Abstract: A method to predict an increased risk of a greater susceptibility to a metal implant sensitivity in a test person. The method includes providing an isolated sample with a genetic material of the test person, and examining a single nucleotide polymorphism rs1143627 SEQ?ID?NO:?1 AGCCTCCTACTTCTGCTTTTGAAAGC[C/T]ATAAAA ACAGCGAGGGAGAACTGG,? in a gene coding for interleukin 1 beta and ascertaining whether a C is present at a position of the single nucleotide polymorphism, and/or examining a VNTR polymorphism rs2234663 with the repeat SEQ?ID?NO:?2 ATCCTGGGGAAAGTGAGGGAAATATGGACATCACATGGAACAACAT CCAGGAGACTCAGGCCTCTAGGAGTAACTGGGTAGTGTGC, in a gene coding for a IL1 receptor antagonist, IL1-RN and ascertaining whether the repeat is present five times.

Abstract: A rubber compound for use in a stator. The stator may be deployed in a positive displacement motor. The rubber compound includes a fiber reinforcement, wherein fibers in the fiber reinforcement create a grain direction in which “with the grain” is generally orthogonal to “across the grain”. In some embodiments, the rubber compound has a first value for 25% tensile Modulus across the grain and a second value for 25% tensile Modulus with the grain, wherein the first value is at least 10% lower than the second value. In such embodiments, the fiber reinforcement may further include a fiber loading of greater than 1.0 phr of fibers. In such embodiments, the rubber compound may further have a 25% tensile Modulus of greater than 400 psi across the grain and a 50% tensile Modulus of greater than 700 psi across the grain.

Abstract: A system for account mapping includes functionality for obtaining more than one labeled accounts labeled by more than one accountant; pre-processing more than one labeled accounts using natural language processing, using the more than one pre-processed labeled accounts to train an account mapping model that performs multinomial classification; receiving an account name from an accounting application where the account name includes a text label for an account included in a chart of accounts; generating an account mapping by applying the account mapping model to the account name, where the account mapping includes a type of the account, a sub-type of the account, a code, and a series associated with an accounting form; returning the account mapping to the accounting application through an Application Programming Interface (API); and receiving a corrected account mapping from an accountant and using the corrected account mapping as a new text label to incrementally update the account mapping model.

Abstract: Techniques for identifying and managing an organization's remote attack surface that account for the fluid nature of the remote attack surface are described. Data collected from organization-issued endpoint devices are obtained and analyzed to determine public IP addresses used by the endpoint devices. The devices connected to external networks (i.e., non-organization networks) at various time windows are identified by distinguishing between public IP addresses that are associated with the organization and those that are not. Data obtained from ongoing global probing of public IP addresses, which at least indicate software instances hosted on networks corresponding to the public IP address, are correlated with each public IP address determined to be associated with an external network to which an endpoint device has connected. From these data, any security risks that connections to external networks may pose to the organization's network can be identified.

Abstract: Devices, methods and systems for generating wideband, high-fidelity arbitrary radio frequency (RF) passband signals are described. A voltage tunable optical filter for arbitrary RF passband signal generation includes a first input configured to receive a broadband optical pulse train, a second input configured to receive a first control voltage representative of an amplitude signal, an electrooptic modulator to receive the broadband optical pulse train and the first control voltage, to modulate the broadband optical pulse train in accordance with the amplitude signal, and to produce two complementary optical outputs that form two arms of an interferometer, an optical delay component to impart an optical path difference into one of the complementary outputs of the electrooptic modulator, and a combiner or a splitter to receive two complementary optical outputs of the electrooptic modulator after impartation of the optical path difference and to produce an output interference pattern of fringes.

Abstract: A sensor pod system includes one or more sensor pods with a plurality of sensors configured to collect data from an environment. A sensor pod may have an effective field of view created by individual sensors with overlapping fields of view. The sensor pod system may include sensors of different types and modalities. Sensor pods of the sensor pod system may be modularly disposed on a vehicle, for example, an autonomous vehicle to collect and provide data of the environment during operation of the vehicle. The sensor pods may be disposed at elevated locations around the vehicle to reduce obstacles within the sensor pods fields of view.

Abstract: Example implementations relate to metadata operations in a storage system. An example storage system includes a machine-readable storage storing instructions executable by a processor to determine to generate a synthetic full backup based on data stream representations of a plurality of data streams. The instructions are also executable to, in response to a determination to generate the synthetic full backup, create a logical group including the data stream representations. The instructions are also executable to specify a cache resource allocation for the logical group, and generate the synthetic full backup from data stream representations using an amount of a cache resource limited by the cache resource allocation for the logical group.

Abstract: A glass container is provided having a glass tube with a first end and a second end and a glass bottom closing the second end. The glass tube has a longitudinal axis and has, in a direction from the first to the second end, a top region, a junction region, a neck region, a shoulder region, and a body region. The top region is at the first end and has an outer diameter (dt), the neck region has an outer diameter (dn) with dn<dt, the body region extends to the second end and has an outer diameter (db) with db>dt, and the glass tube in the body region has a thickness (lb). The outer contour in a transition area between the top and neck regions is defined by a radius of curvature. The glass containers have a neck squeeze test load of at least 1100 N.

Abstract: An anti-polish ring for an internal combustion engine is provided. The anti-polish ring includes an axially extending ring portion that is configured to scrape a top portion of a piston in a cylinder liner. The anti-polish ring is configured to accommodate passage of an intake or exhaust valve thereby. The anti-polish ring may include an alignment feature so that the anti-polish ring is inserted in a predetermined orientation in the cylinder. The anti-polish ring may include a heat shield and/or a seating member.

Abstract: The invention provides a delayed release dosage form and a bolus configured for administration to an animal, wherein said dosage form and said bolus is configured to release a hydrophobic substance to the animal over a period of time. Preferably the hydrophobic substance is a haloform. Also provided is the use of the delayed release dosage form or bolus of the invention to reduce methane production in a ruminant animal. Also provided is the method of manufacturing a bolus of the invention.

Abstract: The invention provides a delayed release dosage form and a bolus configured for administration to an animal, wherein said dosage form and said bolus is configured to release a hydrophobic substance to the animal over a period of time. Preferably the hydrophobic substance is a haloform. Also provided is the use of the delayed release dosage form or bolus of the invention to reduce methane production in a ruminant animal. Also provided is the method of manufacturing a bolus of the invention.

Abstract: A system for a virtual integrated remote assistant is provided. In some implementations, the system performs operations comprising receiving an input for a surgical procedure. The operations further include determining first feedback for the surgical procedure. The operations further include receiving, in response to the first feedback, a user input. The operations further include receiving second feedback from a laser apparatus. The operations further include performing eye tracking verification for a user. The operations further include displaying a graphical display of a virtual assistant. Related systems, methods, and articles of manufacture are also described.

Abstract: Tapered stator designs are engineered in a positive displacement motor (PDM) power section to relieve stator stress concentrations at the lower (downhole) end of the power section in the presence of rotor tilt. A contoured stress relief (i.e. a taper) is provided in the stator to compensate for rotor tilt, where the taper is preferably more aggressive at the lower end of the stator near the bit.

Abstract: Devices, systems and methods for encoding information using optical components are described. Information associated with a first optical signal (e.g., an optical pump) is encoded onto the phase of a second optical signal (e.g., an optical probe) using cross phase modulation (XPM) in a non-linear optical medium. The optical signals are multiplexed together into the nonlinear optical medium. The probe experiences a modified index of refraction as it propagates through the medium and thus accumulates a phase change proportional to the intensity of the pump. The disclosed devices can be incorporated into larger components and systems for various applications such as scientific diagnostics, radar, remote sensing, wireless communications, and quantum computing that can benefit from encoding and generation of low noise, high resolution signals.

Abstract: Example implementations relate to storing manifest portions in a metadata cache. An example includes receiving, by a storage controller, a read request associated with a first data unit. In response to receiving the read request, the storage controller stores a manifest portion in a metadata cache, the stored manifest portion comprising a plurality of records, the plurality of records including a first record associated with the first data unit. The storage controller determines storage information of the first data unit using pointer information included in the first record of the stored manifest portion, and replaces the pointer information in the first record with the determined storage information of the first data unit.

Abstract: The invention relates to a housing (20) for electrically isolating and mechanically stabilizing a plug-in coil element (10), wherein the plug-in coil element (10) has a coil (13) having a winding body (30), a first coil end (15) and a second coil end (16), as well as a first connecting element (11) for electrically connecting to a connecting element along a plug-in direction (S), and a second connecting element (12) for electrically connecting along the plug-in direction (S), wherein the winding body (30) has a first winding body end (31) and a second winding body end (32), and the first coil end (15) is formed to be spaced from the first winding body end (31), and the second coil end (16) is formed to be spaced from the second winding body end (32), wherein the first connecting element (11) is connected to the first coil end (15), and the second connecting element (12) is connected to the second coil end (16), moreover having protruding from a housing opening (39) to the outside, a sheathing portion (21)

Abstract: A rubber compound for use in a stator in a positive displacement motor. The rubber compound includes a fiber reinforcement, wherein fibers in the fiber reinforcement create a grain direction in which “with the grain” is generally orthogonal to “across the grain”. In some embodiments, the rubber compound has a first value for 25% tensile Modulus across the grain and a second value for 25% tensile Modulus with the grain, wherein the first value is at least 10% lower than the second value. In such embodiments, the fiber reinforcement may further include a fiber loading of greater than 5.0 phr of fibers. In such embodiments, the rubber compound may further have a 25% tensile Modulus of greater than 400 psi across the grain and a 50% tensile Modulus of greater than 700 psi across the grain.

Abstract: A services platform acts as an intermediary between an existing enterprise analytic environment, and one or more underlying cloud service providers. The platform provides enterprise “big data-as-a-service,” by which an enterprise can seamlessly and easily provision new capacity for processing its analytic workload, and migrate data sources (e.g., data warehouse marts, enterprise data warehouses, analytic sandboxes, and the like) to the cloud for processing. The platform provides end-to-end enterprise class manageability of enterprise data assets, from data collection, aggregation, movement, staging and processing, all while providing service levels, security, access and governance. The platform integrates directly but seamlessly into the enterprise analytic stack, and existing analytics applications work as normal. The platform provides a way for the enterprise to translate its workloads into clusters of compute resources that meet its service level requirements.

Abstract: The invention provides a delayed release dosage form and a bolus configured for administration to an animal, wherein the dosage form and the bolus is configured to release a hydrophobic substance to the animal over a period of time. Preferably the hydrophobic substance is a haloform. Also provided is the use of the delayed release dosage form or bolus of the invention to reduce methane production in a ruminant animal. Also provided is the method of manufacturing a bolus of the invention.

Abstract: The present invention relates to a system for the preparation of a packaged food composition, wherein the system comprises a collecting unit, a weighting unit, a mixing unit, a filling unit, transferring units and a control unit.