Abstract: An IoT system includes a computing module for controlling an integral function of the system and including an analysis unit and a machine learning unit. The analysis unit is capable of operational analysis and creating a predictive model and creating a predictive model according to the data analyzed. The machine learning unit has an algorithm function to create a corresponding learning model. An IoT module is electrically connected to the computing module to serve as an intermediate role. At least one detection unit is electrically connected to the IoT module and disposed in soil to detect data of environmental and soil conditions and sends the data detected to the computing module for subsequent analysis.

Abstract: The disclosure provides polypeptides comprising an engineered p27, or a fragment thereof. Such polypeptides may be used to form trimeric protein complexes with a cyclin-dependent kinase 4 (Cdk4) (or a variant thereof) or Cdk6 (or a variant thereof), and a cyclin D (CycD) or a variant thereof.

Abstract: This invention provides novel polydentate selective high affinity ligands (SHALs) that can be used in a variety of applications in a manner analogous to the use of antibodies. SHALs typically comprise a multiplicity of ligands that each bind different region son the target molecule. The ligands are joined directly or through a linker thereby forming a polydentate moiety that typically binds the target molecule with high selectivity and avidity.

Abstract: A composition comprising at least one sugar alcohol and a population of viable probiotic bacteria belonging to the class Bacilli is disclosed. The product is devoid of sugar or comprises no more than 5% of the amount of said sugar alcohol in the composition, the composition being formulated for oral delivery.

Abstract: The invention relates to an adjuvant comprising Pattern Recognition Receptor (PRR) agonist molecules linked to polymer chains that are capable of undergoing particle formation in aqueous conditions, or in aqueous conditions in response to external stimuli; and methods of treatment or prevention of disease using such an adjuvant.

Abstract: A respiratory training device providing both inspiratory and expiratory functional evaluation and training, as well as independent regulation of both the inspiratory and expiratory airway resistance levels used during training. The respiratory training device also includes data acquisition, recording, storage, retrieval and display functions for airway pressure monitoring data to provide functional evaluation, physiological monitoring, and diagnostic features. The respiratory training device allows the user to easily develop and follow precise and advanced training protocols, and utilize the respiratory device in both the clinical and home setting.

Abstract: The invention provides compounds of formula Ia, Ib, Ic, or as well as compositions comprising a compound of formula Ia-Id, methods of making such compounds, and methods of using such compounds, e.g., as inhibitors of bacterial RNA polymerase and as antibacterial agents.

Abstract: A method for predicting a face beauty grade includes the following steps of: acquiring a beautiful face image of a face beauty database, preprocessing the beautiful face image, and extracting a beauty feature vector of the beautiful face image, the preprocessing unifying data of the beautiful face image; recognizing continuous features of samples of the same type in a feature space by using a bionic pattern recognition model, and classifying the beauty feature vector to obtain a face beauty grade prediction model; and collecting a face image to be recognized, and inputting the face image to be recognized into the face beauty grade prediction model to predict a face beauty grade and obtain the beauty grade of the face image to be recognized.

Abstract: The invention provides siRNA molecules for use in controlling pest infestation. The siRNA molecules target the mature mRNA of D. noxia cprr1-8 in a region between nucleotides 464 and 774 of SEQ ID NO: 23, or an equivalent region of an ortholog of D. noxia cprr1-8. Ingestion of the siRNA molecule by a pest inhibits the biological activity of the pest. In one embodiment, the siRNA molecule comprises a polynucleotide which has at least 80% sequence identity to the sequence 5? UAAACAAUCGCAAGAAGCUGA 3? (SEQ ID NO: 1) and a polynucleotide which has at least 80% sequence identity to the sequence 5? AGCUUCUUGCGAUUGUUUAAG 3? (SEQ ID NO: 2). Compositions comprising the siRNA molecules, vectors encoding the siRNA molecules, and methods for using the siRNA molecules are also provided.

Abstract: A swallowing sensor device includes a sensor unit comprising a sensor and a device that wirelessly transmits information detected by the sensor and a board group formed by stacking a plurality of rigid boards. The board group includes a fist rigid board on which one part of the sensor unit is mounted, a second rigid board on which other part of the sensor unit except for the one part of the sensor unit is mounted, and a third rigid board being disposed between the first rigid board and the second rigid board and comprising a through-hole drilled thereon, the through-hole being configured to electrically connecting the one part and the other part.

Abstract: A computer vision pipeline is provided for fully automated interpretation of cardiac function, using a combination of machine learning strategies to enable building a scalable analysis pipeline for echocardiogram interpretation. Videos from patients with heart failure can be analyzed and processed as follows: 1) preprocessing of echo studies; 2) convolutional neural networks (CNN) processing for view identification; 3) segmentation of chambers and delineation of cardiac boundaries using CNNs; 4); particle tracking to compute longitudinal strain; and 5) targeted disease detection.

Abstract: A positive electrode material which is used in a positive electrode of a lithium ion secondary battery disclosed here includes a positive electrode active material including a compound capable of storing and releasing lithium ions, a first coating material disposed on at least a part of the surface of the positive electrode active material, and a second coating material disposed on at least a part of the surface of the positive electrode active material. The positive electrode material is characterized in that the first coating material contains a nickel oxide having a rock salt structure, and the second coating material contains a titanium oxide.

Abstract: The present invention provides an electrolyte for a rechargeable zinc-metal battery. The electrolyte comprises an aqueous solution having a pH of from about 3 to about 7; a zinc-ion based electrolyte comprising zinc ion and a fluorine containing anion; and a lithium salt of said fluorine containing anion. The electrolyte of the present invention not only enables substantially dendrite-free Zn plating/stripping at nearly 100% CE, but also retains water in the open atmosphere.

Abstract: A controlled thermal coefficient product manufacturing system and method is disclosed. The disclosed product relates to the manufacture of metallic material product (MMP) having a thermal expansion coefficient (TEC) in a predetermined range. The disclosed system and method provides for a first material deformation (FMD) of the MMP that comprises at least some of a first material phase (FMP) wherein the FMP comprises martensite randomly oriented and a first thermal expansion coefficient (FTC). In response to the FMD at least some of the FMP is oriented in at least one predetermined orientation. Subsequent to deformation, the MMP comprises a second thermal expansion coefficient (STC) that is within a predetermined range and wherein the thermal expansion of the MMP is in at least one predetermined direction. The MMP may be comprised of a second material phase (SMP) that may or may not transform to the FMP in response to the FMD.

Abstract: An arteriovenous graft and methods of reducing the risk of graft thrombosis and extending patency of the arteriovenous graft are provided herein. The arteriovenous graft is operable for attaching to a vein at a venous anastomosis. In some aspects, the arteriovenous graft includes a plurality of grooves at a venous anastomosis end of the arteriovenous graft and the venous anastomoses may be arranged such that the arteriovenous graft and the vein meet at an angle of 30° or less.

Abstract: Provided herein are methods for determining a metabolic rate for at least one endogenous short-chain fatty acid in a subject, for diagnosing a pulmonary disease in a subject and for diagnosing a neurological disorder in a subject. Generally in the methods stable isotope labeled short-chain fatty acid are pulsed and metabolic rates are calculated in a first baseline blood sample and in a series of second blood samples obtained at intervals. The metabolic rates provide information about fatty acid metabolism and production.

Abstract: A tracking system and a tracking method using the same are disclosed. The tracking system includes a marker, a camera unit, a first inertial measuring unit, a second inertial measuring unit and a tracking processing unit. The marker is fixed on the measurement object, and the camera unit outputs a marker image by photographing the marker. The first inertial measuring unit is fixed on the camera unit, and measures and outputs first inertia comprising first accelerated velocity and first angular velocity. The second inertial measuring unit is fixed to one of the measurement object and the marker, and measures and outputs second inertia comprising second accelerated velocity and second angular velocity. The tracking processing unit primarily extracts the position and the posture of the measurement object using the marker image, and secondarily extracts the position and the posture of the measurement object using the first and second inertias.

Abstract: The present technology relates generally to compositions and methods for creating recombinant T cell receptor (TCR) libraries and methods of their therapeutic use. The compositions and methods of the present technology are useful for rapid isolation of antigen-specific TCR repertoires as personalized, targeted therapies for cancer and viral infection.

Abstract: The present invention discloses a large-current power supply and a constant-current control method and system thereof. The large-current power supply provided by the present invention includes: a primary power supply, an energy-feedback circuit and a direct-current (DC) large-current generator; the energy-feedback circuit includes a freewheel diode and a magnetic reset winding; and a secondary coil of the DC large-current generator is connected to a load. Without an output rectifier diode and a filter capacitor at a load end of the large-current power supply provided by the present invention, the power consumption problem of the output rectifier diode at a large current is unnecessarily considered, and an electrolytic capacitor does not need to be used for filtration; and therefore, the service life of the power supply is greatly prolonged, a larger current is output easily by extending, and the power supply has the advantages of simple circuit, small size, easy control and high working reliability.

Abstract: Techniques for growing, at least one of: (a) quantum dots and (b) nano-crystals, on a surface of a material are provided. One method comprises placing a precursor on the surface; adding an antisolvent to the precursor; and growing at least one of the quantum dots and the nanocrystals on the surface.