INHIBITION OF VIRAL GENE EXPRESSION USING SMALL INTERFERING RNA
The invention provides methods, compositions, and kits comprising small interfering RNA (shRNA or siRNA) that are useful for inhibition of viral-mediated gene expression. Small interfering RNAs as described herein can be used in methods of treatment of HCV infection. ShRNA and siRNA constructs targetING the internal ribosome entry site (IRES) sequence of HCV are described.
Latest Patents:
- MULTI-FUNCTIONAL ACTIVE COMPLEX FOR RESTORATION OF SKIN BARRIER AND SEBUM REGULATION AND METHOD FOR ADMINISTERING THE SAME
- COLLABORATIVE CARE METHOD FOR SCALP HAIR FOLLICLES AND STRANDS
- ANTIMICROBIAL COMPOSITIONS
- INJECTABLE COMPOSITION, PHARMACEUTICAL FORMULATION INCLUDING THE SAME, AND METHOD FOR PREPARING THE COMPOSITION
- A MACROLIDE FOR USE IN A METHOD OF PREVENTING OR TREATING AN IMMUNOLOGICAL DISEASE OR DISORDER
This application claims the benefit of PCT application PCT/US2005/032768, filed Sep. 12, 2005, which claims priority under 35 U.S.C. §119 from U.S. Provisional Application No. 60/608,574, filed Sep. 10, 2004, both of which are incorporated herein by reference in their entirety.
STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENTThis invention was made in part during work supported by grant no. 5R43AI056611 from the National Institutes of Health. The government may have certain rights in the invention.
FIELD OF THE INVENTIONThe invention relates to inhibition of viral gene expression, for example, hepatitis C IRES-mediated gene expression, with small interfering RNA (shRNA and siRNA).
BACKGROUND OF THE INVENTIONTreatment and prevention of Hepatitis C virus (HCV) infections remains a major challenge for controlling this worldwide health problem; existing therapies are only partially effective and no vaccine is currently available. Hepatitis C (HCV) virus infects more than 170 million people worldwide and is the leading cause of liver transplants. Existing treatments, including ribavirin and pegylated interferon alpha, are effective only in approximately 50 percent of patients and have substantial side effects. The development of more effective HCV treatments is hampered by the lack of a good small animal model, the inability to stably culture the virus in tissue culture cells, and the high viral mutation rate [1-3]. The availability of an HCV replicon system has allowed the study of HCV replication, host-cell interactions and evaluation of anti-viral agents, and more recently, a transgenic chimeric humanized mouse liver model was developed that allows full HCV infection [4-7]. Moreover, the use of in vivo imaging of HCV IRES-dependent reporter systems has facilitated efficient evaluation of delivery and inhibition by anti-HCV agents in mouse liver over multiple time points using the same animals [8].
RNA interference is an evolutionarily conserved pathway that leads to down-regulation of gene expression. The discovery that synthetic short interfering RNAs (siRNAs) of about 19-29 base pairs can effectively inhibit gene expression in mammalian cells and animals without activating an immune response has led to a flurry of activity to develop these inhibitors as therapeutics [9]. Chemical stabilization of siRNAs results in increased serum half life [10], suggesting that intravenous administration may achieve positive therapeutic outcomes if delivery issues can be overcome. Furthermore, small hairpin RNAs (shRNA) have also shown robust inhibition of target genes in mammalian cells and can be easily expressed from bacteriophage (e.g. T7, T3 or SP6) or mammalian (pol III such as U6 or H1 or polII) promoters, making them excellent candidates for viral delivery [11].
Efforts have been made to find effective nucleic acid-based inhibitors against HCV, as existing treatments are not fully effective (reviewed in [4, 12]). These efforts include traditional antisense oligonucleotides, phosphorodiamidate morpholino oligomers [8], ribozymes, and more recently siRNAs. It has been shown that siRNAs can effectively target HCV in human tissue culture cells [13-19] and in animal systems [20].
BRIEF SUMMARY OF THE INVENTIONThe invention provides methods, compositions, and kits for inhibition of IRES-mediated gene expression in a virus, e.g., hepatitis C virus (HCV).
For the inhibitory RNA sequences listed in
In one aspect, the invention provides a composition comprising at least one small interfering RNA that is at least partially complementary to, and capable of interacting with a polynucleotide sequence of a virus, such that inhibition of viral gene expression results from the interaction of the small interfering RNA with the viral target sequence. In one embodiment, the composition includes at least one shRNA, for example, comprising, consisting of, or consisting essentially of a sequence selected from the group consisting of SEQ ID NO:12, SEQ ID NO:16, SEQ ID NO:17, and SEQ ID NO:18, or comprising or consisting essentially of a sequence selected from the group consisting of SEQ ID NO:27, SEQ ID NO:32, and SEQ ID NO:33. In one embodiment, the shRNA comprises, consists of, or consists essentially of the sequence depicted in SEQ ID NO:12. In another embodiment, the composition includes at least one siRNA. In one embodiment, the composition includes at least one siRNA or shRNA, for example, comprising or consisting essentially of a sequence selected from the group consisting of SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:27, SEQ ID NO:32, and SEQ ID NO:33. In some embodiments, the small interfering RNA, e.g., shRNA or siRNA, interacts with a viral sequence of about 19 to about 30 nucleotides, or about 19 to about 25 nucleotides, for example, any of about 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides. In some embodiments, the small interfering RNA binds to a hepatitis C virus sequence. In one embodiment, the small interfering RNA binds to a sequence within the internal ribosome entry site (IRES) sequence of a hepatitis C virus, for example, to the sequence depicted in SEQ ID NO:26 (residues 344-374 of SEQ ID NO:11). In one embodiment, the hepatitis C virus is HCV genotype 1a.
In some embodiments, a composition of the invention comprises a pharmaceutically acceptable excipient, for example, water or saline, and optionally, are provided in a therapeutically effective amount, e.g., for treating HCV infection in a human or in a non-human primate such as a chimpanzee or new world monkey. In one embodiment, the composition is a pharmaceutical composition comprising, consisting of, or consisting essentially of at least one shRNA or siRNA as described herein and a pharmaceutically acceptable excipient.
In another aspect, the invention relates to a kit that includes any of the compositions described above, and optionally, further includes instructions for use in a method of inhibiting gene expression in a virus or treating a viral infection in an individual as described herein. In one embodiment, the kit is for use in a method for treating HCV infection in an individual, such as a human, and comprises an shRNA comprising, consisting of, or consisting essentially of a sequence selected from the group consisting of SEQ ID NO:12, SEQ ID NO:16, SEQ ID NO:17, and SEQ ID NO:18; or comprising or consisting essentially of a sequence selected from the group consisting of SEQ ID NO:27, SEQ ID NO:32, and SEQ ID NO:33, or an siRNA comprising or consisting essentially of a sequence selected from the group consisting of SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:27, SEQ ID NO:32, and SEQ ID NO:33, and optionally further comprises instructions for use in a method of inhibiting gene expression in a hepatitis C virus, such as HCV genotype 1a, or instructions for use in a method of treating a hepatitis C (such as HCV genotype 1a) viral infection in an individual, such as a human, or a non-human primate such as a chimpanzee.
In another aspect, the invention provides a method for treatment of a viral infection in an individual, such as a mammal, for example, a human or non-human primate. The method includes administering to the individual a therapeutically effective amount of a small interfering RNA, such as shRNA or siRNA, that is at least partially complementary to and capable of binding to a polynucleotide sequence of the virus and a pharmaceutically acceptable excipient, such that binding of the small interfering RNA to the viral polynucleotide sequence inhibits gene expression in the virus, e.g., decreases the amount of viral expression in the individual or decreases the amount of viral expression that would be expected in an individual that did not receive the small interfering RNA. In one embodiment, the viral infection comprises a hepatitis C virus, such as HCV genotype 1a. In some embodiments, the virus is selected from the group consisting of hepatitis C genotypes 1a, 1b, 2a, and 2b. In some embodiments, the small interfering RNA comprises, consists of, or consists essentially of any of the shRNA or siRNA sequences described herein as well as sequences located within five nucleotides of one of the siRNA or shRNA sequences described herein. In some embodiments, the small interfering RNA is complementary to a viral sequence of about 19 to about 30 nucleotides, or about 19 to about 25 nucleotides, for example, any of about 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides. In one embodiment, the virus is a hepatitis C virus, such as HCV genotype 1a. In one embodiment, the small interfering RNA binds to a sequence of about 19 to about 25 nucleotides within the IRES region of HCV 1a depicted in SEQ ID NO:26. Treatment may include therapy (e.g., amelioration or decrease in at least one symptom of infection) or cure. In some embodiments, the shRNA is administered parenterally, for example, by intravenous injection or infusion.
In another aspect, the invention provides a method of inhibiting gene expression in a virus, comprising contacting viral RNA or viral mRNA with a small interfering RNA or introducing a small interfering RNA into a virus-containing cell, such that the small interfering RNA, e.g., shRNA or siRNA, contains a sequence that is at least partially complementary to a polynucleotide sequence of the virus and capable of inhibiting viral gene expression, for example, by inducing cleavage of viral polynucleotide sequences. In some embodiments, the small interfering RNA comprises, consists of, or consists essentially of any one of the shRNA or siRNA sequences described herein. In some embodiments, the small interfering RNA binds to a viral sequence of about 19 to about 30 nucleotides, or about 19 to about 25 nucleotides, for example, any of about 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides. In one embodiment, the virus is a hepatitis C virus, such as HCV 1a. In one embodiment, the small interfering RNA interacts with a sequence of about 19 to about 30 nucleotides within the IRES region of HCV genotype 1a depicted in SEQ ID NO:26 as well as sequences located within five nucleotides of one of the siRNA or shRNA sequences described herein. In yet other embodiments, at least two small interfering RNAs are introduced into a cell.
The invention also relates to an RNA sequence that consists of (a) a first RNA sequence, such that the first RNA sequence is a sequence illustrated in
The invention also relates to a DNA sequence that includes a sequence encoding an RNA sequence disclosed herein (e.g., an RNA sequence illustrated in
In some aspects, the invention relates to a composition that includes an RNA sequence as disclosed herein (for example, without limitation, an shRNA illustrated by
In another aspect, the invention includes a method of inhibiting expression or activity of a hepatitis C virus. The method includes providing a cell that can express a hepatitis C virus, and contacting the cell with an RNA sequence as disclosed herein (non-limiting examples of which are illustrated in
In some aspects, the invention relates to a method that includes identifying a subject infected with or suspected of being infected with a hepatitis C virus, providing to the subject a therapeutically effective amount of a composition containing one or more different RNA sequences disclosed herein. In some embodiments, the method also includes determining whether the viral load of the subject is decreased subsequent to providing the composition to the subject. In some embodiments, the method also includes determining whether at least one viral protein or viral nucleic acid sequence is decreased in the subject subsequent to providing the composition to the subject.
Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting.
Other features and advantages of the invention will be apparent from the detailed description, drawings, and from the claims.
The invention provides compositions, methods, and kits for inhibiting viral (e.g., hepatitis C) gene expression and/or treating a viral infection in a mammal.
RNA interference offers a novel therapeutic approach for treating viral infections. The present invention provides small interfering RNAs (e.g., shRNAs and siRNAs) that target a viral sequence and inhibit (i.e., reduce or eliminate) viral gene expression, and methods of using such small interfering RNAs for treatment of a viral infection in a mammal, such as a human. In some embodiments, the small interfering RNA constructs of the invention inhibit gene expression of a virus by inducing cleavage of viral polynucleotide sequences within or near the target sequence that is recognized by the antisense sequence of the small interfering RNA.
As used herein, “small interfering RNA” refers to an RNA construct that contains one or more short sequences that are at least partially complementary to and can interact with a polynucleotide sequence of a virus. Interaction may be in the form of a direct binding between complementary (antisense) sequences of the small interfering RNA and polynucleotide sequences of the viral target, or in the form of an indirect interaction via enzymatic machinery (e.g., a protein complex) that allows the antisense sequence of the small interfering RNA to recognize the target sequence. In some cases, recognition of the target sequence by the small interfering RNA results in cleavage of viral sequences within or near the target site that is recognized by the recognition (antisense) sequence of the small interfering RNA. The small interfering RNA can exclusively contain ribonucleotide residues, or the small interfering RNA can contain one or more modified residues, particularly at the ends of the small interfering RNA or on the sense strand of the small interfering RNA. The term “small interfering RNA” as used herein encompasses shRNA and siRNA, both of which are understood and known to those in the art to refer to RNA constructs with particular characteristics and types of configurations.
As used herein, “shRNA” refers to an RNA sequence comprising a double-stranded region and a loop region at one end forming a hairpin loop. The double-stranded region is typically about 19 nucleotides to about 29 nucleotides in length on each side of the stem, and the loop region is typically about three to about ten nucleotides in length (and 3′- or 5′-terminal single-stranded overhanging nucleotides are optional). One example of such an shRNA, HCVa-wt shRNA, has a 25 base pair double-stranded region (SEQ ID NO:12), a ten nucleotide loop, a GG extension on the 5′ end, and a UU extension on the 3′ end. Additional examples of suitable shRNAs for use in, e.g., inhibiting HCV expression, are provided throughout the specification, e.g.,
As used herein, “siRNA” refers to an RNA molecule comprising a double-stranded region with a 3′ overhang of nonhomologous residues at each end. The double-stranded region is typically about 18 to about 30 nucleotides in length, and the overhang may be of any length of nonhomologous residues, for example, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16 or more nucleotides. The siRNA can also comprise two or more segments of 19-30 base pair separated by unpaired regions. Without committing to any specific theory, the unpaired regions may function to prevent activation of innate immunity pathways. One example of such an siRNA is HCVa-wt siRNA, which has a 25 base pair double-stranded region (SEQ ID NO:12), and a UU extension on each 3′ end.
In one embodiment, a small interfering RNA as described herein comprises a sequence complementary to a sequence of the internal ribosome entry site (IRES) element of hepatitis C (“HCV”). In one embodiment, the virus is HCV genotype 1a.
SiRNA gene inhibition has been shown to robustly inhibit gene expression in a number of mammalian systems. Due to its high level of secondary structure, the HCV IRES has been suggested to be a poor target for siRNAs or shRNAs. Mizusawa reported, however, successful targeting of the HCV IRES in 293 and Huh7 tissue culture cells, reporting 50 and 74 percent knock-down of gene expression, respectively. Similarly, Seo and coworkers [25] reported the ability of 100 nM siRNA to inhibit HCV replication (about 85% knockdown) in 5-2 Huh7 cells. It has now been demonstrated as described herein that small interfering RNAs (shRNAs and siRNAs) directed against the 3′ end of the HCV IRES, including and downstream of the AUG translation start site, can induce 96 percent knockdown of HCV IRES-dependent luciferase expression at 0.3 nM in 293FT cells and 75 percent knockdown at 0.1 nM in Huh7 cells (see
Reports suggest that in vitro-synthesized transcripts from bacteriophage promoters potently induce interferon (IFN) alpha and beta due to the presence of an unnatural 5′ triphosphate [26]. Furthermore, shRNAs expressed from pol III expression vectors may also induce IFN [27]. How this interferon induction would affect use of shRNAs in a clinical setting for HCV infection is unclear. Current HCV therapy includes treatment with interferon alpha, suggesting that if interferon is induced by shRNA, it may have a positive effect. To date, no interferon-related side effects appear to have been reported in animals following administration of RNAi [3]. Additional concerns have been raised regarding off-target effects of siRNA as well as potential cytotoxic effects when siRNAs or shRNAs are delivered by lentiviral vectors [28].
The present invention also relates to methods of testing siRNAs and shRNAs targeting HCV IRES sequences to identify those sequences having sufficient activity (e.g., the highest activity among a selected group of such sequences) to be a candidate for use as a treatment. Testing can also include screening for small interfering activities having undesirable off-target effects or general cytotoxic effects. Off-target effects include, without limitation knockdown of nontargeted genes, inhibition of expression of non-targeted genes, and competition with natural microRNA pathways (Birmingham et al., Nat. Methods. 2006 3(3):199-204; Grimm et al., Nature 2006 441(7092):537-541). Methods of identifying cytotoxic effects are known in the art (for example, Marques et al., Nat. Biotechnol. 2006 24(5):559-565; Robbins et al., Nat. Biotechnol. 2006 24(5):566-571).
The IRES region in the HCV 5′-UTR is highly conserved (92-100% identical [15, 29-31]) and has several segments that appear to be invariant, making the IRES a prime target for nucleic acid-based inhibitors. The region around the AUG translation initiation codon is particularly highly conserved, being invariant at positions +8 to −65 (with the exception of a single nucleotide variation at position −2) as observed in over 81 isolates from various geographical locations [32]. Despite the conservation of sequence in the IRES motif, it is unlikely that targeting a single sequence, even if highly conserved, will be sufficient to prevent escape mutants. RNA viruses are known to have high mutation rates due to the high error rate of the RNA polymerase and the lack of proofreading activity of that enzyme. On average, each time HCV RNA is replicated one error is incorporated into the new strand. This error rate is compounded by the prodigious production of viral particles in an active infection (approximately a trillion per day in a chronically infected patient) [33]. Therefore, in some embodiments of the invention, several conserved sites are targeted or, alternatively, shRNAs as described herein are used as a component of a combination treatment, such as with ribaviran and/or pegylated interferon. As demonstrated herein, a single mismatch does not completely block shRNA activity (see Example 2;
McCaffrey and colleagues reported that a phosphorodiamidate morpholino oligonucleotide directed against a conserved HCV IRES site at the AUG translation initiation site potently inhibits reporter gene expression [8]. The same morpholino inhibitor was used for comparison against the shRNA inhibition described herein. It was found that both the morpholine and the shRNA targeting the conserved HCV IRES site potently and robustly inhibited IRES-dependent gene expression. Four mutations in the morpholino were required to block activity, whereas two changes in the shRNA were sufficient, suggesting greater shRNA specificity. This potential advantage, coupled with the lack of unnatural residues in the shRNA inhibitor and presumably fewer resultant side effects, are balanced by the increased stability of the morpholino oligomer.
A dual reporter luciferase plasmid was used in which firefly luciferase (fLuc) expression was dependent on the HCV IRES [24]. Expression of the upstream renilla luciferase is not HCV IRES-dependent and is translated in a Cap-dependent process. Direct transfection of HCV IRES shRNAs, or alternatively shRNAs expressed from polIII-promoter vectors, efficiently blocked HCV IRES-mediated fLuc expression in human 293FT and Huh7 cells. Control shRNAs containing a double mutation had little or no effect on fLuc expression, and shRNAs containing only a single mutation showed partial inhibition. These shRNAs were also evaluated in a mouse model where DNA constructs were delivered to cells in the liver by hydrodynamic transfection via the tail vein. The dual luciferase expression plasmid, the shRNAs, and secreted alkaline phosphatase plasmid were used to transfect cells in the liver, and the animals were imaged at time points over 12 to 96 hours. In vivo imaging revealed that HCV IRES shRNA directly, or alternatively expressed from a polIII-plasmid vector, inhibited HCV IRES-dependent reporter gene expression; mutant or irrelevant shRNAs had little or no effect. These results indicate that shRNAs, delivered as RNA or expressed from viral or nonviral vectors, are useful as effective antivirals for the control of HCV and related viruses.
Assay of three additional shRNAs targeting different sites on HCV IRES domain IV revealed another potent shRNA, HCVd-wt, whose target position is shifted six nucleotides from that of HCVa-wt. HCVb-wt and HCVc-wt were much less efficient inhibitors.
To further investigate local sequence effects on potency, seven in vitro-transcribed shRNA constructs comprising a 19 base pair sequence complementary to a sequence of the HCV IRES and the corresponding synthetic siRNA comprising the same 19 base pair sequences, targeting all possible positions within the 25 base pair site of HCVa-wt (344-368), were assayed for inhibitory activity. A 25 base pair synthetic siRNA corresponding to HCVa-wt shRNA was also tested. All of the tested constructs exhibited a high level of activity. In general, 19 base pair siRNAs were more potent than 19 base pair shRNAs. The most potent, siHCV19-3 was effective at 1 nM (>90% inhibition), 0.1 nM (about 90% inhibition) and even at a concentration of 0.01 nM (about 40% inhibition). Thus, 19-25 base pair shRNAs and siRNAs designed to target the region 344-374 on the HCV IRES are generally potent inhibitors of HCV expression, with some local differences.
Small hairpin RNAs of the invention can, optionally, include structures resulting in strong noncovalent bonds between the sense and antisense strands of the shRNA. Examples of such noncovalent bonds include cross-links mediated by metal ions. Such cross-links can be formed between natural or modified nucleotide residues, including, for example, modified bases, sugars, and terminal groups, as described in Kazakov and Hecht 2005, Nucleic Acid-Metal Ion Interactions. In: King, R. B. (ed.), Encyclopedia of Inorganic Chemistry. 2nd ed., Wiley, Chichester, vol. VI, pp. 3690-3724, e.g., section 5.4.3. Additional non-limiting examples of variants of such bonds are found patent application WO 99/09045(US2006074041; e.g.,
Examples of targeting sequences are provided throughout the specification. Non-limiting examples of targeting sequences are provided in, for example, Table 1 and
Effects of size and sequence of loop region of the shRNA were also investigated. The loop region of the shRNA stem-loop can be as small as two to three nucleotides and does not have a clear upper limit on size; generally, a loop is between four and nine nucleotides, and is generally a sequence that does not cause unintended effects, e.g., by being complementary to a non-target gene. Highly structured loop sequences such as a GNRA tetraloop can be used in the loop region (e.g., as the loop) in an shRNA. The loop can be at either end of the molecule; that is, the sense strand can be either 5′ or 3′ relative to the loop. Also, a noncomplementary duplex region (approximately one to six base pairs, for example, four CG base pairs) can be placed between the targeting duplex and the loop, for example to serve as a “CG clamp” to strengthen duplex formation. At least 19 base pairs of target-complementary duplex are needed if a noncomplementary duplex is used.
A loop structure can also include reversible linkages such as S—S bonds, which can be formed by oxidation of —SH groups introduced into nucleotide residues, e.g., as described in (Earnshaw et al., J. Mol. Biol., 1997, 274: 197-212; Sigurdsson et al. (Thiol-Containing RNA for the Study of Structure and Function of Ribozymes. METHODS: A Companion to Methods in Enzymology, 1999, 18: 71-77). A non-limiting example of the location for nucleotide residues with SH groups is at the ends of the complementary RNA strands that lie in close proximity upon duplex formation. Such modified nucleotides are introduced during chemical synthesis of the sense and antisense RNA strands of the small interfering RNA. The modified nucleotides in sense and antisense strands may either form base pairs or form non-complementary overhangs of one to three nucleotides.
Additional non-limiting examples of loops and their applications, e.g., in shRNA and siRNA targeting HCV, can be found in the Examples.
TerminiThe 3′ terminus of an shRNA as described herein can have a non-target-complementary overhang of two or more nucleotides, for example, UU or dTdT, however, the overhangs can be any nucleotide including chemically modified nucleotides that, for example, promote enhanced nuclease resistance. In other embodiments, there are one or zero nucleotides overhanging on the 3′ end.
The 5′ end can have a noncomplementary extension, e.g., two Gs (as shown in
Additional features that can optionally be included in shRNAs used to inhibit HCV expression and that are encompassed by the invention are length variations between about 19 base pairs and about 30 base pairs for the target complementary duplex region, small shifts in the sequence targeted (generally zero to about two nucleotides, and shifts as large as about ten nucleotides in either direction along the target may lie within the targetable region). Similarly, mismatches are also tolerated: about one to about two in the antisense strand and about one to about nine in the sense strand (the latter destabilizing the hairpin duplex but not affecting the strength of binding of the antisense strand to the target; the number tolerated depends partly on the length of the target-complementary duplex. As described herein, an shRNA having at least seven G-U mismatches within a 29 base pair target-complementary duplex region can be used successfully for inhibiting HCV expression, e.g., using sequence targeting the HCV IRES. Note that the two mutations shown in
Suitable vectors for producing shRNAs and siRNAs are described herein and are known in the art. In non-limiting examples, shRNAs can be expressed using Pol III promoters such as U6 or H1, in the context of vectors derived from adeno-associated virus or lentiviruses. The human U6 nuclear RNA promoter and human H1 promoter are among the pol III promoters for expressing shRNAs.
One feature that is generally desirable in a vector is relatively prolonged transgene expression. Lentiviral vectors are able to transduce nondividing cells and maintain sustained long-term expression of transgene. Adeno-associated virus serotype 8 is considered safe and is characterized by prolonged transgene expression.
Candidate shRNA and siRNA
In some cases, one or more small interfering RNAs are identified as having activity for inhibiting a targeted virus such as HCV. Additional tests can be carried out to further characterize the suitability of such RNAs for use, e.g., for inhibiting HCV expression in an animal. Animal models can be used for such testing. One non-limiting examples includes a mouse model, e.g., as illustrated in Example 3 (infra). Other animal models suitable for testing an treatment for HCV are known in the art, for example, using chimpanzees.
MethodsThe invention relates to methods of inhibiting gene expression in a virus, comprising contacting the virus with a small interfering RNA, such as a shRNA or siRNA as described herein that comprises a sequence that is at least partially complementary to, and is capable of interacting with a polynucleotide sequence of the virus. In some embodiments, contacting the virus comprises introducing the small interfering RNA into a cell that contains the virus, i.e., a virus infected cell. “Inhibiting gene expression” as used herein refers to a reduction (i.e., decrease in level) or elimination of expression of at least one gene of a virus. For example, reduction in expression compared to corresponding cell or animal infected with the virus. In some embodiments, inhibition of gene expression is accomplished by cleavage of the viral target sequence to which the small interfering RNA binds. Gene expression can be assayed by assaying viral RNA or viral protein. In some cases, efficacy of a method (for example, a treatment using a composition described herein) is assayed by evaluating an infected animal for a decrease in symptoms or a change (e.g., decrease) in the expression or activity of a protein associated with viral infection, e.g., a viral protein such as p24, or a host protein such as an interferon.
The invention also relates to methods for treating a viral infection or for treating a subject suspected of being infected (including a subject exposed to virus for prophylactic treatment) in a mammal, comprising administering to the mammal a composition comprising a therapeutically effective amount of a small interfering RNA, such as a shRNA or siRNA as described herein that includes a sequence that is at least partially complementary to, and capable of interacting with (e.g., hybridizing to under physiological conditions, or effecting RNAi activity), a polynucleotide sequence of the virus, e.g., the IRES sequence of HCV. In some embodiments, the mammal is human. In one embodiment, the mammal is a human and the viral infection is a HCV infection, such as an infection with HCV genotype 1a, and the small interfering RNA comprises a sequence that is at least complementary to a sequence of the IRES of the HCV.
As used herein, a “therapeutically effective amount” is an amount of a small interfering RNA that can render a desired therapeutic outcome (e.g., reduction or elimination of a viral infection). A therapeutically effective amount may be administered in one or more doses. Non-limiting examples of doses are about 0.1 mg/kg to about 50 mg/kg, e.g., about 1 to about 5 mg/kg. Suitable methods of delivery are known in the art and include, for example, intravenous administration (e.g., via a peripheral vein of via a catheter). Non-limiting examples include delivery via the hepatic artery or the portal vein.
Generally, in methods for treating a viral infection in a mammal, the small interfering RNA is administered with a pharmaceutically acceptable carrier. As used herein, a “pharmaceutically acceptable carrier” (also interchangeably termed “pharmaceutically acceptable excipient” herein) is a relatively inert substance that facilitates administration of the small interfering RNA or RNAs. For example, a carrier can give form or consistency to the composition or can act as a diluent. A pharmaceutically acceptable carrier is biocompatible (i.e., not toxic to the host) and suitable for a particular route of administration for a pharmacologically effective substance. Suitable pharmaceutically acceptable carriers include but are not limited to stabilizing agents, wetting and emulsifying agents, salts for varying osmolarity, encapsulating agents, buffers, and skin penetration enhancers. In some embodiments, the pharmaceutically acceptable carrier is water or saline. Examples of pharmaceutically acceptable carriers are described in Remington's Pharmaceutical Sciences (Alfonso R. Gennaro, ed., 18th edition, 1990).
In methods for treating a viral infection, small interfering RNAs as described herein are generally administered parenterally, e.g., subcutaneously, intravenously, or intramuscularly.
CompositionsThe invention provides compositions for inhibiting viral gene expression and/or treating a viral infection in a mammal comprising at least one small interfering RNA as described herein. Compositions of the invention may comprise two or more small interfering RNAs as described herein. In accordance with the invention, a small interfering RNA, e.g., shRNA or siRNA, comprises a sequence that is substantially complementary to a viral polynucleotide sequence of about 19 to about 30 nucleotides, wherein interaction of the substantially complementary sequence of the small interfering RNA with the polynucleotide sequence of the virus inhibits viral gene expression, for example, by cleavage of viral polynucleotide sequences.
In some embodiments, the composition comprises an shRNA that includes a sequence selected from the group consisting of SEQ ID NOs: 12, 17, 18, 19, 20, 21, 22, 23, 24, and 25. In some embodiments, the composition comprises an shRNA that includes one of the following: SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51; SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:54, SEQ ID NO:55, or SEQ ID NO:56 (Table 10). In some embodiments, the composition comprises one or more shRNAs of SEQ ID NO:57-110. In some embodiments, the composition comprises a siRNA comprising a sequence selected from SEQ ID NOs:19, 20, 21, 22, 23, 24, and 25. In other embodiments, the composition comprises a siRNA that includes a sequence of SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51; SEQ ID NO:52, SEQ ID NO:53, SEQ ID NO:54, SEQ ID NO:55, or SEQ ID NO:56 (
In some embodiments, the invention provides a pharmaceutical composition comprising a small interfering RNA as described herein and a pharmaceutically acceptable carrier. In some embodiments, the pharmaceutical composition is formulated for parenteral administration to a mammal, for example, a human.
A pharmaceutical composition that includes a short interfering RNA (e.g., an siRNA or an shRNA) is formulated to be compatible with its intended route of administration. Examples of routes of administration include parenteral, e.g., intravenous, intradermal, subcutaneous, inhalation, transdermal (topical), transmucosal, and rectal administration; or oral. Solutions or suspensions used for parenteral, intradermal, or subcutaneous application can include the following components: a sterile diluent such as water for injection, saline solution, fixed oils, polyethylene glycols, glycerin, propylene glycol or other synthetic solvents; antibacterial agents such as benzyl alcohol or methyl parabens; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid; buffers such as acetates, citrates or phosphates and agents for the adjustment of tonicity such as sodium chloride or dextrose. pH can be adjusted with acids or bases, such as hydrochloric acid or sodium hydroxide. A parenteral preparation can be enclosed in ampoules, disposable syringes or multiple dose vials made of glass or plastic.
Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, Cremophor EL™ (BASF, Parsippany, N.J.) or phosphate buffered saline (PBS). In all cases, the composition must be sterile and should be fluid to the extent that easy syringability exists. It should be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyetheylene glycol, and the like), and suitable mixtures thereof. The proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the selected particle size in the case of dispersion and by the use of surfactants. Prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like. In some cases, isotonic agents are included, for example, sugars, or polyalcohols such as manitol, sorbitol, or sodium chloride. Prolonged absorption of an injectable composition can be effected by including in the composition an agent which delays absorption, for example, aluminum monostearate or gelatin.
Sterile injectable solutions can be prepared by incorporating the active compound in the specified amount in an appropriate solvent with one or a combination of ingredients enumerated above, as needed, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the active compound into a sterile vehicle that contains a basic dispersion medium and other ingredients selected from those enumerated above or others known in the art. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum drying and freeze-drying which yields a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.
Oral compositions generally include an inert diluent or an edible carrier. For the purpose of oral therapeutic administration, the active compound can be incorporated with excipients and used in the form of tablets, troches, or capsules, e.g., gelatin capsules. Pharmaceutically compatible binding agents can be included as part of the composition. The tablets, pills, capsules, troches and the like can contain any of the following ingredients, or compounds of a similar nature: a binder such as microcrystalline cellulose, gum tragacanth or gelatin; an excipient such as starch or lactose, a disintegrating agent such as alginic acid, Primogel, or corn starch; a lubricant such as magnesium stearate or Sterotes; a glidant such as colloidal silicon dioxide; a sweetening agent such as sucrose or saccharin; or a flavoring agent such as peppermint, methyl salicylate, or orange flavoring.
For administration by inhalation, the compounds are delivered in the form of an aerosol spray from pressured container or dispenser that contains a suitable propellant, e.g., a gas such as carbon dioxide, or a nebulizer.
Systemic administration can also be by transmucosal or transdermal means. For transmucosal or transdermal administration, penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art, and include, for example, for transmucosal administration, detergents, bile salts, and fusidic acid derivatives. Transmucosal administration can be accomplished through the use of nasal sprays or suppositories. For transdermal administration, the active compounds are formulated into ointments, salves, gels, or creams as generally known in the art.
The compounds can also be prepared in the form of suppositories (e.g., with conventional suppository bases such as cocoa butter and other glycerides) or retention enemas for rectal delivery.
In one embodiment, the active compounds are prepared with carriers that will protect the compound against rapid elimination from the body, such as a controlled release formulation, including implants and microencapsulated delivery systems. Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid. Methods for preparation of such formulations will be apparent to those skilled in the art. The materials can also be obtained commercially from Alza Corporation and Nova Pharmaceuticals, Inc. Liposomal suspensions (including liposomes targeted to infected cells with monoclonal antibodies to viral antigens) can also be used as pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art, for example, as described in U.S. Pat. No. 4,522,811.
It is advantageous to formulate oral or parenteral compositions in dosage unit form for ease of administration and uniformity of dosage. Dosage unit form as used herein refers to physically discrete units suited as unitary dosages for the subject to be treated; each unit containing a predetermined quantity of active compound calculated to produce the desired therapeutic effect in association with the selected pharmaceutical carrier.
Toxicity and therapeutic efficacy of compounds disclosed herein can be determined by pharmaceutical procedures known in the art, for example, in cell cultures or experimental animals, e.g., for determining the LD50 (the dose lethal to 50% of the population) and the ED50 (the dose therapeutically effective in 50% of the population). The dose ratio between toxic and therapeutic effects is the therapeutic index and it can be expressed as the ratio LD50/ED50. Compounds that exhibit high therapeutic indices are preferred. While compounds that exhibit toxic side effects may be used, care should be taken to design a delivery system that targets such compounds to the site of affected tissue to minimize potential damage to uninfected cells and, thereby, reduce side effects.
The data obtained from the cell culture assays and animal studies can be used in formulating a range of dosage for use in humans. The dosage of such compounds lies preferably within a range of circulating concentrations that include the ED50 with little or no toxicity. The dosage may vary within this range depending upon the dosage form employed and the route of administration utilized. For any compound used in the method of the invention, the therapeutically effective dose can be estimated initially from cell culture assays. A dose may be formulated in animal models to achieve a circulating plasma concentration range that includes the IC50 (i.e., the concentration of the test compound which achieves a half-maximal inhibition of symptoms) as determined in cell culture. Such information can be used to more accurately determine useful doses in humans. Levels in plasma may be measured, for example, by high performance liquid chromatography.
The invention also relates to a method of making a medicament for use in treating a subject, e.g., for HCV infection. Such medicaments can also be used for prophylactic treatment of a subject at risk for or suspected of having an HCV infection.
KitsThe invention provides kits comprising a small interfering RNA as described herein. In some embodiments, the kits also include instructions for use in the methods for inhibiting viral gene expression and/or methods for treatment of a viral infection in a mammal described herein. Instructions may be provided in printed form or in the form of an electronic medium such as a floppy disc, CD, or DVD, or in the form of a website address where such instructions may be obtained.
In some embodiments, the kits include a pharmaceutical composition of the invention, for example including at least one unit dose of at least one small interfering RNA such as a shRNA or a siRNA, and instructions providing information to a health care provider regarding usage for treating or preventing a viral infection. The small interfering RNA is often included as a sterile aqueous pharmaceutical composition or dry powder (e.g., lyophilized) composition.
Suitable packaging is provided. As used herein, “packaging” refers to a solid matrix or material customarily used in a system and capable of holding within fixed limits a composition of the invention suitable for administration to an individual. Such materials include glass and plastic (e.g., polyethylene, polypropylene, and polycarbonate) bottles, vials, paper, plastic, and plastic-foil laminated envelopes and the like. If e-beam sterilization techniques are employed, the packaging should have sufficiently low density to permit sterilization of the contents.
Kits may also optionally include equipment for administration of a pharmaceutical composition of the invention, such as, for example, syringes or equipment for intravenous administration, and/or a sterile solution, e.g., a diluent such as water, saline, or a dextrose solution, for preparing a dry powder (e.g., lyophilized) composition for administration.
The invention is further illustrated by the following examples. The examples are provided for illustrative purposes only. They are not to be construed as limiting the scope or content of the invention in any way.
Example 1 Design and Construction of shRNA Expression Cassettes, T7 Transcription Reactions, and Reporter Gene AssaysChemically synthesized oligonucleotides were obtained from IDT (Coralville, Iowa), resuspended in RNase- and pyrogen-free water (Biowhittaker), and annealed as described below. The following oligonucleotide pairs, for making shRNA, contain a T7 promoter element (doubly underlined), sense and antisense HCV IRES sequence and a miR-23 microRNA loop structure (reported to facilitate cytoplasmic localization [21, 22]).
(T7 promoter sequence doubly underlined). T7 transcripts for HCVa-mut shRNA were identical with the exception that nucleotide changes (G→C and C→G) were incorporated into the synthesized oligonucleotides at the singly underlined residues.
HCVa-wt shRNA (
ShRNAs #1-7 (targeting positions 344-362, 345-363, 346-364, 347-365, 348-366, 349-367, 350-368 on the HCV IRES; See
The oligonucleotide pair used to prepare the control shRNA 229 (which targets tumor necrosis factor alpha) is 229-5′-TAATACGACTCACTATAGGGGCG GTGCCTATGTCTCAGCCTCTTCTCACTTCCTGTCATGAGAAGAGGCTGAGACA TAGGCACCGCC TT-3′ (SEQ ID NO:3) and 229-3′-AAGGCG GTGCCTATGTC TCAGCC TCT TCTCA TGACAGGAAG TGAGA AGAGGCTGA GACATAGGCACCCCTATAGTGAGTCGTATTA-5′ (SEQ ID NO:4).
Pol III U6 shRNA Expression Vector Construction—Design of Small Hairpin shRNA Expression Vectors
Oligonucleotide pairs were incubated together at 95° C. for two minutes in RNA polymerase buffer (e.g., 120 μl of each 100 μM oligonucleotide in 60 μl 5× annealing buffer (Promega; 1×=10 mM Tris-HCl (pH 7.5), 50 mM NaCl) and slowly cooled (annealed) over 1 hour to less than 40° C. The oligonucleotides were designed to provide 4-base overhangs for rapid cloning into Bbs1/BamH1-digested pCRII-U6 plasmid (Bbs1 and BamH1 recognition sites or overhangs are underlined in the oligonucleotide sequences). The pCRII-U6 pol III expression plasmid was prepared by subcloning the PCR product obtained from human HT-1080 genomic DNA using primers and huU6-5′ ATCGATCCCCAGTGGAAAGACGCGCAG (SEQ ID NO:5) and huU6-3′-GGATCCGAATTCGAAGACCACGGTGTTTCGTCCTTTCCACAA-5′
(SEQ ID NO:6) [23] into the pCRII vector (Invitrogen) using the TA cloning kit (Invitrogen). The cassette consisting of the annealed oligonucleotides (encoding the HCV IRES shRNA) was ligated into the Bbs1/BamH1-digested pCRII-U6 plasmid. The expressed shRNA contains a miR-23 microRNA loop structure to facilitate cytoplasmic localization [21, 22]. The final pCRII-U6 constructs were confirmed by sequencing. The primers pairs used were: pHCVa-wt 5′-ACCG GAGCACGAATCCTAAACCTCAAAGA CTTCCTGTCA TCTTTGAGGTTTAGGATTCGTGCTC TTTTTTG-3′ (SEQ ID NO:7) and 5′-GATCCAAAAAA GAGCACGAATCCTAAACCTCAAAGA TGACAGGAAG TCTTTGAGGTTTAGGATTCGTGCTC-3′ (SEQ ID NO:8). Oligonucleotides containing the appropriate sequence changes at the underlined residues (see above) were used to generate the pCRII-U6/HCVa-mut (double mutation), HCVsnp1 (single change at 5′ side) and HCVsnp2 (single change at 3′ end) as depicted in
Oligonucleotide pairs were incubated at 95° C. for two minutes in RNA polymerase buffer (e.g., 120 μl of each 100 μM oligonucleotide in 60 μl 5× transcription buffer (Promega)) and slowly cooled (annealed) over 1 hour to less than 40° C. ShRNA was transcribed at 42° C. for four hours from 5 μM of the resulting annealed double-stranded DNA template using the AmpliScribe™ T7 Flash transcription kit (Epicentre Technologies) followed by purification on a gel filtration spin column (Microspin™ G-50, Amersham Biosciences) that had been thoroughly washed three times with phosphate buffered saline (PBS) to remove preservative.
siRNAs
siRNAs were prepared by annealing chemically synthesized (Dharmacon) complementary strands of RNA, each containing the appropriate recognition sequence plus an (overhanging) UU extension on the 3′end.
Transfections and Reporter Gene AssaysHuman 293FT (Invitrogen) and Huh7 cells (American Type Culture Collection (ATCC), Manassas, Va.) were maintained in DMEM (Biowhittaker®) with 10% fetal bovine serum (HyClone), supplemented with 2 mM L-glutamine and 1 mM sodium pyruvate. The day prior to transfection, cells were seeded at 1.7×105 cells/well in a 24-well plate, resulting in about 80% cell confluency at the time of transfection. Cells were transfected with Lipofectamine™ 2000 (Invitrogen, Carlsbad, Calif.) following the manufacturer's instructions. For the inhibition experiments, 293FT or Huh7 cells were cotransfected (in triplicate) with 40 ng pCDNA3/HCV IRES dual luciferase (renilla and firefly) reporter construct, 50 ng pSEAP2-control plasmid (BD Biosciences Clontech, as transfection controls) and the indicated amounts of T7-generated shRNA (typical amount 1 pmole) or pCRII-U6 shRNA expression construct (710 ng). Compensatory pUC18 plasmid was added to the transfection mix to give a final concentration of 800 ng total nucleic acid per transfection. Forty-eight hours later, supernatant was removed, heated at 65° C. for 15-30 minutes, and 5-10 μl of the supernatant was added to 150 μl p-nitrophenyl phosphate liquid substrate system (pNPP, Sigma). After a 30-60 minute incubation at room temperature, samples were read (405 nm) on a Molecular Devices Thermomax microplate reader and quantitated using SOFTmax software (Molecular Devices). The remaining cells were lysed and luciferase activity measured using the Dual-Luciferase Reporter assay system (Promega) and MicroLumat LB 96 P luminometer (Berthold).
MiceSix-week old female Balb/c mice were obtained from the animal facility of Stanford University. Animals were treated according to the NIH Guidelines for Animal Care and the Guidelines of Stanford University.
Mouse Hydrodynamic Injections and In Vivo ImagingHydrodynamic tail vein injections were performed as described by McCaffrey and colleagues with minor modifications including omission of RNasin [24]. A total volume of 1.8 ml of phosphate-buffered saline containing inhibitor (RNA or plasmid), 10 μg of pHCV Dual Luc plasmid, and 2 μg pSEAP2-control plasmid (BD Biosciences Clontech, contains the SV40 early promoter), was steadily injected into the mouse tail vein over about five seconds (N=4-6 animals per group). At the indicated times, 100 of 30 mg/ml luciferin was injected intraperitoneally. Ten minutes following the injection, live anesthetized mice were analyzed using the IVIS7 imaging system (Xenogen Corp., Alameda, Calif.) and the resulting light emission data quantitated using LivingImage software (Xenogen). Raw values are reported as relative detected light per minute and standard errors of the mean for each group (N=4-5 animals) are shown.
Secreted Alkaline Phosphatase (SEAP) AssayAt day 5, mice were bled through the retro-orbital vein of the eye. The serum was separated from blood cells by microcentrifugation, heated at 65° C. for 30 minutes to inactivate endogenous alkaline phosphates, and 5-10 μl of the serum was added to 150 μl pNPP liquid substrate system (see above). After a 30-60 minute incubation at room temperature, samples were read (405 nm) and quantitated as described above.
Example 2 shRNA Inhibition of HCV IRES-Mediated Gene Expression in Human Tissue Culture CellsIn this study, short interfering RNAs (shRNAs and siRNAs) designed and constructed as in Example 1 to target a conserved region of the hepatitis C IRES were tested for their ability to inhibit HCV IRES-mediated reporter expression in human tissue culture cells.
Three other shRNAs were also designed with the same stem length and loop sequence that target nearby positions in Domain IV of the HCV IRES (
To test the effectiveness of the HCV shRNAs to inhibit HCV IRES-mediated gene expression, human 293FT or hepatocyte Huh7 cells were co-transfected with pCDNA3/HCV IRES dual luciferase expression plasmid, secreted alkaline phosphatase expression plasmid (pSEAP2, to control for efficiency of transfection) as well as in vitro synthesized shRNAs or alternatively, pol III expression vectors containing the corresponding shRNA cassettes.
As seen in
Specificity and Potency of Inhibition of HCV IRES-Mediated Gene Expression by shRNAs in 293FT Cells
To further test inhibition of HCV-IRES driven gene expression, 293FT cells were cotransfected with dual luciferase reporter and SEAP expressing plasmids as well as 1 pmole of in vitro transcribed shRNAs. The target plasmid was pCDNA3/HCV IRES dual luciferase reporter (HCV IRES, as shown in
HCVa-wt shRNA targeting the region of the IRES immediately downstream of the AUG translation start site strongly inhibited HCV IRES-mediated fLuc expression in both human 293FT (
Little or no inhibition was observed when the HCV shRNA was targeted to a similar dual luciferase construct in which the HCV IRES was replaced by the encephalomyocarditis virus (EMCV) IRES (
To confirm that the shRNAs were acting by degrading their target mRNA, a Northern blot analysis was performed (
Dose response experiments showed that the HCVa-wt shRNA effectively inhibited HCV IRES-dependent gene expression at 0.3 nM in 293FT cells (96 percent inhibition, see
To further investigate local sequence effects on potency, seven in vitro-transcribed 19 bp shRNA and the corresponding synthetic 19 base pair siRNA, targeting all possible positions within the 31-base pair site of HCVa (344-374;
The ability of the HCV shRNA and HCV shRNA expression plasmid to inhibit target gene expression was extended to a mouse model system using hydrodynamic injection to deliver the nucleic acids to mouse liver.
SFV has been used as a model system for more virulent positive-strand RNA viruses. To examine the inhibitory effect of RNAi on SFV growth, shRNAs targeting four SFV genes (nsp-1, nsp-2 and nsp-4, and capsid) and one mismatched control for the nsp-4 site were generated and expressed from a U6 promoter. Their ability to tested their ability to inhibit the proliferation of SFV-A7-EGFP, a version of the replication-proficient SFV strain SFV-A7 that expresses a eGFP reporter gene [49]. A modest reduction (about 35%) of SFV-GFP replication was seen with shRNAs targeting the nsp-1 (
A site within the capsid coding region that was previously shown to be effective on Sindbis virus [50] was not effective on SFV. The Sindbis-SFV sequence homology at this site is only 77%. SFV is a very rapidly growing virus, producing up to 200,000 cytoplasmic RNAs during its infectious cycle. To see if cells could better protected from a slower-growing virus, the effects of these siRNAs on a replication-deficient strain of SFV-GFP were tested in two separate experiments.
Dose-response experiments were performed to examine inhibition of an HCV replicon system in Huh7 cells by HCVa-wt shRNA and HCVa-mut shRNA as well as a non-specific control shRNA (229). The antiviral activity of test compounds was assayed in the stably HCV RNA-replicating cell line, AVA5, derived by transfection of the human hepatoblastoma cell line, Huh7 (Blight, et al., Science, 2000, 290:1972). RNA-based inhibitors were co-transfected with DsRed expression plasmid into cultures that were about 80 percent confluent. HCV RNA levels were assessed 48 hours after transfection using dot blot hybridization. Assays were conducted in triplicate cultures. A total of 4-6 untreated control cultures, and triplicate cultures treated with 10, 3, and 1 IU/ml α-interferon (active antiviral with no cytotoxicity), and 100, 10, and 1 uM ribavirin (no antiviral activity and cytotoxic) served as positive antiviral and toxicity controls. The transfection efficiency was estimated by fluorescence microscopy (DsRed expression). Both HCV and b-actin RNA levels in triplicate treated cultures were determined as a percentage of the mean levels of RNA detected in untreated cultures (6 total). Beta-actin RNA levels are used both as a measure of toxicity, and to normalize the amount of cellular RNA in each sample. A level of 30% or less HCV RNA (relative to control cultures) is considered to be a positive antiviral effect, and a level of 50% or less b-actin RNA (relative to control cultures) is considered to be a cytotoxic effect. Cytotoxicity is measured using an established neutral red dye uptake assay (Korba, B. E. and J. L. Gerin (1992). Use of a standardized cell culture assay to determine activities of nucleoside analogs against hepatitis B virus replication (Antivir. Res. 19:55-70).
]Inhibition of an HCV replicon system in Huh7 cells by HCVa-wt shRNA and HCVa-mut shRNA as well as an irrelevant control shRNA (229); dose response. The antiviral activity of test compounds was assayed in the stably HCV RNA-replicating cell line, AVA5, derived by transfection of the human hepatoblastoma cell line, Huh7 (Blight et al. Science, 2000, 290:1972). RNA-based inhibitors were co-transfected with DsRed expression plasmid into ˜80 percent confluent cultures and HCV RNA levels were assessed 48 hours after transfection using dot blot hybridization. Assays were conducted in triplicate cultures. A total of 4-6 untreated control cultures, and triplicate cultures treated with 10, 3, and 1 IU/ml a-interferon (active antiviral with no cytotoxicity), and 100, 10, and 1 uM ribavirin (no antiviral activity and cytotoxic) served as positive antiviral and toxicity controls. The transfection efficiency was estimated by fluorescence microscopy (DsRed expression). Both HCV and beta-actin RNA levels in triplicate treated cultures were determined as a percentage of the mean levels of RNA detected in untreated cultures (6 total). Beta actin RNA levels were used both as a measure of toxicity, and to normalize the amount of cellular RNA in each sample. A level of 30% or less HCV RNA (relative to control cultures) was considered to be a positive antiviral effect, and a level of 50% or less beta-actin RNA (relative to control cultures) was considered to be a cytotoxic effect. Cytotoxicity was measured using an established neutral red dye uptake assay (Korba et al., Antiviral Res., 1992, 19:55-70). Use of a standardized cell culture assay to determine activities of nucleoside analogs against hepatitis B virus replication (Korba et al., 1992 supra).
Example 5 Identification of shRNAs that Inhibit HCV IRES-Dependent Gene Expression in Tissue Culture CellsThe ability of in vitro-transcribed small hairpin RNAs (shRNAs) to inhibit hepatitis C virus internal ribosome entry site (HCV IRES)-dependent gene expression in cultured cells was investigated. As disclosed supra, a 25 base pair shRNA HCVa-wt that targets the 3′ end of the HCV IRES, near the AUG translation start site (Table 2) was found to be effective for disrupting expression of HCV. To assess the ability of co-transfected shRNA constructs to interfere with the function of the IRES, a reporter construct (pHCV Dual Luciferase plasmid) in which firefly luciferase (fLuc) expression is dependent on the HCV IRES was used (
It was found that at a concentration of 1 nM, HCVa-wt caused 90% inhibition of HCV IRES-dependent luciferase expression in 293FT cells (Wang et al., 2005, supra). In subsequent experiments, 26 additional shRNAs targeting various regions of the HCV IRES were designed and tested (
All of the shRNAs (27 total, including HCVa-wt were assayed for activity as described in Wang, 2005. Briefly, human 293FT cells were co-transfected with pHCV Dual Luciferase® Reporter expression plasmid (Promega, Madison, Wis.), and a secreted alkaline phosphatase expression plasmid (pSEAP2, Clontech, Mountain View, Calif.) to control for efficiency of transfection and possible off-target effects), and shRNA. Results are shown in
It is desirable that a treatment for HCV be effective against mutated HCV. To determine the performance of the RNAs described herein in this regard (e.g., shRNAs targeting HCV IRES), and to address whether off-target effects are problematic, the sensitivity of selected shRNA directed against HCV IRES to point mutations in the target sequence was tested. For these experiments, a C340U mutation was introduced in the HCV IRES using the QuikChange® II Site-Directed Mutagenesis Kit (Stratagene, La Jolla, Calif.). Of the 27 shRNAs that were assayed, nine targeted the mutated region (
However, in the replicon system, shRNAs were surprisingly found to be SNP-sensitive (see below).
Example 7 Fine Mapping of Target SitesSix short 19 base pair shRNAs were designed to target a 44 nucleotide site near the 3′-terminus of the HCV IRES: three targeting nucleotides 331-353 and three targeting nucleotides 354-374. These molecules contained 10 nucleotide loops and 5′-GG and 3′-UU overhangs. Screening was performed to identify of non-overlapping candidates that were most effective among those sequences tested for inhibition of HCV expression. All six of the shRNAs tested were able to inhibit activity in the assay system. Three of the six shRNAs (sh52, sh53, and sh54) were identified as the most effective (
Additional experiments were performed to test how shRNA design affects gene silencing activity. HCVa-wt contained a 25 base pair stem with 5′-GG and 3′-UU overhangs (which may form non-canonical base pairs) and a ten nucleotide miR-23 loop. To test the importance of these parameters in the effectiveness for inhibition of expression, each of these parameters was separately varied (
Small hairpin RNAs lacking the 3′-UU terminal sequence (single-stranded overhang) had the same efficacy as the parental shRNA containing this feature. Control shRNA with full-length (25 nucleotide) sense but short (13 nucleotide) antisense regions had no activity, confirming the importance of duplex structure in the targeting sequence. shRNAs having a 3′-CC instead of 3′-UU terminus (allowing formation of 2 additional Watson-Crick base pairs) were more effective than HCVa-wt for decreasing HCV expression, but also affected SEAP levels. This nonspecific inhibition could be a consequence of the longer stem (27 base pairs), which can induce genes of the interferon responsive pathway and activate protein kinase R (PKR). Surprisingly, moving the loop to the other end of the shRNA resulted in a dramatic reduction of activity (15% inhibition at 1 nM instead of 90%). Possible explanations for this effect include a shift in the position of Dicer processing (and therefore the sequence targeted) as well as a different GC content at the 5′-end.
Because 19 base pair shRNAs were shown to display potency similar to 25 base pair shRNA, the effects of loop variations for 19 base pair shRNAs were examined. The results are shown in
Removal of the 3′-UU also resulted in dramatic reduction of activity for 19 base pair as well as 20 base pair (but not 25 base pair) shRNAs. Without committing to any particular theory, the 3′-UU and 5′-GG may form non-canonical base pairs and the overall size of shRNA duplex is important such that the duplex cannot be less than 21 base pairs for efficient processing. Thus, for 25 base pair shRNAs, neither the size of the loop nor the presence of a 3′-UU matters, whereas these parameters are important for potency of short, e.g., 19 base pair shRNAs. Without committing to any particular theory, it may be that Dicer binds at the termini prior to processing and does not “sense” the loop in the case of longer shRNAs, but for 19 base pair shRNAs the loop is “felt” as Dicer “measures” 19-21 nucleotides from the ends.
Accordingly, it was found that 19 base pair shRNAs can be as potent as 25 base pair shRNAs and 19 base pair siRNA. It was also found that some shRNA molecules were active at low concentrations of 0.1-1 nM (“hyper-potent shRNAs.” Other groups typically use 10-25-50-100 nM siRNA).
These data demonstrate that sequences that do not include a 3′-UU that are at least 22 base pairs, e.g., 23 base pairs, 24 base pairs, or 25 base pairs, can be suitable for inhibition of HCV expression. Similarly, loop size is not critical for shRNAs that are at least 22 base pairs in length.
Example 9 HCV Replicon SystemA number of shRNA and siRNA inhibitors along with negative controls were used to transfect human hepatocytes (AVA5, a derivative of the Huh7 cell line) stably expressing HCV subgenomic replicons (Blight et al., Science, 2000, 290:5498), and the amount of HCV expression was determined. A range of concentrations was tested and the concentration of RNA resulting in 50% inhibition (IC50 or EC50) was determined. IC50s from two independent experiments are shown side-by-side in
It is to be understood that while the invention has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.
REFERENCES
- 1. Sookoian, S. C., New therapies on the horizon for hepatitis C. Ann Hepatol, 2003. 2: 164-70.
- 2. Randall, G. and C. M. Rice, Interfering with hepatitis C virus RNA replication. Virus Res, 2004. 102: 19-25.
- 3. Radhakrishnan, S. K., T. J. Layden, and A. L. Gartel, RNA interference as a new strategy against viral hepatitis. Virology, 2004. 323: 173-81.
- 4. Hugle, T. and A. Cerny, Current therapy and new molecular approaches to antiviral treatment and prevention of hepatitis C. Rev Med Virol, 2003. 13: 361-71.
- 5. Blight, K. J., A. A. Kolykhalov, and C. M. Rice, Efficient initiation of HCV RNA replication in cell culture. Science, 2000. 290: 1972-4.
- 6. Pietschmann, T. and R. Bartenschlager, Tissue culture and animal models for hepatitis C virus. Clin Liver Dis, 2003. 7: 23-43.
- 7. Mercer, D. F., D. E. Schiller, J. F. Elliott, D. N. Douglas, C. Hao, A. Rinfret, W. R. Addison, K. P. Fischer, T. A. Churchill, J. R. Lakey, D. L. Tyrrell, and N. M. Kneteman, Hepatitis C virus replication in mice with chimeric human livers. Nat Med, 2001. 7: 927-33.
- 8. McCaffrey, A. P., L. Meuse, M. Karimi, C. H. Contag, and M. A. Kay, A potent and specific morpholino antisense inhibitor of hepatitis C translation in mice. Hepatology, 2003. 38: 503-8.
- 9. Lieberman, J., E. Song, S. K. Lee, and P. Shankar, Interfering with disease: opportunities and roadblocks to harnessing RNA interference. Trends Mol Med, 2003. 9: 397-403.
- 10. Layzer, J. M., A. P. McCaffrey, A. K. Tanner, Z. Huang, M. A. Kay, and B. A. Sullenger, In vivo activity of nuclease-resistant siRNAs. Rna, 2004. 10: 766-71.
- 11. Rossi, J. J. and G. J. Hannon, Unlocking the potential of the human genome with RNA interference. Nature, 2004. 431: 35-43.
- 12. McHutchison, J. G. and K. Patel, Future therapy of hepatitis C. Hepatology, 2002. 36: S245-52.
- 13. Wilson, J. A., S. Jayasena, A. Khvorova, S. Sabatinos, I. G. Rodrigue-Gervais, S. Arya, F. Sarangi, M. Harris-Brandts, S. Beaulieu, and C. D. Richardson, RNA interference blocks gene expression and RNA synthesis from hepatitis C replicons propagated in human liver cells. Proc Natl Acad Sci USA, 2003. 100: 2783-8.
- 14. Randall, G., A. Grakoui, and C. M. Rice, Clearance of replicating hepatitis C virus replicon RNAs in cell culture by small interfering RNAs. Proc Natl Acad Sci USA, 2003. 100: 235-40.
- 15. Yokota, T., N. Sakamoto, N. Enomoto, Y. Tanabe, M. Miyagishi, S. Maekawa, L. Yi, M. Kurosaki, K. Taira, M. Watanabe, and H. Mizusawa, Inhibition of intracellular hepatitis C virus replication by synthetic and vector-derived small interfering RNAs. EMBO Rep, 2003. 4: 602-8.
- 16. Kapadia, S. B., A. Brideau-Andersen, and F. V. Chisari, Interference of hepatitis C virus RNA replication by short interfering RNAs. Proc Natl Acad Sci USA, 2003. 100: 2014-8.
- 17. Kronke, J., R. Kittler, F. Buchholz, M. P. Windisch, T. Pietschmann, R. Bartenschlager, and M. Frese, Alternative approaches for efficient inhibition of hepatitis C virus RNA replication by small interfering RNAs. J Virol, 2004. 78: 3436-46.
- 18. Sen, A., R. Steele, A. K. Ghosh, A. Basu, R. Ray, and R. B. Ray, Inhibition of hepatitis C virus protein expression by RNA interference. Virus Res, 2003. 96: 27-35.
- 19. Zhang, J., O. Yamada, T. Sakamoto, H. Yoshida, T. Iwai, Y. Matsushita, H. Shimamura, H. Araki, and K. Shimotohno, Down-regulation of viral replication by adenoviral-mediated expression of siRNA against cellular cofactors for hepatitis C virus. Virology, 2004. 320: 135-43.
- 20. McCaffrey, A. P., L. Meuse, T. T. Pham, D. S. Conklin, G. J. Hannon, and M. A. Kay, RNA interference in adult mice. Nature, 2002. 418: 38-9.
- 21. Kawasaki, H. and K. Taira, Short hairpin type of dsRNAs that are controlled by tRNA(Val) promoter significantly induce RNAi-mediated gene silencing in the cytoplasm of human cells. Nucleic Acids Res, 2003. 31: 700-7.
- 22. Lagos-Quintana, M., R. Rauhut, W. Lendeckel, and T. Tuschl, Identification of novel genes coding for small expressed RNAs. Science, 2001. 294: 853-8.
- 23. Qin, X. F., D. S. An, I. S. Chen, and D. Baltimore, Inhibiting HIV-1 infection in human T cells by lentiviral-mediated delivery of small interfering RNA against CCR5. Proc Natl Acad Sci USA, 2003. 100: 183-8.
- 24. McCaffrey, A. P., K. Ohashi, L. Meuse, S. Shen, A. M. Lancaster, P. J. Lukaysky, P. Sarnow, and M. A. Kay, Determinants of hepatitis C translational initiation in vitro, in cultured cells and mice. Mol Ther, 2002. 5: 676-84.
- 25. Seo, M. Y., S. Abrignani, M. Houghton, and J. H. Han, Small interfering RNA-mediated inhibition of hepatitis C virus replication in the human hepatoma cell line Huh-7. J Virol, 2003. 77: 810-2.
- 26. Kim, D. H., M. Longo, Y. Han, P. Lundberg, E. Cantin, and J. J. Rossi, Interferon induction by siRNAs and ssRNAs synthesized by phage polymerase. Nat Biotechnol, 2004. 22: 321-5.
- 27. Bridge, A. J., S. Pebernard, A. Ducraux, A. L. Nicoulaz, and R. Iggo, Induction of an interferon response by RNAi vectors in mammalian cells. Nat Genet, 2003. 34: 263-4.
- 28. Fish, R. J. and E. K. Kruithof, Short-term cytotoxic effects and long-term instability of RNAi delivered using lentiviral vectors. BMC Mol Biol, 2004. 5: 9.
- 29. Han, J. H., V. Shyamala, K. H. Richman, M. J. Brauer, B. Irvine, M. S. Urdea, P. Tekamp-Olson, G. Kuo, Q. L. Choo, and M. Houghton, Characterization of the terminal regions of hepatitis C viral RNA: identification of conserved sequences in the 5′ untranslated region and poly(A) tails at the 3′ end. Proc Natl Acad Sci USA, 1991. 88: 1711-5.
- 30. Choo, Q. L., K. H. Richman, J. H. Han, K. Berger, C. Lee, C. Dong, C. Gallegos, D. Coit, R. Medina-Selby, P. J. Barr, and et al., Genetic organization and diversity of the hepatitis C virus. Proc Natl Acad Sci USA, 1991. 88: 2451-5.
- 31. Okamoto, H., S. Okada, Y. Sugiyama, K. Kurai, H. Iizuka, A. Machida, Y. Miyakawa, and M. Mayumi, Nucleotide sequence of the genomic RNA of hepatitis C virus isolated from a human carrier: comparison with reported isolates for conserved and divergent regions. J Gen Virol, 1991. 72 (Pt 11): 2697-704.
- 32. Bukh, J., R. H. Purcell, and R. H. Miller, Sequence analysis of the 5′ noncoding region of hepatitis C virus. Proc Natl Acad Sci USA, 1992. 89: 4942-6.
- 33. Rice, C. M., Virology: fresh assault on hepatitis C. Nature, 2003. 426: 129-31.
- 34. Zhang, H., R. Hanecak, V. Brown-Driver, R. Azad, B. Conklin, M. C. Fox, and K. P. Anderson, Antisense oligonucleotide inhibition of hepatitis C virus (HCV) gene expression in livers of mice infected with an HCV-vaccinia virus recombinant. Antimicrob Agents Chemother, 1999. 43: 347-53.
- 35. Jubin, R., N. E. Vantuno, J. S. Kieft, M. G. Murray, J. A. Doudna, J. Y. Lau, and B. M. Baroudy, Hepatitis C virus internal ribosome entry site (IRES) stem loop IIId contains a phylogenetically conserved GGG triplet essential for translation and IRES folding. J Virol, 2000. 74: 10430-7.
- 36. Seyhan A A, Vlassov A V, Ilves H, Egry L, Kaspar R L, Kazakov S A, Johnston B H. Complete, gene-specific siRNA libraries: production and expression in mammalian cells. RNA. 2005. 11:837-46.
- 37. Wang Q, Contag C H, Ilves H, Johnston B H, Kaspar R L. Small hairpin RNAs efficiently inhibit hepatitis C IRES-mediated gene expression in human tissue culture cells and a mouse model. Mol Ther. 2005. 12:562-8
Claims
1. An RNA sequence consisting of
- a. a first RNA sequence, wherein the first RNA sequence is SEQ ID NO:34, (SEQ ID NO:35), (SEQ ID NO:36), (SEQ ID NO:37), (SEQ ID NO:38), (SEQ ID NO:39), (SEQ ID NO:40), (SEQ ID NO:41), (SEQ ID NO:42), (SEQ ID NO:43), (SEQ ID NO:44), (SEQ ID NO:45), (SEQ ID NO:46), (SEQ ID NO:47), (SEQ ID NO:48), (SEQ ID NO:49), (SEQ ID NO:50), (SEQ ID NO:51); (SEQ ID NO:52), (SEQ ID NO:53), (SEQ ID NO:54), (SEQ ID NO:55), (SEQ ID NO:56), or a sequence that differs from a foregoing sequence by one, two, or three nucleotides;
- b. a second RNA sequence that is a complement of the first sequence;
- c. a loop sequence positioned between the first and second nucleic acid sequence, the loop sequence consisting of 4-10 nucleotides; and
- d. optionally, a two nucleotide overhang.
2.-17. (canceled)
18. A method of inhibiting expression or activity of a hepatitis C virus, the method comprising
- a. providing a cell that can express a hepatitis C virus; and
- b. contacting the cell with an RNA sequence of claim 1.
19-61. (canceled)
Type: Application
Filed: Jan 27, 2012
Publication Date: Aug 30, 2012
Applicant:
Inventors: ROGER L. KASPAR (SANTA CRUZ, CA), HEINI ILVES (SANTA CRUZ, CA), ATTILA A. SEYHAN (SAN JOSE, CA), ALEXANDER V. VLASSOV (SANTA CRUZ, CA), BRIAN H. JOHNSTON (SCOTTS VALLEY, CA)
Application Number: 13/360,442
International Classification: C12N 5/02 (20060101); C12N 15/113 (20100101);