IDENTIFICATION OF SMALL MOLECULES THAT FACILITATE THERAPEUTIC EXON SKIPPING
This invention relates, e.g., to a method for enhancing exon skipping in a pre-mRNA of interest, comprising contacting the pre-mRNA with an effective amount of a small molecule selected from the compounds shown in Table 1, or a pharmaceutically acceptable salt, hydrate, solvate, or isomer thereof, and, optionally, with an antisense oligonucleotide that is specific for a splicing sequence in the pre-mRNA Methods for treating Duchenne muscular dystrophy (DMD) are disclosed.
Latest The Regents of the University of california Patents:
- USES OF HYDROGENATED CANNABIDIOL (H4CBD) AND ADVANCED METABOLIC SYNDROME
- Abiotic Catalytic Conversion of Carbon Dioxide to Sugars
- Neuronal Classification from Electrophysiological Recordings Based on Multimodal Deep Learning
- Reversible bioadhesive
- Systems and methods for coherent radiation from a swarm of wirelessly powered and synchronized sensor nodes
This application claims the benefit of the filing date of U.S. Provisional Application No. 61/700,661, filed Sep. 13, 2012, and is a CIP of PCT Application No. PCT/US2012/053157 filed Aug. 30, 2012, which claims the benefit of the filing date of U.S. Provisional Application No. 61/529,041, filed Aug. 30, 2011, all of which are incorporated by reference herein in their entireties.
This invention was made with Government support of Grant No. W81XWH-05-1-0616, awarded by the Department of Defense, and 5RC1AR058333, awarded by the National Institutes of Health. The Government has certain rights in this invention.
SEQUENCE LISTING Sequence ListingThe instant application contains a Sequence Listing which has been submitted in ASCII format via EFS-Web and is hereby incorporated by reference in its entirety. Said ASCII copy, created on Sep. 13, 2013, is named 58086-354490_SL.txt and is 37,016 bytes in size.
BACKGROUND INFORMATIONDuchenne muscular dystrophy (DMD) is a lethal X-linked recessive disease characterized by progressive muscle weakness over a patient's lifetime [1]. It is the most common childhood form of muscular dystrophy affecting about 1 out of 3500 live male births worldwide [2]. DMD is primarily caused by out of frame multi-exon deletions in the DMD gene that ablate dystrophin protein production [3]. Dystrophin is an essential component of the dystrophin glycoprotein complex (DGC), which functions in linking the actin cytoskeleton to extracellular matrix to provide sarcolemmal stability in the context of muscle contraction. The DGC also plays a role recruiting and organizing signal transducers at the sarcolemmal membrane. Both of these activities are required for muscle cell health, and thus the absence of dystrophin leads to progressive loss of muscle function. Dystrophin binds to actin via N-terminal sequences and to b dystroglycan within the DGC via carboxyl terminal domains, whereas the central portion of the protein consists of a rod domain containing multiple spectrin repeats. Deletions within the central rod domain that preserve the reading frame can produce an internally deleted dystrophin protein that retains some functionality and localizes to the membrane within the DGC [4]. Typically, the more mild allelic disorder, Becker muscular dystrophy, results from DMD mutations in the rod domain which remain in-frame 3′ of the deletion and produce a functional dystrophin protein [5]. There are no curative therapies for DMD, and the only demonstrated pharmacological treatment is corticosteroids, which may prolong ambulation for up to 3 years, but with substantial side effects [6]. An emerging therapy, exon skipping, targets individual exons with antisense oligos (AOs) for exclusion from mRNA based on an individual's known genomic DNA mutation with the goal to change out-of-frame mutations into in-frame DMD deletions that restore the reading frame in dystrophin mRNA and allow translation of dystrophin protein.
Recent phase 1-2a clinical trial results utilizing systemic 2′-O-methyl modified AO directed against DMD exon 51 (Pro051) rescued dystrophin protein at levels ranging from 1.8-15.6% of normal [8]. A modest improvement in the 6 minute walk test at 48 weeks was observed with weekly subcutaneous dosing of 6 mg/kg in a non-placebo controlled extension trail, but it remains to be determined if the levels of dystophin produced are sufficient to impart substantial functional utility or longterm protection of muscle [15]. Morpholino AO directed against exon 51 (AVI-4658) resulted in dystrophin rescue with up to 55% of myofibers induced to be dystrophin positive after 12 weeks of therapy in humans. However, the total amount of dystrophin induced was generally low, at 0-27% of normal [16]. Further, DMD exon skipping efficacy and dystrophin expression varies across patients, and muscle types.
There is a need for an improvement in exon skipping therapy that would result in more total dystrophin expression and broader effect in multiple muscle groups. For example, synergistic treatments that would permit equal efficacy with reduced AO dose, accompanied by lower toxicity, could substantially impact the practicality of the chronic administration of expensive to produce oligonucleotides [17].
The present inventors identify herein low molecular weight compounds (sometimes referred to herein as “small molecules” or “small molecule compounds” or “compounds” of the invention) which block some forms of mRNA splicing and/or enhance (facilitate, augment) other forms of mRNA splicing. The types of splicing that can be regulated by a method of the invention include alternative splicing, in particular exon skipping. Depending on factors such as the splicing sequence and the gene or exon involved, this modulation of splicing can be accomplished in the presence of, or in the absence of, antisense oligonucleotides (AOs) that are specific for splicing sequences of interest. In embodiments of the invention, a small molecule and an AO of the invention act synergistically. The antisense molecules used in a method of the invention are sometimes referred to herein as antisense “splice switching oligonucleotides (SSO's).” Table 1 lists 27 representative small molecules which can be used in a method of the invention. It is to be understood that references herein to the 27 small molecules in Table 1 include pharmaceutically acceptable salts, hydrates, solvates or isomers thereof.
As shown in the Examples herein, the inventors performed a small molecule cell based screen using a human exon 50 (of the DMD gene) reporter cell line, which is activated when exon 50 is skipped. The cell line, which was adapted to allow the screening of thousands of compounds in multiple replicates, was obtained from Dr. Qi Lu. The compounds which were screened were selected from FDA approved libraries or known biologically active molecule libraries. Lead hits (shown in Table 1) were further validated using assessment of RNA sequence and with various dose titrations in mouse cells, and demonstrate synergy with antisense oligonucleotide. Each of the compounds was validated in counterscreens to rule out toxicity and autofluorescence, and demonstrated to have activity in 16 point titrations of the compound, either alone or in synergy with anti-sense oligonucleotide. The aggregate group of compounds defines new classes of drugs which induce (enhance) exon skipping. Some of the compounds are shown to increase the amount of skipped exon 50 dystrophin mRNA when applied externally to cells growing in culture either alone or in synergy with anti-sense oligonucleotide. One of the tested compounds, dantrolene, was demonstrated to affect mdx mice in vivo with systemic administration. Other studies presented herein also demonstate exon skipping of, e.g., exon 23 and exon 50 of DMD. It is expected that at least some of the compounds will induce (enhance) exon skipping and create alternate splice forms of proteins that are relevant to a variety of disease states.
Compounds that were identified in the counter screens include, e.g., Furaltadone hydrochloride, 5-iodotubericidin, bendroflumethiazide, cyclopiazonic acid, GW 5074, indirubin, rescinnamin, U-0126, acetopromazine maleate salt, Ro 31-8220. Additional compounds showing efficacy in counter screen and on mdx mouse myotubes include, e.g., dantrolene, dichlorobenzamil, ellipticine, fenbendazole, GF 109203×, halofantrine, niclosamide, pimozide, reserpine, syringospine. Other compounds shown or expected to show exon skipping activity include, e.g., Ryanodine, RyCal S107, piperacetazine, fluphenazine dihydrochloride, trifluorperazine dihydrochloride, yohimbinic acid, and menadione. Pharmaceutically acceptable salts, hydrates, solvates or isomers of these or other compounds of the invention are also included. For example, sodium ions in the formulas can be substituted with any of a variety of other pharmaceutically acceptable cations. Suitable such salts, hydrates, solvates or isomers will be evident to a skilled worker. See, e.g., Remington's Pharmaceutical Sciences, 18th edition (1990, Mack Publishing Co., Easton, Pa.).
Each of the identified compounds has a different known effect on cells and has been used for different therapeutic purposes. How each of the compounds affects the RNA splicing machinery to alter the efficiency of exclusion of targeted exons is not known at this time. While the detailed molecular mechanisms are not yet established, several of the compounds identified, for instance Dantrolene, have well-characterized effects in cells and in humans. Dantrolene's known effect is to block the ryanodine receptor which prevents release of calcium that is needed for muscle cell contraction when excited. This drug is used clinically to mitigate the effects of malignant hyperthermia. The use of Dantrolene in combination with antisense oligonucleotide to induce an inframe transcript is a novel use for this compound. Dantrolene has been tried as a single agent to treat Duchenne muscular dystrophy without significant beneficial effect and without significant deleterious effects. None of the identified compounds has been used in order to alter exon splicing therapeutically. For example, some of these compounds are known vermicidals, anti-hypertensive, anti-malarial, anti-psychotic or anti-cancer agents.
It is expected that endogenously generated antisense oligonucleotides (for instance from gene delivery) will augment exon skipping in a similar manner as exogenously administered AOs. For example, endogenously generated small nuclear RNA (sRNA) carrying appropriate antisense sequences and transcribed from, e.g., a U7 snRNA-based gene construct can be used in a method of the invention.
Advantages of methods and combinations of the invention include that they augment the efficiency of exon skipping (e.g., when performed in the presence of AO) and thus allow a sufficient amount of skipping to be therapeutically relevant and/or reduce the cost resulting from high doses and repeated administration of expensive AOs.
“Antisense-mediated exon skipping,” as used herein, refers to an approach that uses antisense oligonucleotides (AOs) to modulate splicing by blocking (hiding) specific sequence motifs in the pre-mRNA (sometimes referred to herein as “splicing sequences”) essential for exon inclusion from the splicing machinery. AOs that block aberrant splice sites can restore normal splicing. Alternatively, AOs targeting certain splicing sequences can switch splicing patterns from detrimental to beneficial isoforms or can convert at least partially non-functional mRNAs into functional mRNA. An example of the latter approach is the restoration of a disrupted reading frame, thereby generating semi-functional proteins instead of non-functional proteins.
A compound of the invention can be used to block splicing at a site of interest by specifically interacting with (e.g., binding to) a splicing sequence at that site, either directly or indirectly. By a “splicing sequence” is meant a sequence that regulates and/or is required for splicing out of a particular intron and/or the retention of a particular exon. The splicing sequence can be, for example, a splice donor site, a splice acceptor site, a branch site, an intronic splicing enhancer (ISE), an exonic splicing enhancer (ESE), an intronic splicing silencer or an exonic splicing silencer.
An AO used in a method of the invention can bind directly and specifically to a target splicing sequence of interest. By “specific binding” is meant that the AO binds preferentially to the target sequence of interest, but not to non-target sequences under conditions in which specific binding is desired. The conditions can be, e.g., physiological conditions in the case of in vivo assays or therapeutic treatment, and for in vitro assays, conditions in which the assays are performed. Because the mechanism by which small molecule compounds of the invention block splicing (e.g., enhance exon skipping) is not known for all of the compounds, it is not known whether the compound binds directly to a splice site or acts indirectly (e.g., by binding to another RNA or protein element of a spliceosome). Regardless of the mechanism, a compound of the invention that “specifically” blocks a splicing event of interest is one that preferentially blocks the particular splicing event but does not block non-targeted splicing events, under conditions in which specific blocking is desired.
As used herein, the term “antisense oligonucleotide (AO)” refers to a single-stranded oligonucleotide that is specific for, and complementary to, a splicing sequence of interest, and accordingly is capable of hydrogen bonding to the sequence. One of skill in the art can readily design AOs to be specific for suitable target sequences, many of which are well-known in the art. For example, one can access pre-mRNA sequences comprising suitable splicing sequences in publications or in annotated, publically available databases, such as the GenBank database operated by the NCBI. A skilled worker will be able to design, make and use suitable antisense oligonucleotides, based on these or other sequences, without undue experimentation. A number of AO's have been designed for enhancing exon skipping and some are currently in preclinical or clinical trials. Any of these AOs is suitable for use in a method of the invention.
An antisense nucleic acid may be, e.g., an oligonucleotide, or a nucleic acid comprising an antisense sequence that is operably linked to an expression control sequence and that is expressed in a cell.
Antisense oligonucleotides may have a variety of different backbone chemistries, such as morpholino phosphorodiamidate (PMO) or 2′-O-methyl′ or peptide nucleic acids, etc., which stabilize them. For example, it can be DNA, RNA, PNA or LNA, or chimeric mixtures or derivatives or modified versions thereof. The nucleic acid can be modified at the base moiety, sugar moiety, or phosphate backbone, using conventional procedures and modifications. Modifications of the bases include, e.g., methylated versions of purines or pyrimidines. Modifications may include other appending groups that will be evident to a skilled worker.
Antisense oligonucleotides can be constructed using chemical synthesis procedures known in the art. An AO can be chemically synthesized using naturally occurring nucleotides or variously modified nucleotides designed to increase the biological stability of the molecules or to increase the physical stability of the duplex formed between the antisense and sense nucleic acids, e.g. phosphorothioate derivatives and acridine substituted nucleotides can be used. For guidance in methods of synthesizing AOs used in methods of the present invention, see, e.g.:
For guidance in methods of synthesizing morpholino AO's for use in the present invention, see, e.g., US patent application 2009/0131624 (“Synthesis of morpholino oligomers using double protecte guanine morpholino subunits”).
For guidance in synthesizing oligonucleotides, see, e.g., Gough et al. (1979) Nucleic Acids Research 7, 1955-1964; Hata et al. (1983) Tetrahedron Lett. 24, 2775-2778; Jones et al. (1982A Tetrahedron Lett. 23, 2253-2256; Jones et al. (1982) Tetrahedron Lett. 23, 2257-2260; O. Mitsunobu (1981) Synthesis 1, 1-28; Reese et al. (1981) Tetrahedron Lett. 22, 4755-4758; Reese et al. (1984) J. Chem. Soc., Perkin Trans. 11263-1270; Summerton et al. (1993) U.S. Pat. No. 5,185,444; Summerton et al. (1997) Antisense Nucl. Acid Drug Dev. 7(3), 187-195.
For guidance in synthesizing 2-O-methyl′ oligos, see e.g. Verma et al. (1998) MODIFIED OLIGONUCLEOTIDES: Synthesis and Strategy for Users, Annu. Rev. Biochem. 67, 99-134
For guidance in synthesizing dantrolene, see e.g. Oleinik et al. (1984) Pharmaceutical Chemistry Journal 18 (5), 310-312.
To enhance exon skipping in cells in culture, AO's can be added to cells in culture media. Typically, synthetic oligonucleotides are added to a final concentration of about 10 nM to about 10 microM, e.g., about 50 nM to about 1000 nM (e.g., at increments of 10 nM within the indicated ranges). The term “about” a particular value, as used herein, means plus or minus 10% of the indicated value.
Effective doses of AOs for in vivo administration can be determined, e.g., on the basis of the amounts used for exon skipping in the absence of a small molecule of the present invention. Many AO's have been administered to subjects in the absence of small molecule compounds of the invention, and doses have been established which are at least partically effective and are non-toxic to the subjects. In general, doses of AOs ranging from about 5-100 mg/kg/wk IV (intravenous) (or comparable amounts for other modes of admin) are effective for inducing at least a detectable amount of dystrophin expression with targeted removal of a given exon.
Alternatively, an antisense oligonucleotide can be produced biologically using an expression vector into which a nucleic acid has been subcloned in an antisense orientation (i.e., nucleic acid transcribed from the inserted nucleic acid will be of an antisense orientation to a target sequence of interest). Expression control sequences (e.g., regulatory sequences) operatively linked to a nucleic acid cloned in the antisense orientation can be chosen which direct the expression of the antisense RNA molecule in a cell of interest. For instance, promoters and/or enhancers or other regulatory sequences can be chosen which direct constitutive, tissue specific or inducible expression of an AO. Inducible expression of antisense RNA, regulated by an inducible eukaryotic regulatory system, such as the Tet system (e.g., as described in Gossen et al. (1992) Proc. Natl. Acad. Sci. USA 89, 5547-5551; Gossen et al. (1995) Science 268, 1766-1769; PCT Publication No. WO 94/29442; and PCT Publication No. WO 96/01313) can be used. The antisense expression vector can be in the form of, for example, a recombinant plasmid, phagemid or attenuated virus. Suitable viral vectors include, e.g., adeno-associated virus (AAV) or lentivirus vectors. The antisense expression vector can be introduced into cells using standard techniques well known in the art. For guidance in using AAV vectors for introducing antisense molecules into mdx mice, see e.g. Denti et al. (2008) Hum Gene Ther 19, 601-608 or Incitti et al. (2010) Mol. Ther. 18, 1675-1682.
In one embodiment of the invention, an RNA molecule that comprises the sequence antisense to a splicing sequence in, e.g., the dystrophin pre-mRNA, is produced biologically by using an expression vector into which a nucleic acid has been subcloned. Expression control sequences (e.g. regulatory sequences) operably linked to the cloned nucleic acid can be chosen which direct the expression of the antisense RNA molecule comprising the sequence antisense to a splicing sequence in, e.g., dystrophin pre-mRNA, in a cell of interest. The RNA molecule may comprise, e.g., a U1 snRNA, U2 snRNA, U6 snRNA or U7 snRNA. Without wishing to be limited by any particular mechanism, it is suggested that expression of the snRNA generates an snRNP particle which then binds to the target sequence in dystrophin pre-mRNA via the complementary fragment of snRNA. Any of the types of expression control sequences described in the previous paragraph can be used to direct the expression of the desired RNA in this embodiment.
In one embodiment of the invention, an AO comprises a strand that is completely complementary (100% identical in sequence) to a splicing sequence that it is designed to inhibit. That is, every contiguous nucleotide in the AO is hybridized to every nucleotide in a splicing sequence. However, 100% sequence identity between the AO and the target splicing sequence is not required to practice the present invention. Thus, the invention has the advantage of being able to tolerate naturally occurring sequence variations that might be expected due to genetic mutation, strain polymorphism, or evolutionary divergence. Alternatively, the variants may be artificially generated. Nucleic acid sequences with, e.g., small insertions, deletions, and single point mutations relative to the target sequence can be effective for inhibition. The degree of sequence identity can be, e.g., 95%, 98%, 99%, or 100%. Such a variant AO must, of course, retain the relevant activity of the AO from which it is derived. (e.g., the ability to suppress splicing at a site of interest). Such variants are sometimes referred to herein as “active variants.”
The length of an AO may vary, provided that it is capable of binding selectively to the intended splicing sequence within the pre-mRNA molecule. A skilled worker can readily determine a satisfactory length. Generally, an AO is from about 10 nt in length to about 50 nt in length. Any length of nucleotides within this range, including the endpoints, can be used in a method of the invention. In one embodiment, the length of the AO is about 17-30 nt in length.
For further guidance for designing suitable antisense molecules that are complementary to a region of a pre-mRNA involved in splicing (thereby blocking splicing), and for methods for making and delivering such molecules to a cell or a subject, see, e.g., US 2008/0200409 or U.S. Pat. No. 7,973,015, 7,960,541, 7,902,160, 7,888,012, 7,879,992 or 7,737,110.
A method of the invention can be carried out in vitro (e.g., to elucidate the mechanism by which splicing occurs, such as to reveal novel molecular interactions in the processing of mRNA; or to screen for compounds that can block a splicing event and thus, for example, enhance exon skipping).
In another embodiment of the invention, the method is carried out in a subject, in vivo. A “subject,” as used herein, can refer to any animal which is subject to a disease or condition that can be treated by a method of the invention. Suitable subjects include, e.g., a mammal, such as an experimental animal or disease model, a farm animal, pet, or the like. In some embodiments, the animal is a primate, for example a human.
In some embodiments of the invention, a subject is treated with an effective amount of a compound of the invention, or with a combination of a compound of the invention and a suitable AO, each of which is designed to block a splicing event of interest. An “effective amount” of a compound (or combination) of the invention is an amount that is effective to elicit a measurable amount of biological activity, e.g. a measurable amount of enhancement of exon skipping (in some embodiments in the absence of AOs, and in some embodiments in the presence of a suitable AO). Preferably, an effective amount of a compound or combination of the invention does not elicit substantial amounts of undesirable (e.g., toxic) effects. The enhancement can occur prophylactically (e.g. preventively, to inhibit the development of the disorder), or in a subject who already has the condition. For example, treatment by a method of the invention can ameliorate one or more symptoms of the condition.
A skilled worker will recognize a variety of conditions that can be treated by a method of the invention. A probabilistic analysis indicated that over 60% of human disease-causing mutations affect splicing rather than directly affecting coding sequences (Lopez-Bigas et al. (2005) FEBS Letters 579, 1900-3). See also Wang et al. (2007), Splicing in disease: disruption of the splicing code and the decoding machinery, Nature Reviews Genetics 8, 749-761 and Singh et al. (2012), Pre-mRNA splicing in disease and therapeutics, Trends in Molecular Medicine 18, (8), 472-482. Diseases associated with aberrant splicing or missplicing that can be inhibited by a method of the invention include e.g. beta-thalassemia and certain forms of cancers. Alternatively, exon skipping by a method of the invention can remove exons that contain mutations which are associated with diseases, such as mutations that alter the reading frame of the protein encoded by an mRNA. These conditions include, e.g., DMD, as described above (changing DMD dystrophin to a more functional form of dystrophin, in effect converting Duchenne MD into Becker MD). One embodiment of the invention is a method for treating a subject that has Duchenne muscular dystrophy (DMD), or is a non-human model of DMD, comprising administering to the subject an effective amount of small molecule selected from the compounds shown in Table 1, in conjunction with an AO specific for modulating splicing of dystrophin pre-mRNA, such as one for exon 23, 44, 45, 50, 51, 52, or 53 of the DMD gene. The exon skipping can be either single or multi-exon skipping (e.g., skipping of many possible 2-10 exon combinations that will be evident to a skilled worker).
Some suitable exons that can be skipped by a method of the invention are summarized in Table 6 below. Listed are human DMD coding sequences with 50 intronic nucleotides at the exon boundaries. mRNA sequences are in upper case, and intronic sequences in lower case. On the basis of these sequences, a skilled worker can readily design AO's specific for blocking the relevant splice sites.
Exons for which exon skipping can be therapeutic, for the treatment of muscular dystrophy and other conditions, will be evident to a skilled worker. There is a substantial literature on the design of specific exons in DMD and many thousands of other exons in the human genome potentially amenable to exon skipping. For instance, a nonsense mutation within an exon which if deleted would not alter the reading frame, may be able to be removed from the mature RNA by targeted removal by exon skipping. The possible exons in the human genome are too numerous to list. In the DMD gene alone, there are 79 exons and many sequences that can be used to partially block inclusion of a given exon (from exon 2-exon 78) that are therapeutically relevant. For example, in 2007, Wilton et al described a series of oligos that can skip single exons across the DMD gene. (Wilton et al (2007) Mol. Ther. 15, 1288-1296). Other work by Pramono et al demonstrates oligo design principles (Pramono et al. (2012) Hum Gene Ther 23(7), 781-90). Malueka et al describe a decision metric for oligo targeting in DMD (Malueka et al (2012) BMC Genet. 13, 23). Popplewell, et al also describe design principles for the oligo component of the combined therapeutic described in the present invention (Popplewell, et al (2012) Methods Mol. Biol. 867, 143-67). Further, recently published work by Aoki, et al describe the skipping of multiple exons from exon 45-55 in mouse (Aoki, et al (2012) Proc Natl Acad Sci USA. 109 (34), 13763-8). This is therapeutically relevant for human Duchenne therapy as well as up to 65% of all DMD affected individuals could be treated by this cocktail. Since the described invention works on multiple independent exons, it is expected that the chemical entities described herein will improve the removal of specific individual and sets of exons from the mature transcript in vivo and in vitro. The general field of AO design for DMD is described in Aarstma-Rus, 2012 and Lu, 2011. Further, the removal of exonic duplications (see Aartsma-Rus (2007), BMC Med. Genet. 5, 8:43) commonly observed in DMD may also be improved by combination use with the compounds described herein.
For reviews of conditions or diseases that can be treated by a method of the invention, see, e.g., Bauman et al. (2011) Bioeng. Bugs. 2, 125-8, Hammond et al. (2011) Trends Genet. 27, 196-205, Wood et al. (2010) Brain 133, 957-72 or Sazani et al., “Splice-switching oligonucleotides as potential therapeutics” (2007) in Antisense Drug Technology: Principles, Strategies, and Applications, Second Edition (Ed. S. T. Crooke) 89-114 (CRC Press, Boca Raton). Among the diseases treatable by modulation of exon skipping are, e.g., spinal muscle atrophy (SMA), Hutchinson-Gilford progeria syndrome (HGPS), beta-thalassemia, Ataxia telangiectasia (ATM), dysferlinopathies, frontotemporal dementia and cystic fibrosis.
In embodiments of the invention, a compound of the invention is administered to a subject, e.g. as part of an adjuvant treatment, or is contacted (e.g., in vitro) with a pre-mRNA target of interest, in conjunction with a suitable AO that is designed to specifically block a splicing event of interest. “In conjunction with” means that the AO can be administered before, or at the same time as, or after, the compound, and that the two components can be administered in separate delivery vehicles or in the same delivery vehicle. The two agents can be administered with the same, or different, dosage regimens. As used herein, the singular forms “a,” “an,” and “the” include plural referents unless the context clearly dictates otherwise. For example, “an” AO, as used above, means one or more AO molecules, which can be the same or different.
A number of considerations are generally taken into account in designing delivery systems, routes of administration, and formulations for compounds or combinations of compounds and an AO of the invention. The appropriate delivery system for an agent of the invention will depend upon its particular nature, the particular clinical application, and the site of drug action. One skilled in the art can easily determine the appropriate dose, schedule, and method of administration for the exact formulation of the composition being used, in order to achieve the desired response in the individual patient.
Any of a variety of conventional methods can be used to introduce AOs and/or small molecules of the invention into cells, in vitro or in vivo. These methods include, for example, transfection, electroporation, hydrodynamic “high pressure” delivery, nanoparticle delivery, liposomes, colloidal dispersal systems, or other methods known in the art.
Intracellular AO delivery can be enhanced by conjugating cell penetrating peptides to the AO using methods and compounds known in the art. See, e.g., U.S. Pat. No. 7,468,418 and PCT publications WO2009/005793 and WO2009/147368.
Compounds and AO's can be administered (delivered) to a subject by the same or by different modes of administration. Suitable modes of administration include, e.g., subcutaneous, intramuscular, intravenous, oral, intranasal, cutaneous, or suppository routes, depending on the formulation, the compound, and the condition to be treated. Compounds and AO's of the invention may be delivered via a variety of routes including all of the above routes, in dosing patterns that can be optimized with routine, conventional methods. In one embodiment, the compounds are administered chronically to subjects (patients) in conjunction with therapeutic antisense oligonucleodies. In some embodiments, a compound of the invention is administered frequently (e.g., daily or more frequently) to augment less frequent (e.g., monthly or weekly) administration, such as by intravenous or subcutaneous injection, of AO.
Formulations for delivery by a particular method (e.g., solutions, buffers, and preservatives) can be optimized by routine, conventional methods that are well-known in the art. See, e.g., Remington's Pharmaceutical Sciences, 18th edition (1990, Mack Publishing Co., Easton, Pa.). for guidance in suitable formulations.
An “effective” dose of an agent of the invention (either a compound, or a compound in conjunction with an AO, or the AO), or composition thereof, is a dose that, when administered to an animal, particularly a human, in the context of the present invention, is sufficient to effect at least a detectable amount of a therapeutic response in the individual over a reasonable time frame.
The exact amount of the dose (of a small molecule of the invention, used alone or in conjunction with an AO, or of the AO), will vary from subject to subject, depending on the species, age, weight and general condition of the subject, the severity or mechanism of any disorder being treated, the particular agent or vehicle used, its mode of administration and the like. The dose will also be a function of the exon that is being skipped/removed from the mature RNA and the sequence of the AO. The dose used to achieve a desired effect in vivo will be determined by the potency of the particular agent employed, the pharmacodynamics associated with the agent in the host, the severity of the disease state of infected individuals, as well as, in the case of systemic administration, the body weight and age of the individual. The size of the dose also will be determined by the existence of any adverse side effects that may accompany the particular inhibitory agent, or composition thereof, employed. It is generally desirable, whenever possible, to keep adverse side effects to a minimum.
For example, a dose of a small molecule of the invention can range from about 4-10 mg/kg/day, or can be higher or lower. In general, the dose of a small molecule of the invention is one, or close to one, which has been shown to be safe for subjects, such as human patients. Dantrolene, for example, has been shown to be safe when administered to humans up to 8 mg/kg/day during long term administration. Suitable oral doses of Dantrolene include doses of about 4-10, e.g. about 6-8, mg/kg/day. An example herein shows a functional benefit (wire hang test in mdx mice) using 10 mg/kg/week of the oligo AON23 and dantrolene at 10 mg/kg/day compared to 10 mg/kg/week of the AON23 alone (p=0.022).
Dosages for administration of a therapeutic agent of the invention can be in unit dosage form, such as a tablet or capsule. The term “unit dosage form” as used herein refers to physically discrete units suitable as unitary dosages for human and animal subjects, each unit containing a predetermined quantity of an inhibitor of the invention, alone or in combination with other therapeutic agents, calculated in an amount sufficient to produce the desired effect in association with a pharmaceutically acceptable diluent, carrier, or vehicle.
One embodiment of the invention is a method for identifying a small molecule compound that enhances exon skipping in an mRNA of interest, comprising testing candidate small molecules, such as variants of a compound in Table 1, for their ability to enhance exon skipping in the mRNA, and selecting compounds which exhibit greater enhancement activity than the compound from Table 1. The screening method can be carried out in the absence of, or in conjunction with, an AO specific for a splicing sequence of the exon that is to be skipped.
In one embodiment, the method comprises contacting a suitable cell (in vitro or in vivo) with a putative small molecule compound, such as a variant of one of the compounds of Table 1, and measuring the amount of splicing or, in one embodiment, of exon skipping, of interest. Any of the assays discussed herein can be adapted to such a screen. The amount of splicing or exon skipping can be compared to a control value. For example, for an assay which is conducted in the absence of an AO, the control can be a cell that has not been contacted with the compound. For an assay which is conducted in the presence of a suitable AO, the control can be a cell that is contacted with the AO but not the putative compound. A statistically significant decrease in the amount of splicing or increase in the amount of exon skipping in the test cells compared to the control is indicative that the putative compound is superior to the compound from which it has been derived, or to a suitable arbitrarily selected control compound.
As Dantrolene has a known molecular target, the ryanodine receptor which it binds directly, other agents that modify the activity of the ryanodine receptor are likely to have the same effect. For instance, a class of agents called ‘RyCals’ or ‘calcium channel stabilizers’ which stabilize the interaction of calstabin with ryanodine receptor and effectively block ryanodine receptor calcium leak are expected to have a similar effect as Dantrolene. See, e.g., Andersson et al. (2010) Drug Discov Today Dis Mech 7, 3151-e157 or Wehrens et al. (20050 Proc Natl Acad Sci USA 102, 9607-12.
Suitable variant compounds that can be tested will be evident to a skilled worker. For example, a substituent on, e.g., an aromatic or non-aromatic carbon can be substituted with H, alkyl, alkoxy, hydroxyalkyl, thioalkyl, haloalkyl, aminoalkyl, alkoxyalkyl, alkylaminoalkyl, etc. Some suitable variants are discussed below. Others will be evident to a skilled worker. Suitable (e.g., improved) variant compounds that are identified by such a screen are also included in the invention, and are sometimes referred to herein as “active variants” of the compounds. An “active variant,” as used herein, refers to a compound which retains at least one activity of the compound of which it is a variant, e.g. the ability to block splicing of an exon of interest.
The terms “alkyl” used alone or as part of a larger moiety (i.e. “alkoxy,” “hydroxyalkyl,” “alkoxyalkyl,” and “alkoxycarbonyl”) include both straight and branched chains containing one to ten carbon atoms (i.e. 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 carbon atoms), as well as cyclic structures such as cyclopropyl and cyclobutyl. Examples of alkyl groups include methyl (Me), ethyl (Et), propyl (Pr) (including n-propyl (nPr or n-Pr), isopropyl (iPr or i-Pr) and cyclopropyl (cPr or c-Pr)), butyl (Bu) (including n-butyl (nBu or n-Bu), isobutyl (iBu or i-Bu), tert-butyl (Bu or t-Bu) and cyclobutyl (cBu or c-Bu)), pentyl (Pe) (including n-pentyl) and so forth. Alkyl groups also include mixed cyclic and linear alkyl groups, such as cyclopentylmethyl, cyclopentylethyl, cyclohexylmethyl, etc., so long as the total number of carbon atoms is not exceeded. The term “alkoxy” refers to an —O-alkyl radical, such as, for example —O-Me, —O-Et, —O-Pr, and so on. The term “hydroxyalkyl” refers to an alkyl group substituted with one or more hydroxyl, such as, for example, hydroxymethyl, 1-hydroxyethyl, 2-hydroxyethyl, 1,2-dihydroxyethyl, and so forth. The term “thioalkyl” refers to an —S-alkyl group, such as, for example, example —S-Me, —S-Et, —S—Pr. The term “haloalkyl” means alkyl, substituted with one or more halogen atoms, such as trifluoromethyl, chloromethyl, 2,2,2-trifluoroethyl, 1,1,2,2,2,-petanfluoroethyl, and so on. The term “aminoalkyl” means alkyl, substituted with an amine group (NH2), such as, for example, aminomethyl, 1-aminoethyl, 2-aminoethyl, 3-aminopropyl and so forth. The term “alkoxyalkyl” refers to an alkyl group, substituted with an alkoxy group, such as, for example, methoxymethyl, ethoxymethyl, methoxyethyl, and so forth. As used herein, the term “alkylaminoalkyl” refers to an alkyl group substituted with an alkylamine group, such as, for example, N-methylaminomethyl, N,N-dimethylaminomethyl, N,N-methylpentylaminomethyl, 2-(N-methylamino)ethyl, 2-(N,N-dimethylamino)ethyl, and so forth.
The term “halogen” or “halo” means F, Cl, Br, or I.
The term “nitro” means (—NO2).
The term “amine” or “amino” used alone or as part of a larger moiety refers to unsubstituted (—NH2). The term “alkylamine” refers to mono- (—NRH) or di-substituted (—NR2) amine where at least one R group is an alkyl substituent, as defined above. Examples include methylamino (—NHCH3), dimethylamino (—N(CH3)2). The term “arylamine” refers to a mono (—NRH) or di-substituted (—NR2) amine, where at least one R group is an aryl group as defined below, including, for example, phenylamino, diphenylamino, and so forth. The term “heteroarylamine” refers to a mono (—NRH) or di-substituted (—NR2) amine, where at least one R group is a heteroaryl group as defined below, including, for example, 2-pyridylamino, 3-pyridylamino and so forth. The term “aralkylamine” refers to a mono (—NRH) or di-substituted (—NR2) amine, where at least one R group is an aralkyl group, including, for example, benzylamino, phenethylamino, and so forth. The term “heteroaralkylamine” refers to a mono (—NRH) or di-substituted (—NR2) amine, where at least one R group is a heteroaralkyl group. As used herein, the term “alkylaminoalkyl” refers to an alkyl group substituted with an alkylamine group. Analogously, “arylaminoalkyl” refers to an alkyl group substituted with an arylamine, and so forth, for any substituted amine described herein.
The term “alkenyl” used alone or as part of a larger moiety include both straight and branched chains containing at least one double bond and two to ten carbon atoms (i.e. 2, 3, 4, 5, 6, 7, 8, 9, or 10 carbon atoms), as well as cyclic, non-aromatic alkenyl groups such as cyclopropenyl, cyclobutenyl, cyclopentenyl, cyclopentadienyl, cyclohexenyl, cyclohexadienyl, etc. As used herein, alkenyl groups also include mixed cyclic and linear alkyl groups, such as cyclopentenylmethyl, cyclopentenylethyl, cyclohexenylmethyl, etc., so long as the total number of carbon atoms is not exceeded. When the total number of carbons allows (i.e. more than 4 carbons), an alkenyl group may have multiple double bonds, whether conjugated or non-conjugated, but do not include aromatic structures. Examples of alkenyl groups include ethenyl, propenyl, butenyl, butadienyl, isoprenyl, dimethylallyl, geranyl and so forth.
The term “aryl” used alone or as part of a larger moiety, refers to mono-, bi-, or tricyclic aromatic hydrocarbon ring systems having five to fourteen members, such as phenyl, 1-naphthyl, 2-naphthyl, 1-anthracyl and 2-anthracyl. The term “aryl” may be used interchangeably with the term “aryl ring”. “Aryl” also includes fused polycyclic aromatic ring systems in which an aromatic ring is fused to one or more rings. Examples include 1-naphthyl, 2-naphthyl, 1-anthracyl and 2-anthracyl. Also included within the scope of the term “aryl”, as it is used herein, is a group in which an aromatic ring is fused to one or more non-aromatic rings, such as in an indanyl, phenanthridinyl or tetrahydronaphthyl, where the radical or point of attachment is on the aromatic ring. The term “aralkyl” refers to an alkyl substituent substituted by an aryl group. The term “aryloxy” refers to an —O-aryl group, such as, for example phenoxy, 4-chlorophenoxy and so forth. The term “arylthio” refers to an —S-aryl group such as, for example phenylthio, 4-chlorophenylthio, and so forth. The term “aryl” used alone or as part of a larger moiety also refers to aryl rings that are substituted such as, for example, 4-chlorophenyl, 3,4-dibromophenyl and so forth. An aryl group may have more than one substituent, up to the total number of free substitution positions. For example, an aryl group may have 1, 2, 3, 4, or 5 substituents. The substituents may the same or different. Substituents on an aryl group include hydrogen, halogen, alkyl, alkenyl, nitro, hydroxyl, amino, alkylamino, alkoxy, and alkylthio, O-acyl, N-acyl, S-acyl as defined herein.
The term “heteroaryl”, used alone or as part of a larger moiety, refers to heteroaromatic ring groups having five to fourteen members, preferably five to ten, in which one or more ring carbons, preferably one to four, are each replaced by a heteroatom such as N, O, or S. Examples of heteroaryl rings include 2-furanyl, 3-furanyl, N-imidazolyl, 2-imidazolyl, 4-imidazolyl, 5-imidazolyl, 3-isoxazolyl, 4-isoxazolyl, 5-isoxazolyl, 2-oxadiazolyl, 5-oxadiazolyl, 2-oxazolyl, 4-oxazolyl, 5-oxazolyl, 1-pyrrolyl, 2-pyrrolyl, 3-pyrrolyl, 1-pyrazolyl, 3-pyrazolyl, 4-pyrazolyl, 2-pyridyl, 3-pyridyl, 4-pyridyl, 2-pyrimidyl, 4-pyrimidyl, 5-pyrimidyl, 3-pyridazinyl, 2-thiazolyl, 4-thiazolyl, 5-thiazolyl, 5-tetrazolyl, 2-triazolyl, 5-triazolyl, 2-thienyl, 3-thienyl, carbazolyl, benzimidazolyl, benzothienyl, benzofuranyl, indolyl, quinolinyl, benzotriazolyl, benzothiazolyl, benzooxazolyl, benzimidazolyl, isoquinolinyl, indazolyl, isoindolyl, acridinyl, or benzoisoxazolyl. Also included within the scope of the term “heteroaryl”, as it is used herein, is a group in which a heteroaromatic ring is fused to one or more aromatic or nonaromatic rings where the radical or point of attachment is on the heteroaromatic ring. Examples include tetrahydroquinolinyl, tetrahydroisoquinolinyl, and pyrido[3,4-d]pyrimidinyl. The term “heteroaryl” may be used interchangeably with the term “heteroaryl ring” or the term “heteroaromatic.” The term “heteroaralkyl” refers to an alkyl group substituted by a heteroaryl, such as, for example, 2-pyridylmethyl, 3-pyridylmethyl, 1-imidazolomethyl, 2-imidazolomethyl and so forth. The term “heteroaryloxy” refers to an —O-heteroaryl group. The term “heteroarylthio” refers to an —S-aryl group. A heteroaryl group may have more than one substituent, up to the total number of free substitution positions. For example, a heteroaryl group may have 1, 2, 3, 4, or 5 substituents. The substituents may the same or different. Substituents on a heteroaryl group include hydrogen, halogen, alkyl, alkenyl, nitro, hydroxyl, amino, alkylamino, alkoxy, and alkylthio, O-acyl, N-acyl, S-acyl as defined herein.
The term “O-acyl” refers to an “—O—C(O)-alkyl,” “—O—C(O)-aryl,” or “—O—C(O)-heteroaryl” group. The term “N-acyl” refers to an “—NR—C(O)-alkyl,” “—NR—C(O)-aryl,” or “—NR—C(O)-heteroaryl” where R is an alkyl, hydroxyl, or alkoxy group. The term “S-acyl” refers to “—S—C(O)-alkyl,” “—S—C(O)-aryl,” or “—S—C(O)-heteroaryl.” The term “N—O-acyl” refers to an “N—O—C(O)-alkyl,” “N—O—C(O)-aryl,” or “N—O—C(O)-heteroaryl” group.
As used herein, a “substituted” structure refers to a chemical structure where a hydrogen atom has been replaced by a substituent. A “substituent” is a chemical structure that replaces a hydrogen atom on the substituted structure. The term “substituent” does not imply that the substituent is smaller than the substituted structure.
Another embodiment of the invention is a combination for enhancing exon skipping in an mRNA of interest, comprising a compound from Table 1 and an AO that is specific for an exon that is to be skipped, and, optionally, a pharmaceutically acceptable carrier. In one embodiment, the combination comprises a dosage form of a compound of Table 1 and a dosage form of an AO that is specific for the exon which is to be skipped.
Suitable pharmaceutically acceptable carriers will be evident to a skilled worker. For guidance, see, e.g., Remington's Pharmaceutical Sciences (supra).
Another embodiment of the invention is a kit for carrying out one of the methods of the invention. For example, a kit for enhancing exon skipping in a pre-mRNA of interest can comprise a compound from Table 1 and an AO that is specific for an exon splicing sequence in the mRNA of interest. A kit for enhancing exon skipping in a muscle dystrophin mRNA in a subject that has Duchenne Muscular Dystrophy (DMD), in an animal model of DMD, or in an animal that is not necessarily an animal model for DMD, such as a monkey, can comprise a dosage form of a compound of Table 1 and a dosage form of an AO that is specific for the exon which is to be skipped.
A kit of the invention can comprise a device, composition, or other means for administering the agents of the invention to a subject. A kit suitable for a therapeutic treatment in a subject may further comprise a pharmaceutically acceptable carrier and, optionally, a container or packaging material.
Optionally, the kits comprise instructions for performing the method, and/or a notice in the form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals or biological products (such as the FDA), which notice reflects approval by the agency of manufacture, use or sale for human administration. In addition, agents in a kit of the invention may comprise other therapeutic compounds, for combination therapy. Other optional elements of a kit of the invention include suitable buffers, pharmaceutically acceptable carriers, or the like, containers, or packaging materials. The reagents of the kit may be in containers in which the reagents are stable, e.g., in lyophilized form or stabilized liquids. The reagents may also be in single use form, e.g., in single dosage form for use as therapeutics, or in single reaction form for diagnostic use.
Methods for making and using antisense and/or small molecule reagents, and for testing them for desirable properties, are conventional and well-known in the art. Guidance in performing some of the methods of the invention is provided, for example, in Sambrook et al., Molecular Cloning, A Laboratory Manual (volumes Cold Spring Harbor Laboratory Press, USA or Harlowe and Lane, Antibodies a Laboratory Manual 1988 and 1998, Cold Spring Harbor Laboratory Press, USA. These and other references cited herein which provide guidance for performing methods related to the present invention are incorporated by reference herein in their entirety.
In the foregoing and in the following examples, all temperatures are set forth in uncorrected degrees Celsius; and, unless otherwise indicated, all parts and percentages are by weight.
EXAMPLES Example I Identification of Small Molecule Enhancers of Antisense Mediated Exon SkippingIn this Example, we describe the implementation of a strategy to identify compounds that synergize with AO to promote exon skipping and the follow-up of a lead hit, dantrolene, in mutation repair of specific mouse and human models of Duchenne muscular dystrophy in vitro and in vivo. In contrast to prior screens aimed at identifying small molecules which impact exon skipping, our screen is unique at least because it relies on robust quantitation of a skipping reporter in the context of a muscle lineage cell in the presence and absence of suboptimal AO. These screens were performed using a mouse muscle cell line (C2C12) expressing a human DMD exon 50 GFP based reporter [18] selected to minimize experimental variation and sensitivity in the context of an automated and quantitative fluorescent scanning system.
The BioMol small molecule library (n=503) was screened at an effective concentration of 10 uM (dissolved in DMSO) for all compounds both in the presence and absence of 2′-O-methyl AO (AON6) targeting the splice donor site of human DMD exon 50. AO was added prior to small molecule incubation in an effort to identify molecules that facilitate AO skipping rather than AO delivery. The fluorescence induced by each compound was normalized to a vehicle controls per plate to correct for plate to plate variability. Fluorescence was averaged across replicate plates (n=6 without AO screen, n=3 with AO screen). Compounds were rank ordered based on average intensity of fluorescence and difference between the without AO and with AO screen (
The lipid library component of the BioMol library had high variability and these compounds were not analyzed. Within the top 5% of compounds from the remaining BioMol library screened in the context of AO, there was a significant over-representation of compounds modulating intracellular calcium, including dantrolene and ryanodine, both known to target the ryanodine receptor. (Z=5.49; Table 3). We found this intriguing given that calcium signaling has been previously identified as a modulator of mRNA splicing machinery in other settings [19].
Eight of the top nine top hits from the screen with AO were screened in a secondary assay with 12 or 16 point titrations using the Ex50-GFP reporter C2C12 cells in the presence or absence of AON6. Of the 8 compounds that were selected for secondary screening only 3 exhibited: 1) 10% increase in fluorescence in the Ex50-GFP+AO compared to the reporter line without AO and 2) evidence of a dose response. These three compounds were cyclopiazonic acid, dantrolene, and H-7 (
Dantrolene enhancement of AO directed DMD exon skipping was assessed in both mouse and human primary muscle cell systems in vitro. In primary fused mouse myotubes dantrolene synergized with a 2′-O-methyl AO M23D (overlapping splice donor site from +02-18) to enhance Dmd exon 23 skipping. Increasing concentrations of M23D shifted the Dmd mRNA species from an unskipped form to either exon 23 skipped or dual 22 and 23 skipped forms, both of which are in frame and lack exon 23 which contains the mdx premature stop mutation. A sub-optimal dose of M23D AO was established as 100 nM in order to approximate a dose that generates 20% of optimal skipping in fused myotubes, and used to measure potentiation of exon 23 skipping. Optimal skipping was typically achieved in a dose range of 200-600 nM M23D. After incubation with suboptimal M23D, the complex was removed, and 25-50 uM dantrolene was added for a sufficient time to allow for the complete transcription of new Dmd mRNA species [24]. RNA was extracted and the mRNA from exons 20-26 was assessed for exon 23 skipping by RT-PCR. Dantrolene increased the amount of exon 23 skipped product at both 25 and 50 uM concentrations (
Dantrolene treatment also increased DMD exon skipping in a disease relevant human mutational context using reprogrammed primary DMD patient fibroblasts fused to differentiated myotubes. The patient DMD mutation was confirmed as an exon 45-50 deletion predicted to be rendered in frame by skipping DMD exon 51, using a custom 15,000 probe CGH array (
To assess the efficacy of dantrolene as a potentiator of AO mediated exon skipping in an art-recognized in vivo mouse model of DMD, we utilized two separate experimental protocols in which dantrolene was administered systemically in the context of either a single intramuscular or single intravenous injection of AO in mdx mice. See
The entire TA was harvested on the tenth day and divided for analysis into 6-7 intervals, each of 800 μm length. One half of each of the middle four intervals were pooled to prepare sufficient protein for Western blot analysis (total of 1600 um length). Four central sections from the other half were use for immunofluorescence staining Western blotting demonstrated that treatment with dantrolene at either dose in combination with 2 ug of PMOE23 increased expression of dystrophin protein to levels observed with the higher Mug dose of PMOE23. The induced levels of dystrophin observed represent about 20% of C57 dystrophin levels. Western blots from representative mice are shown in
Representative immunoflourescence images of TA cross sections stained with anti-dystrophin antibody are shown in
Results from local PMOE23 administration prompted further exploration of dantrolene's efficacy in the context of systemic PMOE23 delivery to mdx mice. This enabled us to assess whether dantrolene in combination with systemic morpholino PMOE23 could enhance Dmd exon 23 skipping and induce dystrophin protein expression in multiple skeletal muscles. A single intravenous dose of 100 mg/kg PMOE23 was used as a positive control. A single intravenous dose of 10 mg/kg AO was used as a sub-optimal dose alone or in combination with twice daily dosing of 10 mg/kg/day of dantrolene intraperitoneally for the subsequent 6 days [7, 27] (n=3 in control groups and n=4 in experimental groups; Table 5).
Multiple skeletal muscles were harvested for analysis on day 7 including the quadriceps, gastrocnemius, tibialis anterior, diaphragm, triceps and heart. Muscles were assessed for: 1) increased amounts of skipped Dmd exon 23 mRNA species 2) Dystrophin protein rescue by Western blot 3) Dystrophin protein expression by quantitative immunostain, 4) appropriate subcellular localization, and 5) restoration of other components of the dystroglycan complex to the sarcolemmal membrane. To determine if dantrolene enhanced Dmd exon 23 skipping, the quantitative taqman assay was performed on RNA from each skeletal muscle. Dantrolene significantly increased Dmd exon 23 mRNA skipping in an aggregate analysis of all skeletal muscle groups (excluding heart) (
Our results suggest a model in which dantrolene synergizes with AOs, regardless of sequence specificity and chemistry, to enhance targeted DMD exon skipping. This has been demonstrated both in vitro in mouse and human cell systems, as well as in multiple skeletal muscles with intramuscular and intravenous delivery of PMOE in the mdx mouse. Given the timing of addition of AO and drug, it is unlikely that dantrolene is enhancing uptake of AO. Without wishing to be bound by any particular mechanism, we suggest that it is enhancing exon skipping through interaction with a specific molecular target that is modulating DMD splicing activity. The concept of utilizing small molecules to increase exon skipping efficiency has been demonstrated in a patient with a rare point mutation in DMD exon 31 that disrupts an ESE binding site for the SRp30c splicing factor. The addition of TG003, a specific inhibitor for Clks known to phosphorylate SR proteins increased mutant exon 31 skipping and facilitated dystrophin protein rescue [28]. However this therapeutic strategy is unlikely to be generalizable to broad treatment of DMD patients.
Without wishing to be bound by any particular mechanism, we propose that the mechanism by which dantrolene facilitates exon skipping may be that it functions by targeting the ryanodine receptor, its known molecular target. Ryanodine receptor regulates calcium release from the sarcoplasmic reticulum during excitation-contraction coupling in skeletal muscle. Because calcium signaling is a known regulator of splicing activity, dantrolene modulation of RyR1 mediated calcium flux in muscle is a plausible mechanism of its activity, which we are currently investigating. Further RyR expression on the nucleoplasmic reticulum has been implicated in regulating calcium signaling in the nucleus [29]. Hypermitrosylation of RyR in DMD has been attributed to calcium leak and downstream DMD pathology, possibly from calium regulated protein degradation [30]. A more recently developed class of drugs, called ‘rycals’ stabilize the cardiac RyR2/calstabin interactions, and are under active development for heart failure treatment to prevent a chronic leak of calcium through RyR2 [31]. Thus, dantrolene and rycals which prevent chronic calcium leak have been proposed as potential therapeutics for DMD. While it is possible that the synergistic action of dantrolene in mdx muscle is secondary to stabilization of proteins necessary for regulating the splicing machinery that were previously being degraded, this is unlikely, as we have observed effects of dantrolene on exon 23 skipping in cultured myotubes from C57BL6 as well as mdx mice. Nonetheless, potential activity of dantrolene resulting from non-splicing related effects of calcium modulation may provide another level of synergy in protecting DMD muscle function.
Studies of long-term dantrolene efficacy in the context of multiple AP injections and functional redouts, in the models presented herein as well as in humans, will confirm the results presented herein, demonstrating that the optimized administration of the agents of the invention improves DMD disease progression.
Example II Supplementary Studies A. Materials and Methods High-Throughput Screen and Secondary Screening in the Reporter Cell LineA stable clone was generated from C2C12 cells transfected with a human exon 50 DMD GFP reporter (ex50GFP) that has been previously described [18]. Ex50GFP reporter myoblasts were seeded into uncoated 384 well plates and were incubated for 4 hours either with or without 300 nM of 2′-O-methyl phosphorothioate AON6 [5′ AACUUCCUCUUUAACAGAAAAGCAUAC 3′ (SEQ ID NO:1)] targeting the human exon 50 splice donor site. Cells were transfected with AON6 using the FUGENE (Roche) transfection reagent per manufacturer's instructions. Following AON6 incubation, each component of the BioMol library (n=503) was screened at 10 uM concentration with a final concentration of the DMSO carrier being 1%. Forty-eight hours later fluorescence was measured using the MicroXpress high content imager and analyzed using MetaXpress. Immediately preceding imaging, DNA was stained with Hoescht for 30 min. The BioMol screen without AO (−AO) was performed in 6 replicates, and the with AO (+AO) screen was performed in 3 replicates. For the screen analysis raw fluorescence values were normalized to carrier controls present on each plate by subtracting the values. Negative fluorescence values were set to 0. The data from each compound were averaged from all replicates. For secondary screening by 12 or 16 point dose response, Ex50GFP myoblasts or C2C12 cells without the reporter were seeded on uncoated 384 well plates. A sub-optimal dose of AON6 targeting DMD exon 50 was added for 4 hours. Following the 4 hour incubation, a compound dilution was added (beginning at 100 uM with 1:1 dilutions) for either 12 or 16 points. After a 48 hour incubation with compounds, DNA was stained with Hoescht, and fluorescence determined using the high content imager and analyzed with MetaXpress.
Primary Cell Culture and Antisense Oligonucleotide TransfectionPrimary mouse myoblasts were isolated from the quadriceps of a C57/B16 mouse and were carried in culture with 20% FBS in DMEM and 2 ng/uL FGF. For Dmd exon 23 skipping assays cells were seeded onto extracellular matrix (ECM) (Sigma) coated plates in growth media. On day 2 growth media was removed and fusion media (2% horse serum in phenol red free DMEM) was added. On day 3 a 2-O′-methyl phosphorothioate AO M23D(+02-18) [5′ GGCCAAACCUCGGCUUACCU 3′ (SEQ ID NO:3)] was transfected into cells using FUGENE per manufacturers instructions. M23D concentrations ranged from 100 nM to 600 nM, with 100 nM M23D representing the sub-optimal dose. On day 4 cells were washed in PBS, and dantrolene (dissolved in DMSO) was added in fresh fusion media. After 48 hours cells were harvested for analysis.
Primary human dermal fibroblasts (GM05017) from a DMD patient were obtained from Coriell and were maintained in growth media (DMEM with 15% FBS, 1% nonessential amino acids, 1% pen/strep). Prior to experiments the genomic DMD deletion between exons 45-50 was confirmed using a custom CGH array with 14022 probes tiling the DMD gene (
RNA Isolation, RT-PCR and qRT-PCR
RNA was isolated from cell culture using TRIZOL (mouse) and the QIAGEN RNAeasy Microkit (human). RNA was isolated from snap frozen skeletal muscle using the QIAGEN RNAeasy Fibrous Tissue Kit. In the mouse cells cDNA was reverse transcribed from total RNA with OligodT20 (Invitrogen). In the non-quantitative RT-PCR assay a nested PCR was performed between Dmd exons 20-26 as has been previously described [12]. The quantitative taqman assay to assess Dmd exon 23 skipping detection was performed as previously described [25]. In human cells dystrophin cDNA was reverse transcribed with a gene specific primer in DMD exon 54. A nested RT-PCR between DMD exons 43-52 was then performed using previously described primers [10]. For identifying muscle markers in reprogrammed fusing myotubes cDNA was reverse transcribed with OligodT20. Primers for muscle markers were as follows: MyoD (Fwd-5′ GCAGGTGTAACCGTAACC 3′ (SEQ ID NO:4), Rev-5′ ACGTACAAATTCCCTGTAGC 3′ (SEQ ID NO:5)), Myosin Heavy Chain (Fwd-5′ CAGTAGCCCCATCACATTTG 3′(SEQ ID NO:6), Rev-5′ ATAACGCAATGGACAAGTG 3′ (SEQ ID NO:7)), Desmin (Fwd-5′ CCTACTCTGCCCTCAACTTC 3′ (SEQ ID NO:8), Rev-5′ AGTATCCCAACACCCTGCTC 3′ (SEQ ID NO:9)), Myogenin (Fwd-5′ GCCACAGATGCCACTACTTC 3′(SEQ ID NO:10) Rev-5′ CAACTTCAGCACAGGAGACC 3′(SEQ ID NO:11)). GAPDH primers are as follows: Fwd-5′ GAGCCACATCGCTCAGACAC 3′ (SEQ ID NO:12), Rev-5′ CATGTAGTTGAGGTCAATGAAGG 3′(SEQ ID NO:13). The thermocycler conditions were 94 C for 2 min, followed by 33 cycles of 94 C for 30s, 62 C for 30s, and 72 C for 30s, with a final extension of 72 C for 10 min. Amplification of the ryanodine receptor required a nested PCR. For the initial PCR the primers were Fwd-5′-CATCAACTATGTCACCAGCATCCG-3′ (SEQ ID NO:14) and Rev-5′-GGCTGAACCTTAGAAGAGTC-3′ (SEQ ID NO:15) and for the nested PCR the primers were Fwd-5′ GAGACCTTCTATGATGCAGC 3′ (SEQ ID NO:16) and Rev-5′ AGAGCTCGTGGATGTTCTC 3′. (SEQ ID NO:17). Conditions for the initial ryanodine receptor PCR were 95 C for 5 min, 20 cycles of 95 C for 30s, 56 C for 2 min, 72 C for 90s and a final extension of 72 C for 10 min. The nested PCR conditions were 95 C for 5 min, 35 cycles of 95 C for 30s, 59 C for 2 min, 72 C for 90s and a final extension of 72 C for 10 min.
Western BlotTotal protein was isolated from flash frozen skeletal muscle from both the membrane and cytoplasmic fractions. Briefly, ½ of each analyzed muscle were homogenized for 1 minute in 1 mL of ice-cold mito-buffer (0.2 mM EDTA, 0.25 mM sucrose, 10 mM TrisHCl, pH 7.4) with protease/phosphatase inhibitors cocktail (Pierce) and DNAse/RNAse and subjected to low-speed (1500 g) centrifugation for 10 min at 4 C. The supernatant was centrifuged at 100000 g (high speed centrifugation) for 1 hr for isolation of membrane fraction. Isolated membranes and pellet after low speed centrifugation were combined and re-suspended in 300 uL of extraction buffer (50 mM Tris-HCl, pH 7.4, 7 M urea, 2 M thiourea, 4% CHAPS, 2% SDS, 50 mM beta-mercaptoethanol). Protein concentration in solubilized pellet and supernatant after high-speed centrifugation (cytoplasmic fraction) was determined by 2-D Quant Kit (GE Healthcare Life Sciences). 50 ug of total protein from dystrophic mice, or 5 ug from wildtype, was run on a 6% polyacrylamide gel and transferred onto a nitrocellulose membrane for 2 hours at 4 C. The membrane was blocked for 1 hr in 5% milk and then incubated with MANDYS8 (Sigma)1:500 against dystrophin or 1:5000 anti-vinculin (Sigma), a skeletal muscle membrane protein not associated with the DGC that was utilized as a loading control. For analysis dystrophin protein levels were normalized to the vinculin loading control and then pooled across treatment groups or muscles to determine average dystrophin rescue. Dystrophin and vinculin were detected in pellet (miofibrillar/membrane fraction) but not in cytoplasmic fraction.
ImmunofluorescenceUnfixed frozen tissue sections were air dried and incubated for 1 hr in MOM Mouse IgG blocking reagent. Sections were incubated with MANDYS8 (Sigma) for dystrophin detection in the rod domain, Ab15277 (Abcam) for dystrophin detection at the C terminus, and Manex 1A (Developmental Studies Hybridoma Bank) for dystrophin detection at the N terminus. Staining for other members of the dystrophin-glycoprotein complex was performed with NCL-a-SARC (Novocastra) for alpha-sarcoglycan and NCL-b-DG (Novocastra) for beta-dystroglycan. Nuclear DNA was visualized with a DAPI stain. Secondary labeling was performed with a FITC labeled anti-mouse or anti-rabbit from Vector labs.
For immunofluorescence in human cell culture terminally fused myotubes were fixed in 2% paraformaldehyde for 15 min and then blocked in 20% goat serum for 1 hour. Cells were washed and then incubated with 1:40 MF20 for detection of myosin heavy chain (Developmental Studies Hybridoma Bank). Cells were then incubated in Alexa488 (Invitrogen) at 1:400 and were mounted in ProLong Gold Antifade Mounting Medium with DAPI (Invitrogen).
In Vivo Administration of Antisense Oligonucleotide and DantrolenePMOE23 morpholino (GeneTools) was resuspended in 150 mM sterile saline for intramuscular injections in a 25 uL volume into the tibialis anterior muscle. Intravenous administration of PMOE23 was achieved by tail vein injection of morpholino resuspended in 200 uL sterile saline. Dantrolene sodium salt (Sigma) was resusupended in 100% DMSO stock solutions and diluted in sterile saline (final 20% DMSO) immediately prior to the twice daily intraperitoneal injection in a 200 uL volume.
Statistical AnalysisAll statistical analysis were a two-tailed student's t test with unequal variance in EXCEL.
Example III Further DataThe experiments described in the figures as summarized below were carried out using methods described elsewhere herein, and/or by conventional methods that are well-known by those of skill in the art.
These experiments provide data showing, e.g., that 7 additional small molecule compounds can enhance exon skipping of the DMD gene of human myotube which are exon 51 skippable. See
Furthermore, additional confirmatory tests (titrations) are presented and functional testing of dantrolene is shown in a mouse system.
An alternative formulation of dantrolene—Revonto—is also shown to be effective.
REFERENCES
- 1. Emery, A. E., The muscular dystrophies. Lancet, 2002. 359(9307): p. 687-95.
- 2. Emery, A. E., Population frequencies of inherited neuromuscular diseases—a world survey. Neuromuscul Disord, 1991. 1(1): p. 19-29.
- 3. Monaco, A. P., et al., Detection of deletions spanning the Duchenne muscular dystrophy locus using a tightly linked DNA segment. Nature, 1985. 316(6031): p. 842-5.
- 4. Monaco, A. P., et al., An explanation for the phenotypic differences between patients bearing partial deletions of the DMD locus. Genomics, 1988. 2(1): p. 90-5.
- 5. Nakamura, A., et al., Follow-up of three patients with a large in frame deletion of exons 45-55 in the Duchenne muscular dystrophy (DMD) gene. J Clin Neurosci, 2008. 15(7): p. 757-63.
- 6. King, W. M., et al., Orthopedic outcomes of long-term daily corticosteroid treatment in Duchenne muscular dystrophy. Neurology, 2007. 68(19): p. 1607-13.
- 7. Alter, J., et al., Systemic delivery of morpholino oligonucleotide restores dystrophin expression bodywide and improves dystrophic pathology. Nat Med, 2006. 12(2): p. 175-7.
- 8. Goemans, N. M., et al., Systemic administration of PRO051 in Duchenne's muscular dystrophy. N Engl J Med, 2011. 364(16): p. 1513-22.
- 9. Kinali, M., et al., Local restoration of dystrophin expression with the morpholino oligomer AVI-4658 in Duchenne muscular dystrophy: a single-blind, placebo-controlled, dose-escalation, proof-of-concept study. Lancet Neurol, 2009. 8(10): p. 918-28.
- 10. van Deutekom, J. C., et al., Local dystrophin restoration with antisense oligonucleotide PRO051. N Engl J Med, 2007. 357(26): p. 2677-86.
- 11. Yokota, T., et al., Efficacy of systemic morpholino exon-skipping in Duchenne dystrophy dogs. Ann Neurol, 2009. 65(6): p. 667-76.
- 12. Lu, Q. L., et al., Functional amounts of dystrophin produced by skipping the mutated exon in the mdx dystrophic mouse. Nat Med, 2003. 9(8): p. 1009-14.
- 13. Crisp, A., et al., Diaphragm rescue alone prevents heart dysfunction in dystrophic mice. Hum Mol Genet, 2011. 20(3): p. 413-21.
- 14. Aartsma-Rus, A., et al., Theoretic applicability of antisense-mediated exon skipping for Duchenne muscular dystrophy mutations. Hum Mutat, 2009. 30(3): p. 293-9.
- 15. Goemans, N. M., et al., 24 week follow-up data from a phase I/IIa extension study of PRO051/GSK240220968 in subjects with Duchenne muscular dystrophy, in 15th International Congress of The World Muscle Society. 2010, Neuromuscular Disorders. p. 639.
- 16. Shrewsbury, S. B., et al., Current progress and preliminary results with the systemic administration trial of AVI-4658, a novel phosphorodiamidate morpholino oligomer (PMO) skipping dystrophin exon 51 in Duchenne muscular dystrophy (DMD), in 15th International Congress of the World Muscle Society. 2010, Neuromuscular Disorders. p. 639-640.
- 17. Neri, M., et al., Dystrophin levels as low as 30% are sufficient to avoid muscular dystrophy in the human. Neuromuscul Disord, 2007. 17(11-12): p. 913-8.
- 18. Hu, Y., et al., Guanine analogues enhance antisense oligonucleotide-induced exon skipping in dystrophin gene in vitro and in vivo. Mol Ther, 2010. 18(4): p. 812-8.
- 19. Krebs, J., The influence of calcium signaling on the regulation of alternative splicing. Biochim Biophys Acta, 2009. 1793(6): p. 979-84.
- 20. Glahn, K. P., et al., Recognizing and managing a malignant hyperthermia crisis: guidelines from the European Malignant Hyperthermia Group. Br J. Anaesth. 105(4): p. 417-20.
- 21. Verrotti, A., et al., Pharmacotherapy of spasticity in children with cerebral palsy. Pediatr Neurol, 2006. 34(1): p. 1-6.
- 22. Bertorini, T. E., et al., Effect of dantrolene in Duchenne muscular dystrophy. Muscle Nerve, 1991. 14(6): p. 503-7.
- 23. Quinlan, J. G., S. R. Johnson, and F. J. Samaha, Dantrolene normalizes serum creatine kinase in MDX mice. Muscle Nerve, 1990. 13(3): p. 268-9.
- 24. Tennyson, C. N., H. J. Klamut, and R. G. Worton, The human dystrophin gene requires 16 hours to be transcribed and is cotranscriptionally spliced. Nat Genet, 1995. 9(2): p. 184-90.
- 25. O'Leary, D. A., et al., Identification of small molecule and genetic modulators of AON-induced dystrophin exon skipping by high-throughput screening. PLoS One, 2009. 4(12): p. e8348.
- 26. Kimura, E., et al., Cell-lineage regulated myogenesis for dystrophin replacement: a novel therapeutic approach for treatment of muscular dystrophy. Hum Mol Genet, 2008. 17(16): p. 2507-17.
- 27. Malerba, A., et al., Dosing regimen has a significant impact on the efficiency of morpholino oligomer-induced exon skipping in mdx mice. Hum Gene Ther, 2009. 20(9): p. 955-65.
- 28. Nishida, A., et al., Chemical treatment enhances skipping of a mutated exon in the dystrophin gene. Nat Commun, 2011. 2: p. 308.
- 29. Marius, P., et al., Calcium release from ryanodine receptors in the nucleoplasmic reticulum. Cell Calcium, 2006. 39(1): p. 65-73.
- 30. Bellinger, A. M., et al., Hypermitrosylated ryanodine receptor calcium release channels are leaky in dystrophic muscle. Nat Med, 2009. 15(3): p. 325-30.
- 31. Shan, J., et al., Role of chronic ryanodine receptor phosphorylation in heart failure and beta-adrenergic receptor blockade in mice. J Clin Invest. 120(12): p. 4375-87.
From the foregoing description, one skilled in the art can easily ascertain the essential characteristics of this invention, and without departing from the spirit and scope thereof, can make changes and modifications of the invention to adapt it to various usage and conditions and to utilize the present invention to its fullest extent. The preceding preferred specific embodiments are to be construed as merely illustrative, and not limiting of the scope of the invention in any way whatsoever. The entire disclosure of all applications, patents, and publications cited above, including U.S. Provisional Application No. 61/529,041, filed Aug. 30, 2011, and in the figures are hereby incorporated in their entirety by reference, particularly with regard to the information for which they are cited.
Claims
1. A method for enhancing exon skipping in an mRNA of interest, comprising contacting the mRNA with an effective amount of a small molecule compound selected from one or more of furaltadone hydrochloride, 5-iodotubericidin, bendroflumethiazide, cyclopiazonic acid, GW 5074, indirubin, rescinnamin, U-0126, acetopromazine maleate salt, Ro 31-8220, dantrolene, dichlorobenzamil, ellipticine, fenbendazole, GF 109203×, halofantrine, niclosamide, pimozide, reserpine, syringospine, a RyCal, piperacetazine, fluphenazine dihydrochloride, trifluorperazine dihydrochloride, yohimbinic acid, or menadione,
- or a pharmaceutically acceptable salt, hydrate, solvate, or isomer thereof.
2. The method of claim 1, wherein an antisense oligonucleotide (AO) which is specific for a splicing sequence in the mRNA is administered in conjunction with the compound.
3. The method of claim 1, wherein no AO is introduced in conjunction with the compound.
4. The method of claim 1, wherein the mRNA is from the muscle dystrophin (DMD) gene, which encodes a muscle dystrophin protein.
5. The method of claim 4, wherein the exon which is skipped is exon 23, 44, 45, 50, 51, 52 and/or 53 of the DMD gene.
6. The method of claim 1, which is carried out in vitro.
7. The method of claim 1, which is carried out in a subject that has Duchenne Muscular Dystrophy (DMD), is an animal model of DMD, or is another animal in which the exon skipping can be assayed.
8. The method of claim 7, wherein the subject is human.
9. The method of claim 1, wherein the compound is dantrolene or an active variant thereof.
10. The method of claim 9, wherein the compound is dantrolene.
11. A method for treating a subject that has Duchenne Muscular Dystrophy (DMD), or is a non-human model of DMD, comprising administering to the subject an effective amount of a small molecule compound selected from one or more of furaltadone hydrochloride, 5-iodotubericidin, bendroflumethiazide, cyclopiazonic acid, GW 5074, indirubin, rescinnamin, U-0126, acetopromazine maleate salt, Ro 31-8220, dantrolene, dichlorobenzamil, ellipticine, fenbendazole, GF 109203×, halofantrine, niclosamide, pimozide, reserpine, syringospine, Ryanodine, RyCal S107, piperacetazine, fluphenazine dihydrochloride, trifluorperazine dihydrochloride, yohimbinic acid, or menadione,
- or a pharmaceutically acceptable salt, hydrate, solvate, or isomer thereof,
- in conjunction with an AO which is specific for a splicing sequence of exon 23, 45, 44, 50, 51, 52 and/or 53 of the DMD gene.
12. A method for identifying a small molecule compound that enhances exon skipping in an mRNA of interest, comprising testing small molecule candidates for their ability to enhance exon skipping in the mRNA, and selecting compounds which exhibit greater enhancement of exon skipping than one of the molecules in Table 1.
13. The method of claim 12, wherein the small molecule candidates tested in conjunction with an AO specific for a splicing sequence of the exon that is to be skipped.
14. The method of claim 12, wherein the small molecule candidate is a variant of furaltadone hydrochloride, 5-iodotubericidin, bendroflumethiazide, cyclopiazonic acid, GW 5074, indirubin, rescinnamin, U-0126, acetopromazine maleate salt, Ro 31-8220, dantrolene, dichlorobenzamil, ellipticine, fenbendazole, GF 109203×, halofantrine, niclosamide, pimozide, reserpine, syringospine, Ryanodine, RyCal S107, piperacetazine, fluphenazine dihydrochloride, trifluorperazine dihydrochloride, yohimbinic acid, or menadione,
- or a pharmaceutically acceptable salt, hydrate, solvate, or isomer thereof.
15. The method of claim 13, wherein the small molecule candidate is a variant of furaltadone hydrochloride, 5-iodotubericidin, bendroflumethiazide, cyclopiazonic acid, GW 5074, indirubin, rescinnamin, U-0126, acetopromazine maleate salt, Ro 31-8220, dantrolene, dichlorobenzamil, ellipticine, fenbendazole, GF 109203×, halofantrine, niclosamide, pimozide, reserpine, syringospine, Ryanodine, RyCal S107, piperacetazine, fluphenazine dihydrochloride, trifluorperazine dihydrochloride, yohimbinic acid, or menadione,
- or a pharmaceutically acceptable salt, hydrate, solvate, or isomer thereof.
16. A combination for enhancing exon skipping in an mRNA of interest, comprising
- a small molecule compound selected from one or more of furaltadone hydrochloride, 5-iodotubericidin, bendroflumethiazide, cyclopiazonic acid, GW 5074, indirubin, rescinnamin, U-0126, acetopromazine maleate salt, Ro 31-8220, dantrolene, dichlorobenzamil, ellipticine, fenbendazole, GF 109203×, halofantrine, niclosamide, pimozide, reserpine, syringospine, Ryanodine, RyCal S107, piperacetazine, fluphenazine dihydrochloride, trifluorperazine dihydrochloride, yohimbinic acid, or menadione,
- or a a pharmaceutically acceptable salt, hydrate, solvate, or isomer thereof,
- and an AO that is specific for an exon that is to be skipped,
- and, optionally, a pharmaceutically acceptable carrier.
17. A kit for enhancing exon skipping in an mRNA of interest, comprising a compound from Table 1, or a a pharmaceutically acceptable salt, hydrate, solvate, or isomer thereof, and an AO that is specific for an exon splicing sequence in the mRNA of interest, wherein the compound and the AO are optionally packaged in containers, separately or together.
18. A kit for enhancing exon skipping in a muscle dystrophin mRNA in a subject that has Duchenne Muscular Dystrophy (DMD), or is an animal model of DMD, comprising a dosage form of a compound of Table 1, or a pharmaceutically acceptable salt, hydrate, solvate, or isomer thereof, and of an AO that is specific for the exon which is to be skipped, and a pharmaceutically acceptable carrier, wherein the compound and the AO are optionally packaged in containers, separately or together,
- wherein the compound of Table 1 is one or more of Furaltadone hydrochloride, 5-iodotubericidin, bendroflumethiazide, cyclopiazonic acid, GW 5074, indirubin, rescinnamin, U-0126, acetopromazine maleate salt, Ro 31-8220, dantrolene, dichlorobenzamil, ellipticine, fenbendazole, GF 109203×, halofantrine, niclosamide, pimozide, reserpine, syringospine, Ryanodine, RyCal S107, piperacetazine, fluphenazine dihydrochloride, trifluorperazine dihydrochloride, yohimbinic acid, or menadione,
- or a pharmaceutically acceptable salt, hydrate, solvate, or isomer thereof.
19. The method of claim 1, wherein the RyCal is Ryanodine or RyCal S 107.
Type: Application
Filed: Sep 13, 2013
Publication Date: Mar 20, 2014
Applicant: The Regents of the University of california (Oakland, CA)
Inventors: Stanley F. Nelson (Los Angeles, CA), Carrie Miceli (Los Angeles, CA), Miriana Moran (Los Angeles, CA)
Application Number: 14/026,699
International Classification: A61K 31/4178 (20060101); C12Q 1/68 (20060101); A61K 31/7105 (20060101);