Acylated insulin

- Novo Nordisk A/S

The present invention relates to human insulin derivatives having a protracted profile of action in which the A21 and B3 amino acid residues are, independently, any amino acid residue which can be coded for by the genetic code except Lys, Arg and Cys; Phe.sup.B1 may be deleted; the B30 amino acid residue is (a) a non-codable, lipophilic amino acid having from 10 to 24 carbon atoms in which case an acyl group of a carboxylic acid with up to 5 carbon atoms is bound to the E-amino group of Lys.sup.B29 ; (b) any amino acid residue which can be coded by the genetic code except Lys, Arg and Cys, in which case a lipophilic substituent is bound to the E-amino group of Lys.sup.B29 ; or (c) deleted, in which case a lipophilic substituent is bound to the E-amino group of LyS.sup.B29 ; and any Zn.sup.2+ complexes thereof; provided that when the B30 amino acid residue is Thr or Ala, the A21 and B3 amino acid residues are both Asn and Phe.sup.B1 is present, then the insulin derivative is a Zn.sup.2 + complex.

Skip to: Description  ·  Claims  ·  References Cited  · Patent History  ·  Patent History
Description
FIELD OF THE INVENTION

The present invention relates to novel human insulin derivatives which are soluble and have a protracted profile of action, to a method of providing such derivatives, to pharmaceutical compositions containing them, and to the use of such insulin derivatives in the treatment of diabetes.

BACKGROUND OF THE INVENTION

Many diabetic patients are treated with multiple daily insulin injections in a regimen comprising one or two daily injections of a protracted insulin to cover the basal requirement supplemented by bolus injections of a rapid acting insulin to cover the requirement related to meals.

Protracted insulin compositions are well known in the art. Thus, one main type of protracted insulin compositions comprises injectable aqueous suspensions of insulin crystals or amorphous insulin. In these compositions, the insulin compounds utilized typically are protamine insulin, zinc insulin or protamiine zinc insulin.

Certain drawbacks are associated with the use of insulin suspensions. Thus, in order to secure an accurate dosing, the insulin particles must be suspended homogeneously by gentle shaking before a defmed volume of the suspension is withdrawn from a vial or expelled from a cartridge. Also, for the storage of insulin suspensions, the temperature must be kept within more narrow limits than for insulin solutions in order to avoid lump formation or coagulation.

While it was earlier believed that protamines were non-immunogenic, it has now turned out that protamines can be immunogenic in man and that their use for medical purposes may lead to formation of antibodies (Samuel et al., Studies on the immunogenecity of protamines in humans and experimental animals by means of a micro-complement fixation test, Clin. Exp. Immunol. 33, pp. 252-260 (1978)).

Also, evidence has been found that the protamine-insulin complex is itself immunogenic (Kurtz et al., Circulating IgG antibody to protamine in patients treated with protamine-insulins. Diabetologica 25, pp. 322-324 (1983)). Therefore, with some patients the use of protracted insulin compositions containing protamines must be avoided.

Another type of protracted insulin compositions are solutions having a pH value below physiological pH from which the insulin will precipitate because of the rise in the pH value when the solution is injected. A drawback with these solutions is that the particle size distribution of the precipitate formed in the tissue on injection, and thus the timing of the medication, depends on the blood flow at the injection site and other parameters in a somewhat unpredictable manner. A further drawback is that the solid particles of the insulin may act as a local irritant causing inflammation of the tissue at the site of injection.

WO 91/12817 (Novo Nordisk A/S) discloses protracted, soluble insulin compositions comprising insulin complexes of cobalt(III). The protraction of these complexes is only intermediate and the bioavailability is reduced.

Human insulin has three primary amino groups: the N-terminal group of the A-chain and of the B-chain and the .epsilon.-amino group of Lys.sup.B29. Several insulin derivatives which are substituted in one or more of these groups are known in the prior art. Thus, U.S. Pat. No. 3,528,960 (Eli Lilly) relates to N-carboxyaroyl insulins in which one, two or three primary amino groups of the insulin molecule has a carboxyaroyl group. No specifically N.sup..epsilon.B29 -substituted insulins are disclosed.

According to GB Patent No. 1.492.997 (Nat. Res. Dev. Corp.), it has been found that insulin with a carbamyl substitution at N.sup..epsilon.B29 has an improved profile of hypoglycaemic effect.

JP laid-open patent application No. 1-254699 (Kodama Co., Ltd.) discloses insulin wherein a fattty acid is bound to the amino group of Phe.sup.B1 or to the .epsilon.-amino group of Lys.sup.B29 or to both of these. The stated purpose of the derivatisation is to obtain a pharmacologically acceptable, stable insulin preparation.

Insulins, which in the B30 position have an amino acid having at least five carbon atoms which cannot necessarily be coded for by a triplet of nucleotides, are described in JP laid-open patent application No. 57-067548 (Shionogi). The insulin analogues are claimed to be useful in the treatment of diabetes mellitus, particularly in patients who are insulin resistant due to generation of bovine or swine insulin antibodies.

By "insulin derivative" as used herein is meant a compound having a molecular structure similar to that of human insulin including the disulfide bridges between Cys.sup.A7 and Cys.sup.B7 and between Cys.sup.A20 and Cys.sup.B19 and an internal disulfide bridge between Cys.sup.A6 and Cys.sup.A11, and which have insulin activity.

However, there still is a need for protracted injectable insulin compositions which are solutions and contain insulins which stay in solution after injection and possess minimal inflammatory and immunogenic properties.

One object of the present invention is to provide human insulin derivatives, with a protracted profile of action, which are soluble at physiological pH values.

Another object of the present invention is to provide a pharmaceutical composition comprising the human insulin derivatives according to the invention.

It is a further object of the invention to provide a method of making the human insulin derivatives of the invention.

SUMMARY OF THE INVENTION

Surprisingly, it has turned out that certain human insulin derivatives, wherein the .epsilon.-amino group of Lys.sup.B29 has a lipophilic substituent, have a protracted profile of action and are soluble at physiological pH values.

Accordingly, in its broadest aspect, the present invention relates to an insulin derivative having the following sequence: ##STR1## wherein

Xaa at positions A21 and B3 are, independently, any amino acid residue which can be coded for by the genetic code except Lys, Arg and Cys;

Xaa at position B1 is Phe or is deleted;

Xaa at position B30 is (a) a non-codable, lipophilic amino acid having from 10 to 24 carbon atoms, in which case an acyl group of a carboxylic acid with up to 5 carbon atoms is bound to the .epsilon.-amino group of Lys.sup.B29, (b) any amino acid residue which can be coded for by the genetic code except Lys, Arg and Cys, in which case the .epsilon.-amino group of Lys.sup.B29 has a lipophilic substituent or (c) deleted, in which case the .epsilon.-amino group of Lys.sup.B29 has a lipophilic substituent; and any Zn.sup.2+ complexes thereof, provided that when Xaa at position B30 is Thr or Ala, Xaa at positions A21 and B3 are both Asn, and Xaa at position B1 is Phe, then the insulin derivative is a Zn.sup.2+ complex.

In one preferred embodiment, the invention relates to a human insulin derivative in which the B30 amino acid residue is deleted or is any amino acid residue which can be coded for by the genetic code except Lys, Arg and Cys; the A21 and the B3 amino acid residues are, independently, any amino acid residues which can be coded for by the genetic code except Lys, Arg and Cys; Phe.sup.B1 may be deleted; the .epsilon.-amino group of Lys.sup.B29 has a lipophilic substituent which comprises at least 6 carbon atoms; and 2-4 Zn.sup.2+ ions may be bound to each insulin hexamer with the proviso that when B30 is Thr or Ala and A21 and B3 are both Asn, and Phe.sup.B1 is not deleted, then 2-4 Zn.sup.2+ ions are bound to each hexamer of the insulin derivative.

In another preferred embodiment, the invention relates to a human insulin derivative in which the B30 amino acid residue is deleted or is any amino acid residue which can be coded for by the genetic code except Lys, Arg and Cys; the A21 and the B3 amino acid residues are, independently, any amino acid residues which can be coded for by the genetic code except Lys, Arg and Cys, with the proviso that if the B30 amino acid residue is Ala or Thr, then at least one of the residues A21 and B3 is different from Asn; Phe.sup.B1 may be deleted; and the .epsilon.-amino group of Lys.sup.B29 has a lipophilic substituent which comprises at least 6 carbon atoms.

In another preferred embodiment, the invention relates to a human insulin derivative in which the B30 amino acid residue is deleted or is any amino acid residue which can be coded for by the genetic code except Lys, Arg and Cys; the A21 and the B3 amino acid residues are, independently, any amino acid residues which can be coded for by the genetic code except Lys, Arg and Cys; Phe.sup.B1 may be deleted; the .epsilon.-amino group of Lys.sup.B29 has a lipophilic substituent which comprises at least 6 carbon atoms; and 2-4 Zn.sup.2+ ions are bound to each insulin hexamer.

In another preferred embodiment, the invention relates to a human insulin derivative in which the B30 amino acid residue is deleted.

In another preferred embodiment, the invention relates to a human insulin derivative in which the B30 amino acid residue is Asp.

In another preferred embodiment, the invention relates to a human insulin derivative in which the B30 amino acid residue is Glu.

In another preferred embodiment, the invention relates to a human insulin derivative in which the B30 amino acid residue is Thr.

In another preferred embodiment, the invention relates to a human insulin derivative in which the B30 amino acid is a lipophilic amino acid having at least 10 carbon atoms.

In another preferred embodiment, the invention relates to a human insulin derivative in which the B30 amino acid is a lipophilic .alpha.-amino acid having from 10 to 24 carbon atoms.

In another preferred embodiment, the invention relates to a human insulin derivative in which the B30 amino acid is a straight chain, saturated, aliphatic .alpha.-amino acid having from 10 to 24 carbon atoms.

In another preferred embodiment, the invention relates to a human insulin derivative in which the B30 amino acid is D- or L-N.sup..epsilon. -dodecanoyllysine.

In another preferred embodiment, the invention relates to a human insulin derivative in which the B30 amino acid is .alpha.-amino decanoic acid.

In another preferred embodiment, the invention relates to a human insulin derivative in which the B30 amino acid is .alpha.-amino undecanoic acid.

In another preferred embodiment, the invention relates to a human insulin derivative in which the B30 amino acid is .alpha.-amino dodecanoic acid.

In another preferred embodiment, the invention relates to a human insulin derivative in which the B30 amino acid is .alpha.-amino tridecanoic acid.

In another preferred embodiment, the invention relates to a human insulin derivative in which the B30 amino acid is cc-amino tetradecanoic acid.

In another preferred embodiment, the invention relates to a human insulin derivative in which the B30 amino acid is .alpha.-amino pentadecanoic acid.

In another preferred embodiment, the invention relates to a human insulin derivative in which the B30 amino acid is .alpha.-amino hexadecanoic acid.

In another preferred embodiment, the invention relates to a human insulin derivative in which the B30 amino acid is an .alpha.-amino acid.

In another preferred embodiment, the invention relates to a human insulin derivative in which the A21 amino acid residue is Ala.

In another preferred embodiment, the invention relates to a human insulin derivative in which the A21 amino acid residue is Gln.

In another preferred embodiment, the invention relates to a human insulin derivative in which the A21 amino acid residue is Gly.

In another preferred embodiment, the invention relates to a human insulin derivative in which the A21 amino acid residue is Ser.

In another preferred embodiment, the invention relates to a human insulin derivative in which the B3 amino acid residue is Asp.

In another preferred embodiment, the invention relates to a human insulin derivative in which the B3 amino acid residue is Gln.

In another preferred embodiment, the invention relates to a human insulin derivative in which the B3 amino acid residue is Thr.

In another preferred embodiment, the invention relates to a human insulin derivative in which the .epsilon.-amino group of Lys.sup.B29 has a lipophilic substituent which is an acyl group corresponding to a carboxylic acid having at least 6 carbon atoms.

In another preferred embodiment, the invention relates to a human insulin derivative in which the .epsilon.-amino group of Lys.sup.B29 has a lipophilic substituent which is an acyl group, branched or unbranched, which corresponds to a carboxylic acid having a chain of carbon atoms 8 to 24 atoms long.

In another preferred embodiment, the invention relates to a human insulin derivative in which the .epsilon.-amino group of Lys.sup.B29 has a lipophilic substituent which is an acyl group corresponding to a fatty acid having at least 6 carbon atoms.

In another preferred embodiment, the invention relates to a human insulin derivative in which the .epsilon.-amino group of Lys.sup.B29 has a lipophilic substituent which is an acyl group corresponding to a linear, saturated carboxylic acid having from 6 to 24 carbon atoms.

In another preferred embodiment, the invention relates to a human insulin derivative in which the .epsilon.-amino group of Lys.sup.B29 has a lipophilic substituent which is an acyl group corresponding to a linear, saturated carboxylic acid having from 8 to 12 carbon atoms.

In another preferred embodiment, the invention relates to a human insulin derivative in which the .epsilon.-amino group of Lys.sup.B29 has a lipophilic substituent which is an acyl group corresponding to a linear, saturated carboxylic acid having from 10 to 16 carbon atoms.

In another preferred embodiment, the invention relates to a human insulin derivative in which the .epsilon.-amino group of Lys.sup.B29 has a lipophilic substituent which is an oligo oxyethylene group comprising up to 10, preferably up to 5, oxyethylene units.

In another preferred embodiment, the invention relates to a human insulin derivative in which the .epsilon.-amino group of Lys.sup.B29 has a lipophilic substituent which is an oligo oxypropylene group comprising up to 10, preferably up to 5, oxypropylene units.

In another preferred embodiment, the invention relates to a human insulin derivative in which each insulin hexamer binds 2 Zn.sup.2+ ions.

In another preferred embodiment, the invention relates to a human insulin derivative in which each insulin hexamer binds 3 Zn.sup.2+ ions.

In another preferred embodiment, the invention relates to a human insulin derivative in which each insulin hexamer binds 4 Zn.sup.2+ ions.

In another preferred embodiment, the invention relates to the use of a human insulin derivative according to the invention for the preparation of a medicament for treating diabetes.

In another preferred embodiment, the invention relates to a pharmaceutical composition for the treatment of diabetes in a patient in need of such a treatment comprising a therapeutically effective amount of a human insulin derivative according to the invention together with a pharmaceutically acceptable carrier.

In another preferred embodiment, the invention relates to a pharmaceutical composition for the treatment of diabetes in a patient in need of such a treatment comprising a therapeutically effective amount of a human insulin derivative according to the invention, in mixture with an insulin or an insulin analogue which has a rapid onset of action, together with a pharmaceutically acceptable carrier.

In another preferred embodiment, the invention relates to a pharmaceutical composition comprising a human insulin derivative according to the invention which is soluble at physiological pH values.

In another preferred embodiment, the invention relates to a pharmaceutical composition comprising a human insulin derivative according to the invention which is soluble at pH values in the interval from about 6.5 to about 8.5.

In another preferred embodiment, the invention relates to a protracted pharmaceutical composition comprising a human insulin derivative according to the invention.

In another preferred embodiment, the invention relates to a pharmaceutical composition which is a solution containing from about 120 nmol/ml to about 1200 nmol/ml, preferably about 600 nmol/ml of a human insulin derivative according to the invention.

In another preferred embodiment, the invention relates to a method of treating diabetes in a patient in need of such a treatment comprising administering to the patient a therapeutically effective amount of an insulin derivative according to this invention together with a pharmaceutically acceptable carrier.

In another preferred embodiment, the invention relates to a method of treating diabetes in a patient in need of such a treatment comprising administering to the patient a therapeutically effective amount of an insulin derivative according to this invention, in mixture with an insulin or an insulin analogue which has a rapid onset of action, together with a pharmaceutically acceptable carrier.

Examples of preferred human insulin derivatives according to the present invention in which no Zn.sup.2+ ions are bound are the following:

N.sup..epsilon.B29 -tridecanoyl des(B30) human insulin,

N.sup..epsilon.B29 -tetradecanoyl des(B30) human insulin,

N.sup..epsilon.B29 -decanoyl des(B30) human insulin,

N.sup..epsilon.B29 -dodecanoyl des(B30) human insulin,

N.sup..epsilon.B29 -tridecanoyl Gly.sup.A21 des(B30) human insulin,

N.sup..epsilon.B29 -tetradecanoyl Gly.sup.A21 des(B30) human insulin,

N.sup..epsilon.B29 -decanoyl Gly.sup.A21 des(B30) human insulin,

N.sup..epsilon.B29 -dodecanoyl Gly.sup.A21 des(B30) human insulin,

N.sup..epsilon.B29 -tridecanoyl Gly.sup.A21 Gln.sup.B3 des(B30) human insulin,

N.sup..epsilon.B29 -tetradecanoyl Gly.sup.A21 Gln.sup.B3 des(B30) human insulin,

N.sup..epsilon.B29 -decanoyl Gly.sup.A21 Gln.sup.B3 des(B30) human insulin,

N.sup..epsilon.B29 -dodecanoyl Gly.sup.A21 Gln.sup.B3 des(B30) human insulin,

N.sup..epsilon.B29 -tridecanoyl Ala.sup.A21 des(B30) human insulin,

N.sup..epsilon.B29 -tetradecanoyl Ala.sup.A21 des(B30) human insulin,

N.sup..epsilon.B29 -decanoyl Ala.sup.A21 des(B30) human insulin,

N.sup..epsilon.B29 -dodecanoyl Ala.sup.A21 des(B30) human insulin,

N.sup..epsilon.B29 -tridecanoyl Ala.sup.A21 Gln.sup.B3 des(B30) human insulin,

N.sup..epsilon.B29 -tetradecanoyl Ala.sup.A21 Gln.sup.B3 des(B30) human insulin,

N.sup..epsilon.B29 -decanoyl Ala.sup.A21 Gln.sup.B3 des(B30) human insulin,

N.sup..epsilon.B29 -tridecanoyl Gln.sup.B3 des(B30) human insulin,

N.sup..epsilon.B29 -dodecanoyl Ala.sup.A21 Gln.sup.B3 des(B30) human insulin,

.epsilon.B29 -decanoyl Gln.sup.B3 des(B30) human insulin;

N.sup..epsilon.B29 -tetradecanoyl Gln.sup.B3 des(B30) human insulin,

N.sup..epsilon.B29 -dodecanoyl Gln.sup.B3 des(B30) human insulin,

N.sup..epsilon.B29 -tridecanoyl Gly.sup.A21 human insulin,

N.sup..epsilon.B29 -tetradecanoyl Gly.sup.A21 human insulin,

N.sup..epsilon.B29 -decanoyl Gly.sup.A21 human insulin,

N.sup..epsilon.B29 -dodecanoyl Gly.sup.A21 human insulin,

N.sup..epsilon.B29 -tridecanoyl Gly.sup.A21 Gln.sup.B3 human insulin,

N.sup..epsilon.B29 -tetradecanoyl Gly.sup.A21 Gln.sup.B3 human insulin,

N.sup..epsilon.B29 -decanoyl Gly.sup.A21 Gln.sup.B3 human insulin,

N.sup..epsilon.B29 -dodecanoyl Gly.sup.A21 Gln.sup.B3 human insulin,

N.sup..epsilon.B29 -tridecanoyl Ala.sup.A21 human insulin,

N.sup..epsilon.B29 -tridecanoyl Ala.sup.A21 human insulin,

N.sup..epsilon.B29 -decanoyl Ala.sup.A21 human insulin,

N.sup..epsilon.B29 -dodecanoyl Ala.sup.A21 human insulin,

N.sup..epsilon.B29 -tridecanoyl Ala.sup.A21 Gln.sup.B3 human insulin,

N.sup..epsilon.B29 -tetradecanoyl Ala.sup.A21 Gln.sup.B3 human insulin,

N.sup..epsilon.B29 -decanoyl Ala.sup.A21 Gln.sup.B3 human insulin,

N.sup..epsilon.B29 -dodecanoyl Ala.sup.A21 Gln.sup.B3 human insulin,

N.sup..epsilon.B29 -tridecanoyl Gln.sup.B3 human insulin,

N.sup..epsilon.B29 -tetradecanoyl Gln.sup.B3 human insulin,

N.sup..epsilon.B29 -decanoyl Gln.sup.B3 human insulin,

N.sup..epsilon.B29 -dodecanoyl Gln.sup.B3 human insulin,

N.sup..epsilon.B29 -tridecanoyl Gln.sup.B30 human insulin,

N.sup..epsilon.B29 -tetradecanoyl Gln.sup.B30 human insulin,

N.sup..epsilon.B29 -decanoyl Gln.sup.B30 human insulin,

N.sup..epsilon.B29 -dodecanoyl Gln.sup.B30 human insulin,

N.sup..epsilon.B29 -tridecanoyl Gly.sup.A21 Glu.sup.B30 human insulin,

N.sup..epsilon.B29 -tetradecanoyl Gly.sup.A21 Glu.sup.B30 human insulin,

N.sup..epsilon.B29 -decanoyl Gly.sup.A21 Glu.sup.B30 human insulin,

N.sup..epsilon.B29 -dodecanoyl Gly.sup.A21 Glu.sup.B30 human insulin,

N.sup..epsilon.B29 -tridecanoyl Gly.sup.A21 Gln.sup.B3 Glu.sup.B30 human insulin,

N.sup..epsilon.B29 -tetradecanoyl Gly.sup.A21 Gln.sup.B3 Glu.sup.B30 human insulin,

N.sup..epsilon.B29 -decanoyl Gly.sup.A21 Gln.sup.B3 Glu.sup.B30 human insulin,

N.sup..epsilon.B29 -dodecanoyl Gly.sup.A21 Gln.sup.B3 Glu.sup.B30 human insulin,

N.sup..epsilon.B29 -tridecanoyl Ala.sup.A21 Glu.sup.B30 human insulin,

N.sup..epsilon.B29 -tetradecanoyl Ala.sup.A21 Glu.sup.B30 human insulin,

N.sup..epsilon.B29 -decanoyl Ala.sup.A21 Glu.sup.B30 human insulin,

N.sup..epsilon.B29 -dodecanoyl Ala.sup.A21 Glu.sup.B30 human insulin,

N.sup..epsilon.B29 -tridecanoyl Ala.sup.A21 Gln.sup.B3 Glu.sup.B30 human insulin,

N.sup..epsilon.B29 -tetradecanoyl Ala.sup.A21 Gln.sup.B3 Glu.sup.B30 human insulin,

N.sup..epsilon.B29 -decanoyl Ala.sup.A21 Gln.sup.B3 Glu.sup.B30 human insulin,

N.sup..epsilon.B29 -dodecanoyl Ala.sup.A21 Gln.sup.B3 Glu.sup.B30 human insulin,

N.sup..epsilon.B29 -tridecanoyl Gln.sup.B3 Glu.sup.B30 human insulin,

N.sup..epsilon.B29 -tetradecanoyl Gln.sup.B3 Glu.sup.B30 human insulin,

N.sup..epsilon.B29 -decanoyl Gln.sup.B3 Glu.sup.B30 human insulin,

N.sup..epsilon.B29 -dodecanoyl Gln.sup.B3 Glu.sup.B30 human insulin.

Examples of preferred human insulin derivatives according to the present invention in which Zn.sup.2+ ions are bound per insulin hexamer are the following:

(N.sup..epsilon.B29 -tridecanoyl des(B30) human insulin).sub.6, 2Zn.sup.2+,

(N.sup..epsilon.B29 -tetradecanoyl des(B30) human insulin).sub.6, 2Zn.sup.2+,

(N.sup..epsilon.B29 -decanoyl des(B30) human insulin).sub.6, 2Zn.sup.2+,

(N.sup..epsilon.B29 -dodecanoyl des(B30) human insulin).sub.6, 2Zn.sup.2+,

(N.sup..epsilon.B29 -tridecanoyl Gly.sup.A21 des(B30) human insulin).sub.6, 2Zn.sup.2+,

(N.sup..epsilon.B29 -tetradecanoyl Gly.sup.A21 des(B30) human insulin).sub.6, 2Zn.sup.2+,

(N.sup..epsilon.B29 -decanoyl Gly.sup.A21 des(B30) human insulin).sub.6, 2Zn.sup.2+,

(N.sup..epsilon.B29 -dodecanoyl Gly.sup.A21 des(B30) human insulin).sub.6, 2Zn.sup.2+,

(N.sup..epsilon.B29 -tridecanoyl Gly.sup.A21 Gln.sup.B3 des(B30) human insulin).sub.6, 2Zn.sup.2+,

(N.sup..epsilon.B29 -tetradecanoyl Gly.sup.A21 Gln.sup.B3 des(B30) human insulin).sub.6, 2Zn.sup.2+,

(N.sup..epsilon.B29 -decanoyl Gly.sup.A21 Gln.sup.B3 des(B30) human insulin).sub.6, 2Zn.sup.2+,

(N.sup..epsilon.B29 -dodecanoyl Gly.sup.A21 Gln.sup.B3 des(B30) human insulin).sub.6, 2Zn.sup.2+,

(N.sup..epsilon.B29 -tridecanoyl Ala.sup.A21 des(B30) human insulin).sub.6, 2Zn.sup.2+,

(N.sup..epsilon.B29 -tetradecanoyl Ala.sup.A21 des(B30) human insulin).sub.6, 2Zn.sup.2+,

(N.sup..epsilon.B29 -decanoyl Ala.sup.A21 des(B30) human insulin).sub.6, 2Zn.sup.2+,

(N.sup..epsilon.B29 -dodecanoyl Ala.sup.A21 des(B30) human insulin).sub.6, 2Zn.sup.2+,

(N.sup..epsilon.B29 -tridecanoyl Ala.sup.A21 Gln.sup.B3 des(B30) human insulin).sub.6, 2Zn.sup.2+,

(N.sup..epsilon.B29 -tetradecanoyl Ala.sup.A21 Gln.sup.B3 des(B30) human insulin).sub.6, 2Zn.sup.2+,

(N.sup..epsilon.B29 -decanoyl Ala.sup.A21 Gln.sup.B3 des(B30) human insulin).sub.6, 2Zn.sup.2+,

(N.sup..epsilon.B29 -dodecanoyl Ala.sup.A21 Gln.sup.B3 des(B30) human insulin).sub.6, 2Zn.sup.2+,

(N.sup..epsilon.B29 -tridecanoyl Gln.sup.B3 des(B30) human insulin).sub.6, 2Zn.sup.2+,

(N.sup..epsilon.B29 -tetradecanoyl Gln.sup.B3 des(B30) human insulin).sub.6, 2Zn.sup.2+,

(N.sup..epsilon.B29 -decanoyl Gln.sup.B3 des(B30) human insulin).sub.6, 2Zn.sup.2+,

(N.sup..epsilon.B29 -dodecanoyl Gln.sup.B3 des(B30) human insulin).sub.6, 2Zn.sup.2+,

(N.sup..epsilon.B29 -tridecanoyl human insulin).sub.6, 2Zn.sup.2+,

(N.sup..epsilon.B29 -tetradecanoyl human insulin).sub.6, 2Zn.sup.2+,

(N.sup..epsilon.B29 -decanoyl human insulin).sub.6, 2Zn.sup.2+,

(N.sup..epsilon.B29 -dodecanoyl human insulin).sub.6, 2Zn.sup.2+,

(N.sup..epsilon.B29 -tridecanoyl Gly.sup.A21 human insulin).sub.6, 2Zn.sup.2+,

(N.sup..epsilon.B29 -tetradecanoyl Gly.sup.A21 human insulin).sub.6, 2Zn.sup.2+,

(N.sup..epsilon.B29 -decanoyl Gly.sup.A21 human insulin).sub.6, 2Zn.sup.2+,

(N.sup..epsilon.B29 -dodecanoyl Gly.sup.A21 human insulin).sub.6, 2Zn.sup.2+,

(N.sup..epsilon.B29 -tridecanoyl Gly.sup.A21 Gln.sup.B3 human insulin).sub.6, 2Zn.sup.2+,

(N.sup..epsilon.B29 -tetradecanoyl Gly.sup.A21 Gln.sup.B3 human insulin).sub.6, 2Zn.sup.2+,

(N.sup..epsilon.B29 -decanoyl Gly.sup.A21 Gln.sup.B3 human insulin).sub.6, 2Zn.sup.2+,

(N.sup..epsilon.B29 -dodecanoyl Gly.sup.A21 Gln.sup.B3 human insulin).sub.6, 2Zn.sup.2+,

(N.sup..epsilon.B29 -tridecanoyl Ala.sup.A21 human insulin).sub.6, 2Zn.sup.2+,

(N.sup..epsilon.B29 -tetradecanoyl Ala.sup.A21 human insulin).sub.6, 2Zn.sup.2+,

(N.sup..epsilon.B29 -decanoyl Ala.sup.A21 human insulin).sub.6, 2Zn.sup.2+,

(N.sup..epsilon.B29 -dodecanoyl Ala.sup.A21 human insulin).sub.6, 2Zn.sup.2+,

(N.sup..epsilon.B29 -tridecanoyl Ala.sup.A21 Gln.sup.B3 human insulin).sub.6, 2Zn.sup.2+,

(N.sup..epsilon.B29 -tetradecanoyl Ala.sup.A21 Gln.sup.B3 human insulin).sub.6, 2Zn.sup.2+,

(N.sup..epsilon.B29 -decanoyl Ala.sup.A21 Gln.sup.B3 human insulin).sub.6, 2Zn.sup.2+,

(N.sup..epsilon.B29 -dodecanoyl Ala.sup.A21 Gln.sup.B3 human insulin).sub.6, 2Zn.sup.2+,

(N.sup..epsilon.B29 -tridecanoyl Gln.sup.B3 human insulin).sub.6, 2Zn.sup.2+,

(N.sup..epsilon.B29 -tetradecanoyl Gln.sup.B3 human insulin).sub.6, 2Zn.sup.2+,

(N.sup..epsilon.B29 -decanoyl Gln.sup.B3 human insulin).sub.6, 2Zn.sup.2+,

(N.sup..epsilon.B29 -dodecanoyl Gln.sup.B3 human insulin).sub.6, 2Zn.sup.2+,

(N.sup..epsilon.B29 -tridecanoyl Gln.sup.B30 human insulin).sub.6, 2Zn.sup.2+,

(N.sup..epsilon.B29 -tetradecanoyl Glu.sup.B30 human insulin).sub.6, 2Zn.sup.2+,

(N.sup..epsilon.B29 -decanoyl Glu.sup.B30 human insulin).sub.6, 2Zn.sup.2+,

(N.sup..epsilon.B29 -dodecanoyl Glu.sup.B30 human insulin).sub.6, 2Zn.sup.2+,

(N.sup..epsilon.B29 -tridecanoyl Gly.sup.A21 Glu.sup.B30 human insulin).sub.6, 2Zn.sup.2+,

(N.sup..epsilon.B29 -tetradecanoyl Gly.sup.A21 Glu.sup.B30 human insulin).sub.6, 2Zn.sup.2+,

(N.sup..epsilon.B29 -decanoyl Gly.sup.A21 Glu.sup.B30 human insulin).sub.6, 2Zn.sup.2+,

(N.sup..epsilon.B29 -dodecanoyl Gly.sup.A21 Glu.sup.B30 human insulin).sub.6, 2Zn.sup.2+,

(N.sup..epsilon.B29 -tridecanoyl Gly.sup.A21 Gln.sup.B3 Glu.sup.B30 human insulin).sub.6, 2Zn.sup.2+,

(N.sup..epsilon.B29 -tetradecanoyl Gly.sup.A21 Gln.sup.B3 Glu.sup.B30 human insulin).sub.6, 2Zn.sup.2+,

(N.sup..epsilon.B29 -decanoyl Gly.sup.A21 Gln.sup.B3 Glu.sup.B30 human insulin).sub.6, 2Zn.sup.2+,

(N.sup..epsilon.B29 -dodecanoyl Gly.sup.A21 Gln.sup.B3 Glu.sup.B30 human insulin).sub.6, 2Zn.sup.2+,

(N.sup..epsilon.B29 -tridecanoyl Ala.sup.A21 Glu.sup.B30 human insulin).sub.6, 2Zn.sup.2+,

(N.sup..epsilon.B29 -tetradecanoyl Ala.sup.A21 Glu.sup.B30 human insulin).sub.6, 2Zn.sup.2+,

(N.sup..epsilon.B29 -decanoyl Ala.sup.A21 Glu.sup.B30 human insulin).sub.6, 2Zn.sup.2+,

(N.sup..epsilon.B29 -dodecanoyl Ala.sup.A21 Glu.sup.B30 human insulin).sub.6, 2Zn.sup.2+,

(N.sup..epsilon.B29 -tridecanoyl Ala.sup.A21 Gln.sup.B3 Glu.sup.B30 human insulin).sub.6, 2Zn.sup.2+,

(N.sup..epsilon.B29 -tetradecanoyl Ala.sup.A21 Gln.sup.B3 Glu.sup.B30 human insulin).sub.6, 2Zn.sup.2+,

(N.sup..epsilon.B29 -decanoyl Ala.sup.A21 Gln.sup.B3 Glu.sup.B30 human insulin).sub.6, 2Zn.sup.2+,

(N.sup..epsilon.B29 -dodecanoyl Ala.sup.A21 Gln.sup.B3 Glu.sup.B30 human insulin).sub.6, 2Zn.sup.2+,

(N.sup..epsilon.B29 -tridecanoyl Gln.sup.B3 Glu.sup.B30 human insulin).sub.6, 2Zn.sup.2+,

(N.sup..epsilon.B29 -tetradecanoyl Gln.sup.B3 Glu.sup.B30 human insulin).sub.6, 2Zn.sup.2+,

(N.sup..epsilon.B29 -decanoyl Gln.sup.B3 Glu.sup.B30 human insulin).sub.6, 2Zn.sup.2+,

(N.sup..epsilon.B29 -dodecanoyl Gln.sup.B3 Glu.sup.B30 human insulin).sub.6, 2Zn.sup.2+,

Examples of preferred human insulin derivatives according to the present invention in which three Zn.sup.2+ ions are bound per insulin hexamer are the following:

(N.sup..epsilon.B29 -tridecanoyl des(B30) human insulin).sub.6, 3Zn.sup.2+,

(N.sup..epsilon.B29 -tetradecanoyl des(B30) human insulin).sub.6, 3Zn.sup.2+,

(N.sup..epsilon.B29 -decanoyl des(B30) human insulin).sub.6, 3Zn.sup.2+,

(N.sup..epsilon.B29 -dodecanoyl des(B30) human insulin).sub.6, 3Zn.sup.2+,

(N.sup..epsilon.B29 -tridecanoyl Gly.sup.A21 des(B30) human insulin).sub.6, 3Zn.sup.2+,

(N.sup..epsilon.B29 -tetradecanoyl Gly.sup.A21 des(B30) human insulin).sub.6, 3Zn.sup.2+,

(N.sup..epsilon.B29 -decanoyl Gly.sup.A21 des(B30) human insulin).sub.6, 3Zn.sup.2+,

(N.sup..epsilon.B29 -dodecanoyl Gly.sup.A21 des(B30) human insulin).sub.6, 3Zn.sup.2+,

(N.sup..epsilon.B29 -tridecanoyl Gly.sup.A21 Gln.sup.B3 des(B30) human insulin).sub.6, 3Zn.sup.2+,

(N.sup..epsilon.B29 -tetradecanoyl Gly.sup.A21 Gln.sup.B3 des(B30) human insulin).sub.6, 3Zn.sup.2+,

(N.sup..epsilon.B29 -decanoyl Gly.sup.A21 Gln.sup.B3 des(B30) human insulin).sub.6, 3Zn.sup.2+,

(N.sup..epsilon.B29 -dodecanoyl Gly.sup.A21 Gln.sup.B3 des(B30) human insulin).sub.6, 3Zn.sup.2+,

(N.sup..epsilon.B29 -tridecanoyl Ala.sup.A21 des(B30) human insulin).sub.6, 3Zn.sup.2+,

(N.sup..epsilon.B29 -tetradecanoyl Ala.sup.A21 des(B30) human insulin).sub.6, 3Zn.sup.2+,

(N.sup..epsilon.B29 -decanoyl Ala.sup.A21 des(B30) human insulin).sub.6, 3Zn.sup.2+,

(N.sup..epsilon.B29 -dodecanoyl Ala.sup.A21 des(B30) human insulin).sub.6, 3Zn.sup.2+,

(N.sup..epsilon.B29 -tridecanoyl Ala.sup.A21 Gln.sup.B3 des(B30) human insulin).sub.6, 3Zn.sup.2+,

(N.sup..epsilon.B29 -tetradecanoyl Ala.sup.A21 Gln.sup.B3 des(B30) human insulin).sub.6, 3Zn.sup.2+,

(N.sup..epsilon.B29 -decanoyl Ala.sup.A21 Gln.sup.B3 des(B30) human insulin).sub.6, 3Zn.sup.2+,

(N.sup..epsilon.B29 -dodecanoyl Ala.sup.A21 Gln.sup.B3 des(B30) human insulin).sub.6, 3Zn.sup.2+,

(N.sup..epsilon.B29 -tridecanoyl Gln.sup.B3 des(B30) human insulin).sub.6, 3Zn.sup.2+,

(N.sup..epsilon.B29 -tetradecanoyl Gln.sup.B3 des(B30) human insulin).sub.6, 3Zn.sup.2+,

(N.sup..epsilon.B29 -decanoyl Gln.sup.B3 des(B30) human insulin).sub.6, 3Zn.sup.2+,

(N.sup..epsilon.B29 -dodecanoyl Gln.sup.B3 des(B30) human insulin).sub.6, 3Zn.sup.2+,

(N.sup..epsilon.B29 -tridecanoyl human insulin).sub.6, 3Zn.sup.2+,

(N.sup..epsilon.B29 -tetradecanoyl human insulin).sub.6, 3Zn.sup.2+,

(N.sup..epsilon.B29 -decanoyl human insulin).sub.6, 3Zn.sup.2+,

(N.sup..epsilon.B29 -dodecanoyl human insulin).sub.6, 3Zn.sup.2+,

(N.sup..epsilon.B29 -tridecanoyl Gly.sup.A21 human insulin).sub.6, 3Zn.sup.2+,

(N.sup..epsilon.B29 -tetradecanoyl Gly.sup.A21 human insulin).sub.6, 3Zn.sup.2+,

(N.sup..epsilon.B29 -decanoyl Gly.sup.A21 human insulin).sub.6, 3Zn.sup.2+,

(N.sup..epsilon.B29 -dodecanoyl Gly.sup.A21 human insulin).sub.6, 3Zn.sup.2+,

(N.sup..epsilon.B29 -tridecanoyl Gly.sup.A21 Gln.sup.B3 human insulin).sub.6, 3Zn.sup.2+,

(N.sup..epsilon.B29 -tetradecanoyl Gly.sup.A21 Gln.sup.B3 human insulin).sub.6, 3Zn.sup.2+,

(N.sup..epsilon.B29 -decanoyl Gly.sup.A21 Gln.sup.B3 human insulin).sub.6, 3Zn.sup.2+,

(N.sup..epsilon.B29 -dodecanoyl Gly.sup.A21 Gln.sup.B3 human insulin).sub.6, 3Zn.sup.2+,

(N.sup..epsilon.B29 -tridecanoyl Ala.sup.A21 human insulin).sub.6, 3Zn.sup.2+,

(N.sup..epsilon.B29 -tetradecanoyl Ala.sup.A21 human insulin).sub.6, 3Zn.sup.2+,

(N.sup..epsilon.B29 -decanoyl Ala.sup.A21 human insulin).sub.6, 3Zn.sup.2+,

(N.sup..epsilon.B29 -dodecanoyl Ala.sup.A21 human insulin).sub.6, 3Zn.sup.2+,

(N.sup..epsilon.B29 -tridecanoyl Ala.sup.A21 Gln.sup.B3 human insulin).sub.6, 3Zn.sup.2+,

(N.sup..epsilon.B29 -tetradecanoyl Ala.sup.A21 Gln.sup.B3 human insulin).sub.6, 3Zn.sup.2+,

(N.sup..epsilon.B29 -decanoyl Ala.sup.A21 Gln.sup.B3 human insulin).sub.6, 3Zn.sup.2+,

(N.sup..epsilon.B29 -dodecanoyl Ala.sup.A21 Gln.sup.B3 human insulin).sub.6, 3Zn.sup.2+,

(N.sup..epsilon.B29 -tridecanoyl Gln.sup.B3 human insulin).sub.6, 3Zn.sup.2+,

(N.sup..epsilon.B29 -tetradecanoyl Gln.sup.B3 human insulin).sub.6, 3Zn.sup.2+,

(N.sup..epsilon.B29 -decanoyl Gln.sup.B3 human insulin).sub.6, 3Zn.sup.2+,

(N.sup..epsilon.B29 -dodecanoyl Gln.sup.B3 human insulin).sub.6, 3Zn.sup.2+,

(N.sup..epsilon.B29 -tridecanoyl Glu.sup.B30 human insulin).sub.6, 3Zn.sup.2+,

(N.sup..epsilon.B29 -tetradecanoyl Glu.sup.B30 human insulin).sub.6, 3Zn.sup.2+,

(N.sup..epsilon.B29 -decanoyl Glu.sup.B30 human insulin).sub.6, 3Zn.sup.2+,

(N.sup..epsilon.B29 -dodecanoyl Glu.sup.B30 human insulin).sub.6, 3Zn.sup.2+,

(N.sup..epsilon.B29 -tridecanoyl Gly.sup.A21 Glu.sup.B30 human insulin).sub.6, 3Zn.sup.2+,

(N.sup..epsilon.B29 -tetradecanoyl Gly.sup.A21 Glu.sup.B30 human insulin).sub.6, 3Zn.sup.2+,

(N.sup..epsilon.B29 -decanoyl Gly.sup.A21 Glu.sup.B30 human insulin).sub.6, 3Zn.sup.2+,

(N.sup..epsilon.B29 -dodecanoyl Gly.sup.A21 Glu.sup.B30 human insulin).sub.6, 3Zn.sup.2+,

(N.sup..epsilon.B29 -tridecanoyl Gly.sup.A21 Gln.sup.B3 Glu.sup.B30 human insulin).sub.6, 3Zn.sup.2+,

(N.sup..epsilon.B29 -tetradecanoyl Gly.sup.A21 Gln.sup.B3 Glu.sup.B30 human insulin).sub.6, 3Zn.sup.2+,

(N.sup..epsilon.B29 -decanoyl Gly.sup.A21 Gln.sup.B3 Glu.sup.B30 human insulin).sub.6, 3Zn.sup.2+,

(N.sup..epsilon.B29 -dodecanoyl Gly.sup.A21 Gln.sup.B3 Glu.sup.B30 human insulin).sub.6, 3Zn.sup.2+,

(N.sup..epsilon.B29 -tridecanoyl Ala.sup.A21 Glu.sup.B30 human insulin).sub.6, 3Zn.sup.2+,

(N.sup..epsilon.B29 -tetradecanoyl Ala.sup.A21 Glu.sup.B30 human insulin).sub.6, 3Zn.sup.2+,

(N.sup..epsilon.B29 -decanoyl Ala.sup.A21 Glu.sup.B30 human insulin).sub.6, 3Zn.sup.2+,

(N.sup..epsilon.B29 -dodecanoyl Ala.sup.A21 Glu.sup.B30 human insulin).sub.6, 3Zn.sup.2+,

(N.sup..epsilon.B29 -tridecanoyl Ala.sup.A21 Gln.sup.B3 Glu.sup.B30 human insulin).sub.6, 3Zn.sup.2+,

(N.sup..epsilon.B29 -tetradecanoyl Ala.sup.A21 Gln.sup.B3 Glu.sup.B30 human insulin).sub.6, 3Zn.sup.2+,

(N.sup..epsilon.B29 -decanoyl Ala.sup.A21 Gln.sup.B3 Glu.sup.B30 human insulin).sub.6, 3Zn.sup.2+,

(N.sup..epsilon.B29 -dodecanoyl Ala.sup.A21 Gln.sup.B3 Glu.sup.B30 human insulin).sub.6, 3Zn.sup.2+,

(N.sup..epsilon.B29 -tridecanoyl Gln.sup.B3 Glu.sup.B30 human insulin).sub.6, 3Zn.sup.2+,

(N.sup..epsilon.B29 -tetradecanoyl Gln.sup.B3 Glu.sup.B30 human insulin).sub.6, 3Zn.sup.2+,

(N.sup..epsilon.B29 -decanoyl Gln.sup.B3 Glu.sup.B30 human insulin).sub.6, 3Zn.sup.2+,

(N.sup..epsilon.B29 -dodecanoyl Gln.sup.B3 Glu.sup.B30 human insulin).sub.6, 3Zn.sup.2+,

Examples of preferred human insulin derivatives according to the present invention in which four Zn.sup.2+ ions are bound per insulin hexamer are the following:

(N.sup..epsilon.B29 -tridecanoyl des(B30) human insulin).sub.6, 4Zn.sup.2+,

(N.sup..epsilon.B29 -tetradecanoyl des(B30) human insulin).sub.6, 4Zn.sup.2+,

(N.sup..epsilon.B29 -decanoyl des(B30) human insulin).sub.6, 4Zn.sup.2+,

(N.sup..epsilon.B29 -dodecanoyl des(B30) human insulin).sub.6, 4Zn.sup.2+,

(N.sup..epsilon.B29 -tridecanoyl Gly.sup.A21 des(B30) human insulin).sub.6, 4Zn.sup.2+,

(N.sup..epsilon.B29 -tetradecanoyl Gly.sup.A21 des(B30) human insulin).sub.6, 4Zn.sup.2+,

(N.sup..epsilon.B29 -decanoyl Gly.sup.A21 des(B30) human insulin).sub.6, 4Zn.sup.2+,

(N.sup..epsilon.B29 -dodecanoyl Gly.sup.A21 des(B30) human insulin).sub.6, 4Zn.sup.2+,

(N.sup..epsilon.B29 -tridecanoyl Gly.sup.A21 Gln.sup.B3 des(B30) human insulin).sub.6, 4Zn.sup.2+,

(N.sup..epsilon.B29 -tetradecanoyl Gly.sup.A21 Gln.sup.B3 des(B30) human insulin).sub.6, 4Zn.sup.2+,

(N.sup..epsilon.B29 -decanoyl Gly.sup.A21 Gln.sup.B3 des(B30) human insulin).sub.6, 4Zn.sup.2+,

(N.sup..epsilon.B29 -dodecanoyl Gly.sup.A21 Gln.sup.B3 des(B30) human insulin).sub.6, 4Zn.sup.2+,

(N.sup..epsilon.B29 -tridecanoyl Ala.sup.A21 des(B30) human insulin).sub.6, 4Zn.sup.2+,

(N.sup..epsilon.B29 -tetradecanoyl Ala.sup.A21 des(B30) human insulin).sub.6, 4Zn.sup.2+,

(N.sup..epsilon.B29 -decanoyl Ala.sup.A21 des(B30) human insulin).sub.6, 4Zn.sup.2+,

(N.sup..epsilon.B29 -dodecanoyl Ala.sup.A21 des(B30) human insulin).sub.6, 4Zn.sup.2+,

(N.sup..epsilon.B29 -tridecanoyl Ala.sup.A21 Gln.sup.B3 des(B30) human insulin).sub.6, 4Zn.sup.2+,

(N.sup..epsilon.B29 -tetradecanoyl Ala.sup.A21 Gln.sup.B3 des(B30) human insulin).sub.6, 4Zn.sup.2+,

(N.sup..epsilon.B29 -decanoyl Ala.sup.A21 Gln.sup.B3 des(B30) human insulin).sub.6, 4Zn.sup.2+,

(N.sup..epsilon.B29 -dodecanoyl Ala.sup.A21 Gln.sup.B3 des(B30) human insulin).sub.6, 4Zn.sup.2+,

(N.sup..epsilon.B29 -tridecanoyl Gln.sup.B3 des(B30) human insulin).sub.6, 4Zn.sup.2+,

(N.sup..epsilon.B29 -tetradecanoyl Gln.sup.B3 des(B30) human insulin).sub.6, 4Zn.sup.2+,

(N.sup..epsilon.B29 -decanoyl Gln.sup.B3 des(B30) human insulin).sub.6, 4Zn.sup.2+,

(N.sup..epsilon.B29 -dodecanoyl Gln.sup.B3 des(B30) human insulin).sub.6, 4Zn.sup.2+,

(N.sup..epsilon.B29 -tridecanoyl human insulin).sub.6, 4Zn.sup.2+,

(N.sup..epsilon.B29 -tetradecanoyl human insulin).sub.6, 4Zn.sup.2+,

(N.sup..epsilon.B29 -decanoyl human insulin).sub.6, 4Zn.sup.2+,

(N.sup..epsilon.B29 -dodecanoyl human insulin).sub.6, 4Zn.sup.2+,

(N.sup..epsilon.B29 -tridecanoyl Gly.sup.A21 human insulin).sub.6, 4Zn.sup.2+,

(N.sup..epsilon.B29 -tetradecanoyl Gly.sup.A21 human insulin).sub.6, 4Zn.sup.2+,

(N.sup..epsilon.B29 -decanoyl Gly.sup.A21 human insulin).sub.6, 4Zn.sup.2+,

(N.sup..epsilon.B29 -dodecanoyl Gly.sup.A21 human insulin).sub.6, 4Zn.sup.2+,

(N.sup..epsilon.B29 -tridecanoyl Gly.sup.A21 Gln.sup.B3 human insulin).sub.6, 4Zn.sup.2+,

(N.sup..epsilon.B29 -tetradecanoyl Gly.sup.A21 Gln.sup.B3 human insulin).sub.6, 4Zn.sup.2+,

(N.sup..epsilon.B29 -decanoyl Gly.sup.A21 Gln.sup.B3 human insulin).sub.6, 4Zn.sup.2+,

(N.sup..epsilon.B29 -dodecanoyl Gly.sup.A21 Gln.sup.B3 human insulin).sub.6, 4Zn.sup.2+,

(N.sup..epsilon.B29 -tridecanoyl Ala.sup.A21 human insulin).sub.6, 4Zn.sup.2+,

(N.sup..epsilon.B29 -tetradecanoyl Ala.sup.A21 human insulin).sub.6, 4Zn.sup.2+,

(N.sup..epsilon.B29 -decanoyl Ala.sup.A21 human insulin).sub.6, 4Zn.sup.2+,

(N.sup..epsilon.B29 -dodecanoyl Ala.sup.A21 human insulin).sub.6, 4Zn.sup.2+,

(N.sup..epsilon.B29 -tridecanoyl Ala.sup.A21 Gln.sup.B3 human insulin).sub.6, 4Zn.sup.2+,

(N.sup..epsilon.B29 -tetradecanoyl Ala.sup.A21 Gln.sup.B3 human insulin).sub.6, 4Zn.sup.2+,

(N.sup..epsilon.B29 -decanoyl Ala.sup.A21 Gln.sup.B3 human insulin).sub.6, 4Zn.sup.2+,

(N.sup..epsilon.B29 -dodecanoyl Ala.sup.A21 Gln.sup.B3 human insulin).sub.6, 4Zn.sup.2+,

(N.sup..epsilon.B29 -tridecanoyl Gln.sup.B3 human insulin).sub.6, 4Zn.sup.2+,

(N.sup..epsilon.B29 -tetradecanoyl Gln.sup.B3 human insulin).sub.6, 4Zn.sup.2+,

(N.sup..epsilon.B29 -decanoyl Gln.sup.B3 human insulin).sub.6, 4Zn.sup.2+,

(N.sup..epsilon.B29 -dodecanoyl Gln.sup.B3 human insulin).sub.6, 4Zn.sup.2+,

(N.sup..epsilon.B29 -tridecanoyl Glu.sup.B30 human insulin).sub.6, 4Zn.sup.2+,

(N.sup..epsilon.B29 -tetradecanoyl Glu.sup.B30 human insulin).sub.6, 4Zn.sup.2+,

(N.sup..epsilon.B29 -decanoyl Glu.sup.B30 human insulin).sub.6, 4Zn.sup.2+,

(N.sup..epsilon.B29 -dodecanoyl Glu.sup.B30 human insulin).sub.6, 4Zn.sup.2+,

(N.sup..epsilon.B29 -tridecanoyl Gly.sup.A21 Glu.sup.B30 human insulin).sub.6, 4Zn.sup.2+,

(N.sup..epsilon.B29 -tetradecanoyl Gly.sup.A21 Glu.sup.B30 human insulin).sub.6, 4Zn.sup.2+,

(N.sup..epsilon.B29 -decanoyl Gly.sup.A21 Glu.sup.B30 human insulin).sub.6, 4Zn.sup.2+,

(N.sup..epsilon.B29 -dodecanoyl Gly.sup.A21 Glu.sup.B30 human insulin).sub.6, 4Zn.sup.2+,

(N.sup..epsilon.B29 -tridecanoyl Gly.sup.A21 Gln.sup.B3 Glu.sup.B30 human insulin).sub.6, 4Zn.sup.2+,

(N.sup..epsilon.B29 -tetradecanoyl Gly.sup.A21 Gln.sup.B3 Glu.sup.B30 human insulin).sub.6, 4Zn.sup.2+,

(N.sup..epsilon.B29 -decanoyl Gly.sup.A21 Gln.sup.B3 Glu.sup.B30 human insulin).sub.6, 4Zn.sup.2+,

(N.sup..epsilon.B29 -dodecanoyl Gly.sup.A21 Gln.sup.B3 Glu.sup.B30 human insulin).sub.6, 4Zn.sup.2+,

(N.sup..epsilon.B29 -tridecanoyl Ala.sup.A21 Glu.sup.B30 human insulin).sub.6, 4Zn.sup.2+,

(N.sup..epsilon.B29 -tetradecanoyl Ala.sup.A21 Glu.sup.B30 human insulin).sub.6, 4Zn.sup.2+,

(N.sup..epsilon.B29 -decanoyl Ala.sup.A21 Glu.sup.B30 human insulin).sub.6, 4Zn.sup.2+,

(N.sup..epsilon.B29 -dodecanoyl Ala.sup.A21 Glu.sup.B30 human insulin).sub.6, 4Zn.sup.2+,

(N.sup..epsilon.B29 -tridecanoyl Ala.sup.A21 Gln.sup.B3 Glu.sup.B30 human insulin).sub.6, 4Zn.sup.2+,

(N.sup..epsilon.B29 -tetradecanoyl Ala.sup.A21 Gln.sup.B3 Glu.sup.B30 human insulin).sub.6, 4Zn.sup.2+,

(N.sup..epsilon.B29 -decanoyl Ala.sup.A21 Gln.sup.B3 Glu.sup.B30 human insulin).sub.6, 4Zn.sup.2+,

(N.sup..epsilon.B29 -dodecanoyl Ala.sup.A21 Gln.sup.B3 Glu.sup.B30 human insulin).sub.6, 4Zn.sup.2+,

(N.sup..epsilon.B29 -tridecanoyl Gln.sup.B3 Glu.sup.B30 human insulin).sub.6, 4Zn.sup.2+,

(N.sup..epsilon.B29 -tetradecanoyl Gln.sup.B3 Glu.sup.B30 human insulin).sub.6, 4Zn.sup.2+,

(N.sup..epsilon.B29 -decanoyl Gln.sup.B3 Glu.sup.B30 human insulin).sub.6, 4Zn.sup.2+,

(N.sup..epsilon.B29 -dodecanoyl Gln.sup.B3 Glu.sup.B30 human insulin).sub.6, 4Zn.sup.2+,

BRIEF DESCRIPTION OF THE DRAWINGS

The present invention is further illustrated with reference to the appended drawings wherein

FIG. 1 shows the construction of the plasmid pEA5.3.2;

FIG. 2 shows the construction of the plasmid pEA108; and

FIG. 3 shows the construction of the plasmid pEA113.

DETAILED DESCRIPTION OF THE INVENTION

Terminology

The three letter codes and one letter codes for the amino acid residues used herein are those stated in J. Biol. Chem. 243, p. 3558 (1968).

In the DNA sequences, A is adenine, C is cytosine, G is guanine, and T is thymine.

The following acronyms are used:

DMSO for dimethyl sulphoxide, DMF for dimethylformamide, Boc for tert-butoxycarbonyl, RP-BPLC for reversed phase high performance liquid chromatography, X-OSu is an N-hydroxysuccinimid ester, X is an acyl group, and TFA for trifluoroacetic acid.

Preparation of lipophilic insulin derivatives

The insulin derivatives according to the present invention can be prepared i.a. as described in the following:

1. Insulin derivatives featuring in position B30 an amino acid residue which can be coded for by the genetic code e.g. threonine (human insulin) or alanine (porcine insulin).

1.1 Starting from human insulin.

Human insulin is treated with a Boc-reagent (e.g. di-tert-butyl dicarbonate) to form (A1,B1)-diBoc human insulin, i.e., human insulin in which the N-terminal end of both are protected by a Boc-group. After an optional purification, e.g. by HPLC, an acyl group is introduced in the .epsilon.-amino group of Lys.sup.B29 by allowing the product to react with a N-hydroxysuccinimide ester of the formula X-OSu wherein X is the acyl group to be introduced. In the final step, TFA is used to remove the Boc-groups and the product, N.sup..epsilon.B29 -X human insulin, is isolated.

1.2 Starting from a single chain insulin precursor.

A single chain insulin precursor, extended in position B1 with an extension (Ext) which is connected to BI via an arginine residue and in which the bridge from B30 to Al is an arginine residue, i.e. a compound of the general formula Ext-Arg-B(1-30)-Arg-A(1-21), can be used as starting material. Acylation of this starting material with a N-hydroxysuccinimide ester of the general formula X-OSu wherein X is an acyl group, introduces the acyl group X in the .epsilon.-amino group of Ly.sub.B29 and in the N-terminal amino group of the precursor. On treating this acylated precursor of the formula (N.sup..epsilon.B29 -X),X-ExtArg-B(1-30)-Arg-A(1-21) with trypsin in a mixture of water and a suitable water-miscible organic solvent, e.g. DMF, DMSO or a lower alcohol, an intermediate of the formula (N.sup..epsilon.B29 -X),Arg.sup.B33 insulin is obtained. Treating this intermediate with carboxypeptidase B yields the desired product, (N.sup..epsilon.B29 -X) insulin.

2. Insulin derivatives with no amino acid residue in position B30, i.e. des(B30) insulins.

2.1 Starting from human insulin or porcine insulin.

On treatment with carboxypeptidase A in ammonium buffer, human insulin and porcine insulin both yield des(B30) insulin. After an optional purification, the des(B30) insulin is treated with a Boc-reagent (e.g. di-tert-butyl dicarbonate) to form (Al,Bl)-diBoc des(B30) insulin, i.e., des(B30) insulin in which the N-terrinal end of both chains are protected by a Boc-group. After an optional purification, e.g. by HPLC, an acyl group is introduced in the .epsilon.-amino group of Lys.sup.B29 by allowing the product to react with a N-hydroxysuccinimide ester of the formula X-OSu wherein X is the acyl group to be introduced. In the final step, TFA is used to remove the Boc-groups and the product, (N.sup..epsilon.B29 -X) des(B30) insulin, is isolated.

2.2 Starting from a single chain human insulin precursor.

A single chain human insulin precursor, which is extended in position B1 with an extension (Ext) which is connected to B1 via an arginine residue and which has a bridge from B30 to A1 can be a useful starting material. Preferably, the bridge is a peptide of the formula Y.sub.n -Arg, where Y is a codable amino acid except lysine and arginine, and n is zero or an integer between 1 and 35. When n>1, the Y's may designate different amino acids. Preferred examples of the bridge from B30 to A1 are: AlaAlaArg, SerArg, SerAspAspAlaArg and Arg (European Patent No. 163529). Treatment of such a precursor of the general formula Ext-Arg-B(1-30)-Y.sup.n -Arg-A(1-21) with a lysyl endopeptidase, e.g. Achromobacter lyticus protease, yields Ext-Arg-B(1-29) Thr-Y.sub.n -Arg-A(1-21) des(B30) insulin. Acylation of this intermediate with a N-hydroxysuccinimide ester of the general formula X-OSu wherein X is an acyl group, introduces the acyl group X in the .epsilon.-amino group of Lys.sup.B29, and in the N-terminal amino group of the A-chain and the B-chain to give (N.sup..epsilon.B29 -X) X-Ext-Arg-B(1-29) X-Thr-Y.sub.n -Arg-A(1-21) des(B30) insulin. This intermediate on treatment with trypsin in mixture of water and a suitable organic solvent, e.g. DMF, DMSO or a lower alcohol, gives the desired derivative, (N.sup..epsilon.B29 -X) des(B30) human insulin.

Data on N.sup..epsilon.B29 modified insulins.

Certain experimental data on N.sup..epsilon.B29 modified insulins are given in Table 1.

The lipophilicity of an insulin derivative relative to human insulin, k'.sub.rel, was measured on a LiChrosorb RP18 (5 .mu.m, 250.times.4 mm) HPLC column by isocratic elution at 40.degree. C. using mixtures of A) 0.1M sodium phosphate buffer, pH 7.3, containing 10% acetonitrile, and B) 50% acetonitrile in water as eluents. The elution was monitored by following the UV absorption of the eluate at 214 nm. Void time, t.sub.o, was found by injecting 0.1 mM sodium nitrate. Retention time for human insulin, t.sub.human, was adjusted to at least 2t.sub.o by varying the ratio between the A and B solutions. k'.sub.rel =(t.sub.derivative -t.sub.o)/(t.sub.human -t.sub.o).

The degree of prolongation of the blood glucose lowering effect was studied in rabbits. Each insulin derivative was tested by subcutaneous injection of 12 nmol thereof in each of six rabbits in the single day retardation test. Blood sampling for glucose analysis was performed before injection and at 1, 2, 4 and 6 hours after injection. The glucose values found are expressed as percent of initial values. The Index of Protraction, which was calculated from the blood glucose values, is the scaled Index of Protraction (prolongation), see p. 211 in Markussen et al., Protein Engineering 1 (1987) 205-213. The formula has been scaled to render a value of 100 with bovine ultralente insulin and a value of 0 with Actrapid.RTM. insulin (Novo Nordisk A/S, 2880 Bagsvaerd, Denmark).

The insulin derivatives listed in Table 1 were administered in solutions containing 3 Zn.sup.2+ per insulin hexamer, except those specifically indicated to be Zn-free.

For the very protracted analogues the rabbit model is inadequate because the decrease in blood glucose from initial is too small to estimate the index of protraction. The prolongation of such analogues is better characterized by the disappearance rate in pigs. T.sub.50% is the time when 50% of the A14 Tyr(.sup.125 I) analogue has disappeared from the site of injection as measured with an external .gamma.-counter (Ribel, U et al., The Pig as a Model for Subcutaneous Absorption in Man. In: M. serrano-Rios and P.J. Lefebre (Eds): Diabetes 1985; Proceedings of the 12th Congress of the International Diabetes Federation, Madrid, Spain, 1985 (Excerpta Medica, Amsterdam, (1986) 891-96).

In Table 2 are given the T.sub.50% values of a series of very protracted insulin analogues. The analogues were administered in solutions containing 3 Zn.sup.2+ per insulin hexamer.

                                    TABLE 1                                 
     __________________________________________________________________________
                      Relative                                                 
                            Blood glucose, % of initial                        
                                        Index of                               
     Insulin Derivative *)                                                     
                      Lipophilicity                                            
                            1 h                                                
                               2 h                                             
                                  4 h                                          
                                     6 h                                       
                                        protraction                            
     __________________________________________________________________________
     N.sup..epsilon.B29 -benzoyl insulin                                       
                      1.14                                                     
     N.sup..epsilon.B29 -phenylacetyl insulin (Zn-free)                        
                      1.28  55.4                                               
                               58.9                                            
                                  88.8                                         
                                     90.1                                      
                                        10                                     
     N.sup..epsilon.B29 -cyclohexylacetyl insulin                              
                      1.90  53.1                                               
                               49.6                                            
                                  66.9                                         
                                     81.1                                      
                                        28                                     
     N.sup..epsilon.B29 -cyclohexylpropionyl insulin                           
                      3.29  55.5                                               
                               47.6                                            
                                  61.5                                         
                                     73.0                                      
                                        39                                     
     N.sup..epsilon.B29 -cyclohexylvaleroyl insulin                            
                      9.87  65.0                                               
                               58.3                                            
                                  65.7                                         
                                     71.0                                      
                                        49                                     
     N.sup..epsilon.B29 -octanoyl insulin                                      
                      3.97  57.1                                               
                               54.8                                            
                                  69.0                                         
                                     78.9                                      
                                        33                                     
     N.sup..epsilon.B29 -decanoyl, des (B30) insulin                           
                      11.0  74.3                                               
                               65.0                                            
                                  60.9                                         
                                     64.1                                      
                                        65                                     
     N.sup..epsilon.B29 -decanoyl insulin                                      
                      12.3  73.3                                               
                               59.4                                            
                                  64.9                                         
                                     68.0                                      
                                        60                                     
     N.sup..epsilon.B29 -undecanoyl, des (B30) insulin                         
                      19.7  88.1                                               
                               80.0                                            
                                  72.1                                         
                                     72.1                                      
                                        80                                     
     N.sup..epsilon.B29 -lauroyl, des (B30) insulin                            
                      37.0  91.4                                               
                               90.0                                            
                                  84.2                                         
                                     83.9                                      
                                        78                                     
     N.sup..epsilon.B29 -myristoyl insulin                                     
                      113   98.5                                               
                               92.0                                            
                                  83.9                                         
                                     84.5                                      
                                        97                                     
     N.sup..epsilon.B29 -choloyl insulin                                       
                      7.64  58.2                                               
                               53.2                                            
                                  69.0                                         
                                     88.5                                      
                                        20                                     
     N.sup..epsilon.B29 -7-deoxycholoyl insulin (Zn-free)                      
                      24.4  76.5                                               
                               65.2                                            
                                  77.4                                         
                                     87.4                                      
                                        35                                     
     N.sup..epsilon.B29 -lithocholoyl insulin (Zn-free)                        
                      51.6  98.3                                               
                               92.3                                            
                                  100.5                                        
                                     93.4                                      
                                        115                                    
     N.sup..epsilon.B29 -4-benzoyl-phenylalanyl insulin                        
                      2.51  53.9                                               
                               58.7                                            
                                  74.4                                         
                                     89.0                                      
                                        14                                     
     N.sup..epsilon.B29 -3,5-diiodotyrosyl insulin                             
                      1.07  53.9                                               
                               48.3                                            
                                  60.8                                         
                                     82.1                                      
                                        27                                     
     N.sup..epsilon.B29 -L-thyroxyl insulin                                    
                      8.00                                                     
     __________________________________________________________________________
                TABLE 2                                                     
     ______________________________________                                    
                               Subcutaneous                                    
     Derivative of  Relative   disappearance                                   
     Human Insulin  hydrophobicity                                             
                               in pigs                                         
     ______________________________________                                    
     600 .mu.M,     .sup.k' rel                                                
                               T.sub.50%, hours                                
     3 Zn.sup.2+ /hexamer,                                                     
     phenol 0.3%,                                                              
     glycerol 1.6%,                                                            
     pH 7.5                                                                    
     Ne.sup..epsilon.B29 -decanoyl                                             
                    11.0       5.6                                             
     des (B30) insulin                                                         
     N.sup..epsilon.B29 -undecanoyl                                            
                    19.7       6.9                                             
     des (B30) insulin                                                         
     N.sup..epsilon.B29 -lauroyl                                               
                    37         10.1                                            
     des (B30) insulin                                                         
     N.sup..epsilon.B29 -tridecanoyl                                           
                    65         12.9                                            
     des (B30) insulin                                                         
     N.sup..epsilon.B29 -myristoyl                                             
                    113        13.8                                            
     des (B30) insulin                                                         
     N.sup..epsilon.B29 -palmitoyl                                             
                    346        12.4                                            
     des (B30) insulin                                                         
     N.sup..epsilon.B29 -2-succinyl-                                           
                    10.5       13.6                                            
     amido myristic                                                            
     acid insulin                                                              
     N.sup..epsilon.B29 -myristoyl                                             
                    113        11.9                                            
     insulin                                                                   
     N.sup..epsilon.B29 -2-succinyl-                                           
                    420        20.1                                            
     amido palmitic                                                            
     acid insulin                                                              
     N.sup..epsilon.B29 -myristoyl-.alpha.-                                    
                    23.7       8.8                                             
     glutamyl des (B30)                                                        
     insulin                                                                   
     N.sup..epsilon.B29 -myristoyl-.alpha.-                                    
                    20.0       11.9                                            
     glutamyl-glycyl                                                           
     des (B30) insulin                                                         
     N.sup..epsilon.B29 -lithocholoyl-                                         
                    12.5       14.3                                            
     .alpha.-glutamyl                                                          
     des (B30) insulin                                                         
     Human NPH                 10                                              
     ______________________________________                                    

Solubility

The solubility of all the N.sup..epsilon.B29 modified insulins mentioned in Table 1, which contain 3 Zn.sup.2+ ions per insulin hexamer, exceeds 600 nmol/ml in a neutral (pH 7.5), aqueous, pharmaceutical formulation which further comprises 0.3% phenol as preservative, and 1.6% glycerol to achieve isotonicity. 600 nmol/ml is the concentration of human insulin found in the 100 IU/ml compositions usually employed in the clinic.

The .epsilon.-B29 amino group can be a component of an amide bond, a sulphonamide bond, a carbamide, a thiocarbamide, or a carbamate. The lipophilic substituent carried by the .epsilon.-B29 amino group can also be an alkyl group.

Pharmaceutical compositions containing a human insulin derivative according to the present invention may be administered parenterally to patients in need of such a treatment. Parenteral administration may be performed by subcutaneous, intramuscular or intravenous injection by means of a syringe, optionally a pen-like syringe. Alternatively, parenteral administration can be performed by means of an infusion pump. A further option is a composition which may be a powder or a liquid for the administration of the human insulin derivative in the form of a nasal spray.

The injectable human insulin compositions of the invention can be prepared using the conventional techniques of the pharmaceutical industry which involves dissolving and mixing the ingredients as appropriate to give the desired end product.

Thus, according to one procedure, the human insulin derivative is dissolved in an amount of water which is somewhat less than the final volume of the composition to be prepared. An isotonic agent, a preservative and a buffer is added as required and the pH value of the solution is adjusted--if necessary--using an acid, e.g. hydrochloric acid, or a base, e.g. aqueous sodium hydroxide as needed. Finally, the volume of the solution is adjusted with water to give the desired concentration of the ingredients.

Examples of isotonic agents are sodium chloride, mannitol and glyceroL

Examples of preservatives are phenol, m-cresol, methyl p-hydroxybenzoate and benzyl alcohol.

Examples of suitable buffers are sodium acetate and sodium phosphate.

A composition for nasal administration of an insulin derivative according to the present invention may, for example, be prepared as described in European Patent No. 272097 (to Novo Nordisk A/S).

The insulin compositions of this invention can be used in the treatment of diabetes. The optimal dose level for any patient will depend on a variety of factors including the efficacy of the specific human insulin derivative employed, the age, body weight, physical activity, and diet of the patient, on a possible combination with other drugs, and on the severity of the case of diabetes. It is recommended that the daily dosage of the human insulin derivative of this invention be determined for each individual patient by those skilled in the art in a similar way as for known insulin compositions.

Where expedient, the human insulin derivatives of this invention may be used in mixture with other types of insulin, e.g. human insulin or porcine insulin or insulin analogues with a more rapid onset of action. Examples of such insulin analogues are described e.g. in the European patent applications having the publication Nos. EP 214826 (Novo Nordisk A/S), EP 375437 (Novo Nordisk A/S) and EP 383472 (Eli Lilly & Co.).

The present invention is further illustrated by the following examples which, however, are not to be construed as limiting the scope of protection. The features disclosed in the foregoing description and in the following examples may, both separately and in any combination thereof, be material for realizing the invention in diverse forms thereof.

EXAMPLES

Plasmids and DNA material

All expression plasmids are of the cPOT type. Such plasmids are described in EP patent application No. 171 142 and are characterized in containing the Schizosaccharomyces pombe triose phosphate isomerase gene (POT) for the purpose of plasmid selection and stabilization. A plasmid containing the POT-gene is available from a deposited E. coli strain (ATCC 39685). The plasmids furthermore contain the S. cerevisiae triose phosphate isomerase promoter and terminator (P.sub.TPI, and T.sub.TPI). They are identical to pMT742 (Egel-Mitani, M. et al., Gene 73 (1988) 113-120) (see FIG. 1) except for the region defined by the ECoRI-Xbal restriction sites encompassing the coding region for signal/leader/product.

Synthetic DNA fragments were synthesized on an automatic DNA synthesizer (Applied Biosystems model 380A) using phosphoramidite chemistry and commercially available reagents (Beaucage, S. L. and Caruthers, M. H., Tetrahedron Letters 22 (1981) 1859-1869).

All other methods and materials used are common state of the art knowledge (see, e.g. Sambrook, J., Fritsch, E. F. and Maniatis, T., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, New York, 1989).

Analytical

Molecular masses of the insulins prepared were obtained by MS (mass spectroscopy), either by PDMS (plasma desorption mass spectrometry) using a Bio-Ion 20 instrument (Bio-Ion Nordic AB, Uppsala, Sweden) or by ESMS (electrospray mass spectrometry) using an API III Biomolecular Mass Analyzer (Perkin-Elmer Sciex Instruments, Thomhill, Canada).

EXAMPLE 1

Synthesis of Ala.sup.A21 Asp.sup.B3 human insulin precursor from Yeast strain yEA002 using the LaC212spx3 signal/leader. The following oligonucleotides were synthesized: ##STR2##

The following Polymerase Chain Reaction (PCR) was performed using the Gene Amp PCR reagent kit (Perkin Elmer, 761 Main Avewalk, CT 06859, USA) according to the manufacturer's instructions. In all cases, the PCR mixture was overlayed with 100 .mu.l of mineral oil (Sigma Chemical Co., St. Louis, Mo., USA).

2.5 .mu.l of oligonucleotide #98 (2.5 pmol)

2.5 .mu.l of oligonucleotide #128 (2.5 pmol)

10 .mu.l of 10X PCR buffer

16 .mu.l of dNTP mix

0.5 .mu.l of Taq enzyme

58.5 .mu.l of water

One cycle was performed: 94.degree. C. for 45 sec., 49.degree. C. for 1 min, 72.degree. C. for 2 min.

Subsequently, 5 .mu.l of oligonucleotides #16 and #126 was added and 15 cycles were performed: 94.degree. C. for 45 sec., 45.degree. C. for 1 min, 72.degree. C. for 1.5 min. The PCR mixture was loaded onto a 2.5% agarose gel and subjected to electrophoresis using standard techniques (Sambrook et al., Molecular cloning, Cold Spring Harbour Laboratory Press, 1989). The resulting DNA fragment was cut out of the agarose gel and isolated using the Gene Clean Kit (Bio 101 Inc., PO BOX 2284, La Jolla, Calif. 92038, USA) according to the manufacturer's instructions. The purified PCR DNA fragment was dissolved in 10 .mu.l of water and restriction endonuclease buffer and cut with the restriction endonucleases NcoI and Xba I according to standard techniques, run on a 2.5% agarose gel and purified using the Gene Clean Kit as described.

The plasmid pAK188 consists of a DNA sequence of 412 bp composed of a EcoRI/NcoI fragment encoding the synthetic yeast signal/leader gene LaC212spx3 (described in Example 3 of WO 89/02463) followed by a synthetic Ncol/Xbal fragment encoding the insulin precursor MI5, which has a SerAspAspAlaLys bridge connecting the B29 and the A1 amino acid residues (see SEQ ID NOS. 14, 15 and 16), inserted into the EcoRI/XbaI fragment of the vector (phagemid) pBLUESCRIPT IIsk(+/-) (Stratagene, USA). The plasmid pAK188 is shown in FIG. 1.

The plasmid pAK188 was also cut with the restriction endonucleases NcoI and XbaI and the vector fragment of 3139 bp isolated. The two DNA fragments were ligated together using T4 DNA ligase and standard conditions (Sambrook et al., Molecular Cloning, Cold Spring Harbour Laboratory Press, 1989). The ligation mixture was transformed into a competent E. coli strain (R-, M+) followed by selection for ampicillin resistance. Plasmids were isolated from the resulting E. coli colonies using standard DNA miliprep technique (Sambrook et al., Molecular Cloning, Cold Spring Harbour Laboratory Press, 1989), checked with appropriate restrictions endonucleases i.e. EcoRI, Xba I, NcoI and HpaI. The selected plasmid was shown by DNA sequencing analyses (Sequenase, U.S. Biochemical Corp.) to contain the correct sequence for the Ala.sup.A21, Asp.sup.B3 human insulin precursor and named pEA5.3.

The plasmid pKFN1627 is an E. coli--S. cerevisiae shuttle vector, identical to plasmid pKFN1003 described in EP patent No. 375718, except for a short DNA sequence upstream from the unique XbaI site. In pKFN10O3, this sequence is a 178 bp fragment encoding a synthetic aprotinin gene fused in-frame to the yeast mating factor alpha 1 signal-leader sequence. In pKFN1627, the corresponding 184 bp sequence encodes the insulin precursor MI5 (Glu.sup.B1, Glu.sup.B28) (i.e. B(1-29, Glu.sup.B1,Glu.sup.B28)-SerAspAspAlaLys-A(1-21) fused in-frame to the mating factor alpha 1 sequence (see SEQ ID NOS. 17, 18 and 19). The vector pKFN1627 is shown in FIG. 1.

pEA5.3 was cut with the restriction endonucleases EcoRI and XbaI and the resulting DNA fragment of 412 bp was isolated. The yeast expression vector pKFN1627 was cut with the restriction endonucleases NcoI and XbaI and with NcoI and EcoRI and the DNA fragment of 9273 bp was isolated from the first digestion and the DNA fragment of 1644 bp was isolated from the second. The 412 bp EcoRWXbaI fragment was then ligated to the two other fragments, that is the 9273 bp NcoI I/XbaI fragment and the 1644 bp NcoI/EcoRI fragment using standard techniques.

The ligation mixture was transformed into E. coli as described above. Plasmid from the resulting E. coli was isolated using standard techniques, and checked with appropriate restriction endonucleases i.e. EcoRI, XbaI, NcoI, Hpa I. The selected plasmid was shown by DNA sequence analysis (using the Sequenase kit as described by the manufacturer, U.S. Biochemical) to contain the correct sequence for the Ala.sup.A21 Asp.sup.B3 human insulin precursor DNA and to be inserted after the DNA encoding the LaC212spx3 signalleader DNA. The plasmid was named pEA5.3.2 and is shown in FIG. 1. The DNA sequence encoding the LaC212spx3 signal/leader/Ala.sup.A21 Asp.sup.B3 human insulin precursor complex and the amino acid sequence thereof are SEQ D NOS. 20, 21 and 22. The plasmid pEA5.3.2 was transformed into S. cerevisiae strain MT663 as described in European patent application having the publication No. 214826 and the resulting strain was named yEA002.

EXAMPLE 2

Synthesis of Ala.sup.A21 Thr.sup.B3 human insulin precursor from Yeast strain yEA005 using the LaC212spx3 signal/leader. ##STR3##

The DNA encoding Ala.sup.A21 Thr.sup.B3 human insulin precursor was constructed in the same manner as described for the DNA encoding Ala.sup.A21 Asp.sup.B3 human insulin precursor in Example 1. The DNA sequence encoding the LaC212spx3 signal/leader/Ala.sup.A21 Thr.sup.B3 human insulin precursor complex and the amino acid sequence thereof are SEQ ID NOS. 23, 24 and 25. The plasmid pEA8.1.1 was shown to contain the desired sequence, transformed into S. cerevisiae strain MT663 as described in Example 1 and the resulting strain was named yEA005.

EXAMPLE 3

Synthesis of Gly.sup.A21 Asp.sup.B3 human insulin precursor from Yeast strain yEA007 using the LaC212spx3 signal/leader.

The following oligonucleotides were synthesized: ##STR4##

The DNA encoding Gly.sup.A21 Asp.sup.B3 human insulin precursor was constructed in the same manner as described for the DNA encoding Ala.sup.A21 Asp.sup.B3 human insulin precursor in Example 1. The DNA sequence encoding the LaC212spx3 signal/leader/Gly.sup.A21 Asp.sup.B3 human insulin precursor complex and the amino acid sequence thereof are SEQ ID NOS. 26, 27 and 28. The plasmid pEA1.5.6 was shown to contain the desired sequence, transformed into S. cerevisiae strain MT663 as described in Example 1 and the resulting strain was named yEA007.

EXAMPLE 4

Synthesis of Gly.sup.A21 Thr.sup.B3 human insulin precursor from Yeast strain yEA006 using the LaC212spx3 signal/leader.

The following oligonucleotides were synthesized: ##STR5##

The DNA encoding Gly.sup.A21 Thr.sup.B3 human insulin precursor was constructed in the same manner as described for the DNA encoding Ala.sup.A21 Asp.sup.B3 human insulin precursor in Example 1. The DNA sequence encoding the LaC212spx3 signal/leader/Gly.sup.A21 Thr.sup.B3 human insulin precursor complex and the amino acid sequence thereof are SEQ ID NOS. 29, 30 and 31. The plasmid pEA4.4.11 was shown to contain the desired DNA sequence, transformed into S. cerevisiae strain MT663 as described in Example 1 and the resulting strain was named yEA006.

EXAMPLE 5

Synthesis of Arg.sup.B-1 Arg.sup.B31 single chain human insulin precursor having an N-terminal extension (GluGluAlaGluAlaGluAlaArg) from Yeast strain yEA113 using the alpha factor leader.

A) The following oligonucleotides were synthesized: ##STR6##

The following Polymerase Chain Reaction (PCR) was performed using the Gene Amp PCR reagent kit (Perkin Elmer, 761 Main Avewalk, Conn. 06859, USA) according to the manufacturer's instructions. In all cases, the PCR mixture was overlayed with 100 .mu.l of mineral oil (Sigma Chemical Co, St. Louis, Mo., USA). The plasmid pAK220 (which is identical to pAK188) consists of a DNA sequence of 412 bp encoding the synthetic yeast signal/leader LaC212spx3 (described in Example 3 of WO 89/02463) followed by the insulin precursor MI5 (see SEQ ID NOS. 14, 15 and 16) inserted into the vector (phagemid) pBLUESCRIPT IIsk(+/-) (Stratagene, USA).

5 .mu.l of oligonucleotide #220 (100 pmol)

5 .mu.l of oligonucleotide #263 (100 pmol)

10 .mu.l of 10X PCR buffer

16 .mu.l of dNTP mix

0.5 .mu.l of Taq enzyme

0.5 .mu.l of pAK220 plasmid (identical to pAK188) as template (0.2 .mu.g of DNA)

63 .mu.l of water

A total of 16 cycles were performed, each cycle comprising 1 minute at 95.degree. C.; 1 minute at 40.degree. C.; and 2 minutes at 72.degree. C. The PCR mixture was then loaded onto a 2% agarose gel and subjected to electrophoresis using standard techniques. The resulting DNA fragment was cut out of the agarose gel and isolated using the Gene Clean kit (Bio 101 Inc., PO BOX 2284, La Jolla, Calif. 92038, USA) according to the manufacture's instructions. The purified PCR DNA fragment was dissolved in 10 .mu.l of water and restriction endonuclease buffer and cut with the restriction endonucleases HindIII and XbaI according to standard techniques. The HindIII/XbaI DNA fragment was purified using The Gene Clean Kit as described.

The plasmid pAK406 consists of a DNA sequence of 520 bp comprising an EcoRIFHindII fragment derived from pMT636 (described in WO 90/10075) encoding the yeast alpha factor leader and part of the insulin precursor ligated to the HindIII/XbaI fragment from pAK188 encoding the rest of the insulin precursor MI (see SEQ ID NOS. 32, 33 and 34) inserted into the vector cPOT. The vector pAK406 is shown in FIG. 2.

The plasmid pAK233 consists of a DNA sequence of 412 bp encoding the synthetic yeast signal/leader LaC212spx3 (described in Example 3 of WO 89/02463) followed by the gene for the insulin precursor B(1-29)-GluLysArg-A(1-21) (A21-Gly) (see SEQ ID NOS. 35, 36 and 37) inserted into the vector cPOT. The plasniid pAK233 is shown in FIG. 2.

The plasmid pAK233 was cut with the restriction endonucleases NcoI and XbaI and the vector fragment of 9273 bp isolated. The plasmid pAK406 was cut with the restriction endonucleases NcoI and HindIII and the vector fragment of 2012 bp isolated. These two DNA fragments were ligated together with the FindIII/XbaI PCR fragment using T4 DNA ligase and standard conditions. The ligation mixture was then transformed into a competent E. coli strain (R-, M+) followed by selection for ampicillin resistance. Plasmids were isolated from the resulting E. coli colonies using a standard DNA miniprep technique and checked with appropriate restriction endonucleases i.e. EcoRI, XbaI, NcoI, HindIII. The selected plasmid was shown by DNA sequencing analyses to contain the correct sequence for the Arg.sup.B31 single chain human insulin precursor DNA and to be inserted after the DNA encoding the S. cerevisiae alpha factor DNA. The plasmid was named pEA108 and is shown in FIG. 2. The DNA sequence encoding the alpha factor leader/Arg.sup.B31 single chain human insulin precursor complex and the amino acid sequence thereof are SEQ ID NOS. 38, 39 and 40. The plasmid pEA 108 was transformed into S. cerevisiae strain MT663 as described in Example 1 and the resulting strain was named yEA108.

B) The following Polymerase Chain Reaction (PCR) was performed using the Gene Amp PCR reagent kit (Perkin Elmer, 761 Main Avewalk Conn. 06859, USA) according to the manufacturer's instructions. In all cases, the PCR mixture was overlayed with 100 .mu.l of mineral oil (Sigma Chemical Co., St. Louis, Mo., USA)

5 .mu.l of oligonucleotide #220 (100 pmol)

5 .mu.l of oligonucleotide #307 (100 pmol)

10 .mu.l of 10X PCR buffer

16 .mu.l of dNTP mix

0.5 .mu.l of Taq enzyme

0.2 .mu.l of pEA108 plasmid as template (0.1 ug DNA)

63 .mu.l of water

A total of 16 cycles were performed, each cycle comprising 1 minute at 95.degree. C.; 1 minute at 40.degree. C.; and 2 minutes at 72.degree. C.. The PCR mixture was then loaded onto an 2% agarose gel and subjected to electrophoresis using standard techniques. The resulting DNA fragment was cut out of the agarose gel and isolated using the Gene Clean kit (Bio 101 Inc., PO BOX 2284, La Jolla, Calif. 92038, USA) according to the manufacture's instructions. The purified PCR DNA fragment was dissolved in 10 .mu.l of water and restriction endonuclease buffer and cut with the restriction endonucleases NcoI and XbaI according to standard techniques. The NcoI/XbaI DNA fragment was purified using The Gene Clean Kit as described.

The plasmid pAK401 consists of a DNA sequence of 523 bp composed of an EcoRI/NcoI fragment derived from pMT636 (described in WO 90/10075) (constructed by by introducing a NcoI site in the 3'-end of the alpha leader by site directed mutagenesis) encoding the alpha factor leader followed by a NcoIlXbaI fragment from pAK188 encoding the insulin precursor MI5 (see SEQ ID NOS. 41, 42 and 43) inserted into the vector (phagemid) pBLUESCRIPT IIsk(+/-) (Stratagene, USA). The plasmid pAK401 is shown in FIG. 3.

The plasmid pAK401 was cut with the restriction endonucleases NcoI and XbaI and the vector fragment of 3254 bp isolated and ligated together with the NcoI/XbaI PCR fragment. The ligation mixture was then transformed into a competent E. coli strain and plasmids were isolated from the resulting E. coli colonies using a standard DNA miniprep technique and checked with appropriate restriction endonucleases i.e. EcoRI, XbaI, NcoI. The selected plasmid, named p113A (shown in FIG. 3), was cut with EcoRI and XbaI and the fragment of 535 bp isolated.

The plasmid pAK233 was cut with the restriction endonucleases NcoI and XbaI, and with EcoRI/NcoI and the fragments of 9273 and 1644 bp isolated. These two DNA fragments were ligated together with the EcoRI/XbaI fragment from p113A using T4 DNA ligase and standard conditions. The ligation mixture was then transformed into a competent E. coli strain (R-, M+) followed by selection for ampicillin resistance. Plasmids were isolated from the resulting E. coli colonies using a standard DNA miniprep technique and checked with appropriate restriction endonucleases i.e. EcoRI, XbaI, NcoI, HindIII. The selected plasmid was shown by DNA sequencing analyses to contain the correct sequence for the Arg.sup.B31 single chain human insulin precursor DNA with the N-terminal extension GluGluAlaGluAlaGluAlaArg and to be inserted after the DNA encoding the S. cerevisiae alpha factor DNA. The plasmid was named pEA113 and is shown in FIG. 3. The DNA sequence encoding the alpha factor leader/Arg.sup.B-1 Arg.sup.B31 single chain human insulin precursor having an N-terminal extension (GluGluAlaGluAlaGluAlaArg) and the amino acid sequence thereof are SEQ ID NOS. 44, 45 and 46. The plasmid pEA113 was transformed into S. cerevisiae strain MT663 as described in Example 1 and the resulting strain was named yEA113.

EXAMPLE 6

Synthesis of Arg.sup.B-1 Arg.sup.B31 single chain human insulin precursor having an N-terminal extension (GluGluAlaGluAlaGluAlaGluArg) from Yeast strain yEA136 using the alpha factor leader.

The following oligonucleotide was synthesized: ##STR7##

The following PCR was performed using the Gene Amp PCR reagent kit

5 .mu.l of oligonucleotide #220 (100 pmol)

5 .mu.l of oligonucleotide #389 (100 pmol)

10 .mu.l of 10X PCR buffer

16 .mu.l of dNTP mix

0.5 .mu.l of Taq enzyme

2 .mu.l of pEA113 plasmid as template (0.5 ug DNA)

63 .mu.l of water

A total of 12 cycles were performed, each cycle comprising 1 minute at 95.degree. C.; 1 minute at 37.degree. C.; and 2 minutes at 72.degree. C.

The DNA encoding alpha factor leader/Arg.sup.B-1 Arg.sup.B31 single chain human insulin precursor having an N-terminal extension (GluGluAlaGluAlaGluAlaGluArg) was constructed in the same manner as described for the DNA encoding alpha factor leader/Arg.sup.B-1 Arg.sup.B31 single chain human insulin precursor having an N-terminal extension (GluGluAlaGluAlaGluAlaArg) in Example 5. The plasmid was named pEA136. The DNA sequence encoding the alpha factor leader/Arg.sup.B-1 Arg.sup.B31 single chain human insulin precursor having an N-termninal extension (GluGluAlaGluAlaGluAlaGluArg) and the amino acid sequence thereof are SEQ ID NOS. 47, 48 and 49. The plasmid pEA136 was transformed into S. cerevisiae strain MT663 as described in Example 1 and the resulting strain was named yEA136.

EXAMPLE 7

Synthesis of (A1,B1)-diBoc human insulin.

5 g of zinc-free human insulin was dissolved in 41.3 ml of DMSO. To the solution was added 3.090 ml of acetic acid. The reaction was conducted at room temperature and initiated by addition of 565 mg of di-tert-butyl pyrocarbonate dissolved in 5.650 ml of DMSO. The reaction was allowed to proceed for 51/2 hour and then stopped by addition of 250 .mu.l of ethanolamine. The product was precipitated by addition of 1500 ml of acetone. The precipitate was isolated by centrifugation and dried in vacuum. A yield of 6.85 g material was obtained.

(A1,B1)-diBoc insulin was purified by reversed phase HPLC as follows: The crude product was dissolved in 100 ml of 25% ethanol in water, adjusted to pH 3.0 with HCl and applied to a column (5 cm diameter, 30 cm high) packed with octadecyldimethylsilyl-substituted silica particles (mean particle size 15 .mu.m, pore size 100 .ANG.) and equilibrated with elution buffer. The elution was performed using mixtures of ethanol and 1 mM aqueous HCl, 0.3M KCl at a flow of 2 l/h. The insulin was eluted by increasing the ethanol content from 30% to 45%. The appropriate fraction was diluted to 20% ethanol and precipitated at pH 4.8. The precipitated material was isolated by centrifugation and dried in vacuum. Thus 1.701 g of (A1,B1)-diBoc human insulin was obtained at a purity of 94.5%.

EXAMPLE 8

Synthesis of (N.sup..epsilon.B29 -benzoyl human insulin).sub.6, 3Zn.sup.2+.

400 mg of (A1,B1)-diBoc human insulin was dissolved in 2 mnl of DMSO. To the solution was added 748 .mu.l of a mixture of N-methylmorpholine and DMSO (1:9, v/v). The reaction was conducted at 15.degree. C. and initiated by addition of 14.6 mg of benzoic acid N-hydroxysuccinimide ester dissolved in 132 .mu.l DMF. The reaction was stopped after 2 hours by addition of 100 ml of acetone. The precipitated material was isolated by centrifugation and dried in vacuum. 343 mg of material was collected.

The Boc protecting groups were eliminated by addition of 4 ml of TFA. The dissolved material was incubated for 30 minutes and then precipitated by addition of 50 ml of acetone. The precipitate was isolated by centrifugation and dried in vacuum.

N.sup..epsilon.B29 -benzoyl human insulin was purified by reversed phase HPLC as described in Example 7. A yield of 230 mg was obtained. Recrystallization from 15% aqueous ethanol containing 6 mM Zn.sup.2+ and 50 mM citrate at pH 5.5 gave crystals of the title compound which were isolated by centrifugation and dried in vacuum. The yield was 190 mg.

Molecular mass, found by MS: 5911, theory: 5911.

EXAMPLE 9

Synthesis of (N.sup..epsilon.B29 -lithocholoyl human insulin)6 3Zn.sup.2+.

400 mg of (A1,B1)-diBoc human insulin was dissolved in 2 ml of DMSO. To the solution was added 748 .mu.l of a mixture of N-methylmorpholine and DMSO (1:9, v/v). The reaction was conducted at 15.degree. C. and initiated by addition of 31.94 mg of lithocholic acid N-hydroxysuccinimide ester dissolved in 300 .mu.l of DMF. The reaction was stopped after 2 hours by addition of 100 ml of acetone. The precipitated material was isolated by centrifugation and dried in vacuum. 331 mg of material was obtained.

The Boc protecting groups were eliminated by addition of 4 ml of TFA. The dissolved material was incubated for 30 minutes and then precipitated by addition of 50 ml of acetone. The precipitate was isolated by centrifugation and dried in vacuum. The yield was 376 mg.

B29-lithocholoyl insulin was purified by reversed phase HPLC as described in Example 7. A final yield of 67 mg was obtained at a purity of 94%. Recrystallization from 15% aqueous ethanol containing 6 mM Zn.sup.2+ and 50 mM citrate at pH 5.5 gave crystals of the title compound which were isolated by centrifugation and dried in vacuum. The yield was 49 mg.

Molecular mass, found by MS: 6160, theory: 6166.

EXAMPLE 10

Synthesis of (N.sup..epsilon.B29 -decanoyl human insulin).sub.6, 3Zn.sup.2+.

400 mg of (A1,B1)-diBoc human insulin was dissolved in 2 ml of DMSO. To the solution was added 748 .mu.l of a mixture of N-methylmorpholine and DMSO (1:9, v/v). The reaction was conducted at 15.degree. C. and initiated by addition of 18.0 mg of decanoic acid N-hydroxysuccinimide ester dissolved in 132 .mu.l of DMF. The reaction was stopped after 60 minutes and the product precipitated by addition of 100 ml of acetone. The precipitated material was isolated by centrifugation and dried in vacuum. 420 mg of intermediate product was collected.

The Boc protecting groups were eliminated by addition of 4 ml of TFA. The dissolved material was incubated for 30 minutes and the product was then precipitated by addition of 50 ml of acetone. The precipitate was isolated by centrifugation and dried in vacuum. The yield of crude product was 420 mg.

The crude product was purified by reversed phase HPLC as described in Example 7. A final yield of 254 mg of the title product was obtained. The purity was 96.1%. Recrystallization from 15% aqueous ethanol containing 6 mM Zn.sup.2+ and 50 mM citrate at pH 5.5 gave crystals of the title compound which were isolated by centrifugation and dried in vacuum. The yield was 217 mg.

Molecular mass, found by MS: 5962, theory: 5962.

EXAMPLE 11

Synthesis of des(B30) human insulin.

Synthesis of des(B30) human insulin was carried out as described by Markussen (Methods in diabetes research, Vol. I, Laboratory methods, part B, 404-410. Ed: J. Lamer and S. Phol, John Wiley & Sons, 1984). 5 g of human insulin was dissolved in 500 ml of water while the pH value of the solution was kept at 2.6 by addition of 0.5M sulphuric acid. Subsequently, the insulin was salted out by addition of 100 g of ammonium sulphate and the precipitate was isolated by centrifugation. The pellet was dissolved in 800 ml of 0.1M ammonium hydrogen carbonate and the pH value of the solution was adjusted to 8.4 with 1M ammonia.

50 mg of bovine carboxypeptidase A was suspended in 25 ml of water and isolated by centrifugation. The crystals were suspended in 25 ml of water and 1M ammonia was added until a clear solution was obtained at a final pH of 10. The carboxypeptidase solution was added to the insulin solution and the reaction was allowed to proceed for 24 hours. A few drops of toluene were added to act as preservative during the reaction.

After 24 hours the des(B30) human insulin was crystallized by successive addition of 80 g of sodium chloride while the solution was stirred. The pH value was then adjusted to 8.3 and the crystallization was allowed to proceed for 20 hours with gentle stirring. The crystals were isolated on a 1.2 .mu.m filter, washed with 250 ml of ice cold 2-propanol and finally dried in vacuum.

EXAMPLE 12

Synthesis of (A1,B1)-diBoc des(B30) human insulin.

The title compound was synthesized by a method similar to that described in Example 7, using des(B30) porcine insulin as the starting material. The crude product was precipitated by acetone and dried in vacuum. The (A1,B1)-diBoc des(B30) human insulin was purified by reversed phase HPLC as described in Example 7.

EXAMPLE 13

Synthesis of N.sup..epsilon.B29 -decanoyl des(B30) human insulin.

400 mg of (A1,B1)-diBoc des(B30) human insulin was used as starting material for the synthesis of N.sup..epsilon.B29 -decanoyl des(B30) human insulin, following the procedure described in Example 10. The crude product was precipitated by acetone, dried in vacuum and deprotected using TFA. The resulting product was precipitated by acetone and dried in vacuum. N.sup..epsilon.B29 -decanoyl des(1330) human insulin was then purified by reversed phase HPLC as described in Example 10.

Molecular mass, found by MS: 5856, theory: 5861.

EXAMPLE 14

Synthesis of N.sup..epsilon.B29 -dodecanogl des(B30) human insulin.

a. Immobilization of A. lyticus protease

13 mg of A. lyticus protease, dissolved in 5 ml of aqueous 0.2M NaHCO.sub.3 buffer, pH 9.4, was mixed with 4 ml of settled MiniLeak.RTM. Medium gel, which had been washed with the same buffer (MiniLeak is a divinylsulfone activated Sepharose CL 6B, obtained from KemEnTec, Copenhagen). The gel was kept in suspension by gentle stirring for 24 hours at room temperature. Then, the gel was isolated by filtration, washed with water, and suspended in 20 ml of 1M ethanolamine buffer, pH 9.4, and kept in suspension for 24 hours at room temperature. Finally, the gel was washed with water followed by 0.1M acetic acid and stored at 4.degree. C. The enzyme activity in the filtrate was 13% of that in the initial solution, indicating a yield in the immobilization reaction of about 87%.

b. Immobilization of porcine trypsin

Porcine trypsin was immobilized to Minileak.RTM. Low to a degree of substitution of 1 mg per ml of gel, using the conditions described above for immobilization of A. lyticus.

c. Synthesis of Glu(GluAla).sub.3 Arg-B(1-29), ThrArg-A(1-21) insulin using immobilized A. lyticus protease

To 200 mg of Glu(GluAla).sub.3 Arg-B(1-29)-ThrArg-A(1-21) single-chain human insulin precursor, dissolved in 20 ml of 0.1M NaHCO.sub.3 buffer, pH 9.0, was added 4 ml of the gel carrying the immobilized A. lyticus protease. After the gel had been kept in suspension in the reaction mixture for 6 hours at room temperature the hydrolysis was complete, rendering Glu(GluAla).sub.3 -Arg-B(1-29), ThrArg-A(1-21) human insulin (the reaction was followed by reversed phase HPLC). After the hydrolysis, the gel was removed by filtration. To the filtrate was added 5 ml of ethanol and 15 .mu.L of 1M ZnCl.sub.2 and the pH was adjusted to 5.0 using HCl. The precipitation of the product was completed on standing overnight at 4.degree. C. with gentle stirring. The product was isolated by centrifugation. After one washing with 1 ml of ice cold 20% ethanol and drying in vacuo the yield was 190 mg.

d. Synthesis of N.sup..alpha.A1,N.sup..alpha.B1, N.sup..epsilon.B29 -tridodecanoyl Glu(GluAla).sub.3 Arg-B(1-29), Thr-Arg-A(1-21) human insulin using dodecanoic acid N-hydroxysuccinimide ester

190 mg (30 .mu.mol) of Glu(GluAla).sub.3 Arg-B(1-29), ThrArg-A(1-21) insulin was dissolved in 1 ml of DMSO and 1.05 ml of a 0.572M solution of N,N-diisopropylethylamine in DMP. The solution was cooled to 15.degree. C. and 36 mg (120 .mu.mol) of dodecanoic acid N-hydroxysuccinimide ester dissolved in 0.6 ml of DMSO was added. The reaction was completed within 24 hours. The lipophilic title compound was not isolated.

e. Synthesis of N.sup..epsilon.B29 -dodecanoyl des(B33) insulin

The product from the previous step, d., contained in approximately 2,65 ml of DMSO/DMF/N,N-diisopropylethylamine was diluted with 10.6 ml of a 50 mM glycine buffer comprising 20% ethanol and the pH adjusted to 10 with NaOH. After standing for 1 hour at room temperature 1 ml of Minileak gel, carrying 1 mg of immobilized trypsin per ml of gel, was added. The reaction mixture was stirred gently for 48 hours at room temperature. In order to isolate the desired product, the reaction mixture was applied to a reversed phase HPLC column (5 cm in diameter, 30 cm high), packed with octadecyldimethylsilyl-substituted silica particles (mean particle size 15 .mu.m, pore size 100 .ANG.). For the elution was used 20 mM Tris/HCl buffers, adjusted to pH 7.7 and comprising an increasing concentration of ethanol, from 40% to 44% (v/v), at a rate of 2000 ml/h. The major peak eluting at about 43-44% of ethanol contained the title compound. The fractions containing the major peak were pooled, water was added to reduce the ethanol concentration to 20% (v/v), and the pH was adjusted to 5.5. The solution was left overnight at -20.degree. C., whereby the product precipitated. The precipitate was isolated by centrifugation at -8.degree. C. and dried in vacuo. The yield of the title compound was 90 mg.

Molecular mass, found by MS: 5892, theory: 5890.

EXAMPLE 15

Synthesis of N.sup..epsilon.B29 -(N-myristoyl-.alpha.-glutamyl) human insulin.

500 mg of (A1,B1)-diBoc human insulin was dissolved in 2.5 ml of DMSO and 428 .mu.l of ethyl diisopropylamine, diluted with 2.5 ml of DMSO/DMF 1/1 (v/v), was added. The temperature was adjusted to 15.degree. C. and 85 mg of N-myristoyl-Glu(OBut) N-hydroxysuccinimide ester, dissolved in 2.5 ml of DMSO/DMF 1/1 (v/v), was added. After 30 min the reaction mixture was poured into 60 ml of water, the pH adjusted to 5 and the precipitate isolated by centrifugation. The precipitate was dried in vacuo. The dried reaction mixture was dissolved in 25 ml of TFA, and the solution was left for 30 min at room temperature. The TFA was removed by evaporation in vacuo. The gelatinous residue was dissolved in 60 ml of water and the pH was adjusted to 11.2 using concentrated ammonia. The title compound was crystallized from this solution by adjustment of the pH to 8.5 using 6N HCl. The product was isolated by centrifugation, washed once by 10 ml of water, and dried in vacuo. Yield 356 mg. Purity by HPLC 94%.

The product of this example is thus human insulin wherein the .epsilon.-amino group of Lys.sup.B29 has a substituent of the following structure: CH.sub.3 (CH.sub.2).sub.12 CONHCH(CH.sub.2 CH.sub.2 COOH)CO--.

Molecular mass, found by MS: 6146, theory: 6148.

EXAMPLE 16

Synthesis of N.sup..epsilon.B29 -undecanoyl des(B30) human insulin.

The title compound was synthesized analogously to N.sup..epsilon.B29 -dodecanoyl des(B30) human insulin as described in Example 14, by using undecanoic acid N-hydroxysuccinimide ester instead of dodecanoic acid N-hydroxysuccinimide ester.

Molecular mass of the product found by MS: 5876, theory: 5876.

EXAMPLE 17

Synthesis of N.sup..epsilon.B29 -tridecanovl des(B30) human insulin.

The title compound was synthesized analogously to N.sup..epsilon.B29 -dodecanoyl des(B30) human insulin as described in Example 14, by using tridecanoic acid N-hydroxysuccinimide ester instead of dodecanoic acid N-hydroxysuccinimide ester.

Molecular mass of the product found by MS: 5899, theory: 5904.

EXAMPLE 18

Synthesis of N.sup..epsilon.B29 -myristoyl des(B30) human insulin.

The title compound was synthesized analogously to N.sup..epsilon.B29 -dodecanoyl des(B30) human insulin as described in Example 14, by using myristic acid N-hydroxysuccinimide ester instead of dodecanoic acid N-hydroxysuccinimide ester.

Molecular mass of the product found by MS: 5923, theory: 5918.

EXAMPLE 19

Synthesis of N.sup..epsilon.B29 -palmitoyl des(B30) human insulin.

The title compound was synthesized analogously to N.sup..epsilon.B29 -dodecanoyl des(B30) human insulin as described in Example 14, by using palmitic acid N-hydroxysuccinimide ester instead of dodecanoic acid N-hydroxysuccinirnide ester.

Molecular mass of the product found by MS: 5944, theory: 5946.

EXAMPLE 20

Synthesis of N.sup..epsilon.B29 -suberoyl-D-thyroxine human insulin.

a. Preparation of N-(succinimidylsuberoyl)-D-thyroxine.

Disuccinimidyl suberate (1.0 g, Pierce) was dissolved in DMF (50 ml), and Dthyroxine (2.0 g, Aldrich) was added with stirring at 20.degree. C. The thyroxine slowly dissolved, and after 20 hours the solvent was removed by evaporation in vacuo. The oily residue was crystallized from 2-propanol to yield 0.6 g of N-(succinimidylsuberoyl)-D-thyroxine, m.p. 128.degree.-133.degree. C.

b. Reaction of (A1,B1)-diBoc human insulin with N-(succinimidylsuberoyl)-D-thyroxine. (A1,B1)-diBoc human insulin (200 mg) was dissolved in dry DMF (10 ml) by addition of triethylamine (20 .mu.l) at room temperature. Then, N-(succinimidylsuberoyl)-D-thyroxine (80 mg) was added. The reaction was monitored by reversed phase HPLC and when the reaction was about 90% complete, the solvent was removed in vacuo. To the evaporation residue, anhydrous trifluoroacetic acid (5 ml) was added, and the solution was kept for 1 hour at room temperature. After removal of the trifluoroacetic acid in vacuo, the residue was dissolved in a mixture of 1M acetic acid (5 ml) and acetonitrile (1.5 ml), purified by preparative reversed phase HPLC and desalted on a PD-10 column. The yield of N.sup..epsilon.B29 -suberoyl-D-thyroxine human insulin was 50 mg.

The product of this example is thus human insulin wherein the .epsilon.-amino group of Lys.sup.B29 has a substituent of the following structure: Thyrox-CO(CH.sub.2).sub.6 CO--, wherein Thyrox is thyroxine which is bound to the octanedioic acid moiety via an amide bond to its .alpha.-amino group.

Molecular mass of the product found by MS: 6724, theory: 6723.

EXAMPLE 21

Synthesis of N.sup..epsilon.B29 -(2-succinylamido)myristic acid human insulin.

a. Preparation of (.alpha.-aminomyristic acid methyl ester,HCl.

To methanol (5 ml, Merck) at -10.degree. C., thionyl chloride (0.2 ml, Aldrich) was added dropwise while stirring vigorously. Then, .alpha.-aminomyristic acid (0.7 g, prepared from the .alpha.-bromo acid by reaction with ammonia) was added. The reaction mixture was stirred at room temperature overnight, and then evaporated to dryness. The crude product (0.7 g) was used directly in step b.

b. Preparation of N-succinoyl-.alpha.-aminomyristic acid methyl ester. .alpha.-Aminomyristic acid methyl ester,HCl (0.7 g) was dissolved in chloroform (25 ml, Merck). Triethylamine (0.35 ml, Fluka) was added, followed by succinic anhydride (0.3 g, Fluka). The reaction mixture was stirred at room temperature for 2 hours, concentrated to dryness, and the residue recrystallized from ethyl acetate/petroleum ether (1/1). Yield: 0.8 g.

c. Preparation of N-(succinirnidvlsuccinoyl)-.alpha.-iminomyristic acid methyl ester.

N-succinoyl-.alpha.-aminomyristic acid methyl ester (0.8 g) was dissolved in dry DMF (10 ml, Merck, dried over 4 .ANG. molecular sieve). Dry pyridine (80 .mu.l, Merck), and di(N-succinimidyl)carbonate (1.8 g, Fluka) were added, and the reaction mixture was stirred overnight at room temperature. The evaporation residue was purified by flash chromatography on silica gel 60 (Merck), and recrystallized from 2-propanol/petroleum ether (1/1). Yield of N-(succinimidylsuccinoyl)-.alpha.-aminomyristic acid methyl ester: 0.13 g, m.p. 64.degree.-66.degree. C..

d. Reaction of (A1.B1)-diBoc human insulin with N-(succinimidylsuccinoyl)-.alpha.-aminomyristic acid methyl ester.

The reaction was carried out as in Example 20 b., but using N-(succinimidylsuccinoyl)-.alpha.-amninomyristic acid methyl ester (16 mg) instead of N(succinimidylsuberoyl)-D-thyroxine. After removal of the trifluoroacetic acid in vacuo, the evaporation residue was treated with 0.1M sodium hydroxide at 0.degree. C. to saponify the methyl ester. When the saponification was judged to be complete by reversed phase HPLC, the pH value in the solution was adjusted to 3, and the solution was lyophulized. After purification by preparative reversed phase HPLC and desalting on a PD-10 column, the yield of N.sup..epsilon.B29 -(.sub.2 succinylamido)myristic acid human insulin was 39 mg.

The product of this example is thus human insulin wherein the .epsilon.-amino group of Lys.sup.B29 has a substituent of the following structure: CH.sub.3 (CH.sub.2).sub.11 CH(COOH)NHCOCH.sub.2 CH.sub.2 CO--.

Molecular mass of the product found by MS: 6130, theory: 6133.

EXAMPLE 22

Synthesis of NB.sup..epsilon.B29 -octyloxycarbonyl human insulin.

The synthesis was carried out as in Example 20 b., but using noctyloxycarbonyl N-hydroxysuccinimide (9 mg, prepared from n-octyl chloroformate (Aldrich) and N-hydroxysuccinimide), instead of N-(succinimidylsuberoyl)-D-thyroxine. The yield of N.sup..epsilon.B29 -octyloxycarbonyl human insulin was 86 mg.

The product of this example is thus human insulin wherein the .epsilon.-amino group of Lys.sup..epsilon.B29 has a substituent of the following structure: CH.sub.3 (CH.sub.2).sub.7 OCO--.

Molecular mass of the product found by MS: 5960, theory: 5964.

EXAMPLE 23

Synthesis of N.sup..epsilon.B29 -(2-succinylamido)palmitic acid human insulin.

a. Preparation of N-(succinimidylsuccinoyl)-.alpha.-amino palmitic acid methyl ester.

This compound was prepared as described in Example 21 a.-c., using .alpha.-amino palmitic acid instead of .alpha.-amino myristic acid.

b. Reaction of (A1,B1)-diBoc human insulin with N-(succinimidylsuccinoyl)-.alpha.-aminopalmitictic acid methyl ester.

The reaction was carried out as in Example 21 d., but using N-(succinimidylsuccinoyl)-.alpha.-aminopalmitic acid methyl ester instead of N(succinimnidylsuccinoyl)-.alpha.-aminopalmitic acid methyl ester to give N.sup..epsilon.B29-(.sub.2 succinylamido)palmitic acid human insulin.

The product of this example is thus human insulin wherein the .epsilon.-amino group of Lys.sup.B29 has a substituent of the following structure: CH.sub.3 (CH.sub.2).sub.13 CH(COOH)NHCOCH.sub.2 CH.sub.2 CO--.

EXAMPLE 24

Synthesis of N.sup..epsilon.B29 -(2-succinylamidoethyloxy, palmitic acid human insulin.

a. Preparation of N-(succinimidylsuccinoyl)-2-aminoethyloxy palnitic acid methyl ester.

This compound was prepared as described in Example 21 a.-c. but using 2-aminoethyloxy palnitic acid (synthesized by the general procedure described by R. TenBrink, J. Org. Chem. 52 (1987) 418-422 instead of .alpha.-anmino myristic acid.

b. Reaction of (A1,B1)-diBoc human insulin with N-(succinimidylsuccinoyl)-2-aminoethyloxypalmitictic acid methyl ester.

The reaction was carried out as in Example 21 d., but using N(succinimidylsuccinoyl)-2-aminoethyloxypalmitic acid methyl ester instead of N(succinimidylsuccinoyl)-.alpha.-aminomyristic acid methyl ester to give N.sup..epsilon.B29 -(2succinylamidoethyloxy)palmitic acid human insulin.

The product of this example is thus human insulin wherein the .epsilon.-amino group of Lys.sup.B29 has a substituent of the following structure: CH.sub.3 (CH.sub.2).sub.13 CH(COOH)NHCH.sub.2 CH.sub.2 OCOCH.sub.2 CH.sub.2 CO--.

EXAMPLE 25

Synthesis of N.sup..epsilon.B29 -lithocholoyl-.alpha.-glutamyl des(B30) human insulin.

The synthesis was carried out as in Example 13 using N-lithocholoyl-L-glutamic acid (.alpha.-N-hydroxysuccinimide ester, .gamma.-tert-butyl ester instead of decanoic acid N-hydroxysuccinimide ester.

The product of this example is thus des(B30) human insulin wherein the .epsilon.-amino group of Lys.sup.B29 has a substituent of the following structure: lithocholoyl-NHCH(CH.sub.2 CH.sub.2 COOH)CO--.

Molecular mass of the product found by MS: 6194, theory: 6193.

EXAMPLE 26

Synthesis of N.sup..epsilon.B29 -3,3',5,5'-tetraiodothyroacetyl human insulin.

The synthesis was carried out as in Example 10 using 3,3',5,5'-tetraiodothyroacetic acid N-hydroxysuccinimide ester, instead of decanoic acid N-hydroxysuccinimide ester.

Molecular mass of the product found by MS: 6536, theory: 6538.

EXAMPLE 27

Synthesis of N.sup..epsilon.B29 -L-thyroxyl human insulin.

The synthesis was carried out as in Example 10 using Boc-L-thyroxine N-hydroxysuccinimide ester, instead of decanoic acid N-hydroxysuccinimide ester.

Molecular mass of the product found by MS: 6572, theory: 6567.

EXAMPLE 28

A pharmaceutical composition comprising 600 nmol/ml of N.sup..epsilon.B29 -decanoyl des(B30) human insulin, 1/3Zn.sup.2+ in solution.

N.sup..epsilon.B29 -decanoyl des(0330) human insulin (1.2 .mu.mol) was dissolved in water (0.8 ml) and the pH value was adjusted to 7.5 by addition of 0.2M sodium hydroxide. 0.01M zinc acetate (60 .mu.l) and a solution containing 0.75% of phenol and 4% of glycerol (0.8 ml) was added. The pH value of the solution was adjusted to 7.5 using 0.2M sodium hydroxide and the volume of the solution was adjusted to 2 ml with water.

The resulting solution was sterilized by filtration and transferred aseptically to a cartridge or a vial.

EXAMPLE 29

A pharmaceutical composition comprising 600 mmol/ml of N.sup..epsilon.B29 -decanoyl human insulin, 1/2Zn.sup.2+ in solution. 1.2 .mu.mol of the title compound was dissolved in water (0.8 ml) and the pH value was adjusted to 7.5 by addition of 0.2M sodium hydroxide. A solution containing 0.75% of phenol and 1.75% of sodium chloride (0.8 ml) was added. The pH value of the solution was adjusted to 7.5 using 0.2M sodium hydroxide and the volume of the solution was adjusted to 2 ml with water.

The resulting solution was sterilized by filtration and transferred aseptically to a cartridge or a vial.

EXAMPLE 30

A pharmaceutical composition comprising 600 nmol/ml of N.sup..epsilon.B29 -lithocholoyl human insulin in solution.

1.2 .mu.mol of the title compound was suspended in water (0.8 ml) and dissolved by adjusting the pH value of the solution to 8.5 using 0.2M sodium hydroxide. To the solution was then added 0.8 ml of a stock solution containing 0.75% cresol and 4% glycerol in water. Finally, the pH value was again adjusted to 8.5 and the volume of the solution was adjusted to 2 ml with water.

The resulting solution was sterilized by filtration and transferred aseptically to a cartridge or a vial.

  __________________________________________________________________________
     SEQUENCE LISTING                                                          
     (1) GENERAL INFORMATION:                                                  
     (iii) NUMBER OF SEQUENCES: 49                                             
     (2) INFORMATION FOR SEQ ID NO:1:                                          
     (i) SEQUENCE CHARACTERISTICS:                                             
     (A) LENGTH: 21 amino acids                                                
     (B) TYPE: amino acid                                                      
     (D) TOPOLOGY: linear                                                      
     (ii) MOLECULE TYPE: protein                                               
     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:1:                                   
     GlyIleValGluGlnCysCysThrSerIleCysSerLeuTyrGlnLeu                          
     151015                                                                    
     GluAsnTyrCysXaa                                                           
     20                                                                        
     (2) INFORMATION FOR SEQ ID NO:2:                                          
     (i) SEQUENCE CHARACTERISTICS:                                             
     (A) LENGTH: 30 amino acids                                                
     (B) TYPE: amino acid                                                      
     (D) TOPOLOGY: linear                                                      
     (ii) MOLECULE TYPE: protein                                               
     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:                                   
     XaaValXaaGlnHisLeuCysGlySerHisLeuValGluAlaLeuTyr                          
     151015                                                                    
     LeuValCysGlyGluArgGlyPhePheTyrThrProLysXaa                                
     202530                                                                    
     (2) INFORMATION FOR SEQ ID NO:3:                                          
     (i) SEQUENCE CHARACTERISTICS:                                             
     (A) LENGTH: 110 base pairs                                                
     (B) TYPE: nucleic acid                                                    
     (C) STRANDEDNESS: single                                                  
     (D) TOPOLOGY: linear                                                      
     (ii) MOLECULE TYPE: DNA                                                   
     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:                                   
     TGGCTAAGAGATTCGTTGACCAACACTTGTGCGGTTCTCACTTGGTTGAAGCTTTGTACT60            
     TGGTTTGTGGTGAAAGAGGTTTCTTCTACACTCCAAAGTCTGACGACGCT110                     
     (2) INFORMATION FOR SEQ ID NO:4:                                          
     (i) SEQUENCE CHARACTERISTICS:                                             
     (A) LENGTH: 100 base pairs                                                
     (B) TYPE: nucleic acid                                                    
     (C) STRANDEDNESS: single                                                  
     (D) TOPOLOGY: linear                                                      
     (ii) MOLECULE TYPE: DNA                                                   
     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:                                   
     CTGCGGGCTGCGTCTAAGCACAGTAGTTTTCCAATTGGTACAAAGAACAGATAGAAGTAC60            
     AACATTGTTCAACGATACCCTTAGCGTCGTCAGACTTTGG100                               
     (2) INFORMATION FOR SEQ ID NO:5:                                          
     (i) SEQUENCE CHARACTERISTICS:                                             
     (A) LENGTH: 25 base pairs                                                 
     (B) TYPE: nucleic acid                                                    
     (C) STRANDEDNESS: single                                                  
     (D) TOPOLOGY: linear                                                      
     (ii) MOLECULE TYPE: DNA                                                   
     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:5:                                   
     GTCGCCATGGCTAAGAGATTCGTTG25                                               
     (2) INFORMATION FOR SEQ ID NO:6:                                          
     (i) SEQUENCE CHARACTERISTICS:                                             
     (A) LENGTH: 27 base pairs                                                 
     (B) TYPE: nucleic acid                                                    
     (C) STRANDEDNESS: single                                                  
     (D) TOPOLOGY: linear                                                      
     (ii) MOLECULE TYPE: DNA                                                   
     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:6:                                   
     CTGCTCTAGAGCCTGCGGGCTGCGTCT27                                             
     (2) INFORMATION FOR SEQ ID NO:7:                                          
     (i) SEQUENCE CHARACTERISTICS:                                             
     (A) LENGTH: 110 base pairs                                                
     (B) TYPE: nucleic acid                                                    
     (C) STRANDEDNESS: single                                                  
     (D) TOPOLOGY: linear                                                      
     (ii) MOLECULE TYPE: DNA                                                   
     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:7:                                   
     TGGCTAAGAGATTCGTTACTCAACACTTGTGCGGTTCTCACTTGGTTGAAGCTTTGTACT60            
     TGGTTTGTGGTGAAAGAGGTTTCTTCTACACTCCAAAGTCTGACGACGCT110                     
     (2) INFORMATION FOR SEQ ID NO:8:                                          
     (i) SEQUENCE CHARACTERISTICS:                                             
     (A) LENGTH: 25 base pairs                                                 
     (B) TYPE: nucleic acid                                                    
     (C) STRANDEDNESS: single                                                  
     (D) TOPOLOGY: linear                                                      
     (ii) MOLECULE TYPE: DNA                                                   
     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:8:                                   
     GTCGCCATGGCTAAGAGATTCGTTA25                                               
     (2) INFORMATION FOR SEQ ID NO:9:                                          
     (i) SEQUENCE CHARACTERISTICS:                                             
     (A) LENGTH: 100 base pairs                                                
     (B) TYPE: nucleic acid                                                    
     (C) STRANDEDNESS: single                                                  
     (D) TOPOLOGY: linear                                                      
     (ii) MOLECULE TYPE: DNA                                                   
     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:9:                                   
     CTGCGGGCTGCGTCTAACCACAGTAGTTTTCCAATTGGTACAAAGAACAGATAGAAGTAC60            
     AACATTGTTCAACGATACCCTTAGCGTCGTCAGACTTTGG100                               
     (2) INFORMATION FOR SEQ ID NO:10:                                         
     (i) SEQUENCE CHARACTERISTICS:                                             
     (A) LENGTH: 27 base pairs                                                 
     (B) TYPE: nucleic acid                                                    
     (C) STRANDEDNESS: single                                                  
     (D) TOPOLOGY: linear                                                      
     (ii) MOLECULE TYPE: DNA                                                   
     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:10:                                  
     ACGTACGTTCTAGAGCCTGCGGGCTGC27                                             
     (2) INFORMATION FOR SEQ ID NO:11:                                         
     (i) SEQUENCE CHARACTERISTICS:                                             
     (A) LENGTH: 78 base pairs                                                 
     (B) TYPE: nucleic acid                                                    
     (C) STRANDEDNESS: single                                                  
     (D) TOPOLOGY: linear                                                      
     (ii) MOLECULE TYPE: DNA                                                   
     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:11:                                  
     CACTTGGTTGAAGCTTTGTACTTGGTTTGTGGTGAAAGAGGTTTCTTCTACACTCCAAAG60            
     ACTAGAGGTATCGTTGAA78                                                      
     (2) INFORMATION FOR SEQ ID NO:12:                                         
     (i) SEQUENCE CHARACTERISTICS:                                             
     (A) LENGTH: 63 base pairs                                                 
     (B) TYPE: nucleic acid                                                    
     (C) STRANDEDNESS: single                                                  
     (D) TOPOLOGY: linear                                                      
     (ii) MOLECULE TYPE: DNA                                                   
     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:12:                                  
     GCTAACGTCGCCATGGCTAAGAGAGAAGAAGCTGAAGCTGAAGCTAGATTCGTTAACCAA60            
     CAC63                                                                     
     (2) INFORMATION FOR SEQ ID NO:13:                                         
     (i) SEQUENCE CHARACTERISTICS:                                             
     (A) LENGTH: 65 base pairs                                                 
     (B) TYPE: nucleic acid                                                    
     (C) STRANDEDNESS: single                                                  
     (D) TOPOLOGY: linear                                                      
     (ii) MOLECULE TYPE: DNA                                                   
     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:13:                                  
     GCTAACGTCGCCATGGCTAAGAGAGAAGAAGCTGAAGCGAAGCTGAAAGATTCGTTAACC60            
     AACAC65                                                                   
     (2) INFORMATION FOR SEQ ID NO:14:                                         
     (i) SEQUENCE CHARACTERISTICS:                                             
     (A) LENGTH: 415 base pairs                                                
     (B) TYPE: nucleic acid                                                    
     (C) STRANDEDNESS: single                                                  
     (D) TOPOLOGY: linear                                                      
     (ii) MOLECULE TYPE: cDNA                                                  
     (ix) FEATURE:                                                             
     (A) NAME/KEY: CDS                                                         
     (B) LOCATION: 80..391                                                     
     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:14:                                  
     ATCGAATTCCATTCAAGAATAGTTCAAACAAGAAGATTACAAACTATCAATTTCATACAC60            
     AATATAAACGACCAAAAGAATGAAGGCTGTTTTCTTGGTTTTGTCCTTGATC112                   
     MetLysAlaValPheLeuValLeuSerLeuIle                                         
     1510                                                                      
     GGATTCTGCTGGGCCCAACCAGTCACTGGCGATGAATCATCTGTTGAG160                       
     GlyPheCysTrpAlaGlnProValThrGlyAspGluSerSerValGlu                          
     152025                                                                    
     ATTCCGGAAGAGTCTCTGATCATCGCTGAAAACACCACTTTGGCTAAC208                       
     IleProGluGluSerLeuIleIleAlaGluAsnThrThrLeuAlaAsn                          
     303540                                                                    
     GTCGCCATGGCTAAGAGATTCGTTAACCAACACTTGTGCGGTTCTCAC256                       
     ValAlaMetAlaLysArgPheValAsnGlnHisLeuCysGlySerHis                          
     455055                                                                    
     TTGGTTGAAGCTTTGTACTTGGTTTGTGGTGAAAGAGGTTTCTTCTAC304                       
     LeuValGluAlaLeuTyrLeuValCysGlyGluArgGlyPhePheTyr                          
     60657075                                                                  
     ACTCCAAAGTCTGACGACGCTAAGGGTATCGTTGAACAATGTTGTACT352                       
     ThrProLysSerAspAspAlaLysGlyIleValGluGlnCysCysThr                          
     808590                                                                    
     TCTATCTGTTCTTTGTACCAATTGGAAAACTACTGTAACTAGACGCAGC401                      
     SerIleCysSerLeuTyrGlnLeuGluAsnTyrCysAsn                                   
     95100                                                                     
     CCGCAGGCTCTAGA415                                                         
     (2) INFORMATION FOR SEQ ID NO:15:                                         
     (i) SEQUENCE CHARACTERISTICS:                                             
     (A) LENGTH: 104 amino acids                                               
     (B) TYPE: amino acid                                                      
     (D) TOPOLOGY: linear                                                      
     (ii) MOLECULE TYPE: protein                                               
     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:15:                                  
     MetLysAlaValPheLeuValLeuSerLeuIleGlyPheCysTrpAla                          
     151015                                                                    
     GlnProValThrGlyAspGluSerSerValGluIleProGluGluSer                          
     202530                                                                    
     LeuIleIleAlaGluAsnThrThrLeuAlaAsnValAlaMetAlaLys                          
     354045                                                                    
     ArgPheValAsnGlnHisLeuCysGlySerHisLeuValGluAlaLeu                          
     505560                                                                    
     TyrLeuValCysGlyGluArgGlyPhePheTyrThrProLysSerAsp                          
     65707580                                                                  
     AspAlaLysGlyIleValGluGlnCysCysThrSerIleCysSerLeu                          
     859095                                                                    
     TyrGlnLeuGluAsnTyrCysAsn                                                  
     100                                                                       
     (2) INFORMATION FOR SEQ ID NO:16:                                         
     (i) SEQUENCE CHARACTERISTICS:                                             
     (A) LENGTH: 415 base pairs                                                
     (B) TYPE: nucleic acid                                                    
     (C) STRANDEDNESS: single                                                  
     (D) TOPOLOGY: linear                                                      
     (ii) MOLECULE TYPE: DNA                                                   
     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:16:                                  
     TAGCTTAAGGTAAGTTCTTATCAAGTTTGTTCTTCTAATGTTTGATAGTTAAAGTATGTG60            
     TTATATTTGCTGGTTTTCTTACTTCCGACAAAAGAACCAAAACAGGAACTAGCCTAAGAC120           
     GACCCGGGTTGGTCAGTGACCGCTACTTAGTAGACAACTCTAAGGCCTTCTCAGAGACTA180           
     GTAGCGACTTTTGTGGTGAAACCGATTGCAGCGGTACCGATTCTCTAAGCAATTGGTTGT240           
     GAACACGCCAAGAGTGAACCAACTTCGAAACATGAACCAAACACCACTTTCTCCAAAGAA300           
     GATGTGAGGTTTCAGACTGCTGCGATTCCCATAGCAACTTGTTACAACATGAAGATAGAC360           
     AAGAAACATGGTTAACCTTTTGATGACATTGATCTGCGTCGGGCGTCCGAGATCT415                
     (2) INFORMATION FOR SEQ ID NO:17:                                         
     (i) SEQUENCE CHARACTERISTICS:                                             
     (A) LENGTH: 523 base pairs                                                
     (B) TYPE: nucleic acid                                                    
     (C) STRANDEDNESS: single                                                  
     (D) TOPOLOGY: linear                                                      
     (ii) MOLECULE TYPE: cDNA                                                  
     (ix) FEATURE:                                                             
     (A) NAME/KEY: CDS                                                         
     (B) LOCATION: 80..499                                                     
     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:17:                                  
     ATCGAATTCCATTCAAGAATAGTTCAAACAAGAAGATTACAAACTATCAATTTCATACAC60            
     AATATAAACGATTAAAAGAATGAGATTTCCTTCAATTTTTACTGCAGTTTTA112                   
     MetArgPheProSerIlePheThrAlaValLeu                                         
     1510                                                                      
     TTCGCAGCATCCTCCGCATTAGCTGCTCCAGTCAACACTACAACAGAA160                       
     PheAlaAlaSerSerAlaLeuAlaAlaProValAsnThrThrThrGlu                          
     152025                                                                    
     GATGAAACGGCACAAATTCCGGCTGAAGCTGTCATCGGTTACTCAGAT208                       
     AspGluThrAlaGlnIleProAlaGluAlaValIleGlyTyrSerAsp                          
     303540                                                                    
     TTAGAAGGGGATTTCGATGTTGCTGTTTTGCCATTTTCCAACAGCACA256                       
     LeuGluGlyAspPheAspValAlaValLeuProPheSerAsnSerThr                          
     455055                                                                    
     AATAACGGGTTATTGTTTATAAATACTACTATTGCCAGCATTGCTGCT304                       
     AsnAsnGlyLeuLeuPheIleAsnThrThrIleAlaSerIleAlaAla                          
     60657075                                                                  
     AAAGAAGAAGGGGTATCTTTGGATAAGAGAGAAGTTAACCAACACTTG352                       
     LysGluGluGlyValSerLeuAspLysArgGluValAsnGlnHisLeu                          
     808590                                                                    
     TGCGGTTCTCACTTGGTTGAAGCTTTGTACTTGGTTTGTGGTGAAAGA400                       
     CysGlySerHisLeuValGluAlaLeuTyrLeuValCysGlyGluArg                          
     95100105                                                                  
     GGTTTCTTCTACACTGAAAAGTCTGACGACGCTAAGGGTATCGTTGAA448                       
     GlyPhePheTyrThrGluLysSerAspAspAlaLysGlyIleValGlu                          
     110115120                                                                 
     CAATGTTGTACTTCTATCTGTTCTTTGTACCAATTGGAAAACTACTGT496                       
     GlnCysCysThrSerIleCysSerLeuTyrGlnLeuGluAsnTyrCys                          
     125130135                                                                 
     AACTAGACGCAGCCCGCAGGCTCTAGA523                                            
     Asn                                                                       
     140                                                                       
     (2) INFORMATION FOR SEQ ID NO:18:                                         
     (i) SEQUENCE CHARACTERISTICS:                                             
     (A) LENGTH: 140 amino acids                                               
     (B) TYPE: amino acid                                                      
     (D) TOPOLOGY: linear                                                      
     (ii) MOLECULE TYPE: protein                                               
     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:18:                                  
     MetArgPheProSerIlePheThrAlaValLeuPheAlaAlaSerSer                          
     151015                                                                    
     AlaLeuAlaAlaProValAsnThrThrThrGluAspGluThrAlaGln                          
     202530                                                                    
     IleProAlaGluAlaValIleGlyTyrSerAspLeuGluGlyAspPhe                          
     354045                                                                    
     AspValAlaValLeuProPheSerAsnSerThrAsnAsnGlyLeuLeu                          
     505560                                                                    
     PheIleAsnThrThrIleAlaSerIleAlaAlaLysGluGluGlyVal                          
     65707580                                                                  
     SerLeuAspLysArgGluValAsnGlnHisLeuCysGlySerHisLeu                          
     859095                                                                    
     ValGluAlaLeuTyrLeuValCysGlyGluArgGlyPhePheTyrThr                          
     100105110                                                                 
     GluLysSerAspAspAlaLysGlyIleValGluGlnCysCysThrSer                          
     115120125                                                                 
     IleCysSerLeuTyrGlnLeuGluAsnTyrCysAsn                                      
     130135140                                                                 
     (2) INFORMATION FOR SEQ ID NO:19:                                         
     (i) SEQUENCE CHARACTERISTICS:                                             
     (A) LENGTH: 523 base pairs                                                
     (B) TYPE: nucleic acid                                                    
     (C) STRANDEDNESS: single                                                  
     (D) TOPOLOGY: linear                                                      
     (ii) MOLECULE TYPE: DNA                                                   
     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:19:                                  
     TAGCTTAAGGTAAGTTCTTATCAAGTTTGTTCTTCTAATGTTTGATAGTTAAAGTATGTG60            
     TTATATTTGCTAATTTTCTTACTCTAAAGGAAGTTAAAAATGACGTCAAAATAAGCGTCG120           
     TAGGAGGCGTAATCGACGAGGTCAGTTGTGATGTTGTCTTCTACTTTGCCGTGTTTAAGG180           
     CCGACTTCGACAGTAGCCAATGAGTCTAAATCTTCCCCTAAAGCTACAACGACAAAACGG240           
     TAAAAGGTTGTCGTGTTTATTGCCCAATAACAAATATTTATGATGATAACGGTCGTAACG300           
     ACGATTTCTTCTTCCCCATAGAAACCTATTCTCTCTTCAATTGGTTGTGAACACGCCAAG360           
     AGTGAACCAACTTCGAAACATGAACCAAACACCACTTTCTCCAAAGAAGATGTGACTTTT420           
     CAGACTGCTGCGATTCCCATAGCAACTTGTTACAACATGAAGATAGACAAGAAACATGGT480           
     TAACCTTTTGATGACATTGATCTGCGTCGGGCGTCCGAGATCT523                            
     (2) INFORMATION FOR SEQ ID NO:20:                                         
     (i) SEQUENCE CHARACTERISTICS:                                             
     (A) LENGTH: 415 base pairs                                                
     (B) TYPE: nucleic acid                                                    
     (C) STRANDEDNESS: single                                                  
     (D) TOPOLOGY: linear                                                      
     (ii) MOLECULE TYPE: cDNA                                                  
     (ix) FEATURE:                                                             
     (A) NAME/KEY: CDS                                                         
     (B) LOCATION: 80..391                                                     
     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:20:                                  
     ATCGAATTCCATTCAAGAATAGTTCAAACAAGAAGATTACAAACTATCAATTTCATACAC60            
     AATATAAACGACCAAAAGAATGAAGGCTGTTTTCTTGGTTTTGTCCTTGATC112                   
     MetLysAlaValPheLeuValLeuSerLeuIle                                         
     1510                                                                      
     GGATTCTGCTGGGCCCAACCAGTCACTGGCGATGAATCATCTGTTGAG160                       
     GlyPheCysTrpAlaGlnProValThrGlyAspGluSerSerValGlu                          
     152025                                                                    
     ATTCCGGAAGAGTCTCTGATCATCGCTGAAAACACCACTTTGGCTAAC208                       
     IleProGluGluSerLeuIleIleAlaGluAsnThrThrLeuAlaAsn                          
     303540                                                                    
     GTCGCCATGGCTAAGAGATTCGTTGACCAACACTTGTGCGGTTCTCAC256                       
     ValAlaMetAlaLysArgPheValAspGlnHisLeuCysGlySerHis                          
     455055                                                                    
     TTGGTTGAAGCTTTGTACTTGGTTTGTGGTGAAAGAGGTTTCTTCTAC304                       
     LeuValGluAlaLeuTyrLeuValCysGlyGluArgGlyPhePheTyr                          
     60657075                                                                  
     ACTCCAAAGTCTGACGACGCTAAGGGTATCGTTGAACAATGTTGTACT352                       
     ThrProLysSerAspAspAlaLysGlyIleValGluGlnCysCysThr                          
     808590                                                                    
     TCTATCTGTTCTTTGTACCAATTGGAAAACTACTGTGCTTAGACGCAGC401                      
     SerIleCysSerLeuTyrGlnLeuGluAsnTyrCysAla                                   
     95100                                                                     
     CCGCAGGCTCTAGA415                                                         
     (2) INFORMATION FOR SEQ ID NO:21:                                         
     (i) SEQUENCE CHARACTERISTICS:                                             
     (A) LENGTH: 104 amino acids                                               
     (B) TYPE: amino acid                                                      
     (D) TOPOLOGY: linear                                                      
     (ii) MOLECULE TYPE: protein                                               
     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:21:                                  
     MetLysAlaValPheLeuValLeuSerLeuIleGlyPheCysTrpAla                          
     151015                                                                    
     GlnProValThrGlyAspGluSerSerValGluIleProGluGluSer                          
     202530                                                                    
     LeuIleIleAlaGluAsnThrThrLeuAlaAsnValAlaMetAlaLys                          
     354045                                                                    
     ArgPheValAspGlnHisLeuCysGlySerHisLeuValGluAlaLeu                          
     505560                                                                    
     TyrLeuValCysGlyGluArgGlyPhePheTyrThrProLysSerAsp                          
     65707580                                                                  
     AspAlaLysGlyIleValGluGlnCysCysThrSerIleCysSerLeu                          
     859095                                                                    
     TyrGlnLeuGluAsnTyrCysAla                                                  
     100                                                                       
     (2) INFORMATION FOR SEQ ID NO:22:                                         
     (i) SEQUENCE CHARACTERISTICS:                                             
     (A) LENGTH: 415 base pairs                                                
     (B) TYPE: nucleic acid                                                    
     (C) STRANDEDNESS: single                                                  
     (D) TOPOLOGY: linear                                                      
     (ii) MOLECULE TYPE: DNA                                                   
     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:22:                                  
     TAGCTTAAGGTAAGTTCTTATCAAGTTTGTTCTTCTAATGTTTGATAGTTAAAGTATGTG60            
     TTATATTTGCTGGTTTTCTTACTTCCGACAAAAGAACCAAAACAGGAACTAGCCTAAGAC120           
     GACCCGGGTTGGTCAGTGACCGCTACTTAGTAGACAACTCTAAGGCCTTCTCAGAGACTA180           
     GTAGCGACTTTTGTGGTGAAACCGATTGCAGCGGTACCGATTCTCTAAGCAACTGGTTGT240           
     GAACACGCCAAGAGTGAACCAACTTCGAAACATGAACCAAACACCACTTTCTCCAAAGAA300           
     GATGTGAGGTTTCAGACTGCTGCGATTCCCATAGCAACTTGTTACAACATGAAGATAGAC360           
     AAGAAACATGGTTAACCTTTTGATGACACGAATCTGCGTCGGGCGTCCGAGATCT415                
     (2) INFORMATION FOR SEQ ID NO:23:                                         
     (i) SEQUENCE CHARACTERISTICS:                                             
     (A) LENGTH: 415 base pairs                                                
     (B) TYPE: nucleic acid                                                    
     (C) STRANDEDNESS: single                                                  
     (D) TOPOLOGY: linear                                                      
     (ii) MOLECULE TYPE: cDNA                                                  
     (ix) FEATURE:                                                             
     (A) NAME/KEY: CDS                                                         
     (B) LOCATION: 80..391                                                     
     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:23:                                  
     ATCGAATTCCATTCAAGAATAGTTCAAACAAGAAGATTACAAACTATCAATTTCATACAC60            
     AATATAAACGACCAAAAGAATGAAGGCTGTTTTCTTGGTTTTGTCCTTGATC112                   
     MetLysAlaValPheLeuValLeuSerLeuIle                                         
     1510                                                                      
     GGATTCTGCTGGGCCCAACCAGTCACTGGCGATGAATCATCTGTTGAG160                       
     GlyPheCysTrpAlaGlnProValThrGlyAspGluSerSerValGlu                          
     152025                                                                    
     ATTCCGGAAGAGTCTCTGATCATCGCTGAAAACACCACTTTGGCTAAC208                       
     IleProGluGluSerLeuIleIleAlaGluAsnThrThrLeuAlaAsn                          
     303540                                                                    
     GTCGCCATGGCTAAGAGATTCGTTACTCAACACTTGTGCGGTTCTCAC256                       
     ValAlaMetAlaLysArgPheValThrGlnHisLeuCysGlySerHis                          
     455055                                                                    
     TTGGTTGAAGCTTTGTACTTGGTTTGTGGTGAAAGAGGTTTCTTCTAC304                       
     LeuValGluAlaLeuTyrLeuValCysGlyGluArgGlyPhePheTyr                          
     60657075                                                                  
     ACTCCAAAGTCTGACGACGCTAAGGGTATCGTTGAACAATGTTGTACT352                       
     ThrProLysSerAspAspAlaLysGlyIleValGluGlnCysCysThr                          
     808590                                                                    
     TCTATCTGTTCTTTGTACCAATTGGAAAACTACTGTGCTTAGACGCAGC401                      
     SerIleCysSerLeuTyrGlnLeuGluAsnTyrCysAla                                   
     95100                                                                     
     CCGCAGGCTCTAGA415                                                         
     (2) INFORMATION FOR SEQ ID NO:24:                                         
     (i) SEQUENCE CHARACTERISTICS:                                             
     (A) LENGTH: 104 amino acids                                               
     (B) TYPE: amino acid                                                      
     (D) TOPOLOGY: linear                                                      
     (ii) MOLECULE TYPE: protein                                               
     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:24:                                  
     MetLysAlaValPheLeuValLeuSerLeuIleGlyPheCysTrpAla                          
     151015                                                                    
     GlnProValThrGlyAspGluSerSerValGluIleProGluGluSer                          
     202530                                                                    
     LeuIleIleAlaGluAsnThrThrLeuAlaAsnValAlaMetAlaLys                          
     354045                                                                    
     ArgPheValThrGlnHisLeuCysGlySerHisLeuValGluAlaLeu                          
     505560                                                                    
     TyrLeuValCysGlyGluArgGlyPhePheTyrThrProLysSerAsp                          
     65707580                                                                  
     AspAlaLysGlyIleValGluGlnCysCysThrSerIleCysSerLeu                          
     859095                                                                    
     TyrGlnLeuGluAsnTyrCysAla                                                  
     100                                                                       
     (2) INFORMATION FOR SEQ ID NO:25:                                         
     (i) SEQUENCE CHARACTERISTICS:                                             
     (A) LENGTH: 415 base pairs                                                
     (B) TYPE: nucleic acid                                                    
     (C) STRANDEDNESS: single                                                  
     (D) TOPOLOGY: linear                                                      
     (ii) MOLECULE TYPE: DNA                                                   
     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:25:                                  
     TAGCTTAAGGTAAGTTCTTATCAAGTTTGTTCTTCTAATGTTTGATAGTTAAAGTATGTG60            
     TTATATTTGCTGGTTTTCTTACTTCCGACAAAAGAACCAAAACAGGAACTAGCCTAAGAC120           
     GACCCGGGTTGGTCAGTGACCGCTACTTAGTAGACAACTCTAAGGCCTTCTCAGAGACTA180           
     GTAGCGACTTTTGTGGTGAAACCGATTGCAGCGGTACCGATTCTCTAAGCAATGAGTTGT240           
     GAACACGCCAAGAGTGAACCAACTTCGAAACATGAACCAAACACCACTTTCTCCAAAGAA300           
     GATGTGAGGTTTCAGACTGCTGCGATTCCCATAGCAACTTGTTACAACATGAAGATAGAC360           
     AAGAAACATGGTTAACCTTTTGATGACACGAATCTGCGTCGGGCGTCCGAGATCT415                
     (2) INFORMATION FOR SEQ ID NO:26:                                         
     (i) SEQUENCE CHARACTERISTICS:                                             
     (A) LENGTH: 415 base pairs                                                
     (B) TYPE: nucleic acid                                                    
     (C) STRANDEDNESS: single                                                  
     (D) TOPOLOGY: linear                                                      
     (ii) MOLECULE TYPE: cDNA                                                  
     (ix) FEATURE:                                                             
     (A) NAME/KEY: CDS                                                         
     (B) LOCATION: 80..391                                                     
     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:26:                                  
     ATCGAATTCCATTCAAGAATAGTTCAAACAAGAAGATTACAAACTATCAATTTCATACAC60            
     AATATAAACGACCAAAAGAATGAAGGCTGTTTTCTTGGTTTTGTCCTTGATC112                   
     MetLysAlaValPheLeuValLeuSerLeuIle                                         
     1510                                                                      
     GGATTCTGCTGGGCCCAACCAGTCACTGGCGATGAATCATCTGTTGAG160                       
     GlyPheCysTrpAlaGlnProValThrGlyAspGluSerSerValGlu                          
     152025                                                                    
     ATTCCGGAAGAGTCTCTGATCATCGCTGAAAACACCACTTTGGCTAAC208                       
     IleProGluGluSerLeuIleIleAlaGluAsnThrThrLeuAlaAsn                          
     303540                                                                    
     GTCGCCATGGCTAAGAGATTCGTTGACCAACACTTGTGCGGTTCTCAC256                       
     ValAlaMetAlaLysArgPheValAspGlnHisLeuCysGlySerHis                          
     455055                                                                    
     TTGGTTGAAGCTTTGTACTTGGTTTGTGGTGAAAGAGGTTTCTTCTAC304                       
     LeuValGluAlaLeuTyrLeuValCysGlyGluArgGlyPhePheTyr                          
     60657075                                                                  
     ACTCCAAAGTCTGACGACGCTAAGGGTATCGTTGAACAATGTTGTACT352                       
     ThrProLysSerAspAspAlaLysGlyIleValGluGlnCysCysThr                          
     808590                                                                    
     TCTATCTGTTCTTTGTACCAATTGGAAAACTACTGTGGTTAGACGCAGC401                      
     SerIleCysSerLeuTyrGlnLeuGluAsnTyrCysGly                                   
     95100                                                                     
     CCGCAGGCTCTAGA415                                                         
     (2) INFORMATION FOR SEQ ID NO:27:                                         
     (i) SEQUENCE CHARACTERISTICS:                                             
     (A) LENGTH: 104 amino acids                                               
     (B) TYPE: amino acid                                                      
     (D) TOPOLOGY: linear                                                      
     (ii) MOLECULE TYPE: protein                                               
     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:27:                                  
     MetLysAlaValPheLeuValLeuSerLeuIleGlyPheCysTrpAla                          
     151015                                                                    
     GlnProValThrGlyAspGluSerSerValGluIleProGluGluSer                          
     202530                                                                    
     LeuIleIleAlaGluAsnThrThrLeuAlaAsnValAlaMetAlaLys                          
     354045                                                                    
     ArgPheValAspGlnHisLeuCysGlySerHisLeuValGluAlaLeu                          
     505560                                                                    
     TyrLeuValCysGlyGluArgGlyPhePheTyrThrProLysSerAsp                          
     65707580                                                                  
     AspAlaLysGlyIleValGluGlnCysCysThrSerIleCysSerLeu                          
     859095                                                                    
     TyrGlnLeuGluAsnTyrCysGly                                                  
     100                                                                       
     (2) INFORMATION FOR SEQ ID NO:28:                                         
     (i) SEQUENCE CHARACTERISTICS:                                             
     (A) LENGTH: 415 base pairs                                                
     (B) TYPE: nucleic acid                                                    
     (C) STRANDEDNESS: single                                                  
     (D) TOPOLOGY: linear                                                      
     (ii) MOLECULE TYPE: DNA                                                   
     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:28:                                  
     TAGCTTAAGGTAAGTTCTTATCAAGTTTGTTCTTCTAATGTTTGATAGTTAAAGTATGTG60            
     TTATATTTGCTGGTTTTCTTACTTCCGACAAAAGAACCAAAACAGGAACTAGCCTAAGAC120           
     GACCCGGGTTGGTCAGTGACCGCTACTTAGTAGACAACTCTAAGGCCTTCTCAGAGACTA180           
     GTAGCGACTTTTGTGGTGAAACCGATTGCAGCGGTACCGATTCTCTAAGCAACTGGTTGT240           
     GAACACGCCAAGAGTGAACCAACTTCGAAACATGAACCAAACACCACTTTCTCCAAAGAA300           
     GATGTGAGGTTTCAGACTGCTGCGATTCCCATAGCAACTTGTTACAACATGAAGATAGAC360           
     AAGAAACATGGTTAACCTTTTGATGACACCAATCTGCGTCGGGCGTCCGAGATCT415                
     (2) INFORMATION FOR SEQ ID NO:29:                                         
     (i) SEQUENCE CHARACTERISTICS:                                             
     (A) LENGTH: 415 base pairs                                                
     (B) TYPE: nucleic acid                                                    
     (C) STRANDEDNESS: single                                                  
     (D) TOPOLOGY: linear                                                      
     (ii) MOLECULE TYPE: cDNA                                                  
     (ix) FEATURE:                                                             
     (A) NAME/KEY: CDS                                                         
     (B) LOCATION: 80..391                                                     
     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:29:                                  
     ATCGAATTCCATTCAAGAATAGTTCAAACAAGAAGATTACAAACTATCAATTTCATACAC60            
     AATATAAACGACCAAAAGAATGAAGGCTGTTTTCTTGGTTTTGTCCTTGATC112                   
     MetLysAlaValPheLeuValLeuSerLeuIle                                         
     1510                                                                      
     GGATTCTGCTGGGCCCAACCAGTCACTGGCGATGAATCATCTGTTGAG160                       
     GlyPheCysTrpAlaGlnProValThrGlyAspGluSerSerValGlu                          
     152025                                                                    
     ATTCCGGAAGAGTCTCTGATCATCGCTGAAAACACCACTTTGGCTAAC208                       
     IleProGluGluSerLeuIleIleAlaGluAsnThrThrLeuAlaAsn                          
     303540                                                                    
     GTCGCCATGGCTAAGAGATTCGTTACTCAACACTTGTGCGGTTCTCAC256                       
     ValAlaMetAlaLysArgPheValThrGlnHisLeuCysGlySerHis                          
     455055                                                                    
     TTGGTTGAAGCTTTGTACTTGGTTTGTGGTGAAAGAGGTTTCTTCTAC304                       
     LeuValGluAlaLeuTyrLeuValCysGlyGluArgGlyPhePheTyr                          
     60657075                                                                  
     ACTCCAAAGTCTGACGACGCTAAGGGTATCGTTGAACAATGTTGTACT352                       
     ThrProLysSerAspAspAlaLysGlyIleValGluGlnCysCysThr                          
     808590                                                                    
     TCTATCTGTTCTTTGTACCAATTGGAAAACTACTGTGGTTAGACGCAGC401                      
     SerIleCysSerLeuTyrGlnLeuGluAsnTyrCysGly                                   
     95100                                                                     
     CCGCAGGCTCTAGA415                                                         
     (2) INFORMATION FOR SEQ ID NO:30:                                         
     (i) SEQUENCE CHARACTERISTICS:                                             
     (A) LENGTH: 104 amino acids                                               
     (B) TYPE: amino acid                                                      
     (D) TOPOLOGY: linear                                                      
     (ii) MOLECULE TYPE: protein                                               
     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:30:                                  
     MetLysAlaValPheLeuValLeuSerLeuIleGlyPheCysTrpAla                          
     151015                                                                    
     GlnProValThrGlyAspGluSerSerValGluIleProGluGluSer                          
     202530                                                                    
     LeuIleIleAlaGluAsnThrThrLeuAlaAsnValAlaMetAlaLys                          
     354045                                                                    
     ArgPheValThrGlnHisLeuCysGlySerHisLeuValGluAlaLeu                          
     505560                                                                    
     TyrLeuValCysGlyGluArgGlyPhePheTyrThrProLysSerAsp                          
     65707580                                                                  
     AspAlaLysGlyIleValGluGlnCysCysThrSerIleCysSerLeu                          
     859095                                                                    
     TyrGlnLeuGluAsnTyrCysGly                                                  
     100                                                                       
     (2) INFORMATION FOR SEQ ID NO:31:                                         
     (i) SEQUENCE CHARACTERISTICS:                                             
     (A) LENGTH: 415 base pairs                                                
     (B) TYPE: nucleic acid                                                    
     (C) STRANDEDNESS: single                                                  
     (D) TOPOLOGY: linear                                                      
     (ii) MOLECULE TYPE: DNA                                                   
     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:31:                                  
     TAGCTTAAGGTAAGTTCTTATCAAGTTTGTTCTTCTAATGTTTGATAGTTAAAGTATGTG60            
     TTATATTTGCTGGTTTTCTTACTTCCGACAAAAGAACCAAAACAGGAACTAGCCTAAGAC120           
     GACCCGGGTTGGTCAGTGACCGCTACTTAGTAGACAACTCTAAGGCCTTCTCAGAGACTA180           
     GTAGCGACTTTTGTGGTGAAACCGATTGCAGCGGTACCGATTCTCTAAGCAATGAGTTGT240           
     GAACACGCCAAGAGTGAACCAACTTCGAAACATGAACCAAACACCACTTTCTCCAAAGAA300           
     GATGTGAGGTTTCAGACTGCTGCGATTCCCATAGCAACTTGTTACAACATGAAGATAGAC360           
     AAGAAACATGGTTAACCTTTTGATGACACCAATCTGCGTCGGGCGTCCGAGATCT415                
     (2) INFORMATION FOR SEQ ID NO:32:                                         
     (i) SEQUENCE CHARACTERISTICS:                                             
     (A) LENGTH: 523 base pairs                                                
     (B) TYPE: nucleic acid                                                    
     (C) STRANDEDNESS: single                                                  
     (D) TOPOLOGY: linear                                                      
     (ii) MOLECULE TYPE: cDNA                                                  
     (ix) FEATURE:                                                             
     (A) NAME/KEY: CDS                                                         
     (B) LOCATION: 80..499                                                     
     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:32:                                  
     ATCGAATTCCATTCAAGAATAGTTCAAACAAGAAGATTACAAACTATCAATTTCATACAC60            
     AATATAAACGATTAAAAGAATGAGATTTCCTTCAATTTTTACTGCAGTTTTA112                   
     MetArgPheProSerIlePheThrAlaValLeu                                         
     1510                                                                      
     TTCGCAGCATCCTCCGCATTAGCTGCTCCAGTCAACACTACAACAGAA160                       
     PheAlaAlaSerSerAlaLeuAlaAlaProValAsnThrThrThrGlu                          
     152025                                                                    
     GATGAAACGGCACAAATTCCGGCTGAAGCTGTCATCGGTTACTCAGAT208                       
     AspGluThrAlaGlnIleProAlaGluAlaValIleGlyTyrSerAsp                          
     303540                                                                    
     TTAGAAGGGGATTTCGATGTTGCTGTTTTGCCATTTTCCAACAGCACA256                       
     LeuGluGlyAspPheAspValAlaValLeuProPheSerAsnSerThr                          
     455055                                                                    
     AATAACGGGTTATTGTTTATAAATACTACTATTGCCAGCATTGCTGCT304                       
     AsnAsnGlyLeuLeuPheIleAsnThrThrIleAlaSerIleAlaAla                          
     60657075                                                                  
     AAAGAAGAAGGGGTATCTTTGGATAAGAGATTCGTTAACCAACACTTG352                       
     LysGluGluGlyValSerLeuAspLysArgPheValAsnGlnHisLeu                          
     808590                                                                    
     TGCGGTTCTCACTTGGTTGAAGCTTTGTACTTGGTTTGTGGTGAAAGA400                       
     CysGlySerHisLeuValGluAlaLeuTyrLeuValCysGlyGluArg                          
     95100105                                                                  
     GGTTTCTTCTACACTCCAAAGTCTGACGACGCTAAGGGTATCGTTGAA448                       
     GlyPhePheTyrThrProLysSerAspAspAlaLysGlyIleValGlu                          
     110115120                                                                 
     CAATGTTGTACTTCTATCTGTTCTTTGTACCAATTGGAAAACTACTGT496                       
     GlnCysCysThrSerIleCysSerLeuTyrGlnLeuGluAsnTyrCys                          
     125130135                                                                 
     AACTAGACGCAGCCCGCAGGCTCTAGA523                                            
     Asn                                                                       
     140                                                                       
     (2) INFORMATION FOR SEQ ID NO:33:                                         
     (i) SEQUENCE CHARACTERISTICS:                                             
     (A) LENGTH: 140 amino acids                                               
     (B) TYPE: amino acid                                                      
     (D) TOPOLOGY: linear                                                      
     (ii) MOLECULE TYPE: protein                                               
     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:33:                                  
     MetArgPheProSerIlePheThrAlaValLeuPheAlaAlaSerSer                          
     151015                                                                    
     AlaLeuAlaAlaProValAsnThrThrThrGluAspGluThrAlaGln                          
     202530                                                                    
     IleProAlaGluAlaValIleGlyTyrSerAspLeuGluGlyAspPhe                          
     354045                                                                    
     AspValAlaValLeuProPheSerAsnSerThrAsnAsnGlyLeuLeu                          
     505560                                                                    
     PheIleAsnThrThrIleAlaSerIleAlaAlaLysGluGluGlyVal                          
     65707580                                                                  
     SerLeuAspLysArgPheValAsnGlnHisLeuCysGlySerHisLeu                          
     859095                                                                    
     ValGluAlaLeuTyrLeuValCysGlyGluArgGlyPhePheTyrThr                          
     100105110                                                                 
     ProLysSerAspAspAlaLysGlyIleValGluGlnCysCysThrSer                          
     115120125                                                                 
     IleCysSerLeuTyrGlnLeuGluAsnTyrCysAsn                                      
     130135140                                                                 
     (2) INFORMATION FOR SEQ ID NO:34:                                         
     (i) SEQUENCE CHARACTERISTICS:                                             
     (A) LENGTH: 523 base pairs                                                
     (B) TYPE: nucleic acid                                                    
     (C) STRANDEDNESS: single                                                  
     (D) TOPOLOGY: linear                                                      
     (ii) MOLECULE TYPE: DNA                                                   
     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:34:                                  
     TAGCTTAAGGTAAGTTCTTATCAAGTTTGTTCTTCTAATGTTTGATAGTTAAAGTATGTG60            
     TTATATTTGCTAATTTTCTTACTCTAAAGGAAGTTAAAAATGACGTCAAAATAAGCGTCG120           
     TAGGAGGCGTAATCGACGAGGTCAGTTGTGATGTTGTCTTCTACTTTGCCGTGTTTAAGG180           
     CCGACTTCGACAGTAGCCAATGAGTCTAAATCTTCCCCTAAAGCTACAACGACAAAACGG240           
     TAAAAGGTTGTCGTGTTTATTGCCCAATAACAAATATTTATGATGATAACGGTCGTAACG300           
     ACGATTTCTTCTTCCCCATAGAAACCTATTCTCTAAGCAATTGGTTGTGAACACGCCAAG360           
     AGTGAACCAACTTCGAAACATGAACCAAACACCACTTTCTCCAAAGAAGATGTGAGGTTT420           
     CAGACTGCTGCGATTCCCATAGCAACTTGTTACAACATGAAGATAGACAAGAAACATGGT480           
     TAACCTTTTGATGACATTGATCTGCGTCGGGCGTCCGAGATCT523                            
     (2) INFORMATION FOR SEQ ID NO:35:                                         
     (i) SEQUENCE CHARACTERISTICS:                                             
     (A) LENGTH: 409 base pairs                                                
     (B) TYPE: nucleic acid                                                    
     (C) STRANDEDNESS: single                                                  
     (D) TOPOLOGY: linear                                                      
     (ii) MOLECULE TYPE: cDNA                                                  
     (ix) FEATURE:                                                             
     (A) NAME/KEY: CDS                                                         
     (B) LOCATION: 80..385                                                     
     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:35:                                  
     ATCGAATTCCATTCAAGAATAGTTCAAACAAGAAGATTACAAACTATCAATTTCATACAC60            
     AATATAAACGACCAAAAGAATGAAGGCTGTTTTCTTGGTTTTGTCCTTGATC112                   
     MetLysAlaValPheLeuValLeuSerLeuIle                                         
     1510                                                                      
     GGATTCTGCTGGGCCCAACCAGTCACTGGCGATGAATCATCTGTTGAG160                       
     GlyPheCysTrpAlaGlnProValThrGlyAspGluSerSerValGlu                          
     152025                                                                    
     ATTCCGGAAGAGTCTCTGATCATCGCTGAAAACACCACTTTGGCTAAC208                       
     IleProGluGluSerLeuIleIleAlaGluAsnThrThrLeuAlaAsn                          
     303540                                                                    
     GTCGCCATGGCTAAGAGATTCGTTAACCAACACTTGTGCGGTTCTCAC256                       
     ValAlaMetAlaLysArgPheValAsnGlnHisLeuCysGlySerHis                          
     455055                                                                    
     TTGGTTGAAGCTTTGTACTTGGTTTGTGGTGAAAGAGGTTTCTTCTAC304                       
     LeuValGluAlaLeuTyrLeuValCysGlyGluArgGlyPhePheTyr                          
     60657075                                                                  
     ACTCCTAAGGAAAAGAGAGGTATCGTTGAACAATGTTGTACTTCTATC352                       
     ThrProLysGluLysArgGlyIleValGluGlnCysCysThrSerIle                          
     808590                                                                    
     TGTTCTTTGTACCAATTGGAAAACTACTGTGGTTAGACGCAGCCCGCAGGCTC405                  
     CysSerLeuTyrGlnLeuGluAsnTyrCysGly                                         
     95100                                                                     
     TAGA409                                                                   
     (2) INFORMATION FOR SEQ ID NO:36:                                         
     (i) SEQUENCE CHARACTERISTICS:                                             
     (A) LENGTH: 102 amino acids                                               
     (B) TYPE: amino acid                                                      
     (D) TOPOLOGY: linear                                                      
     (ii) MOLECULE TYPE: protein                                               
     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:36:                                  
     MetLysAlaValPheLeuValLeuSerLeuIleGlyPheCysTrpAla                          
     151015                                                                    
     GlnProValThrGlyAspGluSerSerValGluIleProGluGluSer                          
     202530                                                                    
     LeuIleIleAlaGluAsnThrThrLeuAlaAsnValAlaMetAlaLys                          
     354045                                                                    
     ArgPheValAsnGlnHisLeuCysGlySerHisLeuValGluAlaLeu                          
     505560                                                                    
     TyrLeuValCysGlyGluArgGlyPhePheTyrThrProLysGluLys                          
     65707580                                                                  
     ArgGlyIleValGluGlnCysCysThrSerIleCysSerLeuTyrGln                          
     859095                                                                    
     LeuGluAsnTyrCysGly                                                        
     100                                                                       
     (2) INFORMATION FOR SEQ ID NO:37:                                         
     (i) SEQUENCE CHARACTERISTICS:                                             
     (A) LENGTH: 409 base pairs                                                
     (B) TYPE: nucleic acid                                                    
     (C) STRANDEDNESS: single                                                  
     (D) TOPOLOGY: linear                                                      
     (ii) MOLECULE TYPE: DNA                                                   
     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:37:                                  
     TAGCTTAAGGTAAGTTCTTATCAAGTTTGTTCTTCTAATGTTTGATAGTTAAAGTATGTG60            
     TTATATTTGCTGGTTTTCTTACTTCCGACAAAAGAACCAAAACAGGAACTAGCCTAAGAC120           
     GACCCGGGTTGGTCAGTGACCGCTACTTAGTAGACAACTCTAAGGCCTTCTCAGAGACTA180           
     GTAGCGACTTTTGTGGTGAAACCGATTGCAGCGGTACCGATTCTCTAAGCAATTGGTTGT240           
     GAACACGCCAAGAGTGAACCAACTTCGAAACATGAACCAAACACCACTTTCTCCAAAGAA300           
     GATGTGAGGATTCCTTTTCTCTCCATAGCAACTTGTTACAACATGAAGATAGACAAGAAA360           
     CATGGTTAACCTTTTGATGACACCAATCTGCGTCGGGCGTCCGAGATCT409                      
     (2) INFORMATION FOR SEQ ID NO:38:                                         
     (i) SEQUENCE CHARACTERISTICS:                                             
     (A) LENGTH: 511 base pairs                                                
     (B) TYPE: nucleic acid                                                    
     (C) STRANDEDNESS: single                                                  
     (D) TOPOLOGY: linear                                                      
     (ii) MOLECULE TYPE: cDNA                                                  
     (ix) FEATURE:                                                             
     (A) NAME/KEY: CDS                                                         
     (B) LOCATION: 77..487                                                     
     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:38:                                  
     GAATTCCATTCAAGAATAGTTCAAACAAGAAGATTACAAACTATCAATTTCATACACAAT60            
     ATAAACGATTAAAAGAATGAGATTTCCTTCAATTTTTACTGCAGTTTTA109                      
     MetArgPheProSerIlePheThrAlaValLeu                                         
     1510                                                                      
     TTCGCAGCATCCTCCGCATTAGCTGCTCCAGTCAACACTACAACAGAA157                       
     PheAlaAlaSerSerAlaLeuAlaAlaProValAsnThrThrThrGlu                          
     152025                                                                    
     GATGAAACGGCACAAATTCCGGCTGAAGCTGTCATCGGTTACTCAGAT205                       
     AspGluThrAlaGlnIleProAlaGluAlaValIleGlyTyrSerAsp                          
     303540                                                                    
     TTAGAAGGGGATTTCGATGTTGCTGTTTTGCCATTTTCCAACAGCACA253                       
     LeuGluGlyAspPheAspValAlaValLeuProPheSerAsnSerThr                          
     455055                                                                    
     AATAACGGGTTATTGTTTATAAATACTACTATTGCCAGCATTGCTGCT301                       
     AsnAsnGlyLeuLeuPheIleAsnThrThrIleAlaSerIleAlaAla                          
     60657075                                                                  
     AAAGAAGAAGGGGTATCCATGGCTAAGAGATTCGTTAACCAACACTTG349                       
     LysGluGluGlyValSerMetAlaLysArgPheValAsnGlnHisLeu                          
     808590                                                                    
     TGCGGTTCCCACTTGGTTGAAGCTTTGTACTTGGTTTGTGGTGAAAGA397                       
     CysGlySerHisLeuValGluAlaLeuTyrLeuValCysGlyGluArg                          
     95100105                                                                  
     GGTTTCTTCTACACTCCAAAGACTAGAGGTATCGTTGAACAATGTTGT445                       
     GlyPhePheTyrThrProLysThrArgGlyIleValGluGlnCysCys                          
     110115120                                                                 
     ACTTCTATCTGTTCTTTGTACCAATTGGAAAACTACTGCAAC487                             
     ThrSerIleCysSerLeuTyrGlnLeuGluAsnTyrCysAsn                                
     125130135                                                                 
     TAGACGCAGCCCGCAGGCTCTAGA511                                               
     (2) INFORMATION FOR SEQ ID NO:39:                                         
     (i) SEQUENCE CHARACTERISTICS:                                             
     (A) LENGTH: 137 amino acids                                               
     (B) TYPE: amino acid                                                      
     (D) TOPOLOGY: linear                                                      
     (ii) MOLECULE TYPE: protein                                               
     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:39:                                  
     MetArgPheProSerIlePheThrAlaValLeuPheAlaAlaSerSer                          
     151015                                                                    
     AlaLeuAlaAlaProValAsnThrThrThrGluAspGluThrAlaGln                          
     202530                                                                    
     IleProAlaGluAlaValIleGlyTyrSerAspLeuGluGlyAspPhe                          
     354045                                                                    
     AspValAlaValLeuProPheSerAsnSerThrAsnAsnGlyLeuLeu                          
     505560                                                                    
     PheIleAsnThrThrIleAlaSerIleAlaAlaLysGluGluGlyVal                          
     65707580                                                                  
     SerMetAlaLysArgPheValAsnGlnHisLeuCysGlySerHisLeu                          
     859095                                                                    
     ValGluAlaLeuTyrLeuValCysGlyGluArgGlyPhePheTyrThr                          
     100105110                                                                 
     ProLysThrArgGlyIleValGluGlnCysCysThrSerIleCysSer                          
     115120125                                                                 
     LeuTyrGlnLeuGluAsnTyrCysAsn                                               
     130135                                                                    
     (2) INFORMATION FOR SEQ ID NO:40:                                         
     (i) SEQUENCE CHARACTERISTICS:                                             
     (A) LENGTH: 511 base pairs                                                
     (B) TYPE: nucleic acid                                                    
     (C) STRANDEDNESS: single                                                  
     (D) TOPOLOGY: linear                                                      
     (ii) MOLECULE TYPE: DNA                                                   
     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:40:                                  
     CTTAAGGTAAGTTCTTATCAAGTTTGTTCTTCTAATGTTTGATAGTTAAAGTATGTGTTA60            
     TATTTGCTAATTTTCTTACTCTAAAGGAAGTTAAAAATGACGTCAAAATAAGCGTCGTAG120           
     GAGGCGTAATCGACGAGGTCAGTTGTGATGTTGTCTTCTACTTTGCCGTGTTTAAGGCCG180           
     ACTTCGACAGTAGCCAATGAGTCTAAATCTTCCCCTAAAGCTACAACGACAAAACGGTAA240           
     AAGGTTGTCGTGTTTATTGCCCAATAACAAATATTTATGATGATAACGGTCGTAACGACG300           
     ATTTCTTCTTCCCCATAGGTACCGATTCTCTAAGCAATTGGTTGTGAACACGCCAAGGGT360           
     GAACCAACTTCGAAACATGAACCAAACACCACTTTCTCCAAAGAAGATGTGAGGTTTCTG420           
     ATCTCCATAGCAACTTGTTACAACATGAAGATAGACAAGAAACATGGTTAACCTTTTGAT480           
     GACGTTGATCTGCGTCGGGCGTCCGAGATCT511                                        
     (2) INFORMATION FOR SEQ ID NO:41:                                         
     (i) SEQUENCE CHARACTERISTICS:                                             
     (A) LENGTH: 523 base pairs                                                
     (B) TYPE: nucleic acid                                                    
     (C) STRANDEDNESS: single                                                  
     (D) TOPOLOGY: linear                                                      
     (ii) MOLECULE TYPE: cDNA                                                  
     (ix) FEATURE:                                                             
     (A) NAME/KEY: CDS                                                         
     (B) LOCATION: 80..499                                                     
     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:41:                                  
     ATCGAATTCCATTCAAGAATAGTTCAAACAAGAAGATTACAAACTATCAATTTCATACAC60            
     AATATAAACGATTAAAAGAATGAGATTTCCTTCAATTTTTACTGCAGTTTTA112                   
     MetArgPheProSerIlePheThrAlaValLeu                                         
     1510                                                                      
     TTCGCAGCATCCTCCGCATTAGCTGCTCCAGTCAACACTACAACAGAA160                       
     PheAlaAlaSerSerAlaLeuAlaAlaProValAsnThrThrThrGlu                          
     152025                                                                    
     GATGAAACGGCACAAATTCCGGCTGAAGCTGTCATCGGTTACTCAGAT208                       
     AspGluThrAlaGlnIleProAlaGluAlaValIleGlyTyrSerAsp                          
     303540                                                                    
     TTAGAAGGGGATTTCGATGTTGCTGTTTTGCCATTTTCCAACAGCACA256                       
     LeuGluGlyAspPheAspValAlaValLeuProPheSerAsnSerThr                          
     455055                                                                    
     AATAACGGGTTATTGTTTATAAATACTACTATTGCCAGCATTGCTGCT304                       
     AsnAsnGlyLeuLeuPheIleAsnThrThrIleAlaSerIleAlaAla                          
     60657075                                                                  
     AAAGAAGAAGGGGTATCCATGGCTAAGAGATTCGTTAACCAACACTTG352                       
     LysGluGluGlyValSerMetAlaLysArgPheValAsnGlnHisLeu                          
     808590                                                                    
     TGCGGTTCCCACTTGGTTGAAGCTTTGTACTTGGTTTGCGGTGAAAGA400                       
     CysGlySerHisLeuValGluAlaLeuTyrLeuValCysGlyGluArg                          
     95100105                                                                  
     GGTTTCTTCTACACTCCTAAGTCTGACGATGCTAAGGGTATTGTCGAG448                       
     GlyPhePheTyrThrProLysSerAspAspAlaLysGlyIleValGlu                          
     110115120                                                                 
     CAATGCTGTACCTCCATCTGCTCCTTGTACCAATTGGAAAACTACTGC496                       
     GlnCysCysThrSerIleCysSerLeuTyrGlnLeuGluAsnTyrCys                          
     125130135                                                                 
     AACTAGACGCAGCCCGCAGGCTCTAGA523                                            
     Asn                                                                       
     140                                                                       
     (2) INFORMATION FOR SEQ ID NO:42:                                         
     (i) SEQUENCE CHARACTERISTICS:                                             
     (A) LENGTH: 140 amino acids                                               
     (B) TYPE: amino acid                                                      
     (D) TOPOLOGY: linear                                                      
     (ii) MOLECULE TYPE: protein                                               
     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:42:                                  
     MetArgPheProSerIlePheThrAlaValLeuPheAlaAlaSerSer                          
     151015                                                                    
     AlaLeuAlaAlaProValAsnThrThrThrGluAspGluThrAlaGln                          
     202530                                                                    
     IleProAlaGluAlaValIleGlyTyrSerAspLeuGluGlyAspPhe                          
     354045                                                                    
     AspValAlaValLeuProPheSerAsnSerThrAsnAsnGlyLeuLeu                          
     505560                                                                    
     PheIleAsnThrThrIleAlaSerIleAlaAlaLysGluGluGlyVal                          
     65707580                                                                  
     SerMetAlaLysArgPheValAsnGlnHisLeuCysGlySerHisLeu                          
     859095                                                                    
     ValGluAlaLeuTyrLeuValCysGlyGluArgGlyPhePheTyrThr                          
     100105110                                                                 
     ProLysSerAspAspAlaLysGlyIleValGluGlnCysCysThrSer                          
     115120125                                                                 
     IleCysSerLeuTyrGlnLeuGluAsnTyrCysAsn                                      
     130135140                                                                 
     (2) INFORMATION FOR SEQ ID NO:43:                                         
     (i) SEQUENCE CHARACTERISTICS:                                             
     (A) LENGTH: 523 base pairs                                                
     (B) TYPE: nucleic acid                                                    
     (C) STRANDEDNESS: single                                                  
     (D) TOPOLOGY: linear                                                      
     (ii) MOLECULE TYPE: DNA                                                   
     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:43:                                  
     TAGCTTAAGGTAAGTTCTTATCAAGTTTGTTCTTCTAATGTTTGATAGTTAAAGTATGTG60            
     TTATATTTGCTAATTTTCTTACTCTAAAGGAAGTTAAAAATGACGTCAAAATAAGCGTCG120           
     TAGGAGGCGTAATCGACGAGGTCAGTTGTGATGTTGTCTTCTACTTTGCCGTGTTTAAGG180           
     CCGACTTCGACAGTAGCCAATGAGTCTAAATCTTCCCCTAAAGCTACAACGACAAAACGG240           
     TAAAAGGTTGTCGTGTTTATTGCCCAATAACAAATATTTATGATGATAACGGTCGTAACG300           
     ACGATTTCTTCTTCCCCATAGGTACCGATTCTCTAAGCAATTGGTTGTGAACACGCCAAG360           
     GGTGAACCAACTTCGAAACATGAACCAAACGCCACTTTCTCCAAAGAAGATGTGAGGATT420           
     CAGACTGCTACGATTCCCATAACAGCTCGTTACGACATGGAGGTAGACGAGGAACATGGT480           
     TAACCTTTTGATGACGTTGATCTGCGTCGGGCGTCCGAGATCT523                            
     (2) INFORMATION FOR SEQ ID NO:44:                                         
     (i) SEQUENCE CHARACTERISTICS:                                             
     (A) LENGTH: 535 base pairs                                                
     (B) TYPE: nucleic acid                                                    
     (C) STRANDEDNESS: single                                                  
     (D) TOPOLOGY: linear                                                      
     (ii) MOLECULE TYPE: cDNA                                                  
     (ix) FEATURE:                                                             
     (A) NAME/KEY: CDS                                                         
     (B) LOCATION: 77..511                                                     
     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:44:                                  
     GAATTCCATTCAAGAATAGTTCAAACAAGAAGATTACAAACTATCAATTTCATACACAAT60            
     ATAAACGATTAAAAGAATGAGATTTCCTTCAATTTTTACTGCAGTTTTA109                      
     MetArgPheProSerIlePheThrAlaValLeu                                         
     1510                                                                      
     TTCGCAGCATCCTCCGCATTAGCTGCTCCAGTCAACACTACAACAGAA157                       
     PheAlaAlaSerSerAlaLeuAlaAlaProValAsnThrThrThrGlu                          
     152025                                                                    
     GATGAAACGGCACAAATTCCGGCTGAAGCTGTCATCGGTTACTCAGAT205                       
     AspGluThrAlaGlnIleProAlaGluAlaValIleGlyTyrSerAsp                          
     303540                                                                    
     TTAGAAGGGGATTTCGATGTTGCTGTTTTGCCATTTTCCAACAGCACA253                       
     LeuGluGlyAspPheAspValAlaValLeuProPheSerAsnSerThr                          
     455055                                                                    
     AATAACGGGTTATTGTTTATAAATACTACTATTGCCAGCATTGCTGCT301                       
     AsnAsnGlyLeuLeuPheIleAsnThrThrIleAlaSerIleAlaAla                          
     60657075                                                                  
     AAAGAAGAAGGGGTATCCATGGCTAAGAGAGAAGAAGCTGAAGCTGAA349                       
     LysGluGluGlyValSerMetAlaLysArgGluGluAlaGluAlaGlu                          
     808590                                                                    
     GCTAGATTCGTTAACCAACACTTGTGCGGTTCCCACTTGGTTGAAGCT397                       
     AlaArgPheValAsnGlnHisLeuCysGlySerHisLeuValGluAla                          
     95100105                                                                  
     TTGTACTTGGTTTGTGGTGAAAGAGGTTTCTTCTACACTCCAAAGACT445                       
     LeuTyrLeuValCysGlyGluArgGlyPhePheTyrThrProLysThr                          
     110115120                                                                 
     AGAGGTATCGTTGAACAATGTTGTACTTCTATCTGTTCTTTGTACCAA493                       
     ArgGlyIleValGluGlnCysCysThrSerIleCysSerLeuTyrGln                          
     125130135                                                                 
     TTGGAAAACTACTGCAACTAGACGCAGCCCGCAGGCTCTAGA535                             
     LeuGluAsnTyrCysAsn                                                        
     140145                                                                    
     (2) INFORMATION FOR SEQ ID NO:45:                                         
     (i) SEQUENCE CHARACTERISTICS:                                             
     (A) LENGTH: 145 amino acids                                               
     (B) TYPE: amino acid                                                      
     (D) TOPOLOGY: linear                                                      
     (ii) MOLECULE TYPE: protein                                               
     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:45:                                  
     MetArgPheProSerIlePheThrAlaValLeuPheAlaAlaSerSer                          
     151015                                                                    
     AlaLeuAlaAlaProValAsnThrThrThrGluAspGluThrAlaGln                          
     202530                                                                    
     IleProAlaGluAlaValIleGlyTyrSerAspLeuGluGlyAspPhe                          
     354045                                                                    
     AspValAlaValLeuProPheSerAsnSerThrAsnAsnGlyLeuLeu                          
     505560                                                                    
     PheIleAsnThrThrIleAlaSerIleAlaAlaLysGluGluGlyVal                          
     65707580                                                                  
     SerMetAlaLysArgGluGluAlaGluAlaGluAlaArgPheValAsn                          
     859095                                                                    
     GlnHisLeuCysGlySerHisLeuValGluAlaLeuTyrLeuValCys                          
     100105110                                                                 
     GlyGluArgGlyPhePheTyrThrProLysThrArgGlyIleValGlu                          
     115120125                                                                 
     GlnCysCysThrSerIleCysSerLeuTyrGlnLeuGluAsnTyrCys                          
     130135140                                                                 
     Asn                                                                       
     145                                                                       
     (2) INFORMATION FOR SEQ ID NO:46:                                         
     (i) SEQUENCE CHARACTERISTICS:                                             
     (A) LENGTH: 535 base pairs                                                
     (B) TYPE: nucleic acid                                                    
     (C) STRANDEDNESS: single                                                  
     (D) TOPOLOGY: linear                                                      
     (ii) MOLECULE TYPE: DNA                                                   
     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:46:                                  
     CTTAAGGTAAGTTCTTATCAAGTTTGTTCTTCTAATGTTTGATAGTTAAAGTATGTGTTA60            
     TATTTGCTAATTTTCTTACTCTAAAGGAAGTTAAAAATGACGTCAAAATAAGCGTCGTAG120           
     GAGGCGTAATCGACGAGGTCAGTTGTGATGTTGTCTTCTACTTTGCCGTGTTTAAGGCCG180           
     ACTTCGACAGTAGCCAATGAGTCTAAATCTTCCCCTAAAGCTACAACGACAAAACGGTAA240           
     AAGGTTGTCGTGTTTATTGCCCAATAACAAATATTTATGATGATAACGGTCGTAACGACG300           
     ATTTCTTCTTCCCCATAGGTACCGATTCTCTCTTCTTCGACTTCGACTTCGATCTAAGCA360           
     ATTGGTTGTGAACACGCCAAGGGTGAACCAACTTCGAAACATGAACCAAACACCACTTTC420           
     TCCAAAGAAGATGTGAGGTTTCTGATCTCCATAGCAACTTGTTACAACATGAAGATAGAC480           
     AAGAAACATGGTTAACCTTTTGATGACGTTGATCTGCGTCGGGCGTCCGAGATCT535                
     (2) INFORMATION FOR SEQ ID NO:47:                                         
     (i) SEQUENCE CHARACTERISTICS:                                             
     (A) LENGTH: 538 base pairs                                                
     (B) TYPE: nucleic acid                                                    
     (C) STRANDEDNESS: single                                                  
     (D) TOPOLOGY: linear                                                      
     (ii) MOLECULE TYPE: cDNA                                                  
     (ix) FEATURE:                                                             
     (A) NAME/KEY: CDS                                                         
     (B) LOCATION: 77..514                                                     
     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:47:                                  
     GAATTCCATTCAAGAATAGTTCAAACAAGAAGATTACAAACTATCAATTTCATACACAAT60            
     ATAAACGATTAAAAGAATGAGATTTCCTTCAATTTTTACTGCAGTTTTA109                      
     MetArgPheProSerIlePheThrAlaValLeu                                         
     1510                                                                      
     TTCGCAGCATCCTCCGCATTAGCTGCTCCAGTCAACACTACAACAGAA157                       
     PheAlaAlaSerSerAlaLeuAlaAlaProValAsnThrThrThrGlu                          
     152025                                                                    
     GATGAAACGGCACAAATTCCGGCTGAAGCTGTCATCGGTTACTCAGAT205                       
     AspGluThrAlaGlnIleProAlaGluAlaValIleGlyTyrSerAsp                          
     303540                                                                    
     TTAGAAGGGGATTTCGATGTTGCTGTTTTGCCATTTTCCAACAGCACA253                       
     LeuGluGlyAspPheAspValAlaValLeuProPheSerAsnSerThr                          
     455055                                                                    
     AATAACGGGTTATTGTTTATAAATACTACTATTGCCAGCATTGCTGCT301                       
     AsnAsnGlyLeuLeuPheIleAsnThrThrIleAlaSerIleAlaAla                          
     60657075                                                                  
     AAAGAAGAAGGGGTATCCATGGCTAAGAGAGAAGAAGCTGAAGCTGAA349                       
     LysGluGluGlyValSerMetAlaLysArgGluGluAlaGluAlaGlu                          
     808590                                                                    
     GCTGAAAGATTCGTTAACCAACACTTGTGCGGTTCCCACTTGGTTGAA397                       
     AlaGluArgPheValAsnGlnHisLeuCysGlySerHisLeuValGlu                          
     95100105                                                                  
     GCTTTGTACTTGGTTTGTGGTGAAAGAGGTTTCTTCTACACTCCAAAG445                       
     AlaLeuTyrLeuValCysGlyGluArgGlyPhePheTyrThrProLys                          
     110115120                                                                 
     ACTAGAGGTATCGTTGAACAATGTTGTACTTCTATCTGTTCTTTGTAC493                       
     ThrArgGlyIleValGluGlnCysCysThrSerIleCysSerLeuTyr                          
     125130135                                                                 
     CAATTGGAAAACTACTGCAACTAGACGCAGCCCGCAGGCTCTAGA538                          
     GlnLeuGluAsnTyrCysAsn                                                     
     140145                                                                    
     (2) INFORMATION FOR SEQ ID NO:48:                                         
     (i) SEQUENCE CHARACTERISTICS:                                             
     (A) LENGTH: 146 amino acids                                               
     (B) TYPE: amino acid                                                      
     (D) TOPOLOGY: linear                                                      
     (ii) MOLECULE TYPE: protein                                               
     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:48:                                  
     MetArgPheProSerIlePheThrAlaValLeuPheAlaAlaSerSer                          
     151015                                                                    
     AlaLeuAlaAlaProValAsnThrThrThrGluAspGluThrAlaGln                          
     202530                                                                    
     IleProAlaGluAlaValIleGlyTyrSerAspLeuGluGlyAspPhe                          
     354045                                                                    
     AspValAlaValLeuProPheSerAsnSerThrAsnAsnGlyLeuLeu                          
     505560                                                                    
     PheIleAsnThrThrIleAlaSerIleAlaAlaLysGluGluGlyVal                          
     65707580                                                                  
     SerMetAlaLysArgGluGluAlaGluAlaGluAlaGluArgPheVal                          
     859095                                                                    
     AsnGlnHisLeuCysGlySerHisLeuValGluAlaLeuTyrLeuVal                          
     100105110                                                                 
     CysGlyGluArgGlyPhePheTyrThrProLysThrArgGlyIleVal                          
     115120125                                                                 
     GluGlnCysCysThrSerIleCysSerLeuTyrGlnLeuGluAsnTyr                          
     130135140                                                                 
     CysAsn                                                                    
     145                                                                       
     (2) INFORMATION FOR SEQ ID NO:49:                                         
     (i) SEQUENCE CHARACTERISTICS:                                             
     (A) LENGTH: 538 base pairs                                                
     (B) TYPE: nucleic acid                                                    
     (C) STRANDEDNESS: single                                                  
     (D) TOPOLOGY: linear                                                      
     (ii) MOLECULE TYPE: DNA                                                   
     (xi) SEQUENCE DESCRIPTION: SEQ ID NO:49:                                  
     CTTAAGGTAAGTTCTTATCAAGTTTGTTCTTCTAATGTTTGATAGTTAAAGTATGTGTTA60            
     TATTTGCTAATTTTCTTACTCTAAAGGAAGTTAAAAATGACGTCAAAATAAGCGTCGTAG120           
     GAGGCGTAATCGACGAGGTCAGTTGTGATGTTGTCTTCTACTTTGCCGTGTTTAAGGCCG180           
     ACTTCGACAGTAGCCAATGAGTCTAAATCTTCCCCTAAAGCTACAACGACAAAACGGTAA240           
     AAGGTTGTCGTGTTTATTGCCCAATAACAAATATTTATGATGATAACGGTCGTAACGACG300           
     ATTTCTTCTTCCCCATAGGTACCGATTCTCTCTTCTTCGACTTCGACTTCGACTTTCTAA360           
     GCAATTGGTTGTGAACACGCCAAGGGTGAACCAACTTCGAAACATGAACCAAACACCACT420           
     TTCTCCAAAGAAGATGTGAGGTTTCTGATCTCCATAGCAACTTGTTACAACATGAAGATA480           
     GACAAGAAACATGGTTAACCTTTTGATGACGTTGATCTGCGTCGGGCGTCCGAGATCT538             
     __________________________________________________________________________

Claims

1. An insulin derivative having the following sequence: ##STR8## wherein (a) Xaa at positions A21 and B3 are, independently, any amino acid residue which can be coded for by the genetic code except Lys, Arg and Cys;

(b) Xaa at position B1 is Phe or is deleted;
(c) Xaa at position B30 is any amino acid residue which can be coded for by the genetic code except Lys, Arg and Cys; and
(d) the.epsilon.-amino group of Lys.sup.B29 is substituted with an acyl group having at least 10 carbon atoms;

2. The insulin derivative according to claim 1, wherein Xaa at position A21 is Asn.

3. The insulin derivative according to claim 2, wherein the acyl group has from 12 to 24 carbon atoms.

4. The insulin derivative according to claim 1, wherein Xaa at position A21 is Ala, Asn, Gln, Gly or Ser.

5. The insulin derivative according to claim 4, wherein the acyl group has from 12 to 24 carbon atoms.

6. The insulin derivative according to claim 1, wherein Xaa at position B1 is deleted.

7. The insulin derivative according to claim 6, wherein the acyl group has from 12 to 24 carbon atoms.

8. The insulin derivative according to claim 1, wherein Xaa at position B1 is Phe.

9. The insulin derivative according to claim 8, wherein the acyl group has from 12 to 24 carbon atoms.

10. The insulin derivative according to claim 1, wherein Xaa at position B3 is Asn, Asp, Gln or Thr.

11. The insulin derivative according to claim 10, wherein the acyl group has from 12 to 24 carbon atoms.

12. The insulin derivative according to claim 1, wherein Xaa at position B30 is Ala or Thr.

13. The insulin derivative according to claim 12, wherein the acyl group has from 12 to 24 carbon atoms.

14. The insulin derivative according to claim 1, wherein Xaa at position A21 is Ala, Asn, Gln, Gly or Ser, Xaa at position B3 is Asn, Asp, Gln or Thr, and Xaa at position B30 is Ala or Thr.

15. The insulin derivative according to claim 14, wherein the acyl group has from 12 to 24 carbon atoms.

16. The insulin derivative according to claim 1, wherein Xaa at position A21 is Asn, Xaa at position B3 is Asn, Xaa at position B1 is Phe and Xaa at position B30 is Thr.

17. The insulin derivative according to claim 16, wherein the acyl has from 12 to 24 carbon atoms.

18. The insulin derivative according to claim 1, wherein the acyl group has from 12 to 24 carbon atoms.

19. The insulin derivative according to claim 18, wherein the acyl group is a linear, saturated acyl group.

20. The insulin derivative according to claim 19, wherein the acyl group is tetradecanoyl or hexadecanoyl.

21. The insulin derivative according to claim 1 which is N.sup..epsilon.B29 -decanoyl human insulin.

22. The insulin derivative according to claim 1 which is N.sup..epsilon.B29 -dodecanoyl human insulin.

23. The insulin derivative according to claim 1 which is N.sup..epsilon.B29 -tetradecanoyl human insulin.

24. The insulin derivative according to claim 1 which is N.sup..epsilon.B29 -lithocholoyl human insulin.

25. The insulin derivative according to claim 1 which is in the form of a hexamer.

26. The insulin derivative according to claim 25, wherein the acyl group has from 12 to 24 carbon atoms.

27. The insulin derivative according to claim 25, wherein Xaa at position A21 is Asn, Xaa at position B1 is Phe, Xaa at position B3 is Asn, and Xaa at position B30 is Thr.

28. The insulin derivative according to claim 25, wherein two zinc ions bind to the hexamer.

29. The insulin derivative according to claim 28, wherein the acyl group has from 12 to 24 carbon atoms.

30. The insulin derivative according to claim 25, wherein three zinc ions bind to the hexamer.

31. The insulin derivative according to claim 30, wherein the acyl group has from 12 to 24 carbon atoms.

32. The insulin derivative according to claim 25, wherein four zinc ions bind to the hexamer.

33. The insulin derivative according to claim 32, wherein the acyl group has from 12 to 24 carbon atoms.

34. A pharmaceutical composition which is an aqueous solution, comprising (a) an insulin derivative according to claim 1, (b) an isotonic agent, (c) a preservative and (d) a buffer.

35. The pharmaceutical composition according to claim 34, wherein the pH of the aqueous solution is in the range of 6.5-8.5.

36. The pharmaceutical composition according to claim 34, wherein the solubility of the insulin derivative exceeds 600 nmol/ml of the aqueous solution.

37. The pharmaceutical composition according to claim 34, further comprising an insulin or an insulin analogue which has a rapid onset of action.

38. The pharmaceutical composition according to claim 34, wherein Xaa at position A21 is Asn, Xaa at position B3 is Asn, Xaa at position Bi is Phe and Xaa at position B30 is Thr.

39. The pharmaceutical composition according to claim 34, wherein the acyl group has from 12 to 24 carbon atoms.

40. The pharmaceutical composition according to claim 39, wherein the acyl group is tetradecanoyl or hexadecanoyl.

41. The pharmaceutical composition according to claim 34, wherein the insulin derivative is N.sup..epsilon.B29 -decanoyl human insulin.

42. The pharmaceutical composition according to claim 34, wherein the insulin derivative is N.sup..epsilon.B29 -dodecanoyl human insulin.

43. The pharmaceutical composition according to claim 34, wherein the insulin derivative is N.sup..epsilon.B29 -tetradecanoyl human insulin.

44. The pharmaceutical composition according to claim 34, wherein the insulin derivative is N.sup..epsilon.B29 -lithocholoyl human insulin.

45. The pharmaceutical composition according to claim 34, wherein the insulin derivative is in the form of a hexamer.

46. A method of treating diabetes in a patient in need of such a treatment, comprising administering to the patient a therapeutically effective amount of a pharmaceutical composition according to claim 34.

47. An insulin derivative having the following sequence: ##STR9## wherein (a) Xaa at positions A21 and B3 are, independently, any amino acid residue which can be coded for by the genetic code except Lys, Arg and Cys;

(b) Xaa at position B1 is Phe or is deleted;
(c) Xaa at position B30 is deleted; and
(d) the.epsilon.-amino group of Lys.sup.B29 is substituted with an acyl group having at least 10 carbon atoms;

48. The insulin derivative according to claim 47, wherein Xaa at position A21 is Ala, Asn, Gln, Gly or Ser.

49. The insulin derivative according to claim 48, wherein the acyl group has from 12 to 24 carbon atoms.

50. The insulin derivative according to claim 47, wherein Xaa at position B1 is deleted.

51. The insulin derivative according to claim 50, wherein the acyl group has from 12 to 24 carbon atoms.

52. The insulin derivative according to claim 47, wherein Xaa at position B1 is Phe.

53. The insulin derivative according to claim 52, wherein the acyl group has from 12 to 24 carbon atoms.

54. The insulin derivative according to claim 47, wherein Xaa at position B3 is Asn, Asp, Gln or Thr.

55. The insulin derivative according to claim 54, wherein the acyl group has from 12 to 24 carbon atoms.

56. The insulin derivative according to claim 47 wherein Xaa at position A21 is Ala, Asn, Gln, Gly or Ser, and Xaa at position B3 is Asn, Asp, Gln or Thr.

57. The insulin derivative according to claim 56, wherein the acyl group has from 12 to 24 carbon atoms.

58. The insulin derivative according to claim 47, wherein Xaa at position A21 is Asn, Xaa at position B13 is Phe, and Xaa at position B3 is Asn.

59. The insulin derivative according to claim 58, wherein the acyl group has from 12 to 24 carbon atoms.

60. The insulin derivative according to claim 47, wherein the acyl group has from 12 to 24 carbon atoms.

61. The insulin derivative according to claim 60, wherein the acyl group is a linear, saturated acyl group.

62. The insulin derivative according to claim 61, wherein the acyl group is tetradecanoyl or hexadecanoyl.

63. The insulin derivative according to claim 47 which is N.sup..epsilon.B29 -hexadecanoyl des(B30) human insulin.

64. The insulin derivative according to claim 47 which is N.sup..epsilon.B29 -tetradecanoyl des(B30) human insulin.

65. The insulin derivative according to claim 47 which is N.sup..epsilon.B29 -tridecanoyl des(B30) human insulin.

66. The insulin derivative according to claim 47 which is N.sup..epsilon.B29 -decanoyl, des(B30) insulin.

67. The insulin derivative according to claim 47 which is N.sup..epsilon.B29 -lithocholoyl.alpha.-glutamyl, des(B30) human insulin.

68. The insulin derivative according to claim 47 which is N.sup..epsilon.B29 -undecanoyl, des(B30) insulin.

69. The insulin derivative according to claim 47 which is N.sup..epsilon.B29 -dodecanoyl, des(B30) insulin.

70. The insulin derivative according to claim 47 which is in the form of a hexamer.

71. The insulin derivative according to claim 70, wherein the acyl group has from 12 to 24 carbon atoms.

72. The insulin derivative according to claim 70, wherein Xaa at position A21 is Asn, Xaa at position B3 is Asn, and Xaa at position B1 is Phe.

73. The insulin derivative according to claim 70, wherein two zinc ions bind to the hexamer.

74. The insulin derivative according to claim 73, wherein the acyl group has from 12 to 24 carbon atoms.

75. The insulin derivative according to claim 70, wherein three zinc ions bind to the hexamer.

76. The insulin derivative according to claim 75, wherein the acyl group has from 12 to 24 carbon atoms.

77. The insulin derivative according to claim 70, wherein four zinc ions bind to the hexamer.

78. The insulin derivative according to claim 77, wherein the acyl group has from 12 to 24 carbon atoms.

79. A pharmaceutical composition which is an aqueous solution, comprising (a) an insulin derivative according to claim 47; (b) an isotonic agent, (c) a preservative and (d) a buffer.

80. The pharmaceutical composition according to claim 79, wherein the pH of the aqueous solution is in the range of 6.5-8.5.

81. The pharmaceutical composition according to claim 79, wherein the solubility of the insulin derivative exceeds 600 nmol/ml of the aqueous solution.

82. The pharmaceutical composition according to claim 79, further comprising an insulin or an insulin analogue which has a rapid onset of action.

83. The pharmaceutical composition according to claim 79, wherein the insulin derivative is a Zn.sup.2 +complex.

84. The pharmaceutical composition according to claim 79, wherein Xaa at position A21 is Asn, Xaa at position B3 is Asn, and Xaa at position B1 is Phe.

85. The pharmaceutical composition according to claim 79, wherein the acyl group has from 12 to 24 carbon atoms.

86. The pharmaceutical composition according to claim 85, wherein the acyl group is tetradecanoyl or hexadecanoyl.

87. The pharmaceutical composition according to claim 79, wherein the insulin derivative is N.sup..epsilon.B29 -hexadecanoyl des(B30) human insulin.

88. The pharmaceutical composition according to claim 79, wherein the insulin derivative is N.sup..epsilon.B29 -tetradecanoyl des(B30) human insulin.

89. The pharmaceutical composition according to claim 79, wherein the insulin derivative is N.sup..epsilon.B29 -tridecanoyl des(B30) human insulin.

90. The pharmaceutical composition according to claim 79, wherein the insulin derivative is N.sup..epsilon.B29 -decanoyl, des(B30) insulin.

91. The pharmaceutical composition according to claim 79, wherein the insulin derivative is N.sup..epsilon.B29 -lithocholoyl-.alpha.-glutamyl, des(B30) human insulin.

92. The pharmaceutical composition according to claim 79, wherein the insulin derivative is N.sup..epsilon.B29 -undecanoyl, des(B30) insulin.

93. The pharmaceutical composition according to claim 79, wherein the insulin derivative is N.sup..epsilon.B29 -dodecanoyl, des(B30) insulin.

94. The pharmaceutical composition according to claim 79, wherein the insulin derivative is in the form of a hexamer.

95. A method of treating diabetes in a patient in need of such a treatment, comprising administering to the patient a therapeutically effective amount of a pharmaceutical composition according to claim 79.

Referenced Cited
U.S. Patent Documents
3823125 July 1974 Grant et al.
3868356 February 1975 Smyth
3950517 April 13, 1976 Lindsay et al.
4645740 February 24, 1987 Breddam et al.
5008241 April 16, 1991 Markussen et al.
Foreign Patent Documents
0 127 535 A2 May 1984 EPX
0 511 600 A2 November 1992 EPX
22 09 835 April 1976 DEX
1-254699 October 1989 JPX
WO 92/01476 February 1992 WOX
Other references
  • Brange J., Galenics of Insulin, pp.18-100 (1987). Blundell T. et al., The Structure in the Crystal and its Reflection in Chemistry and Biology, vol. 26, pp.279-402 (1972). Hashimoto, et al., Pharmaceutical Research, vol. 6, No. 2, pp. 171-176 (1989). Muranishi et al., Journal of Controlled Release, vol. 19, pp. 179-188 (1992). Brunfeldt, ACTA Endocrinol. 61: 561-576, 1969. Markussen, Prot. Eng. 2:157-166, 1988. Markussen, Prot. Eng. 1:205-213, 1987. GammeHoft, Phys. Rev 64: 1321-1378, 1984.
Patent History
Patent number: 5750497
Type: Grant
Filed: Mar 8, 1995
Date of Patent: May 12, 1998
Assignee: Novo Nordisk A/S (Bagsvaerd)
Inventors: Svend Havelund (Bagsv.ae butted.rd), John Halstr.o slashed.m (Hundested), Ib Jonassen (Valby), Asser Sloth Andersen (Frederiksberg C), Jan Markussen (Herlev)
Primary Examiner: John Ulm
Assistant Examiner: Christine Saoud
Attorneys: Steve T. Zelson, Elias J. Lambiris
Application Number: 8/400,256
Classifications
Current U.S. Class: 514/3; Diabetes (514/866); Metal Complexes, E.g., Zn-insulin, Etc. (530/304)
International Classification: C07K 1462; A61K 3828;