Abstract: A surgical method of cataract fragmentation and extraction via microbubble cavitation is described. In particular, gas-filled microbubbles are injected into a lens capsule of a subject's eye, and cavitation of the microbubbles is activated by applied ultrasound energy. The ultrasound energy can be applied from an external device. The cavitation fragments cataract tissues without damaging other tissue, such as the lens capsule. Fragmented lens material is then aspirated from the lens capsule. The method can be used alone or in conjunction with other methods, such as phacoemulsification.
Type:
Grant
Filed:
January 3, 2020
Date of Patent:
November 9, 2021
Assignees:
California Institute of Technology, The Regents of the University of California, United States Government represented by the Department of Veterans Affairs
Inventors:
Robert H. Grubbs, Marshall L. Stoller, Ying Han, Frank L. Brodie
Abstract: A technique to additively print onto a dissimilar material, especially ceramics and glasses (e.g., semiconductors, graphite, diamond, other metals) is disclosed herein. The technique enables manufacture of heat removal devices and other deposited structures, especially on heat sensitive substrates. It also enables novel composites through additive manufacturing. The process enables rapid bonding, orders-of-magnitude faster than conventional techniques.
Type:
Grant
Filed:
August 9, 2019
Date of Patent:
November 9, 2021
Assignee:
The Research Foundation for the State University of New York
Abstract: A training data generation method for human facial recognition and a data generation apparatus are provided. A large amount of virtual synthesized models are generated based on a face deformation model, where changes are made to face shapes, expressions, and/or angles to increase diversity of the training data. Experimental results show that the aforementioned training data may improve the accuracy of human face recognition.
Abstract: Provided herein is a method and system for analyzing a sample. In some embodiments the method makes use of a plurality of capture agents that are each linked to a different oligonucleotide and a corresponding plurality of labeled nucleic acid probes, wherein each of the labeled nucleic acid probes specifically hybridizes with only one of the oligonucleotides. The sample is labeled with the capture agents en masse, and sub-sets of the capture agents are detected using iterative cycles using corresponding subsets of the labeled nucleic acid probes.
Type:
Grant
Filed:
June 14, 2019
Date of Patent:
November 9, 2021
Assignee:
The Board of Trustees of the Leland Stanford Junior University
Inventors:
Garry P. Nolan, Nikolay Samusik, Julia Kennedy-Darling, Yury Goltsev
Abstract: Systems and methods are described herein to automatically detect objects and other debris located in the road. The lateral movement of a vehicle is monitored to detect lane changes. When a lane change is detected, information about the lane change including geographic coordinates of the lane change are collected. The information collected from various vehicles is correlated to identify possible locations of debris and other objects in the road. The identified locations may be provided to other vehicles for use in one or more navigation or collision detection systems or provided to one or more authorities who may use the information to address the identified objects or debris.
Abstract: Disclosed are methods to treat a renal disorder in a mammal in need thereof by administering to the mammal in need of treatment an effective amount of a store operated calcium entry (SOCE) inhibitor or a pharmaceutically acceptable salt thereof.
Type:
Application
Filed:
October 4, 2019
Publication date:
November 4, 2021
Applicant:
The Trustees of Indiana University
Inventors:
David P. Basile, Purvi Mehrotra, Michael S. Sturek
Abstract: Various aspects and embodiments disclosed herein relate generally to the modelling, treatment, reducing resistance to the treatment, prevention, and diagnosis of diseases characterized by the formation of cancers and cancer treatment induced symptoms including cardiotoxicity. Embodiments include methods of treating cancer, comprising the steps of: providing a patient diagnosed with cancer with a therapeutic regime that includes at least one therapeutically effective dose of at least one agent that reduces the activity of at least one Rho/Rho kinase pathway. Other embodiments include methods of treating cancer, comprising the steps of: treating a patient diagnosed with cancer with a combination of therapeutic agents that includes at least one therapeutically effective anti-cancer agent and at least one compound that reduces the activity of at least one Rho/Rho kinase pathway.
Abstract: A method of reducing the level of a transcription product in a cell comprising contacting with the cell a composition comprising a double-stranded nucleic acid complex comprising a first nucleic acid strand annealed to a second nucleic acid strand, wherein: (i) the first nucleic acid strand hybridizes to the transcription product and comprises (a) a region consisting of at least 4 consecutive nucleotides that are recognized by RNase H when the strand is hybridized to the transcription product, (b) one or more nucleotide analogs located on 5? terminal side of the region, (c) one or more nucleotide analogs located on 3? terminal side of the region and (d) a total number of nucleotides and nucleotide analogs ranging from 8 to 35 nucleotides and (ii) the second nucleic acid strand comprises (a) nucleotides and optionally nucleotide analogs and (b) at least 4 consecutive RNA nucleotides.
Type:
Application
Filed:
May 27, 2021
Publication date:
November 4, 2021
Applicants:
National University Corporation Tokyo Medical and Dental University, Osaka University
Abstract: Articles including a solid porous material having a selenium nanomaterial bound to a surface of and within the solid porous material. The article may be a include no polymeric stabilizer or proteinaceous stabilizer. The solid porous material may be a sponge, a film, a fabric, a non-woven material, or a metal-organic framework (MOF), or a combination thereof. The article may be produced by treating a solid porous material with an aqueous selenous acid solution and heating the solid porous material to form the selenium nanomaterial on the surface of and within the solid porous material.
Abstract: A transparent electrode with a transparent substrate and a composite layer disposed thereon, wherein the composite layer includes a graphene layer and a plurality of nanoparticles, wherein the nanoparticles are embedded in the graphene layer and extend through a thickness of the graphene layer, and wherein the plurality of nanoparticles are in direct contact with the transparent substrate and a gap is present between the graphene layer and the transparent substrate.
Type:
Application
Filed:
June 10, 2021
Publication date:
November 4, 2021
Applicant:
Imam Abdulrahman Bin Faisal University
Inventors:
Ahmed A. Maarouf, Khaled Abdelsabour Mohamed Elsayed
Abstract: Methods of treating propionic acidemia (PA), methylmalonic acidemia (MMA) and fatty acid oxidation disorders are described. The methods include administering an anaplerotic agent that can directly enter the tricarboxylic acid cycle, such as a succinate derivative or pro-drug, for example trisuccinylglycerol (TSG). Methods of restoring tricarboxylic acid (TCA) cycle function in a cell deficient for propionyl-CoA carboxylase (PCC) or methylmalonyl-CoA mutase (MUT) by contacting the cell with a succinate derivative or pro-drug, such as TSG, are also described.
Type:
Application
Filed:
July 7, 2021
Publication date:
November 4, 2021
Applicant:
University of Pittsburgh - Of the Commonwealth System of Higher Education
Abstract: The present disclosure relates to improvement of a cylinder structure of an internal combustion engine, in particular to a cylinder structure of a rotary piston internal combustion engine. The cylinder structure comprises a rotating shaft, the two sides of the rotating shaft are installed on machine bases, front deflector rods and rear deflectors rod are fixed to the two outer ends of the rotating shaft respectively, the included angles between the front deflector rods and the rear deflector rods are 29 degrees, the front deflector rods at the two outer ends are arranged in the radial direction of the rotating shaft at 180 degrees, and the rear deflector rods at the two outer ends are arranged in the radial direction of the rotating shaft at 180 degrees, and a combustion device and a compression device are sequentially arranged between the two machine bases.
Type:
Application
Filed:
December 29, 2020
Publication date:
November 4, 2021
Applicant:
Jiangxi University of Science and Technology
Abstract: Systems and methods for a multi-primary color system for display. A multi-primary color system increases the number of primary colors available in a color system and color system equipment. Increasing the number of primary colors reduces metameric errors from viewer to viewer. One embodiment of the multi-primary color system includes Red, Green, Blue, Cyan, Yellow, and Magenta primaries. The systems of the present invention maintain compatibility with existing color systems and equipment and provide systems for backwards compatibility with older color systems.
Type:
Application
Filed:
July 15, 2021
Publication date:
November 4, 2021
Applicant:
Baylor University
Inventors:
Mitchell J. Bogdanowicz, Ph.D., Corey P. Carbonara, Ph.D., Michael F. Korpi, James M. DeFilippis, Gary B. Mandle
Abstract: The present disclosure describes engineering of cells to co-express TNF-Related Apoptosis-Inducing Ligand (TRAIL) and Decoy Receptor 1 (DcR1). The expression of DcR1 results in competition for TRAIL binding to Death Receptors 4 and 5, thereby protecting the engineered cells from TRAIL-induced apoptosis. Such cells will exhibit longer survival such as when used in cell-based therapies for cancer.
Abstract: Provided herein are compositions and methods for modifying regulatory T cells. The inventors have identified nuclear factors that influence expression of Foxp3, a key transcriptional regulator of Treg cells. Treg cells can be modified by inhibiting and/or overexpressing one or more of these nuclear factors to produce stabilized Treg cells or destabilized Treg cells.
Type:
Application
Filed:
October 10, 2019
Publication date:
November 4, 2021
Applicant:
The Regents of the University of California
Inventors:
Alexander Marson, Jessica T. Cortez, Jeffrey A. Bluestone, Eric Shifrut, Frederic Van Gool
Abstract: De novo artificial protein based reporters that may be expressed in eukaryotic (e.g., mammalian) cells and methods of using the same are provided herein.
Type:
Application
Filed:
June 29, 2021
Publication date:
November 4, 2021
Applicant:
The Trustees of the University of Pennsylvania
Inventors:
Goutham KODALI, Molly Marie SHEEHAN, Joshua MANCINI, Bohdana Marie DISCHER, Michael MAGARACI, Nathan M. ENNIST, Brian CHOW, Peter Leslie DUTTON, Christopher MOSER
Abstract: The present invention provides methods and compositions for treating or preventing breast cancer with S-equol. The method and compositions are particularly suited to treating triple-negative breast cancer. The S-equol may be administered alone or in combination with one or more cytotoxic or immunotherapeutic compound or molecule.
Type:
Application
Filed:
July 9, 2021
Publication date:
November 4, 2021
Applicant:
The Board of Regents of the University of Texas System
Abstract: A traffic regulation system and method which combines energy harvesting from the movement of a plurality of vehicles on a roadway with wireless directional power beam transmission using the harvested energy to encourage compliance with traffic regulations. Electric power is generated from the movement of the moving vehicles by using a wind turbine to harvest wind energy from the movement of vehicles or by piezoelectric plates which harvest compression energy from the weight of the vehicle tires on the road surface. The electric power is transmitted to electric or hybrid vehicles which comply with the traffic regulations. The traffic regulations are one of driving at a posted speed and driving at a safe following distance. A control system adjusts the traffic regulation based on measurements received from a plurality of detectors.
Abstract: A composition for the treatment of bladder fibrosis in a patient in need that includes a miR-29 mimic is disclosed. The miR-29 mimic may include a working RNA strand with the nucleotide sequence UAGCACCAUCUGAAAUCGGUUUU (SEQ ID NO:4) and a passenger RNA strand comprising the nucleotide sequence: AACCGAUUUCuuuUGGUGCUAUU (SEQ ID NO:5). The passenger RNA strand includes a 2?-O-methylation modification to increase stability. Cholesterol is conjugated to the 3?-end of the passenger RNA strand to enhance cellular uptake. The composition may further include a carrier molecule including, but not limited to, branched polyethylenimine at an N/P ratio of 0.8, where N denotes the nitrogens of the polyethylenimine and P denotes the phosphate groups of the working and passenger RNA strands. In some aspects, the composition may be an injectable composition that includes a polyplex dissolved in a 0.5% glucose solution, where the polyplex is formed from the working and passenger RNA strands and the carrier molecule.
Type:
Application
Filed:
May 3, 2021
Publication date:
November 4, 2021
Applicants:
Washington University, Wisconsin Alumni Research Foundation
Inventors:
Jianghui Hou, Dale Bjorling, Zun-Yi Wang