siRNA/Nanoparticle Formulations for Treatment of Middle-East Respiratory Syndrome Coronaviral Infection
The present invention relates to compositions and methods for siRNA therapeutics for prevention and treatment of Middle East Respiratory Syndrome Corona Virus (MERS-CoA) infections. The compositions include a pharmaceutical composition comprising siRNA cocktails that target viral genes and pharmaceutically acceptable polymeric nanoparticle carriers and liposomal nanoparticle carriers.
This application claims the benefit of and priority to U.S. Provisional Patent Application No. 62/215,565, filed Sep. 8, 2015, which is incorporated herein by reference in its entirety.
FIELD OF INVENTIONThe present invention provides a pharmaceutical product composition of matter comprising siRNA sequences targeting genes or single-stranded viral RNAs of Middle-East Respiratory Syndrome Corona Virus (MERS-CoV), and nanoparticle carrier systems such as Histidine-Lysine co-polymers (HKP), or Spermine-Liposome conjugates (SLiC), or a lung tissue targeted moiety, such as a peptide, a nucleotide, a small molecule, and an antibody. The present invention also involves in methods of use for this pharmaceutical product, including formulations of siRNA/nanoparticle carrier, their process development and specific delivery routes and regimens. This invention presents a novel therapeutic agent for treatment of MERS-CoV infection.
BACKGROUND MERS-CoV Virus Disease: Biology and PathologyMiddle East respiratory syndrome (MERS) is a highly lethal respiratory disease caused by a novel single-stranded, positive-sense RNA betacoronavirus, MERS-CoV. Dromedary camels, hosts for MERS-CoV, are implicated in direct or indirect transmission to human beings, although the exact mode of transmission is unknown. Recent studies support that camels serve as the primary source of the MERS-CoV infecting humans, while bats may be the ultimate reservoir of the virus. The virus was first isolated from a patient who died from a severe respiratory illness in June, 2012, in Jeddah, Saudi Arabia. As of May 31, 2015, 1180 laboratory-confirmed cases (483 deaths; 40% mortality) have been reported to WHO (Zumbia A. et al. 2015). The Centers for Disease Control and Prevention (CDC) has labelled it as a transmissible disease from human-to-humans. (Jalal S. 2015). Although most cases of MERS have occurred in Saudi Arabia and the United Arab Emirates, cases have been reported in Europe, the USA, and Asia in people who travelled from the Middle East or their contacts. Clinical features of MERS range from asymptomatic or mild disease to acute respiratory distress syndrome and multiorgan failure, resulting in death, especially in individuals with underlying comorbidities. No specific drug treatment exists for MERS and infection prevention, and control measures are crucial to prevent spread in health-care facilities (Zumbla A. Et al 2015). Clinical severity of the disease observed in humans may be explained the ability of MERS-CoV to replicate in the lower respiratory tract (de Wit E, et al. 2013) and is also related to MERS-CoV's ability to infect a broad range of cells with dipeptidyl peptidase 4 receptor (DPP4) expression, evade the host innate immune response, and induce cytokine dysregulation (Chan J F, 2015).
MERS-CoV is an enveloped single-stranded positive sense RNA virus with a genome of 30,119 nt. The genome structure of MERS-CoV is similar to other coronaviruses, with the 5′ two-thirds of the genome encoding the non-structural proteins (NSPs) required for viral genome replication, the remaining 3′ third of the genome encoding the structural genes that make up the virion (spike, envelope, membrane, and nucleocapsid proteins), and four accessory genes interspersed within the structural gene region. At the 5′ end of the genome, there is a leader sequence (67 nt), which is followed by an untranslated region (UTR). At the 3′ end of the RNA genome there is another UTR, followed by a poly (A) sequence of variable length. Transcription-regulatory sequences (TRS 5′ AACGAA 3′) are found at the 3′ end of the leader sequence and at different positions upstream of genes in the genomic 3′-proximal domain of MERS-CoV. The MERS-CoV genome contains at least 10 predicted open reading frames (ORFs): ORF1a, ORF1b, S, 3, 4a, 4b, 5, E, M and N with sixteen predicted nonstructural proteins being encoded by ORF1a/b. Several unique group-specific ORFs that are not essential for virus replication are encoded by MERS-CoV. The functions of these group-specific ORFs are unknown; however, by analogy to other coronaviruses, they may encode structural proteins or interferon antagonist genes (Totura A L, Baric R S, 2012). Open reading frames ORF2, -6, -7 and -8a are translated from subgenomic mRNAs predicted to encode the four canonical structural genes: a 180/90-kDa spike glycoprotein (S), a ∫23-kDa membrane glycoprotein (M), a small envelope protein (E) and a ˜50-kDa nucleocapsidprotein (N), respectively (Abdel-Moneim A S. 2014).
Similar to other RNA viruses, coronavirus replicate in the host cytoplasm. The replication process is initiated by the viral particle after binding with specific cellular receptors, known as S-protein mediated binding. The receptor for MERS-CoV was recently identified as dipeptidyl peptidase 4 (DDP4, also known as CD26), a protein with diverse functions in glucose homeostasis, T-cell activation, neurotransmitter function, and modulation of cardiac signaling. DPP4 is expressed in a variety of cell types, including endothelial cells (kidney, lung, small intestine, spleen) hepatocytes, enterocytes, activated leukocytes, testes, prostate and cells of the renal glomeruli and proximal tubules. DPP4 recognition is mediated by the receptor-binding domain (RBD, amino acids E367-Y606)(Pascal K, et al. 2015). Following virus entry, the coronavirus genome, a positive sense, capped and polyadenylated RNA strand, is directly translated, resulting in the synthesis of coronavirus replicase gene-encoded NSPs. Coronavirus NSPs are translated as two large polyproteins harboring proteolytic enzymes, namely papain-like and chymotrypsin-like proteinases that extensively process coronavirus polyproteins to liberate up to 16 NSPs (nsp 1-16) (Lundin A. et al. 2014). After entering into the cell, the virus specially modulates the innate immune response, antigen presentation, and mitogen-activated protein kinase.
Current Prophylaxis and TherapeuticsAlthough the emergence of highly pathogenic MERS-CoV highlights an urgent need for potent therapeutic and prophylactic agents, no approved antiviral treatments for any human coronavirus infections are currently available. Supportive treatment with extracorporeal membrane oxygenation and dialysis is often required in patients with organ failure. Recently, tremendous efforts have been made in the search for an effective anti-MERS-CoV agent, and a number of antiviral agents have been identified. For example, some compounds with inhibitory activities in the low micromolar range on MERS-CoV replication in cell cultures have been identified from the libraries of FDA-approved drugs, de Wilde A H. and colleges identified four compounds (chloroquine, chlorpromazine, loperamide, and lopinavir) inhibiting MERS-CoV replication in the low-micromolar range (50% effective concentrations [EC(50)s], 3 to 8 μM) (de Wilde A H et al. 2014).
Antivirals with potent in vitro activities also include neutralizing monoclonal antibodies, antiviral peptides, interferons, mycophenolic acid. It was reported that rhesus macaques treated with a cocktail of IFN-a2b with ribavirin, a nucleoside analog, exhibited reduced MERS-CoV replication and an improved clinical outcome (Falzarano D, et al. 2013). Lu L. and colleges designed and synthesized a peptide (HR2P) derived from the HR2 domain in the S2 subunit of the spike (S) protein of the MERS-CoV EMC/2012 strain. They found that HR2P could bind with the HR1 domain to form a stable six-helix bundle and thus inhibit viral fusion core formation and S protein-mediated cell-cell fusion. HR2P was demonstrated to potently inhibit infection by both pseudotyped and live MERS-CoV in different cell lines. After modification of the HR2P peptide by introducing Glu (E) and Lys (K) residues at the i to i+4 or i to i+3 arrangements, it was found that one of these HR2P analogous peptides, HR2P-M2, exhibited significantly improved stability, solubility and antiviral activity. HR2P-M2 peptide could potently inhibit infection by pseudoviruses expressing MERS-CoV S protein with or without mutation in the HR1 region, suggesting that it could be effective against most currently available MERS-CoV mutants. It was demonstrated that the HR2P-M2 peptide administered via the intranasal route could protect Ad5-hDPP4-transduced mice from challenge by MERS-CoV strains with or without mutations in the HR1 region, indicating that this peptide could be used as a nasal spray to protect high-risk populations, including healthcare workers, MERS patients' family members, and those having close contacts with the patients, from MERS-CoV infection. Intranasal application of the peptide to MERS-CoV-infected patients may suppress viral replication in epithelial cells of the respiratory tract and thus reduce the release of virions, thereby preventing the spreading of MERS-CoV to other people (Lu L. et al. 2015).
Another approach is passive administration of sera from convalescent human MERS patients or other animals to exposed or infected patients. The vast majority of camels in the Middle East have been infected with MERS-CoV, and some contain high titers of antibody to the virus. It was shown that this antibody is protective if delivered either prophylactically or therapeutically to mice infected with MERS-CoV, indicating that this may be a useful intervention in infected patients (Zhao. J. et al. 2015).
In April 2014, three studies conducted by separate laboratories around the world reported the development of fully human neutralizing mAbs against MERS-CoV. All these mAbs target the RBD (receptor-binding domain) of the MERS-CoV S1 glycoprotein and they were identified from non-immune human antibody libraries. Among these antibodies, three highly potent mAbs (m336, m337, m338) were identified from a very large phage-displayed antibody Fab library that was generated by using B cells from the blood of 40 healthy donors. This library was panned against recombinant MERS-CoV RBD to enrich for high affinity binders. The three identified mAbs, all derived from the VH gene 1-69, which has been the source of many other antiviral antibodies, exhibited exceptionally potent activity and neutralized pseudotyped MERS-CoV with 50% inhibitory concentration (IC50), ranging from 0.005 to 0.017 mg/ml. The most potent mAb, m336, inhibited >90% MERS-CoV pseudovirus infection (IC90) in DPP4-expressing Huh-7 cells at a concentration of 0.039 mg/ml. Similarly, m336 showed the most potent live MERS-CoV neutralizing activity in inhibiting the formation of MERS-CoV-induced CPE during live MERS-CoV infection of permissive Vero E6 cells, with an IC50 of 0.07 mg/ml.
In vivo studies have shown that this mAb is very effective in protecting MERS-CoV-susceptible animals from viral challenge (unpublished data), suggesting that the m336m mAb is a very promising drug candidate for the urgent treatment of MERS-CoV-infected patients (Tianlei Ying et al. 2015). Lu L. et colleges performed in vitro studies demonstrating that the combination of HR2P-M2 peptide with m336 mAb exhibited a strong synergistic effect against MERS-CoV infection (unpublished data). This observation suggests that intranasal administration of HR2P-M2 peptide combined with intravenous administration of m336 mAb may be a powerful strategy for treatment of MERS patients (Lu L. et al. 2015).
Jiang and colleges also identified two potent RBD-specific neutralizing mAbs, MERS-4 and MERS-27, by using a non-immune yeast-displayed scFv library to screen against the recombinant MERS-CoV RBD. The most potent mAb, MERS-4, neutralized the pseudotyped MERS-CoV infection in DPP4-expressing Huh-7 cells with an IC50 of 0.056 mg/ml and inhibited the formation of MERS-CoV-induced CPE during live MERS-CoV infection of permissive Vero E6 cells with an IC50 of 0.5 mg/ml. Tang et colleges identified neutralizing mAbs by using a non-immune phage-displayed scFv library. The panning was performed by sequentially using MERS-CoV spike-containing paramagnetic proteoliposomes and MERS-CoV S glycoprotein-expressing 293T cells as antigens. A panel of 7 anti-S1 scFvs was identified and expressed in both scFv-Fc and IgG1 formats, and their neutralizing activity against pseudotyped MERS-CoV in DPP4-expressing 293T cells, as well as live MERS-CoV infection in Vero cells, was measured. The most potent antibody, 3B11, neutralized live MERS-CoV in the plaque reduction neutralization tests with an IC50 of 1.83 mg/ml and 3.50 mg/ml in the scFv-Fc and IgG format, respectively (Tianlei Ying et al. 2015).
Fully Human Antibody and Humanized Mouse ModelPascal K. and colleges used the Velocimmune platform (a mouse that expresses human antibody-variable heavy chains and i light chains) to generate a panel of fully human, noncompeting monoclonal antibodies that bind to MERS-CoV S protein and inhibit entry into target cells. It was showed that two of these antibodies (REGN3051 and REGN3048) can potently neutralize pseudoparticles generated with all clinical MERS-CoV S RBD variants isolated to date. Authors demonstrated that the fully human VelocImmune antibodies neutralize infectious MERS-CoV significantly more efficient than published monoclonals isolated using traditional methods. They also developed a novel humanized model for MERS-CoV infection. They replaced the 79 kb of the mouse Dpp4 gene with 82 kb of its human ortholog. The resulting mice express fully human DPP4 under the control of the mouse regulatory elements, to preserve the proper expression regulation and protein tissue distribution and showed that these antibodies can prevent and treat MERS-CoV infection in vivo (Pascal K E et al. 2015).
CoronavirusesCoronaviruses are enveloped viruses and their positive strand RNA genome, the largest of all RNA viruses, encodes for as many as 16 non-structural proteins (NSPs), 4 major structural proteins, and up to 8 accessory proteins. Many of these proteins provide essential, frequently enzymatic, functions during the viral life cycle, such as coronavirus protease or RNA-dependent RNA polymerase (RdRp) activities. For example, the spike (S) protein mediates binding of different HCoVs to their specific cellular receptors, an event associated with preferential virus tropism for either ciliated or non-ciliated cells of the airway epithelium. The S protein also mediates fusion between lipids of the viral envelope and the host cell plasma membrane or membranes of endocytic vesicles to promote delivery of viral genomic RNA into the cytoplasm. Following virus entry, the coronavirus genome, a positive sense, capped and polyadenylated RNA strand, is directly translated, resulting in the synthesis of coronavirus replicase gene-encoded NSPs Coronavirus NSPs are translated as two large polyproteins harboring proteolytic enzymes, namely papain-like and chymotrypsin-like proteinases that extensively process coronavirus polyproteins to liberate up to 16 NSPs (nsp 1-16). These proteolytic functions are considered essential for coronavirus replication. Likewise, the coronavirus RdRp activities, which reside in nsp8 and nsp12, are considered essential for coronavirus replication. Coronaviruses encode an array of RNA-processing enzymes. These include a helicase activity linked to an NTPase activity in nsp13, a 3′-5′-exonuclease activity linked to a N7-methyltransferase activity in nsp14, an endonuclease activity in nsp15, and a 2′-O-methyltransferase activity in nsp16.
Like all positive strand RNA viruses, coronaviruses synthesize viral RNA at organelle-like structures in order to compartmentalize this critical step of the viral life cycle to a specialized environment that is enriched in replicative viral and host-cell factors, and at the same time protected from antiviral host defense mechanisms. There is now a growing body of knowledge concerning the involvement, rearrangement and requirement of cellular membranes for RNA synthesis of a number of positive-strand RNA viruses, including coronaviruses. Three coronaviral NSPs, i.e., nsp3, nsp4, and nsp6 are thought to participate in formation of these sites for viral RNA synthesis. In particular, these proteins contain multiple trans-membrane domains that are thought to anchor the coronavirus replication complex through recruitment of intracellular membranes to form a reticulovesicular network (RVN) of modified, frequently paired, membranes that includes convoluted membranes and double membrane vesicles (DVM) interconnected via the outer membrane with the rough ER.
Culture SystemsMERS-CoV can replicate in different mammalian cell lines. In humans, it can replicate in the respiratory tract (lung adenocarcinoma cell line A549, embryonic fibroblast cell line HFL and polarized airway epithelium cell line Calu-3), kidney (embryonic kidney cell line; HEK), liver cells (hepatocellular carcinoma cell line; Huh-7), and the intestinal tract (colorectal adenocarcinoma cell line; Caco-2). MERS-CoV can also infect cell lines originating from primates, pigs, bats, civet cats and rabbits (Chan et al. 2013).
Additional Mouse ModelsZhao J and colleges described a novel approach to developing a mouse model for MERS by transducing mice with a recombinant, nonreplicating adenovirus expressing the hDPP4 receptor. After infection with MERS-CoV, mice develop an interstitial pneumonia Similar to infected patients, Ad5-hDPP4-transduced mice with normal immune systems developed mild disease whereas immunocompromised mice, like patients with underlying diseases, were more profoundly affected. It was shown that these transduced, infected mice can be used to determine antivirus immune responses and to evaluate anti-MERS-CoV vaccines and therapies (Zhao J, et al. 2014).
Two Mouse Models have been developed Pascal K et al. In the first, a modified adenovirus expressing huDPP4 was administered intranasally to mice leading to huDPP4 expression in all cells of the lung, not just those that natively express DPP4. In this model, mice showed transient huDPP4 expression and mild lung disease. In the second model, a transgenic mouse was produced to expresses huDPP4 in all cells of the body, which in not physiologically relevant. In this model, MERS-CoV infection leads to high levels of viral RNA and inflammation in the lungs, and also significant inflammation and viral RNA in the brains of infected mice. However, no previous reports have documented tropism of MERS-CoV to the brains of an infected host, suggesting that studying pathogenesis of MERS-CoV in this model is limited.
RNAi and siRNA
RNA interference (RNAi) is a sequence-specific RNA degradation process that provides a direct way to knockdown, or silence, theoretically any gene. In naturally occurring RNA interference, a double stranded RNA is cleaved by an RNase III/helicase protein, Dicer, into small interfering RNA (siRNA) molecules, a dsRNA of 19-23 nucleotides (nt) with 2-nt overhangs at the 3′ ends. These siRNAs are incorporated into a multicomponent-ribonuclease called RNA-induced-silencing-complex (RISC). One strand of siRNA remains associated with RISC, and guides the complex towards a cognate RNA that has sequence complementary to the guider ss-siRNA in RISC. This siRNA-directed endonuclease digests the RNA, thereby inactivating it. Studies have revealed that the use of chemically synthesized 21-25-nt siRNAs exhibit RNAi effects in mammalian cells, and the thermodynamic stability of siRNA hybridization (at terminals or in the middle) plays a central role in determining the molecule's function.
Importantly, it is presently not possible to predict with high degree of confidence which of many possible candidate siRNA sequences potentially targeting an mRNA sequence of a disease gene will, in fact, exhibit effective RNAi activity. Instead, individually specific candidate siRNA polynucleotide or oligonucleotide sequences must be generated and tested to determine whether the intended interference with expression of a targeted gene has occurred.
Target SelectionMERS-CoV is enveloped single-stranded positive-sense RNA viruses, belonging to genus Betacoronavirus. The length of the genome is around 30 k nt. The genome contains 10 predicted open reading frames (ORFs): ORF1a, ORF1b, Spike (S) Protein, 3, 4a, 4b, 5, Envelope (E) Protein, Membrane (M) Protein and Nucleocapsid (N) Protein, with 5′ two third of the genome (ORF1a, ORF1b) encoding 16 non-structure proteins (nsp1-16), and rest 3′ third of the genome encoding 4 structure proteins (S, E, M and N proteins).
The spike (S) protein of MERS-CoV is a glycoprotein with a molecular weight of ˜180/190 kDa, which is an important determinant of virus virulence and host range. Trimers of S protein form the spikes on the MERS-CoV envelope, which are responsible for the receptor binding and membrane fusion. Similar to the HIV envelope (env) and influenza hemagglutinin (HA), S proteins of MERS-CoV are Class I viral fusion proteins, which requires the protease cleavage between the S1 and S2 domains to allow the conformational changes in S2, and initiate the virus entry and syncytia formation. Dipeptidyl peptidase 4 (DDP4, or CD26), a protein with diverse functions in glucose homeostasis, T-cell activation, etc., has been identified as the receptor of MERS-CoV on the host cells. The recognition of DPP4 is mediated by the receptor-binding domain (RBD, aa E367-Y606) of the S protein. DPP4 is expressed in a variety of cell types. It has been discovered on the human cell surface in the airways (such as the lungs) and kidneys recently.
After entry into the cell, two polyproteins, pp1a and pp1ab of MERS-CoV express and undergo cotranslational proteolytic processing into the proteins that form the viral replication complex. During this processing, the activity of nsp-3, papain-like protease (PLpro) and nsp-5, 3C-like proteinase (3CLpro) are critical for the generation of 16 nonstructural proteins from the polyprotein. However, based on the MERS-CoV genome sequences analysis and calculation, we found several siRNA candidates (MPL1-6) match PLpro as the target, but no good candidate matches 3CLpro Meanwhile, the recent studies showed that MERS-CoV PLpro also has the function to inhibit the innate immune response to viral infection by decreasing the levels of ubiquitinated and ISGylated host cell proteins and down-regulating the cytokines, such as CCL5 and IFN-β in stimulated cells.
MERS-CoV RNA-dependent RNA polymerase (RdRp), encoding by nsp-12, is the most important component of viral replication complex. This complex is responsible for both the transcription of the nested subgenomic mRNAs and the replication of the genomic positive-strand RNA. Both processes take place in the cytoplasm. In the viral mRNA transcription, the negative-strand RNAs generate from genomic RNA at first, and then transcribe a set of 3′-coterminal nested subgenomic mRNAs by the replication complex, with a common 5′ “leader” sequence (67 nt) derived from the 5′ end of the genome. The newly synthetic genomic RNAs are produced by the taking the negative-strand RNAs as the template.
The viral challenges through intranasal administrations of 2×LD50 H1N1 (A/Puerto Rico/8/1934) were conducted on day 2 (red arrow) for the virus only, Ribavirin and siRNA treatment groups. Ribavirin as a positive control was administered through gavages of 200 ul to provide 75 mg/kg/day dosing over days 1-5 (orange arrows). The prophylactic efficacy of HKP-siRNA formulation is clearly better than that of Ribavirin.
The present invention provides siRNA molecules that inhibit MERS-CoV gene expression, compositions containing the molecules, and methods of using the molecules and compositions to prevent or treat MERS in a subject, such as a human patient.
SiRNA MoleculesAs used herein, an “siRNA molecule” or an “siRNA duplex” is a duplex oligonucleotide, that is a short, double-stranded polynucleotide, that interferes with the expression of a gene in a cell, after the molecule is introduced into the cell, or interferes with the expression of a viral gene. For example, it targets and binds to a complementary nucleotide sequence in a single stranded (ss) target RNA molecule. SiRNA molecules are chemically synthesized or otherwise constructed by techniques known to those skilled in the art. Such techniques are described in U.S. Pat. Nos. 5,898,031, 6,107,094, 6,506,559, 7,056,704 and in European Pat. Nos. 1214945 and 1230375, which are incorporated herein by reference in their entireties. By convention in the field, when an siRNA molecule is identified by a particular nucleotide sequence, the sequence refers to the sense strand of the duplex molecule.
One or more of the ribonucleotides comprising the molecule can be chemically modified by techniques known in the art. In addition to being modified at the level of one or more of its individual nucleotides, the backbone of the oligonucleotide can be modified. Additional modifications include the use of small molecules (e.g. sugar molecules), amino acids, peptides, cholesterol, and other large molecules for conjugation onto the siRNA molecule.
The siRNA molecules of the invention target a conserved region of the genome of a MERS-CoV. As used herein, “target” or “targets” means that the molecule binds to a complementary nucleotide sequence in a MERS-CoV gene, which is an RNA molecule, or it binds to mRNA produced by the gene. This inhibits or silences the expression of the viral gene and/or its replication. As used herein, a “conserved region” of a MERS-CoV gene is a nucleotide sequence that is found in more than one strain of the virus, is identical among the strains, rarely mutates, and is critical for viral infection and/or replication and/or release from the infected cell.
In one embodiment, the siRNA molecule is a double-stranded oligonucleotide with a length of about 17 to about 27 base pairs. In one aspect of this embodiment, the molecule is a double-stranded oligonucleotide with a length of 19 to 25 base pairs. In another aspect of this embodiment, the molecule is a couple-stranded oligonucleotide with a length of 19 to 25 base pairs. In still another aspect of this embodiment, it is a double-stranded oligonucleotide with a length of 25 base pairs. In all of these aspects, the molecule may have blunt ends at both ends, or sticky ends with overhangs at both ends (unpaired bases extending beyond the main strand), or a blunt end at one end and a sticky end at the other. In one particular aspect, it has blunt ends at both ends. In another particular aspect, the molecule has a length of 25 base pairs (25 mer) and has blunt ends at both ends.
In one embodiment, the conserved MERS-CoV genomic regions are the gene sequences coding for the MERS-CoV proteins Papain-like protease (PLPI), RNA-dependent RNA polymerase (RdRp), and Spike protein. The genomic locations of such genes are shown in
Particular siRNA sequences that represent some of the siRNA molecules of the invention are disclosed in Tables 1-3. In one embodiment, the siRNA molecules are disclosed in Table 3. In one particular embodiment, the siRNA molecules are the following:
The siRNA molecules of the invention also include ones derived from those listed in Tables 1-3 and otherwise herein. The derived molecules can have less than the 25 base pairs shown for each molecule, down to 17 base pairs, so long as the “core” contiguous base pairs remain. That is, once given the specific sequences shown herein, a person skilled in the art can synthesize molecules that, in effect, “remove” one or more base pairs from either or both ends in any order, leaving the remaining contiguous base pairs, creating shorter molecules that are 24, 23, 22, 21, 20, 19, 18, or 17 base pairs in length, if starting with the 25 base pair molecule. For example, the derived molecules of the 25 mer molecules disclosed in Tables 1-3 include: a) 24 contiguous base pairs of any one or more of the molecules; b) 23 contiguous base pairs of any one or more of the molecules; c) 22 contiguous base pairs of any one or more of the molecules; b) 21 contiguous base pairs of any one or more of the molecules; d) 20 contiguous base pairs of any one or more of the molecules; e) 19 contiguous base pairs of any one or more of the molecules; f) 18 contiguous base pairs of any one or more of the molecules; and g) 17 contiguous base pairs of any one or more of the molecules. It is not expected that molecules shorter than 17 base pairs would have sufficient activity or sufficiently low off-target effects to be pharmaceutically useful; however, if any such constructs did, they would be equivalents within the scope of this invention.
Alternatively, the derived molecules can have more than the 25 base pairs shown for each molecule, so long as the initial 25 contiguous base pairs remain. That is, once given the specific sequences disclosed herein, a person skilled in the art can synthesize molecules that, in effect, “add” one or more base pairs to either or both ends in any order, creating molecules that are 26 or more base pairs in length and containing the original 25 contiguous base pairs.
The siRNA molecule may further comprise an immune stimulatory motif. Such motifs can include specific RNA sequences such as 5′-UGUGU-3′ (Judge et al., Nature Biotechnology 23, 457-462 (1 Apr. 2005)), 5′-GUCCUUCAA-3′ (Hornung et al., Nat. Med. 11, 263-270(2005). See Kim et al., Mol Cell 24; 247-254 (2007). These articles are incorporated herein by reference in their entireties. These are siRNA sequences that specifically activate immune responses through Toll-like receptor (TLR) activation or through activation of key genes such as RIG-I or PKR. In one embodiment, the motif induces a TH1 pathway immune response. In another embodiment, the motif comprises 5′-UGUGU-3′, 5′-GUCCUUCAA-3′, 5′-GGGxGG-3′ (where x is A, T, G and C), or CpG motifs 5′-GTCGTT-3′.
Pharmaceutical CompositionsThe invention includes a pharmaceutical composition comprising an siRNA molecule that targets a conserved region of the genome of a MERS-CoV and a pharmaceutically acceptable carrier. In one embodiment, the carrier condenses the molecules to form a nanoparticle. Alternatively, the composition may be formulated into nanoparticles. The compositions may be lyophilized into a dry powder. In one particular embodiment, the pharmaceutically acceptable carrier comprises a polymeric nanoparticle or a liposomal nanoparticle.
In one embodiment, the composition comprises at least two different siRNA molecules that target one or more conserved regions of the genome of a MERS-CoV and a pharmaceutically acceptable carrier. In one aspect of this embodiment, the gene sequences in the conserved regions of the MERS-CoV are critical for the viral infection of a mammal. In one aspect of this embodiment, mammal is a human, mouse, ferret, or monkey. The composition can include one or more additional siRNA molecules that target still other conserved regions of the MERS-CoV genome. In one aspect of this embodiment, a pharmaceutically acceptable carrier comprises a polymeric nanoparticle or a liposomal nanoparticle.
In one embodiment, the targeted conserved regions of the genome comprise gene sequences coding for the following MERS-CoV proteins: Papain-like protease (PLpro), RNA-dependent RNA polymerase (RdRp), and Spike protein. In one aspect of this embodiment, the siRNA molecules target PLpro viral gene expression. Such siRNA molecules include the following:
In another aspect of this embodiment, the siRNA molecules target RdRp viral gene expression. Such siRNA molecules include the following:
In still another aspect of this embodiment, the siRNA molecules target Spike viral gene expression Such siRNA molecules include the following:
In a further aspect of this embodiment, the siRNA molecules are two or more of the following:
In another embodiment, the composition comprises an siRNA cocktail, MSTPR1, wherein a first siRNA molecule comprises MPL1: CGCAAUACGUAAAGCUAAAGAUUAU and a second siRNA molecule comprises MRR1: CCCAGUGUUAUUGGUGUUUAUCAUA.
In another embodiment, the composition comprises an siRNA cocktail, MSTPR2, wherein a first siRNA molecule comprises MPL2: GGGGUUGAUUAUACUAAGAAGUUU and a second siRNA molecule comprises MRR2: GGGAUUUCAUGCUUAAAACAUUGUA.
In another embodiment, the composition comprises an siRNA cocktail, MSTRS2, wherein a first siRNA molecule comprises MRR2: GGGAUUUCAUGCUUAAAACAUUGUA and a second siRNA molecule comprises MSP2: GGCCGUACAUAUUCUAACAUAACUA.
In another embodiment, the composition comprises an siRNA cocktail, MSTRS1, wherein a first siRNA molecule comprises MRR1: CCCAGUGUUAUUGGUGUUUAUCAUA and a second siRNA molecule comprises MSP1: GGCCGUACAUAUUCUAACAUAACUA.
In another embodiment, the composition comprises at least three different siRNA molecules that target one or more conserved regions of the genome of a MERS-CoV and a pharmaceutically acceptable carrier. In one aspect of this embodiment, the pharmaceutically acceptable carrier comprises a polymeric nanoparticle or a liposomal nanoparticle.
In another embodiment, the composition comprises an siRNA cocktail, MSTRS1, wherein a first siRNA molecule comprises MPL1: CGCAAUACGUAAAGCUAAAGAUAU, a second siRNA molecule comprises MRR1: CCCAGUGUUAUUGGUGUUUAUCAUA, and a third siRNA molecule comprises MSP1: GGCCGUACAUAUUCUAACAUAACUA.
In another embodiment, the composition comprises an siRNA cocktail, MSTPRS2, wherein a first siRNA molecule comprises MPL2: GGGUGUUGAUUAUACUAAGAAGUUU a second siRNA molecule comprises MRR2: GGGAUUUCAUGCUUAAAACAUUGUA, and a third siRNA molecule comprises MSP2: GGCCGUACAUAUUCUAACAUAACUA.
In one aspect of all of these embodiments, the siRNA molecules comprise 25 mer blunt-end siRNA molecules and the carrier comprises a Histidine-Lysine copolymer or Spermine-Lipid Conjugate and cholesterol.
Pharmaceutically Acceptable CarriersPharmaceutically acceptable carriers include saline, sugars, polypeptides, polymers, lipids, creams, gels, micelle materials, and metal nanoparticles. In one embodiment, the carrier comprises at least one of the following: a glucose solution, a polycationic binding agent, a cationic lipid, a cationic micelle, a cationic polypeptide, a hydrophilic polymer grafted polymer, a non-natural cationic polymer, a cationic polyacetal, a hydrophilic polymer grafted polyacetal, a ligand functionalized cationic polymer, a ligand functionalized-hydrophilic polymer grafted polymer, and a ligand functionalized liposome. In another embodiment, the polymers comprise a biodegradable histidine-lysine polymer, a biodegradable polyester, such as poly(lactic acid) (PLA), poly(glycolic acid) (PGA), and poly(lactic-co-glycolic acid) (PLGA), a polyamidoamine (PAMAM) dendrimer, a cationic lipid, or a PEGylated PEI. Cationic lipids include DOTAP, DOPE, DC-Chol/DOPE, DOTMA, and DOTMA/DOPE. In still another embodiment, the carrier is a histidine-lysine copolymer that forms a nanoparticle with the siRNA molecule, wherein the diameter of the nanoparticle is about 100 nm to about 400 nm.
In one embodiment, the carrier is a polymer. In one aspect of this embodiment, the polymer comprises a histidine-lysine copolymer (HKP). Such copolymers are described in U.S. Pat. Nos. 7,070,807 B2, 7,163,695 B2, and 7,772,201 B2, which are incorporated herein by reference in their entireties. In one aspect of this embodiment, the HKP comprises the structure (R)K(R)-K(R)-(R)K(X), where R=KHHHKHHHKHHHKHHHK, K=lysine, and H=histidine.
In another embodiment, the carrier is a liposome. In one aspect of this embodiment, the liposome comprises a cationic lipid conjugated with cholesterol. In a further aspect, the cationic lipid comprises a spermine head and one or two oleyl alcoholic tails. Examples of such molecules are disclosed in
The invention also includes methods of using the siRNA molecules and pharmaceutical compositions containing them to prevent or treat MERS-CoV disease. A therapeutically effective amount of the composition of the invention is administered to a subject. In one embodiment, the subject is a mammal such as a mouse, ferret, monkey, or human. In one aspect of this embodiment, the mammal is a laboratory animal, such as a rodent. In another aspect of this embodiment, the mammal is a non-human primate, such as a monkey. In still another aspect of this embodiment, the mammal is a human. As used herein, a “therapeutically effective amount” is an amount that prevents, reduces the severity of or cures MERS disease. Such amounts are determinable by persons skilled in the art, given the teachings contained herein. In one embodiment, a therapeutically effective amount of the pharmaceutical composition administered to a human comprises about 1 mg of the siRNA molecules per kilogram of body weight of the human to about 5 mg of the siRNA molecules per kilogram of body weight of the human. Routes of administration are also determinable by persons skilled in the art, given the teachings contained herein. Such routes include intranasal administration and airway instillation, such as through use of an airway nebulizer.
Such routes also include intraperitoneal, intravenous, and subcutaneous administration.
EXAMPLESWe selected Papain-like protease (PLPRO), RNA-dependent RNA polymerase (RdRp), Spike(S) protein and some of other structure genes (such as M and N protein) and non-structure genes (such as nsp-2, nsp-10 and nsp-15) of MERS-CoV as the targets for an siRNA cocktail-mediated therapeutic approach. The present invention provides siRNA molecules that target a conserved region of MERS-CoV, wherein the siRNA molecules inhibit expression of those genes of MERS-CoV. In a preferred embodiment, the molecule comprises a double-stranded sequence of 17, 18, 19, 20, 21, 22, 23, 24 or 25 nucleotides in length. In one aspect of this embodiment, the siRNA molecule has blunt ends, or has 3′ overhangs of one or more nucleotides on both sides of the double-stranded region. The siRNA cocktail of the invention contains two, three, four, or more sequences targeting those genes of MERS-CoV.
Example 1. MERS-CoV Viral Structure and Protein FunctionMERS-CoV is enveloped single-stranded positive sense RNA viruses with genomes of 30,119 nt. The genome structure of MERS-CoV is similar to other coronaviruses, with the 5′ two-thirds of the genome encoding the non-structural proteins (NSPs) required for viral genome replication, the remaining 3′ third of the genome encoding the structural genes that make up the virion (spike, envelope, membrane, and nucleocapsid proteins), and four accessory genes interspersed within the structural gene region (
Similar to other RNA viruses, coronavirus replicate in the host cytoplasm. The replication process is initiated by the viral particle after binding with specific cellular receptors, known as S-protein mediated binding. The receptor for MERS-CoV was recently identified as dipeptidyl peptidase 4 (DDP4, also known as CD26), a protein with diverse functions in glucose homeostasis. T-cell activation, neurotransmitter function, and modulation of cardiac signaling. DPP4 is expressed in a variety of cell types, including endothelial cells (kidney, lung, small intestine, spleen) hepatocytes, enterocytes, activated leukocytes, testes, prostate and cells of the renal glomeruli and proximal tubules. DPP4 recognition is mediated by the receptor-binding domain (RBD, amino acids E367-Y606). Following virus entry, the coronavirus genome, a positive sense, capped and polyadenylated RNA strand, is directly translated, resulting in the synthesis of coronavirus replicase gene-encoded NSPs Coronavirus NSPs are translated as two large polyproteins harboring proteolytic enzymes, namely papain-like and chymotrypsin-like proteinases that extensively process coronavirus polyproteins to liberate up to 16 NSPs (nsp 1-16). After entering into the cell the virus specially modulates the innate immune response, antigen presentation, mitogen-activated protein kinase (
Using our specific algorithm, we have designed multiple siRNA sequences, including both 25-mer and 23-mer oligos. Table I. siRNA sequences, 25-mer blunt-end oligos and 23-mer sticky-end oligos, targeting various viral RNA Table II. siRNA sequences, 25-mer blunt-end oligos and 23-mer sticky-end oligos, targeting various viral RNA, where the red labeled siRNAs are the most potent siRNA inhibitors and the gold labeled siRNAs are the second best siRNA inhibitors, based on the prediction of our specific algorithm. Table III. We selected the most potent siRNA oligos, 25-mer blunt-end oligos and 23-mer sticky-end oligos, targeting various viral proteins and genes. As demonstrated in the
Firstly, to identify the most potent siRNA for silencing MERS-CoV genes in Vero cell culture experiments, we used psiCheck plasmid carrying MERS-CoV gene sequences.
Secondly, we used Vero cell infected with real MERS-CoV to test the selected siRNA for their anti-MERS CoV infecting activity.
- A. Subcloning MERS-CoV virus gene fragments a surrogates for siRNA potency examination in Vero cells In order to investigate the degrading effect of siRNA candidates on targeted MERS-CoV genes, we used a dual luciferase reporter vector, psiCHECK-2, with gene fragments of Papain like viral protein (nsp5), Coronavirus endopeptidase C30 (nsp6), RNA synthesis protein (nsp10), RNA-dependent RNA polymerase (nsp12), and structure proteins S, E, M and N. psiCHECK-2 Vectors are designed to provide a quantitative and rapid approach for initial optimization of RNA interference (RNAi). The vectors enable monitoring of changes in expression of a target gene fused to a reporter gene. The DNA fragments of nsp5, nsp6, nsp10, nsp12 and structure proteins S, E, M and N were amplified by PCR with specific primers to those genes, and then cloned into the multiple cloning sites of psiCHECK-2 Vector. In this vector, Renilla Luciferase is used as a primary reporter gene, and the siRNA targeting genes located downstream of the Renilla translational stop codon.
Vero cells were seeded in 96-well plates and incubated for 12 h. The reporter plasmids (recombinant vectors) psi-nsp5, psi-nsp6, psi-nsp10, psi-nsp12, psi-S, psi-E, psi-M and psi-N, and siRNA candidates were co-transfected into Vero cells using Lipofectamine 2000 in the DMEM without FBS. The blank psi vector is taken as a negative control. Six hours post-transfection, the media was replaced with the DMEM supplemented with 10% FBS. 18, 24, 36 and 48 h post-transfection the activity of the firefly luminescence and Renilla Luciferase in each well was detected using the Dual Luciferase Kit. The siRNA candidates dramatically decreased luciferase activity which indicates that siRNA could greatly inhibit the expression of the target genes of MERS-CoV were selected for the assay of infection with MERS-CoV in vitro.
- B. Infection of Vero cells with MERS-CoV To investigate whether the real MERS-CoV mRNAs for nsp5, nsp6, nsp10, nsp12 and structure proteins S, E, M and N can be directly degraded by the specific mechanism of RNA interference (RNAi), Vero cells were seeded in 24-well plate and transfected with selected therapeutic single siRNA or siRNA combination candidates using Lipofectamine 2000 in the DMEM without FBS when cell monolayer reached 80% confluency. The transfection efficacy control is Cy3 labeled siRNA. PBS was taken as a negative control. An siRNA with the sequence unrelated to MERS-CoV was used as another negative control. 24 h post-transfection the media containing the transfection reagent was replaced with fresh media supplemented with 2% FBS, and cells were infected with MERS-CoV. One hour post-infection, the inoculation solution was replaced with DMEM supplemented with 10% FBS. 24 h post-infection, cells were harvested for RNA isolation and 5′-rapid amplification of cDNA ends (5′-RACE). In the other parallel experiment, at 24, 48 and 72 h post-infection, the cell supernatants were harvested for viral titer determination. All experiments were performed under Biosafety level-2 condition.
The viral RNA were extracted from the cell supernatants, and the one-step quantitative real-time PCR were performed with forward, reverse primers and TaqMan probe specific to the MERS-CoV isolate FRA/UAE spike protein. The total RNA from the harvested cells was extracted, and 5′-RACE assays were carried out with gene-specific primers for cDNA products of nsp5, nsp6, nsp10, nsp12 and structure proteins S, E, M and N. The single siRNAs or siRNA combinations with high protection efficiency were selected for in vivo studies.
Example 5. HKP/siRNA Nanoparticle and Pulmonary DeliveryHistidine-Lysine co-polymer (HKP) siRNA nanoparticle formulations can be established by mixing together aqueous solutions of HKP and siRNA in 4:1 ratio by a molecular weight (N/P). A typical HKP/siRNA formulation will provide nanoparticles in average size in 150 nm in diameter (
During evaluation of prophylaxis and therapeutic benefit of siRNA inhibitors against influenza infection, we tested HKP/siRNA formulation through intraperitoneal administration, using different dosage and regimens. Based on the observations of these treatment results, we found that the prophylactic effect of HKP/siRNA (two siRNAs are specific to influenza genes) exceed the effect of Ribovirin (
SLiC Liposome Preparation. Regular methods were tried at first to prepare liposomes with newly synthesized SLiC molecules, such as thin film method, solvent injection and so on without much success. Norbert Maurer et al reported a method of liposome preparation in which siRNA or oligonucleotide solution was slowly added under vortexing to the 50% ethanol solution (v/v) of liposome and ethanol was later removed by dialysis. The nanoparticles thus derived were small in size and homogeneous. In this method, siRNA was directly wrapped by cationic lipids during formation of liposome, while in most other methods siRNA or nucleic acid molecules are loaded (or entrapped) into preformed liposome, such as Lipofectamine 2000.
Lipids dissolved in ethanol are in so-called metastable state in which liposomes are not very stable and tend to aggregate. We then prepared un-loaded or pre-formed liposomes using modified Norbert Maurer's method. We found that stable liposome solution could be made by simply diluting ethanol to the final concentration of 12.5% (v/v). Liposomes were prepared by addition of lipids (cationic SLIC/cholesterol, 50:50, mol %) dissolved in ethanol to sterile dd-H2O. The ethanolic lipid solution needs to be added slowly under rapid mixing.
Slow addition of ethanol and rapid mixing were critical for the success in making SLiC liposomes, as the process allows formation of small and more homogeneous liposomes. Unlike conventional methods, in which siRNAs are loaded during the process of liposome formulation and ethanol or other solvent is removed at end of manufacturing, our SLiC liposomes were formulated with remaining ethanol still in the solution so that liposomes were thought to be still in metastable state. When siRNA solution was mixed/loaded with liposome solution cationic groups, lipids will interact with anionic siRNA and condense to form core. SLiC liposomes' metastable state helped or facilitated liposome structure transformation to entrap siRNA or nucleic acids more effectively. Because of the entrapment of siRNA, SLiC liposomes become more compact and homogeneous.
Physiochemical Characterization of SLiC Liposome. After the liposome formation, we have developed an array of assays to characterize the physicochemical properties of SLiC liposome, including particle size, surface potential, morphology study, siRNA loading efficiency and biological activity, etc. The particle size and zeta-potentials of SLiC liposomes were measured with Nano ZS Zeta Sizer (Malvern Instruments, UK). Each new SLiC liposome was tested for particle size and zeta-potential when ethanol contents changed from 50% to 25% and to 12.5%. Data were derived from formulations of different ethanol contents. All SLiC liposomes were prepared at 1 mg/ml in concentration and loaded with siRNA (2:1, w/w). Each of SLiC Liposomes was composed of cationic SLiC and cholesterol dissolved in ethanol at 12.5%, e g. TM2 (12.5). The average particle sizes of three sequential measurements and the average zeta-potentials of three sequential measurements were illustrated in Table IV.
Further analysis of the physiochemical perimeters of the SLiC liposome suggested that ethanol concentrations were positively proportional to particle sizes (the lower of ethanol concentration, the smaller of particle sizes), but negatively proportional to zeta-potential (the lower of ethanol concentration, the higher of zeta-potential at the same time). The higher surface potential will render particles more stable in solution. In addition to stability in solution, data shown later also indicated that toxicity was lower with lower ethanol concentration, too. Therefore, to put all factors together, ethanol concentration of 12.5% (v/v) was selected as solvent to suspend cholesterol as well as SLiC into the master working stock solution before they were used to make liposome formulations.
In contrast to bare SLiC liposome formulation, liposomes particle sizes became much smaller when they were loaded with siRNA at 2:1 (w/w) resulting in particle sizes in the range of 110 to 190 nm in diameter and much lower PDI values. Conventional consideration of liposomal structure dictates that siRNA is loaded or interacted with cationic lipids through electrostatic forces and liposomes wraps siRNA to form spherical particles in shape in order to reduce surface tension. As the result, the liposomes particle sizes became much smaller after loaded with siRNA. Liposomes formulated with siRNA also have lower surface charge, which could be explained by neutralizing effect from loaded siRNA.
Example 8. Airway Delivery with Mouse ModelHuman host-cell dipeptidyl peptidase 4 (hDPP4) has been shown to be the receptor of MERS-CoV. However, mouse is not a suitable small-animal model for MERS-CoV as it has no receptor being recognized and bound by the virus. In this study, the mice were sensitized to MERS-CoV infection by transduction with Adenoviral or Lentiviral vector expressing hDPP4 in the respiratory tract. This mouse model was used to investigate the efficiency of the siRNA on inhibiting the MERS-CoV infection in vivo. The siRNA combination candidate was delivered by encapsidated with HKP-SLiC nanoparticle system. We performed all mouse studies under Biosafety level-3 conditions.
All BALB/c mice were 18 weeks old and tested as specific pathogen-free at the beginning of this study. To develop the susceptibility to MERS-CoV, 30 mice of Adenoviral vector group and 30 mice of Lentiviral vector group were transduced with Adenoviral and Lentiviral vector expressing hDPP4, respectively. Another 20 mice were transduced with empty Adenoviral or Lentiviral vector as the control. For the Adenoviral vector group, hDDP4 gene was cloned into the Ad5. Then MLE 15 cells were transduced with Ad5-hDDP4 at an MOI of 20. The supernatant were collected at 48 h post-infection. The mice were transduced intranasally with 108 pfu of Ad5-hDDP4. For the Lentiviral vector group, hDDP4 gene was cloned into the plasmid pWPXLd. Then, pWPXLd-hDPP4, along with packaging vector, psPAX2, and envelope vector, pMD2.G, was co-transfected into packaging cell line HEK 293T using calcium phosphate method. At 48 h post-transfection, the constructed viral vector was harvested and purified, and transducted with CHO cells. The lentivirus was harvested and concentrated. The mice were transduced intranasally with lentivirus expressing hDPP4 at titers of 108 transducing units/ml (TU/ml).
After confirming the hDPP4 was expressed in the respiratory tract of the mice by western blot, the Adenoviral and Lentiviral vector groups were further divided into prophylactic, therapeutic and control subgroup with ten mice in each subgroup. Ten mice from Ad5-hDDP4 or psPAX2-hDDP4 prophylactic subgroup were intranasally inoculated with siRNA combination encapsidated with HKP-SLiC nanoparticle system 24 h before inoculation. 24 h later, all eighty mice including transduced with empty vector were infected intravenously with 105 pfu of MERS-CoV. The prophylactic, therapeutic and control subgroup were intranasally inoculated with siRNA or PBS at 0, 24, 48, 72 and 96 h post-infection.
All mice were weighed and the survivors of each subgroup were counted daily. The nasal washes were collected at 1, 3, 5, 7, 9, and 14 day post-infection for the viral titration. Two infected mice from each group were sacrificed at 3 and 5 day post-infection, respectively. The tissue collection, including lung, trachea, spleen, liver, heart, brain and kidney, were collected for pathological and virological study.
To determine the viral titers, the tissue samples were homogenized in DMEM, and clarified by centrifugation. Both tissue suspensions and nasal washes were 10-fold serially diluted. The dilutions were added to the Vero cells monolayers grown in 96-well plates. The cytopathic effects (CPEs) were observed on day 3 post-infection, and the TCID50 was calculated by the Reed-Muench method.
To investigate the efficiency of siRNA candidates in inhibiting viral gene expression, the total RNAs were extracted from the tissues and the one-step quantitative real-time PCR were performed with forward, reverse primers and TaqMan probe specific to the conserved region of nsp12 (RNA-dependent RNA polymerase) of MERS-CoV.
Example 9. Intraperitoneal siRNA Nanoparticle SolutionIn vivo administration of siRNAs. The in vivo experiments were conducted using 6-8 week old female mice. For inoculation, allantoic fluid containing the virus at a dose of 5-104 EID50/mL was used. The infectious activity of the virus in allantoic fluid was determined in vivo by titration of lethality. Titers of the virus were calculated using the Reed and Muench method. Non-infected mice that were kept in the same conditions as the infected animals were used as a negative control. Virus was administered to the animals intranasally under a light ether anesthesia. Each group of animals contained 15 mice. siRNA (1:1 ratio of siRNAs 89 and 103) complexed with PAA as described above, was administered to the animals at the dose of 1-10 mg/kg of body weight. siRNA was administered intraperitoneally (200 ul per injection). Control animals received PAA without siRNAs.
Animals were observed for 14 days post inoculation. The mortality of the animals in control and experimental groups was registered daily. The mortality percentage (M) was calculated in each group as: M=N/Nt where: N—the number of animals died within 14 days after infection: Nt—the total number of animals in the group. The index of protection (IP) was calculated as: IP=((Mc−Me)/Mc)×100%, where: Mc and Me—percentage of mortality in control and experimental groups, correspondingly. The median day of death (MDD) within 14 days was calculated as: MZDD=(ΣND)/Nt, where: N—the number of animals surviving D days; Nt—total number of animals in the group Tamiflu® (oseltamivir phosphate, Roche, Switzerland) was used as a reference compound. It was administered at a dose of 25 mg/kg by the same protocol.
The intraperitoneal administration could be a viable alternative, especially in patients with severe influenza with low gas-exchange volume and/or those on mechanical lung ventilation. Since siRNAs of the same length show similar properties (charge, hydrophobicity, molecular weight etc) and since siRNAs can be rapidly designed and manufactured, it is feasible that nanoparticle-mediated siRNA delivery may form an intermediate therapeutic strategy in treating rapidly emerging influenza virus strains with high mortality rates that do not respond to existing therapies, while vaccines to protect the general population are under development. The siRNA cocktail demonstrated herein may provide significant value as a prophylactic/therapeutic with broad anti-influenza strain coverage and this coverage may well extend to as yet unidentified Influenza strains that may emerge in the future. As stated in the Example 6, the therapeutic benefit we observed during the study using siRNA approach against influenza viral infection has provided a good example to follow: the HKP/siRNA nanoparticle delivery through IP route or respiratory route, targeting the conservative regions of the critical viral gene sequences, and siRNA cocktail design, etc.
We demonstrated in this study that polymeric nanoparticle-mediated delivery of a combination of two siRNAs, via IP administration, can result in a potent antiviral effect in the viral-challenged animals. Histidine Lysine Co-Polymer (HKP) nanoparticle-mediated siRNA delivery has been well validated through multiple routes with various animal models (17). We recently completed a full scale safety study for HKP-siRNA nanoparticle formulation via subcutaneous administration into both mouse and monkey models (data not shown). When HKP-siRNA103/105 formulation was TP administrated (10 mg/kg/day), a prophylactic and therapeutic benefit greater than that observed with Ribavirin (75 mg/kg/day) in protecting mice from exposure to a 2×LD50 dose of the virus. (Ribavirin is manufactured by multiple companies in the United States: Copegus produced by Genentech (member of the Roche group), Rebetol by Merck Sharp & Dome, a subsidary of Merck & Co., Inc., and Ribasphere by Kadmon Pharmaceuticals (originally by Three Rivers Pharmaceuticals which was acquired by Kadmon Pharmaceuticals). In addition, several companies, including Sandoz and Teva pharmaceuticals, produce generic ribavirin.) The data obtained suggests that IP injection of peptide nanoparticles containing siRNAs or of a polycationic delivery vehicle carrying siRNAs can both ameliorate the lethality induced by Influenza infection in mice and therefore may suggests the ability to overcome some of these barriers. The amphiphilic poly(allylamine) (PAA) formed polymeric micelles (PM) has been evaluated for siRNA delivery via the GI tract, resulting in efficient siRNA delivery and endosome/lysosome release. PAA and siRNA can be self-assembled into complexes with nano-sized diameters (150-300 nm) and cationic surface charge (+20 to 30 mV). When we IP administered PAA-siRNA89/103 formulation (10 mg/kg) a therapeutic antiviral activity was observed equivalent to that of Tamiflu (25 mg/kg). These results clearly demonstrated that polymeric nanoparticle delivery of siRNA combinations may provide a prophylactic/therapeutic response against newly emergent strains of influenza virus. A similar approach can be considered for a MERS siRNA therapy.
Example 10. Effects on Innate Immunity in LungTo evaluate the cytokine response after HKP/siRNA formulation administration to the mouse airway, we collected the lung lavage samples from the Balb/c mice treated with intratracheal instillation of HKP/siRNA aqueous solution (the cohort and dosage described in Table A). The lavage samples were further measured for the TNF-α, IL-6 and IFN-α changes before and after the treatment using commercial available ELISA assay (
Currently, there is neither an effective vaccine nor drug available for prophylatic or therapeutic strategy. Recently, rhesus macaque has been developed as a model for MERS-CoV using intratracheal inoculation. Similar to human, the infected monkeys showed clinical signs of disease, virus replication, and histological lesions, indicating that rhesus macaque is a good model for evaluation of vaccine and antiviral strategies against MERS-CoV infection.
To investigate the efficiency of the siRNA on protecting and healing from MERS-CoV infection, we plan to perform the non-human primate study in rhesus macaques. The siRNA cocktail candidate will be encapsidated with HKP-SLiC nanoparticle system, and administered intratracheally. This monkey study should be carried out under Biosafety Level-3 condition.
All rhesus monkeys should be 2-3 years old at the beginning of this study. At the beginning, all monkeys need to be tested negative for MERS-CoV. Twelve monkeys should be divided into three groups—prophylactic, protection, and control group with four animals in each group. Four monkeys of prophylactic group should be intratracheally inoculated with siRNA combination encapsidated in HKP-SLiC nanoparticle system using a nebulizer. 24 h later, all twelve monkeys should be intratracheally inoculated with 6.5×107 TCID50 of MERS-CoV in 1 mL. The prophylactic and protection groups should be continuously inoculated with siRNA combination at 0, 24, 48, 72 and 96 h post-infection using the nebulizer. The control group will be inoculated with PBS at the same time points.
All monkeys will be observed twice daily for the symptoms and mortality. Chest X-rays need to be performed 1 day pre-infection and 3, and 5 day post-infection. Oropharyngeal, nasal, and cloacal swabs should be collected at 1, 3, 5, 7, 9, 14, 21, and 28 day post-infection for the viral titration. Two infected monkeys from each group will be sacrificed on the day 3 post-infection. The tissue including lung, trachea, spleen, liver, heart, brain, kidney, and colon tissue will be collected for pathological and virological study.
The viral titers determination in the tissue and swab samples should be performed as described in Example 2. To investigate the efficiency of siRNA candidates on inhibiting viral gene expression, the total RNA will be extracted from the tissues and the one-step quantitative real-time PCR were performed.
To investigate the efficiency of siRNA candidates on inhibiting viral protein expression, the total RNA will be extracted from the tissues and the one-step quantitative real-time PCR will be performed as described in Example 8.
REFERENCES
- 1. Zumbla A, et al. (2015) Middle East respiratory syndrome. Lancet S0140-6736(15)60454-8.
- 2. Jalal S. (2015) The emerging threat of MERS. J Pak Med Assoc. 65(3):310-1.
- 3. de Wit E, et al. (2013) Middle East respiratory syndrome coronavirus (MERS-CoV) causes transient lower respiratory tract infection in rhesus macaques. Proc Natl Acad Sci USA 110:16598-16603.
- 4. Chan J F (2015) Middle East Respiratory Syndrome Coronavirus: Another Zoonotic Betacoronavirus Causing SARS-Like Disease Clin. Microbiol. 28(2): 465-522.
- 5. Totura A L, Baric R S (2012) SARS coronavirus pathogenesis: Host innate immune responses and viral antagonism of interferon. Curr Opin Virol 2:264-275.
- 6. Abdel-Moneim AS (2014) Middle East respiratory syndrome coronavirus (MERS-CoV): evidence and speculations. Arch Virol. 159(7):1575-84.
- 7. Pascal K, et al. (2015) Pre- and postexposure efficacy of fully human antibodies against Spike protein in a novel humanized mouse model of MERS-CoV infection. Proc Natl Acad Sci USA pii: 201510830.
- 8. de Wilde A H et al. (2014) Screening of an FDA-approved compound library identifies four small-molecule inhibitors of Middle East respiratory syndrome coronavirus replication in cell culture. Chemother. 58(8):4875-84. doi: 10.1128/AAC.03011-14.
- 9. Falzarano D, et al., (2013) Treatment with interferon-α2b and ribavirin improves outcome in MERS-CoV-infected rhesus macaques. Nat Med 19(10):1313-1317.
- 10. Lu L. et al. (2015) Urgent development of effective therapeutic and prophylactic agents to control the emerging threat of Middle East respiratory Syndrome (MERS). Emerging Microbes & Infections (2015) 4, e37; doi:10.1038/emi.2015.37.
- 11. Zhao J, et al (2015) Passive immunotherapy with dromedary immune serum in an experimental animal model for middle East respiratory syndrome coronavirus infection. Virol. 89(11):6117-20. doi: 10.1128/JVI.00446-15.
- 12. Tianlei Ying et al (2015) Development of human neutralizing monoclonal antibodies for prevention and therapy of MERS-CoV infections. Microbes and Infection 17 (2015) 142-148.
- 13. Needle D. et al. (2015) Structures of the Middle East respiratory syndrome coronavirus 3C-like protease reveal insights into substrate specificity Acta Cryst. (2015). D71, 1102-1111.
- 14. Chan et al. (2013) Differential cell line susceptibility to the emerging novel humanbetacoronavirus 2c EMC/2012: implications for disease pathogenesis and clinical manifestation. J Infect Dis 207:1743-1752
- 15. Lundin A et al. (2014) Targeting membrane-bound viral RNA synthesis reveals potent inhibition of diverse coronaviruses including the middle East respiratory syndrome virus. PLoS Pathogens, vol. 10, no. 5, Article ID e1004166, 2014.
- 16. Zhao J, et al. (2014) Rapid generation of a mouse model for Middle East respiratory syndrome. Proc Natl Acad Sci USA 111(13):4970-4975.
- 17. Leng, Q and Mixson J. et al. Systemic delivery of HK Raf-1siRNA Polyplexes Inhibits MDA-MB-435 Xenografts. Cancer Gene Therapy. 1-11(2008).
The disclosures of all publications identified herein, including issued patents and published patent applications, and all database entries identified herein by url addresses or accession numbers are incorporated herein by reference in their entirety.
Although this invention has been described in relation to certain embodiments thereof, and many details have been set forth for purposes of illustration, it will be apparent to those skilled in the art that the invention is susceptible to additional embodiments and that certain of the details described herein may be varied considerably without departing from the basic principles of the invention.
Claims
1. A pharmaceutical composition comprising at least two different siRNA molecules that target one or more conserved regions of the genome of a Middle-East Respiratory Syndrome Corona Virus (MERS-CoV) and a pharmaceutically acceptable carrier comprising a polymeric nanoparticle or a liposomal nanoparticle.
2. The composition of claim 1, wherein the gene sequences in the conserved regions of the MERS-CoV are critical for the viral infection of a mammal.
3. (canceled)
4. The composition of claim 1, wherein the targeted conserved regions of the genome comprise gene sequences coding for MERS-CoV proteins selected from the group consisting of Papain-like protease (PLPro), RNA-dependent RNA polymerase (RdRp), and Spike protein.
5-7. (canceled)
8. The composition of claim 4, wherein the siRNA molecules are selected from the group consisting of SEQ ID NOs:1-18.
9-17. (canceled)
18. The composition of claim 1, wherein the polymeric nanoparticle carrier comprises a Histidine-Lysine co-polymer (HKP).
19. (canceled)
20. The composition of claim 1, wherein the liposomal nanoparticle carrier comprises a Spermine-Lipid Conjugate (SLiC) and cholesterol.
21-28. (canceled)
29. A method of treating a mammal with a MERS infection comprising administering to said mammal a pharmaceutically effective amount of the composition of claim 1.
30-36. (canceled)
37. The method of claim 29, wherein the mammal is a human.
38. An siRNA molecule that targets a conserved region of the genome of a MERS-CoV.
39. The siRNA molecule of claim 38, wherein the targeted conserved region of the genome comprises gene sequences coding for MERS-CoV proteins selected from the group consisting of Papain-like protease (PLPro), RNA-dependent RNA polymerase (RdRp), and Spike protein.
40-42. (canceled)
43. The siRNA molecule of claim 38, wherein the molecule is selected from the group consisting of the molecules identified in Table 3.
44. The siRNA molecule of claim 38, wherein the wherein the siRNA molecules are selected from the group consisting of SEQ ID NOs:1-18.
45-47. (canceled)
48. A composition comprising the siRNA molecule of claim 38 and a pharmaceutically acceptable carrier comprising a polymeric nanoparticle or a liposomal nanoparticle.
49. A method of treating a mammal with a MERS infection comprising administering to said mammal a pharmaceutically effective amount of the composition of claim 48.
50. The method of claim 49, wherein the subject mammal is a human.
51. The composition of claim 44, wherein the siRNA molecules comprise derivatives of the identified siRNA molecules, the derivatives having 17-24 contiguous base pairs of original 25 contiguous base pairs of the identified molecules or one or more base pairs in addition to the original 25 contiguous base pairs of the identified molecules.
Type: Application
Filed: Jul 12, 2021
Publication Date: May 12, 2022
Inventors: Patrick Y. LU (Gaithersburg, MD), Vera SIMONENKO (Gaithersburg, MD), Yibin CAI (Gaithersburg, MD), John XU (Gaithersburg, MD), David EVANS (Gaithersburg, MD)
Application Number: 17/373,361