoga maritima, Thermococcus littoralis, and Methanothermus fervidus. An example of a thermostable DNA polymerase is a Taq polymerase. The Taq polymerase is known to have optimal activity at about 70° C.

When the probe is hybridized to a target DNA, the Listeria spp. detection kit may further include a factor specifically cleaving the RNA portion of the probe that includes a DNA sequence and a RNA sequence. The cleaving factor may be RNase H. The cleaving factor may cleave specifically or nonspecifically the RNA portion of the probe. A specific RNA cleaving factor may be RNase HI. A nonspecific RNA cleaving factor may be RNase HII. RNase H may hydrolyze an RNA sequence in a hybrid containing an RNA and a DNA portion. For RNase H activity, a divalent ion (for example, Mg2+, Mn2+) is required. The RNase H cleaves RNA 3′-O-P linkages to produce 3′-hydroxyl and 5′-phosphate end products. The RNase H may be selected from the group consisting of a Pyrococcus furiosus RNase HII, a Pyrococcus horikoshi RNase HII, a Thermococcus litoralis RNase HI, and a Thermus thermophilus RNase HI. The Pyrococcus furiosus RNase HII may have an amino acid sequence of SEQ ID NO. 15. The RNase H may be thermostable. For example, the RNase H may retain its activity during a denaturation process in PCR. The cleaving factor may be a reversibly modified form of a thermostable RNase HII, which is inactive in its modified form and active in its unmodified form, wherein the modification is a coupling of the RNase HII to a ligand, crosslinking of the RNase HII, or chemical reaction of an amino acid residue in the RNase HII, and wherein the enzymatic activity of the modified RNase HII is restored by heating or adjusting pH of a sample containing the RNase HII.

When the RNA portion of the probe that contains a DNA sequence and an RNA sequence is cleaved by the cleaving factor, dissociation may occur. Such dissociation may naturally occur due to a decrease in the melting temperature of the cleaved complex or may be facilitated by a factor, such as temperature elevation. Dissociated fragments may be detected by any method known in the field.

In embodiments, a method of detecting Listeria spp. in a sample includes: (a) amplifying a target nucleic acid of Listeria spp. in the sample to produce an increased number of copies of the target nucleic acid, the amplifying including hybridizing a first primer of SEQ ID NO: 1 and a second primer of SEQ ID NO: 2 or 3 to the target nucleic acid in the sample to obtain a hybridized product of the target nucleic acid and the primers, and extending the first and the second primers of the hybridized product using a template-dependent nucleic acid polymerase to produce an extended primer product; (b) hybridizing the target nucleic acid to at least one probe oligonucleotide which is capable of being hybridized to the target nucleic acid to obtain a hybridized product of the target nucleic acid: probe oligonucleotide, wherein the probe contains an RNA sequence and a DNA sequence, and is coupled to a detectable marker; (c) contacting the hybridized product of the target nucleic acid: probe with RNase H to cleave the probes, resulting in probe fragment dissociation from the target nucleic acid; and (d) detecting the detectable marker.

Amplification of a target sequence in a sample may be performed by using any nucleic amplification method, such as the Polymerase Chain Reaction or by using amplification reactions such as Ligase Chain Reaction, Self-Sustained Sequence Replication, Strand Displacement Amplification, Transcriptional Amplification System, Q-Beta Replicase, Nucleic Acid Sequence Based Amplification (NASBA), Cleavage Fragment Length Polymorphism, Isothermal and Chimeric Primer-initiated Amplification of Nucleic Acid, Ramification-extension Amplification Method or other suitable methods for amplification of nucleic acid.

In other embodiments, the method further include a step of subjecting the sample to reverse transcription to produce a cDNA of a target RNA of Listeria spp. and performing the steps of (a)-(d) described above.

In an embodiment, the method includes amplifying a target nucleic acid fragment of Listeria spp., the amplifying including hybridizing a first primer selected from SEQ ID NO. 1 and a second primer of SEQ ID NO. 2 or 3 to the target nucleic acid in the sample to obtain a hybridized product; and extending the primers of the hybridized product using a template-dependent nucleic acid polymerase to produce an extended primer product; hybridizing the target nucleic acid fragment to at least one probe selected from the group consisting of oligonucleotides of SEQ ID NOs. 4-8 to obtain a hybridized product; contacting the hybridized product from the target nucleic acid fragment and the probe to a RNase H to cleave the probes, resulting in a probe fragment dissociating from the hybridized product; and detecting the detectable marker.

Hereinafter, the method will now be described in greater detail. The method includes amplifying a target nucleic acid fragment of Listeria spp., the amplification including hybridizing a first primer of SEQ ID NO. 1 and a second primer of SEQ ID NO. 2 or 3 to the target nucleic acid in the sample to obtain a hybridized product; and extending the primers of the hybridized product depending on a template using a template-dependent nucleic acid polymerase to produced an extended primer product.

The hybridization may be conducted in a liquid medium. A suitable liquid medium may be selected according to the requirement(s). The liquid medium may be, for example, water, a buffer, or a PCR mixture. Nonlimiting examples of buffers include PBS, Tris, MOPS and Tricine. The hybridization may be conducted under the conditions to facilitate the binding of the primer and the target nucleic acid, for example, at low temperatures and low salt concentrations. Those conditions to facilitate hybridization are known in the field. The target nucleic acid may be a single-stranded or double-stranded nucleic acid. For example, a double-stranded target nucleic acid may be denaturated into separate single strands. The target nucleic acid may be DNA or RNA.

When the target nucleic acid is an RNA molecule, the method further includes reverse transcription of the target RNA molecule to produce cDNA. Thus obtained cDNA may be subjected to the amplification and hybridizing with a probe, followed by the detection of the cleaved probe. Reverse transcription of an RNA molecule is well known in the art. A kit for suitable for detecting a target RNA of Listeria spp. includes a reverse transcriptase activity.

The extending of the primer depending on a template refers to polymerization, which is known in the field. The nucleic acid polymerase may be thermostable.

The method of detecting Listeria spp. includes hybridizing the target nucleic acid fragment to at least one probe including the sequence of SEQ ID NO: 10, 6, or 7 to obtain a hybridized product. The probes may have the sequences of one of SEQ ID NOs. 4-8. The probe may be labeled with a detectable marker, for example, an optically detectable marker. Detectable markers are known in the art and may be suitably selected. For example, a FRET pair may be used for the purpose of detecting the target sequence in an embodiment of the invention.

The hybridization may be conducted in a liquid medium. A suitable liquid medium may be selected according to the requirement(s). The liquid medium may be, for example, water, a buffer, or a PCR mixture. Nonlimiting examples of buffers include PBS, Tris, MOPS (3-(N-morpholino)propanesulfonic acid) and Tricine. The hybridization may be conducted under the conditions to facilitate the binding of the single-stranded nucleic acid probe and the target nucleic acid, for example, at low temperatures and low salt concentrations. Those conditions to facilitate hybridization are known in the field. The target nucleic acid may be a single-stranded or double-stranded nucleic acid. For example, a double-stranded target nucleic acid may be denaturated into separate single strands, as described above. The target nucleic acid may be DNA or RNA.

The method of detecting Listeria spp. includes contacting the hybridized product from the target nucleic acid fragment and the probe to an RNase H to cleave the probe, resulting in probe fragment dissociating from the hybridized product; and the hybridized product and the RNase H may contact each other in a liquid medium. A suitable liquid medium may be selected according to the requirement(s). The liquid medium may be, for example, water, a buffer, or a PCR mixture. Nonlimiting examples of buffers include PBS, Tris, MOPS (3-(N-morpholino)propanesulfonic acid) and Tricine. The contact may be conducted under substantially the same conditions as PCR conditions or in a PCR mixture.

The RNase H may be RNase HI or RNase HII. The RNase H may hydrolyze RNA in the RNA-DNA hybrid. For RNase H activity, a divalent ion (for example, Mg2+, Mn2+) is required. The RNase H cleaves RNA 3′-O-P linkages to produce 3′-hydroxyl and 5′-phosphate end products. The RNase H may be selected from the group consisting of a Pyrococcus furiosus RNase HII, a Pyrococcus horikoshi RNase HII, a Thermococcus litoralis RNase HI, and a Thermus thermophilus RNase HI. The Pyrococcus furiosus RNase HII may have an amino acid sequence of SEQ ID NO. 15. The RNase H may be thermostable. For example, the RNase H may retain its activity during a denaturation process in PCR. The RNase H may be a reversibly modified form of a thermostable RNase HII, which is inactive in its modified form and active in its unmodified form, wherein the modification is a coupling of the RNase HII to a ligand, crosslinking of the RNase HII, or chemical modification of RNase HII, for example chemical modification of an amino acid residue in the RNase HII, and wherein the enzymatic activity of the modified RNase HII is restored by heating or adjusting the pH of a sample containing the RNase HII.

Such dissociation may naturally occur due to the binding force of the strands that is weaken by the cleavage or may be facilitated by a factor, such as temperature elevation. For example, the PCR mixture may include an RNase H enzyme that will specifically cleave the RNA sequence portion of a RNA-DNA duplex (i.e., hybridized product of a target nucleic acid and the probe). After cleavage, the two halves of the probe dissociate from a target amplicon at the reaction temperature and diffuse into the reaction buffer. As the donor and acceptors separate FRET is reversed and donor emission can be monitored. Cleavage and dissociation regenerates a site for further probe binding. In this way it is possible for a single amplicon to serve as a target or multiple rounds of probe cleavage until the primer is extended through the probe binding site.

The method of detecting Listeria spp. includes detecting the cleaved probe or the dissociated probe fragment. The detection of the probe may be carried out by any of a variety of methods, which are appropriately chosen according to the labels. For example, the size of reaction products may be analyzed to detect the labeled probe fragment. The analysis of the size of the probe nucleic acid fragment may be carried out by any known method, for example, gel electrophoresis, gradient sedimentation, size exclusion chromatography, or homochromatography. When the detectable label used is a FRET pair, the labeled probe fragment may be identified in-situ by spectroscopy, without performing size analysis. Thus, real-time detection of the labeled probe fragment is achievable.

The method of detecting Listeria spp. may further include cultivating the sample containing Listeria spp. species in an enrichment medium before the amplification process, to enhance growth of the Listeria spp. species.

The enrichment medium used for the cultivation may have the following features. The enrichment medium may not contain one of esculin or peptone, or both. In another embodiment, the enrichment medium may contain esculin as long it does not interfere with any of the steps performed according to the embodiments of the invention, for example amplification of a target sequence or detecting the target sequence by cleaving the labeled probe and detecting the cleaved labeled probe. The enrichment medium may be a medium for enhancing growth of Listeria spp. species, containing about 10 to about 40 g/L of tryptic soy broth (TSB), about 1 to about 10 g/L of yeast extract (YE), and about 1 to about 15 g/L of lithium chloride. The enriched medium may further contain at least one component selected from the group consisting of about 1 to about 10 g/L of beef extract (BE), or a vitamin mix containing about 0.01 to about 0.5 mg/L of riboflavin, about 0.5 to about 1.5 mg/L of thiamine and about 0.01 to about 1.5 mg/L of biotin; about 1 to about 5 g/L of pyruvate or a salt thereof; and about 0.01 to about 1 g/L of ferric ammonium citrate. The enriched medium may further contain a buffer compound. The buffer compound may include 3-(N-morpholino)propanesulfonic acid (MOPS) free acid and a sodium salt. For example, the enriched medium may contain about 4 g/L of MOPS free acid and about 7.1 g/L of sodium MOPS. Alternatively, the enriched medium may contain about 1 to about 10 mg/L of acriflavine, about 5 to about 15 mg/L of polymyxin B, about 10 to about 30 mg/L of ceftazidime, and about 10 to about 60 mg/L of nalidixic acid.

The enrichment medium may be a medium containing about 10 to about 40 g/L of tryptic soy broth (TSB), about 1 to about 10 g/L of yeast extract (YE), about 1 to about 10 g/L of lithium chloride; about 1 to about 10 g/L of beef extract (BE) and/or a vitamin mix containing about 0.01 to about 0.5 mg/L of riboflavin, about 0.5 to about 1.5 mg/L of thiamine, and about 0.01 to about 1.5 mg/L of biotin; about 1 to about 5 g/L of pyruvate or a salt thereof; about 0.01 to 1 g/L of ferric ammonium citrate; about 4 g/L of MOPS free acid and about 7.1 g/L of sodium MOPS; and about 1 to about 10 mg/L of acriflavine, about 5 to about 15 mg/L of polymyxin B, and about 10 to about 30 mg/L of ceftazidime. For example, the enriched medium may be a medium containing 30 g/L of tryptic soy broth (TSB), 6 g/L of yeast extract, 1 g/L of esculin, 10 g/L of LiCl, 2 g/L of sodium pyruvate, 0.1 g/L of ferric ammonium citrate, 8 g/L of MOPS free acid, 14.2 g/L of MOPS, sodium, 5 g/L of beef extract, and a vitamin mix containing about 0.1 mg/L of riboflavin, about 1.0 mg/L of thiamine, and about 1.0 mg/L of biotin; or a medium (sometimes, referred to as A2.2 medium) containing about 30 g/L of tryptic soy broth (TSB), about 6 g/L of yeast extract (YE), about 1 to about 10 g/L of lithium chloride; 5 g/L of beef extract (BE) and/or a vitamin mix containing about 0.1 mg/L of riboflavin, about 1.0 mg/L of thiamine, and about 1.0 mg/L of biotin; 2 g/L of sodium pyruvate; about 0.1 g/L of ferric ammonium citrate; about 4 g/L of MOPS free acid and about 7.1 g/L of sodium MOPS; about 5 mg/L of acriflavine, about 10 mg/L of polymyxin B, and about 20 mg/L of ceftazidime. Using such an enrichment medium may eliminate or reduce PCR inhibitors in culture products and promote growth of Listeria species while inhibiting growth of background microflora, thus enabling efficient detection of Listeria spp. in a sample.

Enrichment medium may be BHI (brain heart infusion) broth, which may be used as it is or supplemented with trace ingredients such as sodium chloride and/or disodium phosphate. BHI is commercially available from different sources, under different tradenames such as BACTO®, BBL®, or Difco®. Enrichment medium may also be tryptic soy broth (TSB) with or without supplement of 0.6% yeast extract.

An exemplary protocol for detecting a target Listeria spp. sequence may include the steps of providing a food sample or surface wipe, mixing the sample or wipe with a growth medium and incubating to increase the number or population of Listeria (“enrichment”), disintegrating Listeria cells (“lysis”), and subjecting the obtained lysate to amplification and detection of target Salmonella sequence. Food samples may include, but are not limited to, fish such as smoked salmon, dairy products such as milk and cheese, and liquid eggs, poultry, fruit juices, meats such as ground pork, pork, ground beef, or beef, or deli meat, vegetables such as spinach, or environmental surfaces such as stainless steel, rubber, plastic, and ceramic.

The limit of detection (LOD) for food contaminants is described in terms of the number of colony forming units (CFU) that can be detected in either 25 grams of solid or 25 mL of liquid food or on a surface of defined area. By definition, a colony-forming unit is a measure of viable bacterial numbers. Unlike indirect microscopic counts where all cells, dead and living, are counted, CFU measures viable cells. One CFU (one bacterial cell) will grow to form a single colony on an agar plate under permissive conditions. The United States Food Testing Inspection Service defines the minimum LOD as 1 CFU/25 grams of solid food or 25 mL of liquid food or 1 CFU/surface area.

In practice, it is impossible to reproducibly inoculate a food sample or surface with a single CFU and insure that the bacterium survives the enrichment process. This problem is overcome by inoculating the sample at either one or several target levels and analyzing the results using a statistical estimate of the contamination called the Most Probable Number (MPN). As an example, a Listeria culture can be grown to a specific cell density by measuring the absorbance in a spectrophotometer. Ten-fold serial dilutions of the target are plated on agar media and the numbers of viable bacteria are counted. This data is used to construct a standard curve that relates CFU/volume plated to cell density. For the MPN to be meaningful, test samples at several inoculum levels are analyzed. After enrichment and extraction a small volume of sample is removed for real-time analysis. The ultimate goal is to achieve a fractional recovery of between 25% and 75% (i.e. between 25% and 75% of the samples test positive in the assay using RT-PCR employing a CataCleave probe, which will be explained below). The reason for choosing these fractional recovery percentages is that they convert to MPN values of between 0.3 CFU and 1.375 CFU for 25 gram samples of solid food, 25 mL samples of liquid food, or a defined area for surfaces. These MPN values bracket the required LOD of 1 CFU/sample. With practice, it is possible to estimate the volume of diluted innoculum (based on the standard curve) to achieve these fractional recoveries.

Various embodiments will be described in further detail with reference to the following examples. These examples are for illustrative purposes only and are not intended to limit the scope of the invention.

EXAMPLE 1 Real-Time PCR Amplification of Listeria spp.

A primer pair of SEQ ID NOs. 1 and 2 and a probe of SEQ ID NO. 5 were used to amplify and detect a target nucleic acid of Listeria spp. in a sample according to real-time PCR amplification.

(1) Inclusivity Test

For the inclusivity test, 92 Listeria strains representing all 6 Listeria species were cultivated overnight in a Brain Heart Infusion medium at 35° C. 5 μL of test cell suspension was extracted in 45 μl of CZ lysis solution (0.3125 mg/ml NaN3, 12.5 mM Tris (pH 8), 0.25% CHAPS and 1 mg/ml proteinase K) at 55° C. for 15 min followed by 95° C. for 10 min. 2 μL of the resulting lysate was used as template.

The Listeria DNA templates were amplified using real-time PCR in the presence of a primer pair of SEQ ID NOs. 1 and 2 and a probe of SEQ ID NO. 5. The PCR results were identified.

The PCR conditions and the PCR mixture composition were as follows.

PCR conditions: 1 cycle of UNG incubation at 37° C. for 10 minutes; 1 cycle of UNG inactivation and initial denaturation at 95° C. for 10 minutes; 50 cycles of denaturation at 95° C. for 15 seconds, and annealing and extension at 60° C. for 20 seconds.

TABLE 1 Reaction mixture composition per well (μL) Amount Ingredients (μL per a 25 μL reaction) 10 x ICAN 2.5 Forward Primer (20 μM) 1 Reverse Primer (20 μM) 1 CataCleave probe (5 μM) 1 dN/UTP (Fermentas, 2/4 mM) 1 Taq polymerase (5 units/μL) 0.5 UNG (10 units/μL) 0.1 Pfu RNase HII (5 units/) 0.2 Template DNA 2 Water 15.70

In Table 1, 1× ICAN indicates a buffer containing 32 mM HEPES (pH 7.8, titrated by concentrated KOH), 100 mM potassium acetate, 4 mM magnesium acetate, 1% DMSO and 0.11% BSA ; Forward primer and Reverse primer indicate primers of SEQ ID NOs. 1 and 2; and CataCleave probe indicates a probe of SEQ ID NO. 5 with the 5′ end labeled with FAM and the 3′ end labeled with Iowa BFQ (Black Hole Quencher). The culture lysate as a template was directly added to the PCR mixture.

A total of 95 different Listeria species were used, list of which is shown Table 2 below.

TABLE 2 List of strains used in the inclusivity test Listeria species Serotype Strain Listeria monocytogenes ½c CDL 36 Listeria monocytogenes ½c CDL 37 Listeria monocytogenes ½c CDL 38 Listeria monocytogenes 3a CDL 39 Listeria monocytogenes 3a CDL 41 Listeria monocytogenes 3b CDL 42 Listeria monocytogenes 3b CDL 43 Listeria monocytogenes 3b CDL 45 Listeria monocytogenes 3c CDL 47 Listeria monocytogenes 3c CDL 48 Listeria monocytogenes 3c CDL 49 Listeria monocytogenes 3c CDL 50 Listeria monocytogenes 4a CDL 51 Listeria monocytogenes 4a CDL 111 Listeria monocytogenes ½b CDL 112 Listeria monocytogenes ½c CDL 113 Listeria monocytogenes 3b CDL 114 Listeria monocytogenes 3b CDL 115 Listeria monocytogenes ½a CDL 116 Listeria monocytogenes 4a CDL 117 Listeria monocytogenes 4b CDL 118 Listeria monocytogenes 4d/e CDL 120 Listeria monocytogenes 7 CDL 122 Listeria monocytogenes 4b CDL 123 Listeria monocytogenes ½b CDL 125 Listeria monocytogenes ½b CDL 128 Listeria monocytogenes ½b CDL 131 Listeria monocytogenes ½b CDL 132 Listeria monocytogenes 4b CDL 136 Listeria monocytogenes 4b CDL 137 Listeria monocytogenes 4b CDL 138 Listeria monocytogenes 4b CDL 139 Listeria monocytogenes 4b CDL 140 Listeria monocytogenes ½b CDL 142 Listeria monocytogenes ½b CDL 143 Listeria monocytogenes ½a CDL 144 Listeria monocytogenes ½a CDL 145 Listeria monocytogenes ½b CDL 147 Listeria monocytogenes 3b CDL 149 Listeria monocytogenes ½c ATCC 19112, CWD 106 Listeria monocytogenes 4c ATCC 19116, CWD 108 Listeria monocytogenes 4b CWD 1559 Listeria monocytogenes 3b CWD 1591 Listeria monocytogenes ½b CWD 1597 Listeria monocytogenes 3b CWD 1600 Listeria monocytogenes ½a CWD 1609 Listeria monocytogenes 4b ATCC 51414, CWD 104 Listeria monocytogenes 4d ATCC 19117, CWD 109 Listeria monocytogenes 4e ATCC 19118, CWD 110 Listeria monocytogenes ½a CWD 72 Listeria innocua 6a CDL 191 Listeria innocua 4ab CDL 192 Listeria innocua 6b CDL 236 Listeria innocua 6a CDL 237 Listeria innocua 6a CDL 240 Listeria innocua 6b CDL 241 Listeria innocua 4ab CDL 259 Listeria innocua L80/20 Listeria innocua L80/22 Listeria innocua L80/24 Listeria innocua L82/14 Listeria innocua L82/16 Listeria innocua L82/18 Listeria innocua 6a DA-20, CWD 181 Listeria welshimeri 6a CDL 209 Listeria welshimeri 6b CDL 243 Listeria welshimeri L82/2, LFD 5121 Listeria welshimeri L82/10, LFD 5125 Listeria welshimeri L21/44, LFD 782 Listeria welshimeri L21/46, LFD 783 Listeria welshimeri L21/40, LFD 860 Listeria welshimeri 6a ATCC 35897, CWD 114 Listeria seeligeri ½b CDL 84 Listeria seeligeri 4c CDL 98 Listeria seeligeri ½b ATCC 35967, CWD 166 Listeria ivanovii 5 L45/74, LFD 2949 Listeria ivanovii L24/6 Listeria ivanovii L24/22, LFD 891 Listeria ivanovii 5 ATCC 19119, CWD 164 Listeria grayi ATCC 25400, CWD 671 Listeria grayi ATCC 25401, CWD 673 Listeria grayi ATCC 25402, CWD 20 Listeria grayi ATCC 25403, CWD 672 Listeria grayi ATCC 19120, CWD 2091

PCR results of the 95 Listeria strains are shown in FIG. 1. Referring to FIG. 1, all 95 Listeria strains were successfully detected by the real-time PCR assay using the primer pair of SEQ ID NOs. 1 and 2 and the probe of SEQ ID NO. 5. Delayed Ct values were observed for 5 strains of L. grayi due to mismatches between the primers and the target nucleic acid sequences.

(2) Exclusivity Test

For the exclusivity test, 23 non-Listeria species were cultivated to their maximal density in Brain Heart Infusion medium. 5 μL of test cell suspension was extracted in 45 μl of CZ lysis solution (0.3125 mg/ml NaN3, 12.5 mM Tris (pH 8), 0.25% CHAPS and 1 mg/ml proteinase K) at 55° C. for 15 min followed by 95° C. for 10 min. 2 μL of the resulting lysate was used as template. Real-time PCR was carried out using the same PCR mixture composition under the same PCR conditions as in the above.

Twenty-three (23) non-Listeria species used in the experiment include Bacillus mycoides, Brochothrix camp estris, Carnobacterium divergens, Carnobacterium malaroma, Enterobacter aerogenes, Enterobacter cancerogenus, Enterobacter cloacae, Enterobacter intermedia, Enterobacter sakazkii, Escherichia coli, Escherichia coli 0157:H7, Klebsiella pneumoniae, Kurthia zopfii, Lactococcus lactic, Proteus hauseri, Proteus mirabilis, Proteus vulgaris, Rhodococcus aqui, Staphylococcus aureus, Staphylococcus saprophyticus, Streptococcus agalactiae, Streptococcus dysgalactiae, and Streptococcus sanguinis. A plasmid containing the target gene (prs gene) fragment was used a positive control.

List of organisms tested for exclusivity test is shown in Table 3.

TABLE 3 List of organisms tested for exclusivity test Optimal growth Temp Organisms Source (strain) Origin (° C.) Bacillus mycoides ATCC10206 Unknown 30 Brochothrix campestris ATCC43754 Soil 26 Carnobacterium divergens ATCC35677 Beef 30 Carnobacterium gallinarum ATCC49517 Chicken 26 Carnobacterium ATCC43224 Beef 26 maltaromaticum Enterobacter aerogenes ATCC 13048 Sputum 37 Enterobacter cancerogenus ATCC 35317 Human 37 Enterobacter cloacae ATCC 13047 Spinal Fluid 37 Enterobacter intermedia ATCC 33110 Water 37 Enterobacter sakazakii ATCC Human 37 BAA-894 Erysipelothrix ATCC19414 Pig 37 rhusiopathiae Escherichia coli ATCC 11303 37 Escherichia coli O157:H7 ATCC 43895 Meat 37 Klebsiella pneumoniae ATCC 13883 37 Kurthia zopfii ATCC33403 Turkey 26 Lactobacillus casei ATCC393 Cheese 37 Lactobacillus plantarum ATCC10012 Unknown 37 Lactococcus lactis ATCC11454 Unknown 37 Micrococcus aurantiacus ATCC11731 Unknown 37 Propionibacterium ATCC13673 Unknown 30 freudenreichii Proteus hauseri ATCC 13315 37 Proteus mirabilis ATCC 35659 37 Proteus vulgaris ATCC 33420 Clinical Isolate 37 Rhodococcus equi ATCC10146 Horse 37 Staphylococcus aureus ATCC10832 Unknown 37 Staphylococcus epidermidis ATCC12228 Unknown 37 Staphylococcus ATCC15305 Urine 37 saprophyticus Streptococcus agalactiae ATCC12386 Unknown 37 Streptococcus dysgalactiae ATCC12388 Human 37 Streptococcus sanguinis ATCC10556 Human 37

The real-time PCR results on the 23 non-Listeria strains are shown in FIG. 2. Referring to FIG. 2, none of the 23 non-Listeria species were detected in the real-time PCR assay using the primer pair of SEQ ID NOs. 1 and 2 and the probe of SEQ ID NO. 5, A “positive” signal from the positive control sample indicates the quality of the assay performance. These results show that the primers and probe, according to an embodiment of the invention, are highly specific for Listeria spp.

(3) Detection Limit Test

The correlation of the real-time PCR amplification products with the concentration of cells containing a target DNA was identified.

Plasmid DNA into which the prs gene has incorporated was quantified for its optical density and converted to a copy concentration with its known molecular weight. A portion of the stock plasmid DNA was diluted using 10 mM Tris (pH 8.0) to a range from 2.5 copies/μL up to 2.5×106 copies/μL. 2 μL of each of the plasmid dilutions were used as reaction templates. Real-time PCR was carried out using the same PCR mixture composition under the same PCR conditions as in the above.

FIG. 3 is a graph illustrating the real-time PCR results with respect to the number of copies of plasmid containing the target sequences of the Listeria prs. gene. The assay was able to detect 5 copies of the prs gene in a single reaction.

The results described above support that real-time PCR with the primer pair and the probe according to an embodiment of the invention has a high sensitivity and specificity in detecting the presence and amount of Listeria species in a sample.

EXAMPLE 2 Real-Time RT PCR Detection of Listeria spp.

L. monocytogene is diluted with 0.5% non-fat milk to a concentration of 16 cfu/100 μL. 80 μL of the suspension is inoculated on a 10×1 inch ceramic tile surface and air-dried overnight at room temperature. The contaminant on the sample surface is collected with a PBS or DE-soaked sponge and then cultivated in 8 mL of a pre-warmed brain-heart infusion (BHI) medium at 35° C. for 6 hours. Then, 1 mL of the culture products is inoculated into 9 ml of a pre-warmed A2.2 medium (propriety formulation containing 30 g/L of TSB, 6 g/L of yeast extract, 1 g/L of esculin, 10 g/L of LiCl, 2 g/L of sodium pyruvate, 0.1 g/L of ferric ammonium citrate, 8 g/L of MOPS free acid, 14.2 g/L of MOPS, sodium, 5 g/L of beef extract, and 1% of a vitamin mix containing about 0.1 mg/L of riboflavin, about 1.0 mg/L of thiamine and about 1.0 mg/L of biotin, 10 mg/L of polymyxin B, and 20 mg/L of ceftazidime, and 5 mg/L acrifalvine) and further incubated at 35° C. for 24 hours.

The culture products from the secondary enrichment in the A2.2 medium is used for reverse transcriptase (RT) reaction (700 μL of enriched culture products +100 μL of 1× ZAC (1% CHAPS, 2.5 mg/mL sodium azide, and 100 mM Tris (pH8)) +10 μL of proteinase K). A TZ lysis buffer (2.0% Triton X-100 and 2.5 mg sodium azide per 1 ml of 0.1M Tris-HCl buffer, pH8.0) is used for other samples.

The reverse transcription reaction is induced as follows. 7.9 μL of DEPC-water, 0.1 μL of a 20 uM forward and reverse primers, 1 μL of 10 mM dNTP and 1 μL of lysate are mixed. The forward primer and reverse primers are SEQ ID NO: 1 and SEQ ID NO: 3, respectively. The mixture is incubated at 65° C. for 5 minutes, and then placed on ice for 2 minutes. 2 μL of a 10× RT buffer, 4 μL of a 25 mM MgCl2, 2 μL of a 0.1 M DTT, 1 μL of RNase HII (40 U/ml) and 1 μL of Superscript III (1 U/μL, reverse transcriptase) are added to the mixture. After incubation at 50° C. for 50 minutes, the mixture was further incubated at 85° C. for 5 minutes, and then cooled to 4° C. 2 μL of the RT products was mixed with a PCR mixture for PCR.

TABLE 4 Reaction mixture composition: Component μL per 25 μL reaction 10x ICAN PCR buffer 2.5 Forward primer (20 μM) 0.5 Reverse primer (20 μM) 0.5 CataCleave probe (5 μM) 1 dN/UTP, 2/4 mM 1 Taq polymerase (5 units/μL) 0.5 UNG (10 units/μL) 0.1 RNaseH II (5 units/μL) 0.2 cDNA template 2 Water 16.70

In Table 4, 1× ICAN PCR buffer indicates a buffer containing 32 mM HEPES (pH 7.8, titrated by concentrated KOH), 100 mM potassium acetate, 4 mM magnesium acetate, 1% DMSO and 0.11% BSA; Forward primer and Reverse primer indicate primers of SEQ ID NOs. 1 and 3; and CataCleave probe indicates a probe of SEQ ID NO. 7 with the 5′ end labeled with FAM and the 3′ end labeled with Iowa Black FQ (Black Hole Quencher) for short wavelength emission. The synthesized cDNA template from the reverse transcription reaction was used as PCR templates. Pfu RNase HII indicates an RNA-specific thermostable RNase HII enzyme originated from Pyrococcus furiosus.

TABLE 5 Reaction conditions: Temp Step (° C.) Time (sec) Cycles UNG Incubation 37 600 1 Taq activation/ 95 600 1 UNG inactivation/ Initial denaturation PCR 95 15 50 60 20

FIG. 4 is a graph illustrating the real-time PCR results with respect to the copy number of the RNA product of the prs genes. The assay is able to detect 5 copies of prs RNA.

The results described above support that a combination of reverse transcription and real-time PCR with the primer pair and the probe according to an embodiment of the invention has a high sensitivity and specificity in detecting the presence and amount of live Listeria species in a sample.

Any patent, patent application, publication, or other disclosure material identified in the specification is hereby incorporated by reference herein in its entirety. Any material, or portion thereof, that is said to be incorporated by reference herein, but which conflicts with existing definitions, statements, or other disclosure material set forth herein is only incorporated to the extent that no conflict arises between that incorporated material and the present disclosure material.

Claims

1. A composition comprising: TTGCGAAAGAAGTAGGTATTGAG, (SEQ ID NO: 1) CAGGATTACTCGTTGATTGAATAAC, (SEQ ID NO: 2) GTTCCATTAAATTCTGGTTTACAGG. (SEQ ID NO: 3)

a first oligonucleotide of the sequence of SEQ ID NO: 1:
a second oligonucleotide of the sequence of SEQ ID NO: 2 or 3:

2. The composition according to claim 1, further comprising a third oligonucleotide comprising a DNA sequence and an RNA sequence, said third oligonucleotide comprising the sequence of SEQ ID NO: 10: ACAACCACGG AX1ACTTTCTT ATACTTTCTTCAATG (SEQ ID NO: 10), wherein X1 at position 12 is T or U, and wherein at least one of nucleotides at positions 8-13 is a ribonucleotide.

3. The composition according to claim 2, wherein the third oligonucleotide is one selected from the group consisting of SEQ ID NOS: 4, 5, and 8: ACAACCArCrGrGrATACTTTCTTCAATG (SEQ ID NO. 4), wherein “rC,” “rG,” r”G,” and “rA” at positions 8, 9, 10 and 11, respectively are ribonucleotides, ACAACCACGrGATACTTTCTTCAATG (SEQ ID NO. 5), wherein “rG” at position 10 is a ribonucleotide, and ACAACCACGrGrArUrACTTTCTTCAATG (SEQ ID NO. 8), wherein “rG,” “rA,” “rU”, and “rA” at positions 10, 11, 12, and 13, respectively are ribonucleotides.

4. The composition according to claim 1, wherein the third oligonucleotide comprises the sequence of SEQ ID NO: 6 or SEQ ID NO: 7: CATTGAArGrArArAGTATCCGTGGTTGT (SEQ ID NO. 6), wherein “rG,” “rA,” “rA”, and “rA” at positions 8, 9, 10, and 11, respectively are ribonucleotides, or GAAGAAAGTATCCrGrUrGrGTTGTCATG (SEQ ID NO. 7), wherein “rG,” “rU,” “rG”, and “rG” at positions 14, 15, 16, and 17, respectively are ribonucleotides.

5. The composition according to claim 2, wherein the third oligonucleotide is labeled with a detectable marker.

6. The composition according to claim 5, wherein the third oligonucleotide is labeled with a fluorescence resonance energy transfer (FRET) pair.

7. The composition according to claim 4, wherein the third oligonucleotide is labeled with a detectable marker.

8. The composition according to claim 7, wherein the third oligonucleotide is labeled with a fluorescence resonance energy transfer (FRET) pair.

9. A kit for detecting Listeria spp. in a sample, the kit comprising TTGCGAAAGAAGTAGGTATTGAG (SEQ ID NO: 1) CAGGATTACTCGTTGATTGAATAAC (SEQ ID NO: 2) GTTCCATTAAATTCTGGTTTACAGG, (SEQ ID NO: 3) and

(a) a first primer of the sequence of SEQ ID NO: 1:
(b) a second primer of the sequence of SEQ ID NO: 2 or 3:
(c) a probe comprising an RNA sequence and a DNA sequence that are substantially complimentary to a target Listeria spp. gene, and coupled to a detectable label.

10. The kit according to claim 9, further comprising

(d) an amplifying activity for a PCR amplification of the target DNA sequence to produce a Listeria spp. PCR fragment; and
(e) an RNase H activity.

11. The kit according to claim 10, further comprising positive, internal, and negative controls.

12. The kit according to claim 11, further comprising uracil-N-glycosylase.

13. The kit according to claim 9, wherein the probe is coupled to a detectable label at both of its 3′-end and 5′-end.

14. The kit according to claim 13, wherein the detectable label is a fluorescent label.

15. The kit according to claim 14, wherein the probe is labeled with a FRET pair.

16. The kit according to claim 9, wherein the probe is linked to a solid support.

17. The kit according to claim 9, which further comprises an amplification buffer.

18. The kit according to claim 9, which further comprises an amplifying polymerase activity.

19. The kit according to claim 10, wherein the RNase H activity is the activity of a thermostable RNase H.

20. The kit according to claim 10, wherein the RNase H activity is a hot start RNase H activity.

21. The kit according to claim 9, wherein the probe comprises the sequence of SEQ ID NO: 10: ACAACCACGG AX1ACTTTCTT ATACTTTCTT CAATG (SEQ ID NO: 10), wherein X1 at position 12 is T or U, and wherein at least one of nucleotides at positions 8-13 is a ribonucleotide.

22. The kit according to claim 9, wherein the probe comprises the sequence of SEQ ID NO: 6 or SEQ ID NO: 7: CATTGAArGrArArAGTATCCGTGGTTGT (SEQ ID NO. 6), wherein “rG,” “rA,” “rA”, and “rA” at positions 8, 9, 10, and 11, respectively are ribonucleotides, or GAAGAAAGTATCCrGrUrGrGTTGTCATG (SEQ ID NO. 7), wherein “rG,” “rU,” “rG”, and “rG” at positions 14, 15, 16, and 17, respectively are ribonucleotides.

23. The kit according to claim 21, wherein the probe is one selected from the group consisting of SEQ ID NOS: 4, 5, and 8: ACAACCArCrGrGrATACTTTCTTCAATG (SEQ ID NO. 4), wherein “rC,” “rG,” r”G,” and “rA” at positions 8, 9, 10 and 11, respectively are ribonucleotides, ACAACCACGrGATACTTTCTTCAATG (SEQ ID NO. 5), wherein “rG” at position 10 is a ribonucleotide, and ACAACCACGrGrArUrACTTTCTTCAATG (SEQ ID NO. 8), wherein “rG,” “rA,” “rU”, and “rA” at positions 10, 11, 12, and 13, respectively are ribonucleotides.

24. A method of detecting Listeria spp. in a sample, the method comprising:

(a) amplifying a target nucleic acid of Listeria spp. in the sample to produce an increased number of copies of the target nucleic acid, the amplifying including hybridizing a first primer of SEQ ID NO: 1 and a second primer of SEQ ID NO: 2 or SEQ ID NO: 3 to the target nucleic acid in the sample to obtain a hybridized product of the target nucleic acid and the primers, and extending the first and the second primers of the hybridized product using a template-dependent nucleic acid polymerase to produce an extended primer product;
(b) hybridizing the target nucleic acid to at least one probe oligonucleotide which is capable of being hybridized to the target nucleic acid to obtain a hybridized product of the target nucleic acid: probe oligonucleotide, wherein the probe comprises a DNA sequence and an RNA sequence and coupled to a label;
(c) contacting the hybridized product of the target nucleic acid: the probe oligonucleotide to an RNase H to cleave the probes; and
(d) detecting an increase in the emission of a signal from the label on the probe, wherein the increase in signal indicates the presence of the Listeria spp. target nucleic acid in the sample.

25. The method according to claim 24, wherein the probe comprises the sequence of SEQ ID NO: 10: ACAACCACGG AX1ACTTTCTT ATACTTTCTT CAATG (SEQ ID NO: 10), wherein X1 at position 12 is T or U, and wherein at least one of nucleotides at positions 8-13 is a ribonucleotide.

26. The method according to claim 24, wherein the probe comprises the sequence of SEQ ID NO: 6 or SEQ ID NO: 7: CATTGAArGrArArAGTATCCGTGGTTGT (SEQ ID NO. 6), wherein “rG,” “rA,” “rA”, and “rA” at positions 8, 9, 10, and 11, respectively are ribonucleotides, or GAAGAAAGTATCCrGrUrGrGTTGTCATG (SEQ ID NO. 7), wherein “rG,” “rU,” “rG”, and “rG” at positions 14, 15, 16, and 17, respectively are ribonucleotides.

27. The method according to claim 24, wherein the probe is one selected from the group consisting of SEQ ID NOS: 4, 5, and 8: ACAACCArCrGrGrATACTTTCTTCAATG (SEQ ID NO. 4), wherein “rC,” “rG,” r”G,” and “rA” at positions 8, 9, 10 and 11, respectively are ribonucleotides, ACAACCACGrGATACTTTCTTCAATG (SEQ ID NO. 5), wherein “rG” at position 10 is a ribonucleotide, and ACAACCACGrGrArUrACTTTCTTCAATG (SEQ ID NO. 8), wherein “rG,” “rA,” “rU”, and “rA” at positions 10, 11, 12, and 13, respectively are ribonucleotides.

28. The method according to claim 24, wherein the label of the probe is a fluorescence resonance energy transfer pair, one of the pair being coupled to the 3′ end of the probe and the other of the pair being coupled to the 5′ end of the probe.

29. The method according to claim 24, wherein the amplifying is conducted using a method selected from the group consisting of polymerase chain reaction, rolling circle amplification, nucleic acid sequence based amplification, and strand displacement amplification.

30. The method according to claim 24, wherein the amplifying, the hybridizing and the contacting are simultaneously or sequentially carried out.

31. The method according to claim 24, further comprising cultivating the sample containing Listeria spp. in an enriched medium before the amplifying, to enhance growth of the Listeria spp.

32. The method according to claim 31, wherein the enriched medium containing about 10 to about 40 g/L of tryptic soy broth, about 1 to about 10 g/L of yeast extract, and about 1 to about 10 g/L of lithium chloride.

33. The method according to claim 32, wherein the enriched medium further comprises at least one component selected from the group consisting of about 1 to about 10 g/L of beef extract, and/or a vitamin mix containing about 0.01 to about 0.5 mg/L of riboflavin, about 0.5 to about 1.5 mg/L of thiamine and about 0.01 to about 1.5 mg/L of biotin; about 1 to about 5 g/L of pyruvate or a salt thereof; and about 0.01 to about 1 g/L of ferric ammonium citrate.

34. The method according to claim 33, wherein the enriched medium further comprises a buffer compound.

35. The method according to claim 34, wherein the buffer compound comprises 3-(N-morpholino)propanesulfonic acid (MOPS) and a sodium salt thereof.

36. The method according to claim 35, wherein the buffer compound comprises about 4 g/L of MOPS and about 7.1 g/L of sodium MOPS.

37. The method according to claim 31, wherein the enriched medium comprises about 1 to about 10 mg/L of acriflavine, about 5 to about 15 mg/L of polymyxin B, and about 10 to about 30 mg/L of ceftazidime.

38. The method according to claim 31, wherein the enriched medium comprises about 10 to about 40 g/L of tryptic soy broth, about 1 to about 10 g/L of yeast extract, about 1 to about 10 g/L of lithium chloride; about 1 to about 10 g/L of beef extract and/or a vitamin mix containing about 0.01 to about 0.5 mg/L of riboflavin, about 0.5 to about 1.5 mg/L of thiamine, and about 0.01 to about 1.5 mg/L of biotin; about 1 to about 5 g/L of pyruvate or a salt thereof; about 0.1 to about 1 g/L of ferric ammonium citrate; about 4 g/L of 3-(N-morpholino)propanesulfonic acid (MOPS) and about 7.1 g/L of sodium MOPS; and about 1 to about 10 mg/L of acriflavine, about 5 to about 15 mg/L of polymyxin B, and about 10 to about 30 mg/L of ceftazidime.

39. The method according to claim 31, wherein the enriched medium does not comprise at least one selected from esculin and peptone.

40. The method according to claim 31, wherein the enriched medium comprises about 30 g/L of tryptic soy broth, about 6 g/L of yeast extract, about 1 to about 10 g/L of lithium chloride; about 5 g/L of beef extract and/or a vitamin mix containing about 0.1 mg/L of riboflavin, about 1.0 mg/L of thiamine, and about 1.0 mg/L of biotin; about 2 g/L of sodium pyruvate; about 0.2 g/L of ferric ammonium citrate; about 4 g/L of 3-(N-morpholino)propanesulfonic acid (MOPS) and about 7.1 g/L of sodium MOPS; and about 5 mg/L of acriflavine, about 10 mg/L of polymyxin B, and about 20 mg/L of ceftazidime.

41. The method according to claim 31, wherein the enriched medium is a tryptic soy broth supplemented with a yeast extract, or a brain-hear infusion broth.

42. The method according to claim 24, wherein the sample is food or surface wipe.

43. A method of detecting Listeria spp. in a sample, the method comprising:

(a) reverse transcribing the Listeria spp. target RNA in the presence of a reverse transcriptase activity and the reverse amplification primer to produce a target cDNA of the target RNA;
(b) amplifying the target cNDA sequence to produce an increased number of copies of the target nucleic acid, the amplifying including hybridizing a first primer of SEQ ID NO: 19 and a second primer of SEQ ID NO: 20 to the target cDNA to obtain a hybridized product of the target nucleic acid and the primers, and extending the first and the second primers of the hybridized product using a template-dependent nucleic acid polymerase to produce an extended primer product;
(c) hybridizing the target nucleic acid to at least one probe oligonucleotide which is substantially complimentary to the target cDNA to obtain a hybridized product of the target nucleic acid: probe oligonucleotide, wherein the probe comprises a DNA sequence and an RNA sequence and coupled to a label;
(d) contacting the hybridized product of the target nucleic acid: the probe oligonucleotide to an RNase H to cleave the probe; and
(e) detecting an increase in the emission of a signal from the label on the probe, wherein the increase in signal indicates the presence of the Listeria spp. target RNA in the sample.

44. The method according to claim 43, wherein the probe comprises the sequence of SEQ ID NO: 10: ACAACCACGG AX1ACTTTCTT ATACTTTCTT CAATG (SEQ ID NO: 10), wherein X1 at position 12 is T or U, and wherein at least one of nucleotides at positions 8-13 is a ribonucleotide.

45. The method according to claim 43, wherein the probe comprises the sequence of SEQ ID NO: 6 or SEQ ID NO: 7: CATTGAArGrArArAGTATCCGTGGTTGT (SEQ ID NO. 6), wherein “rG,” “rA,” “rA”, and “rA” at positions 8, 9, 10, and 11, respectively are ribonucleotides, or GAAGAAAGTATCCrGrUrGrGTTGTCATG (SEQ ID NO. 7), wherein “rG,” “rU,” “rG”, and “rG” at positions 14, 15, 16, and 17, respectively are ribonucleotides.

46. The method according to claim 43, wherein the probe is one selected from the group consisting of SEQ ID NOS: 4, 5, and 8: ACAACCArCrGrGrATACTTTCTTCAATG (SEQ ID NO. 4), wherein “rC,” “rG,” r”G,” and “rA” at positions 8, 9, 10 and 11, respectively are ribonucleotides, ACAACCACGrGATACTTTCTTCAATG (SEQ ID NO. 5), wherein “rG” at position 10 is a ribonucleotide, and ACAACCACGrGrArUrACTTTCTTCAATG (SEQ ID NO. 8), wherein “rG,” “rA,” “rU”, and “rA” at positions 10, 11, 12, and 13, respectively are ribonucleotides.

47. The method according to claim 43, wherein the label of the probe is a fluorescence resonance energy transfer pair, one of the pair being coupled to the 3′ end of the probe and the other of the pair being coupled to the 5′ end of the probe.

48. The method according to claim 43, wherein the amplifying is accomplished using a method selected from the group consisting of polymerase chain reaction, rolling circle amplification, nucleic acid sequence based amplification, and strand displacement amplification.

49. The method according to claim 43, wherein the amplifying, the hybridizing and the contacting are simultaneously or sequentially carried out.

50. The method according to claim 43, further comprising cultivating the sample containing Listeria spp. in an enriched medium before the amplifying, to enhance growth of the Listeria spp.

51. The method according to claim 50, wherein the enriched medium containing about 10 to about 40 g/L of tryptic soy broth, about 1 to about 10 g/L of yeast extract, and about 1 to about 10 g/L of lithium chloride.

52. The method according to claim 51, wherein the enriched medium further comprises at least one component selected from the group consisting of about 1 to about 10 g/L of beef extract, and/or a vitamin mix containing about 0.01 to about 0.5 mg/L of riboflavin, about 0.5 to about 1.5 mg/L of thiamine and about 0.01 to about 1.5 mg/L of biotin; about 1 to about 5 g/L of pyruvate or a salt thereof; and about 0.01 to about 1 g/L of ferric ammonium citrate.

53. The method according to claim 52, wherein the enriched medium further comprises a buffer compound.

54. The method according to claim 53, wherein the buffer compound comprises 3-(N-morpholino)propanesulfonic acid (MOPS) and a sodium salt thereof.

55. The method according to claim 53, wherein the buffer compound comprises about 4 g/L of MOPS and about 7.1 g/L of sodium MOPS.

56. The method according to claim 50, wherein the enriched medium comprises about 1 to about 10 mg/L of acriflavine, about 5 to about 15 mg/L of polymyxin B, and about 10 to about 30 mg/L of ceftazidime.

57. The method according to claim 50, wherein the enriched medium comprises about 10 to about 40 g/L of tryptic soy broth, about 1 to about 10 g/L of yeast extract, about 1 to about 10 g/L of lithium chloride; about 1 to about 10 g/L of beef extract and/or a vitamin mix containing about 0.01 to about 0.5 mg/L of riboflavin, about 0.5 to about 1.5 mg/L of thiamine, and about 0.01 to about 1.5 mg/L of biotin; about 1 to about 5 g/L of pyruvate or a salt thereof; about 0.1 to about 1 g/L of ferric ammonium citrate; about 4 g/L of 3-(N-morpholino)propanesulfonic acid (MOPS) and about 7.1 g/L of sodium MOPS; and about 1 to about 10 mg/L of acriflavine, about 5 to about 15 mg/L of polymyxin B, and about 10 to about 30 mg/L of ceftazidime.

58. The method according to claim 50, wherein the enriched medium does not comprise at least one selected from esculin and peptone.

59. The method according to claim 50, wherein the enriched medium comprises about 30 g/L of tryptic soy broth, about 6 g/L of yeast extract, about 1 to about 10 g/L of lithium chloride; about 5 g/L of beef extract and/or a vitamin mix containing about 0.1 mg/L of riboflavin, about 1.0 mg/L of thiamine, and about 1.0 mg/L of biotin; about 2 g/L of sodium pyruvate; about 0.2 g/L of ferric ammonium citrate; about 4 g/L of 3-(N-morpholino)propanesulfonic acid (MOPS) and about 7.1 g/L of sodium MOPS; and about 5 mg/L of acriflavine, about 10 mg/L of polymyxin B, and about 20 mg/L of ceftazidime.

60. The method according to claim 50, wherein the enriched medium is a tryptic soy broth supplemented with a yeast extract, or a brain-hear infusion broth.

61. The method according to claim 43, wherein the sample is food or surface wipe.

62. The kit according to claim 10, further comprising

(d) a reverse transcriptase activity for reverse transcription of the target Listeria spp
(e) an amplifying activity for a PCR amplification of the target DNA sequence to produce a Listeria app. PCR fragment; and
(f) an RNase H activity.

63. The kit according to claim 62, further comprising positive, internal, and negative controls.

64. The kit according to claim 63, further comprising uracil-N-glycosylase.

65. The kit according to claim 62, wherein the probe is coupled to a detectable label at both of its 3′-end and 5′-end.

66. The kit according to claim 65, wherein the detectable label is a fluorescent label.

67. The kit according to claim 66, wherein the probe is labeled with a FRET pair.

68. The kit according to claim 62, wherein the probe is linked to a solid support.

69. The kit according to claim 62, which further comprises an amplification buffer.

70. The kit according to claim 62, which further comprises an amplifying polymerase activity.

71. The kit according to claim 62, wherein the RNase H activity is the activity of a thermostable RNase H.

72. The kit according to claim 62, wherein the RNase H activity is a hot start RNase H activity.

73. The kit according to claim 62, wherein the probe comprises the sequence of SEQ ID NO: 10: ACAACCACGG AX1ACTTTCTT ATACTTTCTT CAATG (SEQ ID NO: 10), wherein X1 at position 12 is T or U, and wherein at least one of nucleotides at positions 8-13 is a ribonucleotide.

74. The kit according to claim 62, wherein the probe comprises the sequence of SEQ ID NO: 6 or SEQ ID NO: 7: CATTGAArGrArArAGTATCCGTGGTTGT (SEQ ID NO. 6), wherein “rG,” “rA,” “rA”, and “rA” at positions 8, 9, 10, and 11, respectively are ribonucleotides, or GAAGAAAGTATCCrGrUrGrGTTGTCATG (SEQ ID NO. 7), wherein “rG,” “rU,” “rG”, and “rG” at positions 14, 15, 16, and 17, respectively are ribonucleotides.

75. The kit according to claim 73, wherein the probe is one selected from the group consisting of SEQ ID NOS: 4, 5, and 8: ACAACCArCrGrGrATACTTTCTTCAATG (SEQ ID NO. 4), wherein “rC,” “rG,” r”G,” and “rA” at positions 8, 9, 10 and 11, respectively are ribonucleotides, ACAACCACGrGATACTTTCTTCAATG (SEQ ID NO. 5), wherein “rG” at position 10 is a ribonucleotide, and ACAACCACGrGrArUrACTTTCTTCAATG (SEQ ID NO. 8), wherein “rG,” “rA,” “rU”, and “rA” at positions 10, 11, 12, and 13, respectively are ribonucleotides.

76. The kit according to claim 9, wherein the probe is in free form in a solution.

77. The kit according to claim 62, wherein the probe is in free form in a solution.

Patent History
Publication number: 20120052493
Type: Application
Filed: May 9, 2011
Publication Date: Mar 1, 2012
Applicant: SAMSUNG TECHWIN CO., LTD. (Changwon-city)
Inventor: Jun LI (Baltimore, MD)
Application Number: 13/103,428