Abstract: A system may receive a package previously irradiated for sterilization. The package may have a sensor comprising a reference tag and sensing tag at least partially coated with a material comprising poly(3,4-ethylenedioxythiophene) polystyrene sulfonate (PEDOT:PSS) and Polyurethan (PU). The system may scan the sensing tag and the reference tag. The system may determine, based on radio frequency (RF) signals reflected from the sensing tag and reference tag, the sensor is exposed to radiation. The system may output a quality measure indicative of the sensor being exposed to radiation.

Abstract: This document relates to materials and methods involved in treating cancer. For example, materials and methods for using one or more oncolytic viruses (e.g., one or more oncolytic viruses) to treat cancer in a mammal (e.g., a human) identified as having a cancer likely to respond to oncolytic virotherapy are provided.

Abstract: A receptacle for single-handedly uncapping, recapping and disposing a syringe's needle cap and needle head. The receptacle may include a receptacle unit with first and second ends and a base connected to the second end of the receptacle unit. The receptacle unit may, from its first end to its said second end, a hollow opening. The receptacle unit may, from its first end to its second end, include a wall channel. The wall channel may, at its second end be dimensioned to snugly engage the syringe's needle cap. Additionally, the wall channel may include a device for snuggly engaging a needle cap circumferential ridge and a needle head circumferential ridge.

Abstract: The present disclosure relates to an integrated channel apparatus for a non-heat pump thermal management integrated module and an electric vehicle. The integrated channel apparatus includes a first component and a second component, the first component is provided with a channel group that runs through the first component along a thickness direction and a groove that does not run through the first component, the channel group and the groove are used to accommodate a connecting tube. The second component is provided with multiple strip grooves, each strip groove is provided corresponding to two channels to connect the two channels. During use, the integrated channel apparatus is installed in the non-heat pump thermal management integrated module, and the connecting tubes that need to be connected are placed in the two channels and the strip groove correspondingly connecting the two channels.

Abstract: The present invention provides a stirring-free scalable electrochemical reactor enabled by alternating current and uses thereof in a method of performing electrosynthesis of organic reaction.

Abstract: A method of treating a malignant disease involving T cell exhaustion in a subject, with the proviso that said malignant disease is not a B cell malignancy, is disclosed. The method comprising administering to the subject a therapeutically effective amount of an agent capable of decreasing an activity or expression of CD84, thereby treating the malignant disease involving the T cell exhaustion. Also disclosed is a method of treating an autoimmune or inflammatory disease in a subject, the method comprising administering to a subject a therapeutically effective amount of an agent capable of decreasing an activity or expression of CD84. A method comprising administering to the subject a therapeutically effective amount of an agent capable of decreasing an activity or expression of SLAMF1, with the proviso that said agent is not an agent capable of decreasing an activity or expression of CD84, is also disclosed.

Abstract: A wireless power transfer system includes a wireless power transfer device. The wireless power transfer device includes a first transmitting coil oriented along a first axis; a second transmitting coil on the first transmitting coil and oriented along a second axis different from the first axis; and a nonmagnetic material magnetically decoupling the first transmitting coil from the second transmitting coil in an area of overlap between the first and second transmitting coils.

Abstract: This disclosure provides compositions and methods for altering or changing the tissue tropism, e.g., liver tropism, of adeno-associated viruses (AAV).

Abstract: An energy harvesting system for use with the human body may use an eccentrically mounted weight winding a mainspring that drives a mechanical clock mechanism. The mechanical clock mechanism in turn may produce pulses of electricity, for example, through periodic flexing of a piezoelectric or triboelectric material during the regular motion of the mechanical timing mechanism. By remaining in a mechanical rather than electrical domain, improved simplicity and efficiency may be obtained in the generation of regularly spaced uniform pulses.

Abstract: The present invention solves difficulties in constructing a dialogue corpus, ensures the accuracy of a system utterance, and evaluates a user utterance in a dialogue technology for language learning and a knowledge-grounded dialogue technology, in which a system and method is capable of helping a learner in language learning by constructing a language learning dialogue corpus using passages and exercises commonly used in language education and learning sites, training a dialogue model and a dialogue evaluation model with the language learning dialogue corpus, and allowing a user and a system to have a dialogue on the basis of a given passage. It is expected that it will be possible to implement a dialogue system for language learning that is capable of performing evaluation and easily expanding a domain (expansion of learning content).

Abstract: A method of preparing a polyolefin is disclosed. In some examples, the method comprises contacting an olefin monomer with an olefin polymerization precatalyst and a photoacid generator (PAG) to provide an olefin polymerization mixture; and irradiating the olefin polymerization matrix for a first period of time with ultraviolet or visible light, activating the precatalyst to catalyze polymerization of the olefin monomer, thereby preparing a polyolefin. Additive manufacturing approaches employing the methods are also disclosed, as are ink compositions comprising an olefin polymerization precatalyst and a PAG.

Abstract: Provided herein are systems and methods for an iterative approach to topic modeling and the use of web mapping technology to implement advanced spatial operators for interactive high-dimensional visualization and inference.

Abstract: A horological component including a substrate and at least one first decoration component including at least one first photoluminescent material configured to procure a phosphorescent appearance. The horological component includes a second decoration component including at least one second material, the second material being metallic and configured to procure a metallic appearance, or variochromic and configured to procure a color that varies under the effect of a stimulus, the first decoration component and the second decoration component being arranged relative to one another on the substrate to form a decoration having a metallic appearance or a color that varies under the effect of a stimulus when the horological component is exposed to light and a phosphorescent appearance when the horological component is in the dark. A timepiece can include such a horological component.

Abstract: An interferometer for use in remote sensing systems includes a beam splitter that separates an input wave into a reflected wave, which travels along a first optical path within an upper interferometer arm, and a transmitted wave, which travels along a second optical path within a lower interferometer arm. The reflected and transmitted waves are subsequently recombined by the beam splitter for imaging onto a sensor. A highly dispersive element is incorporated into at least one of the pair of interferometer arms. Due to anomalous dispersion, a frequency shift in a wave transmitted through a dispersive element changes the optical path length within its corresponding arm. As a result, the recombined wave produces an interference pattern with a measurable phase change that can be utilized to calculate the original frequency shift in the input wave with great precision and potential sub-Hertz sensitivity.

Abstract: In one aspect, compositions and wound dressings are described herein. In some embodiments, a composition or wound dressing described herein comprises a mesh formed from a plurality of biodegradable polymer fibers; a first active agent dispersed in the biodegradable polymer fibers; a plurality of biodegradable polymer particles disposed in the mesh; and a second active agent dispersed in the biodegradable polymer particles. The particles can be disposed within the interiors of the fibers of the mesh or between the fibers of the mesh. In another aspect, a composition or wound dressing described herein comprises a first perforated mesh formed from a first plurality of biodegradable polymer fibers; and a second perforated mesh formed from a second plurality of biodegradable polymer fibers, wherein the second perforated mesh is disposed on the first perforated mesh in a stacked configuration and the first and second perforated meshes have different degrees of perforation.

Abstract: A land leveller includes a vehicle frame and a swing frame. The swing frame include a supporting beam assembly and connecting parts, the supporting beam assembly include multiple beam members, and the multiple beam members are connected sequentially at end parts, such that the multiple beam members form a closed shape. The connecting part is arranged at the connecting end part between two adjacent beam members. At least one connecting part is rotatably connected with the vehicle frame, and at least another connecting part is rotatably connected with a driving part.

Abstract: An ultra-high strength maraging stainless steel with nominal composition (in mass) of C?0.03%, Cr: 13.0-14.0%, Ni: 5.5-7.0%, Co: 5.5-7.5%, Mo: 3.0-5.0%, Ti: 1.9-2.5%, Si: ?0.1%, Mn: ?0.1%, P: ?0.01%, S: ?0.01%, and Fe: balance. The developed ultra-high strength maraging stainless steel combines ultra-high strength (with ?b?2000 MPa, ?0.2?1700 MPa, ??8% and ??40%), high toughness (KIC?83 MPa·m1/2) and superior salt-water corrosion resistance (with pitting potential Epit?0.15 (vs SCE)). Therefore, this steel is suitable to make structural parts that are used in harsh corrosive environments like marine environment containing chloride ions, etc.

Abstract: Methods, devices, and systems for treating spasticity, hypertonia or dystonia are disclosed. Treatment involves applying a source of direct current to one or more locations in a subject (animal, human, or other sentient being). Locations for application of direct current include the spinal column, peripheral nerves, and the cranium. The delivery of direct current is adjusted to change biological activity of or level of gene expression and/or protein expression of target molecule NKCC1.

Abstract: A composition for the treatment of bladder fibrosis in a patient in need that includes a miR-29 mimic is disclosed. The miR-29 mimic may include a working RNA strand with the nucleotide sequence UAGCACCAUCUGAAAUCGGUUUU (SEQ ID NO 4) and a passenger RNA strand comprising the nucleotide sequence: AACCGAUUUCuuuUGGUGCUAUU (SEQ ID NO 5). The passenger RNA strand includes a 2?-O-methylation modification to increase stability. Cholesterol is conjugated to the 3?-end of the passenger RNA strand to enhance cellular uptake. The composition may further include a carrier molecule including, but not limited to, branched polyethylenimine at an N/P ratio of 0.8, where N denotes the nitrogens of the polyethylenimine and P denotes the phosphate groups of the working and passenger RNA strands. In some aspects, the composition may be an injectable composition that includes a polyplex dissolved in a 0.5% glucose solution, where the polyplex is formed from the working and passenger RNA strands and the carrier molecule.

Abstract: A method and an apparatus for exclusive reinforcement learning are provided, comprising: collecting information of states of an environment through the communication interface and performing a statistical analysis on the states using the collected information; determining a first state value of a first state among the states in a training phase and a second state value of a second state among the states in an inference phase based on analysis results of the statistical analysis; performing reinforcement learning by using one reinforcement learning unit of a plurality of reinforcement learning unit which performs reinforcement learnings from different perspectives according to the first state value; and selecting one of actions determined by the plurality of reinforcement learning unit based on the second state value and applying selected action to the environment.