Synthetic peptide compounds producing anitbodies binding to human LDH-C.sub .
Synthetic peptide compounds are provided which are capable of producing antibodies binding to the lactate dehydrogenase enzyme of human serum (LDH-C.sub.4). The peptide compounds comprise antigenic sequences of human LDH-C.sub.4. The peptide compounds can be used to prepare vaccines for reducing the fertility of women.
Latest Northwestern University Patents:
- Wall Surface-Temperature-Controlled Thin-Film Coaters (Slot-Die Head)
- Determination of the presence of SARS-CoV-2 or other respiratory pathogen in a person
- Targeting Pleckstrin-2 for treating cancer and other diseases and disorders
- ANTISENSE OLIGONUCLEOTIDES FOR PREVENTING KCNQ2 MISPLICING
- Acousto-mechanic sensors and applications of same
The field of this invention is synthetic peptide compounds capable of producing antibodies to the lactate dehydrogenase enzyme of mammalian semen (LDH-C.sub.4). Such peptides can be used to prepare vaccines for reducing fertility of females.
BACKGROUND OF INVENTIONMammalian spermatozoa have been known to be antigenic for many years. More recently, it has been demonstrated that mammalian sperm contain an antigenic enzyme, which is known as the C.sub.4 isoenzyme of lactate dehydrogenase (LDH-C.sub.4) LDH-C.sub.4 has been isolated in pure crystalline form from mouse testes. Goldberg (1972), J. Biol. Chem. 247:2044-2048. The enzyme has a molecular weight of 140,000 and is composed of four identical C subunits. The amino acid sequence and three-dimensional structure of mouse LDH-C.sub.4 have been studied-described by a number of investigators: Musick, et al. (1976), J. Mol. Biol. 104:659-668; Wheat, et al. (1977), Biochem. & Biophys. Res. Comm. 74, No. 3:1066-1077; Li et al. (1983), J. Biol. Chem. 258:7017-7028; and Pan, et al. (1983), J. Biol. Chem. 258:7005-7016.
In 1974, Dr. Erwin Goldberg reviewed the effects of immunization with LDH-X (LDH-C.sub.4) on fertility, and advanced the possibility that "by using a defined macro-molecular constituent of sperm it becomes possible to elucidate its primary structure in terms of amino acid sequence, to map specifically the antigenic determinant(s) responsible for inducing infertility, and then to construct synthetic peptides containing these determinants. Possessing the capability for synthesizing a molecule with such properties makes the immunological approach to fertility control feasible". Karolinska Symposia on Research Methods in Reproductive Endocrinology 7th Symposium: Immunological Approaches to Fertility Control, Geneva, 1974, 202-222.
Subsequent investigations by Dr. Goldberg and his research associates identified several amino acid sequences of mouse LDH-C.sub.4 which in isolated form (e.g., as short chain peptides) bind to LDH-C.sub.4 antiserum. Wheat, et al. (1981) in Rich, et al., Peptides: Synthesis-Structure-Function, Proc. 7th Amer. Peptide Symp., pp. 557-560; and Gonzales-Prevatt, et al. (1982), Mol. Immunol. 19:1579-1585. Antigenic peptide compounds based on these sequences have been patented. See U.S. Pat. Nos. 4,290,944; 4,310,456; 4,353,822; 4,377,516, 4,392,997; 4,578,219; and 4,585,587.
These antigenic peptides are useful in preparing vaccines to reduce female fertility. Immunization of female mammals results in the development of circulating antibodies specific to LDH-C.sub.4. These immunoglobulins reach the female reproductive tract as a transudate of serum. Kille, et al. (1977), Biol. Reprod. 20:863-871. Antibody in cervical mucus, uterine fluids, and oviducal fluids combine with LDH-C.sub.4 on the sperm surface and impede the progress of the male gamete, presumably by agglutination. Systemic immunization with LDH-C.sub.4 markedly interferes with sperm transport in the female reproductive tract. Kille et al. (1980), J. Reprod. Immunol. 2:15-21.
The current status of research on LDH-C.sub.4 and antigenic peptides for use in female contraceptive vaccines is summarized in two recent publications by the Goldberg group: Goldberg, et al. (1983) In Immunology of Reproduction, Chapt. 22, pp. 493-504; and Wheat, et al. (1983), in Isozymes: Current Topics in Biological and Medical Research, Vol. 7, pp. 113-140.
In the prior work on synthetic antigenic peptides corresponding to antigenic regions of LDH-C.sub.4, it was assumed that the antigenic regions of mouse LDH-C.sub.4 enzyme were essentially homologous with those of human LDH-C.sub.4. Tests in female rabbits had demonstrated immunization effects from the mouse antigenic sequences. The synthetic peptide corresponding to the mouse LDH-C.sub.4 sequence 5-15 was found to be antigenic for immunizing not only female rabbits but also female baboons. See Goldberg and Shelton, in "Immunological Approaches to Contraception and Promotion of Fertility", pages 219-230 (ed. G. P. Talwar, Plenum Publishing Corp., 1986).
SUMMARY OF INVENTIONThis invention is based in part on the discovery that certain of the antigenic sequences of mouse LDH-C.sub.4 are not homologous to the corresponding sequences of human LDH-C.sub.4 but rather vary markedly in their amino acid content. The peptides of this invention correspond exactly with human LDH-C.sub.4 antigenic regions and thereby differentiate the prior antigenic peptides. The synthetic peptides of this invention are thereby expressly adapted for producing antibodies binding to the lactate dehydrogenase enzyme of human semen. It is believed that these peptide compounds of this invention will have greater effectiveness in vaccines for reducing the fertility of women.
DETAILED DESCRIPTIONIn the following description, standard amino acid names and abbreviations are used, as set out in the following table.
______________________________________
Names and Abbreviations of
Amino Acids
Three-letter
Amino Acids Abbreviations
______________________________________
alanine Ala
arginine Arg
asparagine Asn
aspartic acid Asp
cysteine Cys
glutamine Gln
glutamic acid Glu
glycine Gly
histidine His
isoleucine Ile
leucine Leu
lysine Lys
methionine Met
phenylalanine Phe
proline Pro
serine Ser
threonine Thr
tryptophan Trp
tyrosine Tyr
valine Val
______________________________________
Synthetic peptide compounds of the present invention, which comprise a class of antigenic peptides that are capable of producing antibodies binding to the lactate dehydrogenase enzyme of human semen (LDH-C.sub.4), are represented by the following N-terminal to C-terminal sequences: ##STR1##
The amino acids of the above peptides are all L-amino acids with the exception of glycine which does not have L-D forms. The numbers shown above the amino acids correspond to the numbering system previously used for amino acids of mouse LDH-C.sub.4, See Wheat and Goldberg (1985), Annals N.Y. Acad. Sci, 438:156-169. Mouse LDH-C.sub.4 was numbered 1 to 330 with the insertion of aspartic acid treated as follows: Pro-13, Glu-14a, Asp-14b, Lys-15, etc.
The amino acids indicated in parentheses under certain of the amino acids of peptides 1 to 6 represent the different amino acids of the corresponding sequences of mouse LDH-C.sub.4. With reference to peptide (1), amino acids 9, 10, 12, 13, 14a and 15 are different in the human LDH-C.sub.4 than in mouse LDH-C.sub.4. Similar differences are shown with respect to each of the peptide compounds, peptide (2) having four different amino acids, peptide (3) having eight different amino acids, peptide (4) having six different amino acids, peptide (5) having six different amino acids, and peptide (6) having three different amino acids.
Peptide (1) can be extended at its N-terminal end by 1 to 5 amino acids corresponding to amino acids 1 to 5 of the LDH-C.sub.4 human enzyme. Peptide (1) can therefore be produced and used in five different forms, as represented by the following:
(1 a) Glu-Gln-Leu-Ile-Glu-Lys-Leu-Ile-Glu-Asp-Asp-Glu;
(1 b) Lys-Glu-Gln-Leu-Ile-Glu-Lys-Leu-Ile-Glu-Asp-Asp-Glu;
(1 c) Val-Lys-Glu-Gln-Leu-Ile-Glu-Lys-Leu-Ile-Glu-Asp-Asp-Glu;
(1 d) Thr-Val-Lys-Glu-Gln-Leu-Ile-Glu-Lys-Leu-Ile-Glu-Asp-Asp-Glu; and
(1 e) Ser-Thr-Val-Lys-Glu-Gln-Leu-Ile-Glu-Lys-Leu-Ile-Glu-Asp-Asp-Glu.
All the above sequences extend from N-terminal to C-terminal ends of the peptides, and all of the amino acids with the exception of glycine are in their L-forms.
In synthesizing the peptides of this invention, it is sometimes convenient to add cysteine (Cys) at the N-terminal end. When this is done, the sequences are extended by an N-terminal Cys. It should be understood that any of the peptide compounds can be produced and used in that form. This permits conjugation of the peptide to a carrier for immunization.
The peptide compounds of the present invention can be synthesized from their constituent amino acids. For example, the synthesis can be carried out by the Merrifield solid phase method, as described in J.A.C.S. 85:2149-2154 (1963). This solid phase method for synthesizing sequences of amino acids is also described in Stewart and Young, Solid Phase Peptide Synthesis (W. H. Freeman and Co., San Francisco, 1969), pages 1-4. In this procedure, the C-terminal amino acid is attached to chloromethylated polystyrene-divinylbenzene copolymer beads. Each subsequent amino acid, with suitable protecting group, is then added sequentially to the growing chain. For example, as described in the Merrifield article, the protective group may be a carbobenzoxy group. By the procedure of coupling, deprotection, and coupling of the next amino acid, the desired amino acid sequence and chain length can be produced. As a final step, the protective group is removed from the N-terminal amino acid (viz., lysine and the C-terminal amino acid is cleaved from the resin, using a suitable reagent, such as trifluoroacetic acid and hydrogen bromide. Since this synthesis procedure is well known, it is not believed that it will be necessary to further describe it herein.
To utilize the antigenic peptides of this invention in the form of a fertility reducing vaccine, the peptide is conjugated to a carrier molecule, which is preferably a protein which itself elicits an antigenic response and which can be safely administered. For example, the peptide can be coupled to tetanus toxoid for administration by intramuscular injection. For example, a mixture of 1 .mu.Mole tetanus toxoid, 60 .mu.Moles antigenic peptide, and 18 millimoles 1-ethyl-3-(3 dimethyl aminopropyl) carbodiimide hydrochloride reacted in water (pH6) for 12 hours at room temperature and 24 hours at 4.degree. gives a product containing 3.5 moles of peptide/mole tetanus toxoid. Excess reactants can be removed by dialysis or gel filtration. See Pique et al., Immunochemistry 15:55-60 (1978). Alternatively, the peptide may be coupled using bisadiazotized benzidine (Bassiri et al., Endocrinology, 90-722 (1972)) or glutaraldehyde.
Peptides can be made immunogenic by adding a fatty acid (lauric acid) or a short series of hydrophobic amino acids (Phe-Leu-Leu-Val-Val-Cys-Tyr-Gly-Gly) to one end of the peptides and hydrophobically binding that end to meningococcal outer membrane proteins (Smith et al., 6th Int'l Congress of Immunol. Abst., p. 248, 1986; Lowell, G., personal communication to E.G., 1986).
For intramuscular injection, the coupled peptides may be suspended in a sterile isotonic saline solution or other conventional vehicle, and, if desired, an adjuvant may be included. A preferred use of such a vaccine is for administration to human females. Antibodies will be formed which will appear in the oviduct fluids and thereby produce a significant reduction in fertility. For this purpose, the amount to be administered will range from about 1 to 10 milligrams (mg) of the antigenic peptide.
The scientific basis of the present invention as well as its practical application are more fully illustrated by the following experimental examples.
EXPERIMENTAL EXAMPLES EXAMPLE IA human testis specimen was obtained after coadjuvant orchiectomy during operation of a prostatic cancer. RNA was extracted from the testis by the guanidinium isothiocyanate procedure followed by CsCl centrifugation, and total polyadenylated RNA was selected by oligo dT-cellulose. A cDNA expression library was constructed in .lambda.gt11 following a procedure previously reported for the generation of a human placental library (Millan (1986), J. Biol. Chem., 251:3112-3115. cDNA larger than 1.0 kb was ligated to .lambda.gt11 arms. The recombinant DNA was packaged using the Gigapack System (Vector Cloning Systems, San Diego, Calif.). Recombinant phages were obtained at an efficiency of 35,000 plaques/ng of double-stranded cDNA. The library, consisting of 1.8.times.10.sup.6 independent recombinant phages and containing less than 5% nonrecombinants, was amplified on E. coli Y1088.
Immunochemical screeningThree high titer rabbit sera produced by immunization with purified mouse LDH-C.sub.4 protein were pooled and used to screen the human testis cDNA expression library. The antiserum was diluted 100-fold and absorbed with a lysate of E. coli strain Y1090. The testis .lambda.gt11 library was plated at a density of 2.5.times.10.sup.4 plaque-forming units (pfu) per 150 mm.sup.3 petri dish with E. coli Y1090 as host bacteria. After growth at 42.degree. C. and induction with IPTG, the nitrocellulose filters were screened and bound antibody detected by use of goat anti-rabbit IgG coupled to horseradish peroxidase. The generation of murine monoclonal antibodies against mouse LDH-C.sub.4 has previously been reported. Goldman-Leiken and Goldberg (1983), Proc. Nat'l. Acad. Sci. USA 74:5463-5467. Monoclonal antibody F.sub.6 H.sub.8 (an IgG.sub.2a, .kappa.) was used in a secondary screening and binding was detected with goat antimouse IgG labeled with horseradish peroxidase.
Sequence AnalysiscDNA inserts were subcloned into the Eco R1 site of M13mp19 and sequenced using the universal 17-mer sequencing primer (P-L Biochemicals) and 17- and 18-mer oligonucleotides synthesized on an Applied Biosystems DNA synthesizer. Sequencing of the clones was accomplished by the Sanger dideoxy chain termination procedure using the Klenow fragment of DHA polymerase and .sup.35 SdATP as tracer. See Sanger et al., Proc. Nat'l. Acad. Sci. USA, 74:5463-5467; and Biggen et al. (1983), Proc. Nat'l. Acad. Sci. U.S.A., 80:3963-3965.
The pooled antisera prepared as described above reacted with 12 putative clones upon screening 1.8.times.10.sup.5 pfu from the expression library. The positive clones were isolated as single plaques and rescreened as macroplaques. Three of these twelve putative clones tested positive with the F.sub.6 H.sub.8 monoclonal antibody to mouse LDH-C.sub.4. These three clones contained inserts 0.8, 0.9 and 1.0 kbp long that cross-hybridized with each other in Southern blotting. The clone selected for sequence analysis contained a noncross-hybridizing fragment of 0.6 kbp in addition to the 1.0 kbp cDNA suggesting an internal EcoRI restriction site in the LDH-C.sub.4 cDNA. In Northern blot analysis, the nick-translated 1.0 kb subfragment detected a single mRNA species of approximately 1.5 kb in human testis RNA but not in placental RNA. The determined sequence of the human LDH-C.sub.4 cDNA is shown in Diagram A. The complete cloned cDNA included the flanking regions illustrated in diagrams B and C. The 1.0 kbp subfragment includes 66 bp of 5' flanking region and encodes most of the LDH-C.sub.4 protein. The 0.6 kbp subfragment codes for the last 24 amino acids of LDH-C.sub.4, a flanking region and a poly A tail.
DIAGRAM A
__________________________________________________________________________
cDNA and Corresponding Amino Acid Sequences for Human LDH-C.sub.4
Enzyme.sup.(1)
__________________________________________________________________________
##STR2##
75 2
##STR3## 138 23
##STR4## 201 44
##STR5## 264 65
##STR6## 327 86
##STR7## 390 107
##STR8## 453 128
##STR9## 516 149
##STR10## 579 170
##STR11## 642 191
##STR12## 705 212
##STR13## 768 233
##STR14## 831 254
##STR15## 894 275
##STR16## 957 296
##STR17## 1020 317
##STR18## 1090 329
GAACAGAAGATAGCAGGCTGTGTATTTTAAATTTTGAAAGTATTTTCATTGATCTTAAAAAATAAAAACAAATT
4 1173
GGAGACCTGAAAAAAAAAAAAAAAA-3' 1189
__________________________________________________________________________
.sup.(1) Human chemical sequence numbers are in righthand column, with
corresponding mouse sequence numbers at each end of bracketed antigenic
sequences.
EXAMPLE II
Synthesis of the peptides Cys-Ser-Thr-Val-Lys-Glu-Gln-Leu-Ile-Glu-Lys-Leu-Ile-Glu-Asp-Asp-Glu, and Cys-Glu-Gln-Leu-Ile-Glu-Lys-Leu-Ile-Glu-Asp-Asp-Glu was carried out employing known solid phase techniques. In a preferred procedure Fmoc protected Glu, representing the -COOH terminal group of the above peptides, was coupled to 1) p-alkoxybenzyl alcohol resin and 2) dimethylacrylamide-ethylene bisacrylamide-acrylsarcosine methyl ester copolymer that has been derivatised with ethylene diamine and functionalized with a linkage agent. The coupling or esterification reaction was carried out in the presence of dimethylaminopyridine. The amino protecting group was then selectively removed utilizing a suitable reagent whose nature will depend on the protecting groups. In the preferred embodiment the fluorenylmethoxycarbonyl (Fmoc) group was utilized for amino group protection and 20% piperidine in dimethylformamide was the selective deprotection agent. After deprotection, the glutamine is treated with protected aspartic acid, preferably Fmoc-Asp-tbutyl ester which has been preactivated with dicyclohexyl-carbodiimide as the symmetrical anhydride in a manner known per se as to form a peptide bond between the free amino group of the glutamine and the carboxyl group of protected aspartic acid. A double coupling procedure was carried out to ensure 100% completion of reaction. The cycle of deprotection and coupling with amino acid derivatives that has been preformed as the symmetric anhydride or pentafluorophenyl ester was then repeated with the remaining amino-acids in the sequence order of the above peptide. Some of the amino acids required sidechain blocking groups besides the alpha-amino protection. Such amino acids and the blocking groups are as follows:
Asp (t-butyl), Lys (.epsilon.-Boc), Glu (t-butyl), Ser (O-t-butyl), Thr (Ot-butyl), Cys (N-tBoc) where BOC is t-butyloxycarbonyl, S-S-Et (Sethylthio). Completion of the synthesis provided the following peptide resin ##STR19##
Decoupling of the peptide from the resin was accomplished by treatment with 60% trifluoroacetic acid/40% dichloromethane containing 10% anisole with concomittant cleavage of all protecting groups to produce the desired peptide, identified as above. The S-SEt protecting group was removed by treatment with a reducing agent such as Dithiothreitol.
EXAMPLE IIITwo rabbits were injected with the peptide of Example 1a and with the peptide of Example 1e. Both peptides were conjugated to diphtheria toxoid as carrier protein. Antisera from each of these immunized animals showed a positive antibody response to the non-conjugated peptides within two weeks of the primary immunization. Therefore, we conclude that these preparations are antigenic. Furthermore, analyses by gel electrophoresis of antibody binding in human sperm extracts revealed a specific reaction with LDH-C.sub.4. This methodology is described in GoldmanLeikin and Goldberg (1983), Proc. Nat'l. Acad. Sci. USA 80, 3774-3778.
Claims
1. A synthetic peptide compound capable of producing antibodies binding to the lactate dehydrogenase enzyme of human semen (LDH-C.sub.4), consisting of a peptide selected from the group of peptides represented by the following N-terminal to C-terminal amino acid sequences:
- (1 a) Glu-Gln-Leu-Ile-Glu-Lys-Leu-Ile-Glu-Asp-Asp-Glu;
- (1 b) Lys-Glu-Gln-Leu-Ile-Glu-Lys-Leu-Ile-Glu-Asp-Asp-Glu;
- (1 c) Val-Lys-Glu-Gln-Leu-Ile-Glu-Lys-Leu-Ile-Glu-Asp-Asp-Glu;
- (1 d) Thr-Val-Lys-Glu-Gln-Leu-Ile-Glu-Lys-Leu-Ile-Glu-Asp-Asp-Glu;
- (1 e) Ser-Thr-Val-Lys-Glu-Gln-Leu-Ile-Glu-Lys-Leu-Ile-Glu-Asp-Asp-Glu;
- (2) Thr-Leu-Asp-Pro-Lys-Leu-Gly-Thr-Asp-Ser-Asp-Lys-Glu-His-Trp-Lys;
- (3) Gln-Val-Ile-Gln-Ser-Ala-Tyr-Glu-Ile-Ile-Lys-Leu-Lys;
- (4) Glu-Glu-Leu-Phe-Leu-Ser-Ile-Pro-Cys-Val-Leu-Gly-Arg-Asn-Gly-Val-Ser-Asp-Va l-Val-Lys;
- (5) Ile-Asn-Leu-Asn-Ser-Glu-Glu-Glu-Ala-Leu-Phe-Lys-Lys; and
- (6) Ile-Gln-Lys-Asp-Leu-Ile-Phe
2. A synthetic peptide compound of claim 1 having an amino acid sequence selected from sequences (1a) to (1e).
3. A synthetic peptide compound of claim 1 having the amino acid sequence (2).
4. A synthetic peptide compound of claim 1 having the amino acid sequence (3).
5. A synthetic peptide compound of claim 1 having the amino acid sequence (4).
6. A synthetic peptide compound of claim 1 having the amino acid sequence (5).
7. A synthetic peptide compound of claim 1 having the amino acid sequence (6).
| 4290944 | September 22, 1981 | Goldberg |
| 4354967 | October 19, 1982 | Goldberg |
| 4392997 | July 12, 1983 | Goldberg |
| 4578219 | March 25, 1986 | Goldberg et al. |
| 4585587 | April 29, 1986 | Goldberg et al. |
- Beyler et al, Biology of Reproduction, vol. 32, pp. 1201-1210 (1985). Wheat et al, Molecular Immunology, vol. 22 No. 10, pp. 1195-1199 (1985). Ibarra et al, Chem. Abstr., vol. 103 No. 352276 (1985) (Abstract of Arch Invest. Med. 15(3) 239-244, 1984). Goldberg et al, Chem. Abstr., vol. 105 No. 203204d (1986). Beyler et al, Chem. Abstr., vol. 103 No. 116459f (1985) Abstract of Biol. Reprod. 32(5) 1201-1210, 1985. Goldberg and Shelton, Chapt. 42, pp. 435-446 in Zatuchni, et al. (Eds.), "Male Contraception", (Harper & Row, Philadelphia, 1986). Pan et al. (1983), J. Biol. Chem. 258:7005-7016. Li et al. (1983), J. Biol. Chem. 258:7017-7028. Goldberg et al. (1983), In Immunology of Reproduction, Chapt. 22, pp. 493-504. Wheat and Goldberg (1983), In Isozymes: Current Topices in Biological and Medical Research, vol. 7, pp. 113-140. Wheat and Goldberg (1985), Mol. Immunol. 22:643-649.
Type: Grant
Filed: Dec 1, 1986
Date of Patent: Nov 1, 1988
Assignee: Northwestern University (Evanston, IL)
Inventors: Erwin Goldberg (Evanston, IL), Jose L. Millan (San Diego, CA)
Primary Examiner: J. R. Brown
Assistant Examiner: Christina Chan
Law Firm: Tilton, Fallon, Lungmus & Chestnut
Application Number: 6/936,170
International Classification: C07K 708; C07K 706; C07K 710;