Abstract: A mine field layout method suitable for fluidized mining of coal resources is provided. A main shaft and an air shaft are provided in the mine field, the bottom of the main shaft is located in the shallow horizontal coal seam zone, and the bottom of the air shaft is located in the deep horizontal coal seam zone. The horizontal main roadways are arranged at two boundaries along the strike of the coal seam, and inclined main roadways are arranged at two boundaries along the dip direction of the coal seam. Connecting roadways are located inside the mine field and are in communication with the horizontal main roadways. In the coal mining stage, the coal resources can be converted into the fluidized energy product and/or electricity by an unmanned automatic mining machine.

Abstract: Described herein are example methods and systems for neuro-behavioral relationships in dimensional geometric bedding (N-BRIDGE), which includes a comprehensive, data-driven analytic framework for mapping the multi-dimensional relationships between neural and behavioral features in humans N-BRIDGE allows mapping of variations along newly-defined data-driven behavioral dimensions that capture the geometry of behavioral/symptom variation to variation in specific neural features.

Abstract: The invention provides siRNA molecules for use in controlling pest infestation. The siRNA molecules target the mature mRNA of D. noxia cprr1-8 in a region between nucleotides 464 and 774 of SEQ ID NO: 23, or an equivalent region of an ortholog of D. noxia cprr1-8. Ingestion of the siRNA molecule by a pest inhibits the biological activity of the pest. In one embodiment, the siRNA molecule comprises a polynucleotide which has at least 80% sequence identity to the sequence 5? UAAACAAUCGCAAGAAGCUGA 3? (SEQ ID NO: 1) and a polynucleotide which has at least 80% sequence identity to the sequence 5? AGCUUCUUGCGAUUGUUUAAG 3? (SEQ ID NO: 2). Compositions comprising the siRNA molecules, vectors encoding the siRNA molecules, and methods for using the siRNA molecules are also provided.

Abstract: A computer vision pipeline is provided for fully automated interpretation of cardiac function, using a combination of machine learning strategies to enable building a scalable analysis pipeline for echocardiogram interpretation. Videos from patients with heart failure can be analyzed and processed as follows: 1) preprocessing of echo studies; 2) convolutional neural networks (CNN) processing for view identification; 3) segmentation of chambers and delineation of cardiac boundaries using CNNs; 4); particle tracking to compute longitudinal strain; and 5) targeted disease detection.

Abstract: The present invention relates to application of drofenine or a pharmaceutically acceptable salt thereof in the preparation of medicine for treating peripheral neuron axonal injury and peripheral related neuropathy. The drofenine or the pharmaceutically acceptable salt thereof has a significant effect on promoting growth of peripheral sensory neurites, and can relieve symptoms of low nerve conduction velocity and sensation loss of STZ-induced type I diabetic mice and db/db type II diabetic mice, thereby treating diabetic peripheral neuropathy.

Abstract: An electrochemical measurement apparatus includes: a tank containing electrolytic solution and a sample that generates or consumes measurement target substances in the electrolytic solution; a plurality of uniformly mixed working electrodes; and a counter electrode; the apparatus adapted to simultaneously apply a voltage between each of the working electrodes and the counter electrode; and the apparatus configured to measure a current that flows between each of the working electrodes and the counter electrode; wherein any two working electrode groups are mutually different in at least any of the determined voltage, presence/absence of a molecular modification of an electrode surface, and a species of the molecular modification; and whereby a distribution in measurement area of the currents that flow through the working electrodes is acquired.

Abstract: This system is directed to a computerized system for development of textiles with modified physical properties through stitching and can include a set of non-transitory computer readable instructions configured for: receiving a design pattern representing desired physical properties of a textile having a higher stiffness area and a lower stiffness area; developing a contiguous stitching pattern constrained by a pattern perimeter boundary and having a continuous stitching path, developing a first stiffness area within the contiguous stitching pattern having a first area of density, developing a second stiffness area within the contiguous stitching pattern having a second area of density wherein the first area of density has more stitch density than the second area of density, and transmitting the contiguous stitching pattern to an embroidery machine configured to provide a textile having the contiguous stitching pattern incorporating into the textile.

Abstract: A motion capture system and method are provided. In a motion capture method, a plurality of motion datasets are accessed. Each motion dataset is associated with a motion sensing unit at which timestamped motion data points of that motion dataset are generated, each motion sensing unit is configured to be in physical contact with a different part of a body of interest. Each timestamped motion data point is timestamped at the motion sensing unit at which it is generated using a clock time that is synchronized across the plurality of motion sensing units. The timestamped motion data points are processed to generate a kinematic model which describes motion of the respective parts of the body of interest.

Abstract: The inventors describe the use of a polymeric marker, in certain aspects the polymeric marker is conjugated polymeric marker such as P-C-3. Other aspects are directed to methods of analyzing the conjugated marker fluorescence spectral shape, which is strongly dependent on the local/ionic environment. This fluorescence marker is able to interact with and classify various analytes.

Abstract: A classification system of epileptic EEG signals based on non-linear dynamics features includes a preprocessing module, a feature extraction module, a feature sorting module, a feature selection module and a classification module: the preprocessing module uses discrete wavelet transformation to remove noise in the EEG data and obtain effective EEG signal data without noise; the feature extraction module uses multiple entropy algorithms to calculate the non-linear dynamics features of each EEG signal; the feature sorting module sorts features with analysis of variance; the feature selection module selects the optimal feature subset that has the most significant impact on the accuracy of the model uses a uses a forward sequential feature selection algorithm; the classification module transforms the judgment of EEG during the period of epilepsy and EEG during the interval period of epilepsy into a binary classification problem by use of a least squares support vector machine algorithm.

Abstract: A tunable CMOS circuit comprising a CMOS element and a tunable load. The CMOS element is configured to receive in an analogue input signal. The tunable load is connected to the CMOS element and configured to set a switch point of the CMOS element. The CMOS element is configured to output an output current that is largest when the analogue input signal is equal to the switch point. The combination of a CMOS element with a tunable load may also provide a hardware implementation of fuzzy logic. A fuzzy logic gate comprises an input node, a CMOS logic gate including a tunable load, and an output node. The input node is configured to receive an analogue input signal. The CMOS logic gate is connected to the input node. The tunable load is provided on a current path connected to the output node. The output node is configured to output an analogue output signal.

Abstract: The present disclosure describes methods of treating angiogenic disorders of the eye, such as macular degeneration, restenosis following glaucoma treatment or diabetic retinopathy, by administering an activator of C-X-C chemokine receptor 3 (CXCR3). In some embodiments, the activator of CXCR3 is interferon-?-inducible 10 kDa protein (IP-10) or a fragment or variant thereof, such as a fragment comprising or consisting of the C-terminal ?-helix of IP-10. In other embodiments, the activator of CXCR3 is platelet factor 4 (PF4) or a fragment or variant thereof.

Abstract: An antenna system can include a dielectric substrate having a top surface and a bottom surface that is covered by a ground plane. Four identical antenna elements can be disposed on the bottom surface. Each antenna element can be formed by a pentagonal slot that is etched out of the ground plane. The four antenna elements are positioned symmetrically such that a layout of the four antenna elements has left-right symmetry and top-bottom symmetry. The dielectric substrate can be rectangular, and each pentagonal slot can have a side that is parallel with a longer edge of the dielectric substrate without a center of the pentagonal slots positioned between the side and the longer edge. The antenna system can further include a varactor diode for each of the four antenna elements. A capacitance of the varactor diode is loaded across the respective pentagonal slot.

Abstract: A system includes at least one processor and at least one memory storing program instructions that, when executed by the at least one processor, cause the system to send an acoustic ranging transmitter signal between a plurality of calibration reference positions and at least one anchor point, receive an acoustic ranging receiver signal associated with the acoustic ranging transmitter signal and with distances between the plurality of calibration reference positions and the at least one anchor point, and estimate a speed of sound based on the acoustic ranging receiver signal.

Abstract: Provided are methods for treating Alzheimer's disease (AD), which in some embodiments can include administering to a subject in need thereof a composition that includes an inhibitor of an A? oligomer (A?O) biological activity. Also provided are methods for inhibiting development and/or progression of at least one symptom associated with AD, methods for inhibiting neuronal cell cycle re-entry (CRR), methods for inhibiting A? oligomer (A?O) biological activity, methods for inhibiting A? oligomer (A?O)-stimulated activation of calcium-calmodulin-dependent protein kinase II (CaMKII) biological activity, and methods for inhibiting calcium influx-induced excitotoxic neuronal death. In some embodiments, the inhibitor of the A?O biological activity or the inhibitor of N-methyl-D-aspartate receptor (NMDAR) signaling includes a small molecule inhibitor, an inhibitory nucleic acid, a calcium chelator, or any combination thereof.

Abstract: A method of treating a cancer in a patient includes obtaining a sample from the patient, using a C-circle assay to detect a presence of an alternative lengthening of telomeres (ALT) phenotype in the sample, and administering an effect amount of at least one of PRIMA-1 or APR-246 to the patient.

Abstract: Collection devices with valves for liquid specimens are disclosed. In an embodiment, the disclosure provides a collection device including a reservoir having a sealed cavity, the sealed cavity being under a negative pressure; a delivery tube in communication with the sealed cavity of the reservoir and having a delivery inlet, a delivery outlet, and a valve disposed between the delivery inlet and the delivery outlet, the valve being configured to control the communication and blocking between the delivery inlet and the delivery outlet, and an angle being formed by an extension line of the delivery inlet an extension line of the delivery outlet; and a piercing component for piercing a tissue is connected with the delivery inlet of the delivery tube.

Abstract: A method for determining a favorable time window of an infill well of an unconventional oil and gas reservoir, which comprises the following steps: S1, establishing a three-dimensional geological model with physical properties and geomechanical parameters; S2, establishing a natural fracture network model in combination with indoor core-logging-seismic monitoring; S3, calculating complex fractures in hydraulic fracturing of parent wells; S4, establishing an unconventional oil and gas reservoir model and calculating a current pore pressure field; S5, establishing a dynamic geomechanical model and calculating a dynamic geostress field; S6, calculating complex fractures in horizontal fractures of the infill well in different production times of the parent wells based on pre-stage complex fractures and the current geostress field; S7, analyzing a microseismic event barrier region and its dynamic changes in infill well fracturing; and S8, analyzing the productivity in different infill times, and determining an inf

Abstract: A sensor for isolating, identifying, and quantifying one or more analytes in a sample is provided, the sensor having a metal substrate base and a polymer waveguide disposed on the metal substrate base, the polymer waveguide including an optical channel and a polymer disposed in the optical channel; wherein the polymer waveguide optically couples a first and a second fiber optic cable. Also provided herein are methods of using the sensor for isolating, identifying, and quantifying one or more analytes in a sample, the method including contacting the polymer waveguide with a sample, sequentially heating the sensor to a plurality of temperature thresholds, obtaining an optical output at each temperature threshold, and analyzing differences in sequentially-obtained optical outputs in order to identify and determine concentrations of individual analytes of interest in the sample.

Abstract: A tracking system and a tracking method using the same are disclosed. The tracking system includes a marker, a camera unit, a first inertial measuring unit, a second inertial measuring unit and a tracking processing unit. The marker is fixed on the measurement object, and the camera unit outputs a marker image by photographing the marker. The first inertial measuring unit is fixed on the camera unit, and measures and outputs first inertia comprising first accelerated velocity and first angular velocity. The second inertial measuring unit is fixed to one of the measurement object and the marker, and measures and outputs second inertia comprising second accelerated velocity and second angular velocity. The tracking processing unit primarily extracts the position and the posture of the measurement object using the marker image, and secondarily extracts the position and the posture of the measurement object using the first and second inertias.