Method for diagnosing preclinical diabetes by quantification of mitochondrial DNA in peripheral blood
A method for predicting the development of type 2 diabetes before the manifestation of its symptoms in a subject, which comprises measuring the mitochondrial DNA(mtDNA) content in peripheral blood of the subject, comparing the measured mtDNA content with that of a normal control, and predicting the increased risk of development of diabetes when the subjects mtDNA content is lower than that of the normal control.
Latest Patents:
- FLUID DIVERSION MECHANISM FOR BODILY-FLUID SAMPLING
- METHOD AND SYSTEM FOR SELF-ADMINISTRATED SURVEILLANCE OF USE OF ADDICTIVE STIMULUS
- OPTIMIZATION OF THE SPATIAL ARRANGEMENT OF ELECTROPHYSIOLOGICAL SENSORS
- Wearable Electronic Device with Compute Core Having Laser Direct Structuring Antenna for Communicating with Distributed Neuromuscular Sensors Distributed Along Band Portion
- SYSTEM AND METHODS FOR PROVIDING INFORMATION FOR DIAGNOSING PRETERM BIRTH RISK
This application is a continuation-in-part application of U.S. Ser. No. 09/027,504 filed on Feb. 20, 1998 now abandoned.
FIELD OF THE INVENTIONThe present invention relates to a method for predicting the development of type 2 diabetes before the manifestation of the symptoms in a subject by measuring the mitochondrial DNA(“mtDNA”) content in peripheral blood.
BACKGROUND OF THE INVENTIONDiabetes mellitus is a group of metabolic diseases characterized by hyperglycemia resulting from defects in insulin secretion, insulin action or both. The chronic hyperglycemia of diabetes is associated with long-term damage, dysfunction, and failure of various organs, especially the eyes, kidneys, nerves, heart and blood vessels.
The diagnostic criteria for diabetes mellitus recommended by American Diabetes Association are 1) symptoms of diabetes plus casual plasma glucose concentration of 200 mg/dl or higher, 2) fasting plasma glucose concentration of 126 mg/dl or higher, and 3) 2-hour plasma glucose level of 200 mg/dl or higher during the oral glucose tolerance test using a glucose load containing the equivalent of 75 g anhydrous glucose dissolved in water. When any one of the above criteria is met, it must be confirmed, on a subsequent day, by any one of the three methods given above for warranting the diagnosis of diabetes (Report of the Expert Committee on the Diagnosis and Classification of Diabetes Mellitus, Diabetes Care, Vol. 23, Supplement 1, S4-S19(January 2000)).
Type 2 diabetes, i.e., non-insulin dependent diabetes, is characterized by insulin resistance and relative insulin deficiency (Olefsky, J. M. et al., Am. J. Physiol., 243, E15-E30(1982)). Insulin resistance precedes overt type 2 diabetes mellitus in most cases. Detection of insulin resistance before the development of diabetes mellitus may lead to prevention of diabetes. Moreover, insulin resistance is commonly observed in syndrome X (insulin resistance syndrome) which is a loose disease category including diabetes mellitus, hypertension, hyperlipidemia and obesity. Testing for insulin resistance and preclinical diabetes includes insulin clamp technique and modified intravenous glucose tolerance test (DeFronzo et al., Am. J Physiol., 237, E214-223(1979)). However, these testing methods are complicated and time-consuming and, moreover, the insulin clamp technique is not suitable for applying to many people simultaneously. Accordingly, there has existed a need to develop a more convenient method for preclinically diagnosing diabetes mellitus.
As reviewed by Gerbitz et al., the mitochondrial DNA (mtDNA) has been identified as the gene that is directly related to the pathogenesis of diabetes (Gerbitz, K. D. et al., Biochim. Biophys. Acta, 1271, 253-260(1995)). Furthermore, Ames et al. have reported that the aging mechanism involves an increase in the number of impaired mitochondria (Ames, B. N. M. et al., Proc. Natl. Acad. Sci. U.S.A., 90, 7915-7922(1993)), which suggests the possibility that the cause of insulin resistance syndrome may be found in mitochondria since the aging process is accompanied by increased appearance of clinical symptoms of the insulin resistance syndrome.
Hitherto, most pathological studies on mtDNA focused on its biochemical nature, such as mutation or deletion thereof (Shoffner, J. M. and Wallace, D. C., “Oxidative phosphorylation diseases” in The Metabolic and Molecular Bases of Inherited Disease, Vol. 1, pp 1535-1610. Scrier C. R., Beaudet A. L., Sly W. S., Valle D., ded., McGraw Hill, International Edition), while only a limited number of studies have dealt with the quantitative aspect of mtDNA. Shin reported that the amount of mtDNA in peripheral blood of a diabetic patient is lower than normal (Shin, C. S., J. Kor. Diabetes Asso., 18, 344-350(1994)), and Antonetti et al. reported that the muscular mtDNA content is low in a diabetic patient (Antonetti, D. A. et al., J. Clin. Invest., 95, 1383-1388(1995)). However, these studies, which measured the mtDNA of diabetes patents by Southern blot analysis having inherently poor reproducibility, have failed to fulfill the need to develop a convenient and reliable method which may be used as an index in diagnosing diabetes prior to the onset of the disease.
SUMMARY OF THE INVENTIONAccordingly, it is a primary object of the present invention to provide a method for predicting the development of type 2 diabetes before the manifestation of the symptoms in a subject.
In accordance with the present invention, there is provided a method for predicting the development of type 2 diabetes in a subject, which comprises measuring the mitochondrial DNA (mtDNA) content in peripheral blood of the subject, comparing the measured mtDNA content with that of a normal control, and predicting the increased risk of development of diabetes when the subject's mtDNA content is lower than that of the normal control.
BRIEF DESCRIPTION OF THE DRAWINGSThe above and other objects and features of the present invention will become apparent from the following description of the invention, when taken in conjunction with the accompanying drawings, in which:
FIG. 1A shows that competitive PCR gave 631 bp and 571 bp DNA products derived from mtDNA and competitive PCR, respectively;
FIG. 1B depicts the determination of competitive equivalence points;
FIG. 2A delineates the correlation of peripheral blood leukocyte mtDNA copy with fasting plasma glucose level at the time of the second survey( 1995);
FIG. 2B describes the correlation of peripheral blood leukocyte mtDNA copy with waist-hip ratio at the time of the first survey(1993);
FIG. 2C represents the correlation of peripheral blood leukocyte mtDNA copy with waist-hip ratio at the time of the second survey(1995);
FIG. 2D portrays the correlation of peripheral blood leukocyte mtDNA copy with diastolic blood pressure at the time of the second survey(1995);
FIG. 3 presents the correlation between insulin sensitivity index and peripheral blood mtDNA content; and
FIG. 4 discloses the correlation between the amount of peripheral blood leukocyte mtDNA and that of mtDNA in muscle.
DETAILED DESCRIPTION OF THE INVENTIONThe method of the present invention comprises measuring the mitochondrial DNA(“mtDNA”) content in the peripheral blood sample of a subject for preclinically diagnosing type 2 diabetes. More specifically, the inventive method for predicting type 2 diabetes before the manifestation of its symptoms in a subject comprises: measuring the mitochondrial DNA(mtDNA) content in peripheral blood of the subject, comparing the measured mtDNA content with that of a normal control, and predicting the increased risk of development of diabetes when the subject's mtDNA content is lower than that of the normal control.
The present inventors have discovered that onset of type 2 diabetes is preceded by decreased mitochondrial DNA content in peripheral blood before the manifestation of its symptoms in a subject. Accordingly, quantification of peripheral mtDNA provides a new clinical tool for diagnosing preclinical type 2 diabetes.
The mtDNA content can be measured by employing any conventional methods which utilize Southern blot analysis, competitive PCR method, and slot blot method, wherein the competitive PCR method is more preferred.
Further, the mtDNA content of peripheral blood correlates quantitatively with that of muscle. Therefore, the reduction of the mtDNA content in peripheral blood reflects that in muscle which is the major site of occurrence of insulin resistance in a diabetes patient and, accordingly, determination of mtDNA content in peripheral blood can be a reliable tool for diagnosing type 2 diabetes.
Moreover, the mtDNA content in middle aged people has statistically significant correlations with insulin resistance parameters such as blood pressure and waist-hip ratio(WHR).
The following Reference Examples and Examples are intended to further illustrate the present invention without limiting its scope.
Further, percentages given below for solid in solid mixture, liquid in liquid, and solid in liquid are on a wt/wt, vol/vol and wt/vol basis, respectively, unless specifically indicated otherwise.
Reference Example 1 DNA Extraction from Blood and QuantificationBlood samples taken from test subjects were centrifuged. The buffy coat layer was separated therefrom and stored at −70° C. After the frozen buffy coat layer was thawed, total DNA was extracted therefrom using a QIAmp™ tissue kit(QIAGEN, Chatworth, Calif., U.S.A.) and the total DNA concentration of each sample was measured with a spectrophotometer(Beckman, Fullerton, Calif., U.S.A.).
Reference Example 2 Quantification of mtDNA using Competitive PCR(CPCR)To quantify the mtDNA content in a small sample, a competitive PCR was conducted as follows.
(Step 1) Preparation of internal standard
Internal standards were used to compare PCR efficiencies and to attenuate the effects caused by inhibitors or the effects brought about by varying amplification efficiencies. The internal standard was designed to use the same primer set as the target gene but to yield a different-sized PCR product; it was prepared by PCR using the primers shown in Table 1. The primers listed in Table 1 were specially designed based on the nucleotide sequence of human mtDNA disclosed in Anderson S. et al.(Nature, 290, 457-465(1981)).
TABLE 1 Position (Nucleotide Primer 5′-3′ Sequence No.) MtF1 CCTAGGGATAACAGCGCAAT (SEQ ID NO: 1) 2928-2947 MtR1 TAGAAGAGCGATGGTGAGAG (SEQ ID NO: 2) 3558-3539 JS3 GCCATGGGTAGGGCTCTGCCATCTTAACAA (SEQ ID NO: 3) 3317-3308, 3247-3228 JS4 GGCAGAGCCCTACCCATGGCCAACCTCCTA (SEQ ID NO: 4) 3238-3247, 3308-3317Two independent PCR amplifications using the sets of mtF1+JS3 and mtR1+JS4 produced DNA fragments having 331 bp and 261 bp, respectively. Each PCR mixture contained 100 ng of genomic DNA, 25 pmole of each primer, 200 &mgr;M of each of dATP, dTTP, dCTP and dGTP, 1 unit of Taq DNA polymerase, 20 mM Tris-Cl(pH 8.3), 1.5 mM MgCl2, 50 mM KCl, 0.05% Tween 20 and 0.001% gelatin. PCR was conducted under the following conditions: one cycle of 3 min. at 94° C., 1 min. at 60° C. and 1 min. at 72° C.; 34 cycles of 40 sec. at 94° C., 1 min. at 60° C. and 1 min. at 72° C.; and final reaction of 10 min. at 72° C. The PCR product was analyzed on the 1.0% agarose gel by electrophoresis.
Secondary PCR amplification using the above products and the primer set of mtF1+mtR1 produced a 571 bp fragment containing the sequences corresponding to 2928th-3247th nucleotides and 3308th-3558th nucleotides of the mtDNA, with deletion of the intervening 60 bp(position 3248-3307). The composition of the PCR mixture was the same as above except that 1 &mgr;l of each of the 331 bp and 261 bp products were used as a template, and PCR was conducted under the following conditions: 8 cycles of 4 min. at 94° C., 40 sec. at 94° C., 1 min. at 58° C. and 1 min. at 72° C.; 25 cycles of 40 sec. at 94° C., 1 min. at 60° C. and 1 min. at 72° C.; and final reaction of 10 min. at 72° C. The PCR product was analyzed on the 1.0% agarose gel by electrophoresis.
(Step 2) Preparation of a plasmid containing 571 bp fragment
The PCR product of Step 1 was analyzed on the agarose gel by electrophoresis and a band corresponding to the 571 bp fragment was excised therefrom, DNA was extracted from the band by using QIAEX™ II kit(QIAGEN, Chatworth, Calif., U.S.A.). Cloning was conducted by using original TA cloning kit(lnvitrogen Therapeutics, Inc., Houston, Tex. 77054, U.S.A.). Specifically, 20 ng of the DNA was added to 50 ng PCR™ II vector and then ligated with T4 DNA ligase.
One shot™ INVaF′ competent cell(Invitrogen Therapeutics, Inc., Houston, Tex. 77054, U.S.A.) was transformed with the resulting vector, and the transformants were spread on LB agar plate containing 50 &mgr;g/ml of ampicillin and 25 &mgr;g/ml of X-gal and then incubated overnight at 37° C. Transformed cells, i.e., white colonies were selected and incubated overnight on LB broth containing 50 &mgr;g/ml of ampicillin. The plasmid DNA was extracted therefrom by using QIAGEN plasmid DNA extraction kit(QIAGEN, Chatworth, Calif., U.S.A.).
(Step 3) Competitive PCR
Each of 16.43, 8.21, 4,11, 2.06 and 1.03×105 copies of the plasmid prepared in Step 2 was added as a competitive DNA template to 5 ng of total cellular DNA obtained in Reference Example 1 and subjected to PCR using primers mtF1 and mtR1. The PCR mixture contained 2.5 pmole of each primer, 125 &mgr;M of each of dATP, dTTP, dCTP and dGTP, 1 unit of Taq DNA polymerase, 20 mM Tris-Cl(pH 8.3), 1.5 mM MgCl2, 50 mM KCl, 0.05% Tween 20 and 0.001% gelatin.
PCR was conducted under the following conditions: one cycle of 3 min. at 94° C., 40 sec. at 65° C. and 1 min. at 72° C.; 27 cycles of 1 min. at 94° C., 40 sec. at 65° C. and 1 min. at 72° C.; and final reaction of 7 min. at 72° C. The PCR product was analyzed on the 1.0% agarose gel by electrophoresis. Gels were stained with EtBr and photographed under UV light(FIG. 1A), and intensities of the target DNA band(631 bp) and competitor band(571 bp) were measured by using NIH Image software(National Institute of Health, ML, U.S.A.). In FIG. 1, lanes 1 to 5 represent the result of PCR using 16.43, 8.21, 4,11, 2.06 and 1.03×105 copies of standard plasmid, respectively.
The logarithm of the calculated ratio of the signal for the competitive template-derived product to the signal for the mtDNA sequence-derived product was plotted against the logarithm of the copy number of the added competitive template, and competition equivalence points were determined by interpolation. MtDNA content was expressed as copy number per picogram of template DNA. The result is shown in FIG. 1B.
Example 1: mtDNA quantity in subjects who developed diabetes Mellitus
To determine whether decreased mtDNA content in peripheral blood leukocytes precedes the development of diabetes mellitus, stored blood samples from two community-based surveys conducted in Yonchon County, Korea in 1993 and 1995 were utilized. 23 newly diagnosed diabetic patients and 22 age- and sex-matched controls were selected from 1197 subjects who participated in both the first(1993) and the second(1995) survey.
Diagnosis of diabetes mellitus was conducted based on World Health Organization criteria(WHO Technical Report Series, No. 646, 8-12(1980)). Patients with newly developed diabetes were those who had not been diabetic at the time of the first survey in 1993 but became diabetic by the time of the second survey conducted two years later. Control subjects were those who were still non-diabetic at the time of the second survey. Peripheral blood samples collected during the first survey in 1993 were retrieved for mtDNA quantification.
The mtDNA content of each of the samples were measured in accordance with the procedures of Reference Examples 1 and 2. The characteristics and mtDNA quantity of subjects who developed diabetes mellitus within two years are shown in Table 2, wherein p value denotes the statistical power on the significance of difference in the listed variables between the converters and non-converters.
TABLE 2 Clinical characteristics of the subjects Converters to Non-converters diabetes (n = 23) (n = 22) p-value Age 61.0 ± 13.0 58.0 ± 14.0 NS* Sex (M/F) 13/10 14/8 NS MtDNA (copies/pg 102.8 ± 41.5 137.8 ± 67.7 <0.05 Template DNA) Body mass index (BMI) 24.7 ± 4.2 23.4 ± 2.6 NS (kg/m2) Waist-hip ratio (WHR) 0.90 ± 0.05 0.88 ± 0.05 NS Fasting glucose 106.4 ± 14.0 100.3 ± 9.7 NS (mg/dl) Post-load glucose 117.0 ± 28.0 120.5 ± 31.7 NS (mg/dl) Systolic blood pressure 133.0 ± 18.0 127.0 ± 21.0 NS (mmHg) Diastolic blood pressure 83.0 ± 12.0 83.0 ± 16.0 NS (mmHg) Fasting insulin 7.3 ± 1.4 7.4 ± 1.8 NS (uIU/ml) Proinsulin (pmol/L) 13.3 ± 7.8 8.4 ± 5.2 NS Cholesterol (mg/dl) 162.1 ± 37.0 155.8 ± 29.3 NS Triglyceride (mg/dl) 144.7 ± 69.4 121.6 ± 79.0 NS HDL-cholesterol 36.9 ± 8.9 33.0 ± 9.0 NS (mg/dl) *NS: Not significantAs shown in Table 2, there were no significant differences in initial anthropometric parameters, blood pressure and lipid profiles between subjects who became diabetic and those who did not. However, the mean mtDNA value for the converters was 102.8±41.5 copies/pg template DNA which is significantly lower than 137.8±67.7 copies/pg template DNA found for controls(p<0.05).
Example 2: Correlation between mtDNA quantity and various parameters
Various parameters of insulin resistance syndrome such as waist-hip ratio(WHR), fasting glucose level and diastolic blood pressure were measured by conventional methods and then plotted against individual mtDNA content of all subjects including both converters and non-converters. Correlations between mtDNA content and the parameters were analyzed by Pearson's correlation.
The results are shown in FIGS. 2A to 2D and Table 3, wherein significant inverse correlations were noted between mtDNA content and WHR(r=−0.31, p<0.05) measured in the first survey(1993), and fasting glucose level(r=−0.35, p<0.05), diastolic blood pressure(r=−0.36, p<0.05) and WHR((r=−0.40, p<0.01) measured in the second survey. Correlations with serum levels of total and high-density cholesterol, triglyceride, insulin and proinsulin were not statistically significant.
TABLE 3 Correlation between mtDNA content and various parameters Index r value p value Age −0.08 0.587 Systolic Blood Pressure 93 −0.26 0.087 (SBP) 95 −0.28 0.067 Diastolic Blood Pressure 93 −0.21 0.170 (DBP) 95 −0.36 0.015 Waist-Hip Ratio 93 −0.31 0.036 (WHR) 95 −0.40 0.007 Fasting Blood Sugar 93 −0.15 0.324 (FBS) 95 −0.35 0.019 2 hr Blood Glucose Level after 93 −0.11 0.469 75 g Oral Glucose Load (Glu2) 95 −0.35 0.092 Body Mass Index (BMI) 93 −0.21 0.169 95 −0/24 0.117Example 3: Correlation between Insulin Sensitivity Index and Peripheral Blood mtDNA Content
(1) Subjects
Eighty-two subjects who had parents having type 2 diabetes were recruited in from the Mokdong cohort study established in Seoul, Korea in 1997, which was consisted of 750 healthy adults above 30 years old. Subjects having the past history of diabetes mellitus, hypertension and atherosclerotic heart disease were excluded in this study.
All subjects underwent a 75-g oral glucose tolerance test. They were classified into 3 groups: with normal glucose tolerance (NGT), with impaired glucose tolerance (IGT) and with newly diagnosed diabetes (DM) according to the WHO criteria. For the control group, age-, sex- and body mass index-matched subjects without a family history of diabetes were randomly selected from the cohort.
(2) Measurement of anthropometric parameters
The blood pressure, height, weight, and circumferences of waist and hip of the subjects were measured by conventional methods. Total body fat content, expressed as fat mass (kg) was determined using bioelectric impedance analyzer (Inbody 2.0, Biospace CO., Ltd.). Percent body fat (%) was calculated using the following formula: fat mass (kg) divided by body weight (kg)×100. Subcutaneous and visceral fat areas were measured and calculated using the computerized tomography conducted at the umbilical level.
(3) Measurements of biochemical parameters
Plasma glucose concentrations were measured by glucose oxidase method (YSI glucose analyzer, Yellow Springs Instrument, Yellow Springs, Ohio, USA). Plasma total cholesterol, triglyceride and HDL-cholesterol were determined by enzymatic methods using Hitachi 7150 autochemistry analyzer. Nonesterified fatty acid (NEFA) was measured by enzymatic method (NEFAzyme kit, Eiken, Japan). Serum insulin (Diagnostic Products Co, USA), C-peptide (Diagnostic Product Co. , USA) and leptin (Linco, USA) were measured by radioimmunoassay.
(4) Measurements of insulin sensitivity
Insulin sensitivity was determined using Insulin-modified frequently sampled intravenous glucose tolerance test of Bergman(Bergman, R. N. et al., Am. J. Physiol., 236: E667-77, 1979).
In brief, fasting blood samples were taken for measurement of plasma glucose and insulin levels following a 14 hour overnight fasting. Glucose (0.3 g/kg of body weight) as a form of 20% glucose solution was intravenously injected over 60 seconds via 18 gauge-cannula in the arm other than the sampling arm. Additional blood samples were taken at 2, 3, 4, 5, 6, 8, 19, 22, 30, 40, 50, 70, 100 and 180 minutes following injection of glucose. At 20 min. post glucose injection, regular insulin (0.0125 U/kg body weight) was administered intravenously to increase the accuracy of the modeling analyses. Insulin sensitivity index (SI) and insulin dependent glucose elimination (glucose effectiveness; SG) were calculated using MINMOD 2.0 software.
(5) Quantification of mitochondrial DNA
Total DNA was extracted from peripheral blood leukocytes in accordance with Reference Example 1. The mtDNA content was determined using real-time quantitative PCR method (ABI Prism 7700) and a mitochondria-specific fluorescent probe. The internal probe labeled with two fluorescent dyes, 5-carboxyfluorescein (FAM) on the 5′ end and N,N,N,N-tetramethyl 6-carboxyrhodamine (TAMRA) on the 3′ end, was prepared by a DNA synthesizer (Perkin Elmer).
The sequences of the probe and PCR primers are described below:
mtDNA amplicon 265 bp
forward primer: 5′-ACGACCTCGATGTTGGATC-3′ (position 2981-3000; SEQ ID NO.: 5)
reverse primer: 5′-GCTCTGCCATCTTAACAAACC-3′ (position 3245-3224; SEQ ID NO.: 6)
probe: 5′-TTCAGACCGGAGTAATCCAGGTCG-3′ (position 3071-3095; SEQ ID NO.: 7)
The probes hybridized within the 265 bp region were amplified with PCR primers. When the two dyes are in close proximity, with an intact oligonucleotide probe, TAMRA acts as a quencher for FAM by absorbing at the FAM emission region. The 5′ exonuclease activity of Taq degrades the hybridizing probe during PCR. Degradation of the probe leads to separation of two dyes with an increase in the intensity of fluorescence. The amount of fluorescence measured in a sample is proportional to the amount of specific PCR product generated. The amount of product in a particular reaction mixture is measured by interpolation using a standard Ct curve generated from known starting DNA concentrations.
The MtDNA content was corrected by 28s ribosomal RNA (rRNA) content, which was simultaneously measured using real-time PCR method. The primers for 28s rRNA were forward primer, 5′-TTAAGGTAGCCAAATGCCTCG-3′(7358-7378; SEQ ID NO: 8) and reverse primer, 5′-CCTTGGCTGTGGTTTCGCT-3′(7460-7441, SEQ ID NO: 9) and the probe was 5′- TGAACGAGATTCCCACTGTCCCTACCTA CTATC-3′(SEQ ID NO: 10).
The PCR mixture consisted of primers(each 10 pmoles), 200 nM Taqman probe, dATP, dCTP and dGTP, each at a concentration of 200 nM, 400 nM dUTP, 4.5 mM MgCl2, 1.25 U AmpliTaq DNA polymerase, 0.5 U AmpErase Uracil N-glycosylase(UNG), and 1x PCR buffer A. Amplification and detection were performed with the ABI Prism 7700 system under the following condition: 1 cycle of 50° C. for 2 min, 1 cycle of 95° C. for 10 min, and 40 cycles of 95° C. for 15 sec and 60° C. for 1 min. The mtDNA content was expressed as mtDNA content/28s rRNA content.
(6) Statistical analysis
All data was presented as mean ± standard error mean (SEM). Difference between diabetic offspring and control was compared by student's t-test. Correlation of mtDNA content with indexes for insulin sensitivity and other parameters of the insulin resistance syndrome was determined using Pearson's correlation and the multiple linear regression analysis. Values at P<0.05 were considered to be significant.
The results are shown in Tables 4 to 7 and FIG. 3.
TABLE 4 Clinical characteristics of the subjects Offspring Control NGT IGT New DM Variable (n = 52) (n = 52) (n = 21) (n = 9) Age (yr) 41.8 ± 0.9 41.7 ± 0.9 45.1 ± 1.3 50.6 ± 1.9* Sex (M/F) 17/35 18/34 11/10 4/5 Body mass index (kg/m2) 24.0 ± 0.3 23.7 ± 0.4 24.2 ± 0.7 25.8 ± 0.7* Waist to hip ratio 0.82 ± 0.0 0.82 ± 0.0 0.84 ± 0.0 0.87 ± 0.0* Fasting glucose (mmol/l) 4.8 ± 0.1 5.0 ± 0.1 5.3 ± 0.2† 7.7 ± 0.8* Fasting insulin (pmol/l) 60.0 ± 5.2 46.9 ± 2.8 60.0 ± 9.7 87.3 ± 16.8* Fasting C-peptide (ng/ml) 1.4 ± 0.1 0.6 ± 0.1 0.6 ± 0.1 0.8 ± 0.0 Systolic BP (mmHg) 117.2 ± 1.9 116.9 ± 1.8 121.0 ± 2.8 121.1 ± 3.5 Diastolic BP (mmHg) 76.5 ± 1.3 75.7 ± 1.3 80.0 ± 2.3 76.7 ± 3.7 Cholesterol (mmol/l) 4.8 ± 0.1 4.9 ± 0.1 5.5 ± 0.2 5.8 ± 0.4* Triglyceride (mmol/l) 1.4 ± 0.1 1.6 ± 0.2 2.4 ± 0.5 1.8 ± 0.2 HDL (mmol/l) 1.2 ± 0.0 1.2 ± 0.0 1.2 ± 0.1 1.2 ± 0.1 Fatty acid (g/l) 0.3 ± 0.0 0.3 ± 0.0 0.4 ± 0.1 0.3 ± 0.1 1. Values are mean ± SEM. 2. NGT, normal glucose tolerance; IGT, impaired glucose tolerance; DM, diabetes mellitus; BP, blood pressure; HDL, high density lipoprotein. 3. *P < 0.05 vs control, NGT and IGT. †P < 0.05 vs control and NGT. TABLE 5 Patterns of body fat distribution and indices of insulin secretion and resistance of the subjects Offspring Control NGT IGT New DM Variable (n = 52) (n = 52) (n = 21) (n = 9) Fat mass (kg) 17.6 ± 1.3 16.9 ± 0.6 16.9 ± 1.1 18.3 ± 1.2 Percent body fat (%) 27.9 ± 1.3 26.7 ± 0.6 25.5 ± 1.2 26.6 ± 1.2 Visceral fat area (cm2) 61.9 ± 8.5 75.0 ± 4.7 87.8 ± 9.1 132.8 ± 13.5* VSR 0.40 ± 0.1 0.49 ± 0.0 0.57 ± 0.1 0.73 ± 0.0* Leptin (ng/ml) 5.8 ± 1.2 7.1 ± 1.1 8.2 ± 2.0 7.1 ± 0.8 SI (10−4/pmol/l) 0.98 ± 0.1 0.84 ± 0.1 0.83 ± 0.2 0.34 ± 0.1* SG (10−2/min) 2.29 ± 0.0 2.18 ± 0.0 1.94 ± 0.0 2.52 ± 0.1 AIR (pmol/l) 318.9 ± 46.1 231.2 ± 29.8‡ 157.8 ± 34.9† 29.2 ± 15.6* 1. Values are mean ± SEM. 2. NGT, normal glucose tolerance; IGT, impaired glucose tolerance; DM, diabetes mellitus; VSR, visceral to subcutaneous ratio; SI, insulin sensitivity index; SG, glucose effectiveness; AIR, acute insulin response. 3. *P < 0.05 vs control, NGT and IGT. †P < 0.05 vs control and NGT. ‡P < 0.05 vs control. TABLE 6 Pearson's correlation coefficiencies between peripheral blood mtDNA content and various clinical parameters in total subjects Variable r P-value Age −0.142 NS Body mass index −0.059 NS Waist to hip ratio −0.006 NS Systolic blood pressure 0.03 NS Diastolic blood pressure −0.049 NS Fasting glucose −0.035 NS Fasting insulin −0.053 NS Fasting C-peptide −0.248 0.032 Visceral fat area −0.198 0.057 Visceral to subcutaneous ratio −0.131 NS Leptin −0.013 NS SI 0.214 0.033 SG 0.07 NS Acute insulin response −0.059 NS 1. NS, not significant 2. SI, insulin sensitivity index; SG, glucose effectiveness. TABLE 7 Multiple linear regression analysis for peripheral blood mtDNA content affecting the insulin sensitivity in offspring of patients with type 2 diabetes mellitus Independent Variables &bgr; R2 F P-value mtDNA content 0.0014 0.046 4.65 0.033 age, mtDNA content 0.0014 0.05 2.426 0.040 age, BMI, mtDNA content 0.0012 0.14 4.909 0.074 age, BMI, fasting insulin, 0.0007 0.236 6.70 0.246 mtDNA content 1. BMI, body mass index. 2. Insulin sensitivity index using logarithmic transformation was used as a dependent variable.FIG. 3 presents the correlation between insulin sensitivity index and peripheral blood mtDNA content.
Example 4: Correlation between mtDNA Contents in Peripheral Blood with That in Muscle
(Step 1) DNA Extraction from Blood and Muscle and Quantification of the Extracted DNA
Blood samples were taken from thirty-six 9 to 10 week-old Sprague-Dawley rats each weighing about 200 to 250 g, and centrifuged. The buffy coat layer was separated therefrom and stored at −70° C. After the frozen buffy coat layer was thawed, total DNA was extracted and its concentration was measured in accordance with the method of Reference Example 1.
On the other hand, about 100 mg of the femoral muscle was separated from each of the rats and stored at −70° C. After the frozen muscle was thawed, it was homogenized in 1 ml of a lysis buffer(10 mM Tris, 100 mM NaCl, 25 mM EDTA, 1% SDS, 100 &mgr;g/ml proteinase-K) and incubated in a 48° C. water-bath for 14 to 16 hours. After further incubation at 37° C. for 30 min., total DNA was extracted therefrom with phenol/chloroform in accordance with a conventional method(Sambrook, et al., Molecular cloning; A Laboratory Manual. 2nded,. Cold Spring Harbor Laboratory Press, N.Y., 1989). 100 &mgr;l, of 10 mM Tris-1 mM EDTA was added to the extracted DNA and the total DNA concentration of each sample was measured at 260 nm with a spectrophotometer(Beckman, Fullerton, Calif., U.S.A.).
(Step 2) Quantification of mtDNA using Competitive PCR(CPCR)
To quantify the mtDNA content in the blood and the muscle samples prepared as above, a competitive PCR was conducted as follows.
(1) Preparation of internal standard and a plasmid containing 694 bp fragment
Internal standards were prepared by PCR using the primers shown in Table 8, in accordance with the method of (Step 1) of Reference Example 2. The primers listed in Table 8 were specially designed based on the nucleotide sequence of rat mtDNA disclosed in Anderson S. et al.(Nature, 290, 457-465(1981)).
TABLE 8 Position (Nucleotide Primer 5′-3′ Sequence No.) MT3 AGGACTTAACCAGACCCAAACACG (SEQ ID NO: 11) 4395-4418 MT4 CCTCTTTTCTGATAGGCGGG (SEQ ID NO: 12) 5164-5145 Df1 CCCTATCAACCCAACCAACAACAACTCCAA (SEQ ID NO: 13) 4721-4730, 4807-4826 Dr1 TGTTGGTTGGGTTGATAGGGTTGAGCAGTT (SEQ ID NO: 14) 4816-4807, 4730-4711Two independent PCR amplifications using the sets of MT3+Dr1 and MT4+Df1 produced DNA fragments having 346 bp and 369 bp, respectively.
Secondary PCR amplification using the above products and the primer set of MT3+MT4 produced a 694 bp fragment containing the sequences corresponding to 4395th-4730th nucleotides and 4807th-5164th nucleotides of the mtDNA, with deletion of the intervening 76 bp(position 4731-4806).
Further, plasmid containing the PCR product was prepared in accordance with the method of (Step 2) of Reference Example 2.
(2) Competitive PCR
The molecular weight of the plasmid DNA obtained in (1) was 3.00×106 mole and, accordingly, 1 ng of the plasmid DNA corresponded to 333 amoles.
Each of 133.20, 66.60, 33.30, 16.65 and 8.33 amoles of the plasmid DNA prepared in (1) was added as a competitive DNA template to 50 ng of total cellular DNA(target DNA) obtained from blood or muscle in (Step 1) and subjected to PCR using primers MT3 and MT4. The PCR mixture contained 50 pmol of each primer, 200 mM of each of DATP, dTTP, dCTP and dGTP, 0.75 unit of Taq DNA polymerase, 20 mM Tris-Cl(pH 8.3), 1.5 mM MgCl2, 50 mM KCl, 0.05% Tween 20 and 0.001% gelatin.
PCR was conducted under the following conditions: one cycle of 3 min. at 94° C., 1 min. at 60° C. and 1 min. at 72° C.; 30 cycles of 40 sec. at 94° C., 1 min. at 60° C. and 1 min. at 72° C.; and final elongation reaction of 7 min. at 72° C.
The PCR product was analyzed on 1.5% agarose gel by electrophoresis. Gels were stained with EtBr and photographed under UV light, and intensities of the target DNA band(770 bp) and competitor band(694 bp), i.e., internal standard, were measured by using NIH Image software(National Institute of Health, ML, U.S.A). Since various concentrations of internal standard DNA were employed, the concentration of target DNA was determined from that of internal standard DNA when the intensity of its band is equal to that of the internal standard DNA.
As shown in FIG. 4, the mtDNA content of peripheral blood correlates quantitatively with that of muscle. Therefore, it is concluded that the reduction of the mtDNA content in peripheral blood reflects that in muscle which is the major site of insulin resistance in diabetes and, accordingly, determination of mtDNA content in peripheral blood can be a reliable tool for diagnosing of diabetes.
While the invention has been described with respect to the above specific embodiments, it should be recognized that various modifications and changes may be made to the invention by those skilled in the art which also fall within the scope of the invention as defined by the appended claims.
14 20 base pairs nucleic acid single linear oligonucleotide DNA unknown 1 CCTAGGGATA ACAGCGCAAT 20 20 base pairs nucleic acid single linear oligonucleotide DNA unknown 2 TAGAAGAGCG ATGGTGAGAG 20 30 base pairs nucleic acid single linear oligonucleotide DNA unknown 3 GCCATGGGTA GGGCTCTGCC ATCTTAACAA 30 30 base pairs nucleic acid single linear oligonucleotide DNA unknown 4 GGCAGAGCCC TACCCATGGC CAACCTCCTA 30 19 base pairs nucleic acid single linear oligonucleotide DNA unknown 5 ACGACCTCGA TGTTGGATC 19 21 base pairs nucleic acid single linear oligonucleotide DNA unknown 6 GCTCTGCCAT CTTAACAAAC C 21 24 base pairs nucleic acid single linear oligonucleotide DNA unknown 7 TTCAGACCGG AGTAATCCAG GTCG 24 21 base pairs nucleic acid single linear oligonucleotide DNA unknown 8 TTAAGGTAGC CAAATGCCTC G 21 19 base pairs nucleic acid single linear oligonucleotide DNA unknown 9 CCTTGGCTGT GGTTTCGCT 19 33 base pairs nucleic acid single linear oligonucleotide DNA unknown 10 TGAACGAGAT TCCCACTGTC CCTACCTACT ATC 33 24 base pairs nucleic acid single linear oligonucleotide DNA unknown 11 AGGACTTAAC CAGACCCAAA CACG 24 20 base pairs nucleic acid single linear oligonucleotide DNA unknown 12 CCTCTTTTCT GATAGGCGGG 20 30 base pairs nucleic acid single linear oligonucleotide DNA unknown 13 CCCTATCAAC CCAACCAACA ACAACTCCAA 30 30 base pairs nucleic acid single linear oligonucleotide DNA unknown 14 TGTTGGTTGG GTTGATAGGG TTGAGCAGTT 30Claims
1. A method for predicting the development of type 2 diabetes before the manifestation of its symptoms in a subject, which comprises measuring the mitochondrial DNA(mtDNA) content in peripheral blood of the subject, comparing the measured mtDNA content with that of a normal control, and predicting the increased risk of development of diabetes when the subject's mtDNA content is lower than that of the normal control.
2. The method of claim 1, wherein the mitochondrial DNA content in peripheral blood is measured using the competitive polymerase chain reaction(CPCR) method.
- Antonetti et al., J. Clin. Invest. vol. 95, pp 1383-1388, 1995.*
- Shin, C.S., J. Kor Diabetes Assoc. vol. 18, pp 344-350,1995.
Type: Grant
Filed: Aug 1, 2000
Date of Patent: May 15, 2001
Assignee: (Seoul)
Inventors: Hong-Kyu Lee (Seoul), Kyong-Soo Park (Seoul), Chan-Soo Shin (Seoul)
Primary Examiner: W. Gary Jones
Assistant Examiner: Jehanne Souaya
Attorney, Agent or Law Firm: Anderson Kill & Olick, PC
Application Number: 09/630,377
International Classification: C12Q/168; C12P/1934;