Abstract: A physical layer transceiver, for connecting a host device to a wireline channel medium having a cable length, includes a host interface for coupling to a host device, a line interface for coupling to the channel medium, and filter circuitry operatively coupled to the line interface. The filter circuitry includes a plurality of filter segments, fewer in number than a total number of link segments in the cable length. Individual filter segments in the plurality of filter segments are configurable to correspond to individual link segments, and are separately controllable from other filter segments. Control circuitry detects a change of transmission conditions in a particular link segment, and upon detection of the change of transmission conditions, changes a configuration of one of the plurality of filter segments to cause an alteration in filtering of signals in the particular link segment at which the change of transmission conditions is detected.

Abstract: Described embodiments provide systems and methods for upgrading user space networking stacks without disruptions to network traffic. A first packet engine can read connection information of existing connections of a second packet engine written to a shared memory region by the second packet engine. The first packet engine can establish one or more virtual connections according to the connection information of existing connections of the second packet engine. Each of the first packet engine and the second packet engine can receive mirrored traffic data. The first packet engine can receive a first packet and determine that the first packet is associated with a virtual connection corresponding to an existing connection of the second packet engine. The first packet engine can drop the first packet responsive to the determination that the first packet is associated with the virtual connection.

Abstract: A building management system includes a search and control system coupled to a building network. The building network includes a plurality of devices of building equipment that operate to affect a variable state or condition within a building. The search and control system is configured to provide a search interface, receive filter criteria, perform a search regarding the devices of building equipment based on the filter criteria, return a set of search results based on the filter criteria, receive a selection of one or more devices of building equipment of the set of search results, receive command criteria regarding a command to provide to the one or more selected devices of building equipment, and provide the command to the one or more selected devices of building equipment. The command causes the one or more selected devices of building equipment to affect the variable state or condition within the building.

Abstract: Disclosed herein are microelectronic structures including bridges, as well as related assemblies and methods. In some embodiments, a microelectronic structure may include a substrate and a bridge.

Abstract: Disclosed herein are microelectronic structures including bridges, as well as related assemblies and methods. In some embodiments, a microelectronic structure may include a substrate and a bridge.

Abstract: Disclosed herein are microelectronic structures including bridges, as well as related assemblies and methods. In some embodiments, a microelectronic structure may include a substrate and a bridge.

Abstract: Disclosed herein are microelectronic structures including bridges, as well as related assemblies and methods. In some embodiments, a microelectronic structure may include a substrate and a bridge.

Abstract: Disclosed herein are microelectronic structures including bridges, as well as related assemblies and methods. In some embodiments, a microelectronic structure may include a substrate and a bridge.

Abstract: A method staging of knee osteoarthritis (OA) comprising a) obtaining a substantially cell-free sample of blood plasma or blood serum from a subject with osteoarthritis; b) detecting a presence of or measuring a level of one or more miRNAs selected from hsa-miR-335-3p, hsa-miR-199a-5p, hsa-miR-671-3p, hsa-miR-1260b, hsa-miR-191-3p, hsa-miR-335-5p, hsa-miR-543, novel_miRNA_1 (gucuggcucaggguuggg) (SEQ ID NO: 1), novel_miRNA_2 (ucccuguucgggcgccacu) (SEQ ID NO: 2), novel_miRNA_3 (uguuuagcauccuguagccugc) (SEQ ID NO: 3), and novel_miRNA_4 (uaguggguuaucagaacu) (SEQ ID NO: 4); and c) identifying the subject as likely to have early stage osteoarthritis or late stage osteoarthritis based on the presence of or measured level of the one or more miRNAs. Isolated nucleic acids, primers, probes, panels and kits are also provided.

Abstract: A first network device may receive first traffic of a session that involves a service. The first network device may identify that the service is configured for distributed node processing. The first network device may identify a second network device that is configured for distributed node processing. The first network device may identify a state machine that is associated with the service. The first network device may determine, based on the state machine, a first function and a second function, wherein the first function is identified by a first label and the second function is identified by a second label. The first network device may process the first traffic based on the first function. The first network device may provide, to the second network device, the first traffic and the second label to permit the second network device to process second traffic in association with the second function.

Abstract: A size associated with a content file is determined to be greater than a threshold size. Contents of the content file split across a plurality of component files are stored. Metadata, for the content file, is updated to reference a plurality of component file metadata structures for the component files. A node of the metadata is configured to track different sizes of portions of the content file stored in different component files of the plurality of component files. File metadata of the content file is split across the plurality of component file metadata structures and each component file metadata structure of the plurality of component file metadata structures specifies a corresponding structure organizing data components for a corresponding portion of the content file.

Abstract: One or more computing devices, systems, and/or methods for determining activity patterns based upon user activity and/or performing operations based upon the activity patterns are provided. For example, activity performed using a communication interface associated with a user account may be detected. The activity may be analyzed to determine an activity pattern associated with a first set of conditions. The activity pattern may be stored in a user profile associated with the user account. The user profile may comprise a plurality of activity patterns. Each activity pattern of the plurality of activity patterns may be associated with a set of conditions of a plurality of sets of conditions. It may be determined that the first set of conditions are met. Responsive to determining that the first set of conditions are met, one or more operations associated with the activity pattern may be performed.

Abstract: Provided is a method, computer program product, and system for performing data address prediction. The method comprises receiving a first instruction for execution by a processor. A load address predictor (LAP) accesses a LAP table entry for a section of an instruction cache. The section is associated with a plurality of instructions that includes the first instruction. The LAP predicts a set of data addresses that will be loaded using the LAP table entry. The method further comprises sending a recommendation to prefetch the set of data addresses to a load-store unit (LSU).

Abstract: In implementations of generating descriptions of image relationships, a computing device implements a description system which receives a source digital image and a target digital image. The description system generates a source feature sequence from the source digital image and a target feature sequence from the target digital image. A visual relationship between the source digital image and the target digital image is determined by using cross-attention between the source feature sequence and the target feature sequence. The system generates a description of a visual transformation between the source digital image and the target digital image based on the visual relationship.

Abstract: Methods, apparatus, and processor-readable storage media for generating data replication configurations using AI techniques are provided herein. An example computer-implemented method includes obtaining input data pertaining to at least one data replication operation; determining a set of configuration parameters for the at least one data replication operation by applying one or more AI techniques to at least a portion of the input data; and performing one or more automated actions based at least in part on the determined set of configuration parameters for the at least one data replication operation.

Abstract: For connection establishment, a system allocates memory that will be occupied by the data and handshake sub-protocol infrastructure that facilitates establishing a TLS connection. After connection establishment, the system allocates memory space for the data and record sub-protocol infrastructure that facilitates the asynchronous communication of application traffic. The memory space for the TLS session (i.e., the communication information separate from the handshake) has a substantially smaller footprint than the memory space for the TLS handshake. The TLS handshake memory space can be released and recycled for other connections while application communications use the smaller memory space allocated and populated with the TLS session data and infrastructure.

Abstract: Systems and methods are disclosed to address inter-cell interference in a heterogeneous network. In one embodiment, a system is disclosed, comprising: a coordinating node situated between a radio access network and a core network; and a first base station in the radio access network in communication with the coordinating node, wherein: the coordinating node has a coordinating scheduler with a first scheduling period; the first base station has a first base station scheduler with a second scheduling period shorter than the first scheduling period; the coordinating scheduler is configured to send a resource reservation list and a resource restriction list to the first base station scheduler once during each first scheduling period; and the first base station is configured to receive the resource reservation list and the resource restriction list and to use the resource reservation list and the resource restriction list when performing mobile device resource scheduling.

Abstract: Techniques are provided for providing a storage abstraction layer for a composite aggregate architecture. A storage abstraction layer is utilized as an indirection layer between a file system and a storage environment. The storage abstraction layer obtains characteristic of a plurality of storage providers that provide access to heterogeneous types of storage of the storage environment (e.g., solid state storage, high availability storage, object storage, hard disk drive storage, etc.). The storage abstraction layer generates storage bins to manage storage of each storage provider. The storage abstraction layer generates a storage aggregate from the heterogeneous types of storage as a single storage container. The storage aggregate is exposed to the file system as the single storage container that abstracts away from the file system the management and physical storage details of data of the storage aggregate.

Abstract: A data acquisition system may include an input for receiving an input signal for the data acquisition system, a plurality of data paths including a first data path and a second data path, and a signal estimator configured to determine a magnitude of the input signal using estimation of the input signal and dynamically deactivate one of the first and second data paths based on the magnitude of the input signal.

Abstract: An enterprise key management server operates in association with a location service that maintains information defining at least one physical boundary of the enterprise. Upon receipt at the key management server of a request that requires release of key material, an additional security check is performed. When the request is received from a GPS-enabled storage device, the key management server queries the location service to determine whether that device is within the boundary. If so, the key material is released. If the requesting device does not provide its location, or if the location service determines that the device is not within the boundary, the key management server fails the request so that the key material is not released. In this manner, the disclosure of the key material to a device that is no longer within the confines of the enterprise, e.g., because it has been stolen, is averted.