MICRORNA AND USE THEREOF IN IDENTIFICATION OF B CELL MALIGNANCIES

Disclosed are nucleic acid sequences, including microRNA sequences and cDNA sequences, as well as vectors, DNA libraries, microarrays, and recombinant cells comprising the nucleic acid sequences described herein. Methods of determining the B cell stage from which a B cell malignancy is derived. Methods of identifying B cell malignancies are also provided. Methods of diagnosing B cell malignancies are provided. Such methods comprise, in certain embodiments, detecting one or more microRNAs or cDNAs as disclosed herein.

Skip to: Description  ·  Claims  · Patent History  ·  Patent History
Description
CROSS REFERENCE TO RELATED APPLICATIONS

This application is related to and claims the benefit of priority of U.S. Provisional Application Ser. No. 61/266,733, filed Dec. 4, 2009, which is incorporated herein by, reference.

STATEMENT OF GOVERNMENT SUPPORT

This invention was made with United States government support from the National Institutes of Health grant no. K12-CA-100639. The United States government has certain rights in this invention.

SEQUENCE LISTING

The sequence listing is filed with the application in electronic format only and is incorporated by reference herein. The sequence listing text file “WO_ASFILED_SequenceListing.txt” was created on Dec. 3, 2010, and is 262,254 bytes in size.

BACKGROUND

Naive B cells migrate through the circulation to lymphoid organs where they undergo the T cell-dependent germinal center reaction. Adaptive immunity is acquired as specific antigen-reactive germinal center B cells differentiate into the major effector B cells of the adaptive immune system: memory cells and plasma cells. See, e.g., FIG. 1A. Although the role of specific transcription factors in mature B cell differentiation has been examined (see Nutt et al. Nature. 1999; 401:556-562; Chang et al. Proc Natl Acad Sci USA. 1996; 93:6947-6952; Turner et al. Cell. 1994; 77:297-306; Shaffer et al., Immunity. 2004; 21:81-93; and Schebesta et al. Curr Opin Immunol. 2002; 14:216-223), mechanisms regulating such transcription factors during mature B cell differentiation are largely unknown.

Many malignancies derived from mature B cells are known and are believed to constitute the majority of leukemias and lymphomas. Such malignancies appear to reflect defined stages of normal B cell differentiation. Diagnosis of leukemias and lymphomas can be particularly difficult because of their shared lineage. These cancers frequently display overlapping morphologies, genetic abnormalities, and expression of surface markers, which can complicate the diagnosis. However, the distinction of these tumors is clinically important because there are important differences in the treatments and expected response to treatment. Thus methods that improve the accuracy of their diagnosis should provide to improved outcomes for these patients.

MicroRNAs are commonly 18-22 nucleotide-long RNA molecules that regulate expression of genes. There is an increasing recognition of the role of microRNAs in oncogenesis, lineage-selection, and immune cell function, including early B cell differentiation. See Calin et al. N Engl J Med. 2005; 353:1793-1801; O'Donnell et al. Nature. 2005; 435:839-843; Chen et al. Science. 2004; 303:83-86; Lim et al. Nature. 2005; 433:769-773; Li et al. Cell. 2007; 129:147-161; Xiao et al., Nat Immunol. 2008; 9:405-414; Baltimore et al. Nat Immunol. 2008; 9:839-845; and Ventura et al. Cell. 2008; 132:875-886. However, the full extent and function of microRNA expression during mature B cell differentiation and in B cell malignancies are not known.

Correct diagnosis of B cell malignancies is important from both a clinical standpoint and from the standpoint of setting appropriate patient expectations. A misdiagnosed B cell malignancy may lead to an inappropriate therapy, which can unnecessarily endanger the patient's life and/or be an ineffective treatment for the B cell malignancy. As an example, the diagnostic distinction of Burkitt lymphoma (BL) from diffuse large B cell lymphomas (DLBCLs) can be difficult because of overlapping morphology, immunophenotype and cytogenetics. Burkitt lymphoma tumors are molecularly distinct from DLBCL, however. The difficulty and importance of obtaining the correct diagnosis in BL was highlighted by the experience of a multicenter clinical trial, CALGB trial#925119, in which nearly half of the 100 patients with an assigned diagnosis of BL were found to have another diagnosis upon further pathology review.

If diagnosed and treated appropriately, nearly 80% of patients with BL can be cured with intensive (high dose) chemotherapy regimens. Thus, a misclassification of BL as DLBCL can result in a missed opportunity to cure the malignancy. On the other hand, misclassification of DLBCL as BL leads to unnecessarily morbidity from intensive chemotherapy regimens. Thus, methods that improve the diagnosis of BL, and other B cell malignancies, can provide better outcomes in patients.

DLBCLs can also be subclassified into two different B cell malignancies, activated B-cell (ABC) DLBCL and germinal center B cell like (GCB) DLBCL. There are at least two important clinical applications for the molecular sub-grouping of DLBCL patients. First, the prognostic information could inform the choices and expectations of patients and their physicians. Second, the important molecular differences in these subgroups form the basis of testing different targeted therapies in these patients. The possibility of a differential response to therapy among ABC and GCB DLBCLs is supported by data that suggest that the benefit of receiving a proteosome inhibitor, bortozemib, is predominantly limited to those patients who have ABC DLBCL. However, the clinical distinction of the subgroups of DLBCL using immunohistochemistry is difficult with current methods distinguishing GCB DLBCL from non-GCB DLBCL with limited success.

Mature B cell differentiation is important for the development of adaptive immunity. The process is also of interest because B cell malignancies are common and retain a number of features derived from their normal counterpart B cell subsets. Unlike other maturation pathways in the hematopoietic and other cell lineages, successive stages of mature B cells do not simply signify progressive differentiation away from the stem cell stage. Rather, each stage represents a specialized state with specific functions. Thus, germinal center (GC) cells interact with CD4 T cells and dendritic cells and undergo somatic hypermutation and Ig-heavy chain class-switching. On the other hand, plasma cells secrete immunoglobulin, while memory cells are primed to proliferate and differentiate into plasma cells upon repeat contact with antigen. The specialized functions demand a finely tuned program of gene regulation.

MicroRNAs represent a novel class of biomarkers that provide new opportunities for clinical translation. First, intact microRNAs can be isolated from tissues preserved using standard methods, such as formalin fixed, paraffin embedded (FFPE) tissue. Thus, microRNA-based biomarkers could be easy to translate to clinical use. Second, microRNAs can be readily assayed using real-time PCR and other methods available in conventional pathology.

SUMMARY

In an aspect the disclosure provides an isolated nucleic acid molecule having at least 80% sequence identity to any one of SEQ ID NOs: 763-1350 or 1565 or a complementary sequence thereof. Embodiments provide for sequence identity of at least 90% or 95%.

In an aspect the disclosure provides an isolated nucleic acid molecule comprises any one of SEQ ID NOs: 763-1350 or 1565 or a complementary sequence thereof. Embodiments provide for isolated nucleic acid molecules comprising a primary miRNA, a precursor miRNA, a mature miRNA, or a DNA molecule coding therefore. Embodiments further provide for a cDNA molecule comprising sequence that corresponds to a miRNA sequence of any one of SEQ ID NOs: 763-1350 or 1565.

Aspects of the disclosure provide compositions, pharmaceutical compositions, vectors, host cells, and DNA libraries comprising at least one nucleic acid molecule described herein.

In an aspect the disclosure provides a method of determining the B cell stage of a B cell malignancy in a subject comprising determining the level of expression of at least one microRNA in a sample comprising a B cell taken from the subject relative the level of expression of the at least one microRNA in a control sample, wherein the at least one microRNA is selected from the microRNAs listed in Table 4.

In an aspect the disclosure provides a method of identifying a B cell malignancy in a subject comprising determining the level of expression of at least one microRNA in a sample comprising a B cell taken from the subject relative the level of expression of the at least one microRNA in a control sample, wherein the at least one microRNA is selected from the microRNAs listed in Table 4.

In an aspect the disclosure provides a method of diagnosing a B cell malignancy in a subject comprising determining the level of expression of at least one microRNA in a sample comprising a B cell taken from the subject relative the level of expression of the at least one microRNA in a control sample, wherein the at least one microRNA is selected from the microRNAs listed in Table 4.

In an aspect the disclosure provides a method of identifying a B cell malignancy in a subject comprising determining the level of expression of at least one microRNA in a sample comprising a B cell taken from the subject relative the level of expression of the at least one microRNA in a control sample, wherein the at least one microRNA is selected from the microRNAs listed in any one of Tables 7 to 35.

In an aspect the disclosure provides a method of diagnosing a B cell malignancy in a subject comprising determining the level of expression of at least one microRNA in a sample comprising a B cell taken from the subject relative to the level of expression of the at least one microRNA in a control sample, wherein the at least one microRNA is selected from the microRNAs listed in any one of Tables 7 to 35.

Embodiments of these aspects provide for identification or diagnosis of a B cell malignancy selected from chronic lymphocytic leukemia, follicular lymphoma, Hodgkin's lymphoma, activated B-cell diffuse large B cell lymphoma (DLBCL), germinal center-like DLBCL, and Burkitt lymphoma.

In an aspect the disclosure provides a method of determining whether a B cell malignancy in a sample is Burkitt lymphoma, activated B cell-like diffuse large B cell lymphoma (DLBCL), or germinal center-like DLBCL, comprising determining the level of expression of at least one microRNA in the sample relative to the level of expression of the at least one microRNA in a control sample, wherein the at least one microRNA is selected from the microRNAs listed in Table 10, column “BL miRNA list”; Table 14, column “BL High”; Table 11; Table 14, column “ABC High”; Table 10, column “GCB miRNA list”; Table 14, column “GCB High”; Table 32, or Table 35.

In an aspect the disclosure provides a method of determining whether a B cell malignancy in a sample is Burkitt lymphoma, activated B cell-like diffuse large B cell lymphoma (DLBCL), or germinal center-like DLBCL, comprising determining the level of expression of at least one microRNA in the sample relative to the level of expression of the at least one microRNA in a control sample, wherein the at least one microRNA is selected from the microRNAs listed in at least one column labeled “GCBvsBL” or “GCBvsABC” in Table 7 or “ABCvsBL” in Table 8.

In an aspect the disclosure provides a method of determining whether a B cell malignancy in a sample is activated B cell-like diffuse large B cell lymphoma (DLBCL), or germinal center-like DLBCL, comprising determining the level of expression of at least one microRNA in the sample relative to the level of expression of the at least one microRNA in a control sample, wherein the at least one microRNA is selected from the microRNAs listed in Table 35.

In an aspect the disclosure provides a microarray comprising miRNA-specific probe oligonucleotides wherein at least one miRNA-specific probe oligonucleotide is specific for a sequence of SEQ ID NOs: 763-1350 or 1565, or any combination thereof.

In an aspect the disclosure provides a kit comprising at least one primer sequence that can detect any one of SEQ ID NOs: 763-1350 or 1565, or a combination thereof.

In an aspect the disclosure provides a kit comprising at least one isolated nucleic acid molecule having a sequence of any one of SEQ ID NOs: 1351-1564.

In an aspect, the disclosure provides a method of identifying a B cell malignancy comprising determining the level of expression of at least one microRNA selected from the microRNAs listed in Table 4. In certain embodiments, a method comprises determining the level of expression of at least one microRNA selected from the microRNAs listed in Tables 7-35.

Other aspects and embodiments will be apparent to one of skill in the art in light of the following detailed description.

DESCRIPTION OF THE FIGURES

FIG. 1 shows that mature B cell subsets demonstrate distinct microRNA profiles. FIG. 1A is a diagram showing the overall schema of mature B cell differentiation. FIG. 1B shows selection of B cell subsets using flow cytometry. FIG. 1C shows the distinction between naive and memory B cells based on IgD and CD27 expression using flow cytometry. FIG. 1D shows relative expression of microRNA in the naive to germinal center B cell transition. FIG. 1E shows relative expression of mRNA in the naive to germinal center B cell transition. FIG. 1F shows relative expression of microRNA in the germinal center B cell to plasma cell transition. FIG. 1G shows relative expression of mRNA in the germinal center B cell to plasma cell transition. FIG. 1H shows relative expression of microRNA in the germinal center B cell to memory B cell transition. FIG. 1I shows relative expression of mRNA in the germinal center B cell to memory B cell transition. In FIGS. 1D, 1F, and 1H, miRNAs that were, on average, at least 2-fold differentially expressed at a false discovery rate of less than 5% are shown according to the color scale. In Figures and 1E, 1G, and 1I, mRNAs that were, on average, at least 2-fold differentially expressed at a false discovery rate of less than 1% are shown according to the color scale. FIG. 1J shows that expression of certain microRNA processing genes, DGCR8, DICER1, EIF2C2, DROSHA, and XP05 is unchanged among the B cell subsets (P>0.1 in all cases).

FIG. 2 shows experimental validation of the interaction of miR-223, which is expressed highly in naive and memory B cells compared to germinal center B cells, and targets the transcription factor LM02. FIG. 2A shows base-pairing of the 3′UTR of the LM02 gene with nucleotides 1-8 of miR-223. This 8-mer is highly conserved across a number of species and serves as a potential binding site for miR-223. FIG. 2B shows the effects of over-expression of miR-223 in germinal center lymphoma-derived BJAB cells in 3 separate experiments. FIG. 2C shows the relative LM02 protein expression from a representative experiment (from 3 replicates) transfecting a scrambled control versus a precursor for miR-223 in BJAB cells. FIG. 2D shows average expression of LM02 relative to Actin over three Western blots of BJAB cells transfected with a scrambled control versus a precursor for miR-223. FIG. 2E shows luciferase activity in BJAB cells transfected with a vector comprising either a luciferase gene coupled to the 3 ′UTR of the LM02 gene or a luciferase gene coupled to the 3 ′UTR of the LM02 gene with the miR-223 binding site mutated, and cotransfected with miR-223.

FIG. 3 shows experimental validation of the interaction of miR-9 and miR-30, which are expressed highly in germinal center B cells compared to plasma cells and target the transcription factor PRDM1. FIG. 3A shows base-pairing of the 3′UTR of the PRDM1 gene with the 5′ seed region of miR-9 and the miR-30 family. FIG. 3B shows the effects of over-expressing miR-9 and 2 members of the miR-30 family, miR-30b and miR-30d, in plasma cell myeloma-derived U266 cells in 3 separate experiments. FIG. 3C shows the relative PRDM1 protein expression from a representative experiment (from 3 replicates) transfecting a scrambled control versus a precursor for miR-9, miR-30b, or miR-30d in U266 cells. FIG. 3D shows the average expression of PRDM1 relative to Actin over three Western blots of U266 cells transfected with a scrambled control versus a precursor for miR-9, miR-30b, or miR-30d. (P<0.05 for miR-30b and miR-30d, P=0.08 for miR-9.) FIG. 3E shows repression of luciferase activity from the PRDM1 3′UTR construct by overexpression of miR-9, miR-30b, and miR-30d wild-type and mutant sequences.

FIG. 4 shows that expression of microRNAs in normal B cells is conserved in certain B cell malignancies. FIG. 4A shows lineage prediction of both IgV mutated and unmutated chronic lymphocytic leukemia, germinal center B cell derived DLBCL, and Burkitt lymphoma based on differential expression of microRNAs in normal naïve B cells and germinal center B cells (microRNAs depicted in FIG. 1D). FIG. 4B shows miRNAs that were found to be differentially expressed (P<0.05) in malignant cells and normal cells as discussed in Example 5. FIG. 4C shows cloning frequency of miRNAs in unselected mature B cells (N=3) and certain B cell malignancies (N=42) from a previously published study (“sequencing data”), as discussed in Example 5. FIG. 4D shows differentially expressed miRNAs that distinguish Burkitt lymphoma, activated B cell-like (ABC) diffuse large B cell lymphoma (DLBCL), germinal center-like DLBCL (GCB DLBCL), and chronic lymphocytic leukemia. Predictor miRNAs from each pair-wise comparison that distinguish each entity are shown in the boxes.

FIG. 5 shows the distribution of miRNAs present in B-cell subsets.

FIG. 6 shows that certain microRNA targets are expressed at lower levels. FIG. 6A shows density plots of the expression frequency of predicted mRNA targets of miRNAs expressed highly in germinal center B cells compared to naive cells. FIG. 6B shows density plots of the expression frequency of predicted mRNA targets of miRNAs expressed highly in germinal center B cells compared to plasma cells. FIG. 6C shows density plots of the expression frequency of predicted mRNA targets of miRNAs expressed highly in the germinal center B cells compared to memory B cells.

FIG. 7 shows that differentially expressed transcription factors are frequently microRNA targets. In FIG. 7A, the left panel indicates the proportion of transcription factors that are differentially expressed in the naive to germinal center B-cell transition that are also predicted targets of differentially expressed miRNAs. The right panel indicates the proportion of transcription factors that are not differentially expressed and also are predicted targets of differentially expressed miRNA in that stage-transition. The p-value indicates the results of a chi-squared test for the enrichment of predicted miRNA targets among the differentially expressed transcription factors. FIG. 7B shows a similar analysis of the germinal center to plasma cell transition. FIG. 7C shows a similar analysis of the germinal center to memory cell transition.

FIG. 8 shows that Mybl transcript levels decrease with miR-223 overexpression. FIG. 8A shows base-pairing of the 3′UTR of the MYBL1 gene with nucleotides 2-8 of miR-223. This 7-mer is highly conserved across a number of species and serves as a potential binding site for miR-223. FIG. 8B shows the effects of over-expression of miR-223 in germinal center lymphoma-derived BJAB cells in 3 separate experiments.

FIG. 9 shows the specificity of real-time PCR probes for members of the miR-30 family.

FIG. 10 shows the results of leave one out cross validation applied to the predictors for Burkitt lymphoma, chronic lymphocytic leukemia, activated B-cell diffuse large B-cell lymphoma, and germinal center B-cell DLBCL.

FIG. 11 shows differentially expressed miRNAs that distinguish activated B cell-like diffuse large B cell lymphoma (DLBCL), germinal center-like DLBCL (GCB DLBCL), Burkitt lymphoma, chronic lymphocytic leukemia, follicular lymphoma, and Hodgkin's lymphoma. Predictor miRNAs from each pair-wise comparison that distinguish each entity are shown in the boxes.

DETAILED DESCRIPTION

All patent and non-patent literature references that are cited herein are incorporated herein by reference in their entirety.

In a general sense, the disclosure relates to nucleic acid sequences, such as microRNAs (miRNA), as well as to the identification and analysis of microRNA expression levels and/or patterns in B cells. Through concomitant microRNA and mRNA profiling, the inventors have identified regulatory roles for microRNAs at each stage in mature B cell differentiation. This provides methods identifying microRNA-mediated regulation of oncogenes and key transcription factors in B cell differentiation. This work establishes the landscape of normal microRNA expression in mature B cells and its role in regulating normal B cell differentiation. Further, our work demonstrates that in contrast to the described down-regulation in other malignancies, stage-specific microRNAs are retained in B cell malignancies. The lineage of common B cell malignancies can be predicted based upon miRNA profiles of normal B cells, pointing to a role for microRNAs in the maintenance of mature B cell phenotypes in normal and malignant B cells.

In an aspect, the disclosure relates to an isolated nucleic acid molecule comprising: (a) a nucleotide sequence as shown in Table 32; (b) a nucleotide sequence which is the complement of (a), (c) a nucleotide sequence comprising a sequence identity of at least 80%, (e.g., 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or at least 99%), to a sequence of (a) or (b) and/or (d) a nucleotide sequence which hybridizes under stringent conditions to a sequence of (a), (b) and/or (c). In some embodiments, the identity of sequence (c) to a sequence of (a) or (b) is at least 90%. In other embodiments, the identity of sequence (c) to a sequence of (a) or (b) at least 95%. The percent identity can be calculated by any routine method used by one of skill in the art such as, for example, the methods described herein.

In embodiments, the isolated nucleic acid molecule relates to a miRNA molecule and analogs thereof, a miRNA precursor molecule, or a primary miRNA molecule, as well as to DNA molecules encoding miRNA, miRNA precursor, or primary miRNA molecules. Accordingly, in such embodiments, the isolated nucleic acid molecule can function as a miRNA molecule under suitable conditions. Suitable conditions include, but are not limited to, various buffer systems that approximate physiologically relevant ionic concentrations and pHs, as well as physiological conditions.

In some embodiments, the nucleic acid molecule comprises a sequence that hybridizes to a nucleotide sequence as shown in Table 32, a complementary sequence thereof or a nucleic acid molecule having at least 80% sequence identity under stringent hybridization conditions. The basic parameters affecting the choice of hybridization conditions and guidance for devising suitable conditions are set forth by Sambrook, et al. (See, 1989, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.; and Current Protocols in Molecular Biology, 1995, Ausubel et al., eds., John Wiley & Sons, Inc.), and can be readily determined by those of ordinary skill in the art based on, for example, the length and/or base composition of the DNA. Generally, stringent salt concentration will ordinarily be less than about 750 mM NaCl and 75 mM trisodium citrate, or less than about 500 mM NaCl and 50 mM trisodium citrate, or even less than about 250 mM NaCl and 25 mM trisodium citrate. High stringency hybridization conditions can be obtained by adding an amount of organic solvent (e.g., at least about 35% to about 50% formamide). Stringent temperature conditions will ordinarily include temperatures of at least about 30° C., (e.g., at least about 37° C., 42° C., 45° C., 50° C., or 55° C.). Varying additional parameters, such as hybridization time, the concentration of detergent (e.g., 0.1-1.0% sodium dodecyl sulfate (SDS)), and the inclusion or exclusion of carrier DNA (e.g., about 100-200 μg/ml denatured salmon sperm DNA (ssDNA)), are well known to those skilled in the art. Stringent hybridization conditions are known in the art and include non-limiting examples such as, washing for 1 hr in 300 mM NaCl, 30 mM trisodium citrate and 0.1% SDS at 45-50° C.; washing for 1 h in 300 mM NaCl, 30 mM trisodium citrate and 0.1% SDS at 45-50° C.; in 500 mM NaCl, 50 mM trisodium citrate, 1% SDS, 35% formamide, and 100 μg/ml denatured salmon sperm DNA (ssDNA) at 37° C.; or in 250 mM NaCl, 25 mM trisodium citrate, 1% SDS, 50% formamide, and 200 μg/ml ssDNA at 42° C. Useful variations on these conditions will be readily apparent to those skilled in the art.

The isolated nucleic acid molecules provided herein suitably have a length of from about 18 to about 100 nucleotides. In embodiments wherein the isolated nucleic acid molecules are miRNAs, the lengths of the miRNAs are suitably in an expected range for the particular type of miRNA molecule. For example, mature miRNAs are typically from about 15 to about 28 nucleotides in length, and suitably have a length of about 19 to about 24 nucleotides (e.g., 19, 20, 21, 22, 23, or 24 nucleotides). Precursor miRNAs typically comprise the mature miRNA sequence and contain a stem-loop structure, suitably of length of about 50 to about 90 nucleotides (e.g., 50, 55, 60, 65, 70, 75, 80, 85, or 90 nucleotides). Primary miRNAs (e.g., a primary transcript comprising a precursor miRNA) can suitably have a length of greater than 100 nucleotides.

The nucleic acid molecules can be provided in either a single-stranded or double-stranded form. Typically, a miRNA as such is identified as a single-stranded molecule, while the precursor miRNA is typically at least partially self-complementary and capable of forming double-stranded portions, e.g. stem- and loop-structures. DNA molecules encoding the miRNA and miRNA precursor molecules (e.g., expression vectors, cloning vectors, and the like) are typically double-stranded. The individual nucleic acids that comprise the isolated nucleic acid molecules can be selected from RNA, DNA, or nucleic acid analog molecules, such as chemically modified sugar (e.g., 2′-modified (2′-F, 2′-OMe, etc.) or backbone (e.g., phosphorothioates), or cap (e.g., 5′- and/or 3′-abasic groups) moieties of ribonucleotides or deoxyribonucleotides. Other nucleic acid analogs, such as peptide nucleic acids (PNA) or locked nucleic acids (LNA), are also suitable in various embodiments described herein. In some embodiments the nucleic acid molecules can comprise any combination of nucleic acid analog(s).

While many of the nucleic acid molecules in the Tables are identified as RNA sequences, e.g., miRNAs, the disclosure of those sequences should be understood to encompass the corresponding DNA (e.g., cDNA) sequences, wherein the uracil (U) nucleotides of the disclosed RNAs are substituted by thymidine (T) nucleotides in the corresponding DNA. One of skill in the art is able to generate such DNA sequences (e.g., cDNA) through routine microbiological techniques known in the art such as, for example, reverse transcription using methods that incorporate the reverse transcriptase enzyme.

In another aspect, the disclosure provides a recombinant expression vector comprising a recombinant nucleic acid sequence operatively linked to an expression control sequence, wherein expression of the recombinant nucleic acid sequence provides a miRNA sequence, a precursor miRNA sequence, or a primary miRNA sequence as described herein. The resulting sequence (e.g., primary or precursor miRNAs) can optionally be further processed to provide the miRNA sequence. In embodiments, the recombinant expression vector comprises at least one sequence in Table 32. Any suitable expression vector can be used such as, for example, a DNA vector (e.g., viral vector, plasmid, etc.). In some embodiments the expression vector is selected for expression in a eukaryotic cell such as, for example, a mammalian cell. One of skill in the art will be able to select an appropriate vector based on the particular application and/or expression system to be employed.

Thus, embodiments provide nucleic acid constructs in the form of plasmids, vectors, transcription or expression cassettes which comprise at least one nucleotide sequence encoding a miRNA described herein, or fragments thereof, and a suitable promoter region. Suitable vectors can be chosen or constructed, which contain appropriate regulatory sequences, such as promoter sequences, terminator sequences, polyadenylation sequences, enhancer sequences, marker genes and other sequences as desired. Vectors can be plasmids, phage (e.g. phage, or phagemid) or viral (e.g. lentivirus, adenovirus, AAV) or any other appropriate vector. For further details see, for example, Molecular Cloning: a Laboratory Manual: 2nd edition, Sambrook et al., 1989, Cold Spring Harbor Laboratory Press.

Relatedness of Nucleic Acid Molecules/Sequences

The term “identity” refers to a relationship between the sequences of two or more two or more nucleic acid molecules, as determined by comparing the sequences. In the art, “identity” also means the degree of sequence relatedness between amino acid or nucleic acid molecule sequences, as the case may be, as determined by the match between strings of nucleotide or amino acid sequences. “Identity” measures the percent of identical matches between two or more sequences with gap alignments addressed by a particular mathematical model or computer programs (i.e., “algorithms”).

Identity of related nucleic acid molecules can be readily calculated by known methods, including but not limited to those described in Computational Molecular Biology, Lesk, A. M., ed., Oxford University Press, New York, 1988; Biocomputing: Informatics and Genome Projects, Smith, D. W., ed., Academic Press, New York, 19933; Computer Analysis of Sequence Data, Part 1, Griffin, A. M., and Griffin, H. G., eds., Humana Press, New Jersey, 1994; Sequence Analysis in Molecular Biology, von Heinje, G., Academic Press, 1987; and Sequence Analysis Primer, Gribskov, M. and Devereux, J., eds., M. Stockton Press, New York, 1991; and Carillo, H., and Lipman, D., SIAM J. Applied Math., 48:1073 (1988).

Non-limiting methods for determining identity are designed to give the largest match between the sequences tested. Methods to determine identity are codified in publicly available computer programs. Preferred computer program methods to determine identity between two sequences include, but are not limited to, the GCG program package, including GAP (Devereux, et al., Nucleic Acids Research 12:387 [1984]; Genetics Computer Group, University of Wisconsin, Madison, Wis.), BLASTN, and FASTA (Atschul et al., J. Molec. Biol. 215:403-410 [1990]). The BLAST X program is publicly available from the National Center for Biotechnology Information (NCBI) and other sources (BLAST Manual, Altschul] et al., NCB NLM NIH Bethesda, Md. 20894; Altschul et al., J. Mol. Biol. 215:403-410 [1990]). The well known Smith Waterman algorithm may also be used to determine identity.

Exemplary parameters for nucleic acid molecule sequence comparison include the following:

Algorithm: Needleman and Wunsch, J. Mol Biol. 48:443-453 (1970)

Comparison matrix: matches=+10, mismatch=0

Gap Penalty: 50

Gap Length Penalty: 3

The GAP program is also useful with the above parameters. The aforementioned parameters are the default parameters for nucleic acid molecule comparisons.

Other exemplary algorithms, gap opening penalties, gap extension penalties, comparison matrices, thresholds of similarity, etc. can be used by those of skill in the art, including those set forth in the Program Manual, Wisconsin Package, Version 9, September 1997. The particular choices to be made will depend on the specific comparison to be made, such as DNA to DNA or RNA to DNA; and additionally, whether the comparison is between given pairs of sequences (in which case GAP or BestFit are generally preferred) or between one sequence and a large database of sequences (in which case FASTA or BLASTA are preferred).

In an aspect, the disclosure provides a vector comprising the isolated polynucleotide as described herein such as, for example one or more of SEQ ID NOs 773-1046 or 1450-1542. In embodiments, the vector can be any type of vector that finds use as a vehicle to transfer foreign genetic material into a cell. Non-limiting examples of vectors include plasmids, viral vectors (e.g., derived from lentivirus, adenovirus, adeno-associated virus (AAV), retrovirus, etc.), bacteriophage, cosmids, and artificial chromosomes. In embodiments, the vector can be an expression (or expression constructs) for driving expression of the polynucleotide in a target cell. Vectors and methods for inserting them into a target cell are known in the art [See, e.g., Sambrook et al., 1989].

In an aspect, the disclosure provides recombinant cells that comprise the vectors and/or polynucleotides described herein. The cells can be any cell suitable as a host for recombinant nucleic acid molecules, and selected based on well known techniques. Techniques for generating and maintaining recombinant cells are known in the art, such as those described in Sambrook et al., 1989.

The term “B cell malignancy,” as used herein, refers to a malignancy derived from any stage of B cell, including, but not limited to, naïve cells, germinal center cells, memory B cells, and plasma cells. Examples of B cell malignancies include, but are not limited to, mantle cell lymphoma, follicular lymphoma, Hodgkin's lymphoma, Burkitt lymphoma, germinal center B-cell like diffuse large B cell lymphoma (DLBCL), chronic lymphocytic leukemia, small lymphocytic lymphoma, lymphoplasmacytic lymphoma, multiple myeloma, and activated B-cell like DLBCL.

In an aspect, the disclosure provides a method of distinguishing B cell malignancies on the basis of the B-cell origin. In certain embodiments, methods of diagnosing B cell malignancies on the basis of the B-cell origin are provided. In certain such embodiments, a B cell malignancy is determined to be derived from a particular B-cell stage. The B-cell origin of a B cell malignancy may be determined, in certain embodiments, by detecting one or more microRNAs that can be used to distinguish B-cell stages. Certain exemplary B-cell stages include, but are not limited to, naïve cells, germinal center cells, memory B cells, and plasma cells. Certain exemplary microRNAs that can be used to distinguish B-cell stages are shown in Table 4. In various embodiments, the method comprises detecting at least one, at least two, at least five, at least 10, at least 20, at least 30, at least 50, at least 75, or at least 100 microRNAs.

In certain embodiments, a panel of microRNAs is selected that will allow determination of the B cell stage from which a B cell malignancy is derived. For example, in certain embodiments, two or more microRNAs from Table 4 are selected such that detection of the levels of those microRNAs in a B cell malignancy will indicate whether the B cell malignancy is derived from naïve, germinal center, plasma, or memory B cells. In various embodiments, the panel of microRNAs comprises at least one, at least two, at least five, at least 10, at least 20, at least 30, at least 50, at least 75, or at least 100 microRNAs from Table 4. One skilled in the art can select a suitable panel of microRNAs, including one or more microRNAs from Table 4, according to the intended use of the panel.

As described throughout the disclosure, the methods herein can include detecting one or a plurality of miRNAs. When the term “at least” is used in association with a number (e.g., “at least 20”) that term will be understood to include 20 as well as optionally any integer after 20 and up to and including the total number of microRNAs disclosed herein.

In some embodiments, a B cell malignancy derived from naïve cells is mantle cell lymphoma. In other embodiments, a B cell malignancy derived from germinal center cells includes, but is not limited to, follicular lymphoma, Hodgkin's lymphoma, Burkitt lymphoma, or germinal center B-cell like diffuse large B cell lymphoma (DLBCL). In other embodiments, a B cell malignancy derived from memory B cells includes, but is not limited to, chronic lymphocytic leukemia or small lymphocytic lymphoma. In some embodiments, a B cell malignancy derived from plasma cells includes, but is not limited to, multiple myeloma or activated B-cell DLBCL.

Certain B cell malignancies can be difficult to distinguish using current methodologies. In extreme cases, almost any B cell malignancy can be confused with another. As illustrative examples, Burkitt lymphoma and DLBCLs are often confused. Similarly, mantle cell lymphoma and small lymphocytic lymphoma can also be confused. Burkitt lymphoma and germinal center DLBCL are both derived from germinal center cells, while activated B-cell DLBCL is derived from plasma cells. Thus, if a B cell malignancy appears to be Burkitt lymphoma or a DLBCL, in certain embodiments, microRNA analysis can be used to narrow down the B cell malignancy to either a germinal center cell-derived B cell malignancy or a plasma cell-derived B cell malignancy. If the B cell malignancy is plasma-cell derived, then it may be activated B-cell DLBCL.

Thus, in certain embodiments, when the identity of a particular B cell malignancy has been narrowed down to two or more possible B cell malignancies, and at least two of those B cell malignancies are derived from different B cell stages, microRNAs that distinguish certain B cell stages can be used to further narrow down the identity of the B cell malignancy. In certain embodiments, microRNAs that distinguish certain B cell stages can be used to identify the B cell malignancy. One or more such microRNAs can be selected, in certain embodiments, from the microRNAs in Table 4. One skilled in the art can select a suitable set of microRNAs, including at least one microRNA from Table 4, for distinguishing particular B cell stages.

In an aspect, the disclosure provides a method of identifying a B cell malignancy comprising detecting one or a plurality of microRNAs. In certain embodiments, the method can provide a diagnosis of a B cell malignancy. In certain embodiments, one or more microRNAs that are characteristic of a particular B cell malignancy are used to identify the B cell malignancy. In certain embodiments, the identity of the B cell malignancy is first narrowed down to a list of two or more particular B cell malignancies using, for example, tumor morphology and/or immunohistochemistry and/or microRNA detection, e.g., to determine the B cell stage from which the tumor is derived. Certain exemplary microRNAs that can be used to identify B cell malignancies are shown in the Tables (e.g., Tables 7-35).

In certain embodiments, methods of identifying B cell malignancies comprise detecting one or more microRNAs from one or more of Tables 7 to 15, and Appendix B, Tables 16 to 30. That is, in certain embodiments, a panel of microRNAs is selected that will identify a B cell malignancy as being one of a particular selection of B cell malignancies. As a non-limiting example, a panel of microRNAs can be designed to identify a B cell malignancy as one of Burkitt lymphoma, ABC DLBCL, or GCB DLBCL. In certain such embodiments, the panel of microRNAs comprises at least one microRNA from Table 10, column “BL miRNA list” and/or Table 14, column “BL High”; at least one microRNA from Table 11 and/or Table 14, column “ABC High”; and at least one microRNA from Table 10, column “GCB miRNA list” and/or Table 14, column “GCB High”.

When other methods indicate a particular identity for a B cell malignancy, in certain embodiments, microRNAs can be used to confirm that identification. Thus, for example, if a B cell malignancy is believed to be a Burkitt lymphoma, that identification can be confirmed by determining the expression level of one or more microRNAs listed in Table 10, column “BL miRNA list” and/or Table 14, column “BL High”. Similarly, if a B cell malignancy is believed to be ABC DLBCL, that identification can be confirmed by determining the expression level of one or more microRNAs listed in Table 11 and/or Table 14, column “ABC High”. If a B cell malignancy is believed to be GCB DLBCL, that identification can be confirmed by determining the expression level of one or more microRNAs listed in Table 10, column “GCB miRNA list” and/or Table 14, column “GCB High”. If a B cell malignancy is believed to be chronic lymphocytic leukemia, that identification can be confirmed by determining the expression level of one or more microRNAs listed in Table 12 and/or Table 15, column “CLL High”. If a B cell malignancy is believed to be Hodgkin's lymphoma, that identification can be confirmed by determining the expression level of one or more microRNAs listed in Table 13 and/or Table 15, column “HL High”. If a B cell malignancy is believed to be follicular lymphoma, that identification can be confirmed by determining the expression level of one or more microRNAs listed in Table 10, column “FL miRNA list” and/or Table 15, column “FL High”.

In certain embodiments, when the identity of a B cell malignancy has been narrowed down to two B cell malignancies selected from Burkitt lymphoma, GCB DLBCL, ABC DLBCL, chronic lymphocytic leukemia, follicular lymphoma, and Hodgkin's lymphoma, the identity of the B cell malignancy can be determined by detecting one or more microRNAs from Tables 16 to 30.

As discussed in the Examples, the miRNAs described herein as differentially expressed in a B cell malignancy have been identified with high confidence, and thus, identification of one miRNA is adequate to perform the methods of identification and diagnosis disclosed herein. Accordingly, in various embodiments, the methods can comprise detecting at least one, at least two, at least five, at least 10, at least 20, at least 30, or at least 50 microRNAs in order to narrow down the identity of, or identify, a B cell malignancy.

As noted above, the treatment regimens and prognoses for the various B cell malignancies can differ significantly. Thus, determining the correct identity and/or origin of a B cell malignancy can be important for selecting an effective therapy and/or setting appropriate patient expectations.

B cell malignancy samples may be obtained and prepared using methods known in the art. One skilled in the art can select an appropriate method of obtaining a B cell malignancy sample according to various parameters, such as the age, size, medical history, and/or identity of the patient. One skilled in the art can select an appropriate method of preparing a B cell malignancy sample for analysis according to the B cell malignancy sample source, size, quality, and/or intended use. For example, in certain embodiments, a B cell malignancy sample is prepared in a manner that preserves microRNAs in the sample as much as practicable under the circumstances.

MicroRNAs can be detected using any method known in the art. Exemplary methods of detecting microRNAs include, but are not limited to, hybridization-based methods and amplification-based methods. Certain exemplary detection methods include, but are not limited to, arrays (including microarrays and bead-based arrays), in situ hybridization, Northern blotting, TaqMan probes, RT-PCR, real-time PCR, and direct sequencing. One skilled in the art can select a suitable detection method according to the sample source, size, quality, and/or particular application.

In certain embodiments, real-time PCR is employed to determine the expression level of a microRNA. In some embodiments a miRNA is considered present in a subpopulation if the cycling time (CT) is less than 36 in all three biological replicates, and a CT greater than 36 is undetected.

In certain embodiments, the expression level of a microRNA in a sample is determined relative to a control sample. A control sample may be selected, in various embodiments, because it is expected to have either high or low expression of the microRNA.

In certain embodiments, the expression level of a microRNA may be normalized to the expression level of a polynucleotide that is expected to be expressed at similar levels in several different cell types and/or at constant levels in the cell type being analyzed.

In certain embodiments, an identified miRNA from Tables 7-35 is used to distinguish one of the six exemplified B cell malignancies from the other malignancies. A “high” and a “low” in Tables 10 to 13 refer to at least a 2-fold difference in the expression of the identified miRNA when one lymphoma is compared to other lymphomas and benign lymph nodes.

In embodiments, mRNA levels can be profiled by using a microarray. In some embodiments, array elements with median signal intensities of less than 7 log 2 units across samples are removed from analysis. In embodiments, a gene is considered for further analysis if it is on-average 2-fold or higher differentially expressed in a binary comparison of B cell subsets and expressed in at least one of the two B cell subsets being compared.

In an embodiment, the level of at least one miRNA is measured by reverse transcribing RNA from a test sample obtained from a subject to provide a set of target oligodeoxynucleotides, hybridizing the target oligodeoxynucleotides to one or more miRNA-specific probe oligonucleotides (e.g., a microarray that comprises miRNA-specific probe oligonucleotides) to provide a hybridization profile for the test sample, and comparing the test sample hybridization profile to a hybridization profile generated from a control sample. An alteration in the signal of at least one miRNA in the test sample relative to the control sample is indicative of the subject either having, or being at risk for developing, a B-cell malignancy. In an embodiment, the signal of at least one miRNA is upregulated, relative to the signal generated from the control sample. In another embodiment, the signal of at least one miRNA is down-regulated, relative to the signal generated from the control sample. In some embodiments, the microarray comprises miRNA-specific probe oligonucleotides for a substantial portion of all known human miRNAs. In a further embodiment, the microarray comprises miRNA-specific probe oligonucleotides for one or more miRNAs selected from the group consisting of SEQ ID NOs: 763-1350, or 1565 and any combination thereof.

The microarray can be prepared from gene-specific oligonucleotide probes generated from known miRNA sequences. The array may contain two different oligonucleotide probes for each miRNA, one containing the active, mature sequence and the other being specific for the precursor of the miRNA. The array may also contain controls, such as one or more mouse sequences differing from human orthologs by only a few bases, which can serve as controls for hybridization stringency conditions. tRNAs and other RNAs (e.g., rRNAs, mRNAs) from both species may also be printed on the microchip, providing an internal, relatively stable, positive control for specific hybridization. One or more appropriate controls for non-specific hybridization may also be included on the microchip. For this purpose, sequences are selected based upon the absence of any homology with any known miRNAs.

The microarray may be fabricated using techniques known in the art. For example, probe oligonucleotides of an appropriate length, e.g., 40 nucleotides, are 5′-amine modified at position C6 and printed using commercially available microarray systems. Labeled cDNA corresponding to the target RNA sequence(s) is prepared by reverse transcribing the target RNA with labeled primer. Following first strand synthesis, the RNA/DNA hybrids are denatured to degrade the RNA templates. The labeled target cDNAs thus prepared are then hybridized to the microarray chip under typical hybridizing conditions. At positions on the array where the immobilized probe DNA recognizes a complementary target cDNA in the sample, hybridization occurs. The labeled target cDNA marks the exact position on the array where binding occurs, allowing automatic detection and quantification. The output consists of a list of hybridization events, indicating the relative abundance of specific cDNA sequences, and therefore the relative abundance of the corresponding complementary miRNAs, in the patient sample.

In an aspect, the disclosure relates to kits. Such kits can be used in methods of identifying a miRNA or mRNA described herein; an expression level or expression pattern of one or more miRNA(s) or mRNA(s) described herein; and/or identifying a B-cell malignancy. In some embodiments the kit can provide a diagnosis of a B-cell type and or a B-cell malignancy. In some embodiments the kit can differentiate one B-cell malignancy from other B-cell malignancies (e.g., ABC-DLBCL from GBC-DLBCL), and can provide information useful to a medical professional regarding a preferred course of therapeutic treatment. Suitably, a kit can comprise an isolated nucleic acid molecule or a plurality of isolated nucleic acid molecules as described herein (e.g., a sequence complementary to any of the miRNAs disclosed in the Tables). In embodiments, the isolated nucleic acid molecule can comprise a sequence of one or more RT-PCR target sequences, primers directed thereto, or a sequence complementary thereto. The kit can also include adapter nucleic acid molecules (e.g., universal adapter molecules for attachment to expressed miRNAs/mRNAs for reverse transcription and amplification); appropriate buffer systems and reagents, detectable labels, an energy source (e.g., ATP), and other agents and components that can be used in performing analysis of miRNA expression (e.g., in RT-PCR, deep sequencing, or microarray-based methods). Kits also include instructions for use.

It will be understood that any numerical value recited herein includes all values from the lower value to the upper value. For example, if a concentration range is stated as 1% to 50%, it is intended that values such as 2% to 40%, 10% to 30%, or 1% to 3%, etc., are expressly enumerated in this specification. These are only examples of what is specifically intended, and all possible combinations of numerical values between the lowest value and the highest value enumerated are to be considered to be expressly stated in this application.

In an aspect, the disclosure provides a DNA library comprising one or more miRNA sequences from Tables 4-5, or 6-33. In a related aspect, the disclosure provides a method for generating such a DNA library. In an embodiment the library comprises a cDNA library that includes sequences derived from a sample of the miRNAs or, in addition or alternatively, the mRNA purified from a particular source such as, for example, a collection of cells, a particular tissue, or an entire organism. In embodiments, the source of the cDNA library is a B cell, such as a B cell in any stage (e.g., naïve, germinal center, memory, activated, or plasma, etc.) or a B cell malignancy (e.g., mantle cell lymphoma, follicular lymphoma, Hodgkin's lymphoma, Burkitt lymphoma, germinal center B-cell like diffuse large B cell lymphoma (DLBCL), chronic lymphocytic leukemia, small lymphocytic lymphoma, lymphoplasmacytic lymphoma, multiple myeloma, and activated B-cell like DLBCL). Typically, the isolated miRNA (or mRNA) is converted to a DNA template by reverse transcription, and comprises the cDNA version of the expressed RNA (e.g., miRNA or mRNA). Thus, a library can represent the cDNA version of the active “transcriptome” in a particular source under the physiological, developmental, or environmental conditions that existed when the miRNA/mRNA was purified.

In an embodiment, the library comprises a miRNA sequence described in Tables 4-5; 7-33. In embodiments, the library comprises at least one of SEQ ID NOs 763-1350 or 1565, and any combination thereof. In an embodiment, the library comprises a collection of miRNA sequences comprising SEQ ID NOs 763-1350 or 1565. In embodiments the library can be used to identify and/or differentiate a B-cell malignancy from other B-cell malignancies. In such embodiments, the library comprises at least one miRNA sequence selected from those listed in any of Tables 4 or 7-35.

As used herein, a “library” is a collection of DNA sequences that is stored and propagated in a population of microorganisms through standard molecular cloning processes. A DNA library can be of any type such as, for example, a cDNA library (formed from reverse-transcribed RNA) or a genomic library (formed from genomic DNA). The DNA library can be used in any routine application or technique known in the art (e.g., gene discovery; cloning of full-length cDNAs to identify/study gene function; miRNA/mRNA expression in different cells or tissues; splice variants in different cells or tissues) and, in some embodiments, can depend on the source of the original DNA fragments. In embodiments, the library can be used to isolate, characterize, and/or quantify the actively expressed miRNA is a population of cells such as, for example, B-cells or B-cell malignancies. In some embodiments, the library can be used to study miRNA-protein interactions or miRNA-based regulation of protein expression or activity.

Any known method of library preparation can be used to make the library described herein, including the methods described in the detailed description and non-limiting Examples. Further general techniques can be based on the methods and techniques known in the art, (see, e.g., RNA Methodologies: A Laboratory Guide for Isolation and Characterization (R. E. Farrell, Academic Press, 1998); cDNA Library Protocols (Cowell & Austin, eds., Humana Press; Functional Genomics (Hunt & Livesey, eds., 2000); and the Annual Review of Genomics and Human Genetics (E. Lander, ed., yearly publications by Annual Reviews). Suitably, the nucleotide sequences of interest in a library are preserved as inserts in a plasmid or the genome of a bacteriophage that has been used to infect bacterial cells. There are differences in the cloning vectors and techniques used in library preparation, but in general each DNA fragment is uniquely inserted into a cloning vector and the pool of recombinant DNA molecules is then transferred into a population of bacteria or yeast such that each organism contains on average one construct (vector+insert). The DNA molecules are copied and propagated along with the population of organisms in culture (thus, effectively, “cloned”). Accordingly, in some embodiments, the term “library” can refer to a population of organisms, each of which carries a DNA molecule inserted into a cloning vector, or alternatively to the collection of all of the cloned vector molecules.

An “increased level” of expression, as used herein, refers to a level of expression that is at least 2-fold greater than the level of expression in a control cell type or tissue. In various embodiments, the level of expression is at least 2.5-fold, at least 3-fold, at least 5-fold, or at least 10-fold, greater than the level of expression in a control cell. Exemplary control cells and tissues include, but are not limited to, normal cells, benign lymph nodes, and other B cell malignancies. In certain embodiments, benign lymph nodes are used as a control tissue. Such benign lymph node tissue contains a variety of cell types.

A “decreased level” of expression, as used herein, refers to a level of expression that is less than 50% of the level of expression in a control cell.

The term “differentially expressed” or “differential expression” relates to a difference in the observed or detected level of expression of a biomolecule such as, for example, nucleic acids (e.g., a polynucleotide, mRNA, miRNA, etc.) or amino acid sequence (e.g., protein, polypeptide, etc.) in a test sample relative to the observed or detected level of expression of the same biomolecule in a control sample or other reference (e.g., a previously established reference level). The difference in expression can be either an increase or a decrease in the expression of the biomolecule in the test sample relative to the control sample.

The Examples that follow provide further illustration of certain aspects and embodiments described in the foregoing description. These illustrative Examples should not be interpreted as limiting the scope of the appended claims.

EXAMPLES Example 1 Materials and Methods

Patient Sample Processing

B cell populations were obtained from young patients undergoing routine tonsillectomy using a protocol approved by the Clinical Center at the National Institutes of Health. Patient tonsils were disaggregated and separated by Ficoll. The mononuclear cell layer was harvested, washed in PBS, and resuspended in ACK lysing buffer to remove small numbers of red blood cells. After a wash and resuspension with 10 ml of PBS with 10% Bovine Serum Albumin, cells were counted and 200 million were stained with fluorochrome-tagged monoclonal antibodies to CDI9, IgD, CD38 and CD27. The specific monoclonal antibodies employed were anti-CDI9-PE-Cy5.5, anti-IgD-FITC, anti-CD27-PE, and anti-CD38-APC, all from BD Biosciences and BD Pharmingen (San Jose Calif.). Cells were sorted using the MoFlo Cell sorter (Dako Cytomation, Colorado Springs, Colo.) into naive B cells (CDI9+IgD+CD2TCD38+), germinal center B cells (CDI9+IgD−CD38++), memory B cells (CDI9+IgD−CD27+CD38dim) and plasma cells (CDI9dimIgD−CD27++CD38+++). Three replicates of each B cell subset were obtained from separate patients. The sample purity was verified by FACS and found to be over 90% in all cases.

Tumor specimens were obtained from patients who were examined under a protocol approved by the Duke University Medical Center Institutional Review Board. The pathologic diagnosis of the samples was verified prior to analysis. Samples from patients with diffuse large B cell lymphoma were further subclassified as described previously. See Hans et al. (2004) Blood 103: 275-282. Chronic lymphocytic leukemia samples were processed and purified as described previously. See Volkheimer et al. (2007) Blood 109: 1559-1567. Total RNA was extracted using the phenol-chloroform method to preserve miRNAs, using Ambion reagents.

microRNA Profiling Using Multiplexed Real-Time PCR

MiRNA expression profiling was conducted using the Applied Biosystems 384-well multiplexed real-time PCR assay using 400 ng of total RNA. Eight reactions, each containing 50 ng of RNA and a multiplex looped primer pool with endogenous small nucleolar (sno)-RNA controls, were used to reverse-transcribe the miRNAs in parallel fashion. Each completed reaction was loaded onto the 384-well plate per manufacturer's instructions, and real-time PCR was run on the ABI 7900HT Prism. For each 384-well plate, we used the automatically determined cycle-threshold (CT) using the SDS 2.2.1 software (Applied Biosystems). Consistent with manufacturer recommendations, we considered CT greater than 36 as undetected. A miRNA was considered to be present in a subpopulation if the CT was less than 36 in all three biological replicates. The probes deemed to be present were normalized to the average expression of a sno-RNA control. The expression values were calculated as 2−ΔCT, then median centered to 500 and log 2-transformed.

Gene Expression (mRNA) Profiling Using Microarrays

Gene expression profiling and normalization were performed using methods identical to those we have described previously. See Dave et al. (2004) N. Engl. J. Med. 351: 2159-2169. Array elements with median signal intensities of less than 7 log 2 units across the samples were removed from analysis, in order to exclude poorly measured genes and genes not appreciably expressed in the samples. Genes that were on-average 2-fold or higher differentially expressed in a binary comparison of B cell subsets, and appreciably expressed in at least one of the 2 B cell subsets being compared, were selected for further analysis as described below. The data have been deposited in the publicly available Gene Expression Omnibus database (GSE12366).

MiRNA Profiling Using Microarray

MiRNA expression profiling from human B cell malignancies was conducted using up to 1 μg of total RNA from sample and reference (normal lymph node), which were labeled with Cy3 or Cy5 fluorescent dyes, using the miRNA/LNA labeling kit (Exiqon, Denmark). The fluorescently labeled samples were combined and hybridized to a miRNA microarray (v.10.0, Exiqon, Denmark), in a nitrogen atmosphere. The micro array slides were scanned with GenePix 4100 Scanner. The quantified signals were normalized using the global Lowess algorithm, using Genespring (Agilent) software. The intensity values for multiple spots were averaged and the normalized values were log 2-transformed. Missing values were replaced with the lowest value for analysis.

MiRNA Target Prediction

Annotated genes on the U133plus 2.0 array were matched to the miRNA target list downloaded from TargetScan (www.targetscan.org). For the purpose of this study, a target gene was defined by the presence of a seed sequence match (nucleotides 2-8) and conservation of the seed sequence and 3 ′UTR in humans, dog, rat, mouse and chicken. Additional conservation was examined in miRNA target genes selected for experimental validation. The distribution of the mRNA expression for these genes was plotted as a density plot using the Splus statistical software (Insightful Corporation). The difference in distribution between the B cell subsets was calculated using a two-sample, 1-sided Kolmogorov-Smirnov test to examine the hypothesis that being a miRNA target conferred repression in the appropriate population (consistent with the known biology of miRNA effects).

The 3′UTRs of LM02, MYBL1 and PRDM1 were aligned using Blastz alignment of Human, Chimp, Mouse, Rat, Dog, Chicken, Frog (Xenopus) and Zebrafish, and were displayed using the UCSC genome browser. The conservation of miR-223 seed sequence and the 3′UTRs of LM02 and MYBL1, as well as that of the miR-30 family and miR-9 on PRDM1, were thus verified.

Western Blot

RIPA Lysis buffer (1× phosphate-buffered saline [PBS], 1 Nonidet P-40, 0.5% sodium deoxycholate, 0.1% SDS, 10 mM phenylmethylsulfonyl fluoride, 1 μg/mL aprotinin, and 100 mM sodium orthovanadate) was added to 750,000 cells and incubated on ice for 30 minutes. The mixture was spun down and the supernatant was transferred to a new tube as the whole cell extract. A total of 20 μg of cell lysate was separated on a 4-18% Tris-Bis NuPAGE gel (Invitrogen) and transferred using the iBlot transfer device (Invitrogen) program 3 for 7 minutes (LM02 detection) or program 2 for 6 minutes (PRDM1). The blots were probed using 1:200 mouse-anti-LM02 (Santa Cruz Biotechnologies SC-65736), 1:750 mouse-anti-Blimp-1 (Santa Cruz Biotechnologies SC-66015) or 1:5000 goat-anti-B-actin (Santa Cruz Biotechnologies SC-47778) for 1 hour at room temperature. The antibodies were detected using 1:10,000 goat-anti-mouse horseradish peroxidase conjugated antibodies (Santa Cruz Biotechnologies). Western Blotting Luminol Reagent (Santa Cruz Biotechnologies) was used to visualize the bands corresponding to each antibody.

Single miRNA/mRNA Expression Using Real-Time Polymerase Chain Reaction (RT-PCR)

With 10 ng of RNA per reaction, miRNAs of interest were reverse-transcribed with ABI individual stem-loop primers designed to detect only mature miRNA, and measured by Taqman real-time PCR normalized to the small nucleolar RNA, RNU48. In order to assess mRNA expression using RT-PCR, 1 μg of RNA was reverse-transcribed with the ABI High Capacity cDNA Reverse Transcription kit. Gene expression was measured with exon-spanning Taqman probes, and normalized to beta-2 micro globulin expression.

Cell Culture

BJAB and H929 were cultured in RPMI (Gibco) supplemented with 10% fetal bovine serum, and U266 was cultured in RPMI supplemented with 15% fetal bovine serum. 293T cells were grown in DMEM media (Gibco) with 10% FBS. All cell lines were grown in 37° C. humidified cell culture incubators with CO2 maintained at 5%.

MiRNA Functional Analysis

MicroRNA Transfection

miRNAs of interest were over-expressed in cell lines of interest by transfecting the appropriate miRNA precursors (Ambion) at 100 nanomoles using Amaxa's Nucleofector system. In particular, BJAB was transfected with Nucleofector solution T, program T-016, U266 with Nucleofector C, program X-005, and H929 with Nucleofector V, program T-001. 1.5 million cells were used per transfection and mixed with appropriate miRNA precursors (Ambion) for a concentration of 100 nM.

Statistical Analysis

Identifying Differentially Expressed miRNA and mRNA

MiRNAs were considered to be differentially expressed if the mean signal was changed at least 2-fold and a false discovery rate (q) was less than 5% using Significance Analysis of Microarrays (SAM) with 1000 permutations. See Tusher et al. Proc Natl Acad Sci USA. 2001; 98:5116-5121.

Differentially expressed genes (mRNA) in Naive versus Germinal Center, Germinal Center versus Plasma Cells, and Germinal Center versus Memory Cells comparisons were identified using SAM. Genes that were 2-fold differentially expressed at a false discovery rate (q) less than 1% with 1000 permutations were identified as significantly differentially expressed.

Transcription Factors and miRNA Target Genes

Transcription factors were identified based on the gene ontology (GO search term “transcription factor”) and matched to the probes of the Affymetrix U133plus 2.0 microarray. Of the total of 938 transcription factor genes thus identified, we selected 364 genes that were differentially expressed in at least one of the B cell stage transitions. We evaluated the breakdown of the differentially expressed transcription factors among miRNA targets versus non targets. The p-values were computed using a chi-square test separately in each B cell stage-transition.

B Cell Malignancy Sample Classification

The top 50 most differentially expressed miRNAs (P<0.01) in each pair-wise B cell malignancy type comparison were chosen as the initial predictor. Singular value decomposition was applied to reduce the list to 20 most informative miRNAs in each pair-wise comparison. See West et al. Proc Natl Acad Sci USA. 2001; 98:11462-11467. A Bayesian logistic regression was performed in Matlab (Mathworks) using the 20-predictor miRNAs for each pair-wise comparison. Each sample was tested using the microRNA-based predictor in a leave-one-out fashion to determine the accuracy of each prediction. For a sample to be classified as a particular B cell malignancy (or normal) type, it had to be predicted as such in every pair-wise comparison.

Normal B Cell Stage Classification of B Cell Malignancies

We constructed a Bayesian predictor to distinguish normal naive from germinal center B cells based on the 32 miRNAs depicted in FIG. 1D. We then applied the predictor without optimization to the microarray data generated for GCB DLCBL, Burkitt lymphoma and chronic lymphocytic leukemia to render a Bayesian prediction of lineage; i.e. naive versus germinal center B cell.

Western Blot Quantitative Analysis

Western blot scans were quantified using NIH ImageJ software. For each experiment, the ratios of protein of interest (LM02, PRDM1) to Actin were determined and mean centered to 100 across the experiment. The average and standard deviation of these values across the three experiments were calculated and displayed relative to the scrambled control expression.

Luciferase Indicator Assay Quantitative Analysis

Firefly luciferase reporter constructs were created in the pL/SV40/GL3 vector for the LM02 3′UTR and the LM02 3′UTR with the predicted miR-223 binding site mutated, as described below. Mature microRNA expression of a pL/CMV/eGFP vector coding for pri-miR-223 from the 3′UTR of EGFP of the vector was confirmed by Taqman-real time PCR in transfected 293T cells. gl3 activity was normalized in dual luciferase assays to pL/SV40/RLuc, with which it was cotransfected. The PRDM1 3′UTR was also cloned into the pL/SV40/GL3 vector. microRNA expression vectors and their respective seed sequence mutants were created for miR-9-2, miR-30b, and miR-30d.

LM02

The LM02 3′UTR was PCR-amplified from BJAB cDNA using primers 1 and 2 (SEQ ID NOs: 1 and 2, respectively) and ligated into the XhoI and XbaI sites of the previously described lentiviral vector pL/SV40/GL3, which expresses firefly luciferase. See Tusher et al. Proc Natl Acad Sci USA. 2001; 98:5116-5121. As a control, an LM02 3′UTR mutant was created using mutant PCR primers 3 and 4 and then outer primers 1 and 2. The resulting fragment was also placed into the XhoI and XbaI sites of pL/SV40/GL3. In this LM02 3′UTR mutant, the seed match predicted to bind to nucleotides 2-8 of miR-223 is converted from 5′AACUGAC 3′ to 5′AACAGUC 3′. To create a miR-223 expression vector, a ˜350 nucleotide-long fragment of pri-miR-223, encompassing the pre-miRNA stem loop in its middle, was PCR-amplified from genomic BJAB DNA with primers 6 and 7 (SEQ ID NOs. 6 and 7) and ligated into the XhoI and XbaI sites of the pL/CMV/eGFP vector. This pL/CMV/eGFP vector was generated by ligating a fragment containing the CMV promoter and the EGFP ORF into the BamHI and XhoI sites of the previously described lentiviral backbone pL. See Tusher et al. Proc Natl Acad Sci USA. 2001; 98:5116-5121. The expression of miR-223 from the 3′UTR of EGFP in the resulting vector was confirmed by Taqman real time PCR in transfected 293T cells.

For luciferase indicator assays, 293T cells plated in 24 well plates were transfected using FUGENE6 as follows:

TABLE 1 Luciferase indicator assay compositions 2.5 ng pL/SV40/GL3 2.5 ng pL/SV40/GL3/ 2.5 ng pL/SV40/GL3/ 2.5 ng pL/SV40/RLuc LMO2 LMO2 seed 0.4 μg pL/CMV/ UTR mut eGFP/miR-223 2.5 ng pL/SV40/RLuc 2.5 ng pL/SV40/RLuc 2.5 ng pL/SV40/GL3 0.4 μg pL/CMV/ 0.4 μg pL/CMV/eGFP/ 2.5 ng pL/SV40/RLuc eGFP/miR-223 miR-223 0.4 μg pL/CMV/eGFP 2.5 ng pL/SV40/ 2.5 ng pL/SV40/GL3/ GL3/LMO2 LMO2 seed UTR mut 2.5 ng pL/SV40/RLuc 2.5 ng pL/SV40/RLuc 0.4 μg pL/CMV/eGFP 0.4 μg pL/CMV/eGFP

Reporter expression was evaluated by dual luciferase assays (Promega) 48 hours post-transfection. Firefly Luciferase (GL3) to internal control Renilla Luciferase (RLuc) ratios from 293T cells transfected with pL/CMV/eGFP/miR-223 were divided by those obtained from 293T transfected with the pL/CMV/eGFP vector control. The average and standard deviation were taken across five experiments for the pL/SV40/gl3 empty, LM02, and LM02 mutant vectors.

Firefly Luciferase (GL3) activity readings of the PRDM1 3′UTR construct were divided by internal control Renilla Luciferase (RLuc) activity readings. The average and standard deviation of these ratios across three experiments were calculated and scaled relative to the empty vector (pL/CMV/eGFP) transfection.

TABLE 2 LM02 primer sequences Primer SEQ ID description Sequence (5′ → 3′) 1543 LMO2 3′UTR, FW ATATCTCGAGGCCCGAGTCCCCGGGCATCTTTGG 1544 LMO2 3′UTR, REV ATATATCTAGACTACACACGACAAATACTTTG 1545 LMO2 3′UTR seed CAGCCCATCCATAGTAACAGTCATGATTAGCAGAAGAAAGG mutant, FW 1546 LMO2 3′UTR seed CCTTTCTTCTGCTAATCATGACTGTTACTATGGATGGGCTG mutant, REV 1547 pri-mir-223, FW ATATCTCGAGGGTCACATCTCCCAGGAAGATC 1548 pri-mir-223, REV ATATATCTAGAAGCACTCTCATGGTGTGTGTAG

PRDM1

The PRDM1 3′UTR was PCR-amplified from BJAB genomic DNA in two reactions using primer pairs 7 and 8 in one reaction, and 9 and 10 in another (SEQ ID NOs: 7 to 10, respectively). The two fragments were then ligated together into the XhoI and NotI sites of pL/SV40/GL3 to generate the entire PRDM1 3′UTR. microRNA expression vectors were created as described above for mir-9-2, mir-30b, and mir-30d with the primers listed below. Again, over-expression from the 3′UTR of EGFP in the resulting vector was confirmed by Taqman real-time PCR in transfected 293T cells. For the PRDM1 luciferase assays, we used the sequences listed below to PCR-mutate the seed sequence of the microRNA expression vectors rather than the PRDM1 3′UTR, which had numerous seed sequence binding sites.

TABLE 3 PRDM1 primer sequences Primer SEQ ID: description sequence 1549 PRDM1 3′UTR piece 1, FW AGAGACTCGAGGATTTTCAGAAAACACTTATTT 1550 PRDM1 3′UTR piece 1, REV TTGCTTCTCTAGAGGAGAAAC 1551 PRDM1 3′UTR piece 2, FW GTTTCTCCTCTAGAGAAGCAA 1552 PRDM1 3′UTR piece 2, REV AGAGAGCGGCCGCAGGGGAGAGACAAATTGCATTG 1553 pri-mir-9-2, FW AGAGACTCGAGATAAAAGGAGGAATCTTAAG 1554 pri-mir-9-2, REV AGAGAGCGGCCGCGAAAAAAACAAAACAAAAACAA 1555 pri-mir-30b, FW AGAGAGCGGCCGCCCGATTGAGTCTTGCCTCAT 1556 pri-mir-30b, REV AGAGAGAATTCAATGGTCTCACATTTCCAAC 1557 pri-mir-30d, FW AGAGAGCGGCCGCATGTCACAGCTATTGTTCAG 1558 pri-mir-30d, REV AGAGAGAATTCGCAGTAAAAGAATGCAGCTA 1559 pri-mir-9-2 seed mutant, FW GGAAGCGAGTTGTTATCTATGCTTATCTAGCTGTATGAGT 1560 pri-mir-9-2 seed mutant, REV ACTCATACAGCTAGATAAGCATAGATAACAACTCGCTTCC 1561 pri-mir-30b seed mutant, FW ACCAAGTTTCAGTTCATGTTAAGATCCTACACTCAGCTGT 1562 pri-mir-30b seed mutant, REV ACAGCTGAGTGTAGGATCTTAACATGAACTGAAACTTGGT 1563 pri-mir-30d seed mutant, FW CAGAAAGTCTGTTGTTGTTAAGATCCCCGACTGGAAGCTG 1564 pri-mir-30d seed mutant, REV CAGCTTCCAGTCGGGGATCTTAACAACAACAGACTTTCTG

Luciferase assays were carried out in a manner similar to those described for LMO2.

IgVH Mutation Status of Chronic Lymphocytic Leukemia Samples

IgVH mutation status was determined as described in Volkheimer et al. (Blood. 2007; 109:1559-1567) using genomic DNA. In brief, genomic DNA was isolated from purified CLL cells and isolated using the GenElute Mammalian DNA extraction Kit from Sigma (St. Louis, Mo.) according to the manufacturer's instructions. DNA was amplified using nested PCR primers. PCR products were electrophoresed, purified, and sequenced using an automated DNA sequencer (Applied Biosystems, Foster City, Calif.) with the BigDye Terminator kit (Perkin Elmer, Boston, Mass.). Forward and reverse sequences were aligned into a single resolved sequence using Sequencher 4.1 software (Gene Codes Corporation, Ann Arbor, Mich.), and then aligned with germline sequences derived from DNA Plot on the V BASE directory website (http://vbase.mrc-cpe.cam.ac.uk/). The percent sequence identity was calculated by dividing the number of mutations from FR1 to FR3 by the total number of nucleotides in this region. Samples were considered somatically mutated if they had greater than 2% mutations in this region.

Example 2 Mature B Cell Stages Display Characteristic Patterns of MicroRNA Expression

Mature B cell subsets can be defined by the expression of surface CD19, IgD, CD38, and CD27, and were obtained by fluorescence activated cell sorting of tonsils from young individuals undergoing routine tonsillectomy. See FIGS. 1B and 1C. Cells were previously gated on CD19 positive cells. Naive and memory B cells were distinguished from germinal center and plasma cells based on surface CD38 and IgD expression.

To determine whether mature B cell subsets had unique patterns of microRNA (miRNA) expression, we used a 384-well multiplexed real time polymerase chain reaction (RT-PCR) assay (Applied Biosystems) that allowed measurement of all 365 miRNAs in miRBase 9.2. See Chen et al. Nucleic Acids Res. 2005; 33:e179; and He et al. Nature. 2007; 447:1130-1134. We detected a total of 113 unique miRNAs in the B cell populations. See Table 4. This detection frequency compares favorably to the identification of 71 unique miRNAs (45 miRNAs with more than one clone) through the examination of 3101 sequences cloned from unselected CD19-positive mature B cells. See Landgraf et al. Cell. 2007; 129:1401-1414. We identified differentially expressed miRNAs in mature B cell subsets using a false discovery rate of less than 5%. See FIGS. 1D, 1F, and 1H. The complete list of assayed miRNAs found to be expressed in the B cell populations is shown in Tables 4 and 5.

In Table 4, normalized expression values for B-cell subsets are shown, along with significance analysis of microarrays q values. Empty microRNA expression cells indicate below-threshold values, defined as RT-QPCR Ct values greater than 36 or undetected. SAM q values greater than 5 were considered non-significant and not displayed.

TABLE 4 MicroRNAs detected in at least one B-cell subset qNaive qGerminal qGerminal Germinal vs Center Center Naïve Center Plasma Cell Memory Germinal vs vs average average average average Center Plasma Cell Memory hsa-let-7a 11.7 9.2 11.2 1.4 hsa-let-7b 10.3 9.0 7.7 11.3 0.0 hsa-let-7c 7.3 7.2 hsa-let-7d 9.0 9.0 10.0 hsa-let-7f 10.3 7.6 8.4 10.2 0.0 hsa-let-7g 13.1 10.3 10.5 14.0 0.0 0.0 hsa-miR-100 7.4 hsa-miR-101 8.4 10.0 hsa-miR-103 9.7 11.4 9.8 10.8 0.0 0.0 hsa-miR-106b 11.7 12.5 11.6 12.7 hsa-miR-125a 6.7 8.3 hsa-miR-125b 6.3 7.3 hsa-miR-130b 7.8 9.8 8.6 10.2 3.6 4.5 hsa-miR-132 7.5 8.9 hsa-miR-133b 7.7 7.7 7.2 7.3 hsa-miR-140 10.8 12.0 11.1 12.0 4.7 hsa-miR-141 7.0 6.2 hsa-miR-142-3p 16.9 17.0 15.3 18.0 1.1 hsa-miR-142-5p 11.7 11.0 9.8 13.4 2.1 hsa-miR-146a 10.1 14.0 14.0 14.6 0.0 hsa-miR-146b 9.2 9.2 8.1 10.5 2.1 hsa-miR-148a 6.7 9.4 11.9 9.0 0.0 hsa-miR-148b 6.4 8.5 hsa-miR-151 8.2 9.6 6.6 9.0 1.5 0.0 hsa-miR-152 6.4 9.7 6.6 hsa-miR-155 14.2 14.6 15.0 15.6 hsa-miR-15a 10.2 10.1 7.8 10.8 2.0 hsa-miR-15b 11.2 14.0 12.6 12.9 0.0 2.8 hsa-miR-16 16.7 17.3 17.1 17.1 hsa-miR-17-3p 9.1 hsa-miR-17-5p 8.8 11.5 8.9 9.4 0.0 0.0 0.0 hsa-miR-181b 9.0 11.7 10.8 9.3 0.0 0.0 hsa-miR-181d 8.2 10.6 8.5 9.0 0.0 1.1 hsa-miR-182 8.7 8.7 hsa-miR-186 8.8 9.2 8.7 9.7 hsa-miR-18a 5.7 8.9 6.8 7.4 0.0 0.0 hsa-miR-191 11.9 12.7 12.4 13.3 hsa-miR-192 9.1 9.0 8.8 10.1 hsa-miR-193b 6.6 hsa-miR-194 6.8 7.4 4.9 9.5 2.0 4.7 hsa-miR-195 10.3 8.7 8.8 9.2 hsa-miR-197 9.7 10.5 8.7 11.0 0.0 hsa-miR-199a* 7.0 hsa-miR-19a 9.7 12.8 11.9 11.1 0.0 hsa-miR-19b 14.0 15.6 14.9 15.0 0.8 hsa-miR-200a 6.5 6.8 hsa-miR-200b 7.5 hsa-miR-200c 9.0 9.6 9.7 hsa-miR-203 7.9 7.6 hsa-miR-20a 12.5 14.9 12.2 13.8 0.0 0.0 hsa-miR-20b 8.4 11.0 8.0 8.5 0.0 1.1 0.0 hsa-miR-21 12.6 13.0 11.2 15.1 2.8 2.1 hsa-miR-210 9.2 11.1 10.7 10.2 0.8 hsa-miR-214 7.6 hsa-miR-22 8.3 7.4 hsa-miR-221 6.9 hsa-miR-222 11.4 11.6 7.8 12.7 0.0 4.7 hsa-miR-223 13.7 10.4 9.6 14.6 0.0 0.0 hsa-miR-23a 8.7 hsa-miR-23b 6.2 hsa-miR-24 11.7 11.8 12.8 13.4 2.1 hsa-miR-25 9.7 10.8 8.8 11.2 2.8 hsa-miR-26a 14.7 13.6 14.2 16.3 0.0 hsa-miR-26b 12.6 12.1 12.0 14.1 3.4 hsa-miR-27a 6.5 11.1 0.0 hsa-miR-27b 7.2 hsa-miR-28 9.4 13.3 8.4 10.3 0.0 0.0 0.0 hsa-miR-296 6.9 8.1 6.6 7.9 0.0 2.0 hsa-miR-29a 13.4 11.7 13.5 15.0 0.0 hsa-miR-29c 11.2 8.7 12.3 13.3 1.5 2.6 0.0 hsa-miR-301 6.0 9.6 7.7 7.9 0.0 0.0 hsa-miR-30a-3p 8.2 hsa-miR-30a-5p 11.9 12.6 11.3 13.0 2.0 hsa-miR-30b 11.7 12.6 11.2 13.0 2.8 hsa-miR-30c 13.0 13.9 12.7 14.3 4.5 hsa-miR-30d 10.8 11.9 10.1 12.1 3.8 0.0 hsa-miR-30e-3p 8.3 9.0 6.8 9.9 0.0 hsa-miR-30e-5p 12.5 8.1 10.2 14.8 0.0 hsa-miR-31 9.0 hsa-miR-32 8.4 7.0 10.5 hsa-miR-320 10.1 8.2 10.3 10.5 1.5 2.6 0.0 hsa-miR-324-3p 8.8 9.9 9.0 9.5 hsa-miR-324-5p 8.0 7.8 hsa-miR-328 8.1 8.6 7.4 8.7 2.8 hsa-miR-331 9.4 12.6 12.0 10.8 0.0 2.6 hsa-miR-335 6.3 6.9 hsa-miR-339 7.3 5.7 8.9 hsa-miR-342 12.7 12.5 10.6 13.1 0.0 hsa-miR-345 6.8 7.1 7.8 8.6 3.4 hsa-miR-361 8.3 hsa-miR-365 6.0 7.8 8.3 8.4 0.0 hsa-miR-374 8.0 8.9 10.4 9.8 hsa-miR-423 8.0 9.7 7.6 8.7 0.0 0.0 hsa-miR-425 6.9 hsa-miR-425-5p 8.7 11.6 9.7 10.2 0.0 0.0 hsa-miR-484 11.5 12.3 12.9 12.0 hsa-miR-486 7.0 8.8 9.9 9.6 3.8 hsa-miR-532 7.0 7.8 hsa-miR-545 5.5 6.3 hsa-miR-572 7.7 6.8 hsa-miR-629 6.7 7.3 7.2 9.0 1.4 hsa-miR-646 6.0 7.3 hsa-miR-650 8.8 11.4 8.0 hsa-miR-659 7.6 6.0 6.8 hsa-miR-660 9.5 8.6 10.1 hsa-miR-7 6.1 5.8 hsa-miR-9 7.8 6.8 6.2 2.8 hsa-miR-9* 6.4 6.5 hsa-miR-92 14.5 15.8 14.2 15.5 3.6 0.0 hsa-miR-93 11.5 14.6 10.5 12.3 0.0 0.0 0.0 hsa-miR-98 6.3 5.0 5.0 7.8 2.1 hsa-miR-99a 7.3 hsa-miR-99b 6.8

TABLE 5 miRNAs measured using the multiplex RT-PCR assay, but not consistently detected in any B-cell population hsa-let-7e hsa-miR-383 hsa-miR-376a hsa-miR-566 hsa-miR-I0a hsa-miR-198 hsa-miR-376b hsa-miR-551b hsa-miR-I0b hsa-miR-224 hsa-miR-380-5p hsa-miR-569 hsa-miR-34a hsa-miR-299-5p hsa-miR-410 hsa-miR-570 hsa-miR-34b hsa-miR-409-5p hsa-miR-412 hsa-miR-548a hsa-miR-34c hsa-miR-432 hsa-miR-432 hsa-miR-586 hsa-miR-107 hsa-miR-433 hsa-miR-512-5p hsa-miR-587 hsa-miR-181c hsa-miR-485-5p hsa-miR-199a hsa-miR-548b hsa-miR-215 hsa-miR-489 hsa-miR-199b hsa-miR-588 hsa-miR-218 hsa-miR-494 hsa-miR-219 hsa-miR-589 hsa-miR-372 hsa-miR-506 hsa-miR-323 hsa-miR-550 hsa-miR-375 hsa-miR-508 hsa-miR-338 hsa-miR-591 hsa-miR-378 hsa-miR-521 hsa-miR-368 hsa-miR-593 hsa-miR-137 hsa-miR-134 hsa-miR-373 hsa-miR-596 hsa-miR-200a hsa-miR-147 hsa-miR-373 hsa-miR-597 hsa-miR-I hsa-miR-149 hsa-miR-382 hsa-miR-622 hsa-miR-183 hsa-miR-153 hsa-miR-424 hsa-miR-599 hsa-miR-302a hsa-miR-187 hsa-miR-448 hsa-miR-600 hsa-miR-302c hsa-miR-190 hsa-miR-450 hsa-miR-624 hsa-miR-302d hsa-miR-193a hsa-miR-451 hsa-miR-601 hsa-miR-367 hsa-miR-196a hsa-miR-452 hsa-miR-626 hsa-miR-369-5p hsa-miR-196b hsa-miR-452 hsa-miR-548d hsa-miR-449 hsa-miR-205 hsa-miR-453 hsa-miR-639 hsa-miR-497 hsa-miR-208 hsa-miR-485-3p hsa-miR-613 hsa-miR-501 hsa-miR-213 hsa-miR-488 hsa-miR-614 hsa-miR-509 hsa-miR-220 hsa-miR-490 hsa-miR-615 hsa-miR-510 hsa-miR-325 hsa-miR-492 hsa-miR-616 hsa-miR-511 hsa-miR-326 hsa-miR-493 hsa-miR-548c hsa-miR-514 hsa-miR-337 hsa-miR-503 hsa-miR-617 hsa-miR-515-3p hsa-miR-340 hsa-miR-504 hsa-miR-642 hsa-miR-515-5p hsa-miR-380-3p hsa-miR-505 hsa-miR-618 hsa-miR-517a hsa-miR-422b hsa-miR-507 hsa-miR-644 hsa-miR-517b hsa-miR-422a hsa-miR-513 hsa-miR-647 hsa-miR-517c hsa-miR-429 hsa-miR-516-5p hsa-miR-649 hsa-miR-518a hsa-miR-491 hsa-miR-517 hsa-miR-661 hsa-miR-518b hsa-miR-496 hsa-miR-518c hsa-miR-662 hsa-miR-518c hsa-miR-500 hsa-miR-518f hsa-miR-449b hsa-miR-518d hsa-miR-502 hsa-miR-519b hsa-miR-653 hsa-miR-518e hsa-miR-105 hsa-miR-519c hsa-miR-411 hsa-miR-520a hsa-miR-122a hsa-miR-519d hsa-miR-654 hsa-miR-520b hsa-miR-124a hsa-miR-51ge hsa-miR-575 hsa-miR-520c hsa-miR-126 hsa-miR-522 hsa-miR-576 hsa-miR-520d hsa-miR-128b hsa-miR-523 hsa-miR-578 hsa-miR-520e hsa-miR-129 hsa-miR-524 hsa-miR-579 hsa-miR-520f hsa-miR-130a hsa-miR-526b hsa-miR-580 hsa-miR-520g hsa-miR-139 hsa-miR-96 hsa-miR-585 hsa-miR-520h hsa-miR-143 hsa-miR-651 hsa-miR- 512-3p hsa-miR-95 hsa-miR-145 hsa-miR-376a hsa-miR-631 hsa-miR-126 hsa-miR-182 hsa-miR-542-5p hsa-miR-363 hsa-miR-127 hsa-miR-185 hsa-miR-544 hsa-miR-487b hsa-miR-133a hsa-miR-189 hsa-miR-656 hsa-miR-645 hsa-miR-135a hsa-miR-18b hsa-miR-549 hsa-miR-556 hsa-miR-135b hsa-miR-202 hsa-miR-657 hsa-miR-558 hsa-miR-184 hsa-miR-202 hsa-miR-658 hsa-miR-627 hsa-miR-204 hsa-miR-299-3p hsa-miR-652 hsa-miR-630 hsa-miR-206 hsa-miR-302a hsa-miR-551a hsa-miR-603 hsa-miR-211 hsa-miR-302b hsa-miR-552 hsa-miR-606 hsa-miR-216 hsa-miR-302b hsa-miR-553 hsa-miR-607 hsa-miR-217 hsa-miR-302c hsa-miR-554 hsa-miR-608 hsa-miR-330 hsa-miR-329 hsa-miR-555 hsa-miR-609 hsa-miR-371 hsa-miR-33 hsa-miR-562 hsa-miR-633 hsa-miR-379 hsa-miR-362 hsa-miR-563 hsa-miR-565* hsa-miR-381 hsa-miR-369-3p hsa-miR-564 hsa-miR-594* miRNAs marked with * were not used in analyses because they have been reclassified as non-miRNAs.

The B cell subsets were profiled for gene expression at the whole genome level, as described previously. See Dave et al. N Engl J Med. 2004; 351:2159-2169. At each stage, we identified differentially expressed genes as those genes with a mean two-fold difference in expression and a false-discovery rate of less than 1%. See FIGS. 1E, 1G, and 1I. Genes that we found to be differentially expressed in each stage-transition were consistent with previous studies that examined gene expression in B cell subsets using microarrays with fewer probes, an overlap that was found to be highly statistically significant (P<0.001, chi-squared test). See, e.g., Klein et al. Proc Natl Acad Sci USA. 2003; 100:2639-2644; and Shaffer et al. Immunity. 2001; 15: 375-385.

In the naïve→germinal center (GC) B cell transition, we identified 32 miRNAs that were differentially expressed. Interestingly, all but 4 miRNAs were found to be expressed more highly in GC cells than in naive B cells. See FIG. 1D. We confirmed the mRNA expression patterns of several genes that are known to be differentially expressed in the transition including BCL6, MME, MYBL1, as well as LM02. See FIG. 1E. LM02 was found to be expressed more highly in germinal center B cells compared to both naive B cells and memory B cells. See FIGS. 1E and 1I. In the GC→plasma cell transition, we found 33 miRNAs that were differentially expressed. Once again, we noted a striking asymmetry, with all but 2 miRNAs found to be expressed highly in GC cells, but down-regulated in plasma cells. See FIG. 1F. We also confirmed that the plasma cell-specific genes, PRDM1 (FIG. 1G), XBP1 and IRF4 were highly differentially expressed in our experiments. In the GC→memory B cell transition, there was a preponderance of the 27 significant miRNAs expressed at higher levels in memory cells, See FIG. 1H. Five miRNAs were expressed highly in GC cells compared to all the other B cell types. These included 3 members of the miR-17˜92 cluster (miR-17-5p, miR-20b, miR-93), as well as miR-28 and miR-181b.

The expression pattern of all the miRNAs that were measurable in at least one of the B cell subsets is summarized in FIG. 5. Notably, there were no differences in the expression of genes involved in miRNA processing, including DICER1, DROSHA, XP05 (exportin5), EIF2C2 (ag02) and DGCR8, among the B cell subsets. See FIG. 1J.

Separately, we examined the expression of predicted target genes of differentially expressed microRNAs. We also found that predicted mRNA target genes of microRNAs expressed highly in GC cells were expressed at lower levels in GC cells compared to other stages. See FIG. 6 and Appendix A. FIG. 6A shows density plots of the expression frequency of predicted mRNA targets of microRNAs expressed highly in germinal center B cells compared to naive cells. mRNAs from FIG. 1E that were also predicted targets of the miRNAs (N=830) were plotted for both naive cells and germinal center B cells. The depicted p-value was calculated using a 1-sided Kolmogorov-Smirnov test. FIG. 6B shows density plots of the expression frequency of predicted mRNA targets of miRNAs expressed highly in germinal center B cells compared to plasma cells. mRNAs from FIG. 1G that were also predicted targets of the miRNAs (N=1098) were plotted for both plasma cells and germinal center B cells. The depicted p-value was calculated using a 1-sided Kolmogorov-Smirnov test. FIG. 6C shows density plots of the expression frequency of predicted mRNA targets of miRNAs expressed highly in the germinal center B cells compared to memory B cells. mRNAs from FIG. 1I that were also predicted targets of the miRNAs (N=269) were plotted for both naive cells and germinal center B cells. The depicted p-value was calculated using a 1-sided Kolmogorov-Smirnov test.

In the naïve to germinal center transition (see FIG. 6A), genes with at least a two-fold change in expression were analyzed by SAM using a false discovery rate of less than 1% (Larsson et. al, BMC Bioinformatics. 2005; 6:129), depicted in FIG. 1E. From that list of significantly differentially expressed genes, we determined those that were predicted targets of miRNAs (defined as genes with 3′UTR sequence complementarity to microRNA nucleotides 2-7) that were expressed more highly in germinal center cells. The gene expression distribution of those mRNA targets was graphed for naïve B Cells (blue curve) and germinal center B cells (orange curve). Thus, in FIG. 6A, we show genes differentially expressed between naïve and germinal center B cells that are also predicted targets of miRNA expressed more highly in germinal center B cells. We observe that the expression of these microRNA target genes is lower in germinal center B cells compared to naïve B cells.

A similar analysis was carried out for the transitions from germinal center to plasma cell (FIG. 6B) and germinal center to memory cell (FIG. 6C). In all three cases examined, the distribution of germinal center miRNA target gene expression is statistically significantly lower (leftward shift of orange curve), which suggests a possible gene regulatory role for the miRNAs that are more highly expressed in germinal center cells. We note that the observed lower expression of the miRNA target genes could, however, also be caused by other factors such as downstream effects of particular transcription factors. The complete set of genes plotted in FIG. 6 is listed in Appendix A.

Finally, we found that a higher proportion of differentially expressed transcription factors are predicted microRNA targets. See FIG. 7. Table 6 shows differentially expressed transcription factors, with the average level of expression for each in naïve, germinal center, plasma, and memory cells. Transcription factors for which the significance analysis showed a q value of 0 are indicated.

TABLE 6 Differentially-expressed transcription factors Naïve GC Germinal Plasma vs GC vs Naïve Center Cell Memory GC: q vs PC: q Mem: q ID NAME average average average average value value value 1 AHR 8.9 10.33 8.36 10.38 0 0 2 APBB2 6.86 7.87 7.35 6.39 0 0 3 ARID1A 12.3 12.22 11.11 12.17 0 4 ARID3A 8.03 6.9 9.81 8.76 0 0 0 5 ARNTL 9.47 8.4 8.23 9.7 0 0 6 ATF7 7.83 8.97 8.23 8.44 0 7 BACH1 10.68 9.97 11.76 10.59 0 8 BHLHB3 11.11 8.05 13.26 13.26 0 0 0 9 BPTF 12.23 12.46 11.34 11.86 0 10 BTG1 15.88 14.95 13.94 15.28 0 11 CASP8AP2 10.17 10.55 9.44 10.22 0 12 CBL 11.07 11.69 10.26 11.04 0 13 CBX4 12.23 12.36 13.69 12.68 0 14 CCNE1 7.86 9.18 8.87 7.66 0 0 15 CDH1 5.85 3.85 10.26 4.91 0 16 CITED2 9.11 9.88 12.56 9.22 0 17 CLOCK 9.85 7.68 9.91 9.62 0 0 0 18 CREB5 4.91 5.46 7.24 6.95 0 19 CREBL1 7.53 6.97 8.06 8.09 0 20 CREBL2 10.18 9.95 11.1 10.79 0 21 CSDA 12.12 8.59 10.1 8.98 0 0 22 DEK 12.73 14.09 10.29 13.15 0 0 23 DLX2 6.08 4.66 7.04 7.08 0 0 24 DR1 11.83 11.97 10.65 12.1 0 25 DTX1 10.98 11.6 10.55 9.62 0 0 26 DYRK1B 6.32 5.92 7.61 4.96 0 27 E2F1 7.01 8.37 7.95 7.21 0 0 28 EGR1 11.92 13.24 13.77 12.75 0 29 EGR2 10.21 10.43 8.07 10.4 0 30 EGR3 11.59 9.35 8.24 10.62 0 0 0 31 ELF1 12.39 12.7 11.34 12.55 0 32 ELL 7.12 7.83 9.17 7.59 0 33 ELL2 9.25 8.23 13.6 9.27 0 34 EPAS1 7.1 7.02 8.39 7.5 0 35 ETS1 14.25 14.4 12.62 14.17 0 36 ETS2 6.37 7.5 5.66 4.9 0 0 0 37 ETV1 8.19 6.9 7.38 7.06 0 38 ETV4 5.99 5.42 7.15 6.09 0 39 ETV6 10.36 7.14 8.89 10.43 0 0 0 40 FHL2 4.82 7.77 6.82 5.65 0 0 41 FLNA 9.95 9.2 8.57 11.03 0 42 FOS 12.35 11.25 13.34 11.23 0 0 43 FOSB 10.13 7.21 11.05 10.79 0 0 0 44 FOXC1 6.81 5.84 7.39 6.59 0 45 FOXF2 7.05 4.83 6.37 5.84 0 46 FOXJ2 10.01 8.38 9.97 9.85 0 0 0 47 FOXK2 8.94 8.4 9.63 8.71 0 48 GATA3 8.05 7.76 8.51 9.6 0 49 GATA6 7.08 5.41 7.59 6.26 0 0 50 GCN5L2 10.18 8.97 8.9 10.36 0 0 51 GLI2 6.93 7.26 7.52 6.09 0 52 GPX3 6.72 5.92 7.61 5.58 0 53 HCLS1 13.94 14.42 13.12 13.92 0 54 HIPK2 9.36 8.66 11.04 10.85 0 0 55 HMGA1 11.26 12.47 10.36 10.86 0 0 0 56 HMGB1 15.47 16.36 14.98 14.97 0 0 57 HMGB2 12.96 15.78 12.73 13.36 0 0 0 58 HOXA1 5.36 7.7 7.23 7.64 0 59 HOXA5 7.03 8.32 8.36 7.54 0 60 HOXB4 8.2 7.58 9.27 8.01 0 61 HOXB9 7.4 6.2 8.41 6.87 0 62 HOXC11 6.6 6.4 7.88 6.21 0 63 HOXC8 7.05 5.48 6.88 6.71 0 64 ID4 6.49 5.93 7.79 6.41 0 65 ILF3 11.26 11.94 10.71 10.99 0 66 IRAK1 12.19 11.48 12.8 11.96 0 67 IRF4 11.16 9.28 13.66 10.51 0 0 0 68 ISL1 6.98 5.91 7.6 6.11 0 69 JAZF1 11.93 10.65 7.49 11.31 0 0 70 JMJD1C 12.34 12.34 11.11 12.56 0 71 JUN 12.14 9.34 12.7 12.16 0 0 0 72 JUNB 11.62 9.72 10.84 11.37 0 0 73 KLF11 8.08 5.94 6.88 8.39 0 0 74 KLF2 12.61 9.1 11.7 12.61 0 0 0 75 KLF4 10.04 7.57 9.09 7.49 0 0 76 KLF5 7.08 5.26 6.14 5.07 0 77 KLF6 12.06 11.33 9.24 12.40 0 0 78 KLF7 9.36 8.35 8.88 9.8 0 79 KLF9 9.47 7.34 6.64 9.27 0 0 80 LITAF 12.52 10.18 11.82 12.49 0 0 0 81 LMO1 6.86 4.75 7.16 6.88 0 82 MAF 8.05 9.95 8.25 10.83 0 0 83 MAFB 6.58 7.3 8.56 7.29 0 84 MAML3 8.05 10.85 9.07 7.04 0 0 0 85 MDFIC 12.06 13.67 13.6 13.08 0 86 MEIS2 7.45 7.15 7.56 5.29 0 87 MEN1 10.79 11.33 10.49 10.23 0 88 MITF 7.51 8.05 8.01 6.41 0 89 MTF1 10.08 9.92 8.86 10.5 0 90 MXD1 9.07 7.59 9.62 8.9 0 0 0 91 MXI1 10.63 7.85 11.1 9.42 0 0 0 92 MYB 6.97 8.62 5.61 7.99 0 0 93 MYBL1 9.68 14.13 10.02 9.72 0 0 0 94 MYBL2 9.07 12.41 9.12 8.52 0 0 0 95 NAT14 6.62 7.66 7.33 7.63 0 96 NF1 9.23 10.46 11.21 9.88 0 97 NFAT5 11.71 12.09 10.72 11.77 0 98 NFATC4 6.36 7.92 8.96 5.71 0 0 99 NFIX 8.09 7.43 8.67 7.37 0 100 NFKB1 11.91 11.9 10.7 11.55 0 101 NFYC 10.2 10.27 9.03 10.03 0 102 NR3C2 8.85 5.58 4.91 8.41 0 0 103 NR6A1 9.1 6.03 6.42 7.62 0 0 104 NRIP1 11.79 10.3 10.33 11.20 0 105 PAX3 7.01 5.55 5.01 5.96 0 106 PHF1 11.85 10.69 12.26 11.45 0 0 107 POU3F1 6.08 7.52 6.86 7.52 0 108 POU4F1 5.62 8.85 8.46 7.53 0 0 109 POU4F2 7.09 5.72 7.21 5.1 0 0 110 PPARD 11.23 9.98 10.29 10.69 0 111 PPARG 7.79 7.22 6.74 5.47 0 112 PPARGC1B 6.89 6.09 6.51 7.91 0 113 PRDM1 8.49 9.15 14.1 9.33 0 114 PRDM4 10.48 9.81 9.76 10.83 0 115 PROX1 7.18 6.38 7.89 5.54 0 116 RAN 13.46 14.57 12.39 13.78 0 0 117 RSF1 10.05 9.1 9.56 10.18 0 118 RUNX1T1 7.37 5.95 6.63 6.34 0 119 RUNX2 8.75 7.91 10.22 9.75 0 0 120 RUNX3 11.8 11.13 10.26 12.47 0 121 RXRA 9.07 7.15 8.81 8.32 0 0 0 122 SAP30 8.22 9.91 9.28 8.33 0 0 123 SCMH1 8.48 9.69 9.65 8.62 0 0 124 SCML1 10.32 8.48 7.81 7.91 0 125 SCML2 10.33 8.76 9.27 8.96 0 126 SF1 11.72 11.44 10.36 11.37 0 127 SIAH2 10.35 12.34 10.57 9.90 0 0 0 128 SLC2A4RG 8.25 8.98 7.4 8.91 0 129 SMAD1 5.91 8.1 6.34 7.33 0 0 130 SMAD2 10.45 11.57 10.8 10.98 0 131 SMAD3 10.72 9.23 7.74 10.54 0 0 0 132 SMARCA2 11.14 10.12 10.79 11.19 0 0 133 SOLH 8.78 7.88 8.7 9.03 0 134 SOX4 8.99 9.14 9.17 10.2 0 135 SOX5 9.3 10.47 7.33 9.08 0 0 0 136 SOX9 6.72 8.42 8.18 7.03 0 0 137 SP4 11.26 10.14 9.58 11.75 0 0 138 SRCAP 8.58 8.06 6.96 8.38 0 139 SREBF1 8.23 8.36 6.56 5.89 0 0 140 STAT5B 10.35 10.95 9.73 10.7 0 141 SUFU 7.12 6.03 7.84 7.62 0 0 142 SUPT16H 11.12 11.35 9.6 10.71 0 143 SUPT3H 7.77 6.3 8.05 8.35 0 0 0 144 TARDBP 12.31 12.72 11.49 11.91 0 145 TBP 10.55 10.14 9.09 10.38 0 146 TBX3 5.67 6.05 7.89 5.53 0 147 TCEA1 13.31 15 14.05 13.6 0 0 148 TCERG1 12.29 12.5 11.46 12.04 0 149 TCF7 10.21 10.82 9.97 12.61 0 150 TFAP2A 6.7 5.54 8.26 6.88 0 151 TFAP4 7.28 5.29 5.42 5.13 0 152 TFDP1 10.95 12.9 10.49 11.36 0 0 0 153 TFEB 11.56 11.15 9.49 11.77 0 154 THRA 7.41 7.26 8.48 7.05 0 155 THRB 7.45 7.51 6.11 6.29 0 0 156 TLE1 9.19 7.74 9.63 9.13 0 0 0 157 TMF1 10.76 9.68 10.71 10.42 0 158 TSC22D3 13.22 11.26 12.67 13.4 0 0 0 159 UHRF1 9.23 12.22 8.72 8.96 0 0 0 160 VEZF1 10.98 11.45 9.94 10.81 0 161 XBP1 10.1 10.74 15.84 10.65 0 162 YBX1 14.79 15.31 14.2 14.53 0 163 YWHAH 8.94 10.82 9.09 9.36 0 0 0 164 YWHAZ 13.38 13.62 12.61 13.62 0 165 ZFP36L1 14.07 12.89 10.09 13.87 0 0 166 ZHX3 8.29 7.76 7.47 6.66 0 167 ZNF207 12.29 13.51 12.69 12.54 0 168 ZNF217 11.68 10.77 9.73 11.61 0 169 ZNF219 6.13 6.11 8.42 6.48 0 170 ZNF238 13.05 11.27 10.08 12.54 0 0 0 171 ZNF3 8.86 7.27 8.75 8.89 0 0 0 172 ZNF367 7.97 10.99 8.04 8.22 0 0 0 173 ZNF398 10.39 9.28 10.47 10.25 0 0

Example 3 MiR-223 Regulates LM02 in the Naive˜Germinal Center and Germinal Center˜Memory Cell Transitions

MiR-223 has previously been described as being important in the commitment to myeloid lineage. See Chen et al. Science. 2004; 303:83-86; Johnnidis et al. Nature. 2008; 451:1125-1129. We found miR-223 to be expressed at nearly 8-fold higher levels in both naive and memory cells compared to GC cells. This miRNA has a highly conserved sequence complementarity to the 3 ′UTR of 2 transcription factors that are expressed highly during GC cell differentiation: LM02 (FIG. 2A) and MYBL1 (FIG. 8A). Higher expression of miR-223 in the naive B cell stage could inhibit the untimely expression of these transcription factors until the cell is ready to undergo the germinal center reaction.

We evaluated the effects of miR-223 expression on its predicted target gene, LM02, by transfecting precursors of miR-223 into a cell line derived from GC cell lymphoma cells (B1AB). Over-expression of miR-223 resulted in a consistent down-regulation of LM02 at the transcript level compared to a transfection with a scrambled control with no sequence complementarity to the human genome. See FIG. 2B. In that figure, the blue bars depict expression of LM02 24 hours after transfection with a scrambled control that does not possess complementarity to the human genome. The orange bars depict the expression of LM02 24 hours after transfection with a precursor for miR-223. The expression of LM02 was consistently lower in the cells treated with the miR-223 precursor, and the results were statistically significant (P<0.05 in all cases, student's t-test). There was no effect on the expression of a non-target control, beta-2 micro globulin in these experiments (data not shown). Over-expression of miR-223 also resulted in a consistent down-regulation of LM02 at the protein level compared to a transfection with a scrambled control with no sequence complementarity to the human genome. See FIG. 2C. We quantified the results of 3 separate experiments examining LM02 protein expression and found consistent down-regulation of LM02 in cells treated with miR-223 compared to cells transfected with scrambled controls. See FIG. 2D. Those results that were statistically significant (P<0.05, student's t-test). The extent of down-regulation of LM02 mRNA and protein by miR-223 was comparable, suggesting that miR-223 regulation of LM02 occurs predominantly at the mRNA level. Similarly, over-expression of miR-223 resulted in a down-regulation of MYBL1 transcripts. See FIG. 8B. In that figure, the blue bars depict expression of MYBL1 mRNA 24 hours after transfection with a scrambled control that does not possess complementarity to the human genome. The orange bars depict the expression of Mybl1 24 hours after transfection with a precursor for miR-223. The expression of LM02 was consistently lower in the cells treated with the miR-223 precursor (P<0.05 in all cases).

As additional validation, we investigated whether the miR-223 had a direct effect on LM02 by cloning the 3′UTR sequence of LM02 3′ to the firefly luciferase ORF (Fluc). See Gottwein et al. Nature. 2007; 450:1096-1099. The resulting constructs and the unmodified vector were co-transfected into 293T cells along with a Renilla luciferase internal control and pL-CMV-eGFP constructs expressing either no miRNA or miR-223. Fluc expression from constructs bearing LM02 3′ UTR sequences were differentially down-regulated by miR-223 compared to those with mutated seed sequences; the seed sequence mutant construct had consistently diminished miR-223 repression compared to the wild-type construct in 5 separate experiments. See FIG. 2E. Those results were statistically significant (P<0.05, student's t-test). These observations provide evidence for an inhibitory role for miR-223 in regulating the transcription factor LM02.

Activation of LM02 has been associated with the development of leukemia in patients undergoing gene therapy. Hacein-Bey-Abina et al. Science. 2003; 302:415-419. On the other hand, higher expression of PRDM1 alone is sufficient to induce plasma cell-differentiation. Turner et al. Cell. 1994; 77:297-306. Inappropriate expression of such genes must be effectively turned off for a cell to maintain its state. This mode of regulation is reflected in the effects of miR-223, miR-9 and miR-30, which turn off the inappropriate expression of LM02 and PRDM1 and might promote state maintenance and inhibition of lymphomagenesis.

On the other hand, our data also identify a number of instances in which miRNAs are co-expressed with their predicted targets. It is possible that such interactions within the cell help to stabilize a defined expression level by dampening fluctuations. For example, in GC cells, we found that miR-181b was strongly co-expressed with its predicted target, BCL6. Such interactions could also be important in B cell stage maintenance and curbing the oncogenic potential of genes involved in B cell differentiation. See Cattoretti et al. Cancer Cell. 2005; 7:445-455; Dorsett et al. Immunity. 2008; 28:630-638.

Example 4 MiR-9 and the miR-30 Family Regulate PRDM1 (blimp-1) in the Germinal Center→Plasma Cell Transition

In the GC→plasma cell transition, we observed that several members of the miR-30 family were expressed at 2-fold or higher levels in GC cells. See FIG. 1F. The transcription factor PRDM1 is an essential regulator of plasma cell differentiation. Martins et al. Annu Rev Immunol. 2008; 26:133-169. The miR-30 family comprises 5 members (miR-30a, 30b, 30c, 30d and 30e), of which 4 (all except 30e) were found to be expressed at higher levels in GC cells compared to plasma cells. Control transfection experiments documented good specificity of the RT-PCR probes for individual members of the miR-30 family with no discernible cross-hybridization. See FIG. 9. Three separate transfection experiments using high concentrations of miR-30b precursors are shown in the left panel with measurement of miR-30b and miR-30d. Similar experiments were performed with precursors for miR-30d (right panel).

The 3′UTR of PRDM1 contains 3 highly conserved binding sites complementary to the seed sequence of members of the miR-30 family, as well as 3 binding sites for the seed sequence of miR-9, 2 of which are highly conserved across multiple species. See FIG. 3A. The 3′UTR region of PRDM1 complementary to miR-30 is shown in red. The 3 sites are complementary to nucleotides 2-8 (UTR position 408), nucleotides 1-8 (UTR position 2370) and nucleotides 2-8 (UTR position 2383) on the miRNA, respectively. The 3′UTR region of PRDM1 complementary to miR-9 is shown in green. The 3 sites are complementary to nucleotides 1-7 (UTR position 1459), nucleotides 2-8 (UTR position 2108) and nucleotides 2-8 (UTR position 2323) on the miRNA respectively. These sites are highly conserved across a number of species, with the exception of one miR-9 site (UTR position 1459) that is only present in humans.

To evaluate the effects of the miR-30 family and miR-9 on PRDM1 expression in plasma cells, we introduced precursors of miR-9, miR-30b and miR-30d into the U266 multiple myeloma (plasma cell) cell line. Overexpression of miR-30 family members miR-30b and miR-30d, as well as miR-9, had no effect on PRDM1 at the mRNA level. See FIG. 3B. In that figure, the blue bars depict expression of PRDM1 24 hours after transfection with a scrambled control with no complementarity to the human genome. The magenta bars depict the expression of PRDM1 24 hours after transfection with a hairpin precursor for miR-30b, while the red bars depict the expression of PRDM1 24 hours after transfection with a hairpin precursor for miR-30d. The green bars depict the expression of PRDM1 24 hours after transfection with a hairpin precursor for miR-9. By contrast, there was a consistent down-regulation of PRDM1 at the protein level. See FIGS. 3C and 3D. Those results were statistically significant in each case (P<0.05, student's t-test), except for the transfections with the precursor to miR-9 (P=0.08, student's t-test). Overexpression of each of those microRNAs had an average knockdown effect of around 40%. These exclusively post-transcriptional effects of miR-9 and miR-30 on PRDM1 expression are consistent with one mechanism of miRNA regulation that has been described previously in other systems. See, e.g., O'Donnell et al. Nature. 2005; 435:839-843; Gottwein et al. Nature. 2007; 450:1096-1099; Selbach et al. Nature. 2008; 455:58-63; and Back et al. Nature. 2008; 455:64-71. There was no effect on the expression of a non-target control (Actin).

Additionally, luciferase reporter activity of the PRDM1 3′UTR construct was decreased by overexpression of miR-9, miR-30b, and miR-30d, but not their respective seed sequence mutants. See FIG. 3E, which shows the average of three experiments. The down-regulation of the luciferase reporter signal and its restoration in the mutant constructs was found to be statistically significant in each of the 3 microRNAs: miR-9, miR-30b and miR-30d (P<0.05, student's t-test). The luciferase reporter activity level was rescued to the activity level of the empty vector control when the seed sequence of the microRNAs was mutated.

The combined effect of 5 different microRNA species (miR-30a, miR-30b, miR-30c, miR-30d and miR-9) is likely to be more potent than that of a single microRNA. The role of mutual repression of BCL6 and PRDM1 in the germinal center to plasma cell differentiation as been described previously. See Martins et al. Immunol. 2008; 26:133-169. Our data suggest that microRNAs may bolster the effects of BCL6 in the inhibition of PRDM1.

Our data show that members of the miR-17˜92 family are consistently expressed in GC cells and may play a role in mature B cell differentiation. Interestingly, the miR-17˜92 family has been implicated in early B cell differentiation and mice lacking the loci that encode these miRNAs have arrested early B cell development. See Ventura et al. Cell. 2008; 132:875-886. The expression patterns of the miR-17˜92 family suggest that the regulatory motifs embedded in the interaction of this miRNA family and its targets might have an additional function in regulating mature B cell differentiation.

A striking observation in this study is the high degree of asymmetry observed in relative expression of miRNAs in GC cells compared to naive and plasma cells. At least 2 hypotheses could account for these findings. First, miRNA expression may promote a highly regulated state that enables GC cells to interact with T cells and antigen presenting cells, and to leave the GC cells poised for differentiation into memory or plasma cells. Second, miRNAs expressed highly in naive and plasma cells may be underrepresented in current miRNA libraries. Such libraries are often constructed from lymph nodes, which are typically enriched in GC cells. High throughput sequencing of sorted populations of B cells could reveal novel miRNAs that are highly expressed in those populations. Interestingly, a larger number of miRNAs were highly expressed in memory cells compared to GC cells. This observation might stem from the fact that memory cells are known to be heterogeneous (Sanz et al. Semin Immunol. 2008; 20:67-82) and standard methods used to select memory cells may capture a diverse group of memory subpopulations.

Example 5 MiRNAs and B Cell Malignancies

To examine the expression of B cell stage-specific microRNAs in B cell malignancies, we undertook miRNA profiling of 75 tissue samples derived from normal lymph nodes (N=5) as well as patients with B cell malignancies including the molecular subsets of diffuse large B cell lymphoma (DLBCL; see Rosenwald et al. N Engl J Med. 2002; 346:1937-1947), germinal center B cell-like (GCB) DLBCL (N=20) and activated B cell-like (ABC) DLBCL (N=20), as well as cases of IgV mutated and unmutated chronic lymphocytic leukemia (N=20) and Burkitt lymphoma (N=10).

We constructed a Bayesian predictor from miRNAs that distinguished normal memory B cells from GC cells. See FIG. 1H. We tested the predictor in the B cell malignancies derived from germinal center B cells (Burkitt lymphoma and GCB DLBCL) along with chronic lymphocytic leukemia, which is thought to arise from memory B cells. See Klein et al. J Exp Med. 2001; 194:1625-1638. Using leave one out cross-validation, we found that the predictor constructed from miRNAs expressed in normal B cells was able to correctly identify the B cell specific stage of the B cell malignancy type in over 95% of the cases. See FIG. 4A.

An interesting aspect regarding the role of miRNAs in malignancies is their reported down-regulation in a number of malignancies compared to normal cells from the same lineage. See Lu et al. Nature. 2005; 435:834-838. To further examine this effect in B cell malignancies, we examined the expression of 113 miRNAs that we had identified in normal B cells. See Table 4, above. Of the 113 miRNAs, 103 were detected using the microarrays that we used to profile B cell malignancies and normal lymph nodes. We applied a 2-sided student's t-test to evaluate the relative expression of those 103 miRNAs in B cell malignancies (N=60) and normal lymph nodes (N=5). 34 miRNAs were differentially expressed (P<0.05) at higher levels in malignant cells and 9 miRNAs were expressed more highly in normal cells. 60 miRNAs were not differentially expressed. See FIG. 4B.

As additional validation, we examined miRNA cloning frequencies for sequences cloned from normal and malignant B cells. See Landgraf et al. Cell. 2007; 129:1401-1414. MiRNAs for which a sequence was identified in at least 2 of the 3 available normal B cell samples were used in the analysis. We applied a 2-sided student's t-test (P<0.05) to compare the differential cloning frequency of the miRNAs between normal B cells (N=3) and a variety of mature B cell malignancy patient samples and cell lines (N=42). In all, we found 56 miRNAs that were consistently expressed in normal B cells. We found 13 of those 56 miRNAs were differentially expressed (P<0.05) between normal and malignant B cells, of which 12 miRNAs were expressed more highly in malignant cells and 1 miRNA was expressed more highly in normal cells. See FIG. 4C. In order to avoid effects from tumor-infiltrating non-malignant cells, we repeated the analysis with 20 chronic lymphocytic leukemia samples in the malignant group. The results were similar to those obtained with the larger set of malignancies (data not shown).

These results demonstrate that miRNAs are not down-regulated in B cell malignancies compared to normal B cells and that normal B cell stage-specific miRNAs are maintained in B cell malignancies.

MicroRNA profiling also revealed that each B cell malignancy type had a distinctive pattern of miRNA expression. See FIG. 4D. In order to evaluate the ability of miRNA profiles to distinguish different B cell malignancy types, we constructed Bayesian predictors from the most highly differentially expressed miRNAs for each pair-wise comparison. See Tables 7, 8, and 9.

TABLE 7 Predictor microRNAs that distinguish germinal center B-cell (GCB) DLBCL from Burkitt Lymphoma, activated B-cell (ABC) DLBCL, and chronic lymphocytic leukemia GCBvsBL GCBvsABC GCBvsCLL hsa-miR-146a hsa-miR-142-3p hsa-miR-126 hsa-miR-154 hsa-miR-16 hsa-miR-130a hsa-miR-155 hsa-miR-184 hsa-miR-I0b hsa-miR-184 hsa-miR-191 hsa-miR-154 hsa-miR-29b hsa-miR-19a hsa-miR-193b hsa-miR-29c hsa-miR-19b hsa-miR-199a-3p hsa-miR-363 hsa-miR-299-5p hsa-miR-365 hsa-miR-503 hsa-miR-32 hsa-miR-99b hsa-miR-519c-5p hsa-miR-30e* hsa-miR-143 hsa-miR-301a hsa-miR-151-5p hsa-miR-585 hsa-miR-152 hsa-miR-583 hsa-miR-193a-5p hsa-miR-30b* mghv-miR-MI-7-5p hsa-miR-886-5p hsa-miR-590-5p hsa-miR-142-5p hsa-miR-I00 hsa-miR-149* hsa-miR-106b hsa-miR-768-5p hsa-miR-300 hsa-miR-30e hsa-miR-145 hsa-miR-625* hsa-miR-140-3p hsa-miR-943 kshv-miR-K12-3 hsa-miR-20a hsa-miR-371-5p hsa-miR-28-5p hsa-miR-526b* hsa-miR-675 hsa-miR-25* hsa-miR-28-5p hsa-miR-150 ebv-miR-BHRFI-2 hsa-miR-30c hsa-miR-181a BL = Burkitt lymphoma, ABC = activated B-cell DLBCL, CLL = chronic lymphocytic lymphoma

TABLE 8 Predictor microRNAs that distinguish activated B-cell (ABC) DLBCL from Burkitt Lymphoma and chronic lymphocytic leukemia ABCvsBL ABCvsCLL hsa-miR-182 hsa-miR-193b hsa-miR-377 hsa-miR-99b hsa-miR-660 hsa-miR-551a hsa-miR-595 mghv-miR-MI-7-3p ebv-miR-BARTI0 hsa-miR-585 hsa-miR-532-5p hsa-miR-617 hsa-miR-200c* hsa-miR-629* hsa-miR-362-3p hsa-miR-575 hsa-miR-455-3p kshv-miR-K12-6-5p hsa-miR-128 hsa-miR-193a-5p hsa-miR-21* hsa-miR-30e hsa-miR-589 hsa-miR-296-3p hsa-miR-135a* hsa-miR-518b hsa-miR-532-3p hsa-miR-492 hsa-miR-548d-5p hsa-miR-220c hsa-miR-652 hsa-miR-326 hsa-miR-150* hsa-miR-671-5p hsa-miR-330-5p hsa-miR-340* hsa-miR-339-3p hsa-miR-150 hsa-miR-502-3p hsa-miR-193b* BL = Burkitt lymphoma, CLL = chronic lymphocytic lymphoma.

TABLE 9 Predictor microRNAs that distinguish Burkitt lymphoma from chronic lymphocytic leukemia BLvsCLL hsa-miR-130b hsa-miR-154 hsa-miR-155 hsa-miR-29b hsa-miR-29c hsa-miR-637 hsa-miR-658 hsa-miR-193a-5p hsa-miR-886-5p hsa-miR-768-5p hsa-miR-101 hsa-miR-933 hsa-miR-371-5p hsa-miR-675 hsa-miR-150 hsa-miR-874 hsa-miR-181a hsa-miR-30c ebv-miR-BHRFI-2 hsa-miR-628-3p CLL = chronic lymphocytic lymphoma

We tested the performance of the predictor using leave-one-out cross-validation applied to the predictors for Burkitt lymphoma, chronic lymphocytic leukemia, activated B-cell diffuse large B-cell lymphoma, and germinal center B-cell DLBCL. For a sample prediction to be correct, it had to be classified correctly in each pair-wise comparison with all remaining entities. We found it to be over 90% accurate in the identification of each entity. See FIG. 10.

We next expanded the analysis to include follicular lymphoma and Hodgkin's lymphoma. We included the samples from the earlier study and we undertook miRNA profiling of the following additional samples: normal lymph nodes (N=5) and patients with germinal center B cell-like (GCB) DLBCL (N=10), activated B cell-like (ABC) DLBCL (N=10), chronic lymphocytic leukemia (N=10), Burkitt lymphoma (N=10), follicular lymphoma (N=10), and Hodgkin's lymphoma (N=9). As before, microRNA profiling revealed that each B cell malignancy type had a distinctive pattern of miRNA expression. See FIG. 11.

From that data, we identified microRNAs that can be used to distinguish each of the six B cell malignancies analyzed from the other five. Lists of those microRNAs, and whether they are expressed in high levels or low levels relative to the other 5 B cell malignancies, are shown in Tables 10 through 13. In certain embodiments, each of those microRNAs could be used to distinguish one of the six B cell malignancies from the other five. High and low in the table refer to at least a 2 fold difference when compared to other lymphomas and benign lymph nodes.

TABLE 10 Predictor microRNAs that distinguish Burkitt lymphoma, germinal center B-cell (GCB) DLBCL, and follicular lymphoma from all other B cell malignancies in the study BL vs GCB vs FL vs BL miRNA list others GCB miRNA list others FL miRNA list others hsa-miR-106a High hsa-miR-93/mmu-miR- High hsa-miR-96/mmu-miR- High hsa-miR-17/mmu- High 93/rno-miR-93 96/rno-miR-96 miR-17/rno-miR-17- hsa-miR-886-3p High hsa-miR-138/mmu-miR- High 5p/rno-miR-17 hsa-miR-365/mmu-miR- High 138/rno-miR-138 hsa-miR-628-3p High 365/rno-miR-365 hsa-miR-342-5p/mmu- High hsa-miR-193a-5p High hsa-miR-378/mmu-miR- High miR-342-5p/rno-miR-342- hsa-miR-371-5p High 378/rno-miR-378 5p hsa-miR-20a/mmu- High hsa-miR-320/mmu-miR- High hsa-miR-337-3p High miR-20a/rno-miR-20a 320/rno-miR-320 hsa-miR-301a/mmu-miR- High hsa-miR-23a/mmu- Low hsa-miR-103/mmu-miR- High 301a/rno-miR-301a miR-23a/rno-miR-23a 103/rno-miR-103 hsa-miR-922 High hsa-miR-27a/mmu- Low hsa-miR-637 High hsa-miR-744/mmu-miR- High miR-27a/rno-miR-27a hsa-miR-148a/mmu- High 744 hsa-miR-34b/mmu- Low miR-148a hsa-miR-221* High miR-34b-3p hsa-miR-199a-3p/hsa- High hsa-miR-215 High hsa-miR-21/mmu- Low miR-199b-3p/mmu-miR- hsa-miR-197/mmu-miR- High miR-21/rno-miR-21 199a-3p/mmu-miR- 197 hsa-miR-29a/mmu- Low 199b/rno-miR-199a-3p hsa-miR-92b/mmu-miR- High miR-29a/rno-miR-29a hsa-miR-126*/mmu- High 92b/rno-miR-92b hsa-let-7b/mmu-let- Low miR-126-5p/rno-miR- hsa-miR-218-2*/mmu- High 7b/rno-let-7b 126* miR-218-2*/rno-miR- hsa-let-7f/mmu-let- Low kshv-miR-K12-6-3p High 218* 7f/rno-let-7f hsa-miR-125a-5p/mmu- High hsa-miR-636 High hsa-miR-29b/mmu- Low miR-125a-5p/rno-miR- hsa-miR-600 High miR-29b/rno-miR- 125a-5p kshv-miR-K12-7 High 29b hsa-miR-551b/mmu- Low hsa-miR-194/mmu-miR- High hsa-miR-549 Low miR-551b/rno-miR-551b 194/rno-miR-194 hsa-miR-374a Low hsa-miR-923 Low hsa-miR-524-5p High hsa-miR-513a-5p Low hsa-miR-22*/mmu-miR- High hsa-miR-148a/mmu- Low 22*/rno-miR-22* miR-148a hsa-miR-34c-5p/mmu- High hsa-miR-223/mmu- Low miR-34c/rno-miR-34c miR-223/rno-miR-223 hsa-miR-151-3p High hsa-miR-138- Low hsa-miR-425/mmu-miR- High 1*/mmu-miR- 425/rno-miR-425 138*/rno-miR-138* ebv-miR-BART16 High hsa-miR-342- Low hsa-miR-20b* High 3p/mmu-miR-342- hsa-miR-574-3p/mmu- High 3p/rno-miR-342-3p miR-574-3p hsa-miR-146b- Low hsa-miR-155* High 5p/mmu-miR- hsa-miR-374b* High 146b/rno-miR-146b hsa-miR-497/mmu-miR- High hsa-miR-195/mmu- Low 497/rno-miR-497 miR-195/rno-miR-195 hsa-miR-708/mmu-miR- High hsa-miR-103/mmu- Low 708/rno-miR-708 miR-103/rno-miR-103 hsa-miR-92a/mmu-miR- High hsa-miR-888* Low 92a/rno-miR-92a hsa-miR-363/mmu- Low hsa-miR-361-3p High miR-363/rno-miR-363 hsa-miR-513a-3p High hsa-miR-140- Low hsa-miR-934 High 3p/mmu-miR- hsa-miR-363*/rno-miR- High 140*/rno-miR-140* 363* hsa-miR-191/mmu- Low mghv-miR-M1-3 High miR-191/rno-miR-191 hsa-miR-129* High hsa-miR-768-5p Low hsa-miR-148b/mmu-miR- High hsa-miR-222/mmu- Low 148b/rno-miR-148b-3p miR-222/rno-miR-222 hsa-miR-493 High hsa-miR-668/mmu- Low hsa-miR-151-5p/mmu- High miR-668 miR-151-5p/rno-miR-151 hsa-miR-221/mmu- Low hsa-miR-146b-3p High miR-221/rno-miR-221 hsa-miR-886-5p High hsa-miR-24-1*/mmu- Low hsa-miR-331-3p/mmu- High miR-24-1*/rno-miR- miR-331-3p/rno-miR-331 24-1* hsa-miR-574-5p/mmu- High hsa-miR-29c/mmu- Low miR-574-5p miR-29c/rno-miR-29c hsa-miR-424 High hsa-miR-146a/mmu- Low hsa-miR-152/mmu-miR- High miR-146a/rno-miR- 152/rno-miR-152 146a hsa-miR-302a/mmu-miR- High hsa-miR-154/mmu- Low 302a miR-154/rno-miR-154 hsa-miR-181a/mmu-miR- High hsa-miR-215 Low 181a/rno-miR-181a hsa-miR-487b/mmu- Low hsa-miR-509-5p High miR-487b/rno-miR- hsa-let-7d/mmu-let- High 487b 7d/rno-let-7d hsa-miR-155 Low hsa-miR-18b High hsa-miR-620 High hsa-miR-18a/mmu-miR- High 18a/rno-miR-18a hsa-miR-298 High hsa-miR-98/mmu-miR- High 98/rno-miR-98 hsa-miR-576-3p High hsa-miR-374b/mmu-miR- High 374/rno-miR-374 hsa-miR-32* High hsa-miR-302d* High ebv-miR-BART17-5p High hsa-miR-620 High hsa-miR-665 High hsa-miR-185/mmu-miR- High 185/rno-miR-185 hsa-miR-34b/mmu-miR- High 34b-3p hsa-let-7e/mmu-let- High 7e/rno-let-7e

TABLE 11 Predictor microRNAs that distinguish activated B-cell (ABC) DLBCL from all other B cell malignancies in the study ABC vs ABC miRNA list others hsa-miR-126/mmu-miR- High 126-3p/rno-miR-126 hsa-miR-125b/mmu-miR- High 125b-5p/rno-miR-125b-5p hsa-miR-145/mmu-miR- High 145/rno-miR-145 hsa-miR-22/mmu-miR- High 22/rno-miR-22 hsa-miR-21/mmu-miR- High 21/rno-miR-21 hsa-miR-199a-3p/hsa-miR- High 199b-3p/mmu-miR-199a- 3p/mmu-miR-199b/rno- miR-199a-3p hsa-miR-24/mmu-miR- High 24/rno-miR-24 hsa-miR-143/mmu-miR- High 143/rno-miR-143 hsa-miR-23b/mmu-miR- High 23b/rno-miR-23b hsa-miR-23a/mmu-miR- High 23a/rno-miR-23a hsa-miR-142-3p/mmu-miR- High 142-3p/rno-miR-142-3p hsa-let-7a/mmu-let-7a/rno- High let-7a hsa-miR-146b-5p/mmu- High miR-146b/rno-miR-146b hsa-miR-27a/mmu-miR- High 27a/rno-miR-27a hsa-miR-30a/mmu-miR- High 30a/rno-miR-30a hsa-miR-27b/mmu-miR- High 27b/rno-miR-27b hsa-let-7c/mmu-let-7c/rno- High let-7c hsa-miR-921 Low ebv-miR-BHRF1-2 Low hsa-miR-199a-5p/mmu- Low miR-199a-5p/rno-miR- 199a-5p hsa-miR-768-5p Low hsa-miR-491-3p Low hsa-miR-185/mmu-miR- Low 185/rno-miR-185 ebv-miR-BART17-5p Low hsa-miR-32* Low hsa-miR-335/mmu-miR- Low 335-5p/rno-miR-335 hsa-miR-149* Low hsa-miR-576-3p Low hsa-miR-214/mmu-miR- Low 214/rno-miR-214 hsa-miR-184/mmu-miR- Low 184/rno-miR-184 hsa-miR-520d-5p Low hsa-miR-518c* Low hsa-miR-801/mmu-miR-801 Low hsa-miR-298 Low hsa-miR-634 Low hsa-miR-583 Low hsa-miR-187* Low hsa-miR-30d/mmu-miR- Low 30d/rno-miR-30d hsa-miR-129-5p/mmu-miR- Low 129-5p/rno-miR-129 hsa-miR-300 Low hsa-miR-620 Low hsa-miR- Low 130b*/mmu-miR- 130b* hsa-miR-20b/mmu- Low miR-20b/rno-miR- 20b-5p kshv-miR-K12-3 Low hsa-miR-28-3p/rno- Low miR-28* hsa-miR-557 Low hsa-miR-150/mmu- Low miR-150/rno-miR- 150 hsa-miR-98/mmu- Low miR-98/rno-miR-98 hsa-miR-486- Low hsa-miR-518a- 5p/hsa-miR-527 hsa-miR-302d* Low hsa-miR-516a-5p Low hsa-miR-148b/mmu- Low miR-148b/rno-miR- 148b-3p hsa-miR-25* Low hsa-miR-374b/mmu- Low miR-374/rno-miR- 374 hsa-miR-638 Low hsa-miR-302a/mmu- Low miR-302a hsa-miR-99b*/mmu- Low miR-99b*/rno-miR- 99b* hsa-miR-29c*/mmu- Low miR-29c*/rno-miR- 29c* hsa-miR-138/mmu- Low miR-138/rno-miR- 138 hsa-miR-766 Low hsa-miR-488 Low hsa-miR-498 Low hsa-miR-339- Low 5p/mmu-miR-339- 5p/rno-miR-339-5p hsa-miR-193b* Low hsa-miR-299- Low 5p/mmu-miR- 299*/rno-miR-299 ebv-miR-BART8* Low hsa-miR-107/mmu- Low miR-107/rno-miR- 107 hsa-miR-519e* Low hsa-miR-146b-3p Low hsa-miR-552 Low hsa-miR-509-5p Low hsa-miR-574- Low 5p/mmu-miR-574- 5p hsa-miR-524-5p Low mghv-miR-M1-7-5p Low hsa-miR-659 Low hcmv-miR-UL148D Low hsa-miR-92a/mmu- Low miR-92a/rno-miR- 92a hsa-miR- Low 30e*/mmu-miR- 30e*/rno-miR- 30e* hsa-miR- Low 183*/mmu-miR- 183* hsa-miR-144* Low hsa-miR-574- Low 3p/mmu-miR-574- 3p hsa-miR-889 Low hsa-miR-525-5p Low kshv-miR-K12-8 Low hsa-miR-32/mmu- Low miR-32/rno-miR- 32 hsa-miR-938 Low hsa-miR-198 Low hsa-miR- Low 186/mmu-miR- 186/rno-miR-186 hsa-miR- Low 18a/mmu-miR- 18a/rno-miR-18a hsa-miR-516b Low hsa-miR-625* Low hsa-miR-551b* Low hsa-miR-885-5p Low hsa-miR-891a Low hsa-miR- Low 340/mmu-miR- 340-5p/rno-miR- 340-5p hsa-let-7d/mmu- Low let-7d/rno-let-7d hsa-miR-151- Low 5p/mmu-miR-151- 5p/rno-miR-151 hsa-miR-18b Low ebv-miR-BHRF1-1 Low hsa-miR-510 Low hsa-miR-625 Low mghv-miR-M1-8 Low ebv-miR-BART19- Low 3p hsa-miR-147 Low hsa-miR-28- Low 5p/mmu-miR- 28/rno-miR-28 ebv-miR-BART13 Low hsa-miR-25/mmu- Low miR-25/rno-miR- 25 hsa-miR-519d Low hsa-miR-361- Low 5p/mmu-miR- 361/rno-miR-361 hsa-miR-331- Low 3p/mmu-miR-331- 3p/rno-miR-331 hsa-miR-423- Low 3p/mmu-miR-423- 3p/rno-miR-423 hsa-miR-93/mmu- Low miR-93/rno-miR- 93

TABLE 12 Predictor microRNAs that distinguish chronic lymphocytic leukemia from all other B cell malignancies in the study CLL vs CLL miRNA list others hsa-miR- High 30e*/mmu-miR- 30e*/rno-miR-30e* hsa-miR-32/mmu- High miR-32/rno-miR-32 hsa-let-7g/mmu- High let-7g hsa-miR-186/mmu- High miR-186/rno-miR- 186 hsa-miR-140- High 5p/mmu-miR- 140/rno-miR-140 hsa-miR- High 196a*/mmu-miR- 196a*/rno-miR- 196a* hsa-miR- High 487b/mmu-miR- 487b/rno-miR-487b hsa-miR-150/mmu- High miR-150/rno-miR- 150 hsa-miR-147 High hsa-miR-486- High 5p/mmu-miR-486 hsa-miR-144* High hsa-miR-154/mmu- High miR-154/rno-miR- 154 hsa-miR-28- High 5p/mmu-miR- 28/rno-miR-28 hsa-miR-299- High 5p/mmu-miR- 299*/rno-miR-299 hsa-miR-33a/mmu- High miR-33/rno-miR-33 hsa-miR-363/mmu- High miR-363/rno-miR- 363 hsa-miR-891a High hsa-miR-768-5p High hsa-miR-361- High 5p/mmu-miR- 361/rno-miR-361 hsa-miR-519d High hsa-miR-335/mmu- High miR-335-5p/rno- miR-335 hsa-miR-668/mmu- High miR-668 hsa-let-7f/mmu-let- High 7f/rno-let-7f hsa-miR-24- High 1*/mmu-miR-24- 1*/rno-miR-24-1* hsa-miR-223/mmu- High miR-223/rno-miR- 223 hsa-miR-140- High 3p/mmu-miR- 140*/rno-miR-140* hsa-miR-144/mmu- High miR-144/rno-miR- 144 hsa-miR-638 High hsa-miR-30d/mmu- High miR-30d/rno-miR- 30d hsa-miR-423- High 3p/mmu-miR-423- 3p/rno-miR-423 hsa-miR-155 High hsa-miR-101/mmu- High miR-101a/rno-miR- 101a hsa-miR-20b/mmu- High miR-20b/rno-miR- 20b-5p hsa-miR-374a High hsa-miR-25/mmu- High miR-25/rno-miR-25 hsa-miR-199a- High 5p/mmu-miR-199a- 5p/rno-miR-199a- 5p hsa-miR-649 High hsa-miR-191/mmu- High miR-191/rno-miR- 191 hsa-miR-30e/mmu- High miR-30e/rno-miR- 30e hsa-miR-107/mmu- High miR-107/rno-miR- 107 hsa-miR-93/mmu- High miR-93/rno-miR-93 hsa-miR-29c/mmu- High miR-29c/rno-miR- 29c hsa-miR-541* High hsa-miR-888* High hsa-miR-549 High hsa-miR-19a/mmu- High miR-19a/rno-miR- 19a hsa-miR-342- High 3p/mmu-miR-342- 3p/rno-miR-342-3p hsa-miR-142- High 5p/mmu-miR-142- 5p/rno-miR-142-5p hsa-miR-801/mmu- High miR-801 hsa-let-7i/mmu-let- High 7i/rno-let-7i hsa-miR-26a/mmu- High miR-26a/rno-miR- 26a hsa-miR-15a/mmu- High miR-15a hsa-miR-195/mmu- High miR-195/rno-miR- 195 hsa-miR- High 106b/mmu-miR- 106b/rno-miR-106b hsa-miR-26b/mmu- High miR-26b/rno-miR- 26b hsa-miR-15b/mmu- High miR-15b/rno-miR- 15b hsa-miR-222/mmu- High miR-222/rno-miR- 222 hsa-miR-185/mmu- High miR-185/rno-miR- 185 hsa-miR-550 High hsa-let-7e/mmu- Low let-7e/rno-let-7e hsa-miR-24/mmu- Low miR-24/rno-miR-24 hsa-miR-30c- Low 2*/mmu-miR-30c- 2*/rno-miR-30c-2* hsa-miR-765 Low mghv-miR-M1-4 Low hsa-miR-933 Low hsa-miR-620 Low hsa-miR-30b* Low hsa-miR-658 Low hsa-miR-10a/mmu- Low miR-10a/rno-miR- 10a-5p hsa-miR-665 Low hsa-miR-185* Low hsa-miR-503 Low hsa-miR-126*/mmu-miR- Low 126-5p/rno-miR-126* hsa-miR-10b/mmu-miR- Low 10b/rno-miR-10b hsa-miR-628-3p Low hsa-miR-422a Low hsa-miR-193a-5p Low hsa-miR-143/mmu-miR- Low 143/rno-miR-143 hsa-miR-371-5p Low hsa-miR-100/mmu-miR- Low 100/rno-miR-100 hsa-miR-365/mmu-miR- Low 365/rno-miR-365 hsa-miR-145/mmu-miR- Low 145/rno-miR-145 kshv-miR-K12-6-3p Low ebv-miR-BART6-3p Low hsa-miR-220c Low hsa-miR-519c-5p/hsa-miR- Low 519b-5p/hsa-miR-523*/hsa- miR-518e*/hsa-miR- 522*/hsa-miR-519a* hsa-miR-130a/mmu-miR- Low 130a/rno-miR-130a hsa-miR-424 Low hsa-miR-483-5p Low hsa-miR-193b Low hsa-miR-637 Low hsa-miR-920 Low hsa-miR-488 Low ebv-miR-BHRF1-2 Low hsa-miR-526b Low hsa-miR-126/mmu-miR-126- Low 3p/rno-miR-126 hsa-miR-943 Low hsa-miR-199a-3p/hsa-miR- Low 199b-3p/mmu-miR-199a- 3p/mmu-miR-199b/rno-miR- 199a-3p mghv-miR-M1-3 Low hsa-miR-934 Low hsa-miR-886-5p Low hsa-miR-200b*/mmu-miR- Low 200b* hsa-miR-485-3p/mmu-miR- Low 485* hsa-miR-181a/mmu-miR- Low 181a/rno-miR-181a hsa-miR-125b/mmu-miR- Low 125b-5p/rno-miR-125b-5p

TABLE 13 Predictor microRNAs that distinguish Hodgkin's lympoma from all other B cell malignancies in the study HL vs HL miRNA list others hsa-miR-338- High 5p/mmu-miR-338- 5p/rno-miR-338* hsa-miR-433/mmu- High miR-433/rno-miR- 433 hsa-miR-552 High hsa-miR-202 High hsa-miR-299-3p High hsa-miR-509-3-5p High hsa-miR-490-5p High hsa-miR-508-5p High hsa-miR-181a-2* High hsa-miR-663 High hsa-miR-326/mmu- High miR-326/rno-miR- 326 hsa-miR-542- High 3p/mmu-miR-542- 3p/rno-miR-542-3p hsa-miR-492 High hsa-miR-584 High hsa-miR-654-5p High ebv-miR-BART20-3p High hsa-miR-542- High 5p/mmu-miR-542- 5p/rno-miR-542-5p ebv-miR-BART9* High hsa-miR-124/mmu- High miR-124/rno-miR- 124 hsa-miR-551a High hsa-miR-208a/mmu- High miR-208a/rno-miR- 208 hsa-miR-220b High hsa-miR-615- High 3p/mmu-miR-615-3p hsa-miR- High 135a*/mmu-miR- 135a* hiv1-miR-H1 High hsa-miR-124*/mmu- High miR-124*/rno-miR- 124* hsa-miR-502-5p High hsa-miR-92b* High hsa-miR-518a-3p High hsa-miR-377* High hsa-miR-125a- High 3p/mmu-miR-125a- 3p/rno-miR-125a-3p hsa-miR-30c- High 1*/mmu-miR-30c- 1*/rno-miR-30c-1* hsa-miR-650 High hsa-miR-629 High hsa-miR-296- High 3p/mmu-miR-296- 3p/rno-miR-296 hsa-miR-425*/mmu- High miR-425* hsa-miR-514 High hsa-miR-519e High hsa-miR-938 High hsa-miR-340*/mmu- High miR-340-3p/rno- miR-340-3p hsa-miR-657 High hsa-miR-9*/mmu- High miR-9*/rno-miR-9* ebv-miR-BART7* High hsa-miR-612 High hsa-miR-640 High hsa-miR-623 High hsa-miR-99b*/mmu- High miR-99b*/rno-miR- 99b* hsa-miR-645 High hsa-miR-484/mmu- High miR-484/rno-miR- 484 hsa-miR-376a* High hsa-miR-345 High hsa-miR-586 High hsa-miR-622 High hsa-miR-206/mmu- High miR-206/rno-miR- 206 hcmv-miR-US25-1* High hsa-miR-302c* High hsa-miR- High 106b*/mmu-miR- 106b*/rno-miR- 106b* hsa-miR-500 High hsa-miR-890 High hsa-miR-10a*/mmu- High miR-10a*/rno-miR- 10a-3p kshv-miR-K12-1 High hsa-miR-629* High hsa-miR-193b* High ebv-miR-BHRF1-3 High hsa-miR-183/mmu- High miR-183/rno-miR- 183 hsa-let-7b*/mmu- High let-7b*/rno-let-7b* hsa-miR-409- High 5p/mmu-miR-409- 5p/rno-miR-409-5p hsa-miR-585 High hsa-miR-526b* High hsa-miR-337-3p High hsa-miR-212/mmu- High miR-212/rno-miR- 212 hsa-miR-548b-3p High hcmv-miR-UL112 High hsa-miR-601 High hsa-let-7d*/mmu- High let-7d*/rno-let-7d* hsa-miR-181b/mmu- High miR-181b/rno-miR- 181b hsa-miR-195* High kshv-miR-K12-5 High hsa-miR-500* High hsa-miR-24- High 2*/mmu-miR-24- 2*/rno-miR-24-2* hsa-miR-382/mmu- High miR-382/rno-miR- 382 ebv-miR-BART8* High hsa-miR-125b- High 2*/rno-miR-125b* hsa-miR-194* High hsa-miR-297/mmu- High miR-297a hsa-miR-610 High hsa-miR-575 High hsa-miR-21* High hsa-miR-936 High kshv-miR-K12-6-5p High hsa-miR-553 High hsa-miR-652/mmu- High miR-652/rno-miR- 652 hsa-miR-877/mmu- High miR-877/rno-miR- 877 hsa-miR-526a/hsa- High miR-520c-5p/hsa- miR-518d-5p hsa-miR-122* High hsa-miR-576-5p High mghv-miR-M1-6 High hsa-miR-551b* High hsa-miR-125b- High 1*/mmu-miR-125b- 3p/rno-miR-125b- 3p hsa-miR-137/mmu- High miR-137/rno-miR- 137 ebv-miR-BART18-3p High hsa-miR-452 High hsa-miR-23a*/rno- High miR-23a* hsa-miR-617 High hsa-miR-550* High hsa-miR-557 High hsa-miR-331- High 5p/mmu-miR-331- 5p hsa-miR-296- High 5p/mmu-miR-296- 5p/rno-miR-296* mghv-miR-M1-2 High ebv-miR-BART6-3p High hsa-miR-518b High hsa-miR-99b/mmu- High miR-99b/rno-miR- 99b hsa-miR-525-5p High hsa-miR-589 High hsa-miR-7-2* High hsa-miR-490- High 3p/mmu-miR-490 hsa-miR- High 150*/mmu-miR- 150* hsa-miR-17*/rno- High miR-17-3p hsa-miR-509-3p High ebv-miR-BHRF1-1 High hsa-miR- High 183*/mmu-miR- 183* hsa-miR-635 High hsa-miR- High 130b/mmu-miR- 130b/rno-miR-130b mghv-miR-M1-8 High hsa-miR-887 High hsa-miR-210/mmu- High miR-210/rno-miR- 210 hsa-miR-766 High hsa-miR-671- High 5p/mmu-miR-671- 5p hsa-miR-659 High hsa-miR-330- High 5p/mmu-miR- 330/rno-miR-330 hsa-miR-323- High 3p/mmu-miR-323- 3p/rno-miR-323 ebv-miR-BART13 High ebv-miR-BART5 High hsa-miR-602 High hcmv-miR-UL148D High hsa-miR-373* High hsa-miR-526b High hsa-miR-328/mmu- High miR-328/rno-miR- 328 hsa-miR-874/mmu- High miR-874/rno-miR- 874 ebv-miR-BART19-3p High hsa-miR-595 High hsa-miR-889 High mghv-miR-M1-7-5p High hsa-miR-483-5p High hsa-miR- High 487b/mmu-miR- 487b/rno-miR-487b hsa-miR-675 High hsa-miR-220c High mghv-miR-M1-7-3p High hsa-miR-485- High 3p/mmu-miR-485* hsa-miR-198 High hsa-miR-483-3p High hcmv-miR-UL70-3p High hsa-miR-149/mmu- High miR-149 hsa-miR-516a-5p High hsa-miR- High 145*/mmu-miR- 145* hsa-miR-656 High hsa-miR-502-3p High hsa-miR-29c*/mmu-miR- High 29c*/rno-miR-29c* hsa-miR-937 High hsa-miR-515-5p High hsa-miR-153/mmu-miR- High 153/rno-miR-153 hsa-miR-519e* High hsa-miR-128/mmu-miR- High 128/rno-miR-128 hsa-miR-516b High hsa-miR-532-5p/mmu-miR- High 532-5p/rno-miR-532-5p kshv-miR-K12-8 High hsa-miR-455-3p High hsa-miR-27a*/mmu-miR- High 27a*/rno-miR-27a* hsa-miR-510 High hsa-miR-505/rno-miR-505 High hsa-miR-187* High hsa-miR-498 High hsa-miR-625 High hsa-miR-129-5p/mmu-miR- High 129-5p/rno-miR-129 ebv-miR-BHRF1-2 High hsa-miR-143* High kshv-miR-K12-3 High hsa-miR-660 High hsa-miR-25* High hsa-miR-29a*/mmu-miR- High 29a*/rno-miR-29a* hsa-miR-422a High hsa-miR-518a-5p/hsa-miR- High 527 hsa-miR-519c-5p/hsa-miR- High 519b-5p/hsa-miR- 523*/hsa-miR-518e*/hsa- miR-522*/hsa-miR-519a* hsa-miR-28-3p/rno-miR-28* High hsa-miR-300 High hsa-miR-130a/mmu-miR- High 130a/rno-miR-130a hsa-miR-583 High hsa-miR-149* High hsa-miR-184/mmu-miR- High 184/rno-miR-184 hsa-miR-625* High hsa-miR-99a/mmu-miR- High 99a/rno-miR-99a hsa-miR-199b-5p High hsa-miR-513a-5p High hsa-miR-494/mmu-miR- High 494/rno-miR-494 mghv-miR-M1-4 High hsa-miR-634 High hsa-miR-923 High hsa-miR-503 High ebv-miR-BART2-3p High hsa-miR-520d-5p High hsa-miR-30b* High hsa-miR-30c-2*/mmu-miR- High 30c-2*/rno-miR-30c-2* hsa-miR-658 High hsa-miR-921 High hsa-miR-423-5p/mmu-miR- High 423-5p hsa-miR-933 High hsa-miR-23b/mmu-miR- Low 23b/rno-miR-23b hsa-miR-27b/mmu-miR- Low 27b/rno-miR-27b hsa-miR-550 Low hsa-let-7a/mmu-let-7a/rno- Low let-7a hsa-miR-24/mmu-miR- Low 24/rno-miR-24 hsa-miR-451/mmu-miR- Low 451/rno-miR-451 hsa-miR-30a/mmu-miR- Low 30a/rno-miR-30a hsa-miR-20b/mmu-miR- Low 20b/rno-miR-20b-5p hsa-miR-26a/mmu-miR- Low 26a/rno-miR-26a hsa-miR-26b/mmu-miR- Low 26b/rno-miR-26b hsa-miR-101/mmu-miR- Low 101a/rno-miR-101a hsa-miR-106b/mmu-miR- Low 106b/rno-miR-106b hsa-miR-16/mmu-miR- Low 16/rno-miR-16 hsa-miR-29b/mmu-miR- Low 29b/rno-miR-29b hsa-miR-768-3p Low hsa-miR-30e/mmu-miR- Low 30e/rno-miR-30e hsa-miR-106a Low hsa-miR-142-5p/mmu-miR- Low 142-5p/rno-miR-142-5p hsa-miR-144/mmu-miR- Low 144/rno-miR-144 hsa-miR-17/mmu-miR- Low 17/rno-miR-17-5p/rno-miR- 17 hsa-miR-15b/mmu-miR- Low 15b/rno-miR-15b hsa-miR-30c/mmu-miR- Low 30c/rno-miR-30c hsa-miR-142-3p/mmu-miR- Low 142-3p/rno-miR-142-3p hsa-miR-20a/mmu-miR- Low 20a/rno-miR-20a hsa-miR-30b/mmu-miR- Low 30b/rno-miR-30b-5p hsa-miR-19a/mmu-miR- Low 19a/rno-miR-19a hsa-miR-19b/mmu-miR- Low 19b/rno-miR-19b

From the data in Tables 10 through 13, we identified subsets of microRNAs that are sufficient to distinguish each of the six B cell malignancies from the other five. We selected only microRNAs that are expressed more highly in the selected B cell malignancy. Those microRNAs are listed in Tables 14 and 15. In certain embodiments, each of the microRNAs listed in Tables 14 and 15 can be used to distinguish one B cell malignancy from the other five.

TABLE 14 Predictor microRNAs that distinguish activated B-cell (ABC) DLBCL, germinal center B-cell like (GCB) DLBCL, and Burkitt lymphoma ABC High GCB High BL High hsa-miR-22/mmu-miR-22/rno-miR- hsa-miR-93/mmu-miR-93/rno-miR-93 hsa-miR-628- 22 hsa-miR-103/mmu-miR-103/rno-miR-103 3p hsa-miR-21/mmu-miR-21/rno-miR- hsa-miR-320/mmu-miR-320/rno-miR-320 21 hsa-miR-125a-5p/mmu-miR-125a-5p/rno-miR- hsa-miR-24/mmu-miR-24/rno-miR- 125a-5p 24 hsa-miR-23b/mmu-miR-23b/rno- miR-23b hsa-miR-23a/mmu-miR-23a/rno- miR-23a hsa-let-7a/mmu-let-7a/rno-let-7a hsa-let-7c/mmu-let-7c/rno-let-7c

TABLE 15 Predictor microRNAs that distinguish chromic lymphocytic leukemia, follicular lymphoma, and Hodgkin's lymphoma CLL High FL High HL High hsa-miR-32/mmu-miR-32/rno- hsa-miR-152/mmu-miR- hsa-miR-498 miR-32 152/rno-miR-152 hsa-miR-525-5p hsa-miR-150/mmu-miR-150/rno- hsa-miR-885-5p hsa-miR-551b* miR-150 hsv1-miR-H1 hsa-miR-340*/mmu-miR-340- hsa-miR-140-5p/mmu-miR- hsa-miR-548d-5p 3p/rno-miR-340-3p 140/rno-miR-140 hsa-miR-488 hsa-miR-494/mmu-miR-494/rno- hsa-let-7g/mmu-let-7g ebv-miR-BART16 miR-494 hsa-miR-154/mmu-miR-154/rno- hsa-miR-22*/mmu-miR- hsa-miR-183*/mmu-miR-183* miR-154 22*/rno-miR-22* hsa-miR-659 hsa-miR-486-5p/mmu-miR-486 hsa-miR-513a-3p hsa-miR-193b* hsa-miR-101/mmu-miR- hsa-miR-708/mmu-miR- hsa-miR-766 101a/rno-miR-101a 708/rno-miR-708 hsa-miR-516a-5p hsa-miR-30e/mmu-miR-30e/rno- hsa-miR-425/mmu-miR- hsa-miR-125b-1*/mmu-miR- miR-30e 425/rno-miR-425 125b-3p/rno-miR-125b-3p hsa-miR-768-5p hsa-miR-337-3p ebv-miR-BART6-3p hsa-miR-363/mmu-miR-363/rno- ebv-miR-BART17-5p ebv-miR-BART8* miR-363 hsa-miR-221* hsa-miR-509-3-5p hsa-miR-668/mmu-miR-668 hsa-miR-92b/mmu-miR- hsa-miR-602 hsa-miR-147 92b/rno-miR-92b ebv-miR-BHRF1-1 hsa-miR-196a*/mmu-miR- hsa-miR-197/mmu-miR-197 mghv-miR-M1-2 196a*/rno-miR-196a* hsa-miR-32* hsa-miR-145*/mmu-miR-145* hsa-miR-142-5p/mmu-miR-142- hsa-miR-342-5p/mmu-miR- hsa-miR-296-5p/mmu-miR-296- 5p/rno-miR-142-5p 342-5p/rno-miR-342-5p 5p/rno-miR-296* hsa-miR-199a-5p/mmu-miR- hsa-miR-524-5p hsa-miR-17*/rno-miR-17-3p 199a-5p/rno-miR-199a-5p hsa-miR-34c-5p/mmu-miR- hsa-miR-452 hsa-miR-24-1*/mmu-miR-24- 34c/rno-miR-34c hsa-miR-326/mmu-miR-326/rno- 1*/rno-miR-24-1* hsa-let-7e/mmu-let-7e/rno-let- miR-326 hsa-miR-891a 7e hsa-miR-652/mmu-miR-652/rno- hsa-miR-550 hsa-miR-151-3p miR-652 hsa-miR-801/mmu-miR-801 hsa-miR-744/mmu-miR-744 hsa-miR-623 hsa-miR-549 hsa-miR-574-3p/mmu-miR- hsa-miR-194* hsa-miR-888* 574-3p hsa-miR-125a-3p/mmu-miR- hsa-miR-600 125a-3p/rno-miR-125a-3p hsa-miR-20b* hsa-miR-10a*/mmu-miR- hsa-miR-194/mmu-miR- 10a*/rno-miR-10a-3p 194/rno-miR-194 hsa-miR-519e hsa-miR-363*/rno-miR-363* hsa-miR-502-5p hsa-miR-155* hsa-miR-124*/mmu-miR- hsa-miR-34b/mmu-miR-34b-3p 124*/rno-miR-124* hsa-miR-922 hsa-miR-345 hsa-miR-497/mmu-miR- hsa-miR-584 497/rno-miR-497 hsa-miR-650 hsa-miR-493 hsa-miR-202 hsa-miR-138/mmu-miR- hsa-miR-548b-3p 138/rno-miR-138 hsa-miR-492 hsa-miR-215 hsa-miR-135a*/mmu-miR-135a* hsa-miR-302a/mmu-miR-302a ebv-miR-BART20-3p hsa-miR-96/mmu-miR-96/rno- hsa-miR-586 miR-96 hsa-miR-338-5p/mmu-miR-338- hsa-miR-218-2*/mmu-miR- 5p/rno-miR-338* 218-2*/rno-miR-218* hsa-miR-92b* kshv-miR-K12-7 hiv1-miR-H1 hsa-miR-301a/mmu-miR- hsa-miR-508-5p 301a/rno-miR-301a hsa-miR-542-5p/mmu-miR-542- 5p/rno-miR-542-5p hsa-miR-490-5p hsa-miR-663 hsa-miR-433/mmu-miR-433/rno- miR-433

Finally, we identified sets of microRNAs that can distinguish between each pair of B cell malignancies in the study. Lists of those microRNAs are shown in Appendix B, Tables 16 to 30. In certain embodiments, each of the listed microRNAs is sufficient to distinguish between the two B cell malignancies listed in the table description.

The consistent expression of a number of miRNAs in a diverse set of B cell malignances suggests a role for miRNAs in the maintenance of tumor phenotype. Assays for stage-specific B cell markers such as BCL6, a marker for GC cells, are essential in the clinical diagnosis of B cell malignancies. Our data suggest that stage-specific biology in B cell malignancies is retained at the miRNA level. Recent work has demonstrated the utility of gene expression profiling in reliably distinguishing closely related B cell malignancies. See Hummel et al. N Engl J Med. 2006; 354:2419-2430; Dave et al. N Engl J Med. 2006; 354:2431-2442. However, clinical translation of gene expression profiling has proved to be difficult because of the need for freshly frozen tissue. Since intact miRNAs can be isolated from tissues preserved using standard methods (see, e.g., Doleshal et al. J Mol Diagn. 2008; 10:203-211; Xi et al. Rna. 2007; 13:1668-1674), diagnostic methods based upon miRNA profiles could be fairly easy to translate to clinical use.

Interestingly, in contrast to a previous study (Lu et al. Nature 2005; 435:834-838), we did not note a decrease in the expression of the total number or overall expression levels of miRNAs in B cell malignancies compared to normal lymph nodes. Although B cell malignancies maintain the expression of a number of stage-specific miRNAs, their miRNA expression patterns are clearly deranged compared to normal lymph nodes. The consequences of altered miRNA expression in B cell tumors would be important to explore in future studies.

In conclusion, our study demonstrates that mature B cell subsets have distinct patterns of microRNA expression, suggesting a role for miRNAs in B cell differentiation. We provide experimental evidence that transcription factors such as LM02 and PRDM1 are direct targets of differentially expressed miRNAs. B cell malignancies demonstrate a distinct pattern of miRNA expression that could be useful in distinguishing morphologically identical subtypes of these tumors. The conserved expression of stage-specific microRNAs in normal and malignant B cells suggests a role for microRNAs in the maintenance of the mature B cell phenotype.

Example 6 Differential Expression of miRNAs in ABC DLBCL Vs. GBC DLBCL Malignancies

As discussed above, microRNAs have shown promise as biomarkers in a number of malignancies. Diffuse large B cell lymphoma (DLBCL) is the most common form of lymphoma and is known to comprise at least 2 molecularly distinct subgroups with different responses to standard therapy. These two distinct subgroups are typically identified as ABC DLBCL and GC (or GCB) DLBCL.

However, the current methods used to distinguish GCB from non GCB DLBCL are limited fashion and can yield inconsistent results. While gene expression profiling remains the gold standard for distinguishing these 2 molecular subgroups it is not routinely performed in clinical laboratories. In an effort to expand and improve the existing analytical options we sought to develop microRNA-based assays. We created RNA libraries from 31 different samples and performed deep sequencing analysis to identify the present miRNAs.

Small RNA Library Creation and Deep Sequencing

Total RNA was extracted from the 31 samples using the phenol-chloroform method to preserve microRNAs, using Ambion reagents. Total RNA (typically 5 μg) from each sample was run on denaturing polyacrylamide-urea gels. The ˜17-25 nucleotide RNAs were excised from the gel, ligated to sequencing adaptors on both ends and reverse transcribed. The resulting cDNA library was PCR-amplified for 15 cycles and gel purified on 6% acrylamide gel. The gel-purified amplicon quality and quantity were analyzed on a 6% acrylamide gel relative to oligonucleotides of known concentration and size. 120 μl of 1-4 μM library were loaded on to the Illumina cluster station, where DNA molecules were attached to high-density universal adaptors in the flow cells and amplified. The DNA clusters generated via this process were sequenced with sequencing-by-synthesis technology, where successive high-resolution images of the four-color fluorescence excitation dependent on the base incorporated during each cycle were captured. Sequencing reads were generated for each of the 31 samples and base calls were rendered using Illumina software. All the primary sequencing data and gene expression data is publicly available through the GEO archive through accession GSE22898.

The small RNA libraries from the 31 samples which were subjected to massively parallel, high-throughput sequencing using the Illumina platform generated a total of 328 million separate reads. Our approach to analyzing the sequences and discovering microRNAs broadly follows a previously described method (see, Zheng, Q., et al. GOEAST: a web-based software toolkit for Gene Ontology enrichment analysis, Nucleic acids Res. 2008; 36 (Web Server issue: W358-363). All bioinformatics analyses were performed using a cluster of 1024 Linux computer nodes. Preprocessing was carried out using locally written Shell and Perl scripts.

From the raw sequences generated by high-throughput sequencing, the 3′- and 5′-adaptor sequences were trimmed. Low quality sequences were identified as those sequencing reads that contained stretches of consecutive identical bases or uncalled nucleotides (N) in the first 12 bases and sequencing reads shorter than 17 nucleotides. To minimize redundancy, reads were initially curtailed to the first 22 nucleotides and identical sequences were represented with a single fasta entry for analysis. Each unique sequence was mapped to the reference genome (Ensembl, build 50) and reads were filtered such that only perfect alignments (full length, 100% identity) were retained. Reads that aligned to more than five positions in the genome and reads that overlapped with the UCSC RNA genes were identified and excluded from microRNA analysis.

Identification and Analysis of the Captured miRNA Sequences

Sequences that occurred 20 or more times in at least one sample were consolidated and annotated for the 31 samples. Genomic loci that overlapped with microRNAs described in miRBase (version 13) were identified as known microRNAs (see Table 31). The remaining genomic loci were identified as encoding candidate novel microRNAs (see Table 32).

The vast majority (96%) of the candidate novel microRNAs were found in more than one sample, with only a small minority of microRNAs were expressed exclusively in a specific B cell subset or malignancy. Many of the microRNAs that we identified in normal and malignant B cells were expressed at ten-fold or higher levels in these non B cell cases. These findings suggest that the microRNAs we have identified are broadly expressed and may have roles in a number of diverse tissue types.

miRNA Profiling Using Real-Time PCR

miRNA expression profiling was conducted using the Applied Biosystems 384-well multiplexed real-time PCR assay using 400 ng of total RNA. Eight reactions, each containing 50 ng of RNA and a multiplex looped primer pool with endogenous small nucleolar (sno)-RNA controls, were used to reverse-transcribe the miRNAs in parallel fashion (see Tables 33 and 34 for primers). The completed reactions were loaded onto the 384-well plate per manufacturer's instructions, and real-time PCR was run on the ABI 7900HT Prism instrument. For each 384-well plate, we used the automatically determined cycle-threshold (CT) using the SDS 2.2.1 software (Applied Biosystems). Consistent with manufacturer recommendations, a CT greater than 35 was treated as undetected. The probes deemed to be present were normalized to the average expression of a sno-RNA control. The expression values were calculated as 2−ΔCT, then median centered to 500 and log 2-transformed.

For further validation of the deep sequencing results, we selected candidate novel microRNAs (see Table 34) that were detectably measured in at the sequencing data from least one of four diffuse large B cell lymphoma (DLBCL) cases. Using stem-loop reverse transcription (Ashburner, M., et al., Nat Genet. (2000); 25(1):25-29) for quantitative PCR, we tested the expression of the candidate microRNAs in 101 primary tumors from patients with DLBCL and found that about 92% were detectably measured by real-time PCR in at least 10% of these cases, suggesting that real-time PCR reproducibly identifies microRNAs that are expressed in lymphomas. We also used real-time PCR to measure the expression of known microRNAs (see Table 33) in the same 101 samples and found that over 90% of these were also detected in at least 10% of the cases using real-time PCR. We found that six of the seven RT-PCR constructs that targeted RNA hairpins that had low probability of being a microRNA resulted in no detectable signal. These results suggest that our assays have high specificity for microRNAs and that the computational predictions based on our sequencing data correctly identified microRNAs.

Differentiating ABC DLBCL Vs. GCB DLBCL Malignancies

Gene expression profiling of patients with DLBCL has demonstrated that the tumors comprise at least two distinct diseases with different response rates to standard chemotherapy regimens (Chen, C., et al., Nucleic Acids Res. (2005); 33(20):e179). We hypothesized that microRNAs might be used to make this clinically important distinction for which gene expression profiling remains the gold standard. We performed gene expression profiling on 101 DLBCL cases and further subdivided these cases into the molecular subgroups.

Tumor samples from 101 patients with diffuse large B cell lymphoma were obtained at the time of diagnosis and freshly frozen. These cases were profiled using Affymetrix Gene 1.0 ST arrays. The molecular subgroups were distinguished using a Bayesian approach described previously (Ambros, V., et al., RNA (2003);9(3):277-279).

We found that 25 microRNAs with the highest t-statistic were equally efficacious as the gene expression profiling in differentiating the two groups of DLBCL with over 95% overlap between the classifications rendered by the two methods, using leave out one cross-validation (see Table 35). Interestingly, a subset of these 25 predictor microRNAs was candidate novel microRNAs, suggesting a biological and clinical relevance for these candidate novel microRNAs in DLBCL tumors.

Our work provides an exhaustive identification of the microRNAs in normal and malignant B cells; that is a prerequisite to the delineation of their role. Further, we have developed a comprehensive framework that spans the identification of microRNAs from deep sequencing data to measuring their expression using real-time PCR and validating their expression in primary human tumors.

It is also conceivable that some of the low-abundance microRNAs that we have identified in our study may be expressed at higher levels in other development stages or in other cell types. This notion is confirmed by our examination of the novel microRNAs in non B cell data. For instance, a number of the microRNAs that we discovered were also present at 10-fold or higher levels in cell lines derived from breast cancer and cervical cancer, suggesting that the microRNAs that we have discovered in B cells have broad biological significance.

Deep Sequencing Reveals a Novel miRNA Cluster that Regulates the TGF-β Pathway

Although microRNAs appear to be distributed throughout the genome, a number of microRNAs have been found in clusters such as miR-17-92 that are transcribed from a single primary transcript and cleaved into the individual microRNAs by the enzyme DROSHA. We found 2 separate clusters of candidate novel microRNAs on chromosome 9 and chromosome 14 (within the IgH locus), respectively. The first cluster was previously annotated as a hypothetical gene LOC100130622, and subsequently discarded from Refseq when no associated protein was identified. Our data demonstrate that this cluster (miR-2355), conserved only in primates, encodes 6 separate microRNAs: has-miR-2355a-1, has-miR-2356-1, has-miR-2355a-2, has-miR-2356-2, hsa-miR2355a-3, and hsa-miR-2355b (see Table 32 for sequence).

In order to evaluate whether the microRNAs encoded in these clusters originate from the same primary transcript, we took KMS12 multiple myeloma cells which express these microRNAs and used siRNA to knock-down the expression of the microRNA processing enzyme Drosha. This enzyme acts at the first step of microRNA processing by cleaving microRNA precursors from the primary transcript. We found that decreased Drosha expression was associated with increased accumulation of primary transcripts of both the miR-17-92 cluster as well as the novel miR-2355 cluster. MicroRNAs from miR-2355 cluster were found to be expressed more highly in normal germinal center (GC) B cells compared to memory cells.

The microRNAs of this cluster all share the same seed sequence, suggesting that they target the same genes. Among the computationally predicted targets of this microRNA cluster, we identified SMAD2 and SMAD3 which are well known mediators of the TGF-beta signaling pathway. We noted that gene expression of both SMAD2 and SMAD3 in our set of 101 DLBCLs were inversely correlated with this cluster (P<0.001, correlation test). Gene set enrichment analysis revealed that expression of the TGF-beta pathway in DLBCL samples varied inversely with the expression of the microRNA cluster, with a higher expression of the microRNA associated with a lower expression of the pathway (P<10−6), which has been noted as a factor in the biology of these tumors.

TABLE 31 miRNAs identified by deep sequencing analysis. Putative Mature/ miRBase miRBase SEQ Minor Mature/ Mature/Minor miRBase SEQ ID Mature Sequence miRNA  miRBase Minor Accession Mature/Minor ID NO. Captured ID ID ID Number Sequence NO.   1 CUGCGCAAGCUACUGCCUUGCU hsa-let- hsa-let- hsa-let- MIMAT0004585 CUGCGCAAGCUACUGCCUUGCU  393 7i* 7i 7i*   2 CCACGGAUGUUUGAGCAUGUGC hsa-mir- hsa-mir- hsa-miR- MIMAT0004516 ACGGAUGUUUGAGCAUGUGCUA  394 105-1* 105-1 105*   3 CCACGGAUGUUUGAGCAUGUGC hsa-mir- hsa-mir- hsa-miR- MIMAT0004516 ACGGAUGUUUGAGCAUGUGCUA  395 105-2* 105-2 105*   4 UACUGCAAUGUAAGCACUUCUU hsa-mir- hsa-mir- hsa-miR- MIMAT0004517 CUGCAAUGUAAGCACUUCUUAC  396 106a* 106a 106a*   5 CAUUAUUACUUUUGGUACGCG hsa-mir- hsa-mir- hsa-miR- MIMAT0000444 CAUUAUUACUUUUGGUACGCG  397 126* 126 126*   6 AAGCCCUUACCCCAAAAAGUAU hsa-mir- hsa-mir- hsa-miR- MIMAT0004548 AAGCCCUUACCCCAAAAAGUAU  398 129* 129-1 129*   7 AAGCCCUUACCCCAAAAAGCAU hsa-mir- hsa-mir- hsa-miR- MIMAT0004605 AAGCCCUUACCCCAAAAAGCAU  399 129-2* 129-2 129-3p   8 UCUACAGUGCACGUGUCUCCAG hsa-mir- hsa-mir- hsa-miR- MIMAT0000250 UCUACAGUGCACGUGUCUCCAG  400 139-5p 139 139-5p   9 CUGGUACAGGCCUGGGGGACAG hsa-mir- hsa-mir- hsa-miR- MIMAT0004610 CUGGUACAGGCCUGGGGGACAG  401 150* 150 150*  10 ACUGCAGUGAAGGCACUUGUAG hsa-mir- hsa-mir- hsa-miR- MIMAT0000071 ACUGCAGUGAAGGCACUUGUAG  402 17* 17 17*  11 UGAAUUACCGAAGGGCCAUAA hsa-mir- hsa-mir- hsa-miR- MIMAT0004560 GUGAAUUACCGAAGGGCCAUAA  403 183* 183 183*  12 AGGGGCUGGCUUUCCUCUGGUC hsa-mir- hsa-mir- hsa-miR- MIMAT0004611 AGGGGCUGGCUUUCCUCUGGUC  404 185* 185 185*  13 ACUGCCCUAAGUGCUCCUUCUGG hsa-mir- hsa-mir- hsa-miR- MIMAT0002891 ACUGCCCUAAGUGCUCCUUCUGG  405 18a* 18a 18a*  14 AACUGGCCUACAAAGUCCCAGU hsa-mir- hsa-mir- hsa-miR- MIMAT0000459 AACUGGCCUACAAAGUCCCAGU  406 193a-3p 193a 193a-3p  15 CGGGGUUUUGAGGGCGAGAUGA hsa-mir- hsa-mir- hsa-miR- MIMAT0004767 CGGGGUUUUGAGGGCGAGAUGA  407 193b* 193b 193b*  16 CCCAGUGUUCAGACUACCUGUUC hsa-mir- hsa-mir- hsa-miR- MIMAT0000231 CCCAGUGUUCAGACUACCUGUUC  408 199a-2* 199a-2 199a-5p  17 UAGUUUUGCAUAGUUGCACUAC hsa-mir- hsa-mir- hsa-miR- MIMAT0004490 AGUUUUGCAUAGUUGCACUACA  409 19a* 19a 19a*  18 AGUUUUGCAGGUUUGCAUCCAGC hsa-mir- hsa-mir- hsa-miR- MIMAT0004491 AGUUUUGCAGGUUUGCAUCCAGC  410 19b-1* 19b-1 19b-1*  19 ACUGUAGUAUGGGCACUUCCAG hsa-mir- hsa-mir- hsa-miR- MIMAT0004752 ACUGUAGUAUGGGCACUUCCAG  411 20b* 20b 20b*  20 ACCUGGCAUACAAUGUAGAUUU hsa-mir- hsa-mir- hsa-miR- MIMAT0004568 ACCUGGCAUACAAUGUAGAUUU  412 221* 221 221*  21 GGGUUCCUGGCAUGCUGAUUU hsa-mir- hsa-mir- hsa-miR- MIMAT0004587 UGGGUUCCUGGCAUGCUGAUUU  413 23b* 23b 23b*  22 AGGCGGAGACUUGGGCAAUUG hsa-mir- hsa-mir- hsa-miR- MIMAT0004498 AGGCGGAGACUUGGGCAAUUG  414 25* 25 25*  23 AGAGCUUAGCUGAUUGGUGAAC hsa-mir- hsa-mir- hsa-miR- MIMAT0004588 AGAGCUUAGCUGAUUGGUGAAC  415 27b* 27b 27b*  24 CUGGGAGGUGGAUGUUUACUUC hsa-mir- hsa-mir- hsa-miR- MIMAT0004589 CUGGGAGGUGGAUGUUUACUUC  416 30b* 30b 30b*  25 CUGGGAGAGGGUUGUUUACUCC hsa-mir- hsa-mir- hsa-miR- MIMAT0004674 CUGGGAGAGGGUUGUUUACUCC  417 30c-1* 30c-1 30c-1*  26 CUGGGAGAAGGCUGUUUACUCU hsa-mir- hsa-mir- hsa-miR- MIMAT0004550 CUGGGAGAAGGCUGUUUACUCU  418 30c-2* 30c-2 30c-2*  27 CUUUCAGUCGGAUGUUUACAGC hsa-mir- hsa-mir- hsa-miR- MIMAT0000693 CUUUCAGUCGGAUGUUUACAGC  419 30e* 30e 30e*  28 UCCCUGUCCUCCAGGAGCUCACG hsa-mir- hsa-mir- hsa-miR- MIMAT0000764 UCCCUGUCCUCCAGGAGCUCACG  420 339-5p 339 339-5p  29 UCUCACACAGAAAUCGCACCCGU hsa-mir- hsa-mir- hsa-miR- MIMAT0000753 UCUCACACAGAAAUCGCACCCGU  421 342-3p 342 342-3p  30 AAUCAGCAAGUAUACUGCCCUA hsa-mir- hsa-mir- hsa-miR- MIMAT0004557 CAAUCAGCAAGUAUACUGCCCU  422 34a* 34a 34a*  31 UCCCCCAGGUGUGAUUCUGAUUU hsa-mir- hsa-mir- hsa-miR- MIMAT0004682 UCCCCCAGGUGUGAUUCUGAUUU  423 361-3p 361 361-3p  32 AAUCCUUGGAACCUAGGUGUGAGU hsa-mir- hsa-mir- hsa-miR- MIMAT0000705 AAUCCUUGGAACCUAGGUGUGAGU  424 362-5p 362 362-5p  33 AGGGACUUUCAGGGGCAGCUGU hsa-mir- hsa-mir- hsa-miR- MIMAT0009199 AGGGACUUUCAGGGGCAGCUGU  425 365-2* 365-2 365*  34 CUUAUCAGAUUGUAUUGUAAUU hsa-mir- hsa-mir- hsa-miR- MIMAT0004688 CUUAUCAGAUUGUAUUGUAAUU  426 374a* 374a 374a*  35 CUUAGCAGGUUGUAUUAUCAUU hsa-mir- hsa-mir- hsa-miR- MIMAT0004956 CUUAGCAGGUUGUAUUAUCAUU  427 374b* 374b 374b*  36 AGGUUACCCGAGCAACUUUGCAU hsa-mir- hsa-mir- hsa-miR- MIMAT0001638 AGGUUACCCGAGCAACUUUGCAU  428 409-5p 409 409-5p  37 CAAAACGUGAGGCGCUGCUAU hsa-mir- hsa-mir- hsa-miR- MIMAT0004749 CAAAACGUGAGGCGCUGCUAU  429 424* 424 424*  38 UAUGUGCCUUUGGACUACAUCG hsa-mir- hsa-mir- hsa-miR- MIMAT0003150 UAUGUGCCUUUGGACUACAUCG  430 455-5p 455 455-5p  39 GUCAUACACGGCUCUCCUCUCU hsa-mir- hsa-mir- hsa-miR- MIMAT0002176 GUCAUACACGGCUCUCCUCUCU  431 485-3p 485 485-3p  40 UGUCUUACUCCCUCAGGCACAU hsa-mir- hsa-mir- hsa-miR- MIMAT0003257 UGUCUUACUCCCUCAGGCACAU  432 550-1* 550-1 550*  41 UGUCUUACUCCCUCAGGCACAU hsa-mir- hsa-mir- hsa-miR- MIMAT0003257 UGUCUUACUCCCUCAGGCACAU  433 550-2* 550-2 550*  42 GAAAUCAAGCGUGGGUGAGACC hsa-mir- hsa-mir- hsa-miR- MIMAT0004794 GAAAUCAAGCGUGGGUGAGACC  434 551b* 551b 551b*  43 AUUCUAAUUUCUCCACGUCUUU hsa-mir- hsa-mir- hsa-miR- MIMAT0003241 AUUCUAAUUUCUCCACGUCUUU  435 576-5p 576 576-5p  44 UCAGAACAAAUGCCGGUUCCCAGA hsa-mir- hsa-mir- hsa-miR- MIMAT0003256 UCAGAACAAAUGCCGGUUCCCAGA  436 589* 589 589*  45 GAGCUUAUUCAUAAAAGUGCAG hsa-mir- hsa-mir- hsa-miR- MIMAT0003258 GAGCUUAUUCAUAAAAGUGCAG  437 590-5p 590 590-5p  46 GGGGGUCCCCGGUGCUCGGAUC hsa-mir- hsa-mir- hsa-miR- MIMAT0004804 GGGGGUCCCCGGUGCUCGGAUC  438 615-5p 615 615-5p  47 GACUAUAGAACUUUCCCCCUCA hsa-mir- hsa-mir- hsa-miR- MIMAT0004808 GACUAUAGAACUUUCCCCCUCA  439 625* 625 625*  48 UGGUGGGCCGCAGAACAUGUGC hsa-mir- hsa-mir- hsa-miR- MIMAT0003330 UGGUGGGCCGCAGAACAUGUGC  440 654-5p 654 654-5p  49 AGGAAGCCCUGGAGGGGCUGGAG hsa-mir- hsa-mir- hsa-miR- MIMAT0003880 AGGAAGCCCUGGAGGGGCUGGAG  441 671-5p 671 671-5p  50 AACUAGACUGUGAGCUUCUAGA hsa-mir- hsa-mir- hsa-miR- MIMAT0004927 CAACUAGACUGUGAGCUUCUAG  442 708* 708 708*  51 CAACAAAUCACAGUCUGCCAUA hsa-mir- hsa-mir- hsa-miR- MIMAT0004553 CAACAAAUCACAGUCUGCCAUA  443 7-1* 7-1 7-1*  52 AUAAAGCUAGAUAACCGAAAGU hsa-mir- hsa-mir- hsa-miR- MIMAT0000442 AUAAAGCUAGAUAACCGAAAGU  444 9-1* 9-1 9*  53 AUAAAGCUAGAUAACCGAAAGU hsa-mir- hsa-mir- hsa-miR- MIMAT0000442 AUAAAGCUAGAUAACCGAAAGU  445 9-2* 9-2 9*  54 AGGGACGGGACGCGGUGCAGUG hsa-mir- hsa-mir- hsa-miR- MIMAT0004792 AGGGACGGGACGCGGUGCAGUG  446 92b* 92b 92b*  55 AUAAAGCUAGAUAACCGAAAGU hsa-mir- hsa-mir- hsa-miR- MIMAT0000442 AUAAAGCUAGAUAACCGAAAGU  447 9-3* 9-3 9*  56 UGAGGUAGUAGGUUGUAUAGUU hsa-let- hsa-let- hsa-let- MIMAT0000062 UGAGGUAGUAGGUUGUAUAGUU  448 7a-2 7a-2 7a  57 UGAGGUAGUAGGUUGUAUAGUU hsa-let- hsa-let- hsa-let- MIMAT0000062 UGAGGUAGUAGGUUGUAUAGUU  449 7a-3 7a-3 7a  58 UGAGGUAGUAGGUUGUAUGGUU hsa-let- hsa-let- hsa-let- MIMAT0000064 UGAGGUAGUAGGUUGUAUGGUU  450 7c 7c 7c  59 UGAGGUAGGAGGUUGUAUAGUU hsa-let- hsa-let- hsa-let- MIMAT0000066 UGAGGUAGGAGGUUGUAUAGUU  451 7e 7e 7e  60 UGAGGUAGUAGAUUGUAUAGUU hsa-let- hsa-let- hsa-let- MIMAT0000067 UGAGGUAGUAGAUUGUAUAGUU  452 7f-1 7f-1 7f  61 UGAGGUAGUAGUUUGUACAGUU hsa-let- hsa-let- hsa-let- MIMAT0000414 UGAGGUAGUAGUUUGUACAGUU  453 7g 7g 7g  62 UGAGGUAGUAGUUUGUGCUGUU hsa-let- hsa-let- hsa-let- MIMAT0000415 UGAGGUAGUAGUUUGUGCUGUU  454 7i 7i 7i  63 AACCCGUAGAUCCGAACUUGUG hsa-mir- hsa-mir- hsa-miR- MIMAT0000098 AACCCGUAGAUCCGAACUUGUG  455 100 100 100  64 UACAGUACUGUGAUAACUGAA hsa-mir- hsa-mir- hsa-miR- MIMAT0000099 UACAGUACUGUGAUAACUGAA  456 101-1 101-1 101  65 GUACAGUACUGUGAUAACUGAA hsa-mir- hsa-mir- hsa-miR- MIMAT0000099 UACAGUACUGUGAUAACUGAA  457 101-2 101-2 101  66 AGCAGCAUUGUACAGGGCUAUGA hsa-mir- hsa-mir- hsa-miR- MIMAT0000101 AGCAGCAUUGUACAGGGCUAUGA  458 103-1 103-1 103  67 AGCAGCAUUGUACAGGGCUAUGA hsa-mir- hsa-mir- hsa-miR- MIMAT0000101 AGCAGCAUUGUACAGGGCUAUGA 4589 103-2 103-2 103  68 AAAUGCUCAGACUCCUGUGGUG hsa-mir- hsa-mir- hsa-miR- MIMAT0000102 UCAAAUGCUCAGACUCCUGUGGU  460 105-1 105-1 105  69 AAAUGCUCAGACUCCUGUGGUG hsa-mir- hsa-mir- hsa-miR- MIMAT0000102 UCAAAUGCUCAGACUCCUGUGGU  461 105-2 105-2 105  70 AAAAGUGCUUACAGUGCAGGUAG hsa-mir- hsa-mir- hsa-miR- MIMAT0000103 AAAAGUGCUUACAGUGCAGGUAG  462 106a 106a 106a  71 UAAAGUGCUGACAGUGCAGAU hsa-mir- hsa-mir- hsa-miR- MIMAT0000680 UAAAGUGCUGACAGUGCAGAU  463 106b 106b 106b  72 AGCAGCAUUGUACAGGGCUAUCA hsa-mir- hsa-mir- hsa-miR- MIMAT0000104 AGCAGCAUUGUACAGGGCUAUCA  464 107 107 107  73 UACCCUGUAGAUCCGAAUUUGUG hsa-mir- hsa-mir- hsa-miR- MIMAT0000253 UACCCUGUAGAUCCGAAUUUGUG  465 10a 10a 10a  74 UACCCUGUAGAACCGAAUUUGUG hsa-mir- hsa-mir- hsa-miR- MIMAT0000254 UACCCUGUAGAACCGAAUUUGUG  466 10b 10b 10b  75 UGGAAUGUAAAGAAGUAUGUAU hsa-mir- hsa-mir- hsa-miR- MIMAT0000416 UGGAAUGUAAAGAAGUAUGUAU  467 1-1 1-1 1  76 UGGAAUGUAAAGAAGUAUGUAU hsa-mir- hsa-mir- hsa-miR- MIMAT0000416 UGGAAUGUAAAGAAGUAUGUAU  468 1-2 1-2 1  77 UGGAGUGUGACAAUGGUGUUUG hsa-mir- hsa-mir- hsa-miR- MIMAT0000421 UGGAGUGUGACAAUGGUGUUUG  469 122 122 122  78 UAAGGCACGCGGUGAAUGCC hsa-mir- hsa-mir- hsa-miR- MIMAT0000422 UAAGGCACGCGGUGAAUGCC  470 124-1 124-1 124  79 UAAGGCACGCGGUGAAUGCC hsa-mir- hsa-mir- hsa-miR- MIMAT0000422 UAAGGCACGCGGUGAAUGCC  471 124-2 124-2 124  80 UAAGGCACGCGGUGAAUGCC hsa-mir- hsa-mir- hsa-miR- MIMAT0000422 UAAGGCACGCGGUGAAUGCC  472 124-3 124-3 124  81 ACCCGUCCCGUUCGUCCCCGGA hsa-mir- hsa-mir- hsa-miR- MIMAT0005899 ACCCGUCCCGUUCGUCCCCGGA  473 1247 1247 1247  82 ACGGUGCUGGAUGUGGCCUUU hsa-mir- hsa-mir- hsa-miR- MIMAT0005902 ACGGUGCUGGAUGUGGCCUUU  474 1250 1250 1250  83 AGAAGGAAAUUGAAUUCAUUUA hsa-mir- hsa-mir- hsa-miR- MIMAT0005944 AGAAGGAAAUUGAAUUCAUUUA  475 1252 1252 1252  84 AGCCUGGAAGCUGGAGCCUGCAGU hsa-mir- hsa-mir- hsa-miR- MIMAT0005905 AGCCUGGAAGCUGGAGCCUGCAGU  476 1254 1254 1254  85 AGGAUGAGCAAAGAAAGUAGAUU hsa-mir- hsa-mir- hsa-miR- MIMAT0005906 AGGAUGAGCAAAGAAAGUAGAUU  477 1255a 1255a 1255a  86 AGGCAUUGACUUCUCACUAGCU hsa-mir- hsa-mir- hsa-miR- MIMAT0005907 AGGCAUUGACUUCUCACUAGCU  478 1256 1256 1256  87 CGUACCGUGAGUAAUAAUGCG hsa-mir- hsa-mir- hsa-miR- MIMAT0000445 UCGUACCGUGAGUAAUAAUGCG  479 126 126 126  88 AUGGGUGAAUUUGUAGAAGGAU hsa-mir- hsa-mir- hsa-miR- MIMAT0005914 AUGGGUGAAUUUGUAGAAGGAU  480 1262 1262 1262  89 AUGGUACCCUGGCAUACUGAGU hsa-mir- hsa-mir- hsa-miR- MIMAT0005915 AUGGUACCCUGGCAUACUGAGU  481 1263 1263 1263  90 CAGGAUGUGGUCAAGUGUUGUU hsa-mir- hsa-mir- hsa-miR- MIMAT0005918 CAGGAUGUGGUCAAGUGUUGUU  482 1265 1265 1265  91 CCUCAGGGCUGUAGAACAGGGCU hsa-mir- hsa-mir- hsa-miR- MIMAT0005920 CCUCAGGGCUGUAGAACAGGGCU  483 1266 1266 1266  92 CUGGACUGAGCCGUGCUACUGG hsa-mir- hsa-mir- hsa-miR- MIMAT0005923 CUGGACUGAGCCGUGCUACUGG  484 1269 1269 1269  93 CUGGAGAUAUGGAAGAGCUGUGU hsa-mir- hsa-mir- hsa-miR- MIMAT0005924 CUGGAGAUAUGGAAGAGCUGUGU  485 1270 1270 1270  94 CUUGGCACCUAGCAAGCACUCA hsa-mir- hsa-mir- hsa-miR- MIMAT0005796 CUUGGCACCUAGCAAGCACUCA  486 1271 1271 1271  95 UCGGAUCCGUCUGAGCUUGGCU hsa-mir- hsa-mir- hsa-miR- MIMAT0000446 UCGGAUCCGUCUGAGCUUGGCU  487 127-3p 127 127-3p  96 UACGUAGAUAUAUAUGUAUUUU hsa-mir- hsa-mir- hsa-miR- MIMAT0005933 UACGUAGAUAUAUAUGUAUUUU  488 1277 1277 1277  97 UAGUACUGUGCAUAUCAUCUAU hsa-mir- hsa-mir- hsa-miR- MIMAT0005936 UAGUACUGUGCAUAUCAUCUAU  489 1278 1278 1278  98 UCACAGUGAACCGGUCUCUUU hsa-mir- hsa-mir- hsa-miR- MIMAT0000424 UCACAGUGAACCGGUCUCUUU  490 128-1 128-1 128  99 UCACAGUGAACCGGUCUCUUU hsa-mir- hsa-mir- hsa-miR- MIMAT0000424 UCACAGUGAACCGGUCUCUUU  491 128-2 128-2 128 100 CUUUUUGCGGUCUGGGCUUGC hsa-mir- hsa-mir- hsa-miR- MIMAT0000242 CUUUUUGCGGUCUGGGCUUGC  492 129-1 129-1 129-5p 101 CUUUUUGCGGUCUGGGCUUGC hsa-mir- hsa-mir- hsa-miR- MIMAT0000242 CUUUUUGCGGUCUGGGCUUGC  493 129-2 129-2 129-5p 102 UGUGAGGUUGGCAUUGUUGUCU hsa-mir- hsa-mir- hsa-miR- MIMAT0005884 UGUGAGGUUGGCAUUGUUGUCU  494 1294 1294 1294 103 UUAGGCCGCAGAUCUGGGUGA hsa-mir- hsa-mir- hsa-miR- MIMAT0005885 UUAGGCCGCAGAUCUGGGUGA  495 1295 1295 1295 104 UUCAUUCGGCUGUCCAGAUGUA hsa-mir- hsa-mir- hsa-miR- MIMAT0005800 UUCAUUCGGCUGUCCAGAUGUA  496 1298 1298 1298 105 UUGCAGCUGCCUGGGAGUGACUUC hsa-mir- hsa-mir- hsa-miR- MIMAT0005797 UUGCAGCUGCCUGGGAGUGACUUC  497 1301 1301 1301 106 CGGUUUGAGGCUACAGUGAGAU hsa-mir- hsa-mir- hsa-miR- MIMAT0005892 UUUGAGGCUACAGUGAGAUGUG  498 1304 1304 1304 107 ACGUUGGCUCUGGUGGUG hsa-mir- hsa-mir- hsa-miR- MIMAT0005950 ACGUUGGCUCUGGUGGUG  499 1306 1306 1306 108 ACUCGGCGUGGCGUCGGUCGUG hsa-mir- hsa-mir- hsa-miR- MIMAT0005951 ACUCGGCGUGGCGUCGGUCGUG  500 1307 1307 1307 109 CAGUGCAAUGUUAAAAGGGCAU hsa-mir- hsa-mir- hsa-miR- MIMAT0000425 CAGUGCAAUGUUAAAAGGGCAU  501 130a 130a 130a 110 CAGUGCAAUGAUGAAAGGGCAU hsa-mir- hsa-mir- hsa-miR- MIMAT0000691 CAGUGCAAUGAUGAAAGGGCAU  502 130b 130b 130b 111 UAACAGUCUACAGCCAUGGUCG hsa-mir- hsa-mir- hsa-miR- MIMAT0000426 UAACAGUCUACAGCCAUGGUCG  503 132 132 132 112 ACCGUGGCUUUCGAUUGUUACU hsa-mir- hsa-mir- hsa-miR- MIMAT0004594 ACCGUGGCUUUCGAUUGUUACU  504 132* 132 132* 113 UGUGACUGGUUGACCAGAGGGG hsa-mir- hsa-mir- hsa-miR- MIMAT0000447 UGUGACUGGUUGACCAGAGGGG  505 134 134 134 114 UAUGGCUUUUCAUUCCUAUGUGA hsa-mir- hsa-mir- hsa-miR- MIMAT0000758 UAUGGCUUUUCAUUCCUAUGUGA  506 135b 135b 135b 115 ACUCCAUUUGUUUUGAUGAUGGA hsa-mir- hsa-mir- hsa-miR- MIMAT0000448 ACUCCAUUUGUUUUGAUGAUGGA  507 136 136 136 116 AGCUGGUGUUGUGAAUCAGGCCG hsa-mir- hsa-mir- hsa-miR- MIMAT0000430 AGCUGGUGUUGUGAAUCAGGCCG  508 138-1 138-1 138 117 AGCUGGUGUUGUGAAUCAGGCCG hsa-mir- hsa-mir- hsa-miR- MIMAT0000430 AGCUGGUGUUGUGAAUCAGGCCG  509 138-2 138-2 138 118 UGGAGACGCGGCCCUGUUGGAG hsa-mir- hsa-mir- hsa-miR- MIMAT0004552 GGAGACGCGGCCCUGUUGGAGU  510 139-3p 139 139-3p 119 UACCACAGGGUAGAACCACGG hsa-mir- hsa-mir- hsa-miR- MIMAT0004597 UACCACAGGGUAGAACCACGG  511 140-3p 140 140-3p 120 UAACACUGUCUGGUAAAGAUGG hsa-mir- hsa-mir- hsa-miR- MIMAT0000432 UAACACUGUCUGGUAAAGAUGG  512 141 141 141 121 CCCAUAAAGUAGAAAGCACU hsa-mir- hsa-mir- hsa-miR- MIMAT0000433 CAUAAAGUAGAAAGCACUACU  513 142 142 142-5p 122 UGAGAUGAAGCACUGUAGCUC hsa-mir- hsa-mir- hsa-miR- MIMAT0000435 UGAGAUGAAGCACUGUAGCUC  514 143 143 143 123 GGAUAUCAUCAUAUACUGUAAG hsa-mir- hsa-mir- hsa-miR- MIMAT0004600 GGAUAUCAUCAUAUACUGUAAG  515 144 144 144* 124 GUCCAGUUUUCCCAGGAAUCCCU hsa-mir- hsa-mir- hsa-miR- MIMAT0000437 GUCCAGUUUUCCCAGGAAUCCCU  516 145 145 145 125 UGAGAACUGAAUUCCAUGGGUU hsa-mir- hsa-mir- hsa-miR- MIMAT0000449 UGAGAACUGAAUUCCAUGGGUU  517 146a 146a 146a 126 UGAGAACUGAAUUCCAUAGGCU hsa-mir- hsa-mir- hsa-miR- MIMAT0002809 UGAGAACUGAAUUCCAUAGGCU  518 146b 146b 146b-5p 127 UCAGUGCACUACAGAACUUUGU hsa-mir- hsa-mir- hsa-miR- MIMAT0000243 UCAGUGCACUACAGAACUUUGU  519 148a 148a 148a 128 UCAGUGCAUCACAGAACUUUGU hsa-mir- hsa-mir- hsa-miR- MIMAT0000759 UCAGUGCAUCACAGAACUUUGU  520 148b 148b 148b 129 UCUCCCAACCCUUGUACCAGUG hsa-mir- hsa-mir- hsa-miR- MIMAT0000451 UCUCCCAACCCUUGUACCAGUG  521 150 150 150 130 CUAGACUGAAGCUCCUUGAGG hsa-mir- hsa-mir- hsa-miR- MIMAT0000757 CUAGACUGAAGCUCCUUGAGG  522 151-3p 151 151-3p 131 UCAGUGCAUGACAGAACUUGG hsa-mir- hsa-mir- hsa-miR- MIMAT0000438 UCAGUGCAUGACAGAACUUGG  523 152 152 152 132 UUAAUGCUAAUCGUGAUAGGGGU hsa-mir- hsa-mir- hsa-miR- MIMAT0000646 UUAAUGCUAAUCGUGAUAGGGGU  524 155 155 155 133 UAGCAGCACAUAAUGGUUUGUG hsa-mir- hsa-mir- hsa-miR- MIMAT0000068 UAGCAGCACAUAAUGGUUUGUG  525 15a 15a 15a 134 UAGCAGCACAUCAUGGUUUACA hsa-mir- hsa-mir- hsa-miR- MIMAT0000417 UAGCAGCACAUCAUGGUUUACA  526 15b 15b 15b 135 UAGCAGCACGUAAAUAUUGGCG hsa-mir- hsa-mir- hsa-miR- MIMAT0000069 UAGCAGCACGUAAAUAUUGGCG  527 16-1 16-1 16 136 UAGCAGCACGUAAAUAUUGGCG hsa-mir- hsa-mir- hsa-miR- MIMAT0000069 UAGCAGCACGUAAAUAUUGGCG  528 16-2 16-2 16 137 CAAAGUGCUUACAGUGCAGGUAG hsa-mir- hsa-mir- hsa-miR- MIMAT0000070 CAAAGUGCUUACAGUGCAGGUAG  529 17 17 17 138 AACAUUCAACGCUGUCGGUGAGU hsa-mir- hsa-mir- hsa-miR- MIMAT0000256 AACAUUCAACGCUGUCGGUGAGU  530 181a-1 181a-1 181a 139 AACAUUCAACGCUGUCGGUGAGU hsa-mir- hsa-mir- hsa-miR- MIMAT0000256 AACAUUCAACGCUGUCGGUGAGU  531 181a-2 181a-2 181a 140 AACAUUCAUUGCUGUCGGUGGGU hsa-mir- hsa-mir- hsa-miR- MIMAT0000257 AACAUUCAUUGCUGUCGGUGGGU  532 181b-1 181b-1 181b 141 AACAUUCAUUGCUGUCGGUGGGU hsa-mir- hsa-mir- hsa-miR- MIMAT0000257 AACAUUCAUUGCUGUCGGUGGGU  533 181b-2 181b-2 181b 142 AACAUUCAACCUGUCGGUGAGU hsa-mir- hsa-mir- hsa-miR- MIMAT0000258 AACAUUCAACCUGUCGGUGAGU  534 181c 181c 181c 143 AACAUUCAUUGUUGUCGGUGGGU hsa-mir- hsa-mir- hsa-miR- MIMAT0002821 AACAUUCAUUGUUGUCGGUGGGU  535 181d 181d 181d 144 UUUGGCAAUGGUAGAACUCACACU hsa-mir- hsa-mir- hsa-miR- MIMAT0000259 UUUGGCAAUGGUAGAACUCACACU  536 182 182 182 145 UAUGGCACUGGUAGAAUUCACU hsa-mir- hsa-mir- hsa-miR- MIMAT0000261 UAUGGCACUGGUAGAAUUCACU  537 183 183 183 146 UGGACGGAGAACUGAUAAGGGU hsa-mir- hsa-mir- hsa-miR- MIMAT0000454 UGGACGGAGAACUGAUAAGGGU  538 184 184 184 147 UGGAGAGAAAGGCAGUUCCUGA hsa-mir- hsa-mir- hsa-miR- MIMAT0000455 UGGAGAGAAAGGCAGUUCCUGA  539 185 185 185 148 CAAAGAAUUCUCCUUUUGGGCU hsa-mir- hsa-mir- hsa-miR- MIMAT0000456 CAAAGAAUUCUCCUUUUGGGCU  540 186 186 186 149 CAUCCCUUGCAUGGUGGAGGG hsa-mir- hsa-mir- hsa-miR- MIMAT0000457 CAUCCCUUGCAUGGUGGAGGG  541 188-5p 188 188-5p 150 UAAGGUGCAUCUAGUGCAGAUAG hsa-mir- hsa-mir- hsa-miR- MIMAT0000072 UAAGGUGCAUCUAGUGCAGAUAG  542 18a 18a 18a 151 CAACGGAAUCCCAAAAGCAGCUG hsa-mir- hsa-mir- hsa-miR- MIMAT0000440 CAACGGAAUCCCAAAAGCAGCUG  543 191 191 191 152 CUGACCUAUGAAUUGACAGCC hsa-mir- hsa-mir- hsa-miR- MIMAT0000222 CUGACCUAUGAAUUGACAGCC  544 192 192 192 153 UGGGUCUUUGCGGGCGAGAUGA hsa-mir- hsa-mir- hsa-miR- MIMAT0004614 UGGGUCUUUGCGGGCGAGAUGA  545 193a-5p 193a 193a-5p 154 AACUGGCCCUCAAAGUCCCGCU hsa-mir- hsa-mir- hsa-miR- MIMAT0002819 AACUGGCCCUCAAAGUCCCGCU  546 193b 193b 193b 155 UGUAACAGCAACUCCAUGUGGA hsa-mir- hsa-mir- hsa-miR- MIMAT0000460 UGUAACAGCAACUCCAUGUGGA  547 194-1 194-1 194 156 UAGCAGCACAGAAAUAUUGGC hsa-mir- hsa-mir- hsa-miR- MIMAT0000461 UAGCAGCACAGAAAUAUUGGC  548 195 195 195 157 UAGGUAGUUUCAUGUUGUUGGG hsa-mir- hsa-mir- hsa-miR- MIMAT0000226 UAGGUAGUUUCAUGUUGUUGGG  549 196a-1 196a-1 196a 158 UAGGUAGUUUCAUGUUGUUGGG hsa-mir- hsa-mir- hsa-miR- MIMAT0000226 UAGGUAGUUUCAUGUUGUUGGG  550 196a-2 196a-2 196a 159 UAGGUAGUUUCCUGUUGUUGGG hsa-mir- hsa-mir- hsa-miR- MIMAT0001080 UAGGUAGUUUCCUGUUGUUGGG  551 196b 196b 196b 160 UUCACCACCUUCUCCACCCAGC hsa-mir- hsa-mir- hsa-miR- MIMAT0000227 UUCACCACCUUCUCCACCCAGC  552 197 197 197 161 ACAGUAGUCUGCACAUUGGUUA hsa-mir- hsa-mir- hsa-miR- MIMAT0000232 ACAGUAGUCUGCACAUUGGUUA  553 199a-1 199a-1 199a-3p 162 ACAGUAGUCUGCACAUUGGUUA hsa-mir- hsa-mir- hsa-miR- MIMAT0000232 ACAGUAGUCUGCACAUUGGUUA  554 199a-2 199a-2 199a-3p 163 ACAGUAGUCUGCACAUUGGUUA hsa-mir- hsa-mir- hsa-miR- MIMAT0004563 ACAGUAGUCUGCACAUUGGUUA  555 199b 199b 199b-3p 164 UGUGCAAAUCUAUGCAAAACUGA hsa-mir- hsa-mir- hsa-miR- MIMAT0000073 UGUGCAAAUCUAUGCAAAACUGA  556 19a 19a 19a 165 UGUGCAAAUCCAUGCAAAACUGA hsa-mir- hsa-mir- hsa-miR- MIMAT0000074 UGUGCAAAUCCAUGCAAAACUGA  557 19b-1 19b-1 19b 166 UGUGCAAAUCCAUGCAAAACUGA hsa-mir- hsa-mir- hsa-miR- MIMAT0000074 UGUGCAAAUCCAUGCAAAACUGA  558 19b-2 19b-2 19b 167 UAACACUGUCUGGUAACGAUGU hsa-mir- hsa-mir- hsa-miR- MIMAT0000682 UAACACUGUCUGGUAACGAUGU  559 200a 200a 200a 168 UAAUACUGCCUGGUAAUGAUGA hsa-mir- hsa-mir- hsa-miR- MIMAT0000318 UAAUACUGCCUGGUAAUGAUGA  560 200b 200b 200b 169 UAAUACUGCCGGGUAAUGAUGGA hsa-mir- hsa-mir- hsa-miR- MIMAT0000617 UAAUACUGCCGGGUAAUGAUGGA  561 200c 200c 200c 170 UUCCUAUGCAUAUACUUCUUUG hsa-mir- hsa-mir- hsa-miR- MIMAT0002810 UUCCUAUGCAUAUACUUCUUUG  562 202* 202 202* 171 GUGAAAUGUUUAGGACCACUAG hsa-mir- hsa-mir- hsa-miR- MIMAT0000264 GUGAAAUGUUUAGGACCACUAG  563 203 203 203 172 UUCCCUUUGUCAUCCUAUGCCU hsa-mir- hsa-mir- hsa-miR- MIMAT0000265 UUCCCUUUGUCAUCCUAUGCCU  564 204 204 204 173 UCCUUCAUUCCACCGGAGUCUG hsa-mir- hsa-mir- hsa-miR- MIMAT0000266 UCCUUCAUUCCACCGGAGUCUG  565 205 205 205 174 UGGAAUGUAAGGAAGUGUGUGG hsa-mir- hsa-mir- hsa-miR- MIMAT0000462 UGGAAUGUAAGGAAGUGUGUGG  566 206 206 206 175 UAAAGUGCUUAUAGUGCAGGUAG hsa-mir- hsa-mir- hsa-miR- MIMAT0000075 UAAAGUGCUUAUAGUGCAGGUAG  567 20a 20a 20a 176 CAAAGUGCUCAUAGUGCAGGUAG hsa-mir- hsa-mir- hsa-miR- MIMAT0001413 CAAAGUGCUCAUAGUGCAGGUAG  568 20b 20b 20b 177 UAGCUUAUCAGACUGAUGUUGA hsa-mir- hsa-mir- hsa-miR- MIMAT0000076 UAGCUUAUCAGACUGAUGUUGA  569 21 21 21 178 CUGUGCGUGUGACAGCGGCUGA hsa-mir- hsa-mir- hsa-miR- MIMAT0000267 CUGUGCGUGUGACAGCGGCUGA  570 210 210 210 179 UAACAGUCUCCAGUCACGGCC hsa-mir- hsa-mir- hsa-miR- MIMAT0000269 UAACAGUCUCCAGUCACGGCC  571 212 212 212 180 ACAGCAGGCACAGACAGGCAGU hsa-mir- hsa-mir- hsa-miR- MIMAT0000271 ACAGCAGGCACAGACAGGCAGU  572 214 214 214 181 UGACCUAUGAAUUGACAG hsa-mir- hsa-mir- hsa-miR- MIMAT0000272 AUGACCUAUGAAUUGACAGAC  573 215 215 215 182 AAAUCUCUGCAGGCAAAUGUGA hsa-mir- hsa-mir- hsa-miR- MIMAT0004959 AAAUCUCUGCAGGCAAAUGUGA  574 216b 216b 216b 183 AUACUGCAUCAGGAACUGAUUG hsa-mir- hsa-mir- hsa-miR- MIMAT0000274 UACUGCAUCAGGAACUGAUUGGA  575 217 217 217 184 AGAGUUGAGUCUGGACGUCCCG hsa-mir- hsa-mir- hsa-miR- MIMAT0004567 AGAGUUGAGUCUGGACGUCCCG  576 219-1 219-1 219-1-3p 185 AAGCUGCCAGUUGAAGAACUGU hsa-mir- hsa-mir- hsa-miR- MIMAT0000077 AAGCUGCCAGUUGAAGAACUGU  577 22 22 22 186 AGCUACAUUGUCUGCUGGGUUUC hsa-mir- hsa-mir- hsa-miR- MIMAT0000278 AGCUACAUUGUCUGCUGGGUUUC  578 221 221 221 187 AGCUACAUCUGGCUACUGGGU hsa-mir- hsa-mir- hsa-miR- MIMAT0000279 AGCUACAUCUGGCUACUGGGU  579 222 222 222 188 CGUGUAUUUGACAAGCUGAGUU hsa-mir- hsa-mir- hsa-miR- MIMAT0004570 CGUGUAUUUGACAAGCUGAGUU  580 223* 223 223* 189 CAAGUCACUAGUGGUUCCGUU hsa-mir- hsa-mir- hsa-miR- MIMAT0000281 CAAGUCACUAGUGGUUCCGUU  581 224 224 224 190 AUCACAUUGCCAGGGAUUUCC hsa-mir- hsa-mir- hsa-miR- MIMAT0000078 AUCACAUUGCCAGGGAUUUCC  582 23a 23a 23a 191 AUCACAUUGCCAGGGAUUACC hsa-mir- hsa-mir- hsa-miR- MIMAT0000418 AUCACAUUGCCAGGGAUUACC  583 23b 23b 23b 192 UGGCUCAGUUCAGCAGGAACAG hsa-mir- hsa-mir- hsa-miR- MIMAT0000080 UGGCUCAGUUCAGCAGGAACAG  584 24-1 24-1 24 193 UGGCUCAGUUCAGCAGGAACAG hsa-mir- hsa-mir- hsa-miR- MIMAT0000080 UGGCUCAGUUCAGCAGGAACAG  585 24-2 24-2 24 194 CAUUGCACUUGUCUCGGUCUGA hsa-mir- hsa-mir- hsa-miR- MIMAT0000081 CAUUGCACUUGUCUCGGUCUGA  586 25 25 25 195 UUCAAGUAAUCCAGGAUAGGCU hsa-mir- hsa-mir- hsa-miR- MIMAT0000082 UUCAAGUAAUCCAGGAUAGGCU  587 26a-1 26a-1 26a 196 UUCAAGUAAUCCAGGAUAGGCU hsa-mir- hsa-mir- hsa-miR- MIMAT0000082 UUCAAGUAAUCCAGGAUAGGCU  588 26a-2 26a-2 26a 197 UUCAAGUAAUUCAGGAUAGGU hsa-mir- hsa-mir- hsa-miR- MIMAT0000083 UUCAAGUAAUUCAGGAUAGGU  589 26b 26b 26b 198 UUCACAGUGGCUAAGUUCCGC hsa-mir- hsa-mir- hsa-miR- MIMAT0000084 UUCACAGUGGCUAAGUUCCGC  590 27a 27a 27a 199 UUCACAGUGGCUAAGUUCUGC hsa-mir- hsa-mir- hsa-miR- MIMAT0000419 UUCACAGUGGCUAAGUUCUGC  591 27b 27b 27b 200 CACUAGAUUGUGAGCUCCUGGA hsa-mir- hsa-mir- hsa-miR- MIMAT0004502 CACUAGAUUGUGAGCUCCUGGA  592 28 28 28-3p 201 GAGGGUUGGGUGGAGGCUCUCC hsa-mir- hsa-mir- hsa-miR- MIMAT0004679 GAGGGUUGGGUGGAGGCUCUCC  593 296-3p 296 296-3p 202 AUGGUUUACCGUCCCACAUACA hsa-mir- hsa-mir- hsa-miR- MIMAT0002890 UGGUUUACCGUCCCACAUACAU  594 299-5p 299 299-5p 203 UAGCACCAUCUGAAAUCGGUUA hsa-mir- hsa-mir- hsa-miR- MIMAT0000086 UAGCACCAUCUGAAAUCGGUUA  595 29a 29a 29a 204 UAGCACCAUUUGAAAUCAGUGUU hsa-mir- hsa-mir- hsa-miR- MIMAT0000100 UAGCACCAUUUGAAAUCAGUGUU  596 29b-1 29b-1 29b 205 UAGCACCAUUUGAAAUCAGUGUU hsa-mir- hsa-mir- hsa-miR- MIMAT0000100 UAGCACCAUUUGAAAUCAGUGUU  597 29b-2 29b-2 29b 206 UAGCACCAUUUGAAAUCGGUUA hsa-mir- hsa-mir- hsa-miR- MIMAT0000681 UAGCACCAUUUGAAAUCGGUUA  598 29c 29c 29c 207 CAGUGCAAUGAUAUUGUCAAAGC hsa-mir- hsa-mir- hsa-miR- MIMAT0004958 CAGUGCAAUGAUAUUGUCAAAGC  599 301b 301b 301b 208 UGUAAACAUCCUCGACUGGAAG hsa-mir- hsa-mir- hsa-miR- MIMAT0000087 UGUAAACAUCCUCGACUGGAAG  600 30a 30a 30a 209 UGUAAACAUCCUACACUCAGCU hsa-mir- hsa-mir- hsa-miR- MIMAT0000420 UGUAAACAUCCUACACUCAGCU  601 30b 30b 30b 210 UGUAAACAUCCUACACUCUCAGC hsa-mir- hsa-mir- hsa-miR- MIMAT0000244 UGUAAACAUCCUACACUCUCAGC  602 30c-1 30c-1 30c 211 UGUAAACAUCCUACACUCUCAGC hsa-mir- hsa-mir- hsa-miR- MIMAT0000244 UGUAAACAUCCUACACUCUCAGC  603 30c-2 30c-2 30c 212 UGUAAACAUCCCCGACUGGAAG hsa-mir- hsa-mir- hsa-miR- MIMAT0000245 UGUAAACAUCCCCGACUGGAAG  604 30d 30d 30d 213 UGUAAACAUCCUUGACUGGAAG hsa-mir- hsa-mir- hsa-miR- MIMAT0000692 UGUAAACAUCCUUGACUGGAAG  605 30e 30e 30e 214 AGGCAAGAUGCUGGCAUAGCU hsa-mir- hsa-mir- hsa-miR- MIMAT0000089 AGGCAAGAUGCUGGCAUAGCU  606 31 31 31 215 UAUUGCACAUUACUAAGUUGCA hsa-mir- hsa-mir- hsa-miR- MIMAT0000090 UAUUGCACAUUACUAAGUUGCA  607 32 32 32 216 AAAAGCUGGGUUGAGAGGGCGA hsa-mir- hsa-mir- hsa-miR- MIMAT0000510 AAAAGCUGGGUUGAGAGGGCGA  608 320a 320a 320a 217 AAAAGCUGGGUUGAGAGGGCAA hsa-mir- hsa-mir- hsa-miR- MIMAT0005792 AAAAGCUGGGUUGAGAGGGCAA  609 320b-1 320b-1 320b 218 AAAAGCUGGGUUGAGAGGGCAA hsa-mir- hsa-mir- hsa-miR- MIMAT0005792 AAAAGCUGGGUUGAGAGGGCAA  610 320b-2 320b-2 320b 219 AAAAGCUGGGUUGAGAGGGU hsa-mir- hsa-mir- hsa-miR- MIMAT0005793 AAAAGCUGGGUUGAGAGGGU  611 320c-1 320c-1 320c 220 AAAAGCUGGGUUGAGAGGGU hsa-mir- hsa-mir- hsa-miR- MIMAT0005793 AAAAGCUGGGUUGAGAGGGU  612 320c-2 320c-2 320c 221 AAAAGCUGGGUUGAGAGGA hsa-mir- hsa-mir- hsa-miR- MIMAT0006764 AAAAGCUGGGUUGAGAGGA  613 320d-1 320d-1 320d 222 AAAAGCUGGGUUGAGAGGA hsa-mir- hsa-mir- hsa-miR- MIMAT0006764 AAAAGCUGGGUUGAGAGGA  614 320d-2 320d-2 320d 223 CACAUUACACGGUCGACCUCU hsa-mir- hsa-mir- hsa-miR- MIMAT0000755 CACAUUACACGGUCGACCUCU  615 323 323 323-3p 224 CGCAUCCCCUAGGGCAUUGGUGU hsa-mir- hsa-mir- hsa-miR- MIMAT0000761 CGCAUCCCCUAGGGCAUUGGUGU  616 324 324 5324-p 225 CUGGCCCUCUCUGCCCUUCCGU hsa-mir- hsa-mir- hsa-miR- MIMAT0000752 CUGGCCCUCUCUGCCCUUCCGU  617 328 328 328 226 GCAAAGCACACGGCCUGCAGAGA hsa-mir- hsa-mir- hsa-miR- MIMAT0000751 GCAAAGCACACGGCCUGCAGAGA  618 330 330 330-3p 227 GCCCCUGGGCCUAUCCUAGAA hsa-mir- hsa-mir- hsa-miR- MIMAT0000760 GCCCCUGGGCCUAUCCUAGAA  619 331 331 331-3p 228 UCAAGAGCAAUAACGAAAAAUGU hsa-mir- hsa-mir- hsa-miR- MIMAT0000765 UCAAGAGCAAUAACGAAAAAUGU  620 335 335 335 229 UCCAGCAUCAGUGAUUUUGUUG hsa-mir- hsa-mir- hsa-miR- MIMAT0000763 UCCAGCAUCAGUGAUUUUGUUG  621 338 338 338-3p 230 UGAGCGCCUCGACGACAGAGCCG hsa-mir- hsa-mir- hsa-miR- MIMAT0004702 UGAGCGCCUCGACGACAGAGCCG  622 339-3p 339 339-3p 231 GUGCAUUGUAGUUGCAUUGCA hsa-mir- hsa-mir- hsa-miR- MIMAT0000091 GUGCAUUGUAGUUGCAUUGCA  623 33a 33a 33a 232 GUGCAUUGCUGUUGCAUUGC hsa-mir- hsa-mir- hsa-miR- MIMAT0003301 GUGCAUUGCUGUUGCAUUGC  624 33b 33b 33b 233 UUAUAAAGCAAUGAGACUGAUU hsa-mir- hsa-mir- hsa-miR- MIMAT0004692 UUAUAAAGCAAUGAGACUGAUU  625 340 340 340 234 AGGGGUGCUAUCUGUGAUUGA hsa-mir- hsa-mir- hsa-miR- MIMAT0004694 AGGGGUGCUAUCUGUGAUUGA  626 342-5p 342 342-5p 235 GCUGACUCCUAGUCCAGGGCUC hsa-mir- hsa-mir- hsa-miR- MIMAT0000772 GCUGACUCCUAGUCCAGGGCUC  627 345 345 345 236 UGGCAGUGUCUUAGCUGGUUGU hsa-mir- hsa-mir- hsa-miR- MIMAT0000255 UGGCAGUGUCUUAGCUGGUUGU  628 34a 34a 34a 237 AGGCAGUGUCAUUAGCUGAUUG hsa-mir- hsa-mir- hsa-miR- MIMAT0000685 UAGGCAGUGUCAUUAGCUGAUUG  629 34b* 34b 34b* 238 AGGCAGUGUAGUUAGCUGAUUGC hsa-mir- hsa-mir- hsa-miR- MIMAT0000686 AGGCAGUGUAGUUAGCUGAUUGC  630 34c-5p 34c 34c-5p 239 UUAUCAGAAUCUCCAGGGGUAC hsa-mir- hsa-mir- hsa-miR- MIMAT0000703 UUAUCAGAAUCUCCAGGGGUAC  631 361-5p 361 361-5p 240 AACACACCUAUUCAAGGAUUCA hsa-mir- hsa-mir- hsa-miR- MIMAT0004683 AACACACCUAUUCAAGGAUUCA  632 362-3p 362 362-3p 241 AAUUGCACGGUAUCCAUCUGUA hsa-mir- hsa-mir- hsa-miR- MIMAT0000707 AAUUGCACGGUAUCCAUCUGUA  633 363 363 363 242 UAAUGCCCCUAAAAAUCCUUAU hsa-mir- hsa-mir- hsa-miR- MIMAT0000710 UAAUGCCCCUAAAAAUCCUUAU  634 365-2 365-2 365 243 AAUAAUACAUGGUUGAUCUUU hsa-mir- hsa-mir- hsa-miR- MIMAT0000721 AAUAAUACAUGGUUGAUCUUU  635 369 369 369-3p 244 GCCUGCUGGGGUGGAACCUGGU hsa-mir- hsa-mir- hsa-miR- MIMAT0000722 GCCUGCUGGGGUGGAACCUGGU  636 370 370 370 245 ACUCAAACUGUGGGGGCACU hsa-mir- hsa-mir- hsa-miR- MIMAT0004687 ACUCAAACUGUGGGGGCACU  637 371 371 371-5p 246 UUAUAAUACAACCUGAUAAGUG hsa-mir- hsa-mir- hsa-miR- MIMAT0000727 UUAUAAUACAACCUGAUAAGUG  638 374a 374a 374a 247 AUAUAAUACAACCUGCUAAGUG hsa-mir- hsa-mir- hsa-miR- MIMAT0004955 AUAUAAUACAACCUGCUAAGUG  639 374b 374b 374b 248 UUUGUUCGUUCGGCUCGCGUGA hsa-mir- hsa-mir- hsa-miR- MIMAT0000728 UUUGUUCGUUCGGCUCGCGUGA  640 375 375 375 249 AGAGGUUGCCCUUGGUGAAUUC hsa-mir- hsa-mir- hsa-miR- MIMAT0004689 AGAGGUUGCCCUUGGUGAAUUC  641 377* 377 377* 250 ACUGGACUUGGAGUCAGAAGG hsa-mir- hsa-mir- hsa-miR- MIMAT0000732 ACUGGACUUGGAGUCAGAAGG  642 378 378 378 251 UGGUAGACUAUGGAACGUAGG hsa-mir- hsa-mir- hsa-miR- MIMAT0000733 UGGUAGACUAUGGAACGUAGG  643 379 379 379 252 UAUACAAGGGCAAGCUCUCUGU hsa-mir- hsa-mir- hsa-miR- MIMAT0000736 UAUACAAGGGCAAGCUCUCUGU  644 381 381 381 253 GAAGUUGUUCGUGGUGGAUUCG hsa-mir- hsa-mir- hsa-miR- MIMAT0000737 GAAGUUGUUCGUGGUGGAUUCG  645 382 382 382 254 AGAUCAGAAGGUGAUUGUGGCU hsa-mir- hsa-mir- hsa-miR- MIMAT0000738 AGAUCAGAAGGUGAUUGUGGCU  646 383 383 383 255 CGAAUGUUGCUCGGUGAACCCC hsa-mir- hsa-mir- hsa-miR- MIMAT0001639 GAAUGUUGCUCGGUGAACCCCU  647 409-3p 409 409-3p 256 AAUAUAACACAGAUGGCCUGU hsa-mir- hsa-mir- hsa-miR- MIMAT0002171 AAUAUAACACAGAUGGCCUGU  648 410 410 410 257 AUAGUAGACCGUAUAGCGUACG hsa-mir- hsa-mir- hsa-miR- MIMAT0003329 UAGUAGACCGUAUAGCGUACG  649 411 411 411 258 AUCAACAGACAUUAAUUGGGCGC hsa-mir- hsa-mir- hsa-miR- MIMAT0003339 AUCAACAGACAUUAAUUGGGCGC  650 421 421 421 259 UGAGGGGCAGAGAGCGAGACUUU hsa-mir- hsa-mir- hsa-miR- MIMAT0004748 UGAGGGGCAGAGAGCGAGACUUU  651 423 423 423-5p 260 CAGCAGCAAUUCAUGUUUUGAA hsa-mir- hsa-mir- hsa-miR- MIMAT0001341 CAGCAGCAAUUCAUGUUUUGAA  652 424 424 424 261 UAAUACUGUCUGGUAAAACCGU hsa-mir- hsa-mir- hsa-miR- MIMAT0001536 UAAUACUGUCUGGUAAAACCGU  653 429 429 429 262 UCUUGGAGUAGGUCAUUGGGUGG hsa-mir- hsa-mir- hsa-miR- MIMAT0002814 UCUUGGAGUAGGUCAUUGGGUGG  654 432 432 432 263 AUCAUGAUGGGCUCCUCGGUGU hsa-mir- hsa-mir- hsa-miR- MIMAT0001627 AUCAUGAUGGGCUCCUCGGUGU  655 433 433 433 264 UUGCAUAUGUAGGAUGUCCCAU hsa-mir- hsa-mir- hsa-miR- MIMAT0001532 UUGCAUAUGUAGGAUGUCCCAU  656 448 448 448 265 UGGCAGUGUAUUGUUAGCUGGU hsa-mir- hsa-mir- hsa-miR- MIMAT0001541 UGGCAGUGUAUUGUUAGCUGGU  657 449a 449a 449a 266 AGGCAGUGUAUUGUUAGCUGGC hsa-mir- hsa-mir- hsa-miR- MIMAT0003327 AGGCAGUGUAUUGUUAGCUGGC  658 449b 449b 449b 267 UUUUGCGAUGUGUUCCUAAUAU hsa-mir- hsa-mir- hsa-miR- MIMAT0001545 UUUUGCGAUGUGUUCCUAAUAU  659 450a-1 450a-1 450a 268 UUUUGCGAUGUGUUCCUAAUAU hsa-mir- hsa-mir- hsa-miR- MIMAT0001545 UUUUGCGAUGUGUUCCUAAUAU  660 450a-2 450a-2 450a 269 UUUUGCAAUAUGUUCCUGAAUA hsa-mir- hsa-mir- hsa-miR- MIMAT0004909 UUUUGCAAUAUGUUCCUGAAUA  661 450b-5p 450b 450b-5p 270 AACUGUUUGCAGAGGAAACUGA hsa-mir- hsa-mir- hsa-miR- MIMAT0001635 AACUGUUUGCAGAGGAAACUGA  662 452 452 452 271 UAGUGCAAUAUUGCUUAUAGGGU hsa-mir- hsa-mir- hsa-miR- MIMAT0003885 UAGUGCAAUAUUGCUUAUAGGGU  663 454 454 454 272 GCAGUCCAUGGGCAUAUACAC hsa-mir- hsa-mir- hsa-miR- MIMAT0004784 GCAGUCCAUGGGCAUAUACAC  664 455-3p 455 455-3p 273 AAGACGGGAGGAAAGAAGGGAG hsa-mir- hsa-mir- hsa-miR- MIMAT0004761 AAGACGGGAGGAAAGAAGGGAG  665 483-5p 483 483-5p 274 UCAGGCUCAGUCCCCUCCCGAU hsa-mir- hsa-mir- hsa-miR- MIMAT0002174 UCAGGCUCAGUCCCCUCCCGAU  666 484 484 484 275 AGAGGCUGGCCGUGAUGAAUUC hsa-mir- hsa-mir- hsa-miR- MIMAT0002175 AGAGGCUGGCCGUGAUGAAUUC  667 485-5p 485 485-5p 276 UCCUGUACUGAGCUGCCCCGAG hsa-mir- hsa-mir- hsa-miR- MIMAT0002177 UCCUGUACUGAGCUGCCCCGAG  668 486-5p 486 486-5p 277 AAUCGUACAGGGUCAUCCACUU hsa-mir- hsa-mir- hsa-miR- MIMAT0003180 AAUCGUACAGGGUCAUCCACUU  669 487b 487b 487b 278 CCCAGAUAAUGGCACUCUCAA hsa-mir- hsa-mir- hsa-miR- MIMAT0002804 CCCAGAUAAUGGCACUCUCAA  670 488* 488 488* 279 UUGUACAUGGUAGGCUUUCAUU hsa-mir- hsa-mir- hsa-miR- MIMAT0002813 UUGUACAUGGUAGGCUUUCAUU  671 493* 493 493* 280 UGAAACAUACACGGGAAACCUC hsa-mir- hsa-mir- hsa-miR- MIMAT0002816 UGAAACAUACACGGGAAACCUC  672 494 494 494 281 AAACAAACAUGGUGCACUUCUU hsa-mir- hsa-mir- hsa-miR- MIMAT0002817 AAACAAACAUGGUGCACUUCUU  673 495 495 495 282 CAGCAGCACACUGUGGUUUGU hsa-mir- hsa-mir- hsa-miR- MIMAT0002820 CAGCAGCACACUGUGGUUUGU  674 497 497 497 283 UUAAGACUUGCAGUGAUGUUU hsa-mir- hsa-mir- hsa-miR- MIMAT0002870 UUAAGACUUGCAGUGAUGUUU  675 499-5p 499 499-5p 284 AUGCACCUGGGCAAGGAUUCUG hsa-mir- hsa-mir- hsa-miR- MIMAT0002871 AUGCACCUGGGCAAGGAUUCUG  676 500* 500 500* 285 AAUGCACCCGGGCAAGGAUUCU hsa-mir- hsa-mir- hsa-miR- MIMAT0004774 AAUGCACCCGGGCAAGGAUUCU  677 501-3p 501 501-3p 286 AAUGCACCUGGGCAAGGAUUCA hsa-mir- hsa-mir- hsa-miR- MIMAT0004775 AAUGCACCUGGGCAAGGAUUCA  678 502-3p 502 502-3p 287 UAGCAGCGGGAACAGUUCUGCAG hsa-mir- hsa-mir- hsa-miR- MIMAT0002874 UAGCAGCGGGAACAGUUCUGCAG  679 503 503 503 288 AGACCCUGGUCUGCACUCUAUC hsa-mir- hsa-mir- hsa-miR- MIMAT0002875 AGACCCUGGUCUGCACUCUAUC  680 504 504 504 289 GGGAGCCAGGAAGUAUUGAUGU hsa-mir- hsa-mir- hsa-miR- MIMAT0004776 GGGAGCCAGGAAGUAUUGAUGU  681 505* 505 505* 290 UGAUUGUAGCCUUUUGGAGUAGA hsa-mir- hsa-mir- hsa-miR- MIMAT0002880 UGAUUGUAGCCUUUUGGAGUAGA  682 508-3p 508 508-3p 291 UACUGCAGACGUGGCAAUCAUG hsa-mir- hsa-mir- hsa-miR- MIMAT0004975 UACUGCAGACGUGGCAAUCAUG  683 509-3-5p 509-3 509-3-5p 292 UUCACAGGGAGGUGUCAU hsa-mir- hsa-mir- hsa-miR- MIMAT0002877 UUCACAGGGAGGUGUCAU  684 513a-1 513a-1 513a-5p 293 UUCACAGGGAGGUGUCAU hsa-mir- hsa-mir- hsa-miR- MIMAT0002877 UUCACAGGGAGGUGUCAU  685 513a-2 513a-2 513a-5p 294 UUCACAAGGAGGUGUCAUUUAU hsa-mir- hsa-mir- hsa-miR- MIMAT0005788 UUCACAAGGAGGUGUCAUUUAU  686 513b 513b 513b 295 UUCUCAAGGAGGUGUCGUUUAU hsa-mir- hsa-mir- hsa-miR- MIMAT0005789 UUCUCAAGGAGGUGUCGUUUAU  687 513c 513c 513c 296 CAUGCCUUGAGUGUAGGACCGU hsa-mir- hsa-mir- hsa-miR- MIMAT0002888 CAUGCCUUGAGUGUAGGACCGU  688 532 532 532-5p 297 UGUGACAGAUUGAUAACUGAAA hsa-mir- hsa-mir- hsa-miR- MIMAT0003389 UGUGACAGAUUGAUAACUGAAA  689 542-3p 542 542-3p 298 AAACAUUCGCGGUGCACUUCUU hsa-mir- hsa-mir- hsa-miR- MIMAT0004954 AAACAUUCGCGGUGCACUUCUU  690 543 543 543 299 CAAAACUGGCAAUUACUUUUGC hsa-mir- hsa-mir- hsa-miR- MIMAT0003251 CAAAACUGGCAAUUACUUUUGC  691 548a-1 548a-1 548a-3p 300 CAAAACUGGCAAUUACUUUUGC hsa-mir- hsa-mir- hsa-miR- MIMAT0003251 CAAAACUGGCAAUUACUUUUGC  692 548a-2 548a-2 548a-3p 301 CAAAACUGGCAAUUACUUUUGC hsa-mir- hsa-mir- hsa-miR- MIMAT0003251 CAAAACUGGCAAUUACUUUUGC  693 548a-3 548a-3 548a-3p 302 CAAGAACCUCAGUUGCUUUUGU hsa-mir- hsa-mir- hsa-miR- MIMAT0003254 CAAGAACCUCAGUUGCUUUUGU  694 548b-3p 548b 548b-3p 303 AAAAACUGAGACUACUUUUGCA hsa-mir- hsa-mir- hsa-miR- MIMAT0005874 AAAAACUGAGACUACUUUUGCA  695 548e 548e 548e 304 AAAAGUAAUCGCGGUUUUUGUC hsa-mir- hsa-mir- hsa-miR- MIMAT0005928 AAAAGUAAUCGCGGUUUUUGUC  696 548h-1 548h-1 548h 305 AAAAGUAAUCGCGGUUUUUGUC hsa-mir- hsa-mir- hsa-miR- MIMAT0005928 AAAAGUAAUCGCGGUUUUUGUC  697 548h-2 548h-2 548h 306 AAAAGUAAUCGCGGUUUUUGUC hsa-mir- hsa-mir- hsa-miR- MIMAT0005928 AAAAGUAAUCGCGGUUUUUGUC  698 548h-3 548h-3 548h 307 AAAAGUAAUCGCGGUUUUUGUC hsa-mir- hsa-mir- hsa-miR- MIMAT0005928 AAAAGUAAUCGCGGUUUUUGUC  699 548h-4 548h-4 548h 308 AAAAGUAAUUGCGGUCUUUGGU hsa-mir- hsa-mir- hsa-miR- MIMAT0005875 AAAAGUAAUUGCGGUCUUUGGU  700 548j 548j 548j 309 AAAAGUACUUGCGGAUUUUGCU hsa-mir- hsa-mir- hsa-miR- MIMAT0005882 AAAAGUACUUGCGGAUUUUGCU  701 548k 548k 548k 310 AAAAGUAUUUGCGGGUUUUGUC hsa-mir- hsa-mir- hsa-miR- MIMAT0005889 AAAAGUAUUUGCGGGUUUUGUC  702 548l 548l 548l 311 CAAAAGUAAUUGUGGAUUUUGU hsa-mir-  hsa-mir- hsa-miR- MIMAT0005916 CAAAAGUAAUUGUGGAUUUUGU  703 548n 548n 548n 312 AGUGCCUGAGGGAGUAAGAGCCC hsa-mir- hsa-mir- hsa-miR- MIMAT0004800 AGUGCCUGAGGGAGUAAGAGCCC  704 550-1 550-1 550 313 AGUGCCUGAGGGAGUAAGAGCCC hsa-mir- hsa-mir- hsa-miR- MIMAT0004800 AGUGCCUGAGGGAGUAAGAGCCC  705 550-2 550-2 550 314 GCGACCCAUACUUGGUUUCAG hsa-mir- hsa-mir- hsa-miR- MIMAT0003233 GCGACCCAUACUUGGUUUCAG  706 551b 551b 551b 315 CACGCUCAUGCACACACCCACA hsa-mir- hsa-mir- hsa-miR- MIMAT0003239 CACGCUCAUGCACACACCCACA  707 574-3p 574 574-3p 316 AAGAUGUGGAAAAAUUGGAAUC hsa-mir- hsa-mir- hsa-miR- MIMAT0004796 AAGAUGUGGAAAAAUUGGAAUC  708 576-3p 576 576-3p 317 GUAGAUAAAAUAUUGGUACCUG hsa-mir- hsa-mir- hsa-miR- MIMAT0003242 UAGAUAAAAUAUUGGUACCUG  709 577 577 577 318 UAACUGGUUGAACAACUGAACC hsa-mir- hsa-mir- hsa-miR- MIMAT0004797 UAACUGGUUGAACAACUGAACC  710 582-3p 582 582-3p 319 UUACAGUUGUUCAACCAGUUACU hsa-mir- hsa-mir- hsa-miR- MIMAT0003247 UUACAGUUGUUCAACCAGUUACU  711 582-5p 582 582-5p 320 UUAUGGUUUGCCUGGGACUGAG hsa-mir- hsa-mir- hsa-miR- MIMAT0003249 UUAUGGUUUGCCUGGGACUGAG  712 584 584 584 321 UGAGAACCACGUCUGCUCUGAG hsa-mir- hsa-mir- hsa-miR- MIMAT0004799 UGAGAACCACGUCUGCUCUGAG  713 589 589 589 322 UAAUUUUAUGUAUAAGCUAGU hsa-mir- hsa-mir- hsa-miR- MIMAT0004801 UAAUUUUAUGUAUAAGCUAGU  714 590-3p 590 590-3p 323 UACGUCAUCGUUGUCAUCGUCA hsa-mir- hsa-mir- hsa-miR- MIMAT0003266 UACGUCAUCGUUGUCAUCGUCA  715 598 598 598 324 UCCGAGCCUGGGUCUCCCUCUU hsa-mir- hsa-mir- hsa-miR- MIMAT0003283 UCCGAGCCUGGGUCUCCCUCUU  716 615-3p 615 615-3p 325 AAGUCAUUGGAGGGUUUGAGCA hsa-mir- hsa-mir- hsa-miR- MIMAT0004805 AGUCAUUGGAGGGUUUGAGCAG  717 616 616 616 326 AAACUCUACUUGUCCUUCUGAGU hsa-mir- hsa-mir- hsa-miR- MIMAT0003287 AAACUCUACUUGUCCUUCUGAGU  718 618 618 618 327 AGGGGGAAAGUUCUAUAGUCC hsa-mir- hsa-mir- hsa-miR- MIMAT0003294 AGGGGGAAAGUUCUAUAGUCC  719 625 625 625 328 AUGCUGACAUAUUUACUAGAGG hsa-mir- hsa-mir- hsa-miR- MIMAT0004809 AUGCUGACAUAUUUACUAGAGG  720 628-5p 628 628-5p 329 UGGGUUUACGUUGGGAGAACU hsa-mir- hsa-mir- hsa-miR- MIMAT0004810 UGGGUUUACGUUGGGAGAACU  721 629 629 629 330 AAAGACAUAGGAUAGAGUCACCUC hsa-mir- hsa-mir- hsa-miR- MIMAT0003311 AAAGACAUAGGAUAGAGUCACCUC  722 641 641 641 331 ACACUUGUAUGCUAGCUCAGGU hsa-mir- hsa-mir- hsa-miR- MIMAT0003313 ACUUGUAUGCUAGCUCAGGUAG  723 643 643 643 332 UUUAGGAUAAGCUUGACUUUUG hsa-mir- hsa-mir- hsa-miR- MIMAT0003321 UUUAGGAUAAGCUUGACUUUUG  724 651 651 651 333 AAUGGCGCCACUAGGGUUGUG hsa-mir- hsa-mir- hsa-miR- MIMAT0003322 AAUGGCGCCACUAGGGUUGUG  725 652 652 652 334 UAUGUCUGCUGACCAUCACCUU hsa-mir- hsa-mir- hsa-miR- MIMAT0004814 UAUGUCUGCUGACCAUCACCUU  726 654-3p 654 654-3p 335 UACCCAUUGCAUAUCGGAGUUG hsa-mir- hsa-mir- hsa-miR- MIMAT0003338 UACCCAUUGCAUAUCGGAGUUG  727 660 660 660 336 UCCGGUUCUCAGGGCUCCACC hsa-mir- hsa-mir- hsa-miR- MIMAT0004819 UCCGGUUCUCAGGGCUCCACC  728 671-3p 671 671-3p 337 AAGGAGCUUACAAUCUAGCUGGG hsa-mir- hsa-mir- hsa-miR- MIMAT0004926 AAGGAGCUUACAAUCUAGCUGGG  729 708 708 708 338 UGGAAGACUAGUGAUUUUGUUGU hsa-mir- hsa-mir- hsa-miR- MIMAT0000252 UGGAAGACUAGUGAUUUUGUUGU  730 7-1 7-1 7 339 UGGAAGACUAGUGAUUUUGUUGU hsa-mir- hsa-mir- hsa-miR- MIMAT0000252 UGGAAGACUAGUGAUUUUGUUGU  731 7-2 7-2 7 340 UGGAAGACUAGUGAUUUUGUUGU hsa-mir- hsa-mir- hsa-miR- MIMAT0000252 UGGAAGACUAGUGAUUUUGUUGU  732 7-3 7-3 7 341 CGGCUCUGGGUCUGUGGGGA hsa-mir- hsa-mir- hsa-miR- MIMAT0004957 CGGCUCUGGGUCUGUGGGGA  733 760 760 760 342 UGCACCAUGGUUGUCUGAGCAUG hsa-mir- hsa-mir- hsa-miR- MIMAT0003882 UGCACCAUGGUUGUCUGAGCAUG  734 767-5p 767 767-5p 343 UGAGACCUCUGGGUUCUGAGCU hsa-mir- hsa-mir- hsa-miR- MIMAT0003886 UGAGACCUCUGGGUUCUGAGCU  735 769-5p 769 769-5p 344 GCAGGAACUUGUGAGUCUCCU hsa-mir- hsa-mir- hsa-miR- MIMAT0004953 GCAGGAACUUGUGAGUCUCCU  736 873 873 873 345 CUGCCCUGGCCCGAGGGACCGA hsa-mir- hsa-mir- hsa-miR- MIMAT0004911 CUGCCCUGGCCCGAGGGACCGA  737 874 874 874 346 GUAGAGGAGAUGGCGCAGGG hsa-mir- hsa-mir- hsa-miR- MIMAT0004949 GUAGAGGAGAUGGCGCAGGG  738 877 877 877 347 GUGAACGGGCGCCAUCCCGAGG hsa-mir- hsa-mir- hsa-miR- MIMAT0004951 GUGAACGGGCGCCAUCCCGAGG  739 887 887 887 348 UUAAUAUCGGACAACCAUUGU hsa-mir- hsa-mir- hsa-miR- MIMAT0004921 UUAAUAUCGGACAACCAUUGU  740 889 889 889 349 UGCAACGAACCUGAGCCACUGA hsa-mir- hsa-mir- hsa-miR- MIMAT0004902 UGCAACGAACCUGAGCCACUGA  741 891a 891a 891a 350 CACUGUGUCCUUUCUGCGUAG hsa-mir- hsa-mir- hsa-miR- MIMAT0004907 CACUGUGUCCUUUCUGCGUAG  742 892a 892a 892a 351 UCUUUGGUUAUCUAGCUGUAUGA hsa-mir- hsa-mir- hsa-miR- MIMAT0000441 UCUUUGGUUAUCUAGCUGUAUGA  743 9-1 9-1 9 352 UCUUUGGUUAUCUAGCUGUAUGA hsa-mir- hsa-mir- hsa-miR- MIMAT0000441 UCUUUGGUUAUCUAGCUGUAUGA  744 9-2 9-2 9 353 UAUUGCACUUGUCCCGGCCUGU hsa-mir- hsa-mir- hsa-miR- MIMAT0000092 UAUUGCACUUGUCCCGGCCUGU  745 92a-1 92a-1 92a 354 UAUUGCACUUGUCCCGGCCUGU hsa-mir- hsa-mir- hsa-miR- MIMAT0000092 UAUUGCACUUGUCCCGGCCUGU  746 92a-2 92a-2 92a 355 UAUUGCACUCGUCCCGGCCUCC hsa-mir- hsa-mir- hsa-miR- MIMAT0003218 UAUUGCACUCGUCCCGGCCUCC  747 92b 92b 92b 356 CAAAGUGCUGUUCGUGCAGGUAG hsa-mir- hsa-mir- hsa-miR- MIMAT0000093 CAAAGUGCUGUUCGUGCAGGUAG  748 93 93 93 357 UCUUUGGUUAUCUAGCUGUAUGA hsa-mir- hsa-mir- hsa-miR- MIMAT0000441 UCUUUGGUUAUCUAGCUGUAUGA  749 9-3 9-3 9 358 AAGGCAGGGCCCCCGCUCCCC hsa-mir- hsa-mir- hsa-miR- MIMAT0004983 AAGGCAGGGCCCCCGCUCCCC  750 940 940 940 359 UUCUCUGUUUUGGCCAUGUGUG hsa-mir- hsa-mir- hsa-miR- MIMAT0004985 UCUUCUCUGUUUUGGCCAUGUG  751 942 942 942 360 AAAUUAUUGUACAUCGGAUGAG hsa-mir- hsa-mir- hsa-miR- MIMAT0004987 AAAUUAUUGUACAUCGGAUGAG  752 944 944 944 361 UUCAACGGGUAUUUAUUGAGCA hsa-mir- hsa-mir- hsa-miR- MIMAT0000094 UUCAACGGGUAUUUAUUGAGCA  753 95 95 95 362 UUUGGCACUAGCACAUUUUUGCU hsa-mir- hsa-mir- hsa-miR- MIMAT0000095 UUUGGCACUAGCACAUUUUUGCU  754 96 96 96 363 UGAGGUAGUAAGUUGUAUUGUU hsa-mir- hsa-mir- hsa-miR- MIMAT0000096 UGAGGUAGUAAGUUGUAUUGUU  755 98 98 98 364 AACCCGUAGAUCCGAUCUUGUG hsa-mir- hsa-mir- hsa-miR- MIMAT0000097 AACCCGUAGAUCCGAUCUUGUG  756 99a 99a 99a 365 CACCCGUAGAACCGACCUUGCG hsa-mir- hsa-mir- hsa-miR- MIMAT0000689 CACCCGUAGAACCGACCUUGCG  757 99b 99b 99b 366 AACAUAGAGGAAAUUCCACGU hsa-mir- hsa-mir- hsa-mir- AACAUAGAGGAAAUUCCACGU  758 376c 376c 376c 367 AUCAUAGAGGAAAAUCCAUGUU hsa-mir- hsa-mir- hsa-mir- AUCAUAGAGGAAAAUCCAUGUU  759 376b 376b 376b 368 UGGUGGGCCGCAGAACAUGUGC hsa-mir- hsa-mir- hsa-mir- UGGUGGGCCGCAGAACAUGUGC  760 654 654 654 369 AUCAUAGAGGAAAAUCCACGU hsa-mir- hsa-mir- hsa-mir- AUCAUAGAGGAAAAUCCACGU  761 376a-2 376a-2 376a-2 370 AUCAUAGAGGAAAAUCCACGU hsa-mir- hsa-mir- hsa-mir- AUCAUAGAGGAAAAUCCACGU  762 376a-1 376a-1 376a-1 371 AAAACCGUCUAGUUACAGUUGU hsa-mir- 1537 372 AUAUACAGGGGGAGACUCUCAU hsa-mir- 1185-2 373 CCUAGAAUGGGGAUUGUGGG hsa-mir- 1301* 374 AGCGAGACCUCAACUCUACAAU hsa-mir- 1303 375 UCGACCGGACCUCGACCGGCUC hsa-mir- 1307* 376 AUGUAGGGAUGGAAGCCAUGAA hsa-mir- 135a-2 377 CUCACUGAACAAUGAAUGCAA hsa-mir- 181b-1* 378 CGGGUAGAGAGGGCAGUGGGAG hsa-mir- 197* 379 GCUGGGAAGGCAAAGGGACGU hsa-mir- 204* 380 ACCUUGGCUCUAGACUGCUUAC hsa-mir- 212* 381 GCUCUGACUUUAUUGCACUACU hsa-mir- 301a 382 AGGGACUUUUGGGGGCAGAUGU hsa-mir- 365-1 383 UUGGGGACAUUUUGCAUUCAU hsa-mir- 450a-2* 384 AAUGUGUAGCAAAAGACAGA hsa-mir- 511-1-3p 385 AAUGUGUAGCAAAAGACAGA hsa-mir- 511-2-3p 386 AUCAUACAAGGACAAUUUCUUU hsa-mir- 539 387 AAAGGUAAUUGCAGUUUUUCCC hsa-mir- 570 388 UCGCGGUUUGUGCCAGAUGACG hsa-mir- 579 389 AGAAGGCACUAUGAGAUUUAGA hsa-mir- 605 390 AGACACAUUUGGAGAGGGAACC hsa-mir- 642 391 AGGACCUUCCCUGAACCAAGGA hsa-mir- 659 392 AUAUACAGGGGGAGACUCUUAU hsa-mir- 1185-1

TABLE 32 Novel miRNAs identified by deep sequencing analysis. SEQ Temporary SEQ ID Mature Assigned miRBase ID NO. Sequence Captured miRNA ID ID NO. miRNA Precursor Sequence 763 CCAAAACUGCAGUUACUUUUG has-mir-548o- pending 1057 UggUgcaaaagUaaUUgcggUUUUUgccaUUaaaagUaaUgc 2 ggCCAAAACUGCAGUUACUUUUGcaccc 764 GAGCCUGGAAGCUGGAGCCUGC hsa-mir-1254- hsa-mir- 1058 cUGAGCCUGGAAGCUGGAGCCUGCagUgagcUaUgaUca 2 1254-2 UgUcccUgUacUcUagccUgggca 765 CGGGCGUGGUGGUGGGGGUG hsa-mir-1268b hsa-mir- 1059 accCGGGCGUGGUGGUGGGGGUGggUgccUgUaaUUcca 1268b gcUagUUggga 766 UCGAGGAGCUCACAGUCUAGA hsa-miR-151- hsa-mir- 1060 agUcUcUcUUcagggcUcccgagacacagaaacagacaccUgccc 5p-2 151b UCGAGGAGCUCACAGUCUAGAca 767 UAAGGUGCAUCUAGUGCAGUU hsa-mir-18b- hsa-mir- 1061 UcUUgUgUUAAGGUGCAUCUAGUGCAGUUagUgaagcag 2 18b cUUagaaUcUacUgcccUaaaUgccccUUcUggcacaggc 768 GAGGGUUGGGUGGAGGC hsa-miR-296- hsa-miR- 1062 cUgccUccaccccgccUggccUgacccagccagggcUcUagGAGG 2 296-2 GUUGGGUGGAGGCaa 769 AUCAUAGAGGAAAAUCCAUGUU hsa-mir-376b- hsa-mir- 1063 UaaaacgUggaUaUUccUUcUaUgUUUacgUgaUUccUggU 2 376b UaAUCAUAGAGGAAAAUCCAUGUUUUc 770 AACAUAGAGGAAAUUCCACGU hsa-mir-376c- hsa-mir- 1064 UaaaaggUggaUaUUccUUcUaUgUUUaUgUUaUUUaUgg 2 376c UUaAACAUAGAGGAAAUUCCACGUUUUc 771 ACUGGACUUGGAGUCAGAAA hsa-mir-378b- hsa-mir- 1065 acUgUUUcUgUccUUgUUcUUgUUgUUaUUACUGGACU 1 378d-1 UGGAGUCAGAAAcagg 772 ACUGGACUUGGAGUCAGAAA hsa-mir-378b- hsa-mir- 1066 aggagagaacACUGGACUUGGAGUCAGAAAacUUUcaUcc 2 378d-2 aagUcaUUcccUgcUcUaagUcccaUUUcUgUUcca 773 ACUGGACUUGGAGUCAGGA hsa-miR-378c hsa-mir- 1067 cUgacUccagUgUccaggccaggggcagacagUggacagagaacag 378e UgcccaagaccACUGGACUUGGAGUCAGGAcaU 774 AGGCAGUGUAUUGCUAGCGGCU hsa-mir-449c hsa-mir- 1068 UcaggUAGGCAGUGUAUUGCUAGCGGCUgUUaaUgaUU 449c UUaacagUUgcUagUUgcacUccUcUcUgU 775 UGCACCCAGGCAAGGAUUCUGC hsa-mir-500- hsa-mir- 1069 gUUcccccUcUcUaaUccUUgcUaccUgggUgagagUgcUUUc 2 500b UgaaUgcagUGCACCCAGGCAAGGAUUCUGCaagggggag U 776 UAAUCCUUGCUACCUGGGUGAG hsa-mir-500- has-mir- 1070 gUUcccccUcUcUAAUCCUUGCUACCUGGGUGAGagUgc 2* 500b UUUcUgaaUgcagUgcacccaggcaaggaUUcUgcaagggggag U 777 AAAAGUAAUCGCGGUUUUUGUC hsa-mir-548h- hsa-mir- 1071 acAAAAGUAAUCGCGGUUUUUGUCaUUacUUUUaacUg 5 548h-5 UaaaaaccacggUUgcUUUUgc 778 AAAAGUAAUUGUGGAUUUUGCU hsa-mir-548r- hsa-mir- 1072 aUgUUggUgcAAAAGUAAUUGUGGAUUUUGCUaUUacU 1 548ab UgUaUUUaUUUgUaaUgcaaaacccgcaaUUagUUUUgcacc aacc 779 AAAAGUAAUUGUGGAUUUUGCU hsa-mir-548r- has-mir- 1073 UgUUggUgcAAAAGUAAUUGUGGAUUUUGCUaUUacU 2 548ab UgUaUUUaUUUgUaaUgcaaaacccgcaaUUagUUUUgcacc aacc 780 UGUCUUACUCCCUCAGGCACAU hsa-miR-550- pending 1074 cUggUgcagUgccUgagggagUaagagUccUgUUgUUgUaaga 3* UagUGUCUUACUCCCUCAGGCACAUcUccaa 781 GGUGGGCUUCCCGGAGGG hsa-mir-2221 hsa-mir- 1075 gaaaacaaccaGGUGGGCUUCCCGGAGGGcggaacacccagc 4417 cccagcaUccagggcUcaccUaccacgUUUg 782 GAAGCGGUGGCUGGGCUG hsa-mir-2222 pending 1076 gaggcggcccUagcgccaUUUUgUgggagcGAAGCGGUGGCU GGGCUGcgcUUg 783 CACUGCAGGACUCAGCAG hsa-mir-2223 hsa-mir- 1077 UggUUUUUgcUcUgagUgaccgUggUggUUgUgggagUCAC 4418 UGCAGGACUCAGCAGgaaUUc 784 UGAGGGAGGAGACUGCA hsa-mir-2224 hsa-mir- 1078 UggUggUgUgUgccUgUagUcUUagcUacUcgggaggcUGAG 4419a GGAGGAGACUGCAgUgagUggaggUcacgccacUg 785 ACUGGACUUGGAGCCAGAAG hsa-mir-2225 hsa-mir- 1079 gUcaggUccUggacUcccaUagUUUUcaggcUgcUaaacaacag 378f aacgagcACUGGACUUGGAGCCAGAAGUcUUggg 786 GUCACUGAUGUCUGUAGCUGAG hsa-mir-2226 hsa-mir- 1080 cUcUUggUaUgaacaUcUgUgUgUUcaUgUcUcUcUgUgca 4420 caggggacgagaGUCACUGAUGUCUGUAGCUGAGac 787 GAUGAGGAUGGAUAGCAAGGAA hsa-mir-2227 hsa-mir- 1081 cUggccUcUgUgccUggaUacUUUaUacgUgUaaUUgUGAU 3605 GAGGAUGGAUAGCAAGGAAgccgc 788 ACCUGUCUGUGGAAAGGAGCUA hsa-mir-2228 hsa-mir- 1082 cUgggUcUccUUUcUgcUgagagUUgaacacUUgUUgggaca 4421 ACCUGUCUGUGGAAAGGAGCUAccUac 789 AAAAGCAUCAGGAAGUACCCA hsa-mir-2229 hsa-mir- 1083 agUUcUUcUgcagacAAAAGCAUCAGGAAGUACCCAccaU 4422 gUaccagUgggcccUUcUUgaUgcUcUUgaUUgcagaggagcc 790 UGCCUGGAACAUAGUAGGGACU hsa-mir-2230- hsa-mir- 1084 UccUUUaUUgagUcccUacUaUgUUccaggcaccUacgaUacc 1 3116-2 cagUGCCUGGAACAUAGUAGGGACUcaaUaaagU 791 UGCCUGGAACAUAGUAGGGACU hsa-mir-2230- hsa-mir- 1085 ccUUUaUUgagUcccUacUaUgUUccaggcaccUacgaUaccc 2 3116-1 agUGCCUGGAACAUAGUAGGGACUcaaUaaagU 792 UGGAUUAAAAACAAUGGAGG hsa-mir-2231 pending 1086 cgccUccaUgUUUcagcaUcUaUgUcaUgggcUUggUccUgga gUGGAUUAAAAACAAUGGAGGU 793 AUAGGCACCAAAAAGCAACAA hsa-mir-2232 hsa-mir- 1087 aUcaUgUacUgcagUUgccUUUUUgUUcccaUgcUgUUUaa 4423 gccUagcAUAGGCACCAAAAAGCAACAAcagUaUgUgaa 794 ACUGGGCUUGGAGUCAGAAG hsa-mir-2233 hsa-mir- 1088 cACUGGGCUUGGAGUCAGAAGaccUggcUccagcccagcUc 378g gUaUUaggUUggUgcaaaagUUaUUgUggUUUUUgcUaUU 795 CAAAAACCGGCAAUUACUUUUG hsa-mir-2234 hsa-mir- 1089 UUUUUUUaaUggCAAAAACCGGCAAUUACUUUUGcacU 548ac aaccUagUag 796 GUCAAAUGAAGGGCUGAUCACG hsa-mir-2235 pending 1090 aaagUGUCAAAUGAAGGGCUGAUCACGaaaUagcgcaUU agcUcUUUUUUUgaaaacUUg 797 AAAGGGAGGAUUUGCUUAGAAGG hsa-mir-2236 pending 1091 gacUggcUacgUagUUcgggcaaaUccUccaaaagggAAAGGG AUGG AGGAUUUGCUUAGAAGGAUGGcgcUcc 798 AGAGUUAACUCAAAAUGGACUA hsa-mir-2237 hsa-mir- 1092 cUUacaUcacacacAGAGUUAACUCAAAAUGGACUAaUU 4424 UUUccacUagUUagUccaUUUcaagUUaacUcUgUgUgUga UgUagU 799 UGUUGGGAUUCAGCAGGACCAU hsa-mir-2238 hsa-mir- 1093 gUgcUUUacaUgaaUggUcccaUUgaaUcccaacagcUUUgcg 4425 aagUgUUGUUGGGAUUCAGCAGGACCAUUcgUgUaaag Uaa 800 UAAAUAGAGUAGGCAAAGGACA hsa-mir-2239 hsa-mir- 1094 UaaaUggUUaUgUccUUUgccUaUUcUaUUUaagacacccU 3121 gUaccUUAAAUAGAGUAGGCAAAGGACAgaaacaUUUU 801 AGAGUCGAGAGUGGGAGAAGAG hsa-mir-2240 pending 1095 gcAGAGUCGAGAGUGGGAGAAGAGcggagcgUgUgagcag UacUgcggccUccUcUccUcUccUaaccUcgcUcUc 802 GAAGAUGGACGUACUUU hsa-mir-2241 hsa-mir- 1096 agUUGAAGAUGGACGUACUUUgUcUgacUacaaUaUUca 4426 aaaggagUcUacUcUUcaUcUUg 803 UCUGAAUAGAGUCUGAAGAGU hsa-mir-2242 hsa-mir- 1097 gaagccUcUUggggcUUaUUUagacaaUggUUUcaUcaUUUc 4427 gUCUGAAUAGAGUCUGAAGAGUcUUU 804 CAAGGAGACGGGAACAUGGAGC hsa-mir-2243 hsa-mir- 1098 UUggcaggUgccaUgUUgccUgcUccUUacUgUacacgUggcU 4428 ggCAAGGAGACGGGAACAUGGAGCcgccaU 805 AAGAGGAAGAAAUGGCUGGUUC hsa-mir-2244 hsa-mir- 1099 aggaagAAGAGGAAGAAAUGGCUGGUUCUcaggUgaaUg 3916 UgUcUgggUUcaggggaUgUgUcUccUcUUUUcU 806 UUCGCGGGCGAAGGCAAAGUC hsa-mir-2245 hsa-mir- 1100 ggcgggcUUCGCGGGCGAAGGCAAAGUCgaUUUccaaaag 3124 UgacUUUccUcacUcccgUgaagUcggcg 807 AAAAGCUGGGCUGAGAGGCG hsa-mir-2246 hsa-mir- 1101 agggagAAAAGCUGGGCUGAGAGGCGacUggUgUcUaaU 4429 UUgUUUgUcUcUccaacUcagacUgccUggccca 808 AUGGCCAAAACUGCAGUUAUUU hsa-mir-2247 hsa-mir- 1102 cUgcaaaaaUaaUUgcagUUUUUgccaUUaUUUUUaaUaa 548s UUaUaaUaAUGGCCAAAACUGCAGUUAUUUUUgcac 809 UAGUGGAUGAUGCACUCUGUGC hsa-mir-2248 hsa-mir- 1103 cUacUUccagUAGUGGAUGAUGCACUCUGUGCagggccaa 3681 cUgUgcacacagUgcUUcaUccacUacUggaagUgU 810 AGGCUGGAGUGAGCGGAG hsa-mir-2249 hsa-mir- 1104 gUgAGGCUGGAGUGAGCGGAGaUcgUaccacUgcacUcca 4430 accUggUga 811 GAAAACGACAAUGACUUUUGCA hsa-mir-2250 hsa-mir- 1105 cUgUUaggUUggUgcaaaagUaaUUgUggUUUUUgaaagUa 548ad acUUggcGAAAACGACAAUGACUUUUGCAccaaUcUaaUa c 812 GCGACUCUGAAAACUAGAAGGU hsa-mir-2251 hsa-mir- 1106 UggUUUGCGACUCUGAAAACUAGAAGGUUUaUgacUgg 4431 gcaUUUcUcacccaaUgcccaaUaUUgaacUUUcUagUUgUc agagUcaUUaaccc 813 AGAAGGCUGGAGCGCGGCGGU hsa-mir-2252 pending 1107 gcacUgcggUUcUgaggccgUUacUccggcUUcUccaUagaggg cggAGAAGGCUGGAGCGCGGCGGUga 814 AAAGACUCUGCAAGAUGCCU hsa-mir-2253 hsa-mir- 1108 gcaUcUUgcagagccgUUccaaUgcgacaccUcUagagUgUcaU 4432 ccccUagaaUgUcaccUUggAAAGACUCUGCAAGAUGCCU 815 ACAGGAGUGGGGGUGGGACAU hsa-mir-2254 hsa-mir- 1109 caUccUccUUacgUcccaccccccacUccUgUUUcUggUgaaaU 4433 aUUcaaACAGGAGUGGGGGUGGGACAUaaggaggaUa 816 AGGAGAAGUAAAGUAGAA hsa-mir-2255 hsa-mir- 1110 UcacUUUAGGAGAAGUAAAGUAGAAcUUUggUUUUcaa 4434 cUUUUccUacagUgU 817 AUGGCCAGAGCUCACACAGAGG hsa-mir-2256 hsa-mir- 1111 aggcagcaaAUGGCCAGAGCUCACACAGAGGgaUgagUgca 4435-1 cUUcaccUgcagUgUgacUcagcaggccaacagaUgcUa 818 GCAGGACAGGCAGAAGUGGAU hsa-mir-2257 hsa-mir- 1112 gccUcacUUUUccacUUaUgccUgcccUgccccUcgaaUcUgcU 4436 ccacgaUUUggGCAGGACAGGCAGAAGUGGAUaagUgagg a 819 AUCAGGGCUUGUGGAAUGGGAA hsa-mir-2258 hsa-mir- 1113 ggcccAUCAGGGCUUGUGGAAUGGGAAggagaagggacgc 3127 UUccccUUcUgcaggccUgcUgggUg 820 AUGGCCAGAGCUCACACAGAGG hsa-mir-2259 hsa-mir- 1114 gcaaAUGGCCAGAGCUCACACAGAGGgaUgagUgcacUUc 4435-2 accUgcagUgUgacUcagcaggccaacagaUgcU 821 UGAGGAUAUGGCAGGGAAGGGG hsa-mir-2260 hsa-mir- 1115 acgUggUGAGGAUAUGGCAGGGAAGGGGagUUUcccUc 3679 UaUUcccUUccccccagUaaUcUUcaUcaUgc 822 AGGAGGUUGGUGUGGAUU hsa-mir-2261 pending 1116 UaUgAGGAGGUUGGUGUGGAUUcUgUUgaagaaaaagaa ggggaacacUaaUUUUccaUU 823 UUGGAAGACAUGGAGCAUGAGG hsa-mir-2262 pending 1117 UUUUGGAAGACAUGGAGCAUGAGGUaagUgccUagaUcc UcaaaccacUUgccUccaccUaUgcUUccaggU 824 UCUGGCAAGUAAAAAACUCUCA hsa-mir-2263 hsa-mir- 1118 cUUccUCUGGCAAGUAAAAAACUCUCAUUUUccUUaaaa 3128 aaUgagagUUUUUUacUUgcaaUaggaaa 825 UGGGCUCAGGGUACAAAGGUU hsa-mir-2264 hsa-mir- 1119 acUUUgUgcaUUgggUccacaaggaggggaUgacccUUgUGG 4437 GCUCAGGGUACAAAGGUU 826 CAAAAACUGCAAUUACUUUCA hsa-mir-2265- hsa-mir- 1120 gcagUUUUUgccaUUaagUUgcggUUUUUgccaUUaUaaUg 1 548ae-1 gCAAAAACUGCAAUUACUUUCAcaccUgc 827 CAAAAACUGCAAUUACUUUCA hsa-mir-2265- hsa-mir- 1121 UgUgcaaaagUaaUUgUggUUUUUgUcaUUUaaaagUaaUg 2 548ae-2 gCAAAAACUGCAAUUACUUUCAcacc 828 GCUGCACCGGAGACUGGGUAA hsa-mir-2266- hsa-mir- 1122 acUUgUcaUgUcUUacccagUcUccggUgcagccUgUUgUcaa 1 3130-1 gGCUGCACCGGAGACUGGGUAAgacaUgacaagc 829 GCUGCACCGGAGACUGGGUAA hsa-mir-2266- hsa-mir- 1123 UgUcUUacccagUcUccggUgcagccUUgacaacagGCUGCAC 2 3130-2 CGGAGACUGGGUAAgacaUgacaagUU 830 AUCCCCAGAUACAAUGGACAAU hsa-mir-2267 hsa-mir- 1124 cgUgUcAUCCCCAGAUACAAUGGACAAUaUgcUaUUaUa 2355 aUcgUaUggcaUUgUccUUgcUgUUUggagaUaaUacU 831 AUUGUCCUUGCUGUUUGGAGAU hsa-mir-2267* pending 1125 cgUgUcaUccccagaUacaaUggacaaUaUgcUaUUaUaaUcg UaUggcAUUGUCCUUGCUGUUUGGAGAUaaUacU 832 CACAGGCUUAGAAAAGACAGU hsa-mir-2268 hsa-mir- 1126 UaagUgUaaacUUaaggacUgUcUUUUcUaagccUgUgccUU 4438 gccUUUccUUUggCACAGGCUUAGAAAAGACAGUcUUUa agUUUacacUUc 833 UCGAGGACUGGUGGAAGGGCCU hsa-mir-2269 hsa-mir- 1127 UcUcagagUCGAGGACUGGUGGAAGGGCCUUUccccUca 3131 gaccaaggcccUggccccagcUUcUUcUcagagU 834 GUGACUGAUACCUUGGAGGCAU hsa-mir-2270 hsa-mir- 1128 ccaGUGACUGAUACCUUGGAGGCAUUUUaUcUaagaUac 4439 acacaaagcaaaUgccUcUaaggUaUcagUUUaccaggcca 835 AGGGCUGGACUCAGCGGCGGAG hsa-mir-2271 pending 1129 gcgcagAGGGCUGGACUCAGCGGCGGAGcUggcUgcUggc cUcagUUcUgccUcUgUccaggUccUUgUga 836 UGUCGUGGGGCUUGCUGGCUUG hsa-mir-2272 hsa-mir- 1130 cUcUcaccaagcaagUgcagUggggcUUgcUggcUUgcaccgUg 4440 acUcccUcUcaccaagcaagUGUCGUGGGGCUUGCUGGCU UGcacUgUgaagaU 837 ACAGGGAGGAGAUUGUA hsa-mir-2273 hsa-mir- 1131 cagagUcUccUUcgUgUacagggaggagacUgUacgUgagagaU 4441 agUcagaUccgcaUgUUagagcagagUcUccUUcgUgUACAG GGAGGAGAUUGUAc 838 ACUGGACUUGGAGGCAGAA hsa-mir-2274 hsa-mir- 1132 UggUcaUUgagUcUUcaaggcUagUggaaagagcACUGGACU 378b UGGAGGCAGAAagaccc 839 GCCGGACAAGAGGGAGG hsa-mir-2275 hsa-mir- 1133 gcgcccUcccUcUcUccccggUgUgcaaaUgUgUgUgUgcggUg 4442 UUaUGCCGGACAAGAGGGAGGUg 840 AUACACAUACACGCAACACACA hsa-mir-2276 hsa-mir- 1134 aUgUgUgUgUaUaUgUgUgUUgcaUgUgUgUaUaUgUgUg 466 UaUaUaUgUacacAUACACAUACACGCAACACACAUaUa UacaUgcac 841 UUGGAGGCGUGGGUUUU hsa-mir-2277 hsa-mir- 1135 ggUgggggUUGGAGGCGUGGGUUUUagaaccUaUcccUU 4443 UcUagcccUgagca 842 AAUUCCCUUGUAGAUAACCCGG hsa-mir-2278 hsa-mir- 1136 cgaUcacUagaUUaUcUacaagggaaUUUUUUUUUaaUUU 3938 aaaaAAUUCCCUUGUAGAUAACCCGGUggUca 843 AAGACUGGAGACAAAGUGGGAG hsa-mir-2279 pending 1137 CACCACCAAAAUCUCCAGGGGCAUCGUUGAAAUCGUA AGGGAUGUGCAGCUCAUUAAGACUGGAGACAAAGUG GGAG 844 CUGACUGAAUAGGUAGGGUCAU hsa-mir-2280 hsa-mir- 1138 aaaCUGACUGAAUAGGUAGGGUCAUUUUUcUgUgacUg 3136 cacaUggcccaaccUaUUcagUUagUUc 845 CUCGAGUUGGAAGAGGCG hsa-mir-2281 hsa-mir- 1139 gUgacgacUggccccgccUcUUccUcUcggUcccaUaUUgaaCU 4444 CGAGUUGGAAGAGGCGagUccggUcUcaaa 846 AGAUUGUUUCUUUUGCCGUGCA hsa-mir-2282 hsa-mir- 1140 UUccUgcAGAUUGUUUCUUUUGCCGUGCAagUUUaagU 4445 UUUUgcacggcaaaagaaacaaUccagagggU 847 CACGGCAAAAGAAACAAUCCA hsa-mir-2282* has-mir- 1141 UUccUgcagaUUgUUUcUUUUgccgUgcaagUUUaagUUU 4445 UUgCACGGCAAAAGAAACAAUCCAgagggU 848 CAGGGCUGGCAGUGACAUGGGU hsa-mir-2283 hsa-mir- 1142 cUggUccaUUUcccUgccaUUcccUUggcUUcaaUUUacUcc 4446 CAGGGCUGGCAGUGACAUGGGUcaa 849 GGUGGGGGCUGUUGUUU hsa-mir-2284 hsa-mir- 1143 gUUcUagagcaUggUUUcUcaUcaUUUgcacUacUgaUacU 4447 UggggUcagaUaaUUgUUUgUGGUGGGGGCUGUUGUUU gcaUUgUaggaU 850 UGGGGAGGUGUGGAGUCAGCAU hsa-mir-2285 pending 1144 gggcaUGGGGAGGUGUGGAGUCAGCAUggggcUaggaggc cccgcgcUgacccgccUUcUccgcagcUg accUgagcaccaUUUacUgagUccUUUgUUcUcUacUagUUU 851 GCAGAGAACAAAGGACUCAGU hsa-mir-2286 hsa-mir- 1145 gUagUagUUcgUaGCAGAGAACAAAGGACUCAGUaaaUg 3919 gUgcUcagga 852 GGCUCCUUGGUCUAGGGGUA hsa-mir-2287 hsa-mir- 1146 aggagUgaccaaaagacaagagUgcgagccUUcUaUUaUgcccag 4448 acagggccaccagagGGCUCCUUGGUCUAGGGGUAaUgcca 853 CGUCCCGGGGCUGCGCGAGGCA hsa-mir-2288 hsa-mir- 1147 agcagcccUcggcggcccggggggcgggcggcggUgccCGUCCCG 4449 GGGCUGCGCGAGGCAcaggcg 854 AAAGGUAAUUGUGGUUUCUGC hsa-mir-2289- hsa-mir- 1148 gUgcAAAGGUAAUUGUGGUUUCUGCUUUUaaaggUaaU 1 548ag-1 ggcaaaUaUUacaUUUacUUUUgcacca 855 AAAGGUAAUUGUGGUUUCUGC hsa-mir-2289- hsa-mir- 1149 UgcAAAGGUAAUUGUGGUUUCUGCcaUUgaaagUaaagg 2 548ag-2 caagaaccUcaaUUaccUUUgcagc 856 UGGGGAUUUGGAGAAGUGGUGA hsa-mir-2290 hsa-mir- 1150 UgUcUGGGGAUUUGGAGAAGUGGUGAgcgcaggUcUUU 4450 ggcaccaUcUccccUggUcccUUggcU 857 AAAAGUGAUUGCAGUGUUUG hsa-mir-2291 hsa-mir- 1151 aggUUggUgcAAAAGUGAUUGCAGUGUUUGccaaUaaaa 548ah gUaaUgacaaaaacUgcagUUacUUUUgcaccagccc 858 UGGUAGAGCUGAGGACA hsa-mir-2292 hsa-mir- 1152 UcUgUaccUcagcUUUgcUcccaaccaaccacUUccacaUgUU 4451 UUgcUGGUAGAGCUGAGGACAgc 859 UUGAAUUCUUGGCCUUAAGUGAU hsa-mir-2293 hsa-mir- 1153 UggaUcacUUgaggccaagagUgcaaggcUgUagUgUgcacagc 4452 cUUGAAUUCUUGGCCUUAAGUGAUccc 860 UAGGAGCUCAACAGAUGCCUGU hsa-mir-2294 hsa-mir- 1154 UcagagUAGGAGCUCAACAGAUGCCUGUUgacUgaaUaa 3139 UaaacaggUaUcgcaggagcUUUUgUUaUgU 861 AGCUUUUGGGAAUUCAGGUAG hsa-mir-2295 hsa-mir- 1155 UgUccUcUUgaggUaccUgaaUUaccaaaagcUUUaUgUaUU 3140 cUgaagUUaUUgaaaaUaagAGCUUUUGGGAAUUCAGGU AGUUcaggagUgacU 862 GAGCUUGGUCUGUAGCGGUU hsa-mir-2296 hsa-mir- 1156 UggaGAGCUUGGUCUGUAGCGGUUUccUUggggcaggUg 4453 gggacUgcUccUUUgggaggaaggaggaggcccaggccgcgUcUU cagg 863 GGAUCCGAGUCACGGCACCA hsa-mir-2297 hsa-mir- 1157 ccGGAUCCGAGUCACGGCACCAaaUUUcaUgcgUgUccgU 4454 gUgaagagaccacca 864 CAAAAGUGAUCGUGGUUUUUG hsa-mir-2298 hsa-mir- 1158 gUggUgCAAAAGUGAUCGUGGUUUUUGcaaUUUUUUaa 548t UgacaaaaaccacaaUUacUUUUgcaccaa 865 AGGGUGUGUGUGUUUUU hsa-mir-2299 hsa-mir- 1159 agaAGGGUGUGUGUGUUUUUccUgagaaUaagagaaggaa 4455 ggacagccaaaUUcUUca 866 CCUGGUGGCUUCCUUUU hsa-mir-2300 hsa-mir- 1160 aUgaaCCUGGUGGCUUCCUUUUcUgggaggaagUUagggU 4456 Uca 867 UCACAAGGUAUUGACUGGCGUA hsa-mir-2301 hsa-mir- 1161 ggagUacUccagUcaaUaccgUgUgagUUagaaaagcUcaaUU 4457 CACAAGGUAUUGACUGGCGUAUUca 868 AGAGGUAGGUGUGGAAGAA hsa-mir-2302 hsa-mir- 1162 gagcgcacAGAGGUAGGUGUGGAAGAAagUgaaacacUaU 4458 UUUaggUUUUagUUacacUcUgcUgUggUgUgcUg 869 CCAGGAGGCGGAGGAGGUGGAG hsa-mir-2303 hsa-mir- 1163 acCCAGGAGGCGGAGGAGGUGGAGgUUgcagUgagccaag 4459 aUcgUggcacUgacUccagccUgggg 870 GUGGAGGACUGAGAAGGUGAG hsa-mir-2304 pending 1164 aUgaUGUGGAGGACUGAGAAGGUGAGgcagUUUUgcccc gUgcUgccUUccaccggUUaagaccUccaaaaUcga 871 ACUGACAGGAGAGCAUUUUGA hsa-mir-2305 hsa-mir- 1165 ggacaaaaUUaaaaUgcUcUUcUgUcaUUgUaaUagUUcaUa 3660 UgggcACUGACAGGAGAGCAUUUUGAcUUUgUca 872 AGCGCGGGCUGAGCGCUGCCAG hsa-mir-2306 hsa-mir- 1166 ggUUcacUggUcgUgcUUccUgcgggcUgAGCGCGGGCUGA 2277 GCGCUGCCAGUcagcg 873 AAGCUCGGGCGCUCCGGCUGU hsa-mir-2307 pending 1167 gcUcagUcagcUgggccgccUcagcUcUcggagUaggAAGCUCG GGCGCUCCGGCUGUaaggagcc 874 AUAGUGGUUGUGAAUUUACCUU hsa-mir-2308 hsa-mir- 1168 gUUUUUUgcccAUAGUGGUUGUGAAUUUACCUUcUccU 4460 cUUUgcagUgaUaaaggaggUaaaUUcacaaccacUgUgggcag aaac 875 GAUUGAGACUAGUAGGGCUAGGC hsa-mir-2309 hsa-mir- 1169 gagUaggcUUaggUUaUgUacgUagUcUaggccaUacgUgUU 4461 ggaGAUUGAGACUAGUAGGGCUAGGCcUacUg 876 CUACCCCAGGAUGCCAGCAUAG hsa-mir-2310 pending 1171 aUagcUggUUggcaUUcUggcccUggUUcaUgccaacUcUUg UgUUgaCUACCCCAGGAUGCCAGCAUAGUUgc 877 ACUGGACUUGGUGUCAGAUGG hsa-mir-2311 hsa-mir- 1171 acaggaacACUGGACUUGGUGUCAGAUGGgaUgagcccUg 378h gcUcUgUUUccUagcagcaaUcUgaUcUUgagcUagUcacUgg 878 GACAAUGAUGAGAAGACCUGAG hsa-mir-2312 pending 1172 gggGACAAUGAUGAGAAGACCUGAGgaUUUgcagccccca gcccUgggUUcaagUcccagcUcUaccccUUcUUggcccc 879 ACCGCUCGAUCUUGGGACC hsa-mir-2313 pending 1173 gUUUcACCGCUCGAUCUUGGGACCcaccgcUgcccUcagcU ccgagUccagggcgaggUaagggcUggagUcgggcagga 880 UAGUGGAUGAUGGAGACUCGGU hsa-mir-2314 hsa-mir- 1174 aUUgaggcacUgggUAGUGGAUGAUGGAGACUCGGUacc 3691 cacUgcUgagggUggggaccaagUcUgcgUcaUccUcUccUcag UgccUcaaa 881 CUCGGGAGCGUUAGAGAUGGA hsa-mir-2315 pending 1175 gUCUCGGGAGCGUUAGAGAUGGAgacUaacgUcUUccaa gggagaUUgcgUcUccacUUUcacccUggUacUgagag 882 GGCUGGAGCGAGUGCAGUGGUG hsa-mir-2316 hsa-mir- 1176 UgcccaGGCUGGAGCGAGUGCAGUGGUGcagUcagUccU 3135b agcUcacUgcagccUcgaacUccUgggcU 883 UCAGGUGUGGAAACUGAGGCAG hsa-mir-2317 hsa-mir- 1177 UUUUCAGGUGUGGAAACUGAGGCAGgaggcagUgaagUa 3934 acUUgcUcaggUUgcacagcUgggaagU 884 UGACACGGAGGGUGGCUUGGGAA hsa-mir-2318 hsa-mir- 1178 cUUcccagcUgcccUaagUcaggagUggcUUUccUGACACGG 4462 AGGGUGGCUUGGGAAa 885 GAAGAUGGUGCUGUGCUGAGGA hsa-mir-2319 pending 1179 ggUGAAGAUGGUGCUGUGCUGAGGAaaggggaUgcagagc ccUgcccagcaccaccaccUccUaUg 886 AAAGACUGCAAUUACUUUUGCG hsa-mir-2320 hsa-mir- 1180 aUggUgcaaaagUaaUgUggUUUUUUUcUUUacUUUUaaU 548u ggcAAAGACUGCAAUUACUUUUGCGcca 887 GAGACUGGGGUGGGGCC hsa-mir-2321 hsa-mir- 1181 aaUagaUUaUUggUcaccaccUccagUUUcUgaaUUUgUGA 4463 GACUGGGGUGGGGCCUgagaaUUUgc 888 AAGGUUUGGAUAGAUGCAAUA hsa-mir-2322 hsa-mir- 1182 ggaaccUUagUAAGGUUUGGAUAGAUGCAAUAaagUaUg 4464 UccacagcUgaaaggacaUacUUUaUUgcaUgUaUccaaaccU UacUaaUUca 889 AAAGGUAAUUGCAGUUUUUCCC hsa-mir-2323 hsa-mir- 1183 gUaUUaggUUggUgcAAAGGUAAUUGCAGUUUUUCCCa 548ai UUUaaaaUaUggaaaaaaaaaUcacaaUUacUUUUgcaUcaa ccUaaUaa 890 AGGGGACCAAAGAGAUAUAUAG hsa-mir-2324 hsa-mir- 1184 gaaacUacacUUUaAGGGGACCAAAGAGAUAUAUAGaUa 3144 UcagcUaccUaUaUaccUgUUcggUcUcUUUaaagUgUagU UUa 891 UAAAAACUGCAAUUACUUUUA hsa-mir-2325- hsa-mir- 1185 aUUggUgUaaaagUaaUUgcaggUUaUgccaUUaaaagUaaU 1 548aj-1 ggUAAAAACUGCAAUUACUUUUAcacUaac 892 UAAAAACUGCAAUUACUUUUA hsa-mir-2325- hsa-mir- 1186 aaggUaUUaggUUggUgcaaaagUaaUUgcagUUUUUgcUa 2 548aj-2 UUacUUUUaaUggUAAAAACUGCAAUUACUUUUAcacca accUaaUaUUUa 893 CUCAAGUAGUCUGACCAGGGGA hsa-mir-2326 hsa-mir- 1187 caUgUgUccccUggcacgcUaUUUgaggUUUacUaUggaacC 4465 UCAAGUAGUCUGACCAGGGGAcacaUga 894 UCUGGCUGAGGAGGAAGUGGAG hsa-mir-2327- pending 1188 gcUcUagUagccacagccaUccccUagagggaUCUGGCUGAGG 1 AGGAAGUGGAGg 895 UCUGGCUGAGGAGGAAGUGGAG hsa-mir-2327- pending 1189 ccgccUcagUggcUUccUccacagccaccUccggagggaUCUGGC 2 UGAGGAGGAAGUGGAGgUgUcacUgg 896 GGCGACAAAACGAGACCCUGU hsa-mir-2328 hsa-mir- 1190 cUgGGCGACAAAACGAGACCCUGUcUUUUUUUUUUUc 1273c UgagacagagUcUcgUUcUgUUgcccaa 897 GGGUGCGGGCCGGCGGGG hsa-mir-2329 hsa-mir- 1191 acgcGGGUGCGGGCCGGCGGGGUagaagccacccggcccggc 4466 ccggcccggcga 898 CCUGCUGGUCAGGAGUGGAUAC hsa-mir-2330 hsa-mir- 1192 gccaUUCCUGCUGGUCAGGAGUGGAUACUggagcaaUag 3692 aUacagUUccacacUgacacUgcagaagUgga 899 CAUGCUAGGAUAGAAAGAAUGG hsa-mir-2331 hsa-mir- 1193 aUUUUcUUUgcUaagUcccUUcUUUcUaUccUagUaUaac 3146 UUgaagaaUUcaaaUagUCAUGCUAGGAUAGAAAGAAUG GgacUUggccagggaagaa 900 AAUGUGGAAGUGGUCUGAGGCA hsa-mir-2332 pending 1194 gaaUagaaagAAUGUGGAAGUGGUCUGAGGCAUaUagag UaUaUgccaagaacacUaccaUa 901 GCAAAGUGAUGAGUAAUACUGG hsa-mir-2333 hsa-mir- 1195 acagUaacUUUUaUUcUcaUUUUccUUUUcUcUaccUUgU 3609 agagaaGCAAAGUGAUGAGUAAUACUGGcUgg 902 UGGCGGCGGUAGUUAUGGGCUU hsa-mir-2334 hsa-mir- 1196 UggUGGCGGCGGUAGUUAUGGGCUUcUcUUUcUcacca 4467 gcagccccUgggccgccgccUcccU 903 AGAGCAGAAGGAUGAGAU hsa-mir-2335 hsa-mir- 1197 agUcUUcUccUggggcUUUggUggcUaUggUUgacUgggccac 4468 UcAGAGCAGAAGGAUGAGAUg 904 UGGAAUGGCCUGAAGGUGGA hsa-mir-2336 pending 1198 ccUggcagcccUcUggccUagUUcccaccacacaUgaggUggUG GAAUGGCCUGAAGGUGGAacaga 905 GCUCCCUCUAGGGUCGCUCGGA hsa-mir-2337 hsa-mir- 1199 ccgacgcggagagcggcUcUaggUgggUUUggcggcggcgaggaca 4469 ccgccGCUCCCUCUAGGGUCGCUCGGAgcgUga 906 UGGCAAACGUGGAAGCCGAGA hsa-mir-2338 hsa-mir- 1200 cgagccUcUUUcggcUUUccagUUUgUcUcggUccUUUggaa 4470 cgUGGCAAACGUGGAAGCCGAGAgggcUcU 907 UUUGUAUGGAUAUGUGUGUGUA hsa-mir-2339 hsa-mir- 1201 aUaUacaUacaUgUacacacacaUgUcaUccacacacaUacaUa 3149 UaUaUaUgUUUGUAUGGAUAUGUGUGUGUAUgUgUg UgUaUac 908 UGAGGAGAUCGUCGAGGUUGGC hsa-mir-2340 hsa-mir- 1202 aaagcaggccaaccUcgaggaUcUccccagccUUggcgUUcaggU 3150b gcUGAGGAGAUCGUCGAGGUUGGCcUgcUUc 909 UGGGAACUUAGUAGAGGUUUAA hsa-mir-2341 hsa-mir- 1203 ccaaaUUUaaaacUUaaaccUcUacUaagUUUccaUgaaaaga 4471 acccaUGGGAACUUAGUAGAGGUUUAAgUUUUaaaUUU ga 910 GGUGGGGGGUGUUGUUUU hsa-mir-2342- hsa-mir- 1204 UggcagacccUUgcUcUcUcacUcUcccUaaUggggcUgaagac 1 4472-1 agcUcaggggcagGGUGGGGGGUGUUGUUUUUgUUU 911 GGUGGGGGGUGUUGUUUU hsa-mir-2342- hsa-mir- 1205 UggUgggGGUGGGGGGUGUUGUUUUUgUUUUUgagaca 2 4472-2 gagUcUUgcUccgUcgcccaggccggagU 912 CUAGUGCUCUCCGUUACAAGUA hsa-mir-2343 hsa-mir- 1206 aaggaacaggggacacUUgUaaUggagaacacUaagcUaUggac 4473 UgcUaUggacUgCUAGUGCUCUCCGUUACAAGUAUcccc UgUUaccU 913 CACUUGUAAUGGAGAACACUAA hsa-mir-2344 pending 1207 aaaggaacaggggaCACUUGUAAUGGAGAACACUAAgcUa UggacUgcUaUggacUgcUagUgcUcUccgUUacaagUaUccc cUgUUaccUUg 914 UUGUGGCUGGUCAUGAGGCUAA hsa-mir-2345 hsa-mir- 1208 UUgccUaccUUgUUagUcUcaUgaUcagacacaaaUaUggcUc 4474 UUUGUGGCUGGUCAUGAGGCUAAcaaggUaggcac 915 CCCUGGGGUUCUGAGGACAUG hsa-mir-2346 pending 1209 aUgcUgCCCUGGGGUUCUGAGGACAUGcUcUgacUcccc UgaUgUccUcUgUUccUcaggUgcUgggcga 916 CAAGGGACCAAGCAUUCAUUAU hsa-mir-2347 hsa-mir- 1210 aUcUcaaUgagUgUgUggUUcUaaaUgacUcaUagUCAAGG 4475 GACCAAGCAUUCAUUAUgaa 917 CAGGAAGGAUUUAGGGACAGGC hsa-mir-2348 hsa-mir- 1211 aaaagccUgUcccUaagUcccUcccagccUUccagagUUggUgc 4476 CAGGAAGGAUUUAGGGACAGGCUUUg 918 CUAUUAAGGACAUUUGUGAUUC hsa-mir-2349 hsa-mir- 1212 UccUccUcccaUcaaUcacaaaUgUccUUaaUggcaUUUaagg 4477a aUUgCUAUUAAGGACAUUUGUGAUUCacgggaggaggU 919 AUUAAGGACAUUUGUGAUUGAU hsa-mir-2350 hsa-mir- 1213 accUccUcccgUgaaUcacaaaUgUccUUaaUagcaaUccUUaa 4477b aUgccAUUAAGGACAUUUGUGAUUGAUgggaggagga 920 AAAAGGCAUAAAACCAAGACA hsa-mir-2351- hsa-mir- 1214 cUUUUUUUgUUgcUUgUcUUggUUUUaUgccUUUUaUg 1 3910-2 UgccUUgaUaUAAAAGGCAUAAAACCAAGACAagcaacag aaaaac 921 AAAAGGCAUAAAACCAAGACA hsa-mir-2351- hsa-mir- 1215 cUgUcagUUUUUcUgUUgcUUgUcUUggUUUUaUgccUU 2 3910-1 UUaUaUcaaggcacaUAAAAGGCAUAAAACCAAGACAagc aacaa 922 GAGGCUGAGCUGAGGAG hsa-mir-2352 hsa-mir- 1216 ggccGAGGCUGAGCUGAGGAGccUccaaaccUgUagacagg 4478 gUcaUgcagUacUaggggcgagccUcaUccccUgcagcccUggcc 923 CUGGGAGGUGUGAUAUUGUGGU hsa-mir-2353 hsa-mir- 1217 gggaggUgUgaUaUcgUggUUccUgggaggUgUgaUaUcgUg 3689c gUUcCUGGGAGGUGUGAUAUUGUGGUUccU 924 UAAAAACUGCAAUUACUUUC hsa-mir-2354- hsa-mir- 1218 aUgccaaaUaUUaggUUggcacaaaagUaaUUgUggcUUUUg 1 548x-2 ccaUUaaaagUaaUggUAAAAACUGCAAUUACUUUCgUgc caaccUaaUaUUUgUgUg 925 UAAAAACUGCAAUUACUUUC hsa-mir-2354- hsa-mir- 1219 agUgcaaaagUaaUUgcagUUUUUgcgUUacUUUcaaUcgU 2 548x-1 AAAAACUGCAAUUACUUUCacacc 926 UGUGAUAUCAUGGUUCCUGGGA hsa-mir-2355- hsa-mir- 1220 gcUcccUgggaggUGUGAUAUCAUGGUUCCUGGGAggUg 1 3689a UgaUccUgUgcUUccUgggaggUgUgaUaUcgUggUUccUgg gagg 927 GGGAGGUGUGAUCUCACACUCG has-mir-2356- hsa-mir- 1221 UGGGAGGUGUGAUCUCACACUCGcUgggaggUgUgcUaU 1 3689d-1 cgUcUUccccgggaggUgUgaUccUgUUcUUccUg 928 CUGGGAGGUGUGAUAUUGUGGU mir-2355-2* has-mir- 1222 gggaggUGUGAUAUCAUGGUUCCUGGGAggUgUgaUccc 3689b-1 gUgcUUcCUGGGAGGUGUGAUAUUGUGGUUccU 929 UGUGAUAUCAUGGUUCCUGGGA hsa-mir-2355- hsa-mir- 1223 gggaggUGUGAUAUCAUGGUUCCUGGGAggUgUgaUccc 2 3689b-1 gUgcUUcCUGGGAGGUGUGAUAUUGUGGUUccU 930 GGGAGGUGUGAUCUCACACUCG has-mir-2356- hsa-mir- 1224 acUGGGAGGUGUGAUCUCACACUCGcUgggaggUgUgcU 2 3689d-2 aUcgUcUUcccUgggaggUgUgaUccUgUUcUUccUgagcg 931 UGUGAUAUCAUGGUUCCUGGGA hsa-mir-2355- has-mir- 1225 gggaggUGUGAUAUCAUGGUUCCUGGGAggUaUgaUaUc 3 3689b-2 gUggUUccUgggaggUgUgaUcccgUgcUcccU 932 UGUGAUAUCGUGCUUCCUGGGA hsa-mir-2355b hsa-mir- 1226 aggUGUGAUAUCGUGCUUCCUGGGAcgUgUgaUgcUgUg 3689f cUUccUgggaggUgUgaUcccacacUc 933 CGCGCGGCCGUGCUCGGAGCAG hsa-mir-2356 hsa-mir- 1227 gaaaccaagUccgagcgUggcUggcgcgggaaagUUcgggaacgC 4479 GCGCGGCCGUGCUCGGAGCAGcgcca 934 CCAGGCUCUGCAGUGGGAACU hsa-mir-2357a hsa-mir- 1228 ccUgUUccgggcaUcaccUcccacUgcagagccUggggagccggac 3155a agcUcccUUcCCAGGCUCUGCAGUGGGAACUgaUgccUgg aacagU 935 CCAGGCUCUGCAGUGGGA hsa-mir-2357b hsa-mir- 1229 ccacUgcagagccUgggaagggagcUgUccggcUccCCAGGCUC 3155b UGCAGUGGGAgU 936 AAAAGUAACUGCGGUUUUUGA hsa-mir-2358 hsa-mir- 1230 gUgcAAAAGUAACUGCGGUUUUUGAgaagUaaUUgaaaa 548ak ccgcaaUUacUUUUgcag 937 AGCCAAGUGGAAGUUACUUUA hsa-mir-2359 hsa-mir- 1231 gcagaggUgagUUgaccUccacagggccacccagggagUaagUAG 4480 CCAAGUGGAAGUUACUUUAccUcUgU 938 GGAGUGGGCUGGUGGUU hsa-mir-2360 hsa-mir- 1232 GGAGUGGGCUGGUGGUUUUUUaagaggaagggagaccUa 4481 agcUagcacaUgagcacgcUc 939 GAGCGAUCCGAGGGACUG hsa-mir-2361 pending 1233 cggcUUcccgcggUccccggUgcUgaggagaGAGCGAUCCGAG GGACUGcgccgcc 940 AAGGGCUUCCUCUCUGCAGGAC hsa-mir-2362- hsa-mir- 1234 acaUUaUUcaggccggUccUgcagagaggaagcccUUccaaUacc 1 3158-2 UgUaagcagAAGGGCUUCCUCUCUGCAGGACcggccUgaa UaaUga 941 AAGGGCUUCCUCUCUGCAGGAC hsa-mir-2362- hsa-mir- 1235 ggaUcaUUaUUcaggccggUccUgcagagaggaagcccUUcUgc 2 3158-1 UUacaggUaUUggAAGGGCUUCCUCUCUGCAGGACcggcc UgaaUaaUgUaaUca 942 AACCCAGUGGGCUAUGGAAAUG hsa-mir-2363 hsa-mir- 1236 agUgagcAACCCAGUGGGCUAUGGAAAUGUgUggaagaU 4482 ggcaUUUcUaUUUcUcagUggggcUcUUacc 943 GGGGUGGUCUGUUGUUG hsa-mir-2364 hsa-mir- 1237 aaaaaacaacaUacUUagUgcaUacccaUaUaaUaUUaGGGG 4483 UGGUCUGUUGUUGUUUUUcU 944 AAAAGGCGGGAGAAGCCCCA hsa-mir-2365 hsa-mir- 1238 gggUUUccUcUgccUUUUUUUccaaUgaaaaUaacgaaaccU 4484 gUUaUUUcccaUUgagggggaAAAAGGCGGGAGAAGCCCC A 945 UGGCUGUUGGAGGGGGCAGGCU hsa-mir-2366 pending 1239 ggagccagcccUccUcccgcacccaaacUUggagcacUUgaccUU UGGCUGUUGGAGGGGGCAGGCUcg 946 UAACGGCCGCGGUACCCUAA hsa-mir-2367 hsa-mir- 1240 agaggcaccgccUgcccagUgacaUgcgUUUAACGGCCGCGG 4485 UACCCUAAcUgUgca 947 UAGGAUUACAAGUGUCGGCCAC hsa-mir-2368 hsa-mir- 1241 ccUAGGAUUACAAGUGUCGGCCACgggcUgggcacagUggc 3159 UcacgccUgUaaUcccagc 948 GCUGGGCGAGGCUGGCA hsa-mir-2369 hsa-mir- 1242 gcaUGCUGGGCGAGGCUGGCAUcUagcacaggcggUagaUg 4486 cUUgcUcUUgccaUUgcaaUga 949 AGAGCUGGCUGAAGGGCAG hsa-mir-2370 hsa-mir- 1243 acUgUccUUcagccAGAGCUGGCUGAAGGGCAGaagggaac 4487 UgUccUUcagccagagcUggcUgaagggcaga 950 AGGGGGCGGGCUCCGGCG hsa-mir-2371 hsa-mir- 1244 ggUAGGGGGCGGGCUCCGGCGcUgggaccccacUagggUgg 4488 cgccUUggccccgccccgccc 951 GCCGAGAGUCGUCGGGGUU hsa-mir-2372 pending 1245 UcGCCGAGAGUCGUCGGGGUUUccUgcUUcaacagUgcU Uggacggaacccggcgc 952 UGGGGCUAGUGAUGCAGGACG hsa-mir-2373 hsa-mir- 1246 gggggUGGGGCUAGUGAUGCAGGACGcUggggacUggaga 4489 agUccUgccUgacccUgUccca 953 UGUGACUUUAAGGGAAAUGGCG hsa-mir-2374 hsa-mir- 1247 UggaaacUGUGACUUUAAGGGAAAUGGCGcacagcagacc 3164 cUgcaaUcaUgccgUUUUgcUUgaagUcgcagUUUccc 954 UCUCAGGAGUAAAGACAGAGUU hsa-mir-2375 hsa-mir- 1248 aacUUgaaggUagggaacUcUgUcUUcacUcaUgagUaccUUc 3664 caacacgagcUCUCAGGAGUAAAGACAGAGUUcccUaccU UcaaUgU 955 AGGUGGAUGCAAUGUGACCUCA hsa-mir-2376 hsa-mir- 1249 caAGGUGGAUGCAAUGUGACCUCAacUcUUggUccUcUg 3165 aggUcacaUUgUaUccaccUUa 956 AACGGCAAUGACUUUUGUACCA hsa-mir-2377 hsa-mir- 1250 ggUcggUgcaaaagUaaUUgcUgUUUUUgccaUUaaaaaUaa 548a1 UggcaUUaaaagUaaUggcaaaAACGGCAAUGACUUUUGU ACCAaUcUaaUaUcU 957 UCUGGUAAGAGAUUUGGGCAUA hsa-mir-2378 hsa-mir- 1251 aUagUUUcUgcaaUgcUcaaaUcUcUggccaaagaccagaacU 4490 UaaUggUcUCUGGUAAGAGAUUUGGGCAUAUUagaaac Uaa 958 AAUGUGGACUGGUGUGACCAAA hsa-mir-2379- hsa-mir- 1252 acaUUUggUcacaccagUccacaUUaacgUggaccagacaaUaU 1 4491 UAAUGUGGACUGGUGUGACCAAAa 959 AAUGUGGACUGGUGUGACCAAA hsa-mir-2379- pending 1253 accUggacaUUUggUcacaccagUccacaUUaacgUggaccagac 2 aaUaUUAAUGUGGACUGGUGUGACCAAAagUccaggc 960 GGGGCUGGGCGCGCGCC hsa-mir-2380 hsa-mir- 1254 cUgcagcgUgcUUcUccaggccccgcgcgcggacagacacacgga 4492 caagUcccgccaGGGGCUGGGCGCGCGCCagccgg 961 AGAAGGCCUUUCCAUCUCUGU hsa-mir-2381 hsa-mir- 1255 ccagagaUgggaaggccUUccggUgaUUaUcacagccaUgccUU 4493 UaccUccAGAAGGCCUUUCCAUCUCUGUc 962 CCAGACUGUGGCUGACCAGAGG hsa-mir-2382 hsa-mir- 1256 agUUUUagUUacccUggUcaUcUgcagUcUgaaaaUacaaaa 4494 UggaaaaUUCCAGACUGUGGCUGACCAGAGGUaacUgaa acc 963 AGGAGAAGCAGGAGCUGU hsa-mir-2383 pending 1257 cUgAGGAGAAGCAGGAGCUGUcUUggUacaUUcaggUcac Ug 964 AAUGUAAACAGGCUUUUUGCU hsa-mir-2384 hsa-mir- 1258 aagaAAUGUAAACAGGCUUUUUGCUcagUggagUUaUUU 4495 UgagcaaaaagcUUaUUUacaUUUcUg 965 GAGGAAACUGAAGCUGAGAGGG hsa-mir-2385 hsa-mir- 1259 ACAUCAGCUCAUAUAAUCCUCGAAGCUGCCUUUAGAA 4496 AUGAGGAAACUGAAGCUGAGAGGG 966 CUCCGGGACGGCUGGGC hsa-mir-2386 hsa-mir- 1260 acCUCCGGGACGGCUGGGCgccggcggccgggagaUccgcgcU 4497 UccUgaaUcccggccggcccgcccggcgcccgUccgcccgcgggUc 967 UGGGCUGGCAGGGCAAGUGCUG hsa-mir-2387 hsa-mir- 1261 agggcUGGGCUGGCAGGGCAAGUGCUGcagaUcUUUgUc 4498 UaagcagccccUgccUUggaUcUccca 968 GAGGCUGAAGGAAGAUGG hsa-mir-2388 hsa-mir- 1262 cUcaggcUcagUggUgcaUgcUUaUagUcccagccacUcUgGA 4419b GGCUGAAGGAAGAUGGcUUgagccU 969 AAGACUGAGAGGAGGGA hsa-mir-2389 hsa-mir- 1263 AAGACUGAGAGGAGGGAacUggUgagUUgUacaUagaaa 4499 UgcUUUcUaacUccUUgUcUcagUcUgUUU 970 UGAGGUAGUAGUUUCUU hsa-mir-2390 hsa-mir- 1264 caggagagaaagUacUgcccagaagcUaaagUgUagaUcaaacgc 4500 aUaaUggcUGAGGUAGUAGUUUCUUgaacUU 971 CGGCUGGGAGCCGAGGCGUCGG hsa-mir-2391 pending 1265 ggCGGCUGGGAGCCGAGGCGUCGGUgcagaccUggagacg ggcaUgggggggcUgcggcUgcUggcUgUg 972 UAUGUGACCUCGGAUGAAUCA hsa-mir-2392 hsa-mir- 1266 UAUGUGACCUCGGAUGAAUCAcUgaaaUaUgUcUgagcU 4501 UcUgUUUcaUcagaUgUcacaUUUU agccUUUagcaagUUgUaaUcUUUUUgcUgaUggagggUcU 973 GCUGAUGAUGAUGGUGCUGAAG hsa-mir-2393 hsa-mir- 1267 UgccUccaUggggaUgGCUGAUGAUGAUGGUGCUGAAGg 4502 c 974 AGAUGUAUGGAAUCUGUAUAU hsa-mir-2394 hsa-mir- 1268 gAGAUGUAUGGAAUCUGUAUAUaUcUaUaUaUaUgUgU 3171 aUaUaUagaUUccaUaaaUcUa 975 UUUAAGCAGGAAAUAGAAUUUA hsa-mir-2395 hsa-mir- 1269 acaaUgUagaUaUUUAAGCAGGAAAUAGAAUUUAcaUaU 4503 aaaUUUcUaUUUgUUUcUaUUUccUgcUUaaaUaUcUaca UUgc 976 UGUGACAAUAGAGAUGAACAUG hsa-mir-2396 hsa-mir- 1270 cUaagaUaaUgUccUccaggUUcaUcUcUgUUgUcaUUUgU 4504 ggcaUggaccaUUUGUGACAAUAGAGAUGAACAUGgagga UaUUaUcUUaa 977 AGGCUGGGCUGGGACGGA hsa-mir-2397 hsa-mir- 1271 ggAGGCUGGGCUGGGACGGAcacccggccUccacUUUcUg 4505 UggcaggUaccUccUccaUgUcggcccgccUUg 978 AAAUGGGUGGUCUGAGGCAA hsa-mir-2398 hsa-mir- 1272 UggccUcUgccaUcagaccaUcUgggUUcaagUUUggcUccaU 4506 cUUUaUgAAAUGGGUGGUCUGAGGCAAgUggUcU 979 UAGGAUGGGGGUGAGAGGUG hsa-mir-2399 hsa-mir- 1273 aUggUcccUcccaaUccagccaUUccUcagaccaggUggcUcccg 2392 agccaccccaggcUgUAGGAUGGGGGUGAGAGGUGcUag 980 CUGGGUUGGGCUGGGCUGGG hsa-mir-2400 hsa-mir- 1274 UcUgggcUgagccgagcUgggUUaagccgagCUGGGUUGGGC 4507 UGGGCUGGGU 981 AAGGGACUGGAGUGGAUUGGGU hsa-mir-2401 pending 1275 ggAAGGGACUGGAGUGGAUUGGGUacaUcUaUUaUagU gggagcaccUacUacaacccgUcccUcaagagUcgagUcacc 982 AAGGGGCUGGAGUGGAUUGGGG hsa-mir-2402 pending 1276 cUggUgaaUcUgggUccgccagcccccagggAAGGGGCUGGA GUGGAUUGGGGaaaUccaU 983 GCGGGGCUGGGCGCGCG hsa-mir-2403 hsa-mir- 1277 aggacccaGCGGGGCUGGGCGCGCGgagcagcgcUgggUgca 4508 gcgccUgcgccggcagcUgcaagggccg 984 ACUAAAGGAUAUAGAAGGUUUU hsa-mir-2404- hsa-mir- 1278 cUUUaaUacUaUcUcaaACUAAAGGAUAUAGAAGGUUU 1 4509-1 UcccUUUcUcUUgcccUgaaaccUUcUgUaUccUUUaUUUU gagaUagUaUUagaa 985 ACUAAAGGAUAUAGAAGGUUUU hsa-mir-2404- hsa-mir- 1279 cUUUaaUacUaUcUcaaACUAAAGGAUAUAGAAGGUUU 2 4509-2 UcccUUUcUcUUgcccUgaaaccUUcUgUaUccUUUaUUUU gagaUagUaUUagaa 986 ACUAAAGGAUAUAGAAGGUUUU hsa-mir-2404- hsa-mir- 1280 cUUUaaUacUaUcUcaaACUAAAGGAUAUAGAAGGUUU 3 4509-3 UcccUUUcUcUUgcccUgaaaccUUcUgUaUccUUUaUUUU gagaUagUaUUagaa 987 AAGCAAUACUGUUACCUGAAAU hsa-mir-2405 hsa-mir- 1281 cUcaaagAAGCAAUACUGUUACCUGAAAUaggcUgcgaaga 3942 UaacagUaUUUcagaUaacagUaUUacaUcUUUgaa 988 UGAGGGAGUAGGAUGUAUGGUU hsa-mir-2406 hsa-mir- 1282 gUgUaUgUGAGGGAGUAGGAUGUAUGGUUgUUagaUa 4510 gacaacUacaaUcUUUUcUcacaacagacag 989 GAAGAACUGUUGCAUUUGCCCU hsa-mir-2407 hsa-mir- 1283 aaaaaaaagggaaaGAAGAACUGUUGCAUUUGCCCUgcac 4511 UcagUUUgcacagggUaaaUgcaaUagUUcUUcUUUcccUU UUUUUa 990 CAGGGCCUCACUGUAUCGCCCA hsa-mir-2408 hsa-mir- 1284 cUcagcccgggcaaUaUagUgagaccUcgUcUcUacaaaaaaUU 4512 gagaCAGGGCCUCACUGUAUCGCCCAggcUgga aUUcUaggUggggAGACUGACGGCUGGAGGCCCAUaagc 991 AGACUGACGGCUGGAGGCCCAU hsa-mir-2409 hsa-mir- 1285 UgUcUaaaacUUcggcccccagaUUUcUggUcUccccacUUcag 4513 aac 992 ACAGGCAGGAUUGGGGAA hsa-mir-2410 hsa-mir- 1286 gUUgagACAGGCAGGAUUGGGGAAacaUcUUUUaccUcg 4514 UcUcUUgccUgUUUUaga 993 AGGACUGGACUCCCGGCAGCCC hsa-mir-2411 hsa-mir- 1287 gcgggaggUgUaacAGGACUGGACUCCCGGCAGCCCcaggg 4515 caggggcgUggggagcUggUccUagcUcagcgcUcccgga 994 UAGUGAGUUAGAGAUGCAGAGC hsa-mir-2412 hsa-mir- 1288 agcgUUaccUggUAGUGAGUUAGAGAUGCAGAGCccUgg 3174 gcUccUcagcaaaccUacUggaUcUgca 995 ACUGGCCUGGGACUACCGGGGG hsa-mir-2413 hsa-mir- 1289 UcUgcagcUcccggcagccUcgggccacacUcccgggaUccccag 3176 ggACUGGCCUGGGACUACCGGGGGUggcggc 996 GGGAGAAGGGUCGGGGC hsa-mir-2414 hsa-mir- 1290 aGGGAGAAGGGUCGGGGCagggagggcagggcaggcUcUgg 4516 ggUggggggUcUgUgagUcagccacggcUcUgcccacgUcUcccc 997 UGGGGCGGAGCUUCCGGAGGCC hsa-mir-2415- hsa-mir- 1291 agcUUccagacgcUccgccccacgUcgcaUgcgccccgggaacgc 1 3180-1 gUGGGGCGGAGCUUCCGGAGGCCcc 998 UGGGGCGGAGCUUCCGGAGGCC hsa-mir-2415- hsa-mir- 1292 agcUUccagacgcUccgccccacgUcgcaUgcgccccgggaacgc 2 3180-2 gUGGGGCGGAGCUUCCGGAGGCCcc 999 UGGGGCGGAGCUUCCGGAGGCC hsa-mir-2415- hsa-mir- 1293 agcUUccagacgcUccgccccacgUcgcaUgcgccccgggaacgc 3 3180-3 gUGGGGCGGAGCUUCCGGAGGCCcc 1000 UGGGGCGGAGCUUCCGGAGGCC hsa-mir-2415- hsa-mir- 1294 agcUUccagacgcUccgccccacgUcgcaUgcgccccgggaacgc 4 3180-4 gUGGGGCGGAGCUUCCGGAGGCCcc 1001 UGGGGCGGAGCUUCCGGAGGCC hsa-mir-2415- hsa-mir- 1295 agcUUccagacgcUccgccccacgUcgcaUgcgccccgggaacgc 5 3180-5 gUGGGGCGGAGCUUCCGGAGGCCcc 1002 CUCGUGGGCUCUGGCCACGGC hsa-mir-2416 hsa-mir- 1296 UggagggcaUUaggcagUggccagagcccUgcagUgcUgggcaUg 3677 ggcUUCUCGUGGGCUCUGGCCACGGCccUgagcUccUcc 1003 AGAAGGGGUGAAAUUUAAACGU hsa-mir-2417- hsa-mir- 1297 gccaggaUcacagacgUUUaaaUUacacUccUUcUgcUgUgcc 1 3179-1 UUacagcagUAGAAGGGGUGAAAUUUAAACGUcUgUga UccUggg 1004 AGAAGGGGUGAAAUUUAAACGU hsa-mir-2417- hsa-mir- 1298 gaUcacagacgUUUaaaUUacacUccUUcUgcUgUgccUUaca 2 3179-2 gcagUAGAAGGGGUGAAAUUUAAACGUcUgUgaUccUgg g 1005 AGAAGGGGUGAAAUUUAAACGU hsa-mir-2417- hsa-mir- 1299 gccaggaUcacagacgUUUaaaUUacacUccUUcUgcUgUgcc 3 3179-3 UUacagcagUAGAAGGGGUGAAAUUUAAACGUcUgUga UccUgg 1006 AAAUAUGAUGAAACUCACAGCUG hsa-mir-2418 hsa-mir- 1300 aggUAAAUAUGAUGAAACUCACAGCUGAGgagcUUagca AG 4517 agUagcUaaggccagagcUUgUgUUUgggUggUgUggcUg 1007 GCUCAGGGAUGAUAACUGUGCUG hsa-mir-2419 hsa-mir- 1301 UgggggaaaagUgcUgggaUUgaUUagUgaUgUcUgcUgggga AGA 4518 accgggGCUCAGGGAUGAUAACUGUGCUGAGAagcccccU 1008 CAGCAGUGCGCAGGGCUG hsa-mir-2420 hsa-mir- 1302 aaccUCAGCAGUGCGCAGGGCUGcacUgUcUccgUcUgcgg 4519 ccUgcagUaagcgggUa 1009 UUGGACAGAAAACACGCAGGAA hsa-mir-2421 hsa-mir- 1303 gUgUgccaccUgcgUgUUUUcUgUccaaaUcagaaaaggaUU 4520 UGGACAGAAAACACGCAGGAAgaaggaa 1010 GCUAAGGAAGUCCUGUGCUCAG hsa-mir-2422 hsa-mir- 1304 UcgGCUAAGGAAGUCCUGUGCUCAGUUUUgUagcaUca 4521 aaacUaggaUUUcUcUUgUUac 1011 CUGGACUGAGCCAUGCUACUGG hsa-mir-2423 hsa-mir- 1305 UgaggUUUCUGGACUGAGCCAUGCUACUGGcUUcUcUg 1269b gUUcUccagcUUacagaUggcUUaUcaUgggaccUcU 1012 UGACUCUGCCUGUAGGCCGGU hsa-mir-2424 hsa-mir- 1306 gcgggcgUUgccUgggggccUcgcagggggagaUccagcccaggcU 4522 ggUUccgcUGACUCUGCCUGUAGGCCGGUggcgUcUUcU gg 1013 GACCGAGAGGGCCUCGGCUGU hsa-mir-2425 hsa-mir- 1307 gcggggGACCGAGAGGGCCUCGGCUGUgUgaggacUagagg 4523 cggccgaggcccgggccggUUcccccga 1014 UAGAGGCUGGAAUAGAGAUUCU hsa-mir-2426 pending 1308 aUUUUAGAGGCUGGAAUAGAGAUUCUUgaggcUUggaa gagUaaggaUcccUUUaUcUgUccUcUaggag 1015 UAGCCUUCAGAUCUUGGUGUUU hsa-mir-2427 hsa-mir- 1309 UggaUcUgaaggcUgccccUUUgcUcUcUggggUAGCCUUCA 3614 GAUCUUGGUGUUUU 1016 CCACUUGGAUCUGAAGGCUGCC hsa-mir-2427* has-mir- 1310 UgggCCACUUGGAUCUGAAGGCUGCCccUUUgcUcUcUg 3614 gggUagccUUcagaUcUUggUgUUUU 1017 AUAGCAGCAUGAACCUGUCUCA hsa-mir-2428 hsa-mir- 1311 gaacgAUAGCAGCAUGAACCUGUCUCAcUgcagaaUUaUU 4524 UUgagacaggcUUaUgcUgcUaUccUUca 1018 UGAGACAGGCUUAUGCUGCUAU hsa-mir-2428* has-mir- 1312 ggaacgaUagcagcaUgaaccUgUcUcacUgcagaaUUaUUUU 4524 GAGACAGGCUUAUGCUGCUAUccUUca 1019 GGGGGGAUGUGCAUGCUGGUU hsa-mir-2429 hsa-mir- 1313 gUcagaGGGGGGAUGUGCAUGCUGGUUggggUgggcUgc 4525 cUgUggaccaaUcagcgUgcacUUccccacccUgaa 1020 CAGGGAGGUGAAUGGUUCUGUC hsa-mir-2430 pending 1314 cUUagcUcccUggcUUcagcccUUUUUcCAGGGAGGUGAA UGGUUCUGUCUcgc 1021 GCUGACAGCAGGGCUGGCCGCU hsa-mir-2431 hsa-mir- 1315 UgcggUgacaUcagggcccagUcccUgcUgUcaUgccccaggUga 4526 cgUgcUggGCUGACAGCAGGGCUGGCCGCUaacgUcacUg Uc 1022 UGGUCUGCAAAGAGAUGACUGU hsa-mir-2432 hsa-mir- 1316 ccagaagUGGUCUGCAAAGAGAUGACUGUgaaUccaagaU 4527 ccacaUcagcUcUgUgcUgccUacaUcUga 1023 UCAUUAUAUGUAUGAUCUGGAC hsa-mir-2433 hsa-mir- 1317 UaUUcUacUgagagUacagaUcUUUaUaUaUaUgaUcaUUa 4528 UaUgUaUgaUgagaUCAUUAUAUGUAUGAUCUGGACacc cagUagaaUc 1024 AUUGGACUGCUGAUGGCCCGU hsa-mir-2434 hsa-mir- 1318 aUgacaggccaUcagcagUccaaUgaagacaUgaagacccaaUgU 4529 cUUcAUUGGACUGCUGAUGGCCCGUcacUggga 1025 UUGGAGGGUGUGGAAGACAUC hsa-mir-2435 pending 1319 cUccacaUUGGAGGGUGUGGAAGACAUCUgggccaacUcU gaUcUcUUcaUcUaccccccaggacUggga 1026 CCCAGCAGGACGGGAGCG hsa-mir-2436 hsa-mir- 1320 cgaccgcacccgcccgaagcUgggUcaaggagCCCAGCAGGACG 4530 GGAGCGcggcgc 1027 AUGGAGAAGGCUUCUGA hsa-mir-2437 hsa-mir- 1321 gccUaggagUccUUggUcagUggggacAUGGAGAAGGCUUC 4531 UGAgga 1028 AAAAGCUGGGUUGAGAA hsa-mir-2438 hsa-mir- 1322 gccUUcUcUUcccagUUcUUccUggagUcggggAAAAGCUG 320e GGUUGAGAAggUgaaaaga 1029 UGGAAGGUAGACGGCCAGAGAG hsa-mir-2439 hsa-mir- 1323 ggUcaccUgUcUggccagcUacgUccccacggcccUUgUcagUg 3190 UGGAAGGUAGACGGCCAGAGAGgUgaccc 1030 UCUGGGAGGUUGUAGCAGUGGA hsa-mir-2440 hsa-mir- 1324 aggaagggaUUCUGGGAGGUUGUAGCAGUGGAaaaagUU 3192 cUUUUcUUccUcUgaUcgcccUcUcagcUcUUUccUUcUg 1031 CCCCGGGGAGCCCGGCG hsa-mir-2441 hsa-mir- 1325 acagaCCCCGGGGAGCCCGGCGgUgaagcUccUggUaUccU 4532 gggUgUcUga 1032 UGGAAGGAGGUUGCCGGACGCU hsa-mir-2442 hsa-mir- 1326 UgagaaUgUGGAAGGAGGUUGCCGGACGCUgcUggcUgc 4533 cUUccagcgUccacUUcccUUUcUcUcUcUcc 1033 CAAGAACCUCAAUUACCUUUGC hsa-mir-2443 pending 1327 cggUUggUgcaaaggUaaUUgUggUUUcUgccaUUgaaagUa aaggCAAGAACCUCAAUUACCUUUGCagcgaccU 1034 AAUCUGAGAAGGCGCACAAGGU hsa-mir-2444 has-mir- 1328 UcgagggAAUCUGAGAAGGCGCACAAGGUUUgUgUccaa 3200 UacagUccacaccUUgcgcUacUcaggUcUgcUcgUg 1035 CACCUUGCGCUACUCAGGUCUG hsa-mir-2444* hsa-mir- 1329 UcgagggaaUcUgagaaggcgcacaaggUUUgUgUccaaUacag 3200 UccaCACCUUGCGCUACUCAGGUCUGcUcgU 1036 GGAGGAACCUUGGAGCUUCGGC hsa-mir-2445 hsa-mir- 1330 ggcUgaagcUcUaaggUUccgccUgcgggcaggaagcGGAGGA 3928 ACCUUGGAGCUUCGGCa 1037 GGAUGGAGGAGGGGUCU hsa-mir-2446 hsa-mir- 1331 UgUgaaUgacccccUUccagagccaaaaUcaccagGGAUGGAG 4534 GAGGGGUCUUgggUacU 1038 ACUGGACUAGGAGUCAGAAGG hsa-mir-2447 hsa-mir- 1332 gggagcACUGGACUAGGAGUCAGAAGGUggagUUcUggg 378i UgcUgUUUUcccacUcUUgggcccUgggcaUgUUcUg 1039 GUGGACCUGGCUGGGAC hsa-mir-2448 hsa-mir- 1333 aacUgggUcccagUcUUcacagUUggUUUcUgacacGUGGAC 4535 CUGGCUGGGACgaUgUg 1040 ACCUGGACCCAGCGUAGACAAA hsa-mir-2449 hsa-mir- 1334 ccACCUGGACCCAGCGUAGACAAAgaggUgUUUcUacUcc 3690 aUaUcUaccUggacccagUgU 1041 CAAAAACUGCAGUUACUUUUGU hsa-mir-2450 hsa-mir- 1335 agUUggUgcaaaagUaaUUgcggUUUUUgccgUcgaaaaUaa 548am UggCAAAAACUGCAGUUACUUUUGUaccaaUg 1042 UUGGGCUGGGCUGGGUUGGG hsa-mir-2451 hsa-mir- 1336 UUUGGGCUGGGCUGGGUUGGGcagUUcUUcUgcUggac 1587 UcaccUgUgaccagc 1043 UGUGGUAGAUAUAUGCACGAU hsa-mir-2452 hsa-mir- 1337 aUgUgUggUagaUaUaUgcacUgUaUaUaaacaUaaUGUGG 4536 UAGAUAUAUGCACGAUaUag 1044 AGAAGGGAAAGAACAUCAA hsa-mir-2453 pending 1338 aUggUgUUUgccUccUUcaUccgcaaggcaUcUgaUgcccacga agUUaggaaggUccUUggggAGAAGGGAAAGAACAUCAAa 1045 CUGUCCUAAGGUUGUUGAGUU hsa-mir-2454 hsa-mir- 1339 cgcaUgacUcUUcaaccUcaggacUUgcagaaUUaaUggaaUg 676 CUGUCCUAAGGUUGUUGAGUUgUgca 1046 AAAAGGCAUUGUGGUUUUUG hsa-mir-2455 hsa-mir- 1340 caUUaggUUggUgcAAAAGGCAUUGUGGUUUUUGccUa 548an UaaaagUaaUggcaaaaaccgcaaUUccUUUUgcaccaaccUaa U 1047 CGGGCGGCGGCUGUGUUGCGCA hsa-mir-2456 pending 1341 cacUcgcgcUgcggccagcgcccgggccUgcgggccCGGGCGGCG GCUGUGUUGCGCAgUc 1048 UAUGGAAGGGAGAAGAGCUUUA hsa-mir-2457 hsa-mir- 1342 UUaUUaaUAUGGAAGGGAGAAGAGCUUUAaUgaUUgga 3202-1 gUcaUUUUcagagcaUUaaagcUcUUcUcccUUccaUaUUaa UgU 1049 CGGCGGGGACGGCGAUUGGU hsa-mir-1908 hsa-mir- 1343 UgccgCGGCGGGGACGGCGAUUGGUccgUaUgUgUggUg 1908 ccaccggccgccggcUccgccccggcc 1050 CCUCCUGCCCUCCUUGCUGUAG hsa-mir-1976 pending 1344 gcaaagggUggcagcaaggaaggcaggggUccUaaggUgUgUCC UCCUGCCCUCCUUGCUGUAGacUUUgg 1051 UGAGCCGAGCUGAGCUUAGCUG hsa-mir-2457 hsa-mir- 1345 UGAGCCGAGCUGAGCUUAGCUGggcUgagcUa 4537 accagggcUgggcUgagcUgggcUgagcUgagcUgagc GAGCUUGGAUGAGCUGGGCUGAacUgggcUgg 1052 GAGCUUGGAUGAGCUGGGCUGA hsa-mir-2458 hsa-mir- 1346 gUUgagcUgggcUgggcUgagUUgagccaggcUgaU 4538 cUgggcUgag 1053 GCUGAACUGGGCUGAGCUGGGC hsa-mir-2459 hsa-mir- 1347 UgagcUgggcUcUgcUgUgcUgUgcUgagcagggcU 4539 gaGCUGAACUGGGCUGAGCUGGGC 1054 CUGGGCUGAAUGACAGUGAUGAG hsa-mir-2460 pending 1348 gUcaagUcagaacagccaggUagagcccUUgUccaaac CUGGGCUGAAUGACAGUGAUGAG 1055 GGGAGCCGGGGCUGUGAGAGGA hsa-mir-2461 pending 1349 cUcUUUgagccUUggcUgccUUggUgcagcagggUc aUcUgUagggccaccccacagcUcUUUccUUccccUc cUcUcUccaGGGAGCCGGGGCUGUGAGAGGA 1056 UUAGUCCUGCCUGUAGGUUUA hsa-mir-2462 hsa-mir- 1350 aagcUgcaUggaccaggacUUggcaccUUUggccUU 4540 AGUCCUGCCUGUAGGUUUA

TABLE 33 Primers for Reverse Transcription for a subset of the known miRNAs  identified by deep sequencing analysis. SEQ Putative Primer for reverse SEQ ID Major/Minor Mature Sequence transcription ID NO. miRNA ID Captured of miRNA NO.   7 hsa-mir-129- AAGCCCUUACCCCAAAAAGCAU AAGCCCTTACCCCAAAAAGCAT 1351 2*  22 hsa-mir-25* AGGCGGAGACUUGGGCAAUUG AGGCGGAGACTTGGGCAATTG 1352  24 hsa-mir-30b* CUGGGAGGUGGAUGUUUACUUC CTGGGAGGTGGATGTTTACTTC 1353  26 hsa-mir-30c- CUGGGAGAAGGCUGUUUACUCU CTGGGAGAAGGCTGTTTACTCT 1354 2*  27 hsa-mir-30e* CUUUCAGUCGGAUGUUUACAGC CTTTCAGTCGGATGTTTACAGC 1355  29 hsa-mir-342- UCUCACACAGAAAUCGCACCCGU TCTCACACAGAAATCGCACCCGT 1356 3p  56 hsa-let-7a-2 UGAGGUAGUAGGUUGUAUAGUU TGAGGTAGTAGGTTGTATAGTT 1357  57 hsa-let-7a-3 UGAGGUAGUAGGUUGUAUAGUU TGAGGTAGTAGGTTGTATAGTT 1358  58 hsa-let-7c UGAGGUAGUAGGUUGUAUGGUU TGAGGTAGTAGGTTGTATGGTT 1359  63 hsa-mir-100 AACCCGUAGAUCCGAACUUGUG AACCCGTAGATCCGAACTTGTG 1360  64 hsa-mir-101-1 UACAGUACUGUGAUAACUGAA TACAGTACTGTGATAACTGAA 1361  65 hsa-mir-101-2 GUACAGUACUGUGAUAACUGAA TACAGTACTGTGATAACTGAA 1362  66 hsa-mir-103-1 AGCAGCAUUGUACAGGGCUAUGA AGCAGCATTGTACAGGGCTATGA 1363  67 hsa-mir-103-2 AGCAGCAUUGUACAGGGCUAUGA AGCAGCATTGTACAGGGCTATGA 1364  70 hsa-mir-106a AAAAGUGCUUACAGUGCAGGUAG AAAAGTGCTTACAGTGCAGGTAG 1365  71 hsa-mir-106b UAAAGUGCUGACAGUGCAGAU TAAAGTGCTGACAGTGCAGAT 1366  72 hsa-mir-107 AGCAGCAUUGUACAGGGCUAUCA AGCAGCATTGTACAGGGCTATCA 1367  73 hsa-mir-10a UACCCUGUAGAUCCGAAUUUGUG TACCCTGTAGATCCGAATTTGTG 1368  74 hsa-mir-10b UACCCUGUAGAACCGAAUUUGUG TACCCTGTAGAACCGAATTTGTG 1369  98 hsa-mir-128-1 UCACAGUGAACCGGUCUCUUU TCACAGTGAACCGGTCTCTTT 1370  99 hsa-mir-128-2 UCACAGUGAACCGGUCUCUUU TCACAGTGAACCGGTCTCTTT 1371 100 hsa-mir-129-1 CUUUUUGCGGUCUGGGCUUGC CTTTTTGCGGTCTGGGCTTGC 1372 101 hsa-mir-129-2 CUUUUUGCGGUCUGGGCUUGC CTTTTTGCGGTCTGGGCTTGC 1373 103 hsa-mir-1295 UUAGGCCGCAGAUCUGGGUGA TTAGGCCGCAGATCTGGGTGA 1374 119 hsa-mir-140- UACCACAGGGUAGAACCACGG TACCACAGGGTAGAACCACGG 1375 3p 122 hsa-mir-143 UGAGAUGAAGCACUGUAGCUC TGAGATGAAGCACTGTAGCTC 1376 125 hsa-mir-146a UGAGAACUGAAUUCCAUGGGUU TGAGAACTGAATTCCATGGGTT 1377 126 hsa-mir-146b UGAGAACUGAAUUCCAUAGGCU TGAGAACTGAATTCCATAGGCT 1378 127 hsa-mir-148a UCAGUGCACUACAGAACUUUGU TCAGTGCACTACAGAACTTTGT 1379 130 hsa-mir-151- CUAGACUGAAGCUCCUUGAGG CTAGACTGAAGCTCCTTGAGG 1380 3p 131 hsa-mir-152 UCAGUGCAUGACAGAACUUGG TCAGTGCATGACAGAACTTGG 1381 132 hsa-mir-155 UUAAUGCUAAUCGUGAUAGGGGU TTAATGCTAATCGTGATAGGGGT 1382 133 hsa-mir-15a UAGCAGCACAUAAUGGUUUGUG TAGCAGCACATAATGGTTTGTG 1383 134 hsa-mir-15b UAGCAGCACAUCAUGGUUUACA TAGCAGCACATCATGGTTTACA 1384 135 hsa-mir-16-1 UAGCAGCACGUAAAUAUUGGCG TAGCAGCACGTAAATATTGGCG 1385 136 hsa-mir-16-2 UAGCAGCACGUAAAUAUUGGCG TAGCAGCACGTAAATATTGGCG 1386 137 hsa-mir-17 CAAAGUGCUUACAGUGCAGGUAG CAAAGTGCTTACAGTGCAGGTAG 1387 138 hsa-mir-181a- AACAUUCAACGCUGUCGGUGAGU AACATTCAACGCTGTCGGTGAGT 1388 1 139 hsa-mir-181a- AACAUUCAACGCUGUCGGUGAGU AACATTCAACGCTGTCGGTGAGT 1389 2 140 hsa-mir-181b- AACAUUCAUUGCUGUCGGUGGGU AACATTCATTGCTGTCGGTGGG 1390 1 141 hsa-mir-181b- AACAUUCAUUGCUGUCGGUGGGU AACATTCATTGCTGTCGGTGGG 1391 2 142 hsa-mir-181c AACAUUCAACCUGUCGGUGAGU AACATTCAACCTGTCGGTGAGT 1392 143 hsa-mir-181d AACAUUCAUUGUUGUCGGUGGGU AACATTCATTGTTGTCGGTGGGTT 1393 147 hsa-mir-185 UGGAGAGAAAGGCAGUUCCUGA TGGAGAGAAAGGCAGTTCCTGA 1394 150 hsa-mir-18a UAAGGUGCAUCUAGUGCAGAUAG TAAGGTGCATCTAGTGCAGATAG 1395 151 hsa-mir-191 CAACGGAAUCCCAAAAGCAGCUG CAACGGAATCCCAAAAGCAGCTG 1396 152 hsa-mir-192 CUGACCUAUGAAUUGACAGCC CTGACCTATGAATTGACAGCC 1397 153 hsa-mir-193a- UGGGUCUUUGCGGGCGAGAUGA TGGGTCTTTGCGGGCGAGATGA 1398 5p 159 hsa-mir-196b UAGGUAGUUUCCUGUUGUUGGG TAGGTAGTTTCCTGTTGTTGGG 1399 160 hsa-mir-197 UUCACCACCUUCUCCACCCAGC TTCACCACCTTCTCCACCCAGC 1400 163 hsa-mir-199b ACAGUAGUCUGCACAUUGGUUA ACAGTAGTCTGCACATTGGTTA 1401 164 hsa-mir-19a UGUGCAAAUCUAUGCAAAACUGA TGTGCAAATCTATGCAAAACTGA 1402 175 hsa-mir-20a UAAAGUGCUUAUAGUGCAGGUAG TAAAGTGCTTATAGTGCAGGTAG 1403 176 hsa-mir-20b CAAAGUGCUCAUAGUGCAGGUAG CAAAGTGCTCATAGTGCAGGTAG 1404 186 hsa-mir-221 AGCUACAUUGUCUGCUGGGUUUC AGCTACATTGTCTGCTGGGTTTC 1405 187 hsa-mir-222 AGCUACAUCUGGCUACUGGGU AGCTACATCTGGCTACTGGGT 1406 190 hsa-mir-23a AUCACAUUGCCAGGGAUUUCC ATCACATTGCCAGGGATTTCC 1407 194 hsa-mir-25 CAUUGCACUUGUCUCGGUCUGA CATTGCACTTGTCTCGGTCTGA 1408 195 hsa-mir-26a-1 UUCAAGUAAUCCAGGAUAGGCU TTCAAGTAATCCAGGATAGGCT 1409 196 hsa-mir-26a-2 UUCAAGUAAUCCAGGAUAGGCU TTCAAGTAATCCAGGATAGGCT 1410 197 hsa-mir-26b UUCAAGUAAUUCAGGAUAGGU TTCAAGTAATTCAGGATAGGT 1411 198 hsa-mir-27a UUCACAGUGGCUAAGUUCCGC TTCACAGTGGCTAAGTTCCGC 1412 203 hsa-mir-29a UAGCACCAUCUGAAAUCGGUUA TAGCACCATCTGAAATCGGTTA 1413 208 hsa-mir-30a UGUAAACAUCCUCGACUGGAAG TGTAAACATCCTCGACTGGAAG 1414 209 hsa-mir-30b UGUAAACAUCCUACACUCAGCU TGTAAACATCCTACACTCAGCT 1415 210 hsa-mir-30c-1 UGUAAACAUCCUACACUCUCAGC TGTAAACATCCTACACTCTCAGC 1416 211 hsa-mir-30c-2 UGUAAACAUCCUACACUCUCAGC TGTAAACATCCTACACTCTCAGC 1417 212 hsa-mir-30d UGUAAACAUCCCCGACUGGAAG TGTAAACATCCCCGACTGGAAG 1418 213 hsa-mir-30e UGUAAACAUCCUUGACUGGAAG TGTAAACATCCTTGACTGGAAG 1419 216 hsa-mir-320a AAAAGCUGGGUUGAGAGGGCGA AAAAGCTGGGTTGAGAGGGCGA 1420 217 hsa-mir-320b- AAAAGCUGGGUUGAGAGGGCAA AAAAGCTGGGTTGAGAGGGCAA 1421 1 218 hsa-mir-320b- AAAAGCUGGGUUGAGAGGGCAA AAAAGCTGGGTTGAGAGGGCAA 1422 2 227 hsa-mir-331 GCCCCUGGGCCUAUCCUAGAA GCCCCTGGGCCTATCCTAGAA 1423 231 hsa-mir-33a GUGCAUUGUAGUUGCAUUGCA GTGCATTGTAGTTGCATTGCA 1424 233 hsa-mir-340 UUAUAAAGCAAUGAGACUGAUU TTATAAAGCAATGAGACTGATT 1425 236 hsa-mir-34a UGGCAGUGUCUUAGCUGGUUGU TGGCAGTGTCTTAGCTGGTTGT 1426 239 hsa-mir-361- UUAUCAGAAUCUCCAGGGGUAC TTATCAGAATCTCCAGGGGTAC 1427 5p 241 hsa-mir-363 AAUUGCACGGUAUCCAUCUGUA AATTGCACGGTATCCATCTGTA 1428 242 hsa-mir-365-2 UAAUGCCCCUAAAAAUCCUUAU TAATGCCCCTAAAAATCCTTAT 1429 246 hsa-mir-374a UUAUAAUACAACCUGAUAAGUG TTATAATACAACCTGATAAGTG 1430 250 hsa-mir-378 ACUGGACUUGGAGUCAGAAGG ACTGGACTTGGAGTCAGAAGG 1431 259 hsa-mir-423 UGAGGGGCAGAGAGCGAGACUUU TGAGGGGCAGAGAGCGAGACTTT 1432 265 hsa-mir-449a UGGCAGUGUAUUGUUAGCUGGU TGGCAGTGTATTGTTAGCTGGT 1433 287 hsa-mir-503 UAGCAGCGGGAACAGUUCUGCAG TAGCAGCGGGAACAGTTCTGCAG 1434 296 hsa-mir-532 CAUGCCUUGAGUGUAGGACCGU CATGCCTTGAGTGTAGGACCGT 1435 316 hsa-mir-576- AAGAUGUGGAAAAAUUGGAAUC AAGATGTGGAAAAATTGGAATC 1436 3p 327 hsa-mir-625 AGGGGGAAAGUUCUAUAGUCC AGGGGGAAAGTTCTATAGTCC 1437 338 hsa-mir-7-1 UGGAAGACUAGUGAUUUUGUUGU TGGAAGACTAGTGATTTTGTTGT 1438 339 hsa-mir-7-2 UGGAAGACUAGUGAUUUUGUUGU TGGAAGACTAGTGATTTTGTTGT 1439 340 hsa-mir-7-3 UGGAAGACUAGUGAUUUUGUUGU TGGAAGACTAGTGATTTTGTTGT 1440 345 hsa-mir-874 CUGCCCUGGCCCGAGGGACCGA CTGCCCTGGCCCGAGGGACCGA 1441 351 hsa-mir-9-1 UCUUUGGUUAUCUAGCUGUAUGA TCTTTGGTTATCTAGCTGTATGA 1442 352 hsa-mir-9-2 UCUUUGGUUAUCUAGCUGUAUGA TCTTTGGTTATCTAGCTGTATGA 1443 353 hsa-mir-92a-1 UAUUGCACUUGUCCCGGCCUGU TATTGCACTTGTCCCGGCCTGT 1444 354 hsa-mir-92a-2 UAUUGCACUUGUCCCGGCCUGU TATTGCACTTGTCCCGGCCTGT 1445 356 hsa-mir-93 CAAAGUGCUGUUCGUGCAGGUAG CAAAGTGCTGTTCGTGCAGGTAG 1446 357 hsa-mir-9-3 UCUUUGGUUAUCUAGCUGUAUGA TCTTTGGTTATCTAGCTGTATGA 1447 364 hsa-mir-99a AACCCGUAGAUCCGAUCUUGUG AACCCGTAGATCCGATCTTGTG 1448 387 hsa-mir-570 AAAGGUAAUUGCAGUUUUUCCC AAAGGTAATTGCAGTTTTTCCCA 1449

TABLE 34 Primers for Reverse Transcription of a subset of novel miRNAs identified by deep sequencing analysis. SEQ Temporary Primer for Reverse SEQ ID Assigned Mature Sequence Transcription ID NO. miRNA ID Captured of miRNA NO.  773 hsa-miR- ACUGGACUUGGAGUCAGGA ACTGGACTTGGAGTCAGGA 1450 378c  774 hsa-mir-449c AGGCAGUGUAUUGCUAGCGGCU AGGCAGTGTATTGCTAGCGGCTGT 1451  775 hsa-mir-500- UGCACCCAGGCAAGGAUUCUGC TGCACCCAGGCAAGGATTCTGC 1452 2  784 hsa-mir-2224 UGAGGGAGGAGACUGCA TGAGGGAGGAGACTGCA 1453  785 hsa-mir-2225 ACUGGACUUGGAGCCAGAAG ACTGGACTTGGAGCCAGAAG 1454  786 hsa-mir-2226 GUCACUGAUGUCUGUAGCUGAG GTCACTGATGTCTGTAGCTGAGACGG 1455  787 hsa-mir-2227 GAUGAGGAUGGAUAGCAAGGAA GATGAGGATGGATAGCAAGGAAG 1456  789 hsa-mir-2229 AAAAGCAUCAGGAAGUACCCA AAAAGCATCAGGAAGTACCCA 1457  796 hsa-mir-2235 GUCAAAUGAAGGGCUGAUCACG GTCAAATGAAGGGCTGATCACGAAATA 1458  798 hsa-mir-2237 AGAGUUAACUCAAAAUGGACUA AGAGTTAACTCAAAATGGACTA 1459  799 hsa-mir-2238 UGUUGGGAUUCAGCAGGACCAU TGTTGGGATTCAGCAGGACCATT 1460  800 hsa-mir-2239 UAAAUAGAGUAGGCAAAGGACA TAAATAGAGTAGGCAAAGGACA 1461  805 hsa-mir-2244 AAGAGGAAGAAAUGGCUGGUUC AAGAGGAAGAAATGGCTGGTTCTCAG 1462  809 hsa-mir-2248 UAGUGGAUGAUGCACUCUGUGC TAGTGGATGATGCACTCTGTGC 1463  814 hsa-mir-2253 AAAGACUCUGCAAGAUGCCU AAAGACTCTGCAAGATGCCT 1464  816 hsa-mir-2255 AGGAGAAGUAAAGUAGAA AGGAGAAGTAAAGTAGAA 1465  817 hsa-mir-2256 AUGGCCAGAGCUCACACAGAGG ATGGCCAGAGCTCACACAGAGG 1466  819 hsa-mir-2258 AUCAGGGCUUGUGGAAUGGGAA ATCAGGGCTTGTGGAATGGGAAG 1467  820 hsa-mir-2259 AUGGCCAGAGCUCACACAGAGG ATGGCCAGAGCTCACACAGAGG 1468  821 hsa-mir-2260 UGAGGAUAUGGCAGGGAAGGGG TGAGGATATGGCAGGGAAGGGGA 1469  825 hsa-mir-2264 UGGGCUCAGGGUACAAAGGUU TGGGCTCAGGGTACAAAGGTTC 1470  828 hsa-mir- GCUGCACCGGAGACUGGGUAA GCTGCACCGGAGACTGGGTAA 1471 2266-1  829 hsa-mir- GCUGCACCGGAGACUGGGUAA GCTGCACCGGAGACTGGGTAA 1472 2266-2  836 hsa-mir-2272 UGUCGUGGGGCUUGCUGGCUUG TGTCGTGGGGCTTGCTGGCTTG 1473  838 hsa-mir-2274 ACUGGACUUGGAGGCAGAA ACTGGACTTGGAGGCAGAA 1474  841 hsa-mir-2277 UUGGAGGCGUGGGUUUU TTGGAGGCGTGGGTTTT 1475  844 hsa-mir-2280 CUGACUGAAUAGGUAGGGUCAU CTGACTGAATAGGTAGGGTCAT 1476  846 hsa-mir-2282 AGAUUGUUUCUUUUGCCGUGCA AGATTGTTTCTTTTGCCGTGCA 1477  847 hsa-mir- CACGGCAAAAGAAACAAUCCA CACGGCAAAAGAAACAATCCA 1478 2282*  848 hsa-mir-2283 CAGGGCUGGCAGUGACAUGGGU CAGGGCTGGCAGTGACATGGGT 1479  849 hsa-mir-2284 GGUGGGGGCUGUUGUUU GGTGGGGGCTGTTGTTT 1480  850 hsa-mir-2285 UGGGGAGGUGUGGAGUCAGCAU TGGGGAGGTGTGGAGTCAGCATG 1481  852 hsa-mir-2287 GGCUCCUUGGUCUAGGGGUA GGCTCCTTGGTCTAGGGGTA 1482  856 hsa-mir-2290 UGGGGAUUUGGAGAAGUGGUGA TGGGGATTTGGAGAAGTGGTGA 1483  857 hsa-mir-2291 AAAAGUGAUUGCAGUGUUUG AAAAGTGATTGCAGTGTTTGCC 1484  860 hsa-mir-2294 UAGGAGCUCAACAGAUGCCUGU TAGGAGCTCAACAGATGCCTGT 1485  861 hsa-mir-2295 AGCUUUUGGGAAUUCAGGUAG AGCTTTTGGGAATTCAGGTAG 1486  864 hsa-mir-2298 CAAAAGUGAUCGUGGUUUUUG CAAAAGTGATCGTGGTTTTTG 1487  865 hsa-mir-2299 AGGGUGUGUGUGUUUUU AGGGTGTGTGTGTTTTT 1488  871 hsa-mir-2305 ACUGACAGGAGAGCAUUUUGA ACTGACAGGAGAGCATTTTGA 1489  874 hsa-mir-2308 AUAGUGGUUGUGAAUUUACCUU ATAGTGGTTGTGAATTTACCTTC 1490  876 hsa-mir-2310 CUACCCCAGGAUGCCAGCAUAG CTACCCCAGGATGCCAGCATAGTT 1491  877 hsa-mir-2311 ACUGGACUUGGUGUCAGAUGG ACTGGACTTGGTGTCAGATGG 1492  880 hsa-mir-2314 UAGUGGAUGAUGGAGACUCGGU TAGTGGATGATGGAGACTCGGT 1493  888 hsa-mir-2322 AAGGUUUGGAUAGAUGCAAUA AAGGTTTGGATAGATGCAATA 1494  889 hsa-mir-2323 AAAGGUAAUUGCAGUUUUUCCC AAAGGTAATTGCAGTTTTTCCCA 1495  890 hsa-mir-2324 AGGGGACCAAAGAGAUAUAUAG AGGGGACCAAAGAGATATATAG 1496  896 hsa-mir-2328 GGCGACAAAACGAGACCCUGU GGCGACAAAACGAGACCCTGTC 1497  897 hsa-mir-2329 GGGUGCGGGCCGGCGGGG GGGTGCGGGCCGGCGGGGT 1498  899 hsa-mir-2331 CAUGCUAGGAUAGAAAGAAUGG CATGCTAGGATAGAAAGAATGG 1499  901 hsa-mir-2333 GCAAAGUGAUGAGUAAUACUGG GCAAAGTGATGAGTAATACTGG 1500  915 hsa-mir-2346 CCCUGGGGUUCUGAGGACAUG CCCTGGGGTTCTGAGGACATG 1501  917 hsa-mir-2348 CAGGAAGGAUUUAGGGACAGGC CAGGAAGGATTTAGGGACAGGC 1502  919 hsa-mir-2350 AUUAAGGACAUUUGUGAUUGAU ATTAAGGACATTTGTGATTGAT 1503  920 hsa-mir- AAAAGGCAUAAAACCAAGACA AAAAGGCATAAAACCAAGACA 1504 2351-1  921 hsa-mir- AAAAGGCAUAAAACCAAGACA AAAAGGCATAAAACCAAGACA 1505 2351-2  924 hsa-mir- UAAAAACUGCAAUUACUUUC TAAAAACTGCAATTACTTTC 1506 2354-1  926 hsa-mir- UGUGAUAUCAUGGUUCCUGGGA TGTGATATCATGGTTCCTGGGA 1507 2355-1  929 hsa-mir- UGUGAUAUCAUGGUUCCUGGGA TGTGATATCATGGTTCCTGGGA 1508 2355-2  931 hsa-mir- UGUGAUAUCAUGGUUCCUGGGA TGTGATATCATGGTTCCTGGGA 1509 2355-3  932 hsa-mir- UGUGAUAUCGUGCUUCCUGGGA TGTGATATCGTGCTTCCTGGGA 1510 2355b  936 hsa-mir-2358 AAAAGUAACUGCGGUUUUUGA AAAAGTAACTGCGGTTTTTGA 1511  938 hsa-mir-2360 GGAGUGGGCUGGUGGUU GGAGTGGGCTGGTGGTT 1512  940 hsa-mir- AAGGGCUUCCUCUCUGCAGGAC AAGGGCTTCCTCTCTGCAGGAC 1513 2362-1  941 hsa-mir- AAGGGCUUCCUCUCUGCAGGAC AAGGGCTTCCTCTCTGCAGGAC 1514 2362-2  949 hsa-mir-2370 AGAGCUGGCUGAAGGGCAG AGAGCTGGCTGAAGGGCAG 1515  953 hsa-mir-2374 UGUGACUUUAAGGGAAAUGGCG TGTGACTTTAAGGGAAATGGCG 1516  954 hsa-mir-2375 UCUCAGGAGUAAAGACAGAGUU TCTCAGGAGTAAAGACAGAGTT 1517  955 hsa-mir-2376 AGGUGGAUGCAAUGUGACCUCA AGGTGGATGCAATGTGACCTCA 1518  977 hsa-mir-2397 AGGCUGGGCUGGGACGGA AGGCTGGGCTGGGACGGA 1519  979 hsa-mir-2399 UAGGAUGGGGGUGAGAGGUG TAGGATGGGGGTGAGAGGTG 1520  988 hsa-mir-2406 UGAGGGAGUAGGAUGUAUGGUU TGAGGGAGTAGGATGTATGGTT 1521  991 hsa-mir-2409 AGACUGACGGCUGGAGGCCCAU AGACTGACGGCTGGAGGCCCAT 1522  994 hsa-mir-2412 UAGUGAGUUAGAGAUGCAGAGC TAGTGAGTTAGAGATGCAGAGC 1523  996 hsa-mir-2414 GGGAGAAGGGUCGGGGC GGGAGAAGGGTCGGGGC 1524 1002 hsa-mir-2416 CUCGUGGGCUCUGGCCACGGC CTCGTGGGCTCTGGCCACGGCC 1525 1003 hsa-mir- AGAAGGGGUGAAAUUUAAACGU AGAAGGGGTGAAATTTAAACGT 1526 2417-1 1004 hsa-mir- AGAAGGGGUGAAAUUUAAACGU AGAAGGGGTGAAATTTAAACGT 1527 2417-2 1005 hsa-mir- AGAAGGGGUGAAAUUUAAACGU AGAAGGGGTGAAATTTAAACGT 1528 2417-3 1007 hsa-mir-2419 GCUCAGGGAUGAUAACUGUGCUGAGA GCTCAGGGATGATAACTGTGCTGAGA 1529 1011 hsa-mir-2423 CUGGACUGAGCCAUGCUACUGG CTGGACTGAGCCATGCTACTGG 1530 1017 hsa-mir-2428 AUAGCAGCAUGAACCUGUCUCA ATAGCAGCATGAACCTGTCTCA 1531 1018 hsa-mir- UGAGACAGGCUUAUGCUGCUAU TGAGACAGGCTTATGCTGCTAT 1532 2428* 1022 hsa-mir-2432 UGGUCUGCAAAGAGAUGACUGU TGGTCTGCAAAGAGATGACTGTG 1533 1025 hsa-mir-2435 UUGGAGGGUGUGGAAGACAUC TTGGAGGGTGTGGAAGACATC 1534 1027 hsa-mir-2437 AUGGAGAAGGCUUCUGA ATGGAGAAGGCTTCTGA 1535 1028 hsa-mir-2438 AAAAGCUGGGUUGAGAA AAAAGCTGGGTTGAGAAG 1536 1029 hsa-mir-2439 UGGAAGGUAGACGGCCAGAGAG TGGAAGGTAGACGGCCAGAGAG 1537 1030 hsa-mir-2440 UCUGGGAGGUUGUAGCAGUGGA TCTGGGAGGTTGTAGCAGTGGA 1538 1036 hsa-mir-2445 GGAGGAACCUUGGAGCUUCGGC GGAGGAACCTTGGAGCTTCGGCA 1539 1038 hsa-mir-2447 ACUGGACUAGGAGUCAGAAGG ACTGGACTAGGAGTCAGAAGG 1540 1041 hsa-mir-2450 CAAAAACUGCAGUUACUUUUGU CAAAAACTGCAGTTACTTTTGT 1541 1046 hsa-mir-2455 AAAAGGCAUUGUGGUUUUUG AAAAGGCATTGTGGTTTTTG 1542

TABLE 35 miRNAs that differentiate ABC DLBCL vs. GCB DLBCL FoldChange pVal ABC vs. ABC vs. MicroRNA GCB GCB UGGUCUGCAAAGAGAUGACUGUG −4.30138 0.001335 (SEQ ID NO. 1565) CAAAAACUGCAGUUACUUUUGU −3.52085 0.022949 (SEQ ID NO. 1041) UGGGGAUUUGGAGAAGUGGUGA −2.8374 0.000753 (SEQ ID NO. 856) hsa-miR-129-3p −2.48708 7.39E−05 ACUGGACUUGGUGUCAGAUGG −1.3712 0.01173 (SEQ ID NO. 877) hsa-miR-196b −1.28463 0.032606 hsa-miR-9 −1.00737 0.003176 hsa-miR-28-5p −0.82319 0.00026 hsa-miR-365 −0.78573 0.032749 hsa-miR-185 −0.75345 0.044082 hsa-miR-199b-3p −0.74898 0.015518 hsa-miR-152 −0.67388 0.001282 hsa-miR-23a −0.65979 0.028732 hsa-miR-193a-5p −0.54233 0.031154 hsa-miR-27a −0.49729 0.027207 hsa-miR-331-3p −0.47573 0.0128 hsa-miR-301a −0.45261 0.014231 hsa-miR-128 −0.4224 0.024065 AGAUUGUUUCUUUUGCCGUGCA 0.557435 0.02141 (SEQ ID NO. 846) hsa-miR-625 0.747299 0.01813 hsa-miR-155 0.781901 0.024175 hsa-miR-20b 0.986918 0.000746 GGCUCCUUGGUCUAGGGGUA 1.945372 0.002596 (SEQ ID NO. 852) UAGUGAGUUAGAGAUGCAGAGC 2.347695 0.009081 (SEQ ID NO. 994) CAGGAAGGAUUUAGGGACAGGC 2.519326 0.04483 (SEQ ID NO.-917) *The 3′-end G of SEQ ID NO. 1565 is optionally omitted (providing SEQ ID NO. 1022).

APPENDIX A Average expression of the genes depicted in FIG. 6* Naïve vs Germinal Germinal Germinal Center vs Center vs Center Plasma Memory Naïve GC GC PC GC Aver- Aver- aver- Aver- Aver- Memory ID Gene Name age age age age age Average 1 VPS37B 10.60 4.58 4.58 9.71 2 SCN3A 9.50 3.98 3 NT5E 10.76 5.69 4 TBC1D9 12.03 7.03 7.03 11.19 7.03 12.88 5 MAP7 1.64 8.03 6 SPRY1 10.40 5.72 7 TNFSF12 8.11 3.54 3.54 7.55 8 SOCS3 9.00 4.48 4.48 9.39 9 EDG1 11.43 6.91 6.91 8.69 10 CTGF 7.62 3.30 3.30 9.65 11 FAM46A 10.65 6.46 6.46 8.29 12 MOBKL2B 11.63 7.45 13 DNMT3A 10.56 6.44 6.44 7.85 14 BHLHB2 10.75 6.64 6.64 10.96 15 LAMC1 9.85 5.80 5.80 9.67 16 CD69 13.27 9.40 9.40 12.27 17 PLEKHA1 10.95 7.20 18 PTGDR 7.20 3.46 19 TXNIP 14.89 11.20 11.20 13.39 11.20 15.10 20 SIDT1 11.52 7.86 7.86 9.38 21 LY6E 8.57 4.92 4.92 7.39 22 IGF1R 8.73 5.13 23 PRICKLE1 11.68 8.09 8.09 9.69 24 CSDA 12.12 8.59 8.59 10.10 25 KLF2 12.61 9.10 9.10 11.70 26 ELOVL2 7.32 3.86 27 CCND2 12.06 8.61 8.61 11.53 28 LASS6 10.29 6.86 6.86 9.42 6.86 9.48 29 DUSP6 11.93 8.53 8.53 10.19 30 CUGBP2 14.28 10.93 10.93 14.29 31 PTPRO 9.64 6.32 6.32 8.63 32 PHF16 10.33 7.04 33 NR3C2 8.85 5.58 34 CRTC3 12.56 9.32 9.32 11.11 35 ADAMTS6 7.68 4.45 36 ETV6 10.36 7.14 7.14 8.89 7.14 10.43 37 LRRC17 3.10 7.49 38 FAM46C 12.18 8.98 8.98 14.76 8.98 10.54 39 SATB2 7.20 4.02 4.02 7.60 40 RNF125 9.00 5.83 41 ST6GALNAC3 8.12 4.96 42 LARGE 9.05 5.89 5.89 8.73 43 ZNF276 9.39 6.25 44 KCNA3 4.83 9.82 45 BCL2 10.89 7.76 7.76 11.41 46 MTSS1 12.92 9.82 9.82 12.05 47 NR6A1 9.10 6.03 6.03 7.62 48 BHLHB3 11.11 8.05 8.05 13.26 8.05 13.26 49 MYO10 7.22 4.19 50 ITM2C 6.44 13.85 51 C18orf1 9.49 6.47 6.47 8.63 52 FXYD7 7.36 4.35 53 DUSP8 7.96 4.96 4.96 8.41 4.96 7.75 54 BTBD3 7.41 4.42 55 TMEPAI 11.15 8.20 8.20 11.03 56 ANTXR2 9.90 6.97 57 FOSB 10.13 7.21 7.21 11.05 58 TMCC3 8.23 5.31 5.31 7.09 5.31 8.05 59 ARL4C 11.31 8.41 8.41 10.32 60 ZMYND11 11.33 8.43 8.43 11.34 8.43 11.68 61 RHOBTB1 7.33 4.48 62 JUN 12.14 9.34 9.34 12.70 63 SKI 10.46 7.67 7.67 10.68 64 TMEM121 7.07 4.29 65 IL13RA1 8.99 6.21 66 KIF13B 6.23 9.01 67 BHLHB5 4.26 7.39 68 PGM2L1 10.35 7.65 69 C14orf4 12.11 9.47 9.47 11.01 9.47 11.65 70 PDE4B 12.38 9.74 9.74 11.60 71 PDE7B 8.64 6.03 72 BCL9L 9.37 6.77 6.77 8.61 73 PCDH9 10.32 7.73 74 ARHGAP5 10.44 7.86 7.86 9.11 7.86 9.85 75 KIAA0802 9.18 6.61 6.61 7.91 6.61 7.89 76 ITGB4 7.48 4.91 77 NOTCH2NL 7.17 8.95 78 CDC42BPA 7.32 4.77 79 SPG20 9.25 6.73 80 KLF4 10.04 7.57 7.57 9.09 81 AHNAK 9.34 6.87 6.87 9.56 6.87 11.51 82 FCHSD1 9.15 6.69 83 KIAA1622 3.94 7.67 84 PLXNC1 10.92 8.48 85 TMEM150 8.39 5.96 86 ACVR2A 7.81 5.38 5.38 8.63 5.38 7.40 87 KALRN 5.61 7.64 88 ANK2 7.69 5.28 5.28 7.54 5.28 7.00 89 FLJ14213 7.61 5.21 5.21 7.97 90 CHPT1 10.92 8.52 91 TCF2 5.69 7.82 92 FGF5 5.41 7.52 93 SLC12A6 12.18 9.80 9.80 11.09 94 MGC17330 11.53 9.16 95 NR4A2 10.21 7.85 7.85 9.21 7.85 10.54 96 SLC39A10 11.06 8.70 97 LITAF 12.52 10.18 10.18 11.82 98 AKT3 9.32 6.99 6.99 9.25 99 PDCD4 12.89 10.57 10.57 13.33 100 STMN3 10.03 7.72 101 SIDT2 13.13 10.85 102 GRIA3 7.04 4.77 103 EML4 12.83 10.57 104 DIP2B 11.26 8.99 8.99 10.77 105 FBN1 4.89 8.17 106 FAM84B 9.21 6.96 107 EGR3 11.59 9.35 9.35 8.24 9.35 10.62 108 CTHRC1 4.25 11.94 109 RRAGD 7.69 5.46 110 MACF1 12.88 10.66 111 FOXF2 7.05 4.83 112 GAB1 8.01 5.81 5.81 10.91 113 ST18 4.42 7.40 114 ZFP36L2 13.78 11.59 11.59 13.43 11.59 14.05 115 GAB2 8.29 6.12 6.12 9.02 116 CHST11 11.17 8.99 8.99 10.28 117 CLOCK 9.85 7.68 7.68 9.91 7.68 9.62 118 PREX1 10.07 7.90 7.90 11.16 119 KLF11 8.08 5.94 5.94 8.39 120 PTGER4 11.66 9.53 121 KLF9 9.47 7.34 7.34 9.27 122 FLJ37078 7.55 5.42 5.42 7.49 123 ODZ2 7.20 5.08 5.08 7.25 5.08 7.22 124 SESN3 11.24 9.11 9.11 7.60 125 PDK4 7.22 5.09 126 CNTNAP3 7.35 5.23 5.23 7.10 127 DUSP1 13.34 11.22 128 MARCKS 11.19 9.07 9.07 11.05 9.07 12.21 129 SPRY4 7.02 4.91 130 LMO1 4.75 7.16 131 MTUS1 7.77 5.66 5.66 8.16 132 ADCY9 8.01 5.91 5.91 7.74 133 SLC17A6 3.80 7.06 134 NOX4 7.45 5.37 5.37 7.22 135 UTRN 9.46 10.97 136 ZBTB10 8.50 6.45 137 SLC26A7 8.37 6.32 6.32 7.89 138 PNRC1 13.14 11.09 139 LLGL2 6.83 9.29 140 CHST1 7.15 5.12 141 CREB3L2 10.53 8.51 8.51 13.30 142 DDIT4 12.69 10.68 143 C20orf108 8.82 6.80 6.80 10.19 144 CDH1 3.85 10.26 145 TFAP4 7.28 5.29 146 SLC38A2 13.57 11.58 11.58 13.74 11.58 13.17 147 SESN1 9.84 7.87 7.87 9.13 148 YPEL2 10.18 8.20 8.20 10.04 149 GRASP 8.47 6.50 150 TSC22D3 13.22 11.26 11.26 12.67 151 ATP11A 9.70 7.75 7.75 9.50 152 L3MBTL3 10.61 8.66 8.66 10.06 153 SORT1 7.61 5.67 5.67 8.11 154 CAV1 4.80 9.11 155 RXRA 9.07 7.15 7.15 8.81 156 CRELD1 8.40 6.48 6.48 8.26 157 RBMS1 12.40 10.49 10.49 8.80 158 LYST 10.90 8.99 159 PIP5K1B 9.61 7.70 7.70 9.97 160 JUNB 11.62 9.72 161 MBOAT1 4.80 7.27 162 IRF4 11.16 9.28 9.28 13.66 163 LIFR 4.62 7.08 164 MORC3 11.25 9.37 165 MBP 11.91 10.05 10.05 8.61 166 SRC 4.98 7.98 167 ALS2CR13 11.79 9.93 9.93 8.89 9.93 11.47 168 MYH1 4.40 7.37 169 DUSP3 9.36 7.50 7.50 9.16 170 HLX1 7.14 5.28 5.28 7.65 171 CDKN1A 9.09 7.23 7.23 8.97 7.23 8.43 172 SOCS5 10.00 8.15 173 PPP1R9A 5.14 7.35 174 TGFBR2 12.81 10.99 10.99 12.63 175 LRRC16 8.47 6.66 176 ZNF629 8.17 6.35 6.35 8.58 177 RPS6KA5 11.75 9.95 9.95 11.48 178 SATB1 12.79 10.99 10.99 9.06 179 SEMA4C 7.38 5.59 5.59 8.49 5.59 7.14 180 ULK1 7.79 5.99 5.99 8.72 5.99 8.06 181 STX3 8.88 7.09 7.09 8.91 182 BAMBI 4.81 7.26 183 MAP3K5 10.63 8.84 8.84 7.66 8.84 10.71 184 KIAA1147 11.70 9.91 9.91 11.53 185 SBK1 5.20 7.04 186 RYR3 7.80 6.02 6.02 8.27 187 ZNF238 13.05 11.27 11.27 10.08 11.27 12.54 188 IL12A 5.65 7.26 189 SLC2A3 12.00 10.23 10.23 11.89 190 GFPT2 3.39 7.18 191 G0S2 7.72 5.96 192 LYRM5 10.29 8.53 8.53 10.93 193 SSH2 11.67 9.91 9.91 11.85 194 NRP1 7.44 5.69 5.69 7.22 195 LMLN 8.92 7.19 196 UCP3 7.71 5.99 197 TMEM166 7.31 5.60 198 CACNA1I 7.46 5.76 5.76 7.06 199 PHOSPHO1 3.55 7.10 200 CRIM1 9.79 8.11 8.11 9.32 201 GATA6 5.41 7.59 202 SACS 10.06 8.39 8.39 10.54 203 CDKN1B 12.91 11.24 11.24 14.41 204 CACNA2D2 5.25 7.57 5.25 7.93 205 MKRN3 3.65 7.10 206 MTFR1 10.40 8.74 8.74 7.34 8.74 10.15 207 GALNT3 10.19 8.54 208 RPS6KA3 12.07 10.42 10.42 11.48 209 DTNA 5.47 7.86 210 MAGI2 7.04 5.40 5.40 7.42 211 FOXJ2 10.01 8.38 8.38 9.97 8.38 9.85 212 KIAA0513 5.29 8.44 5.29 7.36 213 NDRG1 7.75 10.02 214 AKAP7 10.16 8.54 215 CD72 13.74 12.12 216 IGFBP5 7.30 5.69 5.69 7.59 217 REPS2 7.51 5.92 5.92 7.60 218 PRDM12 7.17 5.57 219 ZNF3 8.86 7.27 7.27 8.75 220 TLL2 4.88 7.01 221 PCNX 9.77 8.19 222 ARHGAP24 11.31 9.73 9.73 8.65 9.73 11.32 223 THRAP2 11.31 9.73 224 RNF11 9.72 8.15 8.15 11.08 225 HOXC8 7.05 5.48 226 SCML2 10.33 8.76 227 BMPR2 9.70 8.14 8.14 10.06 228 STAC 5.27 7.20 229 C10orf54 9.12 7.56 7.56 10.16 230 FBXL17 9.51 7.95 7.95 9.36 231 CBX7 10.87 9.32 9.32 10.96 232 UBE2W 9.80 8.25 8.25 9.76 8.25 9.38 233 ProSAPiP1 4.12 7.54 234 UBL3 10.73 9.18 9.18 11.27 9.18 11.03 235 TTYH3 7.35 5.81 5.81 8.16 236 PUNC 5.39 8.85 5.39 7.30 237 GDF11 7.01 5.47 5.47 7.70 238 LMX1A 5.25 7.43 239 TIMP2 7.51 5.97 5.97 7.69 5.97 7.40 240 NHLH2 3.93 7.35 241 CLCF1 10.50 8.98 242 ITGB3 7.66 6.14 243 TMEM132E 3.93 7.20 244 KCTD17 7.45 5.94 5.94 7.33 245 ChGn 7.75 6.24 6.24 8.36 246 DIP2C 9.25 7.75 247 DKFZp667G2110 8.79 7.28 7.28 9.25 248 CSNK1G3 10.84 9.34 9.34 10.70 249 NRIP1 11.79 10.30 250 SMAD3 10.72 9.23 9.23 7.74 9.23 10.54 251 SHOX2 7.05 5.57 252 LDLRAP1 6.80 9.84 6.80 8.59 253 SUPT3H 7.77 6.30 6.30 8.05 254 KCNN2 7.18 5.70 255 DLL1 7.37 5.90 256 CEND1 7.72 6.26 257 NOTCH1 10.90 9.45 258 TLE1 7.74 9.63 259 FCHO2 8.75 7.30 260 JPH4 7.12 5.67 5.67 7.60 261 KCNMB2 7.16 5.72 262 KHDRBS2 7.17 5.73 263 LEFTY1 4.38 7.21 264 ST3GAL5 10.59 9.15 265 LGR4 5.30 7.29 266 FNDC8 4.25 8.01 267 NPTXR 5.87 7.65 268 PRICKLE2 5.47 7.47 269 GRIA4 5.19 7.04 270 RHOB 8.66 7.23 7.23 9.56 271 ZADH2 8.65 7.22 272 ZBTB41 9.73 8.31 8.31 9.42 273 GPRASP2 6.00 7.35 274 SYS1 10.79 9.36 275 RUNX1T1 7.37 5.95 276 DLX2 4.66 7.04 277 SLC30A7 11.58 10.17 278 PER1 8.82 7.40 279 NT5C3 12.67 11.25 280 PDE3A 11.62 10.21 281 OCRL 8.07 6.66 6.66 8.04 282 PSD3 7.99 6.60 283 LPHN1 7.80 6.41 284 TNRC6B 11.87 10.48 10.48 11.77 285 SNN 12.03 10.64 10.64 8.91 10.64 12.10 286 HERPUD2 11.56 10.18 287 UBQLNL 7.45 6.07 288 HES7 7.37 5.99 289 GALNT2 10.08 8.69 8.69 10.63 290 CAMKK1 8.45 7.07 291 ELN 5.44 7.18 292 ICK 8.09 6.72 6.72 8.01 293 POU4F2 7.09 5.72 5.72 7.21 294 GAS2 7.13 5.76 5.76 7.81 295 ARHGEF3 10.11 8.75 8.75 11.04 296 ZBTB4 11.45 10.09 10.09 11.78 297 CHD7 12.14 10.78 10.78 12.08 298 TMEM45B 5.97 7.61 299 CLDN11 5.74 7.22 300 PTPN1 10.85 9.51 301 PHF20 12.00 10.67 302 VAV3 10.44 7.84 303 CARKL 8.38 7.06 7.06 8.94 304 TRIM36 5.43 7.77 305 CTLA4 6.57 7.95 306 POLK 9.69 8.38 8.38 10.55 307 WSB1 13.22 11.91 11.91 13.02 308 ALS2CR2 9.87 8.57 8.57 10.14 309 PLK2 4.94 7.13 310 SRPK2 10.83 9.53 9.53 11.13 311 ARRDC2 10.86 9.55 312 IER5 13.10 11.80 313 EPN1 8.95 7.66 7.66 9.07 314 SLC20A2 9.45 8.16 315 DLG4 4.23 7.22 316 TMTC2 6.16 7.92 317 ETV1 8.19 6.90 318 JAZF1 11.93 10.65 10.65 7.49 319 VAV2 10.22 8.94 320 C15orf27 7.19 5.91 321 FYCO1 9.75 8.47 322 KIAA0789 7.27 6.00 323 OBFC2A 9.94 8.66 8.66 10.94 324 MCF2 7.19 5.92 325 KIAA2018 11.77 10.50 10.50 9.50 326 MTMR10 10.75 9.48 327 FAM63B 6.03 7.83 6.03 7.95 328 SNF1LK 10.20 8.93 8.93 10.18 329 ZNF385 8.89 7.63 330 SESTD1 11.05 9.78 331 SLC31A2 5.41 9.13 332 PCMTD1 12.03 10.76 10.76 12.44 333 NBEA 8.06 6.81 6.81 8.02 6.81 8.35 334 ZNF295 9.24 10.61 335 SIPA1L3 10.81 9.57 336 CC2D1B 9.11 7.87 337 PRKAG2 7.12 8.42 338 PKD1 9.04 7.81 339 CNTNAP2 7.54 6.32 340 FNBP1L 7.90 6.67 341 HEXIM1 10.27 9.05 9.05 10.24 342 C19orf2 12.29 11.07 343 MYLIP 11.62 10.41 10.41 11.81 344 SLC11A2 9.27 8.06 345 CLU 9.92 8.71 346 GCN5L2 10.18 8.97 347 DKFZP564J0863 10.85 9.65 9.65 11.11 348 CNNM2 7.85 6.64 6.64 8.07 349 CDC42SE1 12.07 10.87 10.87 12.18 350 HOXB9 6.20 8.41 351 NFATC3 11.39 10.19 352 UNC84B 11.12 9.93 9.93 8.59 353 DUSP5 6.23 9.44 354 ING1 11.35 10.17 355 ITM2B 11.23 13.62 356 FAM53B 11.67 10.49 357 ZFP36L1 14.07 12.89 12.89 10.09 358 NIPA1 9.75 8.57 8.57 10.07 359 GALNT1 10.93 9.76 9.76 11.12 360 MYPN 4.25 7.32 361 ITPK1 10.03 8.86 362 TTYH2 7.90 6.73 363 DOCK10 10.80 9.63 9.63 11.53 364 C14orf28 9.18 8.01 8.01 9.58 8.01 9.50 365 RP11-130N24.1 4.76 7.62 366 FGF12 5.82 7.33 367 ATP2B2 7.93 6.76 368 PPP1R9B 9.77 8.60 369 PPP3CA 13.50 12.33 12.33 13.86 370 TFAP2A 5.54 8.26 371 CYLD 10.91 9.75 372 PHF1 11.85 10.69 10.69 12.26 373 NEBL 7.98 6.82 6.82 8.08 374 ACIN1 12.04 10.89 10.89 11.99 375 SPTBN1 12.28 11.14 11.14 12.53 11.14 12.42 376 VAMP4 10.81 9.67 9.67 11.18 377 DNAJB9 10.80 9.66 9.66 15.21 9.66 11.03 378 ZDHHC2 11.55 10.42 379 TRIO 10.57 9.43 380 TMEM25 6.24 8.57 381 TAF9B 10.82 9.69 382 ARID3A 8.03 6.90 6.90 9.81 383 KIAA0182 10.68 9.55 384 RPS6KA2 8.61 7.49 385 C3orf58 11.47 10.34 386 CAST 11.94 10.82 387 SH3PXD2A 8.46 7.34 388 RAB6B 5.93 7.36 389 RNF141 11.47 10.35 390 SP4 11.26 10.14 391 ARMCX2 9.44 8.32 8.32 9.54 392 ZNF398 10.39 9.28 393 PBX3 9.69 8.58 8.58 7.00 394 FOS 12.35 11.25 11.25 13.34 395 FHOD3 6.40 7.94 396 C20orf59 10.11 9.01 9.01 10.92 397 FAM117A 11.67 10.57 10.57 12.06 10.57 11.64 398 ATP8B2 8.58 7.49 7.49 10.87 7.49 8.88 399 UXS1 9.53 8.43 400 GOLGA8A 12.84 11.74 11.74 13.14 11.74 13.05 401 SUFU 6.03 7.84 402 NAGPA 9.32 8.23 403 MLLT6 11.70 10.61 404 CPEB4 9.46 8.36 8.36 12.21 405 TMEM50B 10.67 9.58 9.58 11.41 9.58 10.63 406 AMPD3 11.65 10.56 10.56 8.76 407 SIX5 5.19 7.53 408 MMP16 5.66 7.47 409 LBH 11.87 10.79 10.79 8.83 410 POM121 9.60 11.26 411 ATP8B1 11.93 10.86 10.86 8.88 412 ARHGAP29 3.75 7.60 413 ZNF395 11.78 10.76 414 CRY2 6.50 8.01 415 BIN1 10.68 9.67 416 PSAP 11.24 13.41 11.24 12.71 417 ISL1 5.91 7.60 418 DNAJB5 8.04 6.97 419 KIAA0284 6.42 8.79 420 RBM35B 11.44 10.38 421 ADCY7 11.53 10.47 422 ARRDC3 9.46 10.68 423 MICAL1 11.72 10.67 424 MTHFR 10.31 9.26 425 HOOK3 8.57 7.53 7.53 6.52 426 EFNB3 5.16 7.79 427 ARHGAP12 9.86 8.82 428 LMBR1L 9.33 8.29 429 FGF7 5.88 7.86 430 USP2 5.50 7.52 431 SMARCA2 11.14 10.12 432 ELL2 8.23 13.60 433 C1orf26 7.06 10.01 434 CXCR4 14.61 13.45 435 HDGFRP3 5.58 7.39 436 BNC2 6.18 7.72 437 YPEL3 10.16 11.81 10.16 11.47 438 PPFIA3 4.58 8.06 439 DLGAP4 9.34 10.68 440 ZBTB7A 9.84 11.10 441 D4S234E 5.90 7.38 442 FNDC3A 9.41 13.60 443 FOXC1 5.84 7.39 444 KIF26B 5.55 7.30 445 NAV2 6.26 7.90 446 DDX3Y 8.07 10.38 447 FGD1 7.31 6.06 448 HTR4 7.26 9.01 7.26 8.40 449 C22orf31 5.67 8.10 450 RNF44 11.48 10.14 451 GALNAC4S-6ST 10.43 12.71 452 CCNT2 10.15 11.23 453 CHIC1 8.91 10.02 454 NNAT 5.97 8.19 5.97 7.84 455 CTDP1 6.81 8.26 456 BTG1 14.95 13.94 457 CMTM4 5.27 7.81 458 GOLGA8B 11.37 12.63 459 HBP1 10.07 12.13 460 GDPD1 6.35 7.61 461 CDYL 9.31 10.61 9.31 10.50 462 ZNF217 10.77 9.73 463 KIF5A 6.13 7.75 464 C1QL1 5.80 8.11 465 SOLH 7.88 9.03 466 ZC3H6 9.81 10.96 467 LATS2 7.61 10.19 468 COL18A1 6.46 7.85 469 C11orf24 9.89 11.07 470 SCUBE3 6.14 7.88 471 SEMA4G 5.57 7.81 472 FOXP1 12.31 10.84 473 TRIB2 10.62 9.61 474 LOC285382 5.35 7.20 475 RUNX2 7.91 10.22 476 LOC196463 4.16 7.52 477 LPGAT1 10.57 7.99 478 RASSF2 12.52 10.93 479 IRF1 9.86 11.60 480 RAB40B 7.31 10.89 481 CTDSPL 6.37 7.83 482 CLCN4 7.44 6.39 483 CACNB1 6.41 8.20 484 SYNGR1 8.45 10.40 485 ST8SLA4 10.67 11.81 486 PLD3 7.63 10.59 487 FOXO3A 10.17 12.41 488 TSPAN33 10.49 9.38 489 HIST1H4F 6.20 8.08 490 LAPTM4A 12.05 13.06 491 PRKCB1 12.14 10.50 492 PROX1 6.38 7.89 493 CDK5R1 10.12 7.78 494 MAP3K9 7.96 9.13 495 GPX3 5.92 7.61 496 GNS 8.79 11.06 497 ARL15 8.27 6.51 498 OXR1 9.21 11.17 9.21 10.25 499 AAK1 7.38 9.54 7.38 8.47 500 SH3PX3 6.72 8.58 501 MS4A7 10.55 8.35 502 FLJ20273 5.96 11.23 5.96 8.65 503 ISCU 12.01 13.55 504 ITGA2 5.70 7.60 505 ME1 5.87 7.89 506 LRP1 4.92 7.04 507 ZNF652 9.66 10.81 508 TRAK1 11.07 9.85 509 SLC8A1 6.27 7.83 510 C1orf119 10.76 11.98 511 KLF6 11.33 9.24 11.33 12.40 512 TRIM2 6.22 8.20 513 USP3 11.11 12.51 514 ARID5B 11.02 12.48 515 RASD1 6.15 9.32 516 ZCCHC2 10.63 8.93 517 LEFTY2 5.08 7.03 518 BACH1 9.97 11.76 519 IRAK1 11.48 12.80 520 RP11-217H1.1 10.76 13.04 521 HLCS 6.54 8.45 522 NAGK 10.94 12.14 523 CELSR2 6.26 7.89 524 PCBP4 7.75 9.08 525 FLJ25476 9.49 10.72 526 TPP1 12.10 11.06 527 ACVR1 7.95 9.31 528 EHD3 8.99 10.35 529 FAM80B 9.35 8.02 530 SPRYD3 8.19 9.51 531 PRDM4 9.81 10.83 532 C6orf134 7.92 5.60 533 HSP90B1 12.04 16.36 534 DYNC1I1 5.98 7.33 535 NFLX 7.43 8.67 536 DOCK4 5.96 7.97 537 ZNF287 7.09 8.47 538 XRN1 10.92 12.37 539 YES1 6.39 8.60 540 RBM35A 8.19 9.44 541 HOXB4 7.58 9.27 542 OTUD7B 7.24 8.57 543 CELSR3 6.83 8.39 544 RHOC 7.71 8.84 545 ZNF607 8.10 6.95 546 XYLT1 10.28 8.78 10.28 8.86 547 FAM89B 9.16 10.75 548 OSBPL8 12.99 11.66 549 SRCRB4D 6.82 8.67 550 RASL12 5.05 8.07 551 NAG8 8.39 9.78 552 MAN1A2 10.83 12.15 553 PPARA 8.59 9.65 554 CLDN12 6.66 8.39 555 ID4 5.93 7.79 556 HECTD2 7.98 6.80 557 EFCAB4A 5.93 8.96 558 CREBL1 6.97 8.09 559 SARM1 6.98 8.29 560 MIDN 8.48 7.29 561 EMB 10.48 8.65 562 FOXK2 8.40 9.63 563 INADL 6.87 8.44 564 KCNAB1 6.26 9.76 565 MAP3K8 10.92 9.60 566 C8orf58 7.89 5.62 567 SLC4A7 9.82 8.52 9.82 10.90 568 RAB8B 12.46 10.92 569 C10orf118 8.93 10.20 570 CRTC2 9.37 7.94 571 KLC2 7.31 9.19 572 SRCAP 8.06 6.96 573 CNTFR 7.15 8.67 574 SPTBN2 4.75 7.11 575 SMAD7 8.69 9.93 576 NDFIP1 9.10 10.95 577 BCL11A 14.03 10.63 578 SFXN5 7.26 8.87 579 RIMBP2 5.93 8.33 580 FUT8 8.62 11.08 581 PSEN2 5.86 9.17 582 MAP6 5.22 7.37 583 FOXO1A 11.53 10.14 584 BTG2 11.81 13.82 585 C10orf56 6.93 9.30 586 MAPK1 12.06 10.36 587 ZBTB47 6.63 8.12 588 GOSR2 9.73 11.07 589 ZFP90 10.15 8.92 590 RALGPS1 8.02 9.38 591 DGKI 4.77 7.39 592 RGL2 11.08 9.55 593 PAK6 5.90 8.55 594 DMXL1 11.85 10.31 595 TMEM113 12.28 11.03 596 SNX24 6.75 8.53 597 HOXA3 5.99 8.27 598 SAMD4A 9.84 8.36 599 WDR45 9.88 12.43 600 TLOC1 12.91 14.52 601 LARP2 7.64 11.50 602 DTX2 7.60 6.20 603 ITGA9 7.53 6.32 604 FASTK 10.04 11.22 605 TAOK2 7.47 6.37 606 CRTAP 9.78 11.08 607 SERTAD2 11.91 10.82 608 TBP 10.14 9.09 609 IQGAP2 7.26 11.19 7.26 8.93 610 RASGEF1B 6.23 8.01 611 PIP5K2B 9.69 8.53 612 PRRC1 10.32 11.92 613 RHPN2 6.73 8.21 614 DYRK1B 5.92 7.61 615 ADCY2 5.98 7.97 616 C12orf34 5.61 7.09 617 GMPR 5.35 8.15 618 PAK2 10.86 9.66 619 KIAA1539 8.12 9.49 620 PLAGL1 10.03 6.68 621 LCORL 9.74 11.29 622 BCL9 7.21 9.16 623 CPEB2 9.09 10.23 624 TMEM59 12.10 14.75 625 TRIP10 7.17 9.36 626 CCPG1 8.38 11.86 627 NDE1 10.71 9.30 628 ZDHHC21 9.38 8.11 629 STOX2 5.87 7.66 630 RAB4B 10.63 8.66 631 LRRFIP1 13.25 11.99 632 OSBP 10.10 11.39 633 RAB6A 10.76 12.27 634 RHOV 4.88 7.19 635 SLC39A14 8.80 11.00 636 ADARB1 10.05 7.69 637 ESPN 6.85 8.19 638 SEC31A 11.64 13.61 639 PJA2 10.85 11.99 640 SYNGR3 9.01 7.56 641 LOC339745 11.94 10.54 642 NEDD9 11.23 12.48 643 COL23A1 5.41 7.02 644 PIP5K3 11.93 10.79 645 PTPRG 7.30 8.49 646 DAB2IP 5.61 8.30 647 MAPRE3 5.80 8.60 648 SQSTM1 10.05 11.45 649 RAB6C 10.88 12.04 650 FAM57A 7.58 6.18 651 YPEL5 12.41 13.78 652 TTN 9.61 7.03 653 HTRA3 5.62 8.02 654 CHST2 7.80 12.49 655 BAZ1A 11.43 10.06 656 LRFN5 7.38 6.21 657 MBNL1 14.10 12.62 658 MLL2 10.93 9.89 659 SF1 11.44 10.36 660 FRMPD1 4.80 7.06 661 PPP2R5B 7.60 9.12 662 RNF43 10.04 8.01 663 GAP43 5.07 7.49 664 NOMO1 11.11 14.31 665 VEGFA 7.79 9.36 666 C22orf5 8.75 11.38 667 AKAP11 11.79 10.64 668 INSIG2 9.46 11.32 669 PDIK1L 9.11 10.72 670 TMEM4 10.93 13.32 671 LMNA 7.80 9.75 672 TP53INP1 11.84 14.14 673 NAV1 6.96 8.31 674 SPTY2D1 9.25 10.77 675 CREBL2 9.95 11.10 676 MFAP3L 5.90 7.46 677 REXO2 10.96 13.71 678 SPTBN4 6.77 8.22 679 NOMO2 9.74 12.94 680 PTEN 12.78 11.40 681 FBXL16 6.86 9.56 682 GPM6A 7.87 6.15 7.87 6.67 683 PRX 6.76 8.91 684 HOXC11 6.40 7.88 685 KIAA0329 8.27 9.87 686 PAFAH1B1 11.68 10.33 687 C20orf174 9.58 7.27 688 MTPN 13.87 12.17 689 TMED5 12.25 14.41 690 FURIN 8.03 9.54 691 ELAVL3 4.66 8.01 692 SH2B3 10.31 8.87 693 LIN28B 5.99 7.58 694 KIAA1033 12.65 11.38 695 TMEM28 4.95 7.14 696 TBC1D15 10.30 11.52 697 GOLGA4 10.11 11.71 698 STX1A 5.63 7.82 699 SLC40A1 6.87 8.27 700 KIAA1815 9.18 7.93 701 HNT 5.53 7.09 702 PDE11A 5.72 7.82 703 TGFBR3 7.84 9.52 704 MTF1 9.92 8.86 705 MAN1A1 9.99 13.65 706 THRA 7.26 8.48 707 CBLB 11.46 9.08 708 SLC35F1 6.29 8.16 709 FOXP4 8.52 7.30 710 ELOVL5 13.83 12.78 711 NMUR1 4.13 7.31 712 ITPR1 12.06 9.69 713 CDCA7L 11.95 10.33 714 RASSF1 9.35 10.69 715 IL1RAPL1 6.42 8.18 716 AUH 9.37 11.19 717 DIAPH1 11.52 9.74 718 ENSA 12.33 11.22 719 FAM43A 10.62 9.39 720 CSMD3 4.79 7.58 721 SLC25A37 10.10 8.69 722 SLC33A1 9.78 12.19 723 CNOT6 9.98 8.93 724 GRID1 7.05 8.80 725 C21orf91 11.51 10.18 726 ITPKB 11.28 8.91 727 CP 5.89 7.41 728 HMBOX1 10.05 8.50 729 ARID1A 12.22 11.11 730 C5orf5 11.86 10.38 731 TMSB4X 16.86 15.10 732 EPAS1 7.02 8.39 733 HPS3 11.65 10.16 734 DKK1 6.16 7.86 735 ZNF282 7.89 5.40 736 AP3D1 11.29 12.84 737 DERL1 11.69 13.43 738 C5orf13 9.89 7.62 739 CCNG2 13.32 11.64 740 PGRMC2 9.44 11.38 741 ARF6 13.60 12.55 742 TMEM110 7.75 9.24 743 FAM13A1 7.11 9.69 744 BRMS1L 8.58 10.18 745 TRAM1 12.52 15.17 746 CALU 9.42 11.20 747 GOLPH3 11.55 12.81 748 MAP3K7 11.14 10.06 749 ABCG4 6.90 8.22 750 NELF 8.75 7.70 751 ADIPOR1 9.67 10.92 752 INSR 8.48 11.62 753 GRM5 6.24 7.65 754 TFG 10.76 12.30 755 USP48 11.91 13.09 756 CLCN6 9.26 7.48 757 ZNF219 6.11 8.42 758 C7orf43 8.34 6.62 759 NFKB1 11.90 10.70 760 ARF3 11.11 9.87 761 JMJD1C 12.34 11.11 762 ROD1 13.13 11.42 763 OXSR1 10.69 9.15 764 ERGIC2 10.86 12.81 765 EIF4E3 7.61 9.87 766 SEC24A 10.05 12.85 767 SPRED1 7.19 5.77 768 HNRPH3 12.60 11.38 769 ZDHHC7 10.34 9.05 770 HNRPA1 16.14 15.14 771 TMED2 12.01 14.26 772 VASP 10.60 8.60 773 CHD4 11.40 10.31 774 RTN4RL1 5.48 8.36 775 PPP1R12A 12.03 10.97 776 SGK3 9.58 11.68 777 ARHGAP17 12.37 8.62 778 GORASP2 11.28 13.30 779 C2orf44 8.38 6.72 780 FAM116A 11.12 10.08 781 SSR1 12.75 14.73 782 MYH9 11.24 9.89 783 PIK3CD 12.99 10.03 784 DAZAP2 14.26 13.23 785 SEL1L 10.74 14.04 786 LOC388284 7.05 8.32 787 THRB 7.51 6.11 7.51 6.29 788 MGAT2 11.91 14.44 789 C8orf13 9.35 6.47 790 PDZD2 7.00 4.39 791 DERL2 10.74 12.75 792 ZCCHC5 7.39 6.27 793 NFYC 10.27 9.03 794 GLUD2 8.88 7.58 795 ESR1 7.55 9.88 796 NRP2 6.51 8.13 797 NUS1 10.01 11.53 798 BIRC6 12.15 10.94 799 ARID3B 7.83 9.22 800 STCH 10.16 13.88 801 SLC7A11 6.32 8.00 802 OSBPL5 7.91 9.22 7.91 6.62 803 IGFBP3 5.60 7.61 804 LNPEP 13.72 11.05 805 ZNRF1 8.18 9.68 806 DDAH1 7.96 5.87 807 ERG 4.07 7.49 808 APLP2 10.90 8.38 809 ZNFX1 10.14 8.93 810 GPM6B 8.66 6.69 811 BLCAP 11.49 10.10 812 SRP68 11.47 12.88 813 PIK3AP1 14.12 11.74 814 ANKRD28 11.00 12.46 815 KCNH8 8.27 4.80 816 KIAA0430 12.43 10.61 817 PPP2R1B 9.84 8.41 818 TMED9 11.62 13.82 819 CTNNBIP1 7.31 8.89 820 PPP2R5D 9.51 7.92 821 CBX4 12.36 13.69 822 AKAP6 7.38 5.55 7.38 4.93 823 C2orf30 10.72 13.84 824 DR1 11.97 10.65 825 MTDH 12.46 13.96 826 ETS1 14.40 12.62 827 EPHA8 6.12 8.10 828 ANKRD13B 7.23 5.85 829 C4orf16 8.83 7.70 830 SOX4 9.14 10.20 831 SLC12A2 10.23 9.01 832 IER3IP1 11.35 12.56 833 DST 7.02 8.34 834 WRNIP1 11.03 9.49 835 CLCC1 9.63 11.48 836 B4GALT6 7.90 6.82 837 BTBD10 10.12 8.07 838 SDC1 7.05 12.14 839 C10orf12 10.32 8.40 840 ZDHHC3 9.80 8.78 841 GNAI2 10.86 9.27 842 HNRPU 13.82 12.47 843 GNAZ 8.86 7.26 844 ALG9 8.93 10.97 845 FBXL10 11.75 10.43 846 ARID4B 12.19 10.96 847 PPP1R3F 6.19 7.79 848 EPB49 6.49 7.94 849 PCNP 12.91 11.74 850 PCYT1B 11.35 9.77 851 RAB14 11.64 10.41 852 TCERG1 12.50 11.46 853 MKNK2 14.87 12.67 854 COL4A3 8.78 12.23 855 HNRPA0 12.50 11.36 856 P2RX4 8.88 10.29 857 JUP 9.23 5.70 858 EGR2 10.43 8.07 859 SUPT16H 11.35 9.60 860 PNRC2 13.93 11.64 861 SRPR 11.87 13.89 862 BPTF 12.46 11.34 863 RBM16 12.05 10.52 864 YWHAZ 13.62 12.61 865 EDEM3 11.01 12.76 866 C12orf23 11.18 12.40 867 DOC2A 3.96 7.21 868 SETD2 11.54 10.39 869 FAM98A 10.91 12.10 870 C13orf18 13.25 9.86 871 BRP44L 10.48 11.91 872 CCDC6 11.25 9.82 873 GLCCI1 12.22 15.19 874 PLEKHH1 7.03 9.25 875 SMEK1 11.38 10.37 876 ANKRD9 4.70 8.61 877 CSNK1E 8.86 11.48 878 DCUN1D3 7.48 5.95 879 LTB 14.66 9.91 880 EOMES 7.30 6.14 881 PARP8 10.81 8.69 882 ABCD1 7.12 8.49 883 HOXA10 5.56 7.32 884 RNPS1 12.60 11.25 885 AYTL2 12.08 10.79 886 FLJ20699 5.74 8.80 887 SAPS1 11.43 9.76 888 SYNJ1 8.36 9.64 889 ZNF403 12.06 10.91 890 KPNB1 13.37 12.26 891 ISOC1 9.67 10.98 892 HYOU1 9.95 11.85 893 ZNF706 12.83 14.30 894 HDLBP 10.60 13.37 895 ELF1 12.70 11.34 896 TM9SF4 8.66 10.55 897 RAB8A 11.94 10.88 898 MORF4L2 12.94 14.69 899 SERP1 13.31 15.16 900 ADAMTS5 5.71 7.31 901 TRIOBP 11.23 10.18 902 ZNF664 11.32 12.57 903 RAB11FIP1 11.78 9.03 904 MYO18A 8.06 6.19 905 DUSP10 10.13 8.70 906 ATXN1 6.66 10.65 6.66 10.25 907 EPB41L4B 6.12 7.95 908 CNTNAP1 6.51 9.06 909 SLC17A7 6.47 8.01 910 SPCS2 13.75 15.53 911 CCNC 12.68 14.10 912 WDR77 10.67 8.83 913 GMFB 12.03 10.70 914 ITGA6 6.72 10.51 915 CASP8AP2 10.55 9.44 916 SEC24D 8.79 11.88 917 CBX1 12.16 10.96 918 TBX3 6.05 7.89 919 NFAT5 12.09 10.72 920 ATP6V1B2 10.73 9.53 921 ACTG1 16.72 14.81 922 RND3 7.31 5.65 923 HNRPUL1 11.97 10.58 924 TJP1 7.18 10.59 925 RAPGEF4 5.25 8.09 926 RGMA 5.65 7.42 927 NAP1L1 14.70 12.60 928 TARDBP 12.72 11.49 929 DAZAP1 12.74 11.30 930 ZNF609 8.26 6.94 8.26 9.52 931 ARL1 10.44 12.41 932 ERC2 7.03 5.97 933 PDE4A 7.65 9.22 934 CSK 12.83 10.59 935 IMPAD1 8.44 10.05 936 PNN 13.75 12.48 937 DCP2 13.06 10.74 938 PIK3R3 6.34 7.82 939 RAB1A 13.59 14.83 940 CENTB2 12.39 10.97 941 SPTAN1 11.48 9.79 942 DNAJC8 12.25 11.00 943 UNC13B 6.70 8.35 944 DHX15 14.19 12.99 945 VEZF1 11.45 9.94 946 DHDDS 8.74 10.05 947 FAM55C 8.19 9.74 948 USP37 8.89 7.60 949 MMD 11.68 10.32 950 HCLS1 14.42 13.12 951 KIAA1370 13.30 14.72 952 GANC 8.31 6.12 953 SSRP1 11.34 10.27 954 G3BP1 12.24 10.55 955 BAAT 4.91 7.24 956 FNDC3B 8.27 14.34 957 FBXW7 10.21 12.19 958 SPECC1L 10.27 7.66 959 YBX1 15.31 14.20 960 YAP1 7.23 5.61 961 ARF4 12.09 14.23 962 PNKD 10.86 9.79 963 CLEC2D 11.96 10.90 964 XPO1 13.81 11.82 965 TRAM2 9.38 12.80 966 MITF 8.05 6.41 967 CFL1 16.37 14.09 968 CREB5 5.46 7.24 969 GREM1 4.48 7.14 970 LONRF1 11.26 10.00 971 NME7 9.37 8.30 972 PMAIP1 12.26 10.75 973 KLHL14 11.89 10.84 974 AOF1 9.33 7.96 9.33 8.28 975 SMPD3 5.90 7.83 976 RGL1 6.66 8.04 977 LYPD6 5.38 7.39 978 STAT5B 10.95 9.73 979 C10orf6 10.04 8.44 980 CLDND1 10.72 12.01 981 DUSP9 5.59 7.70 982 SLC36A1 8.53 7.23 983 PAM 8.90 10.86 984 GHR 5.87 7.56 985 CBL 11.69 10.26 986 CENTG2 5.96 7.39 987 BACH2 13.68 9.35 13.68 11.88 988 NUP153 12.33 10.55 989 CPD 8.37 9.72 990 APLN 8.58 6.47 991 RFXDC2 11.67 10.00 992 GABRB2 5.58 8.10 993 NOMO3 5.39 7.39 994 RHOJ 6.41 7.75 995 PRDM1 9.15 14.10 996 IGSF3 7.62 5.91 997 UBE2A 12.47 11.47 998 KBTBD8 12.82 9.73 12.82 11.71 999 PRR15 7.27 5.94 7.27 4.67 1000 ILF3 11.94 10.71 1001 WIPF1 13.81 12.41 1002 GCNT2 11.01 8.49 1003 DBNL 10.43 8.48 1004 C14orf43 10.14 8.01 1005 MID1IP1 9.16 8.11 1006 LIMD2 10.43 8.88 1007 HNRPK 14.49 12.95 14.49 13.46 1008 ZNF697 5.74 8.07 1009 TSHZ3 7.31 5.32 1010 MBNL2 11.88 13.47 1011 ELL 7.83 9.17 1012 MAFB 7.30 8.56 1013 GGA2 13.25 10.77 1014 C20orf121 10.01 8.93 1015 CDC2L6 11.52 9.69 1016 TOB2 11.39 9.58 1017 MAP4K4 12.04 10.41 1018 FAM102A 11.41 10.18 1019 ITGB3BP 11.86 10.76 1020 HIVEP1 10.35 9.05 1021 NUDT21 12.51 11.11 1022 EIF4A1 14.02 12.98 1023 TSPAN14 8.38 6.31 1024 SLC2A4RG 8.98 7.40 1025 DGKZ 9.74 7.85 1026 PTPN9 9.30 7.85 1027 BCL7A 11.33 10.10 1028 LSM14A 12.74 11.19 1029 GNB2 11.50 10.12 1030 SLC6A6 11.35 8.51 1031 TACC1 13.21 11.62 1032 LIMK2 9.80 8.12 1033 ACVR2B 6.69 8.33 1034 SCC-112 12.25 10.55 1035 PTBP1 13.38 12.19 13.38 12.21 1036 CITED2 9.88 12.56 1037 SNX5 14.17 13.16 1038 ACTR2 15.12 13.32 1039 OSBPL3 10.59 12.84 1040 SFRS1 14.60 13.24 1041 ADM 7.24 11.10 1042 PFKFB3 11.91 10.01 1043 FNBP1 13.61 12.25 1044 MTMR2 10.53 9.06 1045 DDHD1 10.18 8.74 1046 HSPA5 13.70 16.32 1047 PTK2 12.12 8.33 1048 UBE2I 13.17 11.22 1049 SNAP23 13.78 12.23 1050 MTERFD2 10.53 8.59 1051 COTL1 13.89 10.14 1052 PHACTR2 8.65 6.86 1053 GLRA2 5.93 7.69 1054 NUTF2 10.39 9.26 1055 TSGA14 9.52 8.03 1056 FKBP1A 12.16 10.89 12.16 10.82 1057 LRRC1 8.82 7.68 1058 PDIA6 13.07 14.91 1059 YWHAQ 14.50 12.99 1060 ACHE 5.59 8.29 1061 KRAS 12.36 10.49 1062 FAM107B 13.87 12.55 1063 CCDC117 11.03 9.56 1064 WDR1 13.38 11.36 1065 HMGB1 16.36 14.98 16.36 14.97 1066 CCND3 12.69 9.79 1067 SUV39H1 9.28 8.07 1068 RANBP5 11.94 10.87 1069 SLC25A33 10.24 9.00 1070 EDNRA 5.94 7.12 1071 RAB11A 12.94 11.73 1072 DDEF1 11.98 10.54 1073 CXorf15 11.84 10.47 1074 C4orf34 13.65 10.16 1075 SLC44A1 11.10 13.50 1076 EIF2AK3 12.29 13.83 1077 RAP1B 14.21 13.21 1078 CDK2 10.20 8.73 10.20 9.01 1079 JDP2 7.94 5.97 1080 GSTCD 8.86 7.85 1081 TNKS2 10.95 9.62 10.95 9.62 1082 FUZ 7.15 8.96 7.15 8.19 1083 SYPL1 13.56 10.87 1084 EIF4H 13.07 12.02 1085 PIP5K2A 9.65 8.06 1086 RGS2 11.61 14.48 1087 ARF5 10.35 9.13 1088 JAKMIP2 8.57 6.96 1089 RABGAP1 12.19 9.65 12.19 10.85 1090 LRIG1 9.76 10.77 10.77 9.16 1091 CLTA 13.08 11.71 1092 APBB2 7.87 6.39 1093 SMC1A 12.88 11.33 1094 CDC27 9.86 10.88 1095 STT3A 8.64 9.66 1096 ZFAND6 12.01 13.04 13.04 11.95 1097 BZRAP1 8.43 7.15 1098 DPP3 9.41 10.44 10.44 8.39 1099 CNIH 11.94 12.98 1100 TMEM16F 9.42 10.46 1101 ARHGEF7 11.99 13.03 13.03 11.18 13.03 11.60 1102 CAMTA1 10.60 11.64 1103 PFN1 14.03 15.08 1104 USP12 10.18 11.23 1105 AZIN1 11.24 12.29 1106 GNA13 13.89 14.94 14.94 13.37 1107 RCOR1 10.46 11.51 11.51 9.96 1108 USP1 13.36 11.52 1109 VANGL1 7.47 9.15 1110 CAPZB 11.85 12.91 1111 CDV3 13.86 14.91 1112 ABI1 11.61 12.67 12.67 10.96 1113 ST5 7.21 8.28 1114 TTL 8.63 9.69 9.69 8.03 1115 ANP32E 12.76 13.82 13.82 12.19 1116 USP7 12.27 13.34 1117 BCL11B 7.20 8.27 8.27 9.68 1118 OAZ2 8.98 10.06 1119 PPP2CA 12.04 13.12 13.12 11.89 1120 TSC1 10.58 11.66 1121 CTDSPL2 9.81 10.90 10.90 9.51 10.90 9.68 1122 NEDD4L 7.81 8.90 1123 NAT13 12.06 13.16 1124 ASF1A 9.54 10.64 1125 DPF1 7.18 8.50 7.18 5.84 1126 RAN 13.46 14.57 14.57 12.39 1127 ELAVL1 11.66 12.77 12.77 11.43 1128 GRHL1 5.76 7.24 1129 SMAD2 10.45 11.57 1130 IQWD1 9.70 10.83 10.83 9.73 1131 ETS2 7.50 5.66 1132 CDC25B 10.04 11.18 1133 USP32 10.65 11.78 11.78 10.75 1134 EED 11.76 12.90 12.90 11.50 1135 CTNND2 5.93 7.81 1136 SHROOM3 7.86 9.01 9.01 6.05 1137 PSCD3 6.43 7.57 1138 ATF7 7.83 8.97 1139 CDK6 10.31 11.46 1140 GCH1 12.59 10.17 1141 AP3S1 11.95 13.12 1142 ARL6IP1 12.03 13.20 13.20 11.51 1143 TBC1D1 11.00 12.17 12.17 10.01 1144 ATP2A2 10.75 11.92 11.92 10.76 1145 SORL1 12.49 13.67 13.67 10.58 1146 SOX5 9.30 10.47 10.47 7.33 10.47 9.08 1147 KIAA1411 8.65 9.83 1148 KIAA0922 12.43 13.61 13.61 10.86 13.61 12.35 1149 SSX2IP 7.82 9.00 9.00 7.49 1150 SNRPD1 11.85 13.04 1151 EDD1 11.23 12.42 1152 BLMH 9.01 10.21 1153 PTPLB 11.32 12.52 1154 SLC25A27 7.44 3.28 1155 PGAM1 12.40 13.61 13.61 12.55 1156 HMGA1 11.26 12.47 12.47 10.36 1157 EDEM1 11.34 12.55 1158 PRPF38A 10.27 11.48 11.48 10.00 1159 DCUN1D1 9.82 11.03 1160 ROBO1 7.43 8.64 1161 LRRC59 11.26 12.65 1162 ZNF207 12.29 13.51 1163 GTDC1 9.19 10.42 10.42 9.35 1164 C1orf121 10.47 11.70 1165 NF1 9.23 10.46 1166 CUL3 12.98 14.21 14.21 12.80 14.21 12.99 1167 B4GALT5 8.74 9.97 9.97 8.08 9.97 8.71 1168 GADD45A 8.14 9.37 9.37 11.74 1169 RASD2 5.53 7.35 1170 CD4 6.76 8.01 8.01 6.11 1171 WWC1 6.16 7.88 1172 DUSP2 9.43 10.69 10.69 9.18 1173 TP53INP2 8.44 9.70 9.70 8.53 9.70 8.00 1174 NRAS 8.89 10.16 1175 TFRC 12.12 13.39 13.39 11.88 1176 MASTL 8.76 10.03 10.03 8.23 10.03 8.64 1177 USP6 9.12 10.39 10.39 9.25 1178 VGLL4 10.30 11.57 11.57 10.16 1179 C10orf78 8.93 10.21 1180 BTG3 9.87 11.16 1181 TMOD2 8.64 9.93 9.93 6.94 1182 HOXA5 7.03 8.32 1183 AK2 10.33 11.62 1184 MAP2K1 10.41 11.71 11.71 10.69 11.71 10.61 1185 CASP3 10.16 11.47 1186 STK40 9.30 10.60 10.60 8.13 1187 GRHL3 5.20 7.46 1188 SLC25A4 8.65 9.96 1189 KLHDC5 9.52 10.83 1190 SAMHD1 9.72 11.03 1191 PHLPP 7.93 9.24 9.24 7.58 1192 CCNE1 7.86 9.18 1193 EGR1 11.92 13.24 1194 PIM1 9.44 10.76 10.76 8.87 1195 HECW1 6.49 7.81 1196 CHAC1 6.73 8.76 1197 P4HA2 6.84 8.18 1198 PPM1E 6.59 7.92 1199 KIAA0746 13.65 14.98 1200 LOC401720 6.33 7.63 1201 CAPN5 5.90 7.24 1202 DYNLL1 12.69 14.03 1203 EHMT1 10.40 11.75 1204 RIC8B 7.54 8.89 1205 GRIN1 7.40 8.93 1206 DEK 12.73 14.09 14.09 10.29 1207 E2F1 7.01 8.37 8.37 7.21 1208 FAM45A 10.66 12.02 1209 VAMP1 11.10 12.47 1210 LTBP1 7.23 8.61 1211 SOCS1 9.18 10.56 10.56 9.25 1212 ZCCHC14 6.98 8.36 1213 KLHL3 8.04 9.43 1214 RET 5.90 7.29 7.29 5.99 1215 CUTL1 10.33 11.72 11.72 10.67 11.72 10.50 1216 RBL1 7.58 8.98 8.98 7.52 8.98 7.97 1217 TOP1 11.47 12.87 1218 GPD1L 7.94 9.35 1219 SAR1B 9.03 10.46 10.46 12.55 1220 MTF2 11.84 13.27 13.27 11.18 1221 ANP32B 15.53 14.21 1222 CIT 8.19 9.63 9.63 7.43 9.63 7.77 1223 POU3F1 6.08 7.52 1224 MTMR12 11.44 12.89 12.89 11.13 12.89 11.60 1225 MBOAT2 6.73 8.17 8.17 6.25 1226 DOCK9 9.28 10.73 1227 ZAK 8.60 10.05 10.05 8.21 1228 LOC152485 11.05 12.51 12.51 10.56 1229 HNRPA3 14.33 12.26 1230 LMNB1 10.63 8.78 1231 ZFYVE21 8.42 9.90 1232 TXNDC5 12.47 16.40 1233 UBE2G1 11.36 12.84 1234 KIF23 7.44 8.93 8.93 5.57 8.93 6.64 1235 DPYSL2 9.98 11.46 11.46 9.03 1236 ATP5G3 12.15 13.64 1237 GLRX5 10.08 11.57 1238 NLK 10.41 11.92 1239 ARL6IP6 10.51 12.02 12.02 10.43 1240 CNNM4 6.17 7.68 7.68 5.21 1241 TBC1D4 9.12 10.64 10.64 8.94 1242 CD163 5.49 7.00 1243 PKD2 8.17 9.71 9.71 7.48 1244 DIAPH3 8.23 9.77 9.77 8.34 1245 RAD23B 10.65 12.20 12.20 10.54 1246 DCAMKL2 5.53 7.08 7.08 5.88 1247 LMBR1 7.22 8.77 1248 RRAS2 11.24 12.79 12.79 11.03 1249 MYO1D 6.31 7.88 7.88 10.07 1250 KLHL5 10.57 12.15 12.15 10.43 12.15 10.80 1251 EPS15 12.32 13.91 13.91 12.70 1252 FASLG 5.47 7.06 1253 H2AFY 12.56 14.16 1254 LIMA1 8.47 10.07 10.07 9.06 1255 CDCA4 8.92 10.52 10.52 9.16 1256 HAS3 5.70 7.31 7.31 6.15 1257 HRBL 5.96 7.57 7.57 6.35 7.57 5.97 1258 SYAP1 9.71 11.32 11.32 9.76 1259 MDFIC 12.06 13.67 1260 FAM76B 11.27 12.89 12.89 10.52 1261 SNTB2 8.22 9.85 9.85 8.64 1262 ARL3 8.92 10.55 1263 GPR124 5.50 7.14 1264 BCL2L11 10.79 12.43 12.43 11.14 1265 RNF103 12.03 13.23 1266 MYB 6.97 8.62 8.62 5.61 1267 PKM2 11.21 12.87 1268 VCL 8.92 10.57 10.57 8.25 1269 RBBP7 12.45 14.11 14.11 12.96 14.11 12.70 1270 LBR 12.86 14.53 14.53 12.16 14.53 12.50 1271 RRBP1 6.97 8.64 8.64 11.94 1272 GABRB3 5.33 7.00 1273 SGCB 7.78 9.45 9.45 8.22 1274 FAM81A 6.61 8.30 8.30 5.44 1275 RAB15 5.75 7.44 1276 SOX9 6.72 8.42 1277 SAP30 8.22 9.91 1278 BRWD1 8.60 10.30 10.30 8.72 10.30 9.04 1279 KCNMA1 7.47 9.17 9.17 10.42 1280 WHSC1 9.67 11.37 11.37 9.60 1281 CCDC126 9.36 11.09 1282 GRAMD1C 7.83 9.57 1283 PHF19 8.98 10.73 10.73 9.18 1284 ADAM23 7.02 8.77 8.77 7.00 1285 C9orf150 5.38 7.13 1286 ZNF572 6.52 8.30 8.30 6.82 1287 STK39 9.38 11.15 11.15 9.40 1288 SMS 9.73 11.54 1289 DMD 8.96 10.77 10.77 9.32 1290 C1orf83 6.15 7.96 1291 MFHAS1 9.80 11.61 11.61 9.36 1292 STXBP1 6.57 7.79 1293 CPNE2 5.44 7.27 7.27 4.84 1294 MYH10 7.07 8.90 8.90 7.85 1295 CALM3 9.63 11.46 11.46 10.30 1296 EFNB2 7.01 8.85 1297 ACTN1 5.89 7.74 1298 RBMS3 5.67 7.51 1299 ACOT7 9.70 7.83 1300 RKHD1 5.92 7.77 1301 LRRK1 9.74 11.62 11.62 10.12 1302 PTCH1 7.70 9.58 1303 MGLL 7.30 9.18 9.18 10.57 9.18 8.06 1304 YWHAH 8.94 10.82 10.82 9.09 1305 PDE4D 6.78 8.66 1306 MAF 8.05 9.95 9.95 8.25 1307 PTGER3 5.18 7.09 7.09 6.06 1308 PRKCD 9.49 11.40 1309 CCDC64 8.15 10.07 10.07 7.55 1310 RASL11A 7.89 6.65 1311 KPNA2 11.18 13.09 13.09 11.78 13.09 11.55 1312 GPR137B 8.65 10.58 10.58 9.36 1313 TIAM1 6.97 8.90 1314 TFDP1 10.95 12.90 12.90 10.49 1315 SSBP2 10.47 12.42 12.42 10.32 1316 REEP1 5.64 7.61 1317 MAP2 7.85 9.83 9.83 7.75 1318 HOXA9 5.15 7.12 1319 SCRN1 11.81 9.54 1320 LOC129607 8.79 10.78 10.78 9.33 10.78 9.45 1321 SIAH2 10.35 12.34 12.34 10.57 1322 DKFZP564O0823 6.96 8.95 1323 POLQ 8.30 10.30 10.30 8.98 10.30 7.83 1324 KLF15 5.88 7.88 7.88 9.36 7.88 6.74 1325 PXDN 8.36 10.37 1326 BTBD12 8.06 10.08 10.08 8.56 1327 PHF6 11.19 13.21 13.21 11.96 13.21 12.09 1328 SLC41A2 5.67 7.68 1329 HN1 9.87 11.92 11.92 9.85 11.92 10.58 1330 ZNF608 8.98 11.07 11.07 9.74 1331 RNGTT 10.32 12.45 1332 RAP2A 10.35 12.47 1333 LIMK1 5.18 7.36 7.36 5.05 1334 SMAD1 5.91 8.10 8.10 6.34 1335 NCOA7 10.39 12.58 1336 PRDM15 10.29 12.49 1337 PELI1 10.67 12.88 1338 PLS1 5.43 7.65 7.65 4.53 1339 RAB23 6.14 8.36 1340 NAP1L5 7.40 9.63 9.63 8.30 9.63 8.34 1341 DNER 6.90 9.14 1342 LRRC42 7.58 9.83 1343 ID2 7.74 9.99 1344 IBRDC2 9.98 12.24 12.24 8.84 12.24 9.94 1345 DNMT1 11.21 13.50 1346 STAC3 5.74 8.02 8.02 7.01 1347 HMGB3 8.20 10.50 10.50 8.80 10.50 8.08 1348 BMPR1A 6.75 9.06 1349 SGK 10.06 12.37 1350 CBX2 6.06 8.37 8.37 6.38 1351 LRRC20 5.69 8.03 1352 LRRC4 4.81 7.15 7.15 5.05 1353 HOXA1 5.36 7.70 1354 LRRC62 4.95 7.30 1355 ATAD2 9.00 11.34 11.34 8.44 11.34 9.37 1356 MOBKL1A 9.73 12.08 12.08 9.13 12.08 10.12 1357 LOC220594 10.06 12.41 12.41 10.07 1358 ZNF804A 6.14 8.51 1359 C1orf113 5.99 8.36 8.36 5.74 1360 FMNL2 6.58 8.96 1361 H2AFX 12.49 10.60 1362 ATP1B1 5.60 8.03 1363 GPT2 6.54 8.97 1364 PSRC1 9.89 7.46 1365 SLC25A35 5.23 7.68 1366 LHFPL2 8.94 11.41 1367 UBE2J1 11.34 13.81 13.81 12.22 1368 TBC1D8B 5.43 7.91 7.91 6.89 1369 SGPP1 10.96 13.46 13.46 11.28 1370 C11orf9 4.74 7.24 1371 BCL6 12.29 14.82 14.82 10.60 14.82 11.78 1372 ANUBL1 8.12 10.66 10.66 8.78 1373 MTA3 8.37 10.92 1374 PGBD5 4.87 7.45 7.45 5.87 1375 LPP 11.00 13.59 13.59 10.07 13.59 10.89 1376 NDFIP2 7.39 9.99 1377 STMN1 11.76 9.03 1378 PITPNC1 8.77 11.42 11.42 10.00 1379 SH3RF1 7.37 10.05 10.05 8.10 1380 ASF1B 8.56 11.25 11.25 7.91 11.25 8.27 1381 FLJ20186 12.06 14.82 14.82 12.05 1382 SLC16A2 8.08 5.17 1383 PEX5 9.12 11.90 11.90 9.50 1384 ECT2 7.45 10.23 10.23 7.70 10.23 7.63 1385 MAML3 8.05 10.85 1386 TEAD1 4.42 7.24 1387 HMGB2 12.96 15.78 15.78 12.73 15.78 13.36 1388 NCALD 5.15 7.97 1389 RGC32 7.75 10.62 1390 PPP1R3C 4.18 7.06 1391 DEPDC1B 9.96 7.11 1392 WEE1 10.11 13.01 13.01 10.32 13.01 11.84 1393 FHL2 4.82 7.77 1394 ITGB8 4.70 7.66 1395 SLC1A1 10.86 8.88 1396 FAM83D 7.36 10.32 1397 UHRF1 12.22 8.72 1398 C7orf41 4.94 7.95 7.95 6.29 1399 ZBTB8 5.58 8.59 8.59 11.07 1400 ZNF367 7.97 10.99 10.99 8.04 10.99 8.22 1401 CDC25A 6.03 9.09 9.09 6.81 1402 CHEK1 7.59 10.68 10.68 7.72 1403 CDCA7 10.61 13.76 13.76 10.16 13.76 11.06 1404 FGF13 4.55 7.69 1405 SSBP3 6.20 9.35 1406 EZH2 9.40 12.57 12.57 10.22 1407 TNFSF11 5.18 8.36 8.36 5.91 8.36 9.78 1408 PACSIN1 5.16 8.35 1409 RRM2 10.59 13.82 13.82 9.47 13.82 10.79 1410 POU4F1 5.62 8.85 1411 MYBL2 9.07 12.41 12.41 9.12 1412 KIAA1212 8.46 11.81 11.81 8.55 1413 CCNE2 7.30 10.66 10.66 8.02 10.66 8.03 1414 IGF2BP3 7.92 11.34 11.34 9.93 11.34 9.55 1415 PRKAR2B 6.17 9.66 9.66 8.16 1416 CADPS 5.04 8.58 8.58 6.18 1417 ANKRD15 6.97 10.52 10.52 7.58 1418 DAAM1 9.33 12.92 1419 MAP1B 4.05 7.68 7.68 5.03 7.68 6.23 1420 AFF2 6.32 10.00 1421 E2F7 5.66 9.37 9.37 6.53 9.37 6.89 1422 PRC1 8.37 12.08 1423 ENPP5 3.54 7.26 7.26 4.97 1424 E2F8 7.68 11.41 1425 MED12L 7.82 11.59 11.59 7.46 11.59 10.57 1426 LOC162073 6.30 10.08 1427 LRRC32 4.14 7.93 7.93 6.61 7.93 4.95 1428 DMXL2 6.57 10.38 10.38 6.61 10.38 7.76 1429 FLJ20366 7.86 11.68 11.68 7.62 11.68 9.86 1430 TOX 9.05 12.88 12.88 11.27 1431 MME 11.56 10.33 1432 FGD6 7.63 11.73 11.73 9.12 1433 MYBL1 9.68 14.13 14.13 10.02 14.13 9.72 *Empty cells indicate values not appreciably measured.

TABLE 16 Predictor microRNAs that distinguish activated B-cell (ABC) DLBCL from germinal center B-cell (GCB) DLBC Higher ABC vs GCB in hsa-miR-93/mmu-miR-93/rno-miR-93 GCB hsa-miR-331-3p/mmu-miR-331-3p/rno-miR-331 GCB hsa-miR-129* GCB hsa-miR-423-3p/mmu-miR-423-3p/rno-miR-423 GCB hsa-miR-28-5p/mmu-miR-28/rno-miR-28 GCB mghv-miR-M1-7-3p GCB hsa-miR-518b GCB ebv-miR-BHRF1-1 GCB hsa-miR-140-5p/mmu-miR-140/rno-miR-140 GCB hsa-miR-505* GCB hsa-miR-675 GCB hsa-miR-198 GCB hsa-miR-125b-1*/mmu-miR-125b-3p/mo-miR- GCB 125b-3p hsa-miR-361-5p/mmu-miR-361/rno-miR-361 GCB ebv-miR-BART8* GCB

TABLE 17 Predictor microRNAs that distinguish activated B-cell (ABC) DLBCL from Burkitt lymphoma Higher ABC vs BL in hsa-miR-155 ABC hsa-miR-29c/mmu-miR- ABC 29c/rno-miR-29c hsa-miR-146b-5p/mmu-miR- ABC 146b/rno-miR-146b hsa-miR-29b/mmu-miR- ABC 29b/rno-miR-29b hsa-miR-22/mmu-miR- ABC 22/rno-miR-22 hsa-miR-21/mmu-miR- ABC 21/rno-miR-21 hsa-miR-768-3p ABC hsa-miR-145/mmu-miR- ABC 145/rno-miR-145 hsa-miR-29a/mmu-miR- ABC 29a/rno-miR-29a hsa-miR-30e/mmu-miR- ABC 30e/rno-miR-30e hsa-miR-26a/mmu-miR- ABC 26a/rno-miR-26a hsa-miR-101/mmu-miR- ABC 101a/rno-miR-101a hsa-miR-24/mmu-miR- ABC 24/rno-miR-24 hsa-miR-26b/mmu-miR- ABC 26b/rno-miR-26b hsa-miR-27a/mmu-miR- ABC 27a/rno-miR-27a hsa-miR-27b/mmu-miR- ABC 27b/rno-miR-27b hsa-miR-23b/mmu-miR- ABC 23b/rno-miR-23b hsa-miR-23a/mmu-miR- ABC 23a/rno-miR-23a hsa-miR-125b/mmu-miR- ABC 125b-5p/rno-miR-125b-5p hsa-miR-30a/mmu-miR- ABC 30a/rno-miR-30a hsa-miR-142-3p/mmu-miR- ABC 142-3p/rno-miR-142-3p hsa-let-7a/mmu-let-7a/rno-let- ABC 7a hsa-miR-30b/mmu-miR- ABC 30b/rno-miR-30b-5p hsa-miR-142-5p/mmu-miR- ABC 142-5p/rno-miR-142-5p hsa-miR-34b/mmu-miR-34b-3p ABC hsa-miR-16/mmu-miR-16/rno- ABC miR-16 hsa-miR-30c/mmu-miR- ABC 30c/rno-miR-30c hsa-let-7c/mmu-let-7c/rno-let- ABC 7c hsa-miR-550 ABC hsa-miR-921 BL hsa-miR-30c-2*/mmu-miR- BL 30c-2*/rno-miR-30c-2* hsa-miR-933 BL hsa-miR-658 BL hsa-miR-628-3p BL hsa-miR-503 BL hsa-miR-193a-5p BL hsa-miR-30b* BL hsa-miR-93/mmu-miR-93/rno- BL miR-93 hsa-miR-18b BL hsa-miR-18a/mmu-miR- BL 18a/rno-miR-18a hsa-miR-874/mmu-miR- BL 874/rno-miR-874

TABLE 18 Predictor microRNAs that distinguish activated B-cell (ABC) DLBCL from chronic lymphocytic leukemia Higher ABC vs CLL in hsa-miR-125b/mmu-miR- ABC 125b-5p/rno-miR-125b-5p hsa-miR-126/mmu-miR- ABC 126-3p/rno-miR-126 hsa-miR-199a-3p/hsa- ABC miR-199b-3p/mmu-miR- 199a-3p/mmu-miR- 199b/rno-miR-199a-3p hsa-miR-145/mmu-miR- ABC 145/rno-miR-145 hsa-miR-143/mmu-miR- ABC 143/rno-miR-143 hsa-miR-637 ABC hsa-miR-371-5p ABC kshv-miR-K12-6-3p ABC hsa-miR-628-3p ABC hsa-miR-126*/mmu-miR- ABC 126-5p/rno-miR-126* hsa-miR-193a-5p ABC hsa-miR-21/mmu-miR- ABC 21/rno-miR-21 hsa-miR-24/mmu-miR- ABC 24/rno-miR-24 hsa-miR-503 ABC hsa-miR-23a/mmu-miR- ABC 23a/rno-miR-23a hsa-miR-23b/mmu-miR- ABC 23b/rno-miR-23b hsa-miR-22/mmu-miR- ABC 22/rno-miR-22 hsa-miR-665 ABC hsa-let-7c/mmu-let-7c/rno- ABC let-7c hsa-miR-658 ABC hsa-let-7a/mmu-let-7a/rno- ABC let-7a mghv-miR-M1-4 ABC hsa-miR-933 ABC hsa-miR-550 CLL hsa-miR-30e/mmu-miR- CLL 30e/rno-miR-30e hsa-miR-142- CLL 5p/mmu-miR-142- 5p/rno-miR-142-5p hsa-miR-101/mmu- CLL miR-101a/rno-miR- 101a hsa-miR-185/mmu- CLL miR-185/rno-miR-185 hsa-miR-888* CLL hsa-miR-199a- CLL 5p/mmu-miR-199a- 5p/rno-miR-199a-5p hsa-miR-668/mmu- CLL miR-668 hsa-miR-549 CLL hsa-miR-801/mmu- CLL miR-801 hsa-miR-649 CLL hsa-miR-625* CLL hsa-miR-140- CLL 3p/mmu-miR- 140*/rno-miR-140* hsa-let-7f/mmu-let- CLL 7f/rno-let-7f hsa-miR-768-5p CLL hsa-miR-24-1*/mmu- CLL miR-24-1*/rno-miR- 24-1* ebv-miR-BART13 CLL hsa-miR-339- CLL 5p/mmu-miR-339- 5p/rno-miR-339-5p hsa-miR-20b/mmu- CLL miR-20b/rno-miR- 20b-5p hsa-miR-335/mmu- CLL miR-335-5p/rno-miR- 335 mghv-miR-M1-8 CLL hsa-miR-30d/mmu- CLL miR-30d/rno-miR-30d hsa-miR-363/mmu- CLL miR-363/rno-miR-363 hsa-miR-361-3p CLL hsa-miR-107/mmu- CLL miR-107/rno-miR-107 hsa-miR-154/mmu- CLL miR-154/rno-miR-154 hsa-miR-638 CLL hsa-miR-340/mmu- CLL miR-340-5p/rno-miR- 340-5p hsa-miR-331- CLL 3p/mmu-miR-331- 3p/rno-miR-331 hsa-miR-151- CLL 5p/mmu-miR-151- 5p/rno-miR-151 hsa-miR-636 CLL hsa-miR-33a/mmu- CLL miR-33/rno-miR-33 hsa-miR-486- CLL 5p/mmu-miR-486 hsa-miR-150/mmu- CLL miR-150/rno-miR- 150 hsa-miR-25/mmu- CLL miR-25/rno-miR-25 hsa-miR-331- CLL 5p/mmu-miR-331-5p hsa-miR-299- CLL 5p/mmu-miR- 299*/rno-miR-299 hsa-miR-891a CLL hsa-miR-144* CLL hsa-miR-363*/rno- CLL miR-363* hsa-miR-93/mmu- CLL miR-93/rno-miR-93 hsa-miR-423- CLL 3p/mmu-miR-423- 3p/rno-miR-423 hsa-let-7g/mmu-let- CLL 7g hsa-miR-28-5p/mmu- CLL miR-28/rno-miR-28 hsa-miR-20b* CLL hsa-miR-140- CLL 5p/mmu-miR- 140/rno-miR-140 hsa-miR-519d CLL hsa-miR-147 CLL hsa-miR-487b/mmu- CLL miR-487b/rno-miR- 487b hsa-miR-361- CLL 5p/mmu-miR- 361/rno-miR-361 hsa-miR-186/mmu- CLL miR-186/rno-miR- 186 hsa-miR-32/mmu- CLL miR-32/rno-miR-32 hsa-miR-129* CLL hsa-miR-30e*/mmu- CLL miR-30e*/rno-miR- 30e* hsa-miR-196a*/mmu- CLL miR-196a*/rno-miR- 196a*

TABLE 19 Predictor microRNAs that distinguish activated B-cell (ABC) DLBCL from follicular lymphoma Higher ABC vs FL in hsa-miR-938 ABC hsa-miR-183*/mmu-miR- ABC 183* hsa-miR-197/mmu-miR- ABC 197 hsa-miR-382/mmu-miR- ABC 382/rno-miR-382 hsa-miR-20b* ABC hsa-miR-524-5p ABC hsa-miR-337-3p ABC hsa-miR-600 ABC hsa-miR-96/mmu-miR- ABC 96/rno-miR-96 mghv-miR-M1-8 ABC hsa-miR-29c*/mmu-miR- ABC 29c*/rno-miR-29c* hsa-miR-575 ABC hsa-miR-518a-3p ABC hsa-miR-361-5p/mmu-miR- ABC 361/rno-miR-361 hsa-miR-193b* ABC hsa-miR-340*/mmu-miR- ABC 340-3p/rno-miR-340-3p hsa-miR-708/mmu-miR- ABC 708/rno-miR-708 hsa-miR-129* ABC hsa-miR-525-5p ABC hsa-miR-497/mmu-miR- FL 497/rno-miR-497 hsa-miR-22*/mmu-miR- FL 22*/rno-miR-22* hsa-miR-130b/mmu-miR- FL 130b/rno-miR-130b hsa-miR-551b* FL hsa-miR-331-3p/mmu-miR- FL 331-3p/rno-miR-331 ebv-miR-BART13 FL hsa-miR-877/mmu-miR- FL 877/rno-miR-877 hsa-miR-636 FL hsa-miR-922 FL hsa-miR-198 FL hsa-miR-342-5p/mmu-miR- FL 342-5p/rno-miR-342-5p hsa-miR-585 FL ebv-miR-BART8* FL hsa-miR-617 FL hsa-miR-221* FL hsa-miR-125b-1*/mmu- FL miR-125b-3p/rno-miR- 125b-3p hsa-miR-93/mmu-miR- FL 93/rno-miR-93 hsa-miR-363*/rno-miR- FL 363* hsa-miR-744/mmu-miR- FL 744 hsa-miR-659 FL hsa-miR-490-3p/mmu-miR- FL 490 hsa-let-7d/mmu-let-7d/rno- FL let-7d hsa-miR-361-3p FL ebv-miR-BHRF1-1 FL hsa-miR-92b/mmu-miR- FL 92b/rno-miR-92b hsa-miR-151-5p/mmu-miR- FL 151-5p/rno-miR-151 hsa-miR-144* FL hsa-miR-425/mmu-miR- FL 425/rno-miR-425 hsa-miR-138/mmu-miR- FL 138/rno-miR-138 hsa-miR-92a/mmu-miR- FL 92a/rno-miR-92a hsa-miR-151-3p FL hsa-miR-25/mmu-miR- FL 25/rno-miR-25 hsa-miR-509-3-5p FL hsa-miR-30e*/mmu-miR- FL 30e*/rno-rniR-30e* hsa-miR-28-5p/mmu-miR- FL 28/rno-miR-28 hsa-miR-200b*/mmu-miR- FL 200b* hsa-miR-148b/mmu-miR- FL 148b/rno-miR-148b-3p hsa-miR-488 FL hsa-miR-99b/mmu-miR- FL 99b/rno-miR-99b hsa-miR-339-5p/mmu-miR- FL 339-5p/rno-miR-339-5p hsv1-miR-H1 FL hsa-miR-32/mmu-miR- FL 32/rno-miR-32 hsa-miR-885-5p FL hsa-miR-630 FL ebv-miR-BART16 FL hsa-miR-505* FL hsa-miR-374b* FL hsa-miR-574-3p/mmu-miR- FL 574-3p hsa-miR-874/mmu-miR- FL 874/rno-miR-874 hsa-miR-423-3p/mmu-miR- FL 423-3p/rno-miR-423 hsa-miR-889 FL hcmv-miR-UL148D FL hsa-miR-487b/mmu-miR- FL 487b/rno-miR-487b hsa-miR-552 FL hsa-miR-220b FL hsa-miR-551a FL hsa-let-7d*/mmu-let- FL 7d*/rno-let-7d* kshv-miR-K12-5 FL hsa-miR-629* FL hsa-miR-99b*/mmu-miR- FL 99b*/rno-miR-99b* hsa-miR-615-3p/mmu-miR- FL 615-3p hsa-miR-657 FL hsa-miR-301a/mmu-miR- FL 301a/rno-miR-301a hsa-miR-518b FL hsa-miR-194/mmu- FL miR-194/rno-miR- 194 hsa-miR-647 FL kshv-miR-K12-6-5p FL hsa-miR-622 FL hsa-miR-516b FL hsa-miR-675 FL hsa-miR-526b FL hsa-miR-671- FL 5p/mmu-miR-671-5p hsa-miR-18a/mmu- FL miR-18a/rno-miR- 18a hsa-miR-18b FL hsa-miR-181b/mmu- FL miR-181b/rno-miR- 181b hsa-miR-215 FL hsa-miR-153/mmu- FL miR-153/rno-miR- 153 hsa-miR-625 FL hsa-miR-510 FL hsa-miR-519d FL mghv-miR-M1-7-3p FL hsa-miR-485- FL 3p/mmu-miR-485* hsa-miR-483-5p FL hsa-miR-140- FL 5p/mmu-miR- 140/rno-miR-140 hsa-miR-921 FL hsa-miR-186/mmu- FL miR-186/rno-miR- 186 hsa-miR-196a*/mmu- FL miR-196a*/rno-miR- 196a* hsa-miR-381/mmu- FL miR-381/rno-miR- 381 hsa-miR-620 FL hsa-miR-152/mmu- FL miR-152/rno-miR- 152 hsa-miR-766 FL mghv-miR-M1-7-5p FL hsa-miR-374b/mmu- FL miR-374/rno-miR- 374 hsa-let-7c/mmu-let- FL 7c/rno-let-7c kshv-miR-K12-8 FL mghv-miR-M1-3 FL hsa-miR-920 FL hsa-miR-519e* FL hsa-miR-147 FL hsa-miR-424 FL hsa-miR-193b FL ebv-miR-BART19-3p FL hsa-miR-146b-3p FL hsa-miR-30c/mmu- FL miR-30c/rno-miR- 30c hsa-miR-30a/mmu- FL miR-30a/rno-miR- 30a hsa-miR-939 FL hsa-let-7a/mmu-let- FL 7a/rno-let-7a hsa-miR-122* FL hsa-miR-206/mmu- FL miR-206/rno-miR- 206 ebv-miR-BART18-3p FL hsa-miR-183/mmu- FL miR-183/rno-miR- 183 hsa-miR-9*/mmu- FL miR-9*/rno-miR-9* kshv-miR-K12-1 FL hsa-miR-34c- FL 5p/mmu-miR- 34c/rno-miR-34c hsa-miR-934 FL hsa-miR-890 FL hsa-miR-514 FL hsa-miR-297/mmu- FL miR-297a hsa-miR-553 FL hsa-miR-765 FL hsa-let-7b*/mmu-let- FL 7b*/rno-let-7b* hsa-miR-500* FL hsa-miR-601 FL ebv-miR-BHRF1-3 FL hsa-miR-296- FL 3p/mmu-miR-296- 3p/rno-miR-296 hsa-miR-574- FL 5p/mmu-miR-574-5p hsa-miR-409- FL 5p/mmu-miR-409- 5p/rno-miR-409-5p hsa-miR-195* FL hsa-miR-635 FL hsa-miR-542- FL 3p/mmu-miR-542- 3p/rno-miR-542-3p hcmv-miR-US25-1* FL mghv-miR-M1-2 FL hsa-miR-509-5p FL hsa-miR-340/mmu- FL miR-340-5p/rno- miR-340-5p hsa-miR-891a FL hsa-miR-23a/mmu- FL miR-23a/rno-miR- 23a hsa-miR-19b/mmu- FL miR-19b/rno-miR- 19b hsa-miR-515-5p FL hsa-miR-23b/mmu- FL miR-23b/rno-miR- 23b hsa-miR-498 FL hsa-miR-886-5p FL hsa-miR-220c FL hsa-miR-10a/mmu- FL miR-10a/rno-miR- 10a-5p hsa-miR-32* FL hsa-miR-24/mmu- FL miR-24/rno-miR-24 hsa-miR-98/mmu- FL miR-98/rno-miR-98 hsa-let-7g/mmu-let-7g FL hsa-miR-302a/mmu- FL miR-302a hsa-miR-625* FL hsa-miR-30b* FL hsa-miR-30b/mmu- FL miR-30b/rno-miR- 30b-5p hsa-miR-377* FL hsa-miR-106b*/mmu- FL miR-106b*/rno-miR- 106b* hsa-miR-181a-2* FL hsa-miR-887 FL hsa-miR-208a/mmu- FL miR-208a/rno-miR- 208 ebv-miR-BART7* FL hsa-miR-7-2* FL hsa-miR-155* FL hsa-miR-513a-3p FL kshv-miR-K12-7 FL hsa-miR-299-3p FL hsa-miR-218-2*/mmu- FL miR-218-2*/rno-miR- 218* hsa-miR-130b*/mmu- FL miR-130b* hsa-miR-620 FL hsa-miR-33a/mmu- FL miR-33/rno-miR-33 hsa-miR-7/mmu-miR- FL 7a/rno-miR-7a ebv-miR-BART6-3p FL hsa-miR-22/mmu- FL miR-22/rno-miR-22 hsa-miR-199b-5p FL hsa-miR-768-3p FL hsa-miR-494/mmu- FL miR-494/rno-miR-494 hsa-miR-602 FL hsa-miR-125b-2*/rno- FL miR-125b* hsa-miR-300 FL hsa-let-7e/mmu-let- FL 7e/rno-let-7e hsa-miR-298 FL hsa-miR-576-3p FL hsa-miR-187* FL hsa-miR-365/mmu- FL miR-365/rno-miR-365 hsa-miR-518a-5p/hsa- FL miR-527 hsa-miR-302d* FL hsa-miR-105 FL hsa-miR-126/mmu- FL miR-126-3p/rno-miR- 126 hsa-miR-107/mmu- FL miR-107/rno-miR-107 hsa-miR-299-5p/mmu- FL miR-299*/rno-miR- 299 hsa-miR-28-3p/rno- FL miR-28* hsa-miR-21/mmu- FL miR-21/rno-miR-21 hsa-miR-27b/mmu- FL miR-27b/rno-miR-27b hsa-miR-516a-5p FL hsa-miR-129-5p/mmu- FL miR-129-5p/rno-miR- 129 hsa-miR-583 FL hsa-miR-483-3p FL hsa-miR-326/mmu- FL miR-326/rno-miR-326 hsa-miR-548d-5p FL hsa-miR-629 FL ebv-miR-BART5 FL hsa-miR-665 FL hsa-miR-493 FL hsa-miR-484/mmu- FL miR-484/rno-miR-484 hsa-miR-645 FL hsa-miR-452 FL hsa-miR-518c* FL hsa-miR-24-2*/mmu- FL miR-24-2*/rno-miR- 24-2* hsa-miR-124/mmu- FL miR-124/rno-miR-124 hsa-miR-184/mmu- FL miR-184/rno-miR-184 hsa-miR-27a*/mmu- FL miR-27a*/rno-miR- 27a* hsa-miR-25* FL hsa-miR-34b/mmu- FL miR-34b-3p ebv-miR-BART17-5p FL hsa-miR-658 FL hsa-miR-212/mmu- FL miR-212/rno-miR-212 hsa-miR-99a/mmu- FL miR-99a/rno-miR-99a hsa-miR-801/mmu- FL miR-801 hsa-miR-491-3p FL hsa-miR-551b/mmu- FL miR-551b/rno-miR- 551b hsa-miR-214/mmu- FL miR-214/rno-miR-214 hsa-miR-30e/mmu- FL miR-30e/rno-miR-30e hsa-miR-888* FL hsa-miR-505/rno-miR- FL 505 hsa-miR-27a/mmu- FL miR-27a/rno-miR-27a hsa-miR-15a/mmu- FL miR-15a hsa-miR-20a/mmu- FL miR-20a/rno-miR-20a kshv-miR-K12-3 FL hsa-miR-455-3p FL hsa-miR-486-5p/mmu- FL miR-486

TABLE 20 Predictor microRNAs that distinguish activated B-cell (ABC) DLBCL from Hodgkin's lymphoma Higher ABC vs HL in hsa-miR-19b/mmu-miR- ABC 19b/rno-miR-19b hsa-miR-30b/mmu-miR- ABC 30b/rno-miR-30b-5p hsa-miR-142-3p/mmu- ABC miR-142-3p/rno-miR-142- 3p hsa-miR-768-3p ABC hsa-miR-30c/mmu-miR- ABC 30c/rno-miR-30c hsa-miR-29b/mmu-miR- ABC 29b/rno-miR-29b hsa-miR-24/mmu-miR- ABC 24/rno-miR-24 hsa-miR-22/mmu-miR- ABC 22/rno-miR-22 hsa-miR-30e/mmu-miR- ABC 30e/rno-miR-30e hsa-miR-30a/mmu-miR- ABC 30a/rno-miR-30a hsa-miR-26b/mmu-miR- ABC 26b/rno-miR-26b hsa-miR-26a/mmu-miR- ABC 26a/rno-miR-26a hsa-miR-15a/mmu-miR- ABC 15a hsa-miR-16/mmu-miR- ABC 16/rno-miR-16 hsa-miR-142-5p/mmu- ABC miR-142-5p/rno-miR-142- 5p hsa-miR-29a/mmu-miR- ABC 29a/rno-miR-29a hsa-miR-101/mmu-miR- ABC 101a/rno-miR-101a hsa-miR-126/mmu-miR- ABC 126-3p/rno-miR-126 hsa-miR-451/mmu-miR- ABC 451/rno-miR-451 hsa-let-7a/mmu-let-7a/rno- ABC let-7a hsa-miR-23b/mmu-miR- ABC 23b/rno-miR-23b hsa-miR-21/mmu-miR- ABC 21/rno-miR-21 hsa-miR-29c/mmu-miR- ABC 29c/rno-miR-29c hsa-miR-20a/mmu-miR- ABC 20a/rno-miR-20a hsa-miR-27b/mmu-miR- ABC 27b/rno-miR-27b hsa-miR-23a/mmu-miR- ABC 23a/rno-miR-23a hsa-miR-27a/mmu-miR- ABC 27a/rno-miR-27a hsa-miR-550 ABC hsa-let-7c/mmu-let-7c/rno- ABC let-7c hsa-miR-34b/mmu-miR- ABC 34b-3p hsa-miR-933 HL hsa-miR-30c-2*/mmu- HL miR-30c-2*/rno-miR-30c- 2* hsa-miR-503 HL hsa-miR-765 HL hsa-miR-658 HL hsa-miR-620 HL hsa-miR-921 HL hsa-miR-30b* HL mghv-miR-M1-4 HL hsa-miR-939 HL hsa-miR-494/mmu-miR- HL 494/rno-miR-494 hsa-miR-32* HL hsa-miR-491-3p HL hsa-miR-10a/mmu-miR- HL 10a/rno-miR-10a-5p hsa-miR-33a/mmu-miR- HL 33/rno-miR-33 hsa-miR-99a/mmu-miR- HL 99a/rno-miR-99a hsa-miR-199b-5p HL hsa-miR-365/mmu-miR- HL 365/rno-miR-365 hsa-miR-520d-5p HL hsa-miR-518c* HL hsa-miR-32/mmu-miR- HL 32/rno-miR-32 hsa-miR-214/mmu-miR- HL 214/rno-miR-214 hsa-miR-98/mmu-miR- HL 98/rno-miR-98 hsa-miR-302d* HL hsa-miR-30e*/mmu-miR- HL 30e*/rno-miR-30e* hsa-miR-374b/mmu-miR- HL 374/rno-miR-374 hsa-miR-29a*/mmu-miR- HL 29a*/rno-miR-29a* hsa-miR-532-5p/mmu- HL miR-532-5p/rno-miR-532- 5p hsa-miR-149* HL hsa-miR-422a HL ebv-miR-BHRF1-2 HL hsa-miR-634 HL hsa-miR-143* HL hsa-miR-620 HL hsa-miR-660 HL hsa-miR-140-5p/mmu- HL miR-140/rno-miR-140 hsa-miR-28-5p/mmu-miR- HL 28/rno-miR-28 hsa-miR-519c-5p/hsa- HL miR-519b-5p/hsa-miR- 523*/hsa-miR-518e*/hsa- miR-522*/hsa-miR-519a* hsa-miR-505/rno-miR-505 HL hsa-miR-184/mmu-miR- HL 184/rno-miR-184 hsa-miR-107/mmu-miR- HL 107/rno-miR-107 hsa-miR-298 HL hsa-miR-455-3p HL hsa-miR-638 HL hsa-miR-502-3p HL hsa-miR-149/mmu-miR- HL 149 hsa-miR-583 HL hsa-miR-105 HL hsa-miR-128/mmu-miR- HL 128/rno-miR-128 hsa-miR-656 HL hsa-miR-497/mmu-miR- HL 497/rno-miR-497 hsa-miR-152/mmu-miR- HL 152/rno-miR-152 hsa-miR-151-5p/mmu- HL miR-151-5p/rno-miR-151 hsa-miR-148b/mmu-miR- HL 148b/rno-miR-148b-3p hsa-miR-300 HL hsa-miR-144* HL hsa-miR-145*/mmu-miR- HL 145* hcmv-miR-UL70-3p HL hsa-miR-28-3p/rno-miR- HL 28* hsa-miR-27a*/mmu-miR- HL 27a*/rno-miR-27a* hsa-miR-194/mmu-miR- HL 194/rno-miR-194 hsa-miR-130b*/mmu-miR- HL 130b* hsa-miR-548d-5p HL hsa-miR-937 HL hsa-miR-7/mmu-miR- HL 7a/rno-miR-7a hsa-miR-518a-5p/hsa- HL miR-527 hsa-miR-323-3p/mmu- HL miR-323-3p/rno-miR-323 hsa-miR-215 HL hsa-miR-513a-3p HL hsa-miR-595 HL hsa-miR-515-5p HL hsa-miR-483-3p HL hsa-miR-330-5p/mmu- HL miR-330/rno-miR-330 hsa-miR-18b HL hsa-miR-509-3p HL hsa-miR-151-3p HL hsa-miR-934 HL hsa-miR-328/mmu-miR- HL 328/rno-miR-328 hsa-miR-187* HL kshv-miR-K12-3 HL hsa-miR-373* HL hsa-miR-96/mmu-miR- HL 96/rno-miR-96 hsa-miR-186/mmu-miR- HL 186/rno-miR-186 hsa-miR-886-5p HL hsa-miR-424 HL hsa-miR-147 HL hsa-miR-340/mmu-miR- HL 340-5p/rno-miR-340-5p hsa-miR-129-5p/mmu- HL miR-129-5p/rno-miR-129 hsa-miR-25* HL hsa-miR-193b HL hsa-miR-574-5p/mmu- HL miR-574-5p hsa-miR-589 HL hsa-miR-339-5p/mmu- HL miR-339-5p/rno-miR- 339-5p hsa-miR-34c-5p/mmu- HL miR-34c/rno-miR-34c hsa-miR-891a HL hsa-miR-18a/mmu-miR- HL 18a/rno-miR-18a hsa-miR-196a*/mmu- HL miR-196a*/rno-miR- 196a* hsa-miR-17*/rno-miR- HL 17-3p hsa-miR-296-5p/mmu- HL miR-296-5p/rno-miR- 296* hsa-miR-25/mmu-miR- HL 25/rno-miR-25 hsa-miR-509-5p HL hsa-miR-550* HL hsa-miR-708/mmu-miR- HL 708/rno-miR-708 hsa-miR-146b-3p HL hsa-miR-625* HL hsa-miR-210/mmu-miR- HL 210/rno-miR-210 hsa-miR-93/mmu-miR- HL 93/rno-miR-93 hsa-miR-548b-3p HL hsa-miR-652/mmu-miR- HL 652/rno-miR-652 hsa-miR-153/mmu-miR- HL 153/rno-miR-153 mghv-miR-M1-3 HL hsa-miR-194* HL hsa-miR-23a*/rno-miR- HL 23a* hsa-miR-943 HL hsa-let-7d/mmu-let- HL 7d/rno-let-7d hsa-miR-498 HL hsa-miR-381/mmu-miR- HL 381/rno-miR-381 hsa-miR-586 HL hsa-miR-137/mmu-miR- HL 137/rno-miR-137 hsa-miR-610 HL hsa-miR-920 HL hsa-miR-936 HL hsa-miR-744/mmu-miR- HL 744 ebv-miR-BART5 HL hsa-miR-21* HL hsa-miR-516a-5p HL hsa-miR-576-5p HL mghv-miR-M1-6 HL hsa-miR-425/mmu-miR- HL 425/rno-miR-425 hsa-miR-220c HL hsa-miR-10a*/mmu-miR- HL 10a*/rno-miR-10a-3p hsa-miR-452 HL hsa-miR-345 HL hsa-miR-29c*/mmu-miR- HL 29c*/rno-miR-29c* hsa-miR-887 HL hsa-miR-7-2* HL hsa-miR-363*/rno-miR- HL 363* hsa-miR-22*/mmu-miR- HL 22*/rno-miR-22* hsa-miR-922 HL hsa-miR-92b* HL hsa-miR-526a/hsa-miR- HL 520c-5p/hsa-miR-518d- 5p hsa-miR-574-3p/mmu- HL miR-574-3p hsa-miR-92a/mmu-miR- HL 92a/rno-miR-92a hsa-miR-423-3p/mmu- HL miR-423-3p/rno-miR-423 hsa-miR-526b HL hsa-miR-526b* HL ebv-miR-BART6-3p HL hsa-miR-92b/mmu-miR- HL 92b/rno-miR-92b hsa-miR-519e* HL hiv1-miR-H1 HL hsa-miR-623 HL hsa-miR-483-5p HL mghv-miR-M1-2 HL mghv-miR-M1-7-3p HL hsa-miR-519e HL hsa-miR-361-5p/mmu- HL miR-361/rno-miR-361 hsa-miR-650 HL hsa-miR-361-3p HL hsa-miR-374b* HL kshv-miR-K12-8 HL hsa-miR-150*/mmu-miR- HL 150* hsa-miR-425*/mmu-miR- HL 425* hsa-miR-135a*/mmu- HL miR-135a* hsa-miR-612 HL hsa-miR-212/mmu-miR- HL 212/rno-miR-212 hsa-miR-125b-2*/rno- HL miR-125b* hcmv-miR-UL112 HL hsa-miR-500 HL hsa-miR-502-5p HL ebv-miR-BART18-3p HL hsa-miR-625 HL hsa-miR-138/mmu-miR- HL 138/rno-miR-138 hsa-miR-500* HL hsa-miR-124*/mmu-miR- HL 124*/rno-miR-124* hsa-miR-516b HL hsa-miR-30c-1*/mmu- HL miR-30c-1*/rno-miR- 30c-1* hsa-miR-331-5p/mmu- HL miR-331-5p hsa-miR-510 HL hsa-miR-376a* HL hsa-miR-640 HL hsa-miR-331-3p/mmu- HL miR-331-3p/rno-miR-331 hsa-miR-602 HL hsa-miR-485-3p/mmu- HL miR-485* hsa-miR-488 HL hsa-miR-125a- HL 3p/mmu-miR-125a- 3p/rno-miR-125a-3p hsa-miR-24-2*/mmu- HL miR-24-2*/rno-miR- 24-2* hsa-miR-484/mmu- HL miR-484/rno-miR- 484 hsa-miR-106b*/mmu- HL miR-106b*/rno-miR- 106b* hsa-miR-600 HL hsa-let-7b*/mmu-let- HL 7b*/rno-let-7b* hsa-miR-302c* HL hsa-miR-20b* HL hsa-miR-524-5p HL hsa-miR-505* HL hsa-miR-542- HL 5p/mmu-miR-542- 5p/rno-miR-542-5p hsa-miR-557 HL hsa-miR-183/mmu- HL miR-183/rno-miR- 183 hsa-miR-122* HL hsa-miR-675 HL hsv1-miR-H1 HL hsa-miR-99b/mmu- HL miR-99b/rno-miR- 99b hsa-miR-766 HL hsa-miR-409- HL 5p/mmu-miR-409- 5p/rno-miR-409-5p ebv-miR-BART20-3p HL hsa-miR-129* HL mghv-miR-M1-7-5p HL hsa-miR-671- HL 5p/mmu-miR-671-5p hsa-miR-629 HL hsa-miR-553 HL hsa-let-7d*/mmu-let- HL 7d*/rno-let-7d* hsa-miR-601 HL hsa-miR-645 HL hsa-miR-221* HL hsa-miR-874/mmu- HL miR-874/rno-miR- 874 hsa-miR-890 HL hsa-miR-492 HL hsa-miR-629* HL hsa-miR-635 HL hsa-miR-130b/mmu- HL miR-130b/rno-miR- 130b hsa-miR-197/mmu- HL miR-197 hsa-miR-654-5p HL hsa-miR-518b HL hsa-miR-889 HL hsa-miR-584 HL hsa-miR-198 HL hsa-miR-636 HL hsa-miR-630 HL hsa-miR-490-5p HL hsa-miR-663 HL hcmv-miR-UL148D HL hsa-miR-337-3p HL hsa-miR-9*/mmu- HL miR-9*/rno-miR-9* hsa-miR-200b*/mmu- HL miR-200b* ebv-miR-BART9* HL hsa-miR-342- HL 5p/mmu-miR-342- 5p/rno-miR-342-5p hsa-miR-206/mmu- HL miR-206/rno-miR- 206 hcmv-miR-US25-1* HL hsa-miR-659 HL hsa-miR-514 HL kshv-miR-K12-6-5p HL hsa-miR-508-5p HL hsa-miR-377* HL ebv-miR-BART16 HL hsa-miR-181b/mmu- HL miR-181b/rno-miR- 181b hsa-miR-622 HL kshv-miR-K12-1 HL hsa-miR-490- HL 3p/mmu-miR-490 hsa-miR-125b- HL 1*/mmu-miR-125b- 3p/rno-miR-125b-3p hsa-miR-124/mmu- HL miR-124/rno-miR- 124 hsa-miR-657 HL ebv-miR-BHRF1-3 HL kshv-miR-K12-5 HL hsa-miR-487b/mmu- HL miR-487b/rno-miR- 487b hsa-miR-183*/mmu- HL miR-183* hsa-miR-297/mmu- HL miR-297a hsa-miR-885-5p HL hsa-miR-296- HL 3p/mmu-miR-296- 3p/rno-miR-296 ebv-miR-BART19-3p HL hsa-miR-617 HL hsa-miR-519d HL hsa-miR-195* HL hsa-miR-575 HL hsa-miR-208a/mmu- HL miR-208a/rno-miR- 208 hsa-miR-647 HL hsa-miR-525-5p HL ebv-miR-BART8* HL hsa-miR-340*/mmu- HL miR-340-3p/rno-miR- 340-3p hsa-miR-220b HL hsa-miR-382/mmu- HL miR-382/rno-miR- 382 hsa-miR-585 HL hsa-miR-877/mmu- HL miR-877/rno-miR- 877 hsa-miR-99b*/mmu- HL miR-99b*/rno-miR- 99b* ebv-miR-BHRF1-1 HL hsa-miR-326/mmu- HL miR-326/rno-miR- 326 ebv-miR-BART7* HL hsa-miR-615- HL 3p/mmu-miR-615-3p mghv-miR-M1-8 HL hsa-miR-193b* HL ebv-miR-BART13 HL hsa-miR-433/mmu- HL miR-433/rno-miR- 433 hsa-miR-202 HL hsa-miR-551b* HL hsa-miR-551a HL hsa-miR-542- HL 3p/mmu-miR-542- 3p/rno-miR-542-3p hsa-miR-338- HL 5p/mmu-miR-338- 5p/rno-miR-338* hsa-miR-299-3p HL hsa-miR-518a-3p HL hsa-miR-181a-2* HL hsa-miR-938 HL hsa-miR-509-3-5p HL hsa-miR-552 HL

TABLE 21 Predictor microRNAs that distinguish germinal center B-cell like (GCB) DLBCL from Burkitt lymphoma GCBvsBL Higher in hsa-miR-129* GCB hsa-miR-28-5p/mmu-miR-28/rno- GCB miR-28 hsa-miR-155 GCB hsa-miR-196a*/mmu-miR-196a*/rno- GCB miR-196a* hsa-miR-146a/mmu-miR-146a/rno- GCB miR-146a hsa-miR-331-3p/mmu-miR-331- GCB 3p/rno-miR-331 hsa-miR-215 GCB hsa-miR-600 GCB mghv-miR-M1-7-3p GCB hsa-miR-107/mmu-miR-107/rno- GCB miR-107 hsa-miR-886-3p GCB hsa-miR-140-5p/mmu-miR-140/rno- GCB miR-140 hsa-miR-154/mmu-miR-154/rno- GCB miR-154 hsa-miR-103/mmu-miR-103/rno- GCB miR-103 hsa-let-7g/mmu-let-7g GCB hsa-miR-222/mmu-miR-222/rno- GCB miR-222 hsa-miR-221/mmu-miR-221/rno- GCB miR-221 hsa-miR-320/mmu-miR-320/rno- GCB miR-320 hsa-miR-140-3p/mmu-miR-140*/rno- GCB miR-140* hsa-miR-148a/mmu-miR-148a GCB hsa-miR-365/mmu-miR-365/rno-miR- GCB 365 hsa-miR-29c/mmu-miR-29c/rno-miR- GCB 29c hsa-miR-30d/mmu-miR-30d/rno-miR- GCB 30d hsa-miR-214/mmu-miR-214/rno-miR- GCB 214 hsa-miR-146b-5p/mmu-miR-146b/rno- GCB miR-146b hsa-miR-342-3p/mmu-miR-342-3p/rno- GCB miR-342-3p hsa-miR-374a GCB hsa-miR-223/mmu-miR-223/rno-miR- GCB 223 hsa-miR-29b/mmu-miR-29b/rno-miR- GCB 29b hsa-miR-21/mmu-miR-21/rno-miR-21 GCB hsa-miR-29a/mmu-miR-29a/rno-miR- GCB 29a hsa-miR-23b/mmu-miR-23b/rno-miR- GCB 23b hsa-miR-24/mmu-miR-24/rno-miR-24 GCB hsa-miR-26a/mmu-miR-26a/rno-miR- GCB 26a hsa-miR-26b/mmu-miR-26b/rno-miR- GCB 26b hsa-miR-34b/mmu-miR-34b-3p GCB hsa-miR-503 BL hsa-miR-30b* BL

TABLE 22 Predictor microRNAs that distinguish germinal center B-cell like (GCB) DLBCL from chronic lymphocytic leukemia Higher GCB vs CLL in hsa-miR-181a/mmu- GCB miR-181a/rno-miR- 181a hsa-miR-886-5p GCB mghv-miR-M1-7-3p GCB hsa-miR-934 GCB mghv-miR-M1-3 GCB hsa-miR-485- GCB 3p/mmu-miR-485* hsa-miR-125b/mmu- GCB miR-125b-5p/rno- miR-125b-5p hsa-miR-637 GCB hsa-miR-365/mmu- GCB miR-365/rno-miR- 365 hsa-miR-505* GCB hsa-miR-199a- GCB 3p/hsa-miR-199b- 3p/mmu-miR-199a- 3p/mmu-miR- 199b/rno-miR-199a- 3p hsa-miR-675 GCB hsa-miR-424 GCB ebv-miR-BHRF1-2 GCB hsa-miR-519c- GCB 5p/hsa-miR-519b- 5p/hsa-miR- 523*/hsa-miR- 518e*/hsa-miR- 522*/hsa-miR- 519a* hsa-miR-130a/mmu- GCB miR-130a/rno-miR- 130a hsa-miR-943 GCB hsa-miR-126/mmu- GCB miR-126-3p/rno- miR-126 hsa-miR-193b GCB hsa-miR-198 GCB hsa-miR- GCB 200b*/mmu-miR- 200b* kshv-miR-K12-6-3p GCB hsa-miR-220c GCB hsa-miR-374b* GCB hsa-miR-518b GCB hsa-miR-920 GCB hsa-miR-125b- GCB 1*/mmu-miR-125b- 3p/rno-miR-125b-3p ebv-miR-BART8* GCB ebv-miR-BART16 GCB hsa-miR-630 GCB hsa-miR-483-5p GCB hsa-miR-422a GCB hsa-miR-526b GCB hsa-miR-145/mmu- GCB miR-145/rno-miR- 145 hsa-miR-126*/mmu- GCB miR-126-5p/rno- miR-126* hsa-miR-143/mmu- GCB miR-143/rno-miR- 143 hsa-miR-100/mmu- GCB miR-100/rno-miR-100 hsa-miR-371-5p GCB hsa-miR-193a-5p GCB hsa-miR-628-3p GCB hsa-miR-185* GCB hsa-miR-10b/mmu- GCB miR-10b/rno-miR-10b hsa-miR-665 GCB hsa-miR-503 GCB hsa-miR-642 GCB hsa-miR-658 GCB hsa-miR-21/mmu- GCB miR-21/rno-miR-21 hsa-miR-23a/mmu- GCB miR-23a/rno-miR-23a hsa-miR-125a- GCB 5p/mmu-miR-125a- 5p/rno-miR-125a-5p hsa-miR-24/mmu- GCB miR-24/rno-miR-24 hsa-miR-23b/mmu- GCB miR-23b/rno-miR-23b hsa-miR-620 GCB hsa-miR-933 GCB hsa-miR-30b* GCB hsa-miR-22/mmu- GCB miR-22/rno-miR-22 hsa-let-7e/mmu-let- GCB 7e/rno-let-7e mghv-miR-M1-4 GCB hsa-miR-149* GCB hsa-miR-765 GCB hsa-let-7c/mmu-let- GCB 7c/rno-let-7c hsa-miR-423- CLL 5p/mmu-miR-423-5p hsa-miR-32* CLL hsa-miR-34b/mmu- CLL miR-34b-3p hsa-miR-551b/mmu- CLL miR-551b/rno-miR- 551b hsa-let-7i/mmu-let- CLL 7i/rno-let-7i hsa-miR-29a/mmu- CLL miR-29a/rno-miR-29a hsa-miR-138- CLL 1*/mmu-miR- 138*/rno-miR-138* hsa-miR-29b/mmu- CLL miR-29b/rno-miR-29b hsa-miR-191/mmu- CLL miR-191/rno-miR-191 hsa-miR-26b/mmu- CLL miR-26b/rno-miR-26b hsa-miR-26a/mmu- CLL miR-26a/rno-miR-26a hsa-miR-550 CLL hsa-miR-374a CLL hsa-miR-142-5p/mmu- CLL miR-142-5p/rno-miR- 142-5p hsa-miR-29c/mmu- CLL miR-29c/rno-miR-29c hsa-miR-140-3p/mmu- CLL miR-140*/rno-miR- 140* hsa-miR-30e/mmu- CLL miR-30e/rno-miR-30e hsa-miR-801/mmu- CLL miR-801 hsa-miR-768-3p CLL hsa-miR-549 CLL hsa-miR-199a-5p/mmu- CLL miR-199a-5p/rno-miR- 199a-5p hsa-miR-223/mmu- CLL miR-223/rno-miR-223 hsa-miR-101/mmu- CLL miR-101a/rno-miR- 101a hsa-miR-888* CLL hsa-miR-24-1*/mmu- CLL miR-24-1*/rno-miR-24- 1* hsa-miR-519d CLL hsa-miR-154/mmu- CLL miR-154/rno-miR-154 hsa-miR-638 CLL hsa-miR-668/mmu- CLL miR-668 hsa-miR-891a CLL hsa-miR-768-5p CLL hsa-miR-140-5p/mmu- CLL miR-140/rno-miR-140 hsa-miR-196a*/mmu- CLL miR-196a*/rno-miR- 196a* hsa-miR-150/mmu- CLL miR-150/rno-miR-150 hsa-let-7g/mmu-let-7g CLL hsa-miR-363/mmu- CLL miR-363/rno-miR-363 hsa-miR-486-5p/mmu- CLL miR-486 hsa-miR-32/mmu-miR- CLL 32/rno-miR-32 hsa-miR-147 CLL hsa-miR-20b* CLL hsa-miR-487b/mmu- CLL miR-487b/rno-miR- 487b hsa-miR-636 CLL hsa-miR-144* CLL hsa-miR-186/mmu- CLL miR-186/rno-miR-186 hsa-miR-30e*/mmu- CLL miR-30e*/rno-miR- 30e* hsa-miR-331-5p/mmu- CLL miR-331-5p

TABLE 23 Predictor microRNAs that distinguish germinal center B-cell like (GCB) DLBCL from follicular lymphoma Higher GCB vs FL in hsa-miR-378/mmu- GCB miR-378/rno-miR-378 hsa-miR-20b/mmu- GCB miR-20b/rno-miR-20b- 5p hsa-miR-19b/mmu- GCB miR-19b/rno-miR-19b hsa-miR-106a GCB hsa-miR-17/mmu-miR- GCB 17/rno-miR-17-5p/rno- miR-17 hsa-miR-93/mmu-miR- GCB 93/rno-miR-93 hsa-miR-20a/mmu- GCB miR-20a/rno-miR-20a hsa-miR-23b/mmu- GCB miR-23b/rno-miR-23b hsa-miR-23a/mmu- GCB miR-23a/rno-miR-23a hsa-miR-22/mmu-miR- GCB 22/rno-miR-22 hsa-miR-19a/mmu- GCB miR-19a/rno-miR-19a hsa-miR-320/mmu- GCB miR-320/rno-miR-320 hsa-miR-106b/mmu- GCB miR-106b/rno-miR- 106b hsa-miR-103/mmu- GCB miR-103/rno-miR-103 hsa-miR-30c/mmu- GCB miR-30c/rno-miR-30c ebv-miR-BHRF1-2 GCB hsa-miR-125a- GCB 5p/mmu-miR-125a- 5p/rno-miR-125a-5p hsa-let-7a/mmu-let- GCB 7a/rno-let-7a hsa-miR-628-3p GCB hsa-let-7c/mmu-let- GCB 7c/rno-let-7c hsa-miR-423-5p/mmu- FL miR-423-5p hsa-miR-24-1*/mmu- FL miR-24-1*/rno-miR- 24-1* ebv-miR-BART2-3p FL hsa-miR-138-1*/mmu- FL miR-138*/rno-miR- 138* hsa-miR-768-5p FL hsa-miR-30b* FL hsa-miR-494/mmu- FL miR-494/rno-miR-494 hsa-miR-583 FL hsa-miR-185/mmu- FL miR-185/rno-miR-185 hsa-miR-765 FL hsa-miR-34b/mmu- FL miR-34b-3p hsa-miR-921 FL hsa-miR-551b/mmu- FL miR-551b/rno-miR- 551b hsa-miR-549 FL hsa-miR-939 FL hsa-miR-302d* FL ebv-miR-BART17-5p FL hsa-miR-801/mmu- FL miR-801 hsa-miR-888* FL hsa-miR-620 FL hsa-miR-576-3p FL hsa-miR-32* FL hsa-miR-574-5p/mmu- FL miR-574-5p hsa-miR-505/rno-miR- FL 505 hsa-miR-885-5p FL hsa-miR-455-3p FL hsa-miR-152/mmu- FL miR-152/rno-miR-152 hsa-miR-200b*/mmu- FL miR-200b* mghv-miR-M1-2 FL hcmv-miR-UL148D FL hsa-miR-497/mmu-miR- FL 497/rno-miR-497 ebv-miR-BART13 FL ebv-miR-BART16 FL hsa-miR-125b-2*/rno- FL miR-125b* hsa-miR-490-3p/mmu- FL miR-490 hsa-miR-99b/mmu-miR- FL 99b/rno-miR-99b hsa-miR-339-5p/mmu- FL miR-339-5p/rno-miR- 339-5p hsa-miR-574-3p/mmu- FL miR-574-3p hsa-miR-515-5p FL hsa-miR-877/mmu-miR- FL 877/rno-miR-877 hsa-miR-208a/mmu-miR- FL 208a/rno-miR-208 hcmv-miR-US25-1* FL hsa-miR-326/mmu-miR- FL 326/rno-miR-326 hsa-miR-488 FL hsa-miR-629 FL hsa-miR-24-2*/mmu- FL miR-24-2*/rno-miR-24- 2* hsa-miR-124/mmu-miR- FL 124/rno-miR-124 hsa-miR-493 FL hsv1-miR-H1 FL hsa-miR-484/mmu-miR- FL 484/rno-miR-484 hsa-miR-483-3p FL hsa-miR-27a*/mmu-miR- FL 27a*/rno-miR-27a* hsa-miR-144* FL hsa-miR-617 FL hsa-miR-377* FL hsa-miR-363*/rno-miR- FL 363* hsa-miR-148b/mmu-miR- FL 148b/rno-miR-148b-3p kshv-miR-K12-1 FL hsa-miR-7/mmu-miR- FL 7a/rno-miR-7a hsa-miR-193b* FL hsa-miR-542-3p/mmu- FL miR-542-3p/rno-miR- 542-3p hsa-miR-601 FL hsa-miR-106b*/mmu- FL miR-106b*/rno-miR- FL 106b* hsa-miR-7-2* FL kshv-miR-K12-6-5p FL hsa-miR-645 FL hsa-miR-524-5p FL hsa-miR-548d-5p FL hsa-miR-9*/mmu-miR- FL 9*/rno-miR-9* hsa-miR-92a/mmu-miR- FL 92a/rno-miR-92a hsa-miR-22*/mmu-miR- FL 22*/rno-miR-22* hsa-miR-500* FL hsa-miR-890 FL hsa-miR-297/mmu-miR- FL 297a hsa-miR-197/mmu-miR- FL 197 hsa-miR-20b* FL hsa-miR-629* FL hsa-miR-887 FL hsa-miR-425/mmu- FL miR-425/rno-miR-425 hsa-miR-99b*/mmu- FL miR-99b*/rno-miR- 99b* hsa-miR-513a-3p FL hsa-miR-206/mmu- FL miR-206/rno-miR-206 hsa-miR-155* FL hsa-miR-181b/mmu- FL miR-181b/rno-miR- 181b hsa-miR-299-3p FL hsa-miR-218-2*/mmu- FL miR-218-2*/rno-miR- 218* mghv-miR-M1-8 FL ebv-miR-BART18-3p FL hsa-miR-708/mmu- FL miR-708/rno-miR-708 hsa-miR-409-5p/mmu- FL miR-409-5p/rno-miR- 409-5p hsa-miR-553 FL hsa-miR-361-3p FL hsa-miR-296-3p/mmu- FL miR-296-3p/rno-miR- 296 ebv-miR-BHRF1-3 FL hsa-miR-34c-5p/mmu- FL miR-34c/rno-miR-34c hsa-let-7b*/mmu-let- FL 7b*/rno-let-7b* hsa-miR-301a/mmu- FL miR-301a/rno-miR- 301a hsa-miR-122* FL hsa-miR-183/mmu- FL miR-183/rno-miR-183 kshv-miR-K12-5 FL kshv-miR-K12-7 FL hsa-miR-552 FL hsa-miR-151-3p FL hsa-miR-194/mmu- FL miR-194/rno-miR-194 hsa-miR-585 FL hsa-miR-340*/mmu- FL miR-340-3p/rno-miR- 340-3p hsa-let-7d*/mmu-let- FL 7d*/rno-let-7d* hsa-miR-622 FL hsa-miR-575 FL hsa-miR-514 FL hsa-miR-92b/mmu- FL miR-92b/rno-miR-92b hsa-miR-551a FL hsa-miR-221* FL hsa-miR-922 FL hsa-miR-938 FL hsa-miR-615-3p/mmu- FL miR-615-3p hsa-miR-220b FL hsa-miR-744/mmu- FL miR-744 hsa-miR-657 FL hsa-miR-382/mmu- FL miR-382/rno-miR-382 hsa-miR-518a-3p FL hsa-miR-138/mmu- FL miR-138/rno-miR-138 hsa-miR-636 FL hsa-miR-96/mmu- FL miR-96/rno-miR-96 hsa-miR-509-3-5p FL hsa-miR-337-3p FL hsa-miR-342-5p/mmu- FL miR-342-5p/rno-miR- 342-5p

TABLE 24 Predictor microRNAs that distinguish germinal center B-cell like (GCB) DLBCL from Hodgkin's lymphoma Higher GCB vs HL in hsa-miR-19b/mmu-miR- GCB 19b/rno-miR-19b hsa-miR-19a/mmu-miR- GCB 19a/rno-miR-19a hsa-miR-106a GCB hsa-miR-20b/mmu-miR- GCB 20b/rno-miR-20b-5p hsa-miR-17/mmu-miR- GCB 17/rno-miR-17-5p/rno- miR-17 hsa-miR-15b/mmu-miR- GCB 15b/rno-miR-15b hsa-miR-20a/mmu-miR- GCB 20a/rno-miR-20a hsa-miR-30b/mmu-miR- GCB 30b/rno-miR-30b-5p hsa-miR-142-3p/mmu-miR- GCB 142-3p/rno-miR-142-3p hsa-miR-30c/mmu-miR- GCB 30c/rno-miR-30c hsa-miR-378/mmu-miR- GCB 378/rno-miR-378 hsa-miR-93/mmu-miR- GCB 93/rno-miR-93 hsa-miR-106b/mmu-miR- GCB 106b/rno-miR-106b hsa-miR-374a GCB hsa-miR-24/mmu-miR- GCB 24/rno-miR-24 hsa-miR-29b/mmu-miR- GCB 29b/rno-miR-29b hsa-miR-22/mmu-miR- GCB 22/rno-miR-22 hsa-miR-142-5p/mmu-miR- GCB 142-5p/rno-miR-142-5p hsa-miR-30e/mmu-miR- GCB 30e/rno-miR-30e hsa-miR-30a/mmu-miR- GCB 30a/rno-miR-30a hsa-miR-30d/mmu-miR- GCB 30d/rno-miR-30d hsa-miR-23b/mmu-miR- GCB 23b/rno-miR-23b hsa-miR-16/mmu-miR- GCB 16/rno-miR-16 hsa-miR-191/mmu-miR- GCB 191/rno-miR-191 hsa-miR-15a/mmu-miR- GCB 15a hsa-miR-26b/mmu-miR- GCB 26b/rno-miR-26b hsa-miR-23a/mmu-miR- GCB 23a/rno-miR-23a hsa-let-7a/mmu-let-7a/rno- GCB let-7a hsa-miR-103/mmu-miR- GCB 103/rno-miR-103 hsa-miR-140-3p/mmu-miR- GCB 140*/rno-miR-140* hsa-miR-154/mmu-miR- GCB 154/rno-miR-154 hsa-miR-320/mmu-miR- GCB 320/rno-miR-320 hsa-miR-550 GCB hsa-miR-125a-5p/mmu- GCB miR-125a-5p/rno-miR- 125a-5p hsa-let-7c/mmu-let-7c/rno- GCB let-7c hsa-miR-185/mmu-miR- HL 185/rno-miR-185 hsa-miR-658 HL hsa-miR-549 HL hsa-miR-634 HL hsa-miR-551b/mmu-miR- HL 551b/rno-miR-551b hsa-miR-518c* HL hsa-miR-888* HL hsa-miR-765 HL hsa-miR-423-5p/mmu-miR- HL 423-5p hsa-miR-30c-2*/mmu-miR- HL 30c-2*/rno-miR-30c-2* hsa-miR-503 HL hsa-miR-921 HL hsa-miR-520d-5p HL hsa-miR-574-5p/mmu-miR- HL 574-5p hsa-miR-32* HL hsa-miR-939 HL ebv-miR-BART2-3p HL ebv-miR-BHRF1-2 HL hsa-miR-583 HL hsa-miR-30b* HL hsa-miR-149* HL mghv-miR-M1-4 HL hsa-miR-513a-5p HL hsa-miR-494/mmu-miR- HL 494/rno-miR-494 hsa-miR-498 HL hsa-miR-485-3p/mmu-miR- HL 485* hsa-miR-129-5p/mmu-miR- HL 129-5p/rno-miR-129 hsa-miR-25* HL hsa-miR-923 HL hsa-miR-519d HL hsa-miR-516a-5p HL hsa-miR-99a/mmu-miR- HL 99a/rno-miR-99a hsa-miR-943 HL hsa-miR-885-5p HL ebv-miR-BHRF1-1 HL hsa-miR-152/mmu-miR- HL 152/rno-miR-152 ebv-miR-BART8* HL hsa-miR-200b*/mmu-miR- HL 200b* hsa-miR-125b-1*/mmu- HL miR-125b-3p/rno-miR- 125b-3p hsa-miR-526b HL hsa-miR-29a*/mmu-miR- HL 29a*/rno-miR-29a* hsa-miR-532-5p/mmu-miR- HL 532-5p/rno-miR-532-5p hsa-miR-183*/mmu-miR- HL 183* hsa-miR-659 HL hsa-miR-145*/mmu-miR- HL 145* mghv-miR-M1-7-5p HL hsa-miR-143* HL hsa-miR-660 HL hsa-miR-130b/mmu- HL miR-130b/rno-miR-130b hsa-miR-671-5p/mmu- HL miR-671-5p hsa-miR-525-5p HL hsa-miR-505/rno-miR- HL 505 hsa-miR-488 HL hsa-miR-766 HL hsa-miR-20b* HL hsa-miR-339-5p/mmu- HL miR-339-5p/rno-miR- 339-5p hsa-miR-524-5p HL hsa-miR-455-3p HL hsa-miR-92a/mmu-miR- HL 92a/rno-miR-92a hsa-miR-502-3p HL hsa-miR-210/mmu-miR- HL 210/rno-miR-210 hsv1-miR-H1 HL ebv-miR-BART6-3p HL hsa-miR-490-3p/mmu- HL miR-490 hsa-miR-149/mmu-miR- HL 149 hsa-miR-128/mmu-miR- HL 128/rno-miR-128 hsa-miR-635 HL hcmv-miR-UL148D HL hsa-miR-373* HL hsa-miR-647 HL hsa-miR-197/mmu-miR- HL 197 hsa-miR-602 HL hsa-miR-656 HL hsa-miR-874/mmu-miR- HL 874/rno-miR-874 ebv-miR-BART19-3p HL hsa-miR-551b* HL hsa-miR-96/mmu-miR- HL 96/rno-miR-96 hsa-miR-889 HL hsa-miR-425/mmu-miR- HL 425/rno-miR-425 hsa-miR-34c-5p/mmu- HL miR-34c/rno-miR-34c hcmv-miR-UL70-3p HL hsa-miR-27a*/mmu- HL miR-27a*/rno-miR-27a* hsa-miR-194/mmu-miR- HL 194/rno-miR-194 hsa-miR-17*/rno-miR- HL 17-3p hsa-miR-548d-5p HL hsa-miR-7/mmu-miR- HL 7a/rno-miR-7a hsa-miR-877/mmu-miR- HL 877/rno-miR-877 hsa-miR-22*/mmu-miR- HL 22*/rno-miR-22* hsa-miR-323-3p/mmu- HL miR-323-3p/rno-miR- 323 hsa-miR-708/mmu-miR- HL 708/rno-miR-708 hsa-miR-513a-3p HL hsa-miR-595 HL hsa-miR-922 HL hsa-miR-515-5p HL hsa-miR-99b/mmu-miR- HL 99b/rno-miR-99b hsa-miR-483-3p HL hsa-miR-330-5p/mmu- HL miR-330/rno-miR-330 hsa-miR-509-3p HL hsa-miR-151-3p HL ebv-miR-BART13 HL hsa-miR-617 HL hsa-miR-328/mmu-miR- HL 328/rno-miR-328 hsa-miR-361-3p HL hsa-miR-138/mmu-miR- HL 138/rno-miR-138 ebv-miR-BART7* HL hsa-miR-589 HL hsa-miR-576-5p HL hsa-miR-452 HL hsa-miR-7-2* HL hsa-miR-296-5p/mmu- HL miR-296-5p/rno-miR- 296* hsa-miR-550* HL hsa-miR-92b/mmu-miR- HL 92b/rno-miR-92b kshv-miR-K12-1 HL hsa-miR-526a/hsa-miR- HL 520c-5p/hsa-miR-518d- 5p mghv-miR-M1-2 HL hsa-miR-548b-3p HL hsa-miR-297/mmu-miR- HL 297a hsa-miR-195* HL hsa-miR-652/mmu-miR- HL 652/rno-miR-652 hsa-miR-221* HL hsa-miR-194* HL hsa-miR-23a*/rno-miR- HL 23a* hsa-miR-125b-2*/rno- HL miR-125b* hsa-miR-212/mmu-miR- HL 212/rno-miR-212 ebv-miR-BART18-3p HL hsa-miR-586 HL hsa-miR-137/mmu-miR- HL 137/rno-miR-137 hsa-miR-610 HL hcmv-miR-UL112 HL hsa-miR-181b/mmu- HL miR-181b/rno-miR-181b hsa-miR-936 HL hsa-miR-744/mmu- HL miR-744 kshv-miR-K12-6-5p HL hcmv-miR-US25-1* HL hsa-miR-21* HL mghv-miR-M1-6 HL mghv-miR-M1-8 HL hsa-miR-10a*/mmu- HL miR-10a*/rno-miR- 10a-3p hsa-miR-345 HL hsa-miR-887 HL hsa-miR-193b* HL hsa-miR-122* HL kshv-miR-K12-5 HL hsa-miR-92b* HL hsa-miR-526b* HL hsa-miR-553 HL hsa-miR-601 HL hiv1-miR-H1 HL hsa-miR-623 HL hsa-miR-519e HL hsa-miR-650 HL hsa-miR-575 HL hsa-miR-629* HL hsa-miR-890 HL hsa-miR- HL 150*/mmu-miR- 150* hsa-miR- HL 425*/mmu-miR- 425* hsa-miR- HL 135a*/mmu-miR- 135a* hsa-miR-612 HL hsa-miR-636 HL hsa-miR-500 HL hsa-miR-502-5p HL hsa-miR-9*/mmu- HL miR-9*/rno-miR-9* hsa-miR-500* HL hsa-miR- HL 124*/mmu-miR- 124*/rno-miR-124* hsa-miR-30c- HL 1*/mmu-miR-30c- 1*/rno-miR-30c-1* hsa-miR- HL 99b*/mmu-miR- 99b*/rno-miR-99b* hsa-miR-331- HL 5p/mmu-miR-331- 5p hsa-miR-206/mmu- HL miR-206/rno-miR- 206 hsa-miR-376a* HL hsa-miR-585 HL hsa-miR-640 HL hsa-miR-377* HL hsa-miR-125a- HL 3p/mmu-miR-125a- 3p/rno-miR-125a-3p hsa-miR-24- HL 2*/mmu-miR-24- 2*/rno-miR-24-2* hsa-miR-484/mmu- HL miR-484/rno-miR- 484 hsa-miR- HL 106b*/mmu-miR- 106b*/rno-miR- 106b* hsa-let-7b*/mmu- HL let-7b*/rno-let-7b* hsa-miR-302c* HL hsa-miR-542- HL 5p/mmu-miR-542- 5p/rno-miR-542-5p hsa-miR-622 HL ebv-miR-BHRF1-3 HL hsa-miR-181a-2* HL hsa-miR-183/mmu- HL miR-183/rno-miR- 183 hsa-miR-409- HL 5p/mmu-miR-409- 5p/rno-miR-409-5p ebv-miR-BART20- HL 3p hsa-miR-629 HL hsa-let-7d*/mmu- HL let-7d*/rno-let-7d* hsa-miR-645 HL hsa-miR-492 HL hsa-miR-654-5p HL hsa-miR-208a/mmu- HL miR-208a/rno-miR- 208 hsa-miR-584 HL hsa-miR-382/mmu- HL miR-382/rno-miR- 382 hsa-miR- HL 340*/mmu-miR- 340-3p/rno-miR- 340-3p hsa-miR-490-5p HL hsa-miR-663 HL hsa-miR-337-3p HL hsa-miR-518a-3p HL ebv-miR-BART9* HL hsa-miR-342- HL 5p/mmu-miR-342- 5p/rno-miR-342-5p hsa-miR-514 HL hsa-miR-508-5p HL hsa-miR-124/mmu- HL miR-124/rno-miR- 124 hsa-miR-657 HL hsa-miR-938 HL hsa-miR-296- HL 3p/mmu-miR-296- 3p/rno-miR-296 hsa-miR-551a HL hsa-miR-542- HL 3p/mmu-miR-542- 3p/rno-miR-542-3p hsa-miR-220b HL hsa-miR-326/mmu- HL miR-326/rno-miR- 326 hsa-miR-615- HL 3p/mmu-miR-615- 3p hsa-miR-433/mmu- HL miR-433/rno-miR- 433 hsa-miR-202 HL hsa-miR-338- HL 5p/mmu-miR-338- 5p/rno-miR-338* hsa-miR-552 HL hsa-miR-299-3p HL hsa-miR-509-3-5p HL

TABLE 25 Predictor microRNAs that distinguish Burkitt lymphoma from chromic lymphocytic leukemia Higher BL vs CLL in hsa-miR-874/mmu- BL miR-874/rno-miR-874 hsa-miR-125b/mmu- BL miR-125b-5p/rno-miR- 125b-5p hsa-miR-126/mmu- BL miR-126-3p/rno-miR- 126 ebv-miR-BHRF1-2 BL hsa-miR-193b BL hsa-miR-371-5p BL hsa-miR-193a-5p BL hsa-miR-628-3p BL hsa-miR-185* BL hsa-miR-503 BL hsa-miR-199a-3p/hsa- BL miR-199b-3p/mmu- miR-199a-3p/mmu- miR-199b/rno-miR- 199a-3p hsa-miR-143/mmu- BL miR-143/rno-miR-143 hsa-miR-130a/mmu- BL miR-130a/rno-miR- 130a hsa-miR-145/mmu- BL miR-145/rno-miR-145 hsa-miR-30b* BL hsa-miR-665 BL hsa-miR-658 BL hsa-miR-933 BL hsa-miR-30c-2*/mmu- BL miR-30c-2*/rno-miR- 30c-2* hsa-miR-765 BL hsa-miR-620 BL hsa-miR-520d-5p BL hsa-miR-494/mmu- BL miR-494/rno-miR-494 hsa-miR-551b/mmu- CLL miR-551b/rno-miR- 551b hsa-miR-106b/mmu- CLL miR-106b/rno-miR- 106b hsa-miR-30c/mmu- CLL miR-30c/rno-miR-30c hsa-miR-16/mmu-miR- CLL 16/rno-miR-16 hsa-miR-27a/mmu- CLL miR-27a/rno-miR-27a hsa-miR-27b/mmu- CLL miR-27b/rno-miR-27b hsa-miR-550 CLL hsa-miR-30a/mmu- CLL miR-30a/rno-miR-30a hsa-miR-30b/mmu-miR- CLL 30b/rno-miR-30b-5p hsa-miR-34b/mmu-miR- CLL 34b-3p hsa-miR-801/mmu-miR- CLL 801 hsa-miR-26b/mmu-miR- CLL 26b/rno-miR-26b hsa-let-7b/mmu-let- CLL 7b/rno-let-7b hsa-miR-142-5p/mmu- CLL miR-142-5p/rno-miR- 142-5p hsa-miR-26a/mmu-miR- CLL 26a/rno-miR-26a hsa-miR-29a/mmu-miR- CLL 29a/rno-miR-29a hsa-miR-768-3p CLL hsa-miR-199a-5p/mmu- CLL miR-199a-5p/rno-miR- 199a-5p hsa-miR-30e/mmu-miR- CLL 30e/rno-miR-30e hsa-miR-29b/mmu-miR- CLL 29b/rno-miR-29b hsa-miR-101/mmu-miR- CLL 101a/rno-miR-101a hsa-miR-138-1*/mmu- CLL miR-138*/rno-miR-138* hsa-miR-195/mmu-miR- CLL 195/rno-miR-195 hsa-miR-549 CLL hsa-miR-103/mmu-miR- CLL 103/rno-miR-103 hsa-miR-649 CLL hsa-miR-335/mmu-miR- CLL 335-5p/rno-miR-335 hsa-miR-342-3p/mmu- CLL miR-342-3p/rno-miR- 342-3p hsa-miR-423-3p/mmu- CLL miR-423-3p/rno-miR- 423 hsa-miR-222/mmu-miR- CLL 222/rno-miR-222 hsa-miR-374a CLL hsa-miR-888* CLL hsa-miR-30d/mmu-miR- CLL 30d/rno-miR-30d hsa-miR-299-5p/mmu- CLL miR-299*/rno-miR-299 hsa-miR-107/mmu-miR- CLL 107/rno-miR-107 hsa-miR-105 CLL hsa-let-7f/mmu-let- CLL 7f/rno-let-7f hsa-miR-191/mmu-miR- CLL 191/rno-miR-191 hsa-miR-223/mmu-miR- CLL 223/rno-miR-223 hsa-miR-361-5p/mmu- CLL miR-361/rno-miR-361 hsa-miR-29c/mmu- CLL miR-29c/rno-miR-29c hsa-miR-147 CLL hsa-miR-361-3p CLL hsa-miR-140-3p/mmu- CLL miR-140*/rno-miR- 140* hsa-miR-486-5p/mmu- CLL miR-486 hsa-miR-33a/mmu- CLL miR-33/rno-miR-33 hsa-miR-636 CLL hsa-miR-24-1*/mmu- CLL miR-24-1*/rno-miR-24- 1* hsa-miR-144* CLL hsa-miR-668/mmu- CLL miR-668 hsa-miR-768-5p CLL hsa-miR-363/mmu- CLL miR-363/rno-miR-363 hsa-miR-150/mmu- CLL miR-150/rno-miR-150 hsa-miR-519d CLL hsa-miR-891a CLL hsa-miR-186/mmu- CLL miR-186/rno-miR-186 hsa-miR-331-5p/mmu- CLL miR-331-5p hsa-miR-28-5p/mmu- CLL miR-28/rno-miR-28 hsa-miR-154/mmu- CLL miR-154/rno-miR-154 hsa-miR-155 CLL hsa-miR-363*/rno-miR- CLL 363* hsa-miR-32/mmu-miR- CLL 32/rno-miR-32 hsa-miR-30e*/mmu- CLL miR-30e*/rno-miR- 30e* hsa-miR-140-5p/mmu- CLL miR-140/rno-miR-140 hsa-let-7g/mmu-let-7g CLL hsa-miR-20b* CLL hsa-miR-129* CLL hsa-miR-196a*/mmu- CLL miR-196a*/rno-miR- 196a* hsa-miR-487b/mmu- CLL miR-487b/rno-miR- 487b

TABLE 26 Predictor microRNAs that distinguish Burkitt lymphoma from follicular lymphoma Higher BL vs FL in hsa-miR-17/mmu-miR- BL 17/rno-miR-17-5p/rno- miR-17 hsa-miR-106a BL hsa-miR-19b/mmu-miR- BL 19b/rno-miR-19b hsa-miR-20a/mmu-miR- BL 20a/rno-miR-20a hsa-miR-19a/mmu-miR- BL 19a/rno-miR-19a hsa-miR-628-3p BL hsa-miR-503 BL hsa-miR-371-5p BL hsa-miR-106b/mmu- BL miR-106b/rno-miR-106b hsa-miR-30c-2*/mmu- BL miR-30c-2*/rno-miR- 30c-2* ebv-miR-BART2-3p FL hsa-let-7e/mmu-let- FL 7e/rno-let-7e hsa-miR-551b/mmu- FL miR-551b/rno-miR-551b hsa-miR-26b/mmu-miR- FL 26b/rno-miR-26b hsa-miR-26a/mmu-miR- FL 26a/rno-miR-26a hsa-miR-620 FL hsa-miR-801/mmu-miR- FL 801 ebv-miR-BART17-5p FL hsa-miR-29a/mmu-miR- FL 29a/rno-miR-29a hsa-miR-34b/mmu-miR- FL 34b-3p hsa-miR-32* FL hsa-miR-29b/mmu-miR- FL 29b/rno-miR-29b hsa-miR-649 FL hsa-miR-576-3p FL hsa-miR-302a/mmu- FL miR-302a hsa-miR-365/mmu-miR- FL 365/rno-miR-365 hsa-miR-148a/mmu- FL miR-148a hsa-miR-146b-5p/mmu- FL miR-146b/rno-miR-146b hsa-miR-505/rno-miR- FL 505 hsa-miR-33a/mmu-miR- FL 33/rno-miR-33 hsa-miR-455-3p FL hsa-miR-374b/mmu- FL miR-374/rno-miR-374 hsa-miR-214/mmu-miR- FL 214/rno-miR-214 hsa-miR-138-1*/mmu- FL miR-138*/rno-miR-138* hsa-miR-140-3p/mmu- FL miR-140*/rno-miR-140* hsa-miR-212/mmu-miR- FL 212/rno-miR-212 hsa-miR-29c/mmu-miR- FL 29c/rno-miR-29c hsa-miR-888* FL hsa-miR-222/mmu-miR- FL 222/rno-miR-222 hsa-miR-152/mmu-miR- FL 152/rno-miR-152 hsa-miR-183*/mmu- FL miR-183* hsa-miR-768-5p FL hsa-miR-107/mmu-miR- FL 107/rno-miR-107 hsa-miR-574-5p/mmu- FL miR-574-5p hsa-miR-154/mmu-miR- FL 154/rno-miR-154 hsa-miR-620 FL hsa-miR-886-5p FL hsa-miR-208a/mmu- FL miR-208a/rno-miR-208 hsa-miR-374b* FL hsa-miR-525-5p FL hsa-miR-363/mmu-miR- FL 363/rno-miR-363 hsa-miR-99b/mmu-miR- FL 99b/rno-miR-99b hsa-miR-148b/mmu- FL miR-148b/rno-miR- 148b-3p kshv-miR-K12-6-5p FL hsa-miR-125b-1*/mmu- FL miR-125b-3p/rno-miR- 125b-3p hsa-miR-526b FL hsa-miR-629 FL hsa-miR-617 FL hsa-miR-124/mmu-miR- FL 124/rno-miR-124 hsa-miR-493 FL hsa-miR-24-1*/mmu- FL miR-24-1*/rno-miR- 24-1* hsa-miR-200b*/mmu- FL miR-200b* hsa-miR-484/mmu- FL miR-484/rno-miR-484 hsa-miR-483-3p FL hsa-miR-516b FL hsa-miR-125b-2*/rno- FL miR-125b* hsa-miR-490-3p/mmu- FL miR-490 hsa-miR-140-5p/mmu- FL miR-140/rno-miR-140 hsa-miR-877/mmu- FL miR-877/rno-miR-877 hsa-miR-381/mmu- FL miR-381/rno-miR-381 hsa-miR-193b* FL hsa-miR-635 FL hsa-miR-542-3p/mmu- FL miR-542-3p/rno-miR- 542-3p hsa-miR-181a-2* FL hsa-miR-32/mmu- FL miR-32/rno-miR-32 hsa-miR-105 FL hsa-miR-488 FL hsa-miR-505* FL ebv-miR-BART16 FL hsa-miR-891a FL hsa-miR-221/mmu- FL miR-221/rno-miR-221 hsa-miR-7/mmu-miR- FL 7a/rno-miR-7a hsa-miR-299-3p FL hsa-miR-575 FL hsa-miR-585 FL hsa-miR-30e*/mmu- FL miR-30e*/rno-miR- 30e* hcmv-miR-US25-1* FL hsa-miR-708/mmu- FL miR-708/rno-miR-708 hsv1-miR-H1 FL hsa-let-7g/mmu-let-7g FL hsa-miR-146a/mmu- FL miR-146a/rno-miR- 146a ebv-miR-BART8* FL hsa-miR-106b*/mmu- FL miR-106b*/rno-miR- 106b* hsa-miR-601 FL hsa-miR-553 FL hsa-miR-518b FL hsa-miR-548d-5p FL hsa-miR-382/mmu- FL miR-382/rno-miR-382 hsa-miR-630 FL hsa-miR-144* FL hsa-miR-519d FL mghv-miR-M1-3 FL hsa-miR-497/mmu- FL miR-497/rno-miR-497 hsa-miR-524-5p FL hsa-miR-500* FL hsa-miR-920 FL hsa-miR-297/mmu- FL miR-297a hsa-miR-509-3-5p FL hsa-miR-340*/mmu- FL miR-340-3p/rno-miR- 340-3p hsa-miR-99b*/mmu- FL miR-99b*/rno-miR- 99b* hsa-miR-887 FL hsa-miR-331-3p/mmu- FL miR-331-3p/rno-miR- 331 hsa-miR-206/mmu- FL miR-206/rno-miR-206 hsa-miR-377* FL mghv-miR-M1-8 FL hsa-miR-513a-3p FL hsa-miR-146b-3p FL hsa-miR-155* FL hsa-miR-574-3p/mmu- FL miR-574-3p hsa-miR-615-3p/mmu- FL miR-615-3p hsa-miR-28-5p/mmu- FL miR-28/rno-miR-28 hsa-miR-934 FL hsa-miR-151-5p/mmu- FL miR-151-5p/rno-miR- 151 hsa-miR-885-5p FL hsa-miR-409-5p/mmu- FL miR-409-5p/rno-miR- 409-5p hsa-let-7d*/mmu-let- FL 7d*/rno-let-7d* hsa-miR-155 FL hsa-let-7b*/mmu-let- FL 7b*/rno-let-7b* hsa-miR-7-2* FL hsa-miR-221* FL hsa-miR-9*/mmu-miR- FL 9*/rno-miR-9* hsa-miR-122* FL hsa-miR-130b/mmu- FL miR-130b/rno-miR- 130b hsa-miR-183/mmu- FL miR-183/rno-miR-183 hsa-miR-92a/mmu- FL miR-92a/rno-miR-92a hsa-miR-890 FL hsa-miR-938 FL kshv-miR-K12-7 FL hsa-miR-629* FL hsa-miR-922 FL kshv-miR-K12-5 FL hsa-miR-197/mmu- FL miR-197 hsa-miR-552 FL hsa-miR-151-3p FL hsa-miR-194/mmu- FL miR-194/rno-miR-194 hsa-miR-218-2*/mmu- FL miR-218-2*/rno-miR- 218* hsa-miR-181b/mmu- FL miR-181b/rno-miR- 181b ebv-miR-BART18-3p FL hsa-miR-34c-5p/mmu- FL miR-34c/rno-miR-34c hsa-miR-622 FL hsa-miR-514 FL hsa-miR-657 FL hsa-miR-518a-3p FL hsa-miR-647 FL hsa-miR-22*/mmu- FL miR-22*/rno-miR-22* hsa-miR-196a*/mmu- FL miR-196a*/rno-miR- 196a* kshv-miR-K12-1 FL hsa-miR-425/mmu- FL miR-425/rno-miR-425 hsa-miR-361-3p FL hsa-miR-220b FL hsa-miR-744/mmu- FL miR-744 hsa-miR-551a FL hsa-miR-301a/mmu- FL miR-301a/rno-miR- 301a hsa-miR-92b/mmu- FL miR-92b/rno-miR-92b hsa-miR-487b/mmu- FL miR-487b/rno-miR- 487b hsa-miR-363*/rno-miR- FL 363* hsa-miR-337-3p FL hsa-miR-636 FL hsa-miR-600 FL hsa-miR-138/mmu- FL miR-138/rno-miR-138 hsa-miR-96/mmu-miR- FL 96/rno-miR-96 hsa-miR-20b* FL hsa-miR-342-5p/mmu- FL miR-342-5p/rno-miR- 342-5p hsa-miR-215 FL hsa-miR-129* FL

TABLE 27 Predictor microRNAs that distinguish Burkitt lymphoma from Hodgkin's lymphoma Higher BL vs HL in hsa-miR-19b/mmu-miR- BL 19b/rno-miR-19b hsa-miR-19a/mmu-miR- BL 19a/rno-miR-19a hsa-miR-17/mmu-miR- BL 17/rno-miR-17-5p/rno- miR-17 hsa-miR-106a BL hsa-miR-20a/mmu-miR- BL 20a/rno-miR-20a hsa-miR-106b/mmu-miR- BL 106b/rno-miR-106b hsa-miR-30c/mmu-miR- BL 30c/rno-miR-30c hsa-miR-551b/mmu-miR- HL 551b/rno-miR-551b hsa-miR-921 HL ebv-miR-BART2-3p HL hsa-miR-32* HL hsa-miR-494/mmu-miR- HL 494/rno-miR-494 hsa-miR-29c/mmu-miR- HL 29c/rno-miR-29c hsa-miR-923 HL hsa-miR-199b-5p HL hsa-miR-148a/mmu-miR- HL 148a hsa-miR-130a/mmu-miR- HL 130a/rno-miR-130a hsa-miR-154/mmu-miR- HL 154/rno-miR-154 hsa-miR-151-5p/mmu- HL miR-151-5p/rno-miR-151 hsa-miR-28-5p/mmu- HL miR-28/rno-miR-28 hsa-miR-365/mmu-miR- HL 365/rno-miR-365 hsa-miR-602 HL hsa-miR-222/mmu-miR- HL 222/rno-miR-222 hsa-miR-214/mmu-miR- HL 214/rno-miR-214 hsa-miR-144* HL hsa-miR-107/mmu-miR- HL 107/rno-miR-107 hsa-miR-497/mmu-miR- HL 497/rno-miR-497 hsa-let-7g/mmu-let-7g HL hsa-miR-146a/mmu-miR- HL 146a/rno-miR-146a hsa-miR-186/mmu-miR- HL 186/rno-miR-186 hsa-miR-886-5p HL hsa-miR-152/mmu-miR- HL 152/rno-miR-152 hsa-miR-29a*/mmu-miR- HL 29a*/rno-miR-29a* hsa-miR-140-5p/mmu- HL miR-140/rno-miR-140 hsa-miR-532-5p/mmu- HL miR-532-5p/rno-miR- 532-5p hsa-miR-145*/mmu-miR- HL 145* hsa-miR-515-5p HL hsa-miR-153/mmu-miR- HL 153/rno-miR-153 hsa-miR-513a-5p HL hsa-miR-516a-5p HL hsa-miR-660 HL hsa-miR-29c*/mmu-miR- HL 29c*/rno-miR-29c* hsa-miR-505/rno-miR- HL 505 hsa-miR-455-3p HL hsa-miR-519e* HL hsa-miR-502-3p HL hsa-miR-922 HL hsa-miR-524-5p HL hsa-miR-483-5p HL hsa-miR-708/mmu-miR- HL 708/rno-miR-708 hsa-miR-498 HL ebv-miR-BART19-3p HL hsa-miR-149/mmu-miR- HL 149 hsa-miR-574-3p/mmu- HL miR-574-3p hsa-miR-659 HL hsa-miR-331-3p/mmu- HL miR-331-3p/rno-miR-331 hsa-miR-105 HL hsa-miR-128/mmu-miR- HL 128/rno-miR-128 hsa-miR-200b*/mmu- HL miR-200b* hsa-miR-381/mmu-miR- HL 381/rno-miR-381 hsa-miR-766 HL hsa-miR-557 HL ebv-miR-BART16 HL hsa-miR-488 HL hsa-miR-516b HL mghv-miR-M1-2 HL hsa-miR-891a HL hsa-miR-221/mmu-miR- HL 221/rno-miR-221 hsa-miR-146b-3p HL hsa-miR-526b HL mghv-miR-M1-3 HL hsa-miR-505* HL hsv1-miR-H1 HL hcmv-miR-UL70-3p HL hsa-miR-24-2*/mmu- HL miR-24-2*/rno-miR-24- 2* hsa-miR-617 HL hsa-miR-194/mmu-miR- HL 194/rno-miR-194 hsa-miR-934 HL hsa-miR-220c HL hsa-miR-548d-5p HL hsa-miR-937 HL ebv-miR-BART13 HL hsa-miR-7/mmu-miR- HL 7a/rno-miR-7a hsa-miR-210/mmu-miR- HL 210/rno-miR-210 hsa-miR-490-3p/mmu- HL miR-490 hsa-miR-221* HL hsa-miR-92a/mmu-miR- HL 92a/rno-miR-92a hsa-miR-183*/mmu-miR- HL 183* hsa-miR-513a-3p HL hsa-miR-575 HL hsa-miR-595 HL hsa-miR-920 HL hsa-miR-483-3p HL hsa-miR-330-5p/mmu- HL miR-330/rno-miR-330 hsa-miR-525-5p HL hsa-miR-99b/mmu-miR- HL 99b/rno-miR-99b hsa-miR-509-3p HL hsa-miR-151-3p HL ebv-miR-BHRF1-1 HL hsa-miR-630 HL mghv-miR-M1-7-3p HL hsa-miR-328/mmu-miR- HL 328/rno-miR-328 hsa-miR-452 HL hsa-miR-635 HL ebv-miR-BART5 HL hsa-miR-373* HL hsa-miR-96/mmu-miR- HL 96/rno-miR-96 hsa-miR-382/mmu-miR- HL 382/rno-miR-382 hsa-miR-155 HL hsa-miR-197/mmu-miR- HL 197 kshv-miR-K12-6-5p HL hcmv-miR-UL112 HL hsa-miR-551b* HL hsa-miR-877/mmu-miR- HL 877/rno-miR-877 hsa-miR-589 HL hsa-miR-936 HL hsa-miR-34c-5p/mmu- HL miR-34c/rno-miR-34c hsa-miR-885-5p HL ebv-miR-BART6-3p HL hsa-miR-585 HL hsa-miR-302c* HL hsa-miR-196a*/mmu- HL miR-196a*/rno-miR- 196a* hsa-miR-195* HL hsa-miR-17*/rno-miR-17- HL 3p hsa-miR-296-5p/mmu- HL miR-296-5p/rno-miR- 296* hsa-miR-550* HL ebv-miR-BHRF1-3 HL hsa-miR-296-3p/mmu- HL miR-296-3p/rno-miR-296 hsa-miR-526b* HL hsa-miR-548b-3p HL hsa-miR-652/mmu-miR- HL 652/rno-miR-652 hsa-miR-297/mmu-miR- HL 297a hsa-miR-553 HL hsa-miR-194* HL hsa-miR-23a*/rno-miR- HL 23a* hsa-miR-130b/mmu-miR- HL 130b/rno-miR-130b hsa-miR-586 HL hsa-miR-137/mmu-miR- HL 137/rno-miR-137 hsa-miR-610 HL mghv-miR-M1-8 HL hsa-miR-193b* HL hsa-miR-519d HL hsa-miR-125b-1*/mmu- HL miR-125b-3p/rno-miR- 125b-3p hsa-miR-744/mmu-miR- HL 744 hsa-miR-138/mmu-miR- HL 138/rno-miR-138 hsa-miR-21* HL hsa-miR-576-5p HL hsa-miR-125a-3p/mmu- HL miR-125a-3p/rno-miR- 125a-3p mghv-miR-M1-6 HL hsa-miR-425/mmu-miR- HL 425/rno-miR-425 hsa-miR-10a*/mmu-miR- HL 10a*/rno-miR-10a-3p hsa-miR-215 HL hsa-miR-345 HL hsa-miR-887 HL hsa-miR-7-2* HL hsa-miR-122* HL hsa-miR-363*/rno-miR- HL 363* hsa-miR-22*/mmu-miR- HL 22*/rno-miR-22* hsa-miR-542-5p/mmu- HL miR-542-5p/rno-miR- 542-5p hsa-miR-92b* HL hsa-miR-526a/hsa- HL miR-520c-5p/hsa- miR-518d-5p kshv-miR-K12-5 HL hsa-miR- HL 340*/mmu-miR- 340-3p/rno-miR- 340-3p hsa-let-7d*/mmu- HL let-7d*/rno-let-7d* hsa-miR-92b/mmu- HL miR-92b/rno-miR- 92b hsa-miR-518b HL hiv1-miR-H1 HL hsa-miR-623 HL hsa-miR-645 HL hsa-miR-601 HL hsa-miR-519e HL hsa-miR-650 HL hsa-miR-361-3p HL hsa-miR- HL 150*/mmu-miR- 150* hsa-miR- HL 425*/mmu-miR- 425* hsa-miR- HL 135a*/mmu-miR- 135a* hsa-miR-518a-3p HL hsa-miR-612 HL hsa-miR-212/mmu- HL miR-212/rno-miR- 212 hsa-miR-125b- HL 2*/rno-miR-125b* hsa-miR-500 HL hsa-miR-663 HL hsa-miR-647 HL hsa-miR-502-5p HL ebv-miR-BART18- HL 3p hsa-miR- HL 99b*/mmu-miR- 99b*/rno-miR-99b* ebv-miR-BART7* HL hsa-miR-500* HL hsa-miR- HL 124*/mmu-miR- 124*/rno-miR-124* hsa-miR-206/mmu- HL miR-206/rno-miR- 206 hsa-miR-615- HL 3p/mmu-miR-615- 3p hsa-miR-30c- HL 1*/mmu-miR-30c- 1*/rno-miR-30c-1* hsa-miR-331- HL 5p/mmu-miR-331- 5p hcmv-miR-US25-1* HL hsa-miR-326/mmu- HL miR-326/rno-miR- 326 hsa-miR- HL 181b/mmu-miR- 181b/rno-miR-181b hsa-miR-376a* HL hsa-miR-433/mmu- HL miR-433/rno-miR- 433 hsa-miR-640 HL hsa-miR-938 HL hsa-miR-508-5p HL hsa-miR-484/mmu- HL miR-484/rno-miR- 484 hsa-miR- HL 106b*/mmu-miR- 106b*/rno-miR- 106b* hsa-miR-600 HL hsa-let-7b*/mmu- HL let-7b*/rno-let-7b* hsa-miR-20b* HL hsa-miR-622 HL hsa-miR-657 HL hsa-miR-183/mmu- HL miR-183/rno-miR- 183 hsa-miR-409- HL 5p/mmu-miR-409- 5p/rno-miR-409-5p ebv-miR-BART20- HL 3p ebv-miR-BART8* HL hsa-miR-129* HL hsa-miR-629 HL hsa-miR-890 HL hsa-miR-208a/mmu- HL miR-208a/rno-miR- 208 hsa-miR-492 HL hsa-miR-629* HL hsa-miR-654-5p HL hsa-miR-584 HL hsa-miR-636 HL hsa-miR-490-5p HL hsa-miR-337-3p HL hsa-miR-9*/mmu- HL miR-9*/rno-miR-9* ebv-miR-BART9* HL hsa-miR-509-3-5p HL hsa-miR-342- HL 5p/mmu-miR-342- 5p/rno-miR-342-5p hsa-miR-514 HL hsa-miR-377* HL kshv-miR-K12-1 HL hsa-miR-124/mmu- HL miR-124/rno-miR- 124 hsa-miR-542- HL 3p/mmu-miR-542- 3p/rno-miR-542-3p hsa-miR-220b HL hsa-miR-299-3p HL hsa-miR-181a-2* HL hsa-miR-202 HL hsa-miR- HL 487b/mmu-miR- 487b/rno-miR-487b hsa-miR-551a HL hsa-miR-338- HL 5p/mmu-miR-338- 5p/rno-miR-338* hsa-miR-552 HL

TABLE 28 Predictor microRNAs that distinguish chronic lymphocytic leukemia from follicular lymphoma Higher CLL vs FL in hsa-miR-331-5p/mmu- CLL miR-331-5p hsa-miR-144/mmu-miR- CLL 144/rno-miR-144 hsa-miR-150/mmu-miR- CLL 150/rno-miR-150 hsa-miR-140-5p/mmu- CLL miR-140/rno-miR-140 hsa-miR-335/mmu-miR- CLL 335-5p/rno-miR-335 hsa-miR-186/mmu-miR- CLL 186/rno-miR-186 hsa-miR-486-5p/mmu- CLL miR-486 hsa-miR-154/mmu-miR- CLL 154/rno-miR-154 hsa-miR-223/mmu-miR- CLL 223/rno-miR-223 hsa-miR-299-5p/mmu- CLL miR-299*/rno-miR-299 hsa-let-7g/mmu-let-7g CLL hsa-miR-32/mmu-miR- CLL 32/rno-miR-32 hsa-miR-30e*/mmu-miR- CLL 30e*/rno-miR-30e* hsa-miR-147 CLL hsa-miR-20b/mmu-miR- CLL 20b/rno-miR-20b-5p hsa-miR-101/mmu-miR- CLL 101a/rno-miR-101a hsa-let-7f/mmu-let-7f/rno- CLL let-7f hsa-miR-30e/mmu-miR- CLL 30e/rno-miR-30e hsa-miR-668/mmu-miR- CLL 668 hsa-miR-768-5p CLL hsa-miR-19a/mmu-miR- CLL 19a/rno-miR-19a hsa-miR-199a-5p/mmu- CLL miR-199a-5p/rno-miR- 199a-5p hsa-miR-638 CLL hsa-miR-196a*/mmu-miR- CLL 196a*/rno-miR-196a* hsa-miR-19b/mmu-miR- CLL 19b/rno-miR-19b hsa-miR-30d/mmu-miR- CLL 30d/rno-miR-30d hsa-miR-363/mmu-miR- CLL 363/rno-miR-363 hsa-miR-374a CLL hsa-miR-140-3p/mmu- CLL miR-140*/rno-miR-140* hsa-miR-185/mmu-miR- CLL 185/rno-miR-185 hsa-miR-106b/mmu-miR- CLL 106b/rno-miR-106b hsa-miR-106a CLL hsa-miR-191/mmu-miR- CLL 191/rno-miR-191 hsa-miR-17/mmu-miR- CLL 17/rno-miR-17-5p/rno- miR-17 hsa-let-7i/mmu-let-7i/rno- CLL let-7i hsa-miR-20a/mmu-miR- CLL 20a/rno-miR-20a hsa-miR-142-5p/mmu- CLL miR-142-5p/rno-miR-142- 5p hsa-miR-768-3p CLL hsa-miR-30b/mmu-miR- CLL 30b/rno-miR-30b-5p hsa-miR-891a CLL hsa-miR-24-1*/mmu-miR- CLL 24-1*/rno-miR-24-1* hsa-miR-29c/mmu-miR- CLL 29c/rno-miR-29c hsa-miR-28-5p/mmu-miR- CLL 28/rno-miR-28 hsa-miR-30a/mmu-miR- CLL 30a/rno-miR-30a hsa-miR-155 CLL hsa-miR-361-5p/mmu- CLL miR-361/rno-miR-361 hsa-miR-15a/mmu-miR- CLL 15a hsa-miR-26a/mmu-miR- CLL 26a/rno-miR-26a hsa-miR-30c/mmu-miR- CLL 30c/rno-miR-30c hsa-miR-541* CLL hsa-miR-26b/mmu-miR- CLL 26b/rno-miR-26b hsa-miR-519d CLL hsa-miR-15b/mmu-miR- CLL 15b/rno-miR-15b hsa-miR-550 CLL hsa-miR-29b/mmu-miR- CLL 29b/rno-miR-29b hsa-miR-29a/mmu-miR- CLL 29a/rno-miR-29a hsa-miR-103/mmu-miR- CLL 103/rno-miR-103 hsa-miR-423-3p/mmu- CLL miR-423-3p/rno-miR-423 hsa-miR-549 CLL hsa-miR-107/mmu-miR- CLL 107/rno-miR-107 hsa-miR-888* CLL hsa-miR-801/mmu-miR- CLL 801 hsa-miR-149* FL hsa-miR-634 FL ebv-miR-BART2-3p FL hsa-miR-921 FL hsa-miR-494/mmu-miR- FL 494/rno-miR-494 hsa-miR-933 FL mghv-miR-M1-4 FL hsa-let-7e/mmu-let-7e/rno- FL let-7e hsa-miR-939 FL hsa-miR-518c* FL hsa-miR-32* FL hsa-miR-491-3p FL hsa-miR-185/mmu-miR- FL 185/rno-miR-185 hsa-miR-765 FL ebv-miR-BART17-5p FL hsa-miR-576-3p FL hsa-miR-658 FL hsa-miR-503 FL hsa-miR-30b* FL hsa-miR-302a/mmu-miR- FL 302a hsa-miR-628-3p FL hsa-miR-642 FL hsa-miR-620 FL hsa-miR-99a/mmu- FL miR-99a/rno-miR- 99a hsa-miR-371-5p FL hsa-miR-452 FL hsa-miR-126*/mmu- FL miR-126-5p/rno- miR-126* hsa-miR-298 FL hsa-miR-193a-5p FL hsa-miR-583 FL hsa-miR-143/mmu- FL miR-143/rno-miR- 143 hsa-miR-665 FL hsa-miR-505/rno- FL miR-505 hsa-miR-199b-5p FL hsa-miR-28-3p/rno- FL miR-28* hsa-miR-422a FL hsa-miR-515-5p FL hsa-miR-455-3p FL hsa-miR-10a/mmu- FL miR-10a/rno-miR- 10a-5p hsa-miR-300 FL ebv-miR-BART5 FL hsa-miR-10b/mmu- FL miR-10b/rno-miR- 10b hsa-miR-212/mmu- FL miR-212/rno-miR- 212 hsa-miR-145/mmu- FL miR-145/rno-miR- 145 hsa-miR-187* FL ebv-miR-BHRF1-1 FL ebv-miR-BHRF1-2 FL hsa-miR-126/mmu- FL miR-126-3p/rno- miR-126 hsa-miR- FL 130b*/mmu-miR- 130b* hsa-miR-326/mmu- FL miR-326/rno-miR- 326 mghv-miR-M1-2 FL kshv-miR-K12-6-3p FL hsa-miR-516b FL hsa-miR-519e* FL mghv-miR-M1-7-3p FL hsa-miR-629 FL hsa-miR-24-2*/mmu- FL miR-24-2*/rno-miR- 24-2* hsa-miR-943 FL hsa-miR-124/mmu- FL miR-124/rno-miR- 124 hsa-miR-365/mmu- FL miR-365/rno-miR- 365 hsa-miR-493 FL hsa-miR-29c*/mmu- FL miR-29c*/rno-miR- 29c* hsa-miR-602 FL hsa-miR-484/mmu- FL miR-484/rno-miR- 484 hsa-miR-483-3p FL hsa-miR-125b- FL 2*/rno-miR-125b* hsa-miR-675 FL mghv-miR-M1-7-5p FL hsa-miR-152/mmu- FL miR-152/rno-miR- 152 hsa-miR-27a*/mmu- FL miR-27a*/rno-miR- 27a* hsa-miR-542- FL 3p/mmu-miR-542- 3p/rno-miR-542-3p hsa-miR-100/mmu- FL miR-100/rno-miR- 100 hsa-miR-208a/mmu- FL miR-208a/rno-miR- 208 hsa-miR-766 FL hsa-miR-637 FL hsa-miR-519c- FL 5p/hsa-miR-519b- 5p/hsa-miR- 523*/hsa-miR- 518e*/hsa-miR- 522*/hsa-miR-519a* hsa-miR-409- FL 5p/mmu-miR-409- 5p/rno-miR-409-5p hsa-miR-199a- FL 3p/hsa-miR-199b- 3p/mmu-miR-199a- 3p/mmu-miR- 199b/rno-miR-199a- 3p hsa-miR- FL 106b*/mmu-miR- 106b*/rno-miR- 106b* hsa-miR-130a/mmu- FL miR-130a/rno-miR- 130a hsa-miR-645 FL hsa-miR-548d-5p FL hsa-miR-671- FL 5p/mmu-miR-671-5p hsa-miR-574- FL 3p/mmu-miR-574-3p hsa-miR-125b/mmu- FL miR-125b-5p/rno- miR-125b-5p hsa-miR-500* FL hsa-miR-425/mmu- FL miR-425/rno-miR- 425 ebv-miR-BART8* FL hsa-miR-377* FL hsa-miR-513a-3p FL hsa-miR-181a-2* FL hsa-miR-938 FL hsa-miR-155* FL hsa-miR-218- FL 2*/mmu-miR-218- 2*/rno-miR-218* hsa-miR-198 FL hsa-miR-151-3p FL hsa-miR-299-3p FL hcmv-miR-US25-1* FL hsa-miR-708/mmu- FL miR-708/rno-miR- 708 hsa-miR-659 FL hsa-miR-600 FL hsa-miR-601 FL hsa-miR-296- FL 3p/mmu-miR-296- 3p/rno-miR-296 hsa-let-7b*/mmu-let- FL 7b*/rno-let-7b* ebv-miR-BART6-3p FL hsa-miR-7-2* FL hsa-miR-9*/mmu- FL miR-9*/rno-miR-9* hsa-miR-509-3-5p FL hsa-miR-518b FL hsa-miR-183*/mmu- FL miR-183* hsa-miR-125b- FL 1*/mmu-miR-125b- 3p/rno-miR-125b-3p hsa-miR-183/mmu- FL miR-183/rno-miR- 183 hsa-miR-890 FL hsa-miR-153/mmu- FL miR-153/rno-miR- 153 hsa-miR-874/mmu- FL miR-874/rno-miR- 874 hsa-miR-220c FL hsa-miR-99b*/mmu- FL miR-99b*/rno-miR- 99b* hsa-miR-193b* FL hsa-miR-629* FL hcmv-miR-UL148D FL ebv-miR-BART7* FL hsa-miR-99b/mmu- FL miR-99b/rno-miR- 99b hsa-miR-206/mmu- FL miR-206/rno-miR- 206 hsa-miR-381/mmu- FL miR-381/rno-miR- 381 hsa-miR-194/mmu- FL miR-194/rno-miR- 194 hsa-miR-525-5p FL hsa-miR-193b FL hsa-miR-497/mmu- FL miR-497/rno-miR- 497 ebv-miR-BART18- FL 3p hsa-miR-424 FL hsa-miR-553 FL hsa-let-7d*/mmu-let- FL 7d*/rno-let-7d* hsa-miR-34c- FL 5p/mmu-miR- 34c/rno-miR-34c ebv-miR-BHRF1-3 FL kshv-miR-K12-6-5p FL hsa-miR-551a FL hsa-miR-195* FL hsa-miR-551b* FL hsa-miR-514 FL hsa-miR-552 FL hsa-miR-122* FL hsa-miR-92b/mmu- FL miR-92b/rno-miR- 92b hsa-miR-22*/mmu- FL miR-22*/rno-miR- 22* hsa-miR-635 FL kshv-miR-K12-1 FL hsa-miR-483-5p FL hsa-miR-340*/mmu- FL miR-340-3p/rno- miR-340-3p hsa-miR-615- FL 3p/mmu-miR-615-3p hsa-miR-505* FL hsa-miR-622 FL hsa-miR-181b/mmu- FL miR-181b/rno-miR- 181b hsa-miR-886-5p FL hsa-miR-885-5p FL hsa-miR-220b FL hsa-miR-524-5p FL hsa-miR-382/mmu- FL miR-382/rno-miR- 382 hsa-miR-744/mmu- FL miR-744 hsv1-miR-H1 FL hsa-miR-526b FL hsa-miR-657 FL hsa-miR-130b/mmu- FL miR-130b/rno-miR- 130b hsa-miR-181a/mmu- FL miR-181a/rno-miR- 181a hsa-miR-301a/mmu- FL miR-301a/rno-miR- 301a hsa-miR-490- FL 3p/mmu-miR-490 hsa-miR-485- FL 3p/mmu-miR-485* hsa-miR-297/mmu- FL miR-297a hsa-miR-630 FL hsa-miR-877/mmu- FL miR-877/rno-miR- 877 kshv-miR-K12-5 FL hsa-miR-617 FL mghv-miR-M1-3 FL hsa-miR-920 FL hsa-miR-585 FL hsa-miR-374b* FL hsa-miR-215 FL hsa-miR-342- FL 5p/mmu-miR-342- 5p/rno-miR-342-5p hsa-miR-934 FL hsa-miR-575 FL hsa-miR-488 FL ebv-miR-BART16 FL hsa-miR-647 FL hsa-miR-138/mmu- FL miR-138/rno-miR- 138 hsa-miR-221* FL hsa-miR- FL 200b*/mmu-miR- 200b* hsa-miR-337-3p FL hsa-miR-922 FL hsa-miR-197/mmu- FL miR-197 hsa-miR-96/mmu- FL miR-96/rno-miR-96 hsa-miR-518a-3p FL

TABLE 29 Predictor microRNAs that distinguish Burkitt lymphoma from Hodgkin's lymphoma Higher CLL vs HL in hsa-miR-32/mmu-miR- CLL 32/rno-miR-32 hsa-miR-30e*/mmu-miR- CLL 30e*/rno-miR-30e* hsa-let-7g/mmu-let-7g CLL hsa-miR-144/mmu-miR- CLL 144/rno-miR-144 hsa-miR-140-5p/mmu- CLL miR-140/rno-miR-140 hsa-miR-19a/mmu-miR- CLL 19a/rno-miR-19a hsa-miR-154/mmu-miR- CLL 154/rno-miR-154 hsa-miR-150/mmu-miR- CLL 150/rno-miR-150 hsa-miR-28-5p/mmu- CLL miR-28/rno-miR-28 hsa-miR-363/mmu-miR- CLL 363/rno-miR-363 hsa-miR-101/mmu-miR- CLL 101a/rno-miR-101a hsa-miR-299-5p/mmu- CLL miR-299*/rno-miR-299 hsa-miR-768-5p CLL hsa-miR-19b/mmu-miR- CLL 19b/rno-miR-19b hsa-miR-30e/mmu-miR- CLL 30e/rno-miR-30e hsa-miR-20b/mmu-miR- CLL 20b/rno-miR-20b-5p hsa-miR-374a CLL hsa-let-7f/mmu-let-7f/rno- CLL let-7f hsa-miR-335/mmu-miR- CLL 335-5p/rno-miR-335 hsa-miR-142-5p/mmu- CLL miR-142-5p/rno-miR-142- 5p hsa-miR-486-5p/mmu- CLL miR-486 hsa-miR-33a/mmu-miR- CLL 33/rno-miR-33 hsa-miR-30b/mmu-miR- CLL 30b/rno-miR-30b-5p hsa-miR-768-3p CLL hsa-miR-668/mmu-miR- CLL 668 hsa-miR-15b/mmu-miR- CLL 15b/rno-miR-15b hsa-miR-196a*/mmu- CLL miR-196a*/rno-miR-196a* hsa-miR-140-3p/mmu- CLL miR-140*/rno-miR-140* hsa-miR-29b/mmu-miR- CLL 29b/rno-miR-29b hsa-miR-29c/mmu-miR- CLL 29c/rno-miR-29c hsa-miR-186/mmu-miR- CLL 186/rno-miR-186 hsa-miR-106a CLL hsa-miR-26a/mmu-miR- CLL 26a/rno-miR-26a hsa-miR-106b/mmu-miR- CLL 106b/rno-miR-106b hsa-miR-17/mmu-miR- CLL 17/rno-miR-17-5p/rno- miR-17 hsa-miR-191/mmu-miR- CLL 191/rno-miR-191 hsa-miR-20a/mmu-miR- CLL 20a/rno-miR-20a hsa-miR-30c/mmu-miR- CLL 30c/rno-miR-30c hsa-miR-26b/mmu-miR- CLL 26b/rno-miR-26b hsa-miR-147 CLL hsa-miR-15a/mmu-miR- CLL 15a hsa-miR-30d/mmu-miR- CLL 30d/rno-miR-30d hsa-miR-199a-5p/mmu- CLL miR-199a-5p/rno-miR- 199a-5p hsa-miR-29a/mmu-miR- CLL 29a/rno-miR-29a hsa-miR-223/mmu-miR- CLL 223/rno-miR-223 hsa-miR-30a/mmu-miR- CLL 30a/rno-miR-30a hsa-miR-16/mmu-miR- CLL 16/rno-miR-16 hsa-miR-451/mmu-miR- CLL 451/rno-miR-451 hsa-miR-24-1*/mmu-miR- CLL 24-1*/rno-miR-24-1* hsa-miR-550 CLL hsa-miR-342-3p/mmu- CLL miR-342-3p/rno-miR-342- 3p hsa-miR-195/mmu-miR- CLL 195/rno-miR-195 hsa-miR-801/mmu-miR- CLL 801 hsa-miR-541* CLL hsa-let-7i/mmu-let-7i/rno- CLL let-7i hsa-miR-155 CLL hsa-miR-185/mmu-miR- CLL 185/rno-miR-185 hsa-miR-891a CLL hsa-miR-138-1*/mmu- CLL miR-138*/rno-miR-138* hsa-miR-27b/mmu-miR- CLL 27b/rno-miR-27b hsa-miR-361-5p/mmu- CLL miR-361/rno-miR-361 hsa-miR-129* CLL hsa-miR-638 CLL hsa-miR-34b/mmu-miR- CLL 34b-3p hsa-miR-107/mmu-miR- CLL 107/rno-miR-107 hsa-miR-549 CLL hsa-miR-888* CLL hsa-miR-423-3p/mmu- CLL miR-423-3p/rno-miR-423 hsa-let-7e/mmu-let- HL 7e/rno-let-7e hsa-miR-125a-5p/mmu- HL miR-125a-5p/rno-miR- 125a-5p hsa-miR-576-3p HL hsa-miR-513a-5p HL ebv-miR-BART17-5p HL hsa-miR-185/mmu-miR- HL 185/rno-miR-185 hsa-miR-921 HL hsa-miR-518c* HL hsa-miR-520d-5p HL hsa-miR-939 HL hsa-miR-634 HL hsa-miR-491-3p HL ebv-miR-BART2-3p HL hsa-miR-30c-2*/mmu- HL miR-30c-2*/rno-miR-30c- 2* hsa-miR-765 HL hsa-miR-923 HL hsa-miR-620 HL hsa-miR-933 HL hsa-miR-143/mmu-miR- HL 143/rno-miR-143 hsa-miR-494/mmu-miR- HL 494/rno-miR-494 hsa-miR-665 HL hsa-miR-642 HL hsa-miR-126*/mmu-miR- HL 126-5p/rno-miR-126* hsa-miR-658 HL hsa-miR-149* HL hsa-miR-30b* HL mghv-miR-M1-4 HL hsa-miR-99a/mmu-miR- HL 99a/rno-miR-99a hsa-miR-193a-5p HL hsa-miR-498 HL hsa-miR-628-3p HL hsa-miR-185* HL hsa-miR-371-5p HL hsa-miR-199b-5p HL hsa-miR-126/mmu-miR- HL 126-3p/rno-miR-126 hsa-miR-503 HL hsa-miR-10a/mmu-miR- HL 10a/rno-miR-10a-5p hsa-miR-300 HL hsa-miR-583 HL hsa-miR-518a-5p/hsa- HL miR-527 hsa-miR-10b/mmu-miR- HL 10b/rno-miR-10b hsa-miR-145/mmu- HL miR-145/rno-miR- 145 hsa-miR-128/mmu- HL miR-128/rno-miR- 128 hsa-miR-532- HL 5p/mmu-miR-532- 5p/rno-miR-532-5p hsa-miR-143* HL hsa-miR-28-3p/rno- HL miR-28* hsa-miR- HL 130b*/mmu-miR- 130b* hsa-miR-505/rno- HL miR-505 hsa-miR-25* HL hsa-miR-574- HL 3p/mmu-miR-574-3p hsa-miR-455-3p HL kshv-miR-K12-3 HL hsa-miR-516b HL kshv-miR-K12-8 HL hsa-miR-502-3p HL kshv-miR-K12-6-3p HL hsa-miR-129- HL 5p/mmu-miR-129- 5p/rno-miR-129 hsa-miR-515-5p HL hsa-miR-199a- HL 3p/hsa-miR-199b- 3p/mmu-miR-199a- 3p/mmu-miR- 199b/rno-miR-199a- 3p hsa-miR-149/mmu- HL miR-149 hsa-miR-889 HL hsa-miR-637 HL hsa-miR-600 HL hsa-miR-151-3p HL hsa-miR-656 HL hsa-miR-497/mmu- HL miR-497/rno-miR- 497 hsa-miR-152/mmu- HL miR-152/rno-miR- 152 hsa-miR-100/mmu- HL miR-100/rno-miR- 100 hsa-miR-425/mmu- HL miR-425/rno-miR- 425 hsa-miR-145*/mmu- HL miR-145* hsa-miR-365/mmu- HL miR-365/rno-miR- 365 hsa-miR-422a HL hcmv-miR-UL70-3p HL hsa-miR-27a*/mmu- HL miR-27a*/rno-miR- 27a* hsa-miR-194/mmu- HL miR-194/rno-miR- 194 hsa-miR-548d-5p HL hsa-miR-187* HL hsa-miR-323- HL 3p/mmu-miR-323- 3p/rno-miR-323 hsa-miR-708/mmu- HL miR-708/rno-miR- 708 hsa-miR-29c*/mmu- HL miR-29c*/rno-miR- 29c* hsa-miR-513a-3p HL hsa-miR-595 HL hsa-miR-483-3p HL hsa-miR-330- HL 5p/mmu-miR- 330/rno-miR-330 hsa-miR-519e* HL hsa-miR-509-3p HL hsa-miR-328/mmu- HL miR-328/rno-miR- 328 hsa-miR-373* HL hsa-miR-96/mmu- HL miR-96/rno-miR-96 hsa-miR-215 HL hsa-miR-589 HL hsa-miR-34c- HL 5p/mmu-miR- 34c/rno-miR-34c hsa-miR-125b/mmu- HL miR-125b-5p/rno- miR-125b-5p hsa-miR-130a/mmu- HL miR-130a/rno-miR- 130a hsa-miR-519c- HL 5p/hsa-miR-519b- 5p/hsa-miR- 523*/hsa-miR- 518e*/hsa-miR- 522*/hsa-miR-519a* mghv-miR-M1-7-5p HL hsa-miR-516a-5p HL hsa-miR-424 HL hsa-miR-17*/rno- HL miR-17-3p hsa-miR-296- HL 5p/mmu-miR-296- 5p/rno-miR-296* hsa-miR-550* HL hsa-miR-210/mmu- HL miR-210/rno-miR- 210 hsa-miR-92b/mmu- HL miR-92b/rno-miR- 92b hsa-miR-548b-3p HL hsa-miR-652/mmu- HL miR-652/rno-miR- 652 hsa-miR-138/mmu- HL miR-138/rno-miR- 138 hsa-miR-194* HL hsa-miR-23a*/rno- HL miR-23a* hsa-miR-153/mmu- HL miR-153/rno-miR- 153 hsa-miR-586 HL hsa-miR-137/mmu- HL miR-137/rno-miR- 137 hsa-miR-610 HL hsa-miR-381/mmu- HL miR-381/rno-miR- 381 hsa-miR-936 HL hsa-miR-744/mmu- HL miR-744 ebv-miR-BART5 HL ebv-miR-BHRF1-1 HL hsa-miR-21* HL hsa-miR-576-5p HL mghv-miR-M1-6 HL hsa-miR-193b HL hsa-miR-10a*/mmu- HL miR-10a*/rno-miR- 10a-3p hsa-miR-524-5p HL hsa-miR-452 HL hsa-miR-345 HL hsa-miR-7-2* HL hsa-miR-409- HL 5p/mmu-miR-409- 5p/rno-miR-409-5p hsa-miR-557 HL hsa-miR-181a/mmu- HL miR-181a/rno-miR- 181a hsa-miR-22*/mmu- HL miR-22*/rno-miR-22* hsa-miR-922 HL hsa-miR-92b* HL hsa-miR-938 HL hsa-miR-526a/hsa- HL miR-520c-5p/hsa- miR-518d-5p hsa-miR-526b* HL ebv-miR-BHRF1-2 HL hiv1-miR-H1 HL hsa-miR-623 HL mghv-miR-M1-2 HL mghv-miR-M1-7-3p HL hsa-miR-519e HL hsa-miR-650 HL hsa-miR-766 HL hsa-miR-602 HL hsa-miR-425*/mmu- HL miR-425* hsa-miR- HL 135a*/mmu-miR- 135a* HL hsa-miR-612 HL hsa-miR-212/mmu- HL miR-212/rno-miR- 212 hsa-miR-125b- HL 2*/rno-miR-125b* hcmv-miR-UL112 HL hsa-miR-374b* hsa-miR-886-5p HL hsa-miR-500 HL hsa-miR-502-5p HL ebv-miR-BART18- HL 3p hsa-miR-198 HL hsa-miR-500* HL hsa-miR-342- HL 5p/mmu-miR-342- 5p/rno-miR-342-5p hsa-miR-124*/mmu- HL miR-124*/rno-miR- 124* hsa-miR-30c- HL 1*/mmu-miR-30c- 1*/rno-miR-30c-1* hsa-miR-220c HL hsa-miR-376a* HL hsa-miR-640 HL hcmv-miR-UL148D HL hsa-miR-659 HL hsa-miR-934 HL hsa-miR-125a- HL 3p/mmu-miR-125a- 3p/rno-miR-125a-3p hsa-miR-885-5p HL hsa-miR-24- HL 2*/mmu-miR-24- 2*/rno-miR-24-2* hsa-miR-484/mmu- HL miR-484/rno-miR- 484 hsa-miR- HL 106b*/mmu-miR- 106b*/rno-miR- 106b* hsa-miR-505* HL hsa-let-7b*/mmu-let- HL 7b*/rno-let-7b* hsa-miR-302c* HL hsa-miR-542- HL 5p/mmu-miR-542- 5p/rno-miR-542-5p hsv1-miR-H1 HL mghv-miR-M1-3 HL hsa-miR-183/mmu- HL miR-183/rno-miR- 183 hsa-miR-122* HL hsa-miR-183*/mmu- HL miR-183* hsa-miR-675 HL hsa-miR-99b/mmu- HL miR-99b/rno-miR- 99b hsa-miR-874/mmu- HL miR-874/rno-miR- 874 ebv-miR-BART20- HL 3p hsa-miR-483-5p HL hsa-miR-671- HL 5p/mmu-miR-671-5p hsa-miR-629 HL hsa-miR-553 HL hsa-let-7d*/mmu-let- HL 7d*/rno-let-7d* hsa-miR-601 HL hsa-miR-645 HL hsa-miR-920 HL hsa-miR-525-5p HL hsa-miR-221* HL hsa-miR-890 HL hsa-miR-492 HL hsa-miR-629* HL hsa-miR-635 HL hsa-miR-130b/mmu- HL miR-130b/rno-miR- 130b hsa-miR-197/mmu- HL miR-197 hsa-miR-654-5p HL hsa-miR-518b HL hsa-miR-382/mmu- HL miR-382/rno-miR- 382 hsa-miR-584 HL hsa-miR-99b*/mmu- HL miR-99b*/rno-miR- 99b* hsa-miR-630 HL hsa-miR-490-5p HL hsa-miR-663 HL hsa-miR-337-3p HL hsa-miR-9*/mmu- HL miR-9*/rno-miR-9* hsa-miR-202 HL ebv-miR-BART16 HL ebv-miR-BART9* HL hsa-miR-193b* HL ebv-miR-BART8* HL hsa-miR-206/mmu- HL miR-206/rno-miR- 206 hcmv-miR-US25-1* HL hsa-miR-514 HL kshv-miR-K12-6-5p HL hsa-miR-488 HL hsa-miR-508-5p HL hsa-miR-551b* HL hsa-miR-377* HL ebv-miR-BART6-3p HL hsa-miR-181b/mmu- HL miR-181b/rno-miR- 181b hsa-miR-526b HL hsa-miR-622 HL kshv-miR-K12-1 HL hsa-miR-485- HL 3p/mmu-miR-485* hsa-miR-490- HL 3p/mmu-miR-490 hsa-miR-125b- HL 1*/mmu-miR-125b- 3p/rno-miR-125b-3p hsa-miR-124/mmu- HL miR-124/rno-miR- 124 hsa-miR-657 HL ebv-miR-BHRF1-3 HL hsa-miR-542- HL 3p/mmu-miR-542- 3p/rno-miR-542-3p kshv-miR-K12-5 HL hsa-miR-943 HL hsa-miR-551a HL hsa-miR-297/mmu- HL miR-297a hsa-miR-296- HL 3p/mmu-miR-296- 3p/rno-miR-296 hsa-miR-617 HL hsa-miR-195* HL hsa-miR-575 HL hsa-miR-208a/mmu- HL miR-208a/rno-miR- 208 hsa-miR-647 HL hsa-miR-509-3-5p HL hsa-miR-340*/mmu- HL miR-340-3p/rno- miR-340-3p hsa-miR-220b HL hsa-miR- HL 200b*/mmu-miR- 200b* hsa-miR-585 HL hsa-miR-877/mmu- HL miR-877/rno-miR- 877 hsa-miR-326/mmu- HL miR-326/rno-miR- 326 ebv-miR-BART7* HL hsa-miR-615- HL 3p/mmu-miR-615-3p hsa-miR-433/mmu- HL miR-433/rno-miR- 433 hsa-miR-338- HL 5p/mmu-miR-338- 5p/rno-miR-338* hsa-miR-299-3p HL hsa-miR-518a-3p HL hsa-miR-181a-2* HL hsa-miR-552 HL

TABLE 30 Predictor microRNAs that distinguish follicular lymphoma from Hodgkin's lymphoma Higher FL vs HL in hsa-miR-301a/mmu-miR- FL 301a/rno-miR-301a kshv-miR-K12-7 FL hsa-miR-96/mmu-miR- FL 96/rno-miR-96 hsa-miR-151-5p/mmu- FL miR-151-5p/rno-miR-151 hsa-miR-28-5p/mmu-miR- FL 28/rno-miR-28 hsa-miR-302a/mmu-miR- FL 302a hsa-miR-215 FL hsa-miR-15b/mmu-miR- FL 15b/rno-miR-15b hsa-miR-29b/mmu-miR- FL 29b/rno-miR-29b hsa-miR-138/mmu-miR- FL 138/rno-miR-138 hsa-miR-363/mmu-miR- FL 363/rno-miR-363 hsa-miR-142-5p/mmu- FL miR-142-5p/rno-miR-142- 5p hsa-miR-19a/mmu-miR- FL 19a/rno-miR-19a hsa-miR-497/mmu-miR- FL 497/rno-miR-497 hsa-miR-144* FL hsa-miR-16/mmu-miR- FL 16/rno-miR-16 hsa-miR-138-1*/mmu- FL miR-138*/rno-miR-138* hsa-miR-768-5p FL hsa-miR-30c/mmu-miR- FL 30c/rno-miR-30c hsa-miR-129* FL hsa-miR-801/mmu-miR- FL 801 hsa-miR-34b/mmu-miR- FL 34b-3p hsa-miR-363*/rno-miR- FL 363* hsa-miR-20b* FL hsa-miR-550 FL hsa-miR-600 FL hsa-miR-196a*/mmu- FL miR-196a*/rno-miR-196a* hsa-miR-574-3p/mmu- FL miR-574-3p hsa-miR-620 FL hsa-miR-331-3p/mmu- FL miR-331-3p/rno-miR-331 hsa-let-7e/mmu-let- FL 7e/rno-let-7e hsa-miR-524-5p FL hsa-miR-197/mmu-miR- FL 197 hsa-miR-24-1*/mmu-miR- FL 24-1*/rno-miR-24-1* hsa-miR-519e* HL hsa-miR-628-3p HL mghv-miR-M1-7-5p HL hsa-miR-498 HL hsa-miR-525-5p HL hsa-miR-520d-5p HL hsa-miR-551b* HL hsa-miR-340*/mmu- HL miR-340-3p/rno- miR-340-3p hsa-miR-889 HL hsa-miR-494/mmu- HL miR-494/rno-miR- 494 hsa-miR-874/mmu- HL miR-874/rno-miR- 874 hsa-miR-30c- HL 2*/mmu-miR-30c- 2*/rno-miR-30c-2* hsa-miR-183*/mmu- HL miR-183* hsa-miR-25* HL hsa-miR-513a-5p HL hsa-miR-198 HL hsa-miR-659 HL mghv-miR-M1-4 HL hsa-miR-129- HL 5p/mmu-miR-129- 5p/rno-miR-129 ebv-miR-BART13 HL hsa-miR-193b* HL hsa-miR-422a HL hsa-miR-503 HL kshv-miR-K12-3 HL hsa-miR-766 HL hsa-miR-516a-5p HL hsa-miR-125b- HL 1*/mmu-miR-125b- 3p/rno-miR-125b-3p hsa-miR-149* HL ebv-miR-BART6-3p HL ebv-miR-BART19-3p HL hsa-miR-671- HL 5p/mmu-miR-671-5p ebv-miR-BART8* HL hsa-miR-509-3-5p HL hsa-miR-602 HL ebv-miR-BHRF1-1 HL mghv-miR-M1-7-3p HL mghv-miR-M1-2 HL hsa-miR-675 HL ebv-miR-BHRF1-2 HL hsa-miR-145*/mmu- HL miR-145* hsa-miR-296-5p/mmu- HL miR-296-5p/rno-miR- 296* hsa-miR-17*/rno-miR- HL 17-3p hsa-miR-452 HL hsa-miR-943 HL hsa-miR-326/mmu-miR- HL 326/rno-miR-326 hsa-miR-652/mmu-miR- HL 652/rno-miR-652 hsa-miR-623 HL hsa-miR-194* HL hsa-miR-557 HL hsa-miR-125a-3p/mmu- HL miR-125a-3p/rno-miR- 125a-3p hsa-miR-425*/mmu- HL miR-425* hsa-miR-10a*/mmu- HL miR-10a*/rno-miR-10a- 3p hsa-miR-323-3p/mmu- HL miR-323-3p/rno-miR- 323 hsa-miR-519e HL hsa-miR-502-5p HL hsa-miR-124*/mmu- HL miR-124*/rno-miR-124* hsa-miR-345 HL hsa-miR-584 HL hsa-miR-654-5p HL hsa-miR-331-5p/mmu- HL miR-331-5p hsa-miR-650 HL hsa-miR-202 HL hsa-miR-548b-3p HL hsa-miR-492 HL hsa-miR-135a*/mmu- HL miR-135a* ebv-miR-BART20-3p HL hsa-miR-586 HL hsa-miR-338-5p/mmu- HL miR-338-5p/rno-miR- 338* hsa-miR-92b* HL hiv1-miR-H1 HL hsa-miR-508-5p HL hsa-miR-542-5p/mmu- HL miR-542-5p/rno-miR- 542-5p hsa-miR-490-5p HL hsa-miR-663 HL hsa-miR-433/mmu-miR- HL 433/rno-miR-433

Claims

1. A composition comprising an isolated nucleic acid molecule having at least 80% sequence identity to any one of SEQ ID NOs: 763-1350 or 1565 or a complementary sequence thereof.

2. The composition of claim 1, wherein the isolated nucleic acid molecule is a nucleic acid molecule having at least 90% sequence identity to any one of SEQ ID NOs: 763-1350 or 1565 or a complementary sequence thereof.

3. (canceled)

4. The composition of claim 1, wherein the isolated nucleic acid molecule is a nucleic acid molecule comprising any one of SEQ ID NOs: 763-1350 or 1565 or a complementary sequence thereof.

5. The composition of claim 1, wherein the isolated nucleic acid molecule is a miRNA precursor molecule having the sequence of SEQ ID NOs: 763-1350 or 1565, or a DNA molecule coding the miRNA.

6. The composition of claim 1, wherein the isolated nucleic acid molecule is either single-stranded or at least partially double-stranded.

7. (canceled)

8. The composition of claim 1, wherein the isolated nucleic acid molecule is selected from RNA or DNA molecules.

9. The composition of claim 1, wherein the isolated nucleic acid molecule is a cDNA that corresponds to any one of SEQ ID NOs: 763-1350 or 1565.

10. The composition of claim 1, wherein the isolated nucleic acid molecule comprises at least one modified nucleotide analog.

11. The composition of claim 1, further comprising a carrier or vehicle, wherein the isolated nucleic acid molecule is suitable as a marker or modulator of a B cell malignancy, and wherein the carrier or vehicle is a pharmaceutically acceptable carrier or vehicle suitable for diagnostic or therapeutic applications.

12-14. (canceled)

15. The composition of claim 1, wherein the isolated nucleic acid molecule is operably linked to a recombinant expression vector.

16. A cell comprising the recombinant expression vector of claim 15.

17. (canceled)

18. (canceled)

19. A method of identifying a B cell malignancy in a subject comprising determining the level of expression of at least one microRNA in a sample comprising a B cell taken from the subject relative the level of expression of the at least one microRNA in a control sample, wherein the at least one microRNA is selected from the microRNAs listed in any one of Tables 4 and 7 to 35.

20. (canceled)

21. The method of claim 19, wherein the B cell malignancy is one of at least two potential B cell malignancies, wherein at least two of the potential B cell malignancies are derived from different B cell stages.

22. (canceled)

23. The method of claim 19, wherein the B cell malignancy is selected from chronic lymphocytic leukemia, follicular lymphoma, Hodgkin's lymphoma, activated B-cell diffuse large B cell lymphoma (DLBCL), germinal center-like DLBCL, and Burkitt lymphoma.

24-34. (canceled)

35. A kit comprising one or more sequences selected from a group consisting of

(a) at least one primer sequence that can detect any one of SEQ ID NOs: 763-1350 or 1565, or a combination thereof;
(b) at least one isolated nucleic acid molecule having a sequence of any one of SEQ ID NOs: 1351-1564;
(c) the isolated nucleic acid molecule of claim 1; and
(d) any combination of (a)-(c).

36. (canceled)

37. The kit of claim 35, wherein (a) further comprises enzymes and reagents that are adequate for performing an RT-PCR reaction.

38-41. (canceled)

42. The method of claim 19, further comprising determining whether the B cell malignancy in the sample is Burkitt lymphoma, activated B cell-like diffuse large B cell lymphoma (DLBCL), or germinal center-like DLBCL, comprising determining the level of expression of at least one microRNA in the sample relative to the level of expression of the at least one microRNA in the control sample, wherein the at least one microRNA is selected from the microRNAs listed in Table 7, column “GCBvsBL”; Table 7, column “GCBvsABC”; Table 8, column “ABCvsBL”; Table 10, column “BL miRNA list”; Table 10, column “GCB miRNA list”; Table 11; Table 14, column “BL High”; Table 14, column “ABC High”; Table 14, column “GCB High”; Table 32; or Table 35.

43. The method of claim 42, comprising determining the level of expression of at least one microRNA selected from the microRNAs listed in Table 10, column “BL miRNA list”, and Table 14, column “BL High”; determining the level of expression of at least one microRNA selected from the microRNAs listed in Table 11 and Table 14, column “ABC High”; and determining the level of expression of at least one microRNA selected from the microRNAs listed in Table 10, column “GCB miRNA list”, and Table 14, column “GCB High”.

44. The method of claim 43, wherein at least one microRNA is listed in only one column selected from the columns labeled “GCBvsBL” or “GCBvsABC” in Table 7 or “ABCvsBL” in Table 8.

45. The method of claim 42, wherein at least one microRNA is listed in no more than two columns selected from the columns labeled “GCBvsBL” or “GCBvsABC” in Table 7 or “ABCvsBL” in Table 8.

Patent History
Publication number: 20120302626
Type: Application
Filed: Dec 3, 2010
Publication Date: Nov 29, 2012
Inventors: Sandeep Dave (Chapel Hill, NC), Cassandra Jacobs (Durham, NC)
Application Number: 13/513,757