Abstract: The present invention describes a vegetable oil comprising a polyunsatured fatty acid having at least 20 carbon atoms (LC-PUFA), which oil has (a) an anisidine value (AnV) of less than 25; (b) a peroxide value (POV) of less than 10; (c) a triglyceride content of greater than 90%; and/or (d) an Oil Stability Index (OSI) of greater than 5 hours at 80° C.

Abstract: Compositions and methods are described for preparing media, feeds, and supplements. Such methods and medias may display increased stability of labile components and may use, for example, microsuspension and/or encapsulation technologies, chelation, and optionally, coating and/or mixing the labile compounds with anti-oxidants. The compositions may withstand thermal and/or irradiation treatment and have reduced virus number. These techniques may result in product with extended shelf-life, extended release of their internal components into culture, or in product that can be added aseptically into a bioreactor using minimal volumes. The compositions and methods may optimize the bioproduction workflow and increase efficiency.

Abstract: The present invention relates to recombinant filamentous fungal host cells producing cellulolytic enzyme compositions and methods of producing and using the compositions.

Abstract: The present invention relates to peptides, proteins, nucleic acids and cells for use in immunotherapeutic methods. In particular, the present invention relates to the immunotherapy of cancer. The present invention furthermore relates to tumor-associated T-cell peptide epitopes, alone or in combination with other tumor-associated peptides that can for example serve as active pharmaceutical ingredients of vaccine compositions that stimulate anti-tumor immune responses, or to stimulate T cells ex vivo and transfer into patients. Peptides bound to molecules of the major histocompatibility complex (MHC), or peptides as such, can also be targets of antibodies, soluble T-cell receptors, and other binding molecules.

Abstract: Methods and systems for performing optogenetics using X-rays or ultrasound waves are provided. Visible-light-emitting nanophosphors can be provided to a sample, and X-ray stimulation can be used to stimulate the nanophosphors to emit visible light. Alternatively, ultrasonic waves can be provided to the sample to cause sonoluminescence, also resulting in emission of visible light, and this can be aided by the use of a chemiluminescent agent present in the sample. The emitted light can trigger changes in proteins that modulate membrane potentials in neuronal cells.

Abstract: Disclosed are a medium composition for culturing Clostridium botulinum comprising a potato peptone, a yeast extract and glucose, and a method of preparing a botulinum toxin using the same. The medium excludes animal-derived products and major allergens, and enables the botulinum toxin-producing strain to reach the maximum growth level within a short time, thereby providing effects of shortening the production time and reducing the production cost in the botulinum toxin production process.

Abstract: The present invention provides modified aminoacyl-tRNA synthetases (ARSs) having increased reactivity with N-methyl amino acids compared to natural aminoacyl-tRNA synthetases. The modified aminoacyl-tRNA synthetases according to the present invention can aminoacylate tRNAs with their corresponding N-methyl-substituted amino acids such as N-methyl-phenylalanine, N-methyl-valine, N-methyl-serine, N-methyl-threonine, N-methyl-tryptophan and N-methyl-leucine more efficiently than natural aminoacyl-tRNA synthetases. The present invention enables a more efficient production of polypeptides containing N-methyl amino acids.

Abstract: In certain embodiments, the invention provides a method of purifying a protein of interest from a mixture which comprises the protein of interest and one or more contaminants.

Abstract: This disclosure describes methods for organoid generation including, for example, for generation of a multi-tissue organoid. The multi-tissue organoid may include cartilage, bone, epithelium, and/or fibrous connective tissue. This disclosure further describes methods for isolating cells from the organoids and methods of using the organoids and cells of the organoids.

Abstract: Antigen binding proteins that bind to human CGRP receptor (CGRP R) are provided. Nucleic acids encoding the antigen binding protein, vectors, and cells encoding the same are also provided. The antigen binding proteins can inhibit binding of CGRP R to CGRP, and are useful in a number of CGRP R related disorders, including the treatment and/or prevention of migraine headaches.

Abstract: Disclosed herein is a method and system for converting biomass to biofuel, comprising a reaction apparatus including: a reaction tank configured to hold a process fluid; at least one mechanical rotating device comprising: a submergible chamber configured to operate within process, the submergible chamber having a first section including a first rotatable member and configured to receive biomass feedstock; a second section including a second rotatable member and configured to process biomass feedstock; and a third section including a third rotatable member and configured to treat the processed biomass feedstock effective to convert the processed biomass feedstock; a shaft in operable communication with each of the first, second, and third rotatable members for rotating said rotatable members about an axis; and a drive source for driving the shaft about said axis. Also disclosed herein are kits and methods for using the disclosed system to produce biofuel.

Abstract: Described herein are single chain polypeptides comprising both the b- and a-chains of insulin fused to each other by a linker. Also provided are nucleic acids coding for the same, host cells expressing the same, and methods of use therefor.

Abstract: Provided herein are genetically modified cells and genetically modified plants having increased or decreased expression of a cellulose synthase like G (CSLG) enzyme. These cells and plants may have an increased or decreased content a steroidal alkaloid, a steroidal saponin, or a triterpenoid saponin, compared to a corresponding unmodified cell or plant. Also provided herein are methods of producing a steroidal alkaloid, a steroidal saponin, or a triterpenoid saponin in a genetically modified cell, as well as methods of reducing the content of a steroidal alkaloid, a steroidal saponin, or a triterpenoid saponin in a cell of a plant or a plant part, and methods of increasing the content of a steroidal alkaloid, a steroidal saponin, or a triterpenoid saponin in a cell of a plant or a plant part.

Abstract: A cell culture matrix is provided that has a substrate with a first side, a second side opposite the first side, a thickness separating the first side and the second side, and a plurality of openings formed in the substrate and passing through the thickness of the substrate. The plurality of openings allow flow of at least one of cell culture media, cells, or cell products through the thickness of the substrate, and provides a uniform, efficient, and scalable matrix for cell seeding, proliferation, and culturing. The substrate can be formed from a woven polymer mesh material that provides a high surface area to volume ratio for cells and good fluid flow through the matrix. Bioreactor systems incorporating the cell culture matrix and related methods are also provided.

Abstract: The present disclosure relates to biological processes and systems for the production of isopropanol and/or acetone utilizing modified alcohol dehydrogenases that exhibit increased activity with NADH as a cofactor. The disclosure further relates to polynucleotides and polypeptides of the modified alcohol dehydrogenases, and host cells containing the polynucleotides and expressing the polypeptides.

Abstract: A method for separating at least one target compound from a feed solution is provided. The method includes filling a bioprocess package with a chromatography resin. The bioprocess package includes a 2D flexible container comprising an interior compartment, a height having an upper half and a lower half, an inlet and an outlet, the inlet and the outlet being disposed on the same half of the 2D flexible container, the channel-forming feature being configured to maintain a fluid flow path that fluidly connects the interior compartment of the flexible container with the outlet. The method further includes flowing a feed solution into the bioprocess package to contact the chromatography resin such that substantially all of the at least one target compound binds to the chromatography resin, washing the chromatography resin in the bioprocess package, and eluting the chromatography resin.

Abstract: The disclosure discloses an anti-metabolic disorder FGF analog and an application thereof, and belongs to the technical field of medicines. According to the disclosure, modification is performed based on an FGF19 mutant NGM282 to obtain a FGF19 analog, and the FGF19 analog is used in treating liver impairment, metabolic disorders, obesity, overweight, metabolic syndrome, diabetes and dyslipidemia and has no side effects of elevated cholesterol and dietary decline in a therapeutic process.

Abstract: The present invention provides process for treating crop kernels, comprising the steps of a) soaking kernels in water to produce soaked kernels; b) grinding the soaked kernels; c) treating the soaked kernels in the presence of an effective amount of GH62 polypeptide having arabinofuranosidase activity or a GH43 polypeptide having arabinofuranosidase activity, wherein step c) is performed before, during or after step b).

Abstract: The present invention relates to a growth hormone receptor antagonist comprising a growth hormone variant which is modified by substitution of one or more amino acids of growth hormone. Further, the growth hormone receptor antagonist of the present invention may further comprise a long-acting carrier which is fused to the growth hormone variant. The growth hormone receptor antagonist may have strong binding potency to growth hormone receptor and may exhibit a long-lasting antagonistic action.

Abstract: The present invention is directed to a bioconjugate vaccine, such as an O 1-bioconjugate vaccine, comprising: a protein carrier comprising a protein carrier containing at least one consensus sequence, DIE-X-N-Z-S/T, wherein X and Z may be any natural amino acid except proline; at least one antigenic polysaccharide from at least one pathogenic bacterium, linked to the protein carrier; and, optionally, an adjuvant. In another aspect, the present invention is directed to a method of producing an O 1-bioconjugate in a bioreactor comprising a number steps.

Abstract: The invention provides non-naturally occurring microbial organisms having a 4-hydroxybutyrate, 1,4-butanediol, or other product pathway and being capable of producing 4-hydroxybutyrate, 1,4-butanediol, or other product, wherein the microbial organism comprises one or more genetic modifications. The invention additionally provides methods of producing 4-hydroxybutyrate, 1,4-butanediol, or other product or related products using the microbial organisms.

Abstract: A method comprising obtaining a substantially cell-free sample of blood plasma or blood serum from a subject with osteoarthritis; and detecting a presence of or measuring a level of novel_miRNA_1 (gucuggcucaggguuggg) (SEQ ID NO: 1), novel_miRNA_2 (ucccuguucgggcgccacu) (SEQ ID NO: 2), novel_miRNA_3 (uguuuagcauccuguagccugc) (SEQ ID NO: 3), and novel_miRNA_4 (uaguggguuaucagaacu) (SEQ ID NO: 4). Also provided are methods where additional miRNAs are detected including novel miRNA 5 (SEQ ID NO: 5), novel miRNA 6 (SEQ ID NO: 6), novel miRNA 7 (SEQ ID NO: 7), novel miRNA 8 (SEQ ID NO: 8), novel miRNA 9 (SEQ ID NO: 9), novel miRNA 10 (SEQ ID NO: 10), novel miRNA 11 (SEQ ID NO: 11), novel miRNA 12 (SEQ ID NO: 12), novel miRNA 13 (SEQ ID NO: 13), hsa-miR-335-3p, hsa-miR-199a-5p, hsa-miR-671-3p, hsa-miR-1260b, hsa-miR-191-3p, hsa-miR-335-5p and/or hsa-miR-543.

Abstract: The invention relates to a method for microbial remediation of underground water petroleum hydrocarbon contamination by regulating soil buffer capability, which comprises detecting the soil particle size of contaminated site soil, dividing the contaminated site soil into coarse-grained soil and fine-grained soil; dividing the contaminated site soil into high buffer capacity soil and low buffer capacity soil; and adjusting the composition and ratio of a biostimulant solution added to the contaminated site soil based on the classification of the contaminated site soil. The detecting step includes classifying soil with a particle size between 0.075 mm and 60 mm and a mass greater than or equal to 50% of the total mass as coarse-grained soil; and classifying soil with a particle size not greater than 0.075 mm and a mass greater than or equal to 50% as fine-grained soil.

Abstract: Generation of energy and storage of energy for subsequent use is provided by electromethanogenesis of carbon dioxide into a fuel gas and the storage of the fuel gas for subsequent use. An electromethanogenic reactor includes an anode conductor and a cathode conductor wherein the cathode conductor includes submicron to micron scale pores. Electromethanogenesis microbes and/or enzymes are located in the micron scale pores of the cathode electrode conductor. Carbon dioxide is introduced into the electromethanogenic reactor and the electromethanogenesis microbes/enzymes and the carbon dioxide interact and produce a fuel gas. The fuel gas is stored for subsequent use, for example use in power generation.

Abstract: A method for producing a microbial oil includes steps of: genetically modifying a labyrinthulid by disrupting and/or silencing a gene, or by transforming another gene in addition to the disruption and/or gene silencing of the gene, and culturing the labyrinthulid, such that a fatty acid composition accumulated in the labyrinthulid comprises an increased EPA content; and collecting the microbial oil having the increased EPA content from the labyrinthulid. The labyrinthulid before the modification is selected from (A) a labyrinthulid belonging to the genus Parietichytrium or genus Schizochytrium and having very weak or no activity of producing PUFAs via a PUFA-PKS pathway; and (B) a labyrinthulid belonging to the genus Thraustochytrium in which a host PUFA-PKS gene is disrupted or silenced to a very weak level. The increased EPA content is preferably not less than 11.5% of a total fatty acid composition.

Abstract: A cell culture device includes a culture unit, a gas supply unit, a first pressure unit, at least one inspecting unit and a control unit. The culture unit contains a cell culture liquid. The gas supply unit, connected with the culture unit, is used for transmitting a culture gas into the culture unit. The first pressure unit, connected with the culture unit, is used for applying a pressure to the cell culture liquid in the culture unit. The at least one inspecting unit, connected with the culture unit, is used for receiving the cell culture liquid for inspection. The control unit, electrically coupled with the culture unit, the first pressure unit, the gas supply unit and the at least one inspecting unit, is used for monitoring corresponding condition parameters to determine respective operations. In addition, a cell culture method for the cell culture device is also provided.

Abstract: A bioelectrochemical reactor (1) has an anode chamber (11) having at least two bioanodes (12, 13), and an anodic electrolyte (14) with an anodic electroactive microorganisms,—a cathode chamber (21) with at least one biocathode (22), and a cathodic electrolyte (24) with a cathodic electroactive microorganisms. The anode chamber (11) is separated from the cathode chamber (21) by, running from the anode chamber to the cathode chamber, a cation exchange membrane (31) and an anion exchange membrane (32). The cation and anion exchange membranes are separated from each other by an inter-membrane chamber (30), and means for applying a potential difference between the interconnected bioanodes and the biocathode/biocathodes. The bioanodes and biocathode/biocathodes have active surfaces such that the total active surface of the biocathode/biocathodes (22) is greater than the total active surface of the two bioanodes (12, 13).

Abstract: The invention is directed to compositions and methods for collecting, transporting, and storing, without refrigeration, biological materials, which may comprise samples of biological, clinical, forensic, and/or environmental origin. These compositions preserve the viability of the collected organisms and/or the RNA/DNA and proteins in the sample composition mixture and permit the long-term storage of samples. Compositions are compatible with subsequent manipulation of the sample, including propagation and culture of the collected microorganisms, or isolation, purification, detection, and characterization of proteins, nucleic acids, and other macromolecules.

Abstract: The invention relates to an immunization regimen whereby an infant is protected against respiratory syncytial virus (RSV) through administration of a first anti-RSV immune response inducing composition to his or her mother during pregnancy, followed by administration of a second anti-RSV immune response inducing composition to the infant after birth.

Abstract: Disclosed herein is a method and system for converting biomass to biofuel, comprising a reaction apparatus including: a reaction tank configured to hold a process fluid; at least one mechanical rotating device comprising: a submergible chamber configured to operate within process, the submergible chamber having a first section including a first rotatable member and configured to receive biomass feedstock; a second section including a second rotatable member and configured to process biomass feedstock; and a third section including a third rotatable member and configured to treat the processed biomass feedstock effective to convert the processed biomass feedstock; a shaft in operable communication with each of the first, second, and third rotatable members for rotating said rotatable members about an axis; and a drive source for driving the shaft about said axis. Also disclosed herein are kits and methods for using the disclosed system to produce biofuel.

Abstract: Thermostable Cas9 nucleases. The present invention relates to the field of genetic engineering and more particularly to nucleic acid editing and genome modification. The present invention provides in isolated Cas protein or polypeptide fragment thereof having an amino acid sequence of SEQ ID NO: 1 or a sequence of at least 77% identity therewith, wherein the Cas protein or polypeptide is capable of DNA cleavage at a temperature in the range 50° C. and 100° C. inclusive. The invention further provides isolated nucleic acid molecules encoding said Cas9 nucleases, expression vectors and host cells. The Cas9 nucleases disclosed herein provide novel tools for genetic engineering at elevated temperatures and are of particular value in the genetic manipulation of thermophilic organisms; particularly microorganisms.

Abstract: Use of the molecule with the following formula (I) for its fungicidal and/or bactericidal activity on fungi, oomycetes and/or pathogenic bacteria of plants and crop seeds.

Abstract: Methods for increasing carbon-based chemical product yield in an organism by perturbing redox balance in an organism as well as nonnaturally occurring organisms with perturbed redox balance and methods for their use in producing carbon-based chemical products are provided.

Abstract: Disclosed are materials and methods for improved single chain variable fragments.

Abstract: A system for quickly determining antibiotic sensitivity of a microorganism comprising a triangular-shaped plate and cover for culturing, recovering, and re-suspending recovered microbial colonies and a second triangular-shaped plate comprising a non-liquid medium cut with concentric trenches over which the re-suspended microbial colonies are distributed by centrifugation and contacted with antimicrobial strips or disks.

Abstract: A vacuum airlift system for treating an aqueous effluent includes an upflow liquid portion, where the upflow liquid portion is configured to retain a fluid, and a fluid inlet, the fluid inlet being fluidly coupled with the upflow liquid portion, where the fluid inlet is positioned at about a bottom of the upflow liquid portion. The vacuum airlift system can also include a downflow liquid portion, where the downflow liquid portion is fluidly coupled with the upflow liquid portion, and a fluid outlet, the fluid outlet being fluidly coupled with the downflow liquid portion, where the fluid outlet is positioned at about a bottom of the downflow liquid portion. The vacuum airlift system can also include a plurality of aerators fed by one or more fluidic oscillators, the plurality of aerators being coupled to the upflow liquid column.

Abstract: The present disclosure relates to a human FGF21 mutant with improved effectiveness and stability, preparation method and pharmaceutical composition comprising the mutant, and a use thereof, and specifically relates to a human fibroblast growth factor 21 (FGF21) mutant, a gene encoding the same, and a method for preparing the mutant and a method of using the mutant for treating type 2 diabetes, obesity, dyslipidemia, or metabolic disorders.

Abstract: This invention relates to a method of using a two-step serial centrifugation process in extracting nutritive oil from a fermentation broth, this novel method prevents oil yield losses while preserving product quality.

Abstract: Provided is a method of producing and isolating a diamine produced by microbial fermentation that minimizes undesirable salt formation to provide a lower cost process.

Abstract: Compositions are provided that contain sporulated coccidial oocysts, wherein the compositions are free of antibiotics and comprise formalin at a concentration sufficient to inhibit microbial growth for at least 12 months while maintaining oocyst viability. Methods of preparing such compositions are also provided.

Abstract: The present invention relates to an isolated humanized protein binding to human Glycoprotein VI (hGPVI) for treating a GPVI-related condition in a subject in need thereof, wherein said isolated humanized protein is to be administered during at least 2 hours to the subject, preferably during at least 4 to 6 hours.

Abstract: Provided is a method for intracellularly producing a large amount of a Cry protein in a Bacillus bacterium. A method for producing a Cry protein or a culture product comprising the Cry protein, comprising transforming a Bacillus bacterium with an expression plasmid incorporating a gene encoding the Cry protein operably linked to a regulatory region comprising a ?A-dependent promoter or a ?H-dependent promoter, and culturing the transformed cell, wherein the expression plasmid comprises a polynucleotide encoding a replication protein consisting of the amino acid sequence set forth in SEQ ID NO: 9 or a protein having an identity of 80% or more or more with the amino acid sequence of the replication protein and involved in replication initiation.

Abstract: The present invention provides process for treating crop kernels, comprising the steps of a) soaking kernels in water to produce soaked kernels; b) grinding the soaked kernels; c) treating the soaked kernels in the presence of an effective amount of GH62 polypeptide having arabinofuranosidase activity or a GH43 polypeptide having arabinofuranosidase activity, wherein step c) is performed before, during or after step b).

Abstract: Provided are an apparatus and a method for reaction for use in a co-precipitation reaction for preparing a catalyst or a cathode active material for a lithium secondary battery, which injects a raw material (a solution) at least between impellers according to the solution level in a vessel, thereby making a stirring speed uniform and, in particular, minimizing a concentration difference between solutions. The apparatus for the reaction may comprise: a reaction vessel; a stirring means provided inside the reaction vessel and having multistage impellers; and a raw material injecting means, comprising at least one injection nozzle connected to the reaction vessel, for injecting a raw material at least between impellers.

Abstract: Disclosed are peptides comprising amino acid residues of the dimer interface of human B7-1 and B7-2 and compositions and uses thereof.

Abstract: The present invention generally relates to methods of generating antibodies against a species of pathogen that involve identifying the pathogen that is most genetically representative of member of pathogen species and using the identified pathogen to generate an antibody.

Abstract: This invention relates to engineered CH2 domain molecules containing amino acids in the framework regions that confer enhanced stability and/or solubility. In particular, the invention provides engineered CH2 domain molecules containing amino acid residues that differ from a wild type CH2 domain or a template CH2 domain molecule within one or more framework regions and that result in improved stability and/or solubility.

Abstract: A gas separation apparatus includes a separation membrane module including at least one gas separation membrane element in a housing, a casing for blocking external air, and a heat source unit for adjusting a temperature of a heat medium with which the casing is filled. The casing holds greater than or equal to two separation membrane modules.

Abstract: The disclosure provides a method for biohydrogen production. The method includes: mixing a hydrogen production medium and a buffer solution Na2HPO4/NaH2PO4 having a pH value of 5-9, to yield a first mixture; adding corn stalk powder and cellulase to the first mixture and mixing, to yield a second mixture; adding a suspension of photosynthesis bacteria HAU-M1 at the late exponential phase to the second mixture, to yield a third mixture; and sealing the third mixture and allowing for photo-fermentation biohydrogen production under anaerobic fermentation conditions.

Abstract: Disclosed herein are functionalized hyaluronic acid (HA), a responsive elastic polymer system comprising functionalized HA, and methods of fabrication and utilization of the same. This polymer system may be used for controlled local or systemic drug delivery release of analgesics, anesthetics, antibiotics and other drugs as well as tissue engineering articles.