Novel potassium channel molecules and uses therefor

Abstract

The invention provides isolated nucleic acids molecules, designated ERG-LP nucleic acid molecules, which encode proteins involved in potassium channel mediated activities. The invention also provides antisense nucleic acid molecules, recombinant expression vectors containing ERG-LP nucleic acid molecules, host cells into which the expression vectors have been introduced, and nonhuman transgenic animals in which an ERG-LP gene has been introduced or disrupted. The invention still further provides isolated ERG-LP proteins, fusion proteins, antigenic peptides and anti-ERG-LP antibodies. Diagnostic methods utilizing compositions of the invention are also provided.

Description

RELATED APPLICATIONS

[0001] This application claims priority U.S. patent application Ser. No. 09/119,855, filed on Jul. 21, 1998, incorporated herein in its entirety by this reference.

BACKGROUND OF THE INVENTION

[0002] The fundamental function of a neuron is to receive, conduct, and transmit signals. Despite the varied purpose of the signals carried by different classes of neurons, the form of the signal is always the same and consists of changes in the electrical potential across the plasma membrane of the neuron. The plasma membrane of a neuron contains voltage-gated cation channels, which are responsible for generating this electrical potential (also referred to as an action potential or nerve impulse) across the plasma membrane.

[0003] One class of voltage-gated cation channels are the voltage-gated potassium channels (Kv). These include: (1) the delayed potassium channels, which repolarize the membrane after each action potential to prepare the cell to fire again; (2) the early potassium channels, which open when the membrane is depolarized and act to reduce the rate of firing at levels of stimulation which are just above the threshold required for firing; and (3) the calcium-activated potassium channels, which act along with the voltage-gated calcium channels to decrease the response of the cell to an unchanging prolonged stimulation, a process called adaptation. In addition to being critical for action potential conduction, the voltage-gated potassium channels also play a role in neurotransmitter release. As a result of these activities, voltage-gated potassium channels are important in controlling neuronal excitability (Hille B., Ionic Channels of Excitable Membranes, Second Edition, Sunderland, Mass.: Sinauer, (1992)).

[0004] There is a suprising amount of structural and functional diversity within the voltage-gated potassium channels. This diversity is generated both by the existence of multiple genes and by alternative splicing of RNA transcripts produced from the same gene. Nonetheless, the amino acid sequences of the known voltage-gated potassium channels show similarity. The Drosophila SH locus was the first potassium channel structural gene to be isolated (Kamb A. et al. (1987) Cell 50: 405). Since then, a number of additional potassium channel genes have been cloned from Drosophila and other organisms (Baumann A. et al. (1988) EMBO J. 7: 2457). One of these genes is the X-linked EAG locus, which was originally identified in Drosophila on the basis of mutations that cause a leg-shaking phenotype (Kaplan W. D. et al. (1969) Genetics 61: 399). Electrophysiological studies revealed that EAG mutations caused spontaneous repetitive firing in motor axons and elevated transmitter release at the larval neuromuscular junction (Ganetzky B. et al. (1985) Trends Neurosci. 8:322). The striking hyperexcitability of EAG mutants demonstrates the importance of EAG channels in maintaining normal neuronal excitability in Drosophila (Ganetzky B. et al. (1983) J. Neurogenet. 1: 17-28).

[0005] EAG, along with m-EAG, ELK, and h-ERG define a family of potassium channel genes in Drosophila and mammals. A distinctive feature of the EAG/ERG family is the homology to cyclic nucleotide binding domains of cyclic nucleotide-gated cation channels and cyclic nucleotide-activated protein kinases (Kaupp, U. B. et al. (1991) Trends Neurosci. 14: 150-157). However, unlike the vertebrate cyclic nucleotide-gated cation channels, which are relatively voltage-insensitive, activation of EAG/ERG channels shows a very steep voltage dependence (Robertson, G. et al. (1993) Biophys. J. 64: 430). In addition, whereas cyclic nucleotide-activated cation channels show little selectivity among monovalent and divalent cations, eag is strongly selective for K+ over Na+. The EAG/ERG family may thus be an evolutionary link between voltage-activated potassium channels and cyclic nucleotide-gated cation channels with intermediate structural and functional properties.

SUMMARY OF THE INVENTION

[0006] The present invention is based, at least in part, on the discovery of novel ERG potassium channel family members, referred to herein as “ERG-like proteins” (“ERG-LP”) nucleic acid and protein molecules. The ERG-LP molecules of the present invention are useful as targets for developing modulating agents to regulate a variety of cellular processes. Accordingly, in one aspect, this invention provides isolated nucleic acid molecules encoding ERG-LP proteins or biologically active portions thereof, as well as nucleic acid fragments suitable as primers or hybridization probes for the detection of ERG-LP-encoding nucleic acids.

[0007] In one embodiment, an ERG-LP nucleic acid molecule of the invention is at least 28%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or more homologous to the nucleotide sequence (e.g., to the entire length of the nucleotide sequence) shown in SEQ ID NO:1, SEQ ID NO:3, or a complement thereof. In another embodiment, an ERG-LP nucleic acid molecule of the invention is at least 42%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or more homologous to the nucleotide sequence (e.g., to the entire length of the nucleotide sequence) shown in SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:15, SEQ ID NO:17, or a complement thereof. In another embodiment, an ERG-LP nucleic acid molecule of the invention is at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or more homologous to the nucleotide sequence (e.g., to the entire length of the nucleotide sequence) shown in SEQ ID NO:7, SEQ ID NO:9, or a complement thereof.

[0008] In a preferred embodiment, the isolated nucleic acid molecule includes the nucleotide sequence shown SEQ ID NO:1 or 3, or a complement thereof. In another embodiment, the nucleic acid molecule includes SEQ ID NO:3 and nucleotides 1-112 of SEQ ID NO:1. In another preferred embodiment, the nucleic acid molecule has the nucleotide sequence shown in SEQ ID NO:1 or 3. In another preferred embodiment, the nucleic acid molecule includes a fragment of at least 949 nucleotides of the nucleotide sequence of SEQ ID NO:1, SEQ ID NO:3, or a complement thereof.

[0009] In another preferred embodiment, the isolated nucleic acid molecule includes the nucleotide sequence shown SEQ ID NO:4 or 6, or a complement thereof. In another embodiment, the nucleic acid molecule includes SEQ ID NO:6 and nucleotides 1-214 of SEQ ID NO:4. In yet another embodiment, the nucleic acid molecule includes SEQ ID NO:6 and nucleotides 1844-2694 of SEQ ID NO:4. In another preferred embodiment, the nucleic acid molecule has the nucleotide sequence shown in SEQ ID NO:4 or 6. In another preferred embodiment, the nucleic acid molecule includes a fragment of at least 307 nucleotides of the nucleotide sequence of SEQ ID NO:4, SEQ ID NO:6, or a complement thereof.

[0010] In another preferred embodiment, the isolated nucleic acid molecule includes at least 200 consecutive nucleotides, more preferably at least 400 consecutive nucleotides, more preferably at least 600 consecutive nucleotides, more preferably at least 800 consecutive nucleotides, more preferably at least 1000 consecutive nucleotides, more preferably at least 1200 consecutive nucleotides, more preferably at least 1400 consecutive nucleotides, more preferably at least 1500 consecutive nucleotides of the nucleotide sequence shown SEQ ID NO:4 or 6, or a complement thereof.

[0011] In another preferred embodiment, the isolated nucleic acid molecule includes the nucleotide sequence shown SEQ ID NO:7 or 9, or a complement thereof. In another embodiment, the nucleic acid molecule includes SEQ ID NO:9 and nucleotides 1-262 of SEQ ID NO:7. In another preferred embodiment, the nucleic acid molecule has the nucleotide sequence shown in SEQ ID NO:7 or 9. In another preferred embodiment, the nucleic acid molecule includes a fragment of at least 1114 nucleotides of the nucleotide sequence of SEQ ID NO:7, SEQ ID NO:9, or a complement thereof.

[0012] In another preferred embodiment, the isolated nucleic acid molecule includes the nucleotide sequence shown SEQ ID NO:15 or 17, or a complement thereof. In another embodiment, the nucleic acid molecule includes SEQ ID NO:17 and nucleotides 1-195 of SEQ ID NO:15. In yet another embodiment, the nucleic acid molecule includes SEQ ID NO:17 and nucleotides 3517-5107 of SEQ ID NO:15. In another preferred embodiment, the nucleic acid molecule has the nucleotide sequence shown in SEQ ID NO:15 or 17.

[0013] In another embodiment, an ERG-LP nucleic acid molecule includes a nucleotide sequence encoding a protein having an amino acid sequence sufficiently homologous to the amino acid sequence of SEQ ID NO:2, SEQ ID NO:5, SEQ ID NO:8, or SEQ ID NO:16. In a preferred embodiment, an ERG-LP nucleic acid molecule includes a nucleotide sequence encoding a protein having an amino acid sequence at least 37%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or more homologous to the amino acid sequence of SEQ ID NO:2, or SEQ ID NO:8. In another preferred embodiment, an ERG-LP nucleic acid molecule includes a nucleotide sequence encoding a protein having an amino acid sequence at least 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 93%, 95% or more homologous to the amino acid sequence of SEQ ID NO:5 or SEQ ID NO:16.

[0014] In another preferred embodiment, an isolated nucleic acid molecule encodes the amino acid sequence of human or monkey ERG-LP1. In yet another preferred embodiment, the nucleic acid molecule includes a nucleotide sequence encoding a protein having the amino acid sequence of SEQ ID NO: 2, or SEQ ID NO:8. In yet another preferred embodiment, the nucleic acid molecule is at least 387 nucleotides in length and encodes a protein having an ERG-LP1 activity (as described herein). In yet another preferred embodiment, an isolated nucleic acid molecule encodes the amino acid sequence of human ERG-LP-2. In yet another preferred embodiment, the nucleic acid molecule includes a nucleotide sequence encoding a protein having the amino acid sequence of SEQ ID NO: 5 or SEQ ID NO:16.

[0015] Another embodiment of the invention features nucleic acid molecules, preferably ERG-LP nucleic acid molecules, which specifically detect ERG-LP nucleic acid molecules relative to nucleic acid molecules encoding non-ERG-LP proteins. For example, in one embodiment, such a nucleic acid molecule is at least 949, 950-1000, 1000-1050, 1050-1100 or more nucleotides in length and hybridizes under stringent conditions to a nucleic acid molecule comprising the nucleotide sequence shown in SEQ ID NO:1, or a complement thereof. In preferred embodiments, the nucleic acid molecules are at least 15 (e.g., contiguous) nucleotides in length and hybridize under stringent conditions to nucleotides 1082-1100, 1258-1289, 1336-1343, 1404-1430, 2190-2428, or 3107-3355 of SEQ ID NO:1. In other preferred embodiments, the nucleic acid molecules comprise nucleotides 1082-1100, 1258-1289, 1336-1343, 1404-1430, 2190-2428, or 3107-3355 of SEQ ID NO:1.

[0016] In another particularly preferred embodiment, the nucleic acid molecule comprises a fragment of at least 307, 350-400, 400-450, 450-500 or more nucleotides of the nucleotide sequence of SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:15, SEQ ID NO:17, or a complement thereof. In preferred embodiments, the nucleic acid molecules are at least 15 (e.g., contiguous) nucleotides in length and hybridize under stringent conditions to nucleotides 1-29, 442-621, 755-1013, 1170-1246, or 1463-1651 of SEQ ID NO:4. In other preferred embodiments, the nucleic acid molecules include nucleotides 1-29, 442-621, 755-1013, 1170-1246, or 1463-1651 of SEQ ID NO:4.

[0017] In other preferred embodiments, the nucleic acid molecule encodes a naturally occurring allelic variant of a polypeptide comprising the amino acid sequence of SEQ ID NO:2, wherein the nucleic acid molecule hybridizes to a nucleic acid molecule comprising SEQ ID NO:1 or SEQ ID NO:3 under stringent conditions. In yet other preferred embodiments, the nucleic acid molecule encodes a naturally occurring allelic variant of a polypeptide comprising the amino acid sequence of SEQ ID NO:5, wherein the nucleic acid molecule hybridizes to a nucleic acid molecule comprising SEQ ID NO:4 or SEQ ID NO:6 under stringent conditions. In other preferred embodiments, the nucleic acid molecule encodes a naturally occurring allelic variant of a polypeptide comprising the amino acid sequence of SEQ ID NO:8, wherein the nucleic acid molecule hybridizes to a nucleic acid molecule comprising SEQ ID NO:7 or SEQ ID NO:9 under stringent conditions. In yet other preferred embodiments, the nucleic acid molecule encodes a naturally occurring allelic variant of a polypeptide comprising the amino acid sequence of SEQ ID NO:16, wherein the nucleic acid molecule hybridizes to a nucleic acid molecule comprising SEQ ID NO:15 or SEQ ID NO:17 under stringent conditions.

[0018] Another embodiment of the invention provides an isolated nucleic acid molecule which is antisense to an ERG-LP nucleic acid molecule, e.g., the coding strand of an ERG-LP nucleic acid molecule.

[0019] Another aspect of the invention provides a vector comprising an ERG-LP nucleic acid molecule. In certain embodiments, the vector is a recombinant expression vector. In another embodiment, the invention provides a host cell containing a vector of the invention. The invention also provides a method for producing a protein, preferably an ERG-LP protein, by culturing in a suitable medium, a host cell, e.g., a mammalian host cell such as a non-human mammalian cell, of the invention containing a recombinant expression vector, such that the protein is produced.

[0020] Another aspect of this invention features isolated or recombinant ERG-LP proteins and polypeptides. In one embodiment, the isolated protein, preferably an ERG-LP protein, includes at least one transmembrane domain. In another embodiment, the isolated protein, preferably an ERG-LP protein, includes a P-loop. In another embodiment, the isolated protein, preferably an ERG-LP protein, includes a cyclic nucleotide-binding domain. In another embodiment, the isolated protein, preferably an ERG-LP protein, includes transmembrane region cyclic nucleotide gated channel domain. In another embodiment, the isolated protein, preferably an ERG-LP protein, includes at least one transmembrane domain, a P-loop, a cyclic nucleotide-binding domain, and a transmembrane region cyclic nucleotide gated channel domain. In a preferred embodiment, the protein, preferably an ERG-LP protein, includes at least one transmembrane domain, a P-loop, and a cyclic nucleotide-binding domain, and has an amino acid sequence at least about 25%, 30%, 35%, 37%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 93%, 95% or more homologous to the amino acid sequence of SEQ ID NO:2, SEQ ID NO:5, SEQ ID NO:8, or SEQ ID NO:16. In another preferred embodiment, the protein, preferably an ERG-LP protein, includes at least one transmembrane domain and plays a role in generating an electrical potential across a plasma membrane, e.g., a neuronal plasma membrane or a muscle plasma membrane. In another preferred embodiment, the protein, preferably an ERG-LP protein, includes at least one P-loop and plays a role in generating an electrical potential across a plasma membrane, e.g., a neuronal plasma membrane or a muscle plasma membrane. In another preferred embodiment, the protein, preferably an ERG-LP protein, includes at least one cyclic nucleotide-binding domain, and plays a role in generating an electrical potential across a plasma membrane, e.g., a neuronal plasma membrane or a muscle plasma membrane. In another preferred embodiment, the protein, preferably an ERG-LP protein, includes at least one transmembrane region cyclic nucleotide gated channel domain and plays a role in generating an electrical potential across a plasma membrane, e.g., a neuronal plasma membrane or a muscle plasma membrane. In another preferred embodiment, the protein, preferably an ERG-LP protein, includes at least one transmembrane domain and a P-loop, and plays a role in generating an electrical potential across a plasma membrane, e.g., a neuronal plasma membrane or a muscle plasma membrane. In another preferred embodiment, the protein, preferably an ERG-LP protein, includes at least one transmembrane domain and a cyclic nucleotide-binding domain, and plays a role in generating an electrical potential across a plasma membrane, e.g., a neuronal plasma membrane or a muscle plasma membrane. In another preferred embodiment, the protein, preferably an ERG-LP protein, includes at least one transmembrane domain and a transmembrane region cyclic nucleotide gated channel domain, and plays a role in generating an electrical potential across a plasma membrane, e.g., a neuronal plasma membrane or a muscle plasma membrane. In another preferred embodiment, the protein, preferably an ERG-LP protein, includes at least one P-loop and a cyclic nucleotide-binding domain, and plays a role in generating an electrical potential across a plasma membrane, e.g., a neuronal plasma membrane or a muscle plasma membrane. In another preferred embodiment, the protein, preferably an ERG-LP protein, includes at least one P-loop and a transmembrane region cyclic nucleotide gated channel domain, and plays a role in generating an electrical potential across a plasma membrane, e.g., a neuronal plasma membrane or a muscle plasma membrane. In another preferred embodiment, the protein, preferably an ERG-LP protein, includes at least one transmembrane domain, a P-loop, and a cyclic nucleotide-binding domain, and plays a role in generating an electrical potential across a plasma membrane, e.g., a neuronal plasma membrane or a muscle plasma membrane. In another preferred embodiment, the protein, preferably an ERG-LP protein, includes at least one transmembrane domain, a P-loop, and a transmembrane region cyclic nucleotide gated channel domain, and plays a role in generating an electrical potential across a plasma membrane, e.g., a neuronal plasma membrane or a muscle plasma membrane. In yet another preferred embodiment, the protein, preferably an ERG-LP protein, includes at least one transmembrane domain, a P-loop, and a cyclic nucleotide-binding domain, and is encoded by a nucleic acid molecule having a nucleotide sequence which hybridizes under stringent hybridization conditions to a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:7, or SEQ ID NO:9.

[0021] In another preferred embodiment, the isolated protein includes at least 50 consecutive amino acids, more preferably at least 100 consecutive amino acids, more preferably at least 150 consecutive amino acids, more preferably at least 200 consecutive amino acids, more preferably at least 250 consecutive amino acids, more preferably at least 350 consecutive amino acids, more preferably at least 450 consecutive amino acids, more preferably at least 500 consecutive amino acids of the amino acid sequence shown SEQ ID NO:5 or 16.

[0022] In another embodiment, the invention features fragments of the proteins having the amino acid sequence of SEQ ID NO:2, SEQ ID NO:5, or SEQ ID NO:8 or SEQ ID NO:16, wherein the fragment comprises at least 15 amino acids (e.g., contiguous amino acids) of the amino acid sequence of SEQ ID NO:2, SEQ ID NO:5, SEQ ID NO:8 or SEQ ID NO:16. In another embodiment, the protein, preferably an ERG-LP protein, has the amino acid sequence of SEQ ID NO:2, SEQ ID NO:5, or SEQ ID NO:8 or SEQ ID NO:16.

[0023] In another embodiment, the invention features an isolated protein, preferably an ERG-LP protein, which is encoded by a nucleic acid molecule having a nucleotide sequence at least about 28%, 30%, 35%,40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or more homologous to a nucleotide sequence of SEQ ID NO:1, SEQ ID NO:3, or a complement thereof. In yet another embodiment, the invention features an isolated protein, preferably an ERG-LP protein, which is encoded by a nucleic acid molecule having a nucleotide sequence at least about 42%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or more homologous to a nucleotide sequence of SEQ ID NO:4, SEQ ID NO:6, or a complement thereof. In yet another embodiment, the invention features an isolated protein, preferably an ERG-LP protein, which is encoded by a nucleic acid molecule having a nucleotide sequence at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or more homologous to a nucleotide sequence of SEQ ID NO:7, SEQ ID NO:9, or a complement thereof. In yet another embodiment, the invention features an isolated protein, preferably an ERG-LP protein, which is encoded by a nucleic acid molecule having a nucleotide sequence at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or more homologous to a nucleotide sequence of SEQ ID NO:15, SEQ ID NO:17, or a complement thereof. This invention further features an isolated protein, preferably an ERG-LP protein, which is encoded by a nucleic acid molecule having a nucleotide sequence which hybridizes under stringent hybridization conditions to a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:15, SEQ ID NO:17 or a complement thereof.

[0024] The proteins of the present invention or biologically active portions thereof, can be operatively linked to a non-ERG-LP polypeptide (e.g., heterologous amino acid sequences) to form fusion proteins. The invention further features antibodies, such as monoclonal or polyclonal antibodies, that specifically bind proteins of the invention, preferably ERG-LP proteins. In addition, the ERG-LP proteins or biologically active portions thereof can be incorporated into pharmaceutical compositions, which optionally include pharmaceutically acceptable carriers.

[0025] In another aspect, the present invention provides a method for detecting the presence of an ERG-LP nucleic acid molecule, protein or polypeptide in a biological sample by contacting the biological sample with an agent capable of detecting an ERG-LP nucleic acid molecule, protein or polypeptide such that the presence of an ERG-LP nucleic acid molecule, protein or polypeptide is detected in the biological sample.

[0026] In another aspect, the present invention provides a method for detecting the presence of ERG-LP activity in a biological sample by contacting the biological sample with an agent capable of detecting an indicator of ERG-LP activity such that the presence of ERG-LP activity is detected in the biological sample.

[0027] In another aspect, the invention provides a method for modulating ERG-LP activity comprising contacting a cell capable of expressing ERG-LP with an agent that modulates ERG-LP activity such that ERG-LP activity in the cell is modulated. In one embodiment, the agent inhibits ERG-LP activity. In another embodiment, the agent stimulates ERG-LP activity. In one embodiment, the agent is an antibody that specifically binds to an ERG-LP protein. In another embodiment, the agent modulates expression of ERG-LP by modulating transcription of an ERG-LP gene or translation of an ERG-LP mRNA. In yet another embodiment, the agent is a nucleic acid molecule having a nucleotide sequence that is antisense to the coding strand of an ERG-LP mRNA or an ERG-LP gene.

[0028] In one embodiment, the methods of the present invention are used to treat a subject having a disorder characterized by aberrant ERG-LP protein or nucleic acid expression or activity by administering an agent which is an ERG-LP modulator to the subject. In one embodiment, the ERG-LP modulator is an ERG-LP protein. In another embodiment the ERG-LP modulator is an ERG-LP nucleic acid molecule. In yet another embodiment, the ERG-LP modulator is a peptide, peptidomimetic, or other small molecule. In a preferred embodiment, the disorder characterized by aberrant ERG-LP protein or nucleic acid expression is a CNS disorder.

[0029] The present invention also provides a diagnostic assay for identifying the presence or absence of a genetic alteration characterized by at least one of (i) aberrant modification or mutation of a gene encoding an ERG-LP protein; (ii) mis-regulation of the gene; and (iii) aberrant post-translational modification of an ERG-LP protein, wherein a wild-type form of the gene encodes an protein with an ERG-LP activity.

[0030] In another aspect the invention provides a method for identifying a compound that binds to or modulates the activity of an ERG-LP protein, by providing an indicator composition comprising an ERG-LP protein having ERG-LP activity, contacting the indicator composition with a test compound, and determining the effect of the test compound on ERG-LP activity in the indicator composition to identify a compound that modulates the activity of an ERG-LP protein.

[0031] Other features and advantages of the invention will be apparent from the following detailed description and claims.

BRIEF DESCRIPTION OF THE DRAWINGS

[0032] FIG. 1 depicts the cDNA sequence and predicted amino acid sequence of monkey ERG-LP1. The nucleotide sequence corresponds to nucleic acids 1 to 3355 of SEQ ID NO:1. The amino acid sequence corresponds to amino acids 1 to 1083 of SEQ ID NO:2. The coding region without the 5′ and 3′ untranslated regions of the monkey ERG-LP1 gene is shown in SEQ ID NO:3.

[0033] FIG. 2 depicts the partial cDNA sequence and predicted amino acid sequence of human ERG-LP2. The partial nucleotide sequence corresponds to nucleic acids 1 to 2694 of SEQ ID NO:4. The partial amino acid sequence corresponds to amino acids 1 to 542 of SEQ ID NO:5. The coding region without the 5′ and 3′ untranslated regions of the human ERG-LP2 gene is shown in SEQ ID NO:6.

[0034] FIG. 3 depicts an alignment of the amino acid sequence of monkey ERG-LP1 with the amino acid sequence of the human ERG protein (SEQ ID NO:10).

[0035] FIG. 4 depicts an alignment of the partial amino acid sequence of human ERG-LP2 with the amino acid sequence of the Drosophila ERK protein (SEQ ID NO:11).

[0036] FIG. 5 depicts the partial cDNA sequence and predicted amino acid sequence of human ERG-LP1. The partial nucleotide sequence corresponds to nucleic acids 1 to 1132 of SEQ ID NO:7. The partial amino acid sequence corresponds to amino acids 1 to 290 of SEQ ID NO:8. The coding region without the 5′ and 3′ untranslated regions of the human ERG-LP1 gene is shown in SEQ ID NO:9.

[0037] FIG. 6 depicts a structural, hydrophobicity, and antigenicity analysis of the monkey ERG-LP1 protein.

[0038] FIG. 7 depicts a structural, hydrophobicity, and antigenicity analysis of the partial human ERG-LP2 protein.

[0039] FIG. 8 depicts the cDNA sequence and predicted amino acid sequence of full length human ERG-LP2. The nucleotide sequence corresponds to nucleic acids 1 to of SEQ ID NO:15. The amino acid sequence corresponds to amino acids 1 to 1107 of SEQ ID NO:16. The coding region without the 5′ untranslated regions of the human ERG-LP2 gene is shown in SEQ ID NO:17.

[0040] FIG. 9 depicts a structural, hydrophobicity, and antigenicity analysis of the human ERG-LP2 protein.

[0041] FIG. 10 depicts the results of a search which was performed against the HMM database and which resulted in the identification of a “transmembrane region cyclic nucleotide gated channel” domain in the human ERG-LP2 protein.

[0042] FIG. 11 depicts a global alignment of the full length human ERG-LP2 protein with the the rat Relk1 protein using the the GAP program in the GCG software package, using a Blossum 62 matrix and a gap weight of 12 and a length weight of 4. The results showed a 92.552% identity between the two sequences.

[0043] FIG. 12 depicts a global alignment of the full length human ERG-LP2 protein with the human ERG protein using the GAP program in the GCG software package, using a Blossum 62 matrix and a gap weight of 12 and a length weight of 4. The results showed a 40.852% identity between the two sequences.

[0044] FIG. 13 depicts electrophysiology measurements taken using a single electrode patch-clamp in CHO cells transfected with monkey ERG-LP1.

DETAILED DESCRIPTION OF THE INVENTION

[0045] The present invention is based, at least in part, on the discovery of novel molecules, referred to herein as ERG-LP nucleic acid and protein molecules, which are novel members of the ERG potassium channel family. These novel molecules are capable of, for example, modulating a potassium channel mediated activity in a cell, e.g., a neuronal cell or a muscle cell.

[0046] As used herein, a “potassium channel” refers to a protein which is involved in receiving, conducting, and transmitting signals, in an electrically excitable cell, e.g., a neuronal cell or a muscle cell. Potassium channels are potassium ion selective, and can determine membrane excitability (the ability of, for example, a neuron to respond to a stimulus and convert it into an impulse), influence the resting potential of membranes, wave forms and frequencies of action potentials, and thresholds of excitation. Potassium channels are typically expressed in electrically excitable cells, e.g., neurons, muscle, endocrine, and egg cells, and may form heteromultimeric structures, e.g., composed of pore-forming &agr; and cytoplasmic &bgr; subunits. Examples of potassium channels include: (1) the voltage-gated potassium channels, (2) the ligand-gated potassium channels, e.g., cyclic nucleotide-gated potassium channels, and (3) the mechanically-gated potassium channels. Voltage-gated and ligand-gated potassium channels are expressed in the brain, e.g., in brainstem monoaminergic and forebrain cholinergic neurons, where they are involved in the release of neurotransmitters, or in the dendrites of hippocampal and neocortical pyramidal cells, where they are involved in the processes of learning and memory formation. For a detailed description of potassium channels, see Kandel E. R. et al., Principles of Neural Science, second edition, (Elsevier Science Publishing Co., Inc., N.Y. (1985)), the contents of which are incorporated herein by reference. Thus, the ERG-LP proteins can modulate potassium channel mediated activities and provide novel diagnostic targets for potassium channel associated disorders.

[0047] As used herein, a “potassium channel associated disorder” refers to a disorder, disease or condition which is characterized by a misregulation of a potassium channel mediated activity. Potassium channel associated disorders can detrimentally affect conveyance of sensory impulses from the periphery to the brain and/or conductance of motor impulses from the brain to the periphery; integration of reflexes; interpretation of sensory impulses; or emotional, intellectual (e.g., learning and memory), or motor processes. Examples of potassium channel associated disorders include neurodegenerative disorders, e.g., Alzheimer's disease, dementias related to Alzheimer's disease (such as Pick's disease), Parkinson's and other Lewy diffuse body diseases, multiple sclerosis, amyotrophic lateral sclerosis, progressive supranuclear palsy, epilepsy, and Jakob-Creutzfieldt disease; psychiatric disorders, e.g., depression, schizophrenic disorders, korsakoffs psychosis, mania, anxiety disorders, or phobic disorders; learning or memory disorders, e.g., amnesia or age-related memory loss; neurological disorders, e.g., migraine; obesity; and cardiac disorders, e.g., cardiac arrythmias.

[0048] In another embodiment, the ERG-LP molecules of the invention are capable of modulating a potassium channel mediated activity. As used herein, a “potassium channel mediated activity” refers to an activity which involves a potassium channel, e.g., a potassium channel in a neuronal cell or a muscle cell. Potassium channel mediated activities are activities involved in receiving, conducting, and transmitting signals in, for example, the nervous system. Potassium channel mediated activities include release of neurotransmitters, e.g., dopamine or norepinephrine, from cells, e.g., neuronal cells; modulation of resting potential of membranes, wave forms and frequencies of action potentials, and thresholds of excitation; and modulation of processes such as integration of sub-threshold synaptic responses and the conductance of back-propagating action potentials in, for example, neuronal cells or muscle cells. Thus, the ERG-LP proteins can have one or more of the following activities: (1) modulate the release of neurotransmitters, (2) modulate membrane excitability, (3) influence the resting potential of membranes, (4) modulate wave forms and frequencies of action potentials, (5) modulate thresholds of excitation, and (6) modulate processes which underlie learning and memory, such as integration of sub-threshold synaptic responses and the conductance of back-propagating action potentials.

[0049] One embodiment of the invention features ERG-LP nucleic acid molecules, preferably human ERG-LP molecules, e.g., human ERG-LP1 and human ERG-LP-2, or monkey ERG-LP molecules, e.g., monkey ERG-LP1, which were identified from human or monkey brain libraries. The ERG-LP nucleic acid and protein molecules of the invention are described in further detail in the following subsections.

[0050] A. The ERG-LP1 Nucleic Acid and Protein Molecules

[0051] The present invention is based, at least in part, on the discovery of novel molecules, referred to herein as ERG-LP1 protein and nucleic acid molecules, which comprise a family of molecules having certain conserved structural and functional features. The term “family” when referring to the protein and nucleic acid molecules of the invention is intended to mean two or more proteins or nucleic acid molecules having a common structural domain or motif and having sufficient amino acid or nucleotide sequence homology as defined herein. Such family members can be naturally or non-naturally occurring and can be from either the same or different species. For example, a family can contain a first protein of human origin, as well as other, distinct proteins of human origin or alternatively, can contain homologues of non-human origin. Members of a family may also have common functional characteristics.

[0052] In one embodiment, the isolated proteins of the present invention, preferably ERG-LP1 proteins, are identified based on the presence of at least one or more of a “transmembrane domain”, a “P-loop”, and a “cyclic nucleotide-binding domain.” As used herein, the term “transmembrane domain” includes an amino acid sequence of about 15-40 amino acid residues in length, more preferably, about 15-30 amino acid residues in length, and most preferably about 18-25 amino acid residues in length, which spans the plasma membrane. Transmembrane domains are rich in hydrophobic residues, and typically have an &agr;-helical structure. In a preferred embodiment, at least 50%, 60%, 70%, 80%, 90%, 95% or more of the amino acids of a transmembrane domain are hydrophobic, e.g., leucines, isoleucines, tyrosines, or tryptophans. Transmembrane domains are described in, for example, Zagotta W. N. et al, (1996) Annual Rev. Neuronsci. 19: 235-63, the contents of which are incorporated herein by reference. Amino acid residues 29-45, 229-251, 306-323, 357-381, 480-504, and 618-640 of the monkey ERG-LP1 comprise transmembrane domains.

[0053] As used herein, the term “P-loop” (also known as an H5 domain) includes an amino acid sequence of about 15-25 amino acid residues in length, preferably about 18-22 amino acid residues in length, and most preferably about 20-22 amino acid residues in length, which is involved in lining the potassium channel pore. The P-loop is typically found between transmembrane domains 5 and 6 and is believed to be a major determinant of ion selectivity in potassium channels. In a preferred embodiment, a P-loop can have the following consensus sequence: (D/T)-(A/S)-(L/F)-X1-X1-(A/T)-X2-(S/T)-(S/T)-X2-T-(S/T)-V-G-X1-G-(N/D)-X2-X-(A/P)-X-T-X-X-X (SEQ ID NO:12), where X1 can be F,Y, or W; X2 can be M, I, L, or V; and X can be any amino acid. P-loops are described in, for example, Warmike et al. (1991) Science 252:1560-1562, and Zagotta W. N. et al., (1996) Annual Rev. Neuronsci. 19:235-63, the contents of which are incorporated herein by reference. Amino acid residues 451-471 of the monkey ERG-LP1 protein comprise a P-loop.

[0054] As used herein, a “cyclic nucleotide-binding domain” includes an amino acid sequence of about 60-120 amino acid residues in length, preferably about 60-100 amino acid residues in length, and most preferably about 60-80 amino acid residues in length, which is involved in the binding of cyclic nucleotides, e.g., cGMP or cAMP. In preferred embodiments, the cyclic nucleotide binding domain can have the following consensus sequence: X-X-X-G-(E/D)-X1-(I/L)-X-X-X-G-(D/S/R)-X(7-10)-G-(S/K)-X-X2-(V/I)-X-(R/K)-X-(D/G)-X(7-12)-G-X(6)-(D/E)-X(9-15)-(A/T)-X(2)-(D/A/V)-X(5-10) (SEQ ID NO:13) where X1 can be: T, Y, L, or C and X2 can be: E, A or N. Cyclic nucleotide binding domains are described in, for example, Zagotta W. N. et al., (1996) Annual Rev. Neuronsci. 19:235-63, the contents of which are incorporated herein by reference. Amino acid residues 601-674 of the monkey ERG-LP1 protein comprise a cyclic nucleotide binding domain.

[0055] In another embodiment, ERG-LP1 proteins include at least one or more N-glycosylation sites. Predicted N-glycosylation sites are found, for example, from about amino acids 421-424, 428-431, 436-439, 470-473 and 499-502 of SEQ ID NO:2.

[0056] In another embodiment, ERG-LP1 proteins include at least one or more glycosaminoglycan attachment sites. Predicted glycosaminoglycan attachment sites are found, for example, from about amino acids 922-925 of SEQ ID NO:2.

[0057] In another embodiment, ERG-LP1 proteins include at least one protein kinase C phosphorylation site. Predicted protein kinase C phosphorylation sites are found, for example, from about amino acid residues 129-131, 150-152, 250-252, 336-338, 447-449, 477-479, 769-771, 821-823, 840-842 and 901-903 of SEQ ID NO:2.

[0058] In another embodiment, ERG-LP1 proteins include at least one casein kinase II phosphorylation site. Predicted casein kinase II phosphorylation sites are found, for example, from about amino acid residues 13-16, 20-23, 56-59, 129-132, 250-253, 262-265, 389-392, 431-434, 438-441, 475-478, 560-563, 604-607, 726-729, 733-736, 846-849, 996-999, 1034-1037, 1040-1043 and 1076-1079 of SEQ ID NO:2.

[0059] In another embodiment, ERG-LP1 proteins include at least one tyrosine kinase phosphorylation site. Predicted tyrosine kinase phosphorylation sites are found, for example, from about amino acid residues 404-411 and 517-524 of SEQ ID NO:2.

[0060] Isolated proteins of the present invention, preferably ERG-LP1 proteins, have an amino acid sequence sufficiently homologous to the amino acid sequence of SEQ ID NO:2 or SEQ ID NO:8 or are encoded by a nucleotide sequence sufficiently homologous to SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:7, or SEQ ID NO:9. As used herein, the term “sufficiently homologous” refers to a first amino acid or nucleotide sequence which contains a sufficient or minimum number of identical or equivalent (e.g., an amino acid residue which has a similar side chain) amino acid residues or nucleotides to a second amino acid or nucleotide sequence such that the first and second amino acid or nucleotide sequences share common structural domains or motifs and/or a common functional activity. For example, amino acid or nucleotide sequences which share common structural domains have at least 30%, 40%, or 50% homology, preferably 60% homology, more preferably 70%-80%, and even more preferably 90-95% homology across the amino acid sequences of the domains and contain at least one and preferably two structural domains or motifs, are defined herein as sufficiently homologous. Furthermore, amino acid or nucleotide sequences which share at least 30%, 40%, or 50%, preferably 60%, more preferably 70-80%, or 90-95% homology and share a common functional activity are defined herein as sufficiently homologous. As used interchangeably herein an “ERG-LP1 activity”, “biological activity of ERG-LP1” or “functional activity of ERG-LP1”, refers to an activity exerted by an ERG-LP1 protein, polypeptide or nucleic acid molecule on an ERG-LP1 responsive cell as determined in vivo, or in vitro, according to standard techniques. The biological activity of ERG-LP1 is described herein.

[0061] Accordingly, another embodiment of the invention features isolated ERG-LP1 proteins and polypeptides having an ERG-LP1 activity. Preferred proteins are ERG-LP1 proteins having at least one transmembrane domain, a P-loop, and a cyclic nucleotide-binding domain and, preferably, an ERG-LP1 activity. Other preferred proteins are ERG-LP1 proteins having at least one transmembrane domain and, preferably, an ERG-LP1 activity. Other preferred proteins are ERG-LP1 proteins having at least one P-loop, and, preferably, an ERG-LP1 activity. Other preferred proteins are ERG-LP1 proteins having at least one cyclic nucleotide-binding domain and, preferably, an ERG-LP1 activity. Other preferred proteins are ERG-LP1 proteins having at least one transmembrane domain, a P-loop, and, preferably, an ERG-LP1 activity. Other preferred proteins are ERG-LP1 proteins having at least one transmembrane domain, a cyclic nucleotide-binding domain and, preferably, an ERG-LP1 activity. Other preferred proteins are ERG-LP1 proteins having at least one P-loop, a cyclic nucleotide-binding domain and, preferably, an ERG-LP1 activity. Additional preferred proteins have at least one transmembrane domain, a P-loop, and a cyclic nucleotide-binding domain and are, preferably, encoded by a nucleic acid molecule having a nucleotide sequence which hybridizes under stringent hybridization conditions to a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:7, or SEQ ID NO:9.

[0062] The nucleotide sequence of the isolated monkey ERG-LP1 cDNA and the predicted amino acid sequence of the monkey ERG-LP1 polypeptide are shown in FIG. 1 and in SEQ ID NOs:1 and 2, respectively. The nucleotide sequence of the isolated human ERG-LP1 cDNA and the predicted amino acid sequence of the human ERG-LP1 polypeptide are shown in FIG. 5 and in SEQ ID NOs:7 and 8, respectively. A plasmid containing the nucleotide sequence encoding monkey ERG-LP1 was deposited with American Type Culture Collection (ATCC), Rockville, Md., on ______ and assigned Accession Number ______. This deposit will be maintained under the terms of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purposes of Patent Procedure. This deposit was made merely as a convenience for those of skill in the art and is not an admission that a deposit is required under 35 U.S.C. §112.

[0063] The monkey ERG-LP1 gene, which is approximately 3355 nucleotides in length, encodes a protein having a molecular weight of approximately 124.2 kD and which is approximately 1080 amino acid residues in length. The monkey ERG-LP1 gene is expressed exclusively in the brain (expression is highest in cortical regions, hippocampus, caudate, and amygdala).

[0064] The human ERG-LP1 gene, which is approximately 1132 nucleotides in length, encodes a protein having a molecular weight of approximately 33.3 kD and which is approximately 290 amino acid residues in length. The human ERG-LP1 gene is expressed exclusively in the brain (expression is highest in cortical regions, hippocampus, caudate, and amygdala).

[0065] B. The ERG-LP2 Nucleic Acid and Protein Molecules

[0066] In another embodiment, the isolated proteins of the present invention, preferably ERG-LP2 proteins, are identified based on the presence of at least one or more of a “transmembrane domain”, a “P-loop”, a “cyclic nucleotide-binding domain” and a “transmembrane region cyclic nucleotide gated channel domain.”

[0067] Amino acid residues 226-247, 303-327, 354-377, and 449-473 of the partial human ERG-LP2 protein (SEQ ID NO:5) comprise transmembrane domains. Amino acid residues 423-442 of the partial human ERG-LP2 protein (SEQ ID NO:5) comprise a P-loop. Amino acid residues 295 to 535 of the full length human ERG-LP2 protein (SEQ ID NO:16) comprise a transmembrane region cyclic nucleotide gated channel domain.

[0068] In another embodiment, ERG-LP2 proteins include at least one or more N-glycosylation sites. Predicted N-glycosylation sites are found, for example, from about amino acids 317-320, 406-409, 436-439, 465-468, 614-617, 684-687, 818-821 and 950-953 of SEQ ID NO:16.

[0069] In another embodiment, ERG-LP2 proteins include at least one protein kinase C phosphorylation site. Predicted protein kinase C phosphorylation sites are found, for example, from about amino acid residues 63-65, 126-128, 159-161, 216-218, 250-252, 329-331, 413-415, 616-618, 683-685, 733-735, 741-743, 749-751, 771-773, 807-809, 830-832 and 1078-1080 of SEQ ID NO:16.

[0070] In another embodiment, ERG-LP2 proteins include at least one casein kinase II phosphorylation site. Predicted casein kinase II phosphorylation sites are found, for example, from about amino acid residues 10-13, 17-20, 83-86, 126-129, 138-141, 155-158, 255-258, 441-444, 547-550, 616-619, 624-627, 632-635, 689-692, 705-708, 774-777, 819-822, 1033-1036, 1045-1048 and 1092-1095 of SEQ ID NO:16.

[0071] In another embodiment, ERG-LP2 proteins include at least one tyrosine kinase phosphorylation site. Predicted tyrosine kinase phosphorylation sites are found, for example, from about amino acid residues 397-404 of SEQ ID NO:16.

[0072] In another embodiment, ERG-LP2 proteins include at least one cAMP and cGMP dependent protein kinase phosphorylation site. Predicted cAMP and cGMP dependent protein kinase phosphorylation sites are found, for example, from about amino acid residues 161-164 of SEQ ID NO:16.

[0073] Isolated proteins of the present invention, preferably ERG-LP2 proteins, have an amino acid sequence sufficiently homologous to the amino acid sequence of SEQ ID NO:5 or SEQ ID NO:16 or are encoded by a nucleotide sequence sufficiently homologous to SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:15 or SEQ ID NO:17.

[0074] As used interchangeably herein an “ERG-LP2 activity”, “biological activity of ERG-LP2” or “functional activity of ERG-LP2”, refers to an activity exerted by an ERG-LP2 protein, polypeptide or nucleic acid molecule on an ERG-LP2 responsive cell as determined in vivo, or in vitro, according to standard techniques. The biological activity of ERG-LP2 is described herein.

[0075] Accordingly, another embodiment of the invention features isolated ERG-LP2 proteins and polypeptides having an ERG-LP2 activity. Preferred proteins are ERG-LP2 proteins having at least one transmembrane domain, a P-loop, a cyclic nucleotide-binding domain and a transmembrane region cyclic nucleotide gated channel domain and, preferably, an ERG-LP2 activity. Additional preferred proteins have at least one transmembrane domain, a P-loop, a cyclic nucleotide-binding domain and a transmembrane region cyclic nucleotide gated channel domain and are, preferably, encoded by a nucleic acid molecule having a nucleotide sequence which hybridizes under stringent hybridization conditions to a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:15 or SEQ ID NO:17.

[0076] The nucleotide sequence of the isolated partial human ERG-LP2 cDNA and the predicted amino acid sequence of the human ERG-LP2 polypeptide are shown in FIG. 2 and in SEQ ID NOs:4 and 5, respectively. The nucleotide sequence of the isolated full length human ERG-LP2 cDNA and the predicted amino acid sequence of the human ERG-LP2 polypeptide are shown in FIG. 8 and in SEQ ID NOs:15 and 16, respectively. A plasmid containing the nucleotide sequence encoding human ERG-LP2 was deposited with American Type Culture Collection (ATCC), Rockville, Md., on ______ and assigned Accession Number ______. This deposit will be maintained under the terms of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purposes of Patent Procedure. This deposit was made merely as a convenience for those of skill in the art and is not an admission that a deposit is required under 35 U.S.C. §112.

[0077] The ERG-LP2 gene, which is approximately 3321 nucleotides in length, encodes a protein having a molecular weight of approximately 121 kD and which is approximately 1107 amino acid residues in length. The ERG-LP2 gene is predominantly expressed in the brain.

[0078] Various aspects of the invention are described in further detail in the following subsections:

[0079] I. Isolated Nucleic Acid Molecules

[0080] One aspect of the invention pertains to isolated nucleic acid molecules that encode ERG-LP proteins or biologically active portions thereof, as well as nucleic acid fragments sufficient for use as hybridization probes to identify ERG-LP-encoding nucleic acid molecules (e.g., ERG-LP mRNA) and fragments for use as PCR primers for the amplification or mutation of ERG-LP nucleic acid molecules. As used herein, the term “nucleic acid molecule” is intended to include DNA molecules (e.g., cDNA or genomic DNA) and RNA molecules (e.g., mRNA) and analogs of the DNA or RNA generated using nucleotide analogs. The nucleic acid molecule can be single-stranded or double-stranded, but preferably is double-stranded DNA.

[0081] An “isolated” nucleic acid molecule is one which is separated from other nucleic acid molecules which are present in the natural source of the nucleic acid. Preferably, an “isolated” nucleic acid is free of sequences which naturally flank the nucleic acid (i.e., sequences located at the 5′ and 3′ ends of the nucleic acid) in the genomic DNA of the organism from which the nucleic acid is derived. For example, in various embodiments, the isolated ERG-LP nucleic acid molecule can contain less than about 5 kb, 4 kb, 3 kb, 2 kb, 1 kb, 0.5 kb or 0.1 kb of nucleotide sequences which naturally flank the nucleic acid molecule in genomic DNA of the cell from which the nucleic acid is derived. Moreover, an “isolated” nucleic acid molecule, such as a cDNA molecule, can be substantially free of other cellular material, or culture medium when produced by recombinant techniques, or substantially free of chemical precursors or other chemicals when chemically synthesized.

[0082] A nucleic acid molecule of the present invention, e.g., a nucleic acid molecule having the nucleotide sequence of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:15 or SEQ ID NO:17, or a portion thereof, can be isolated using standard molecular biology techniques and the sequence information provided herein. Using all or portion of the nucleic acid sequence of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:15 or SEQ ID NO:17, as a hybridization probe, ERG-LP nucleic acid molecules can be isolated using standard hybridization and cloning techniques (e.g., as described in Sambrook, J., Fritsh, E. F., and Maniatis, T. Molecular Cloning: A Laboratory Manual. 2nd, ed., Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989).

[0083] Moreover, a nucleic acid molecule encompassing all or a portion of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:15 or SEQ ID NO:17 can be isolated by the polymerase chain reaction (PCR) using synthetic oligonucleotide primers designed based upon the sequence of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:15 or SEQ ID NO:17.

[0084] A nucleic acid of the invention can be amplified using cDNA, mRNA or alternatively, genomic DNA, as a template and appropriate oligonucleotide primers according to standard PCR amplification techniques. The nucleic acid so amplified can be cloned into an appropriate vector and characterized by DNA sequence analysis. Furthermore, oligonucleotides corresponding to ERG-LP nucleotide sequences can be prepared by standard synthetic techniques, e.g., using an automated DNA synthesizer.

[0085] In a preferred embodiment, an isolated nucleic acid molecule of the invention comprises the nucleotide sequence shown in SEQ ID NO:1. The sequence of SEQ ID NO:1 corresponds to the monkey ERG-LP1 cDNA. This cDNA comprises sequences encoding the monkey ERG-LP1 protein (i.e., “the coding region”, from nucleotides 113-3243), as well as 5′ untranslated sequences (nucleotides 1-112). Alternatively, the nucleic acid molecule can comprise only the coding region of SEQ ID NO:1 (e.g., nucleotides 113-3243, corresponding to SEQ ID NO:3).

[0086] In another preferred embodiment, an isolated nucleic acid molecule of the invention comprises the nucleotide sequence shown in SEQ ID NO:4. The sequence of SEQ ID NO:4 corresponds to the partial human ERG-LP2 cDNA. This cDNA comprises sequences encoding the partial human ERG-LP2 protein (i.e., “the coding region”, from nucleotides 215-1843), as well as 5′ untranslated sequences (nucleotides 1-214) and 3′ untranslated sequences (nucleotides 1844-2694). Alternatively, the nucleic acid molecule can comprise only the coding region of SEQ ID NO:4 (e.g., nucleotides 215-1843, corresponding to SEQ ID NO:6).

[0087] In yet another preferred embodiment, an isolated nucleic acid molecule of the invention comprises the nucleotide sequence shown in SEQ ID NO:7. The sequence of SEQ ID NO:7 corresponds to the human ERG-LP1 cDNA. This cDNA comprises sequences encoding the human ERG-LP1 protein (i.e., “the coding region”, from nucleotides 263-1132), as well as 5′ untranslated sequences (nucleotides 1-262). Alternatively, the nucleic acid molecule can comprise only the coding region of SEQ ID NO:7 (e.g., nucleotides 263-1132, corresponding to SEQ ID NO:9).

[0088] In yet another preferred embodiment, an isolated nucleic acid molecule of the invention comprises the nucleotide sequence shown in SEQ ID NO:15. The sequence of SEQ ID NO:15 corresponds to the human ERG-LP2 cDNA. This cDNA comprises sequences encoding the human ERG-LP2 protein (i.e., “the coding region”, from nucleotides 196-3516), as well as 5′ untranslated sequences (nucleotides 1-195). Alternatively, the nucleic acid molecule can comprise only the coding region of SEQ ID NO:15 (e.g., nucleotides 196-3516, corresponding to SEQ ID NO:17).

[0089] In another preferred embodiment, an isolated nucleic acid molecule of the invention comprises a nucleic acid molecule which is a complement of the nucleotide sequence shown in SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:15 or SEQ ID NO:17, or a portion of any of these nucleotide sequences. A nucleic acid molecule which is complementary to the nucleotide sequence shown in SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:15 or SEQ ID NO:17, is one which is sufficiently complementary to the nucleotide sequence shown in SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:15 or SEQ ID NO:17, such that it can hybridize to the nucleotide sequence shown in SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:15 or SEQ ID NO:17.

[0090] In still another preferred embodiment, an isolated nucleic acid molecule of the present invention comprises a nucleotide sequence which is at least about 28%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or more homologous to the entire length of the nucleotide sequence shown in SEQ ID NO:1 or SEQ ID NO:3, or a portion of any of these nucleotide sequences. In yet another preferred embodiment, an isolated nucleic acid molecule of the present invention comprises a nucleotide sequence which is at least about 42%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or more homologous to the entire length of the nucleotide sequence shown in SEQ ID NO:4, or SEQ ID NO:6, or a portion of any of these nucleotide sequences. In yet another preferred embodiment, an isolated nucleic acid molecule of the present invention comprises a nucleotide sequence which is at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or more homologous to the entire length of the nucleotide sequence shown in SEQ ID NO:7 or SEQ ID NO:9, or a portion of any of these nucleotide sequences. In yet another preferred embodiment, an isolated nucleic acid molecule of the present invention comprises a nucleotide sequence which is at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or more homologous to the entire length of the nucleotide sequence shown in SEQ ID NO:15 or SEQ ID NO:17, or a portion of any of these nucleotide sequences.

[0091] Moreover, the nucleic acid molecule of the invention can comprise only a portion of the nucleic acid sequence of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:15 or SEQ ID NO:17, for example a fragment which can be used as a probe or primer or a fragment encoding a biologically active portion of an ERG-LP protein. The nucleotide sequence determined from the cloning of the ERG-LP gene allows for the generation of probes and primers designed for use in identifying and/or cloning other ERG-LP family members, as well as ERG-LP homologues from other species. The probe/primer typically comprises substantially purified oligonucleotide. The oligonucleotide typically comprises a region of nucleotide sequence that hybridizes under stringent conditions to at least about 12 or 15, preferably about 20 or 25, more preferably about 30, 35, 40, 45, 50, 55, 60, 65, or 75 consecutive nucleotides of a sense sequence of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:15 or SEQ ID NO:17, of an anti-sense sequence of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:15 or SEQ ID NO:17, or of a naturally occurring allelic variant or mutant of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:15 or SEQ ID NO:17. In an exemplary embodiment, a nucleic acid molecule of the present invention comprises a nucleotide sequence which is greater than 307, 350-400, 400-450, 450-500, 500-550, 550-600, 600-650, 650-700, 700-750, 750-800, 800-850, 850-900, 949, 950-1000, or more nucleotides in length and hybridizes under stringent hybridization conditions to a nucleic acid molecule of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:15 or SEQ ID NO:17.

[0092] Probes based on the ERG-LP nucleotide sequences can be used to detect transcripts or genomic sequences encoding the same or homologous proteins. In preferred embodiments, the probe further comprises a label group attached thereto, e.g., the label group can be a radioisotope, a fluorescent compound, an enzyme, or an enzyme co-factor. Such probes can be used as a part of a diagnostic test kit for identifying cells or tissue which misexpress an ERG-LP protein, such as by measuring a level of an ERG-LP-encoding nucleic acid in a sample of cells from a subject e.g., detecting ERG-LP mRNA levels or determining whether a genomic ERG-LP gene has been mutated or deleted.

[0093] A nucleic acid fragment encoding a “biologically active portion of an ERG-LP protein” can be prepared by isolating a portion of the nucleotide sequence of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:15 or SEQ ID NO:17, which encodes a polypeptide having an ERG-LP biological activity (the biological activities of the ERG-LP proteins are described herein), expressing the encoded portion of the ERG-LP protein (e.g., by recombinant expression in vitro) and assessing the activity of the encoded portion of the ERG-LP protein.

[0094] The invention further encompasses nucleic acid molecules that differ from the nucleotide sequence shown in SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:15 or SEQ ID NO:17, due to degeneracy of the genetic code and thus encode the same ERG-LP proteins as those encoded by the nucleotide sequence shown in SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:15 or SEQ ID NO:17. In another embodiment, an isolated nucleic acid molecule of the invention has a nucleotide sequence encoding a protein having an amino acid sequence shown in SEQ ID NO:2, SEQ ID NO:5, SEQ ID NO:8 or SEQ ID NO:16.

[0095] In addition to the ERG-LP nucleotide sequences shown in SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:15 or SEQ ID NO:17, it will be appreciated by those skilled in the art that DNA sequence polymorphisms that lead to changes in the amino acid sequences of the ERG-LP proteins may exist within a population (e.g., the human population). Such genetic polymorphism in the ERG-LP genes may exist among individuals within a population due to natural allelic variation. As used herein, the terms “gene” and “recombinant gene” refer to nucleic acid molecules comprising an open reading frame encoding an ERG-LP protein, preferably a mammalian ERG-LP protein. Such natural allelic variations can typically result in 1-5% variance in the nucleotide sequence of an ERG-LP gene. Any and all such nucleotide variations and resulting amino acid polymorphisms in ERG-LP genes that are the result of natural allelic variation and that do not alter the functional activity of an ERG-LP protein are intended to be within the scope of the invention.

[0096] Moreover, nucleic acid molecules encoding other ERG potassium channel family members (e.g., other ERG-LP family members) and thus which have a nucleotide sequence which differs from the ERG-LP sequences of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:7, or SEQ ID NO:9 are intended to be within the scope of the invention. For example, another ERG-LP cDNA can be identified based on the nucleotide sequence of human ERG-LP. Moreover, nucleic acid molecules encoding ERG-LP proteins from different species, and thus which have a nucleotide sequence which differs from the ERG-LP sequences of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:15 or SEQ ID NO:17 are intended to be within the scope of the invention. For example, a mouse ERG-LP cDNA can be identified based on the nucleotide sequence of a human ERG-LP.

[0097] Nucleic acid molecules corresponding to natural allelic variants and homologues of the ERG-LP cDNAs of the invention can be isolated based on their homology to the ERG-LP nucleic acids disclosed herein using the cDNAs disclosed herein, or a portion thereof, as a hybridization probe according to standard hybridization techniques under stringent hybridization conditions.

[0098] Accordingly, in another embodiment, an isolated nucleic acid molecule of the invention is at least 15, 20, 25, 30 or more nucleotides in length and hybridizes under stringent conditions to the nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:15 or SEQ ID NO:17. In other embodiment, the nucleic acid is at least 30, 50, 100, 150, 200, 250, 300, 307, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 949, or 950 nucleotides in length. As used herein, the term “hybridizes under stringent conditions” is intended to describe conditions for hybridization and washing under which nucleotide sequences at least 60% homologous to each other typically remain hybridized to each other. Preferably, the conditions are such that sequences at least about 70%, more preferably at least about 80%, even more preferably at least about 85% or 90% homologous to each other typically remain hybridized to each other. Such stringent conditions are known to those skilled in the art and can be found in Current Protocols in Molecular Biology, John Wiley & Sons, N.Y. (1989), 6.3.1-6.3.6. A preferred, non-limiting example of stringent hybridization conditions are hybridization in 6×sodium chloride/sodium citrate (SSC) at about 45° C., followed by one or more washes in 0.2×SSC, 0.1% SDS at 50-65° C. Preferably, an isolated nucleic acid molecule of the invention that hybridizes under stringent conditions to the sequence of SEQ ID NO:1 corresponds to a naturally-occurring nucleic acid molecule. As used herein, a “naturally-occurring” nucleic acid molecule refers to an RNA or DNA molecule having a nucleotide sequence that occurs in nature (e.g., encodes a natural protein).

[0099] In addition to naturally-occurring allelic variants of the ERG-LP sequences that may exist in the population, the skilled artisan will further appreciate that changes can be introduced by mutation into the nucleotide sequences of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:15 or SEQ ID NO:17, thereby leading to changes in the amino acid sequence of the encoded ERG-LP proteins, without altering the functional ability of the ERG-LP proteins. For example, nucleotide substitutions leading to amino acid substitutions at “non-essential” amino acid residues can be made in the sequence of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:15 or SEQ ID NO:17. A “non-essential” amino acid residue is a residue that can be altered from the wild-type sequence of ERG-LP (e.g., the sequence of SEQ ID NO:2) without altering the biological activity, whereas an “essential” amino acid residue is required for biological activity. For example, amino acid residues that are conserved among the ERG-LP proteins of the present invention, are predicted to be particularly unamenable to alteration. Furthermore, additional amino acid residues that are conserved between the ERG-LP proteins of the present invention and other members of the ERG potassium channel families are not likely to be amenable to alteration.

[0100] Accordingly, another aspect of the invention pertains to nucleic acid molecules encoding ERG-LP proteins that contain changes in amino acid residues that are not essential for activity. Such ERG-LP proteins differ in amino acid sequence from SEQ ID NO:2, SEQ ID NO:5, SEQ ID NO:8, or SEQ ID NO:16 yet retain biological activity. In one embodiment, the isolated nucleic acid molecule comprises a nucleotide sequence encoding a protein, wherein the protein comprises an amino acid sequence at least about 37%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or more homologous to SEQ ID NO:2 or SEQ ID NO:8. In another embodiment, the isolated nucleic acid molecule comprises a nucleotide sequence encoding a protein, wherein the protein comprises an amino acid sequence at least about 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or more homologous to SEQ ID NO:5 or SEQ ID NO:16.

[0101] An isolated nucleic acid molecule encoding an ERG-LP protein homologous to the protein of SEQ ID NO:2, SEQ ID NO:5, SEQ ID NO:8 or SEQ ID NO:16 can be created by introducing one or more nucleotide substitutions, additions or deletions into the nucleotide sequence of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:15 or SEQ ID NO:17, such that one or more amino acid substitutions, additions or deletions are introduced into the encoded protein. Mutations can be introduced into SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:15 or SEQ ID NO:17 by standard techniques, such as site-directed mutagenesis and PCR-mediated mutagenesis. Preferably, conservative amino acid substitutions are made at one or more predicted non-essential amino acid residues. A “conservative amino acid substitution” is one in which the amino acid residue is replaced with an amino acid residue having a similar side chain. Families of amino acid residues having similar side chains have been defined in the art. These families include amino acids with basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), beta-branched side chains (e.g., threonine, valine, isoleucine) and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine). Thus, a predicted nonessential amino acid residue in an ERG-LP protein is preferably replaced with another amino acid residue from the same side chain family. Alternatively, in another embodiment, mutations can be introduced randomly along all or part of an ERG-LP coding sequence, such as by saturation mutagenesis, and the resultant mutants can be screened for ERG-LP biological activity to identify mutants that retain activity. Following mutagenesis of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:15 or SEQ ID NO:17, the encoded protein can be expressed recombinantly and the activity of the protein can be determined.

[0102] In a preferred embodiment, a mutant ERG-LP protein can be assayed for the ability to (1) interact with a non-ERG-LP protein molecule; (2) activate an ERG-LP-dependent signal transduction pathway; (3) modulate the release of neurotransmitters, (4) modulate membrane excitability, (5) influence the resting potential of membranes, wave forms and frequencies of action potentials, and thresholds of excitation, and (6) modulate processes which underlie learning and memory, such as integration of sub-threshold synaptic responses and the conductance of back-propagating action potentials.

[0103] In addition to the nucleic acid molecules encoding ERG-LP proteins described above, another aspect of the invention pertains to isolated nucleic acid molecules which are antisense thereto. An “antisense” nucleic acid comprises a nucleotide sequence which is complementary to a “sense” nucleic acid encoding a protein, e.g., complementary to the coding strand of a double-stranded cDNA molecule or complementary to an mRNA sequence. Accordingly, an antisense nucleic acid can hydrogen bond to a sense nucleic acid. The antisense nucleic acid can be complementary to an entire ERG-LP coding strand, or to only a portion thereof. In one embodiment, an antisense nucleic acid molecule is antisense to a “coding region” of the coding strand of a nucleotide sequence encoding ERG-LP. The term “coding region” refers to the region of the nucleotide sequence comprising codons which are translated into amino acid residues (e.g., the coding region of monkey ERG-LP1 corresponds to SEQ ID NO:3). In another embodiment, the antisense nucleic acid molecule is antisense to a “noncoding region” of the coding strand of a nucleotide sequence encoding ERG-LP. The term “noncoding region” refers to 5′ and 3′ sequences which flank the coding region that are not translated into amino acids (i.e., also referred to as 5′ and 3′ untranslated regions).

[0104] Given the coding strand sequences encoding ERG-LP disclosed herein (e.g., SEQ ID NO:3, SEQ ID NO:6, and SEQ ID NO:9), antisense nucleic acids of the invention can be designed according to the rules of Watson and Crick base pairing. The antisense nucleic acid molecule can be complementary to the entire coding region of ERG-LP mRNA, but more preferably is an oligonucleotide which is antisense to only a portion of the coding or noncoding region of ERG-LP mRNA. For example, the antisense oligonucleotide can be complementary to the region surrounding the translation start site of ERG-LP mRNA. An antisense oligonucleotide can be, for example, about 5, 10, 15, 20, 25, 30, 35, 40, 45 or 50 nucleotides in length. An antisense nucleic acid of the invention can be constructed using chemical synthesis and enzymatic ligation reactions using procedures known in the art. For example, an antisense nucleic acid (e.g., an antisense oligonucleotide) can be chemically synthesized using naturally occurring nucleotides or variously modified nucleotides designed to increase the biological stability of the molecules or to increase the physical stability of the duplex formed between the antisense and sense nucleic acids, e.g., phosphorothioate derivatives and acridine substituted nucleotides can be used. Examples of modified nucleotides which can be used to generate the antisense nucleic acid include 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xantine, 4-acetylcytosine, 5-(carboxyhydroxylmethyl) uracil, 5-carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylqueosine, inosine, N6-isopentenyladenine, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-adenine, 7-methylguanine, 5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, beta-D-mannosylqueosine, 5′-methoxycarboxymethyluracil, 5-methoxyuracil, 2-methylthio-N6-isopentenyladenine, uracil-5-oxyacetic acid (v), wybutoxosine, pseudouracil, queosine, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, uracil-5-oxyacetic acid methylester, uracil-5-oxyacetic acid (v), 5-methyl-2-thiouracil, 3-(3-amino-3-N-2-carboxypropyl) uracil, (acp3)w, and 2,6-diaminopurine. Alternatively, the antisense nucleic acid can be produced biologically using an expression vector into which a nucleic acid has been subcloned in an antisense orientation (i.e., RNA transcribed from the inserted nucleic acid will be of an antisense orientation to a target nucleic acid of interest, described further in the following subsection).

[0105] The antisense nucleic acid molecules of the invention are typically administered to a subject or generated in situ such that they hybridize with or bind to cellular mRNA and/or genomic DNA encoding an ERG-LP protein to thereby inhibit expression of the protein, e.g., by inhibiting transcription and/or translation. The hybridization can be by conventional nucleotide complementarity to form a stable duplex, or, for example, in the case of an antisense nucleic acid molecule which binds to DNA duplexes, through specific interactions in the major groove of the double helix. An example of a route of administration of antisense nucleic acid molecules of the invention include direct injection at a tissue site. Alternatively, antisense nucleic acid molecules can be modified to target selected cells and then administered systemically. For example, for systemic administration, antisense molecules can be modified such that they specifically bind to receptors or antigens expressed on a selected cell surface, e.g., by linking the antisense nucleic acid molecules to peptides or antibodies which bind to cell surface receptors or antigens. The antisense nucleic acid molecules can also be delivered to cells using the vectors described herein. To achieve sufficient intracellular concentrations of the antisense molecules, vector constructs in which the antisense nucleic acid molecule is placed under the control of a strong pol II or pol III promoter are preferred.

[0106] In yet another embodiment, the antisense nucleic acid molecule of the invention is an &agr;-anomeric nucleic acid molecule. An &agr;-anomeric nucleic acid molecule forms specific double-stranded hybrids with complementary RNA in which, contrary to the usual &bgr;-units, the strands run parallel to each other (Gaultier et al. (1987) Nucleic Acids. Res. 15:6625-6641). The antisense nucleic acid molecule can also comprise a 2′-o-methylribonucleotide (Inoue et al. (1987) Nucleic Acids Res. 15:6131-6148) or a chimeric RNA-DNA analogue (Inoue et al. (1987) FEBS Lett. 215:327-330).

[0107] In still another embodiment, an antisense nucleic acid of the invention is a ribozyme. Ribozymes are catalytic RNA molecules with ribonuclease activity which are capable of cleaving a single-stranded nucleic acid, such as an mRNA, to which they have a complementary region. Thus, ribozymes (e.g., hammerhead ribozymes (described in Haselhoff and Gerlach (1988) Nature 334:585-591)) can be used to catalytically cleave ERG-LP mRNA transcripts to thereby inhibit translation of ERG-LP mRNA. A ribozyme having specificity for an ERG-LP-encoding nucleic acid can be designed based upon the nucleotide sequence of an ERG-LP cDNA disclosed herein (i.e., SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:15 or SEQ ID NO:17). For example, a derivative of a Tetrahymena L-19 IVS RNA can be constructed in which the nucleotide sequence of the active site is complementary to the nucleotide sequence to be cleaved in an ERG-LP-encoding mRNA. See, e.g., Cech et al. U.S. Pat. No. 4,987,071; and Cech et al. U.S. Pat. No. 5,116,742. Alternatively, ERG-LP mRNA can be used to select a catalytic RNA having a specific ribonuclease activity from a pool of RNA molecules. See, e.g., Bartel, D. and Szostak, J. W. (1993) Science 261:1411-1418.

[0108] Alternatively, ERG-LP gene expression can be inhibited by targeting nucleotide sequences complementary to the regulatory region of the ERG-LP (e.g., the ERG-LP promoter and/or enhancers) to form triple helical structures that prevent transcription of the ERG-LP gene in target cells. See generally, Helene, C. (1991) Anticancer Drug Des. 6(6):569-84; Helene, C. et al. (1992) Ann. N.Y. Acad. Sci. 660:27-36; and Maher, L. J. (1992) Bioassays 14(12):807-15.

[0109] In yet another embodiment, the ERG-LP nucleic acid molecules of the present invention can be modified at the base moiety, sugar moiety or phosphate backbone to improve, e.g., the stability, hybridization, or solubility of the molecule. For example, the deoxyribose phosphate backbone of the nucleic acid molecules can be modified to generate peptide nucleic acids (see Hyrup B. et al. (1996) Bioorganic & Medicinal Chemistry 4 (1): 5-23). As used herein, the terms “peptide nucleic acids” or “PNAs” refer to nucleic acid mimics, e.g., DNA mimics, in which the deoxyribose phosphate backbone is replaced by a pseudopeptide backbone and only the four natural nucleobases are retained. The neutral backbone of PNAs has been shown to allow for specific hybridization to DNA and RNA under conditions of low ionic strength. The synthesis of PNA oligomers can be performed using standard solid phase peptide synthesis protocols as described in Hyrup B. et al. (1996) supra; Perry-O'Keefe et al. Proc. Natl. Acad. Sci. 93: 14670-675.

[0110] PNAs of ERG-LP nucleic acid molecules can be used in therapeutic and diagnostic applications. For example, PNAs can be used as antisense or antigene agents for sequence-specific modulation of gene expression by, for example, inducing transcription or translation arrest or inhibiting replication. PNAs of ERG-LP nucleic acid molecules can also be used in the analysis of single base pair mutations in a gene, (e.g., by PNA-directed PCR clamping); as ‘artificial restriction enzymes’ when used in combination with other enzymes, (e.g., S1 nucleases (Hyrup B. (1996) supra)); or as probes or primers for DNA sequencing or hybridization (Hyrup B. et al. (1996) supra; Perry-O'Keefe supra).

[0111] In another embodiment, PNAs of ERG-LP can be modified, (e.g., to enhance their stability or cellular uptake), by attaching lipophilic or other helper groups to PNA, by the formation of PNA-DNA chimeras, or by the use of liposomes or other techniques of drug delivery known in the art. For example, PNA-DNA chimeras of ERG-LP nucleic acid molecules can be generated which may combine the advantageous properties of PNA and DNA. Such chimeras allow DNA recognition enzymes, (e.g., RNAse H and DNA polymerases), to interact with the DNA portion while the PNA portion would provide high binding affinity and specificity. PNA-DNA chimeras can be linked using linkers of appropriate lengths selected in terms of base stacking, number of bonds between the nucleobases, and orientation (Hyrup B. (1996) supra). The synthesis of PNA-DNA chimeras can be performed as described in Hyrup B. (1996) supra and Finn P. J. et al. (1996) Nucleic Acids Res. 24 (17): 3357-63. For example, a DNA chain can be synthesized on a solid support using standard phosphoramidite coupling chemistry and modified nucleoside analogs, e.g., 5′-(4-methoxytrityl)amino-5′-deoxy-thymidine phosphoramidite, can be used as a between the PNA and the 5′ end of DNA (Mag, M. et al. (1989) Nucleic Acid Res. 17: 5973-88). PNA monomers are then coupled in a stepwise manner to produce a chimeric molecule with a 5′ PNA segment and a 3′ DNA segment (Finn P. J. et al. (1996) supra). Alternatively, chimeric molecules can be synthesized with a 5′ DNA segment and a 3′ PNA segment (Peterser, K. H. et al. (1975) Bioorganic Med. Chem. Lett. 5: 1119-11124).

[0112] In other embodiments, the oligonucleotide may include other appended groups such as peptides (e.g., for targeting host cell receptors in vivo), or agents facilitating transport across the cell membrane (see, e.g., Letsinger et al. (1989) Proc. Natl. Acad. Sci. US. 86:6553-6556; Lemaitre et al. (1987) Proc. Natl. Acad. Sci. USA 84:648-652; PCT Publication No. W088/09810) or the blood-brain barrier (see, e.g., PCT Publication No. W089/10134). In addition, oligonucleotides can be modified with hybridization-triggered cleavage agents (See, e.g., Krol et al. (1988) Bio-Techniques 6:958-976) or intercalating agents. (See, e.g., Zon (1988) Pharm. Res. 5:539-549). To this end, the oligonucleotide may be conjugated to another molecule, (e.g., a peptide, hybridization triggered cross-linking agent, transport agent, or hybridization-triggered cleavage agent).

[0113] II. Isolated ERG-LP Proteins and Anti-ERG-LP Antibodies

[0114] One aspect of the invention pertains to isolated ERG-LP proteins, and biologically active portions thereof, as well as polypeptide fragments suitable for use as immunogens to raise anti-ERG-LP antibodies. In one embodiment, native ERG-LP proteins can be isolated from cells or tissue sources by an appropriate purification scheme using standard protein purification techniques. In another embodiment, ERG-LP proteins are produced by, recombinant DNA techniques. Alternative to recombinant expression, an ERG-LP protein or polypeptide can be synthesized chemically using standard peptide synthesis techniques.

[0115] An “isolated” or “purified” protein or biologically active portion thereof is substantially free of cellular material or other contaminating proteins from the cell or tissue source from which the ERG-LP protein is derived, or substantially free from chemical precursors or other chemicals when chemically synthesized. The language “substantially free of cellular material” includes preparations of ERG-LP protein in which the protein is separated from cellular components of the cells from which it is isolated or recombinantly produced. In one embodiment, the language “substantially free of cellular material” includes preparations of ERG-LP protein having less than about 30% (by dry weight) of non-ERG-LP protein (also referred to herein as a “contaminating protein”), more preferably less than about 20% of non-ERG-LP protein, still more preferably less than about 10% of non-ERG-LP protein, and most preferably less than about 5% non-ERG-LP protein. When the ERG-LP protein or biologically active portion thereof is recombinantly produced, it is also preferably substantially free of culture medium, i.e., culture medium represents less than about 20%, more preferably less than about 10%, and most preferably less than about 5% of the volume of the protein preparation.

[0116] The language “substantially free of chemical precursors or other chemicals” includes preparations of ERG-LP protein in which the protein is separated from chemical precursors or other chemicals which are involved in the synthesis of the protein. In one embodiment, the language “substantially free of chemical precursors or other chemicals” includes preparations of ERG-LP protein having less than about 30% (by dry weight) of chemical precursors or non-ERG-LP chemicals, more preferably less than about 20% chemical precursors or non-ERG-LP chemicals, still more preferably less than about 10% chemical precursors or non-ERG-LP chemicals, and most preferably less than about 5% chemical precursors or non-ERG-LP chemicals.

[0117] As used herein, a “biologically active portion” of an ERG-LP protein includes a fragment of an ERG-LP protein which participates in an interaction between an ERG-LP molecule and a non-ERG-LP molecule. Biologically active portions of an ERG-LP protein include peptides comprising amino acid sequences sufficiently homologous to or derived from the amino acid sequence of the ERG-LP protein, e.g., the amino acid sequence shown in SEQ ID NO:2, SEQ ID NO:5, SEQ ID NO:8, or SEQ ID NO:16 which include less amino acids than the full length ERG-LP proteins, and exhibit at least one activity of an ERG-LP protein. Typically, biologically active portions comprise a domain or motif with at least one activity of the ERG-LP protein, e.g., binding of a cyclic nucleotide. A biologically active portion of an ERG-LP protein can be a polypeptide which is, for example, 10, 25, 50, 100, 200 or more amino acids in length. Biologically active portions of an ERG-LP protein can be used as targets for developing agents which modulate a potassium channel mediated activity.

[0118] In one embodiment, a biologically active portion of an ERG-LP protein comprises at least one transmembrane domain. In another embodiment, a biologically active portion of an ERG-LP protein comprises at least a P-loop. In another embodiment a biologically active portion of an ERG-LP protein comprises at least a cyclic nucleotide-binding domain. In another embodiment a biologically active portion of an ERG-LP protein comprises at least a transmembrane region cyclic nucleotide gated channel domain. In yet another embodiment a biologically active portion of a ERG-LP protein compirses at least a transmembrane domain, a P-loop, a cyclic nucleotide-binding domain and a transmembrane region cyclic nucleotide gated channel domain.

[0119] It is to be understood that a preferred biologically active portion of an ERG-LP protein of the present invention may contain at least one of the above-identified structural domains. A more preferred biologically active portion of an ERG-LP protein may contain at least two of the above-identified structural domains. Moreover, other biologically active portions, in which other regions of the protein are deleted, can be prepared by recombinant techniques and evaluated for one or more of the functional activities of a native ERG-LP protein.

[0120] In a preferred embodiment, the ERG-LP protein has an amino acid sequence shown in SEQ ID NO:2, SEQ ID NO:5, SEQ ID NO:8 or SEQ ID NO:16. In other embodiments, the ERG-LP protein is substantially homologous to SEQ ID NO:2, SEQ ID NO:5, SEQ ID NO:8, or SEQ ID NO:16, and retains the functional activity of the protein of SEQ ID NO:2, SEQ ID NO:5, SEQ ID NO:8, or SEQ ID NO:16, yet differs in amino acid sequence due to natural allelic variation or mutagenesis, as described in detail in subsection I above.

[0121] Accordingly, in another embodiment, the ERG-LP protein is a protein which comprises an amino acid sequence at least about 25%, 30%, 35%, 37%,40%,45%, 50%, 55%,60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% 96%, 97%, 98%, 99% or more homologous to SEQ ID NO:2, SEQ ID NO:5, SEQ ID NO:8 or SEQ ID NO:16.

[0122] To determine the percent homology of two amino acid sequences or of two nucleic acids, the sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced in the sequence of a first amino acid or nucleic acid sequence for optimal alignment with a second amino or nucleic acid sequence and non-homologous sequences can be disregarded for comparison purposes). In a preferred embodiment, the length of a reference sequence aligned for comparison purposes is at least 30%, preferably at least 40%, more preferably at least 50%, even more preferably at least 60%, and even more preferably at least 70%, 80%, or 90% of the length of the reference sequence (e.g., when aligning a second sequence having 177 amino acid residues, to the ERG-LP amino acid sequence of SEQ ID NO:2, SEQ ID NO:5, SEQ ID NO:8, or SEQ ID NO:16, at least 80, preferably at least 100, more preferably at least 120, even more preferably at least 140, and even more preferably at least 150, 160 or 170 amino acid residues are aligned). The amino acid residues or nucleotides at corresponding amino acid positions or nucleotide positions are then compared. When a position in the first sequence is occupied by the same amino acid residue or nucleotide as the corresponding position in the second sequence, then the molecules are homologous at that position (i.e., as used herein amino acid or nucleic acid “homology” is equivalent to amino acid or nucleic acid “identity”). The percent homology between the two sequences is a function of the number of identical positions shared by the sequences (i.e., % homology=# of identical positions/total # of positions×100).

[0123] The comparison of sequences and determination of percent homology between two sequences can be accomplished using a mathematical algorithim. A preferred, non-limiting example of a mathematical algorithim utilized for the comparison of sequences is the algorithm of Karlin and Altschul (1990) Proc. Natl. Acad. Sci. USA 87:2264-68, modified as in Karlin and Altschul (1993) Proc. Natl. Acad. Sci. USA 90:5873-77. Such an algorithm is incorporated into the NBLAST and XBLAST programs (version 2.0) of Altschul, et al. (1990) J. Mol. Biol. 215:403-10. BLAST nucleotide searches can be performed with the NBLAST program, score=100, wordlength=12 to obtain nucleotide sequences homologous to ERG-LP nucleic acid molecules of the invention. BLAST protein searches can be performed with the XBLAST program, score=50, wordlength=3 to obtain amino acid sequences homologous to ERG-LP protein molecules of the invention. To obtain gapped alignments for comparison purposes, Gapped BLAST can be utilized as described in Altschul et al., (1997) Nucleic Acids Res. 25(17):3389-3402. When utilizing BLAST and Gapped BLAST programs, the default parameters of the respective programs (e.g., XBLAST and NBLAST) can be used. See http://www.ncbi.nlm.nih.gov. Another preferred, non-limiting example of a mathematical algorithim utilized for the comparison of sequences is the algorithm of Myers and Miller, CABIOS (1989). Such an algorithm is incorporated into the ALIGN program (version 2.0) which is part of the GCG sequence alignment software package. When utilizing the ALIGN program for comparing amino acid sequences, a PAM120 weight residue table, a gap length penalty of 12, and a gap penalty of 4 can be used.

[0124] The invention also provides ERG-LP chimeric or fusion proteins. As used herein, an ERG-LP “chimeric protein” or “fusion protein” comprises an ERG-LP polypeptide operatively linked to a non-ERG-LP polypeptide. An “ERG-LP polypeptide” refers to a polypeptide having an amino acid sequence corresponding to ERG-LP, whereas a “non-ERG-LP polypeptide” refers to a polypeptide having an amino acid sequence corresponding to a protein which is not substantially homologous to the ERG-LP protein, e.g., a protein which is different from the ERG-LP protein and which is derived from the same or a different organism. Within an ERG-LP fusion protein the ERG-LP polypeptide can correspond to all or a portion of an ERG-LP protein. In a preferred embodiment, an ERG-LP fusion protein comprises at least one biologically active portion of an ERG-LP protein. In another preferred embodiment, an ERG-LP fusion protein comprises at least two biologically active portions of an ERG-LP protein. Within the fusion protein, the term “operatively linked” is intended to indicate that the ERG-LP polypeptide and the non-ERG-LP polypeptide are fused in-frame to each other. The non-ERG-LP polypeptide can be fused to the N-terminus or C-terminus of the ERG-LP polypeptide.

[0125] For example, in one embodiment, the fusion protein is a GST-ERG-LP fusion protein in which the ERG-LP sequences are fused to the C-terminus of the GST sequences. Such fusion proteins can facilitate the purification of recombinant ERG-LP.

[0126] In another embodiment, the fusion protein is an ERG-LP protein containing a heterologous signal sequence at its N-terminus. In certain host cells (e.g., mammalian host cells), expression and/or secretion of ERG-LP can be increased through use of a heterologous signal sequence.

[0127] The ERG-LP fusion proteins of the invention can be incorporated into pharmaceutical compositions and administered to a subject in vivo. The ERG-LP fusion proteins can be used to affect the bioavailability of an ERG-LP substrate. Use of ERG-LP fusion proteins may be useful therapeutically for the treatment of CNS disorders, e.g., neurodegenerative disorders such as Alzheimer's disease, dementias related to Alzheimer's disease (such as Pick's disease), Parkinson's and other Lewy diffuse body diseases, multiple sclerosis, amyotrophic lateral sclerosis, progressive supranuclear palsy, epilepsy and Jakob-Creutzfieldt disease; autonomic nervous system disorders; gastrointestinal disorders including, but not limited to, esophageal disorders such as atresia and fistulas, stenosis, achalasia, esophageal rings and webs, hiatal hernia, lacerations, esophagitis, diverticula, systemic sclerosis (scleroderma), varices, esophageal tumors such as squamous cell carcinomas and adenocarcinomas, stomach disorders such as diaphragmatic hernias, pyloric stenosis, gastritis, acute gastric erosion and ulceration, peptic ulcers, stomach tumors such as carcinomas and sarcomas, small intestine disorders such as congenital atresia and stenosis, diverticula, Meckel's diverticulum, pancreatic rests, ischemic bowel disease, infective enterocolitis, Crohn's disease, tumors of the small intestine such as carcinomas and sarcomas, disorders of the colon such as malabsorption, obstructive lesions such as hernias, megacolon, diverticular disease, melanosis coli, ischemic injury, hemorrhoids, angiodysplasia of right colon, inflammations of the colon such as ulcerative colitis, and tumors of the colon such as polyps and sarcomas; pain disorders, e.g., pain response elicited during various forms of tissue injury, e.g., inflammation, infection, and ischemia, usually referred to as hyperalgesia (described in, for example, Fields, H. L. (1987) Pain, New York:McGraw-Hill), and pain associated with muscoloskeletal disorders, e.g., joint pain; tooth pain; headaches; pain associated with malignancies, or pain associated with surgery; psychiatric disorders, e.g., depression, schizophrenic disorders, korsakoffs psychosis, mania, anxiety disorders, or phobic disorders; learning or memory disorders, e.g., amnesia or age-related memory loss; neurological disorders; e.g., migraine; and obesity; and cardiovascular disorders such as arteriosclerosis, ischemia reperfusion injury, restenosis, arterial inflammation, vascular wall remodeling, ventricular remodeling, rapid ventricular pacing, coronary microembolism, tachycardia, bradycardia, pressure overload, aortic bending, coronary artery ligation, vascular heart disease, atrial fibrilation, long-QT syndrome, congestive heart failure, sinus node disfunction, angina, heart failure, hypertension, atrial fibrillation, atrial flutter, dilated cardiomyopathy, idiopathic cardiomyopathy, myocardial infarction, coronary artery disease, coronary artery spasm, or arrhythmia.

[0128] Moreover, the ERG-LP-fusion proteins of the invention can be used as immunogens to produce anti-ERG-LP antibodies in a subject, to purify ERG-LP ligands and in screening assays to identify molecules which inhibit the interaction of ERG-LP with an ERG-LP substrate.

[0129] Preferably, an ERG-LP chimeric or fusion protein of the invention is produced by standard recombinant DNA techniques. For example, DNA fragments coding for the different polypeptide sequences are ligated together in-frame in accordance with conventional techniques, for example by employing blunt-ended or stagger-ended termini for ligation, restriction enzyme digestion to provide for appropriate termini, filling-in of cohesive ends as appropriate, alkaline phosphatase treatment to avoid undesirable joining, and enzymatic ligation. In another embodiment, the fusion gene can be synthesized by conventional techniques including automated DNA synthesizers. Alternatively, PCR amplification of gene fragments can be carried out using anchor primers which give rise to complementary overhangs between two consecutive gene fragments which can subsequently be annealed and reamplified to generate a chimeric gene sequence (see, for example, Current Protocols in Molecular Biology, eds. Ausubel et al. John Wiley & Sons: 1992). Moreover, many expression vectors are commercially available that already encode a fusion moiety (e.g., a GST polypeptide). An ERG-LP-encoding nucleic acid can be cloned into such an expression vector such that the fusion moiety is linked in-frame to the ERG-LP protein.

[0130] The present invention also pertains to variants of the ERG-LP proteins which function as either ERG-LP agonists (mimetics) or as ERG-LP antagonists. Variants of the ERG-LP proteins can be generated by mutagenesis, e.g., discrete point mutation or truncation of an ERG-LP protein. An agonist of the ERG-LP proteins can retain substantially the same, or a subset, of the biological activities of the naturally occurring form of an ERG-LP protein. An antagonist of an ERG-LP protein can inhibit one or more of the activities of the naturally occurring form of the ERG-LP protein by, for example, competitively modulating a potassium channel mediated activity of an ERG-LP protein. Thus, specific biological effects can be elicited by treatment with a variant of limited function. In one embodiment, treatment of a subject with a variant having a subset of the biological activities of the naturally occurring form of the protein has fewer side effects in a subject relative to treatment with the naturally occurring form of the ERG-LP protein.

[0131] In one embodiment, variants of an ERG-LP protein which function as either ERG-LP agonists (mimetics) or as ERG-LP antagonists can be identified by screening combinatorial libraries of mutants, e.g., truncation mutants, of an ERG-LP protein for ERG-LP protein agonist or antagonist activity. In one embodiment, a variegated library of ERG-LP variants is generated by combinatorial mutagenesis at the nucleic acid level and is encoded by a variegated gene library. A variegated library of ERG-LP variants can be produced by, for example, enzymatically ligating a mixture of synthetic oligonucleotides into gene sequences such that a degenerate set of potential ERG-LP sequences is expressible as individual polypeptides, or alternatively, as a set of larger fusion proteins (e.g., for phage display) containing the set of ERG-LP sequences therein. There are a variety of methods which can be used to produce libraries of potential ERG-LP variants from a degenerate oligonucleotide sequence. Chemical synthesis of a degenerate gene sequence can be performed in an automatic DNA synthesizer, and the synthetic gene then ligated into an appropriate expression vector. Use of a degenerate set of genes allows for the provision, in one mixture, of all of the sequences encoding the desired set of potential ERG-LP sequences. Methods for synthesizing degenerate oligonucleotides are known in the art (see, e.g., Narang, S. A. (1983) Tetrahedron 39:3; Itakura et al. (1984) Annu. Rev. Biochem. 53:323; Itakura et al. (1984) Science 198:1056; Ike et al. (1983) Nucleic Acid Res. 11:477.

[0132] In addition, libraries of fragments of an ERG-LP protein coding sequence can be used to generate a variegated population of ERG-LP fragments for screening and subsequent selection of variants of an ERG-LP protein. In one embodiment, a library of coding sequence fragments can be generated by treating a double stranded PCR fragment of an ERG-LP coding sequence with a nuclease under conditions wherein nicking occurs only about once per molecule, denaturing the double stranded DNA, renaturing the DNA to form double stranded DNA which can include sense/antisense pairs from different nicked products, removing single stranded portions from reformed duplexes by treatment with S1 nuclease, and ligating the resulting fragment library into an expression vector. By this method, an expression library can be derived which encodes N-terminal, C-terminal and internal fragments of various sizes of the ERG-LP protein.

[0133] Several techniques are known in the art for screening gene products of combinatorial libraries made by point mutations or truncation, and for screening cDNA libraries for gene products having a selected property. Such techniques are adaptable for rapid screening of the gene libraries generated by the combinatorial mutagenesis of ERG-LP proteins. The most widely used techniques, which are amenable to high through-put analysis, for screening large gene libraries typically include cloning the gene library into replicable expression vectors, transforming appropriate cells with the resulting library of vectors, and expressing the combinatorial genes under conditions in which detection of a desired activity facilitates isolation of the vector encoding the gene whose product was detected. Recrusive ensemble mutagenesis (REM), a new technique which enhances the frequency of functional mutants in the libraries, can be used in combination with the screening assays to identify ERG-LP variants (Arkin and Yourvan (1992) Proc. Natl. Acad. Sci. USA 89:7811-7815; Delgrave et al. (1993) Protein Engineering 6(3):327-331).

[0134] In one embodiment, cell based assays can be exploited to analyze a variegated ERG-LP library. For example, a library of expression vectors can be transfected into a cell line which ordinarily synthesizes ERG-LP. The transfected cells are then cultured such that ERG-LP and a particular mutant ERG-LP are expressed and the effect of expression of the mutant on ERG-LP activity in the cells can be detected, e.g., by any of a number of enzymatic assays or by detecting the release of a neurotransmitter. Plasmid DNA can then be recovered from the cells which score for inhibition, or alternatively, potentiation of ERG-LP activity, and the individual clones further characterized.

[0135] An isolated ERG-LP protein, or a portion or fragment thereof, can be used as an immunogen to generate antibodies that bind ERG-LP using standard techniques for polyclonal and monoclonal antibody preparation. A full-length ERG-LP protein can be used or, alternatively, the invention provides antigenic peptide fragments of ERG-LP for use as immunogens. The antigenic peptide of ERG-LP comprises at least 8 amino acid residues of the amino acid sequence shown in SEQ ID NO:2, SEQ ID NO:5, SEQ ID NO:8 or SEQ ID NO:16 and encompasses an epitope of ERG-LP such that an antibody raised against the peptide forms a specific immune complex with ERG-LP. Preferably, the antigenic peptide comprises at least 10 amino acid residues, more preferably at least 15 amino acid residues, even more preferably at least 20 amino acid residues, and most preferably at least 30 amino acid residues.

[0136] Preferred epitopes encompassed by the antigenic peptide are regions of ERG-LP that are located on the surface of the protein, e.g., hydrophilic regions, as well as regions with high antigenicity (see, for example, FIGS. 6, 7 and 9).

[0137] An ERG-LP immunogen typically is used to prepare antibodies by immunizing a suitable subject, (e.g., rabbit, goat, mouse or other mammal) with the immunogen. An appropriate immunogenic preparation can contain, for example, recombinantly expressed ERG-LP protein or a chemically synthesized ERG-LP polypeptide. The preparation can further include an adjuvant, such as Freund's complete or incomplete adjuvant, or similar immunostimulatory agent. Immunization of a suitable subject with an immunogenic ERG-LP preparation induces a polyclonal anti-ERG-LP antibody response.

[0138] Accordingly, another aspect of the invention pertains to anti-ERG-LP antibodies. The term “antibody” as used herein refers to immunoglobulin molecules and immunologically active portions of immunoglobulin molecules, i.e., molecules that contain an antigen binding site which specifically binds (immunoreacts with) an antigen, such as ERG-LP. Examples of immunologically active portions of immunoglobulin molecules include F(ab) and F(ab′)2 fragments which can be generated by treating the antibody with an enzyme such as pepsin. The invention provides polyclonal and monoclonal antibodies that bind ERG-LP. The term “monoclonal antibody” or “monoclonal antibody composition”, as used herein, refers to a population of antibody molecules that contain only one species of an antigen binding site capable of immunoreacting with a particular epitope of ERG-LP. A monoclonal antibody composition thus typically displays a single binding affinity for a particular ERG-LP protein with which it immunoreacts.

[0139] Polyclonal anti-ERG-LP antibodies can be prepared as described above by immunizing a suitable subject with an ERG-LP immunogen. The anti-ERG-LP antibody titer in the immunized subject can be monitored over time by standard techniques, such as with an enzyme linked immunosorbent assay (ELISA) using immobilized ERG-LP. If desired, the antibody molecules directed against ERG-LP can be isolated from the mammal (e.g., from the blood) and further purified by well known techniques, such as protein A chromatography to obtain the IgG fraction. At an appropriate time after immunization, e.g., when the anti-ERG-LP antibody titers are highest, antibody-producing cells can be obtained from the subject and used to prepare monoclonal antibodies by standard techniques, such as the hybridoma technique originally described by Kohler and Milstein (1975) Nature 256:495-497) (see also, Brown et al. (1981) J. Immunol. 127:539-46; Brown et al. (1980) J. Biol. Chem. 255:4980-83; Yeh et al. (1976) Proc. Natl. Acad. Sci. USA 76:2927-31; and Yeh et al. (1982) Int. J. Cancer 29:269-75), the more recent human B cell hybridoma technique (Kozbor et al. (1983) Immunol Today 4:72), the EBV-hybridoma technique (Cole et al. (1985), Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc., pp. 77-96) or trioma techniques. The technology for producing monoclonal antibody hybridomas is well known (see generally R. H. Kenneth, in Monoclonal Antibodies: A New Dimension In Biological Analyses, Plenum Publishing Corp., New York, N.Y. (1980); E. A. Lerner (1981) Yale J. Biol. Med., 54:387-402; M. L. Gefter et al. (1977) Somatic Cell Genet. 3:231-36). Briefly, an immortal cell line (typically a myeloma) is fused to lymphocytes (typically splenocytes) from a mammal immunized with an ERG-LP immunogen as described above, and the culture supernatants of the resulting hybridoma cells are screened to identify a hybridoma producing a monoclonal antibody that binds ERG-LP.

[0140] Any of the many well known protocols used for fusing lymphocytes and immortalized cell lines can be applied for the purpose of generating an anti-ERG-LP monoclonal antibody (see, e.g., G. Galfre et al. (1977) Nature 266:55052; Gefter et al. Somatic Cell Genet., cited supra; Lerner, Yale J. Biol. Med., cited supra; Kenneth, Monoclonal Antibodies, cited supra). Moreover, the ordinarily skilled worker will appreciate that there are many variations of such methods which also would be useful. Typically, the immortal cell line (e.g., a myeloma cell line) is derived from the same mammalian species as the lymphocytes. For example, murine hybridomas can be made by fusing lymphocytes from a mouse immunized with an immunogenic preparation of the present invention with an immortalized mouse cell line. Preferred immortal cell lines are mouse myeloma cell lines that are sensitive to culture medium containing hypoxanthine, aminopterin and thymidine (“HAT medium”). Any of a number of myeloma cell lines can be used as a fusion partner according to standard techniques, e.g., the P3-NS1/1-Ag4-1, P3-x63-Ag8.653 or Sp2/O-Ag14 myeloma lines. These myeloma lines are available from ATCC. Typically, HAT-sensitive mouse myeloma cells are fused to mouse splenocytes using polyethylene glycol (“PEG”). Hybridoma cells resulting from the fusion are then selected using HAT medium, which kills unfused and unproductively fused myeloma cells (unfused splenocytes die after several days because they are not transformed). Hybridoma cells producing a monoclonal antibody of the invention are detected by screening the hybridoma culture supernatants for antibodies that bind ERG-LP, e.g., using a standard ELISA assay.

[0141] Alternative to preparing monoclonal antibody-secreting hybridomas, a monoclonal anti-ERG-LP antibody can be identified and isolated by screening a recombinant combinatorial immunoglobulin library (e.g., an antibody phage display library) with ERG-LP to thereby isolate immunoglobulin library members that bind ERG-LP. Kits for generating and screening phage display libraries are commercially available (e.g., the Pharmacia Recombinant Phage Antibody System, Catalog No. 27-9400-01; and the Stratagene SurgZAP™ Phage Display Kit, Catalog No. 240612). Additionally, examples of methods and reagents particularly amenable for use in generating and screening antibody display library can be found in, for example, Ladner et al. U.S. Pat. No. 5,223,409; Kang et al. PCT International Publication No. WO 92/18619; Dower et al. PCT International Publication No. WO 91/17271; Winter et al. PCT International Publication WO 92/20791; Markland et al. PCT International Publication No. WO 92/15679; Breitling et al. PCT International Publication WO 93/01288; McCafferty et al. PCT International Publication No. WO 92/01047; Garrard et al. PCT International Publication No. WO 92/09690; Ladner et al. PCT International Publication No. WO 90/02809; Fuchs et al. (1991) Bio/Technology 9:1370-1372; Hay et al. (1992) Hum. Antibod. Hybridomas 3:81-85; Huse et al. (1989) Science 246:1275-1281; Griffiths et al. (1993) EMBO J 12:725-734; Hawkins et al. (1992) J. Mol. Biol. 226:889-896; Clarkson et al. (1991) Nature 352:624-628; Gram et al. (1992) Proc. Natl. Acad. Sci. USA 89:3576-3580; Garrad et al. (1991) Bio/Technology 9:1373-1377; Hoogenboom et al. (1991) Nuc. Acid Res. 19:4133-4137; Barbas et al. (1991) Proc. Natl. Acad. Sci. USA 88:7978-7982; and McCafferty et al. Nature (1990) 348:552-554.

[0142] Additionally, recombinant anti-ERG-LP antibodies, such as chimeric and humanized monoclonal antibodies, comprising both human and non-human portions, which can be made using standard recombinant DNA techniques, are within the scope of the invention. Such chimeric and humanized monoclonal antibodies can be produced by recombinant DNA techniques known in the art, for example using methods described in Robinson et al. International Application No. PCT/US86/02269; Akira, et al. European Patent Application 184,187; Taniguchi, M., European Patent Application 171,496; Morrison et al. European Patent Application 173,494; Neuberger et al. PCT International Publication No. WO 86/01533; Cabilly et al. U.S. Pat. No. 4,816,567; Cabilly et al. European Patent Application 125,023; Better et al. (1988) Science 240:1041-1043; Liu et al. (1987) Proc. Natl. Acad. Sci. USA 84:3439-3443; Liu et al. (1987) J. Immunol. 139:3521-3526; Sun et al. (1987) Proc. Natl. Acad. Sci. USA 84:214-218; Nishimura et al. (1987) Canc. Res. 47:999-1005; Wood et al. (1985) Nature 314:446-449; and Shaw et al. (1988) J. Natl. Cancer Inst. 80:1553-1559); Morrison, S. L. (1985) Science 229:1202-1207; Oi et al. (1986) BioTechniques 4:214; Winter U.S. Pat. No. 5,225,539; Jones et al. (1986) Nature 321:552-525; Verhoeyan et al. (1988) Science 239:1534; and Beidler et al. (1988) J. Immunol. 141:4053-4060.

[0143] An anti-ERG-LP antibody (e.g., monoclonal antibody) can be used to isolate ERG-LP by standard techniques, such as affinity chromatography or immunoprecipitation. An anti-ERG-LP antibody can facilitate the purification of natural ERG-LP from cells and of recombinantly produced ERG-LP expressed in host cells. Moreover, an anti-ERG-LP antibody can be used to detect ERG-LP protein (e.g., in a cellular lysate or cell supernatant) in order to evaluate the abundance and pattern of expression of the ERG-LP protein. Anti-ERG-LP antibodies can be used diagnostically to monitor protein levels in tissue as part of a clinical testing procedure, e.g., to, for example, determine the efficacy of a given treatment regimen. Detection can be facilitated by coupling (i.e., physically linking) the antibody to a detectable substance. Examples of detectable substances include various enzymes, prosthetic groups, fluorescent materials, luminescent materials, bioluminescent materials, and radioactive materials. Examples of suitable enzymes include horseradish peroxidase, alkaline phosphatase, -galactosidase, or acetylcholinesterase; examples of suitable prosthetic group complexes include streptavidin/biotin and avidin/biotin; examples of suitable fluorescent materials include umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazinylamine fluorescein, dansyl chloride or phycoerythrin; an example of a luminescent material includes luminol; examples of bioluminescent materials include luciferase, luciferin, and aequorin, and examples of suitable radioactive material include 125I, 131I, 35S or 3H.

[0144] III. Recombinant Expression Vectors and Host Cells

[0145] Another aspect of the invention pertains to vectors, preferably expression vectors, containing a nucleic acid encoding an ERG-LP protein (or a portion thereof). As used herein, the term “vector” refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked. One type of vector is a “plasmid”, which refers to a circular double stranded DNA loop into which additional DNA segments can be ligated. Another type of vector is a viral vector, wherein additional DNA segments can be ligated into the viral genome. Certain vectors are capable of autonomous replication in a host cell into which they are introduced (e.g., bacterial vectors having a bacterial origin of replication and episomal mammalian vectors). Other vectors (e.g., non-episomal mammalian vectors) are integrated into the genome of a host cell upon introduction into the host cell, and thereby are replicated along with the host genome. Moreover, certain vectors are capable of directing the expression of genes to which they are operatively linked. Such vectors are referred to herein as “expression vectors”. In general, expression vectors of utility in recombinant DNA techniques are often in the form of plasmids. In the present specification, “plasmid” and “vector” can be used interchangeably as the plasmid is the most commonly used form of vector. However, the invention is intended to include such other forms of expression vectors, such as viral vectors (e.g., replication defective retroviruses, adenoviruses and adeno-associated viruses), which serve equivalent functions.

[0146] The recombinant expression vectors of the invention comprise a nucleic acid of the invention in a form suitable for expression of the nucleic acid in a host cell, which means that the recombinant expression vectors include one or more regulatory sequences, selected on the basis of the host cells to be used for expression, which is operatively linked to the nucleic acid sequence to be expressed. Within a recombinant expression vector, “operably linked” is intended to mean that the nucleotide sequence of interest is linked to the regulatory sequence(s) in a manner which allows for expression of the nucleotide sequence (e.g., in an in vitro transcription/translation system or in a host cell when the vector is introduced into the host cell). The term “regulatory sequence” is intended to includes promoters, enhancers and other expression control elements (e.g., polyadenylation signals). Such regulatory sequences are described, for example, in Goeddel; Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, Calif. (1990). Regulatory sequences include those which direct constitutive expression of a nucleotide sequence in many types of host cell and those which direct expression of the nucleotide sequence only in certain host cells (e.g., tissue-specific regulatory sequences). It will be appreciated by those skilled in the art that the design of the expression vector can depend on such factors as the choice of the host cell to be transformed, the level of expression of protein desired, and the like. The expression vectors of the invention can be introduced into host cells to thereby produce proteins or peptides, including fusion proteins or peptides, encoded by nucleic acids as described herein (e.g., ERG-LP proteins, mutant forms of ERG-LP proteins, fusion proteins, and the like).

[0147] The recombinant expression vectors of the invention can be designed for expression of ERG-LP proteins in prokaryotic or eukaryotic cells. For example, ERG-LP proteins can be expressed in bacterial cells such as E. coli, insect cells (using baculovirus expression vectors) yeast cells or mammalian cells. Suitable host cells are discussed further in Goeddel, Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, Calif. (1990). Alternatively, the recombinant expression vector can be transcribed and translated in vitro, for example using T7 promoter regulatory sequences and T7 polymerase.

[0148] Expression of proteins in prokaryotes is most often carried out in E. coli with vectors containing constitutive or inducible promoters directing the expression of either fusion or non-fusion proteins. Fusion vectors add a number of amino acids to a protein encoded therein, usually to the amino terminus of the recombinant protein. Such fusion vectors typically serve three purposes: 1) to increase expression of recombinant protein; 2) to increase the solubility of the recombinant protein; and 3) to aid in the purification of the recombinant protein by acting as a ligand in affinity purification. Often, in fusion expression vectors, a proteolytic cleavage site is introduced at the junction of the fusion moiety and the recombinant protein to enable separation of the recombinant protein from the fusion moiety subsequent to purification of the fusion protein. Such enzymes, and their cognate recognition sequences, include Factor Xa, thrombin and enterokinase. Typical fusion expression vectors include pGEX (Pharmacia Biotech Inc; Smith, D. B. and Johnson, K. S. (1988) Gene 67:31-40), pMAL (New England Biolabs, Beverly, Mass.) and pRIT5 (Pharmacia, Piscataway, N.J.) which fuse glutathione S-transferase (GST), maltose E binding protein, or protein A, respectively, to the target recombinant protein.

[0149] Purified fusion proteins can, be utilized in ERG-LP activity assays, (e.g., direct assays or competitive assays described in detail below), or to generate antibodies specific for ERG-LP proteins, for example. In a preferred embodiment, an ERG-LP fusion protein expressed in a retroviral expression vector of the present invention can be utilized to infect bone marrow cells which are subsequently transplanted into irradiated recipients. The pathology of the subject recipient is then examined after sufficient time has passed (e.g., six (6) weeks).

[0150] Examples of suitable inducible non-fusion E. coli expression vectors include pTrc (Amann et al., (1988) Gene 69:301-315) and pET 11d (Studier et al., Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, Calif. (1990) 60-89). Target gene expression from the pTrc vector relies on host RNA polymerase transcription from a hybrid trp-lac fusion promoter. Target gene expression from the pET 11d vector relies on transcription from a T7 gn10-lac fusion promoter mediated by a coexpressed viral RNA polymerase (T7 gn1). This viral polymerase is supplied by host strains BL21(DE3) or HMS174(DE3) from a resident prophage harboring a T7 gn1 gene under the transcriptional control of the lacUV 5 promoter.

[0151] One strategy to maximize recombinant protein expression in E. coli is to express the protein in a host bacteria with an impaired capacity to proteolytically cleave the recombinant protein (Gottesman, S., Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, Calif. (1990) 119-128). Another strategy is to alter the nucleic acid sequence of the nucleic acid to be inserted into an expression vector so that the individual codons for each amino acid are those preferentially utilized in E. coli (Wada et al., (1992) Nucleic Acids Res. 20:2111-2118). Such alteration of nucleic acid sequences of the invention can be carried out by standard DNA synthesis techniques.

[0152] In another embodiment, the ERG-LP expression vector is a yeast expression vector. Examples of vectors for expression in yeast S. cerivisae include pYepSec1 (Baldari, et al., (1987) Embo J. 6:229-234), pMFa (Kurjan and Herskowitz, (1982) Cell 30:933-943), pJRY88 (Schultz et al., (1987) Gene 54:113-123), pYES2 (Invitrogen Corporation, San Diego, Calif.), and picZ (InVitrogen Corp, San Diego, Calif.).

[0153] Alternatively, ERG-LP proteins can be expressed in insect cells using baculovirus expression vectors. Baculovirus vectors available for expression of proteins in cultured insect cells (e.g., Sf 9 cells) include the pAc series (Smith et al. (1983) Mol. Cell Biol. 3:2156-2165) and the pVL series (Lucklow and Summers (1989) Virology 170:31-39).

[0154] In yet another embodiment, a nucleic acid of the invention is expressed in mammalian cells using a mammalian expression vector. Examples of mammalian expression vectors include pCDM8 (Seed, B. (1987) Nature 329:840) and pMT2PC (Kaufman et al. (1987) EMBO J. 6:187-195). When used in mammalian cells, the expression vector's control functions are often provided by viral regulatory elements. For example, commonly used promoters are derived from polyoma, Adenovirus 2, cytomegalovirus and Simian Virus 40. For other suitable expression systems for both prokaryotic and eukaryotic cells see chapters 16 and 17 of Sambrook, J., Fritsh, E. F., and Maniatis, T. Molecular Cloning: A Laboratory Manual. 2nd, ed., Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989.

[0155] In another embodiment, the recombinant mammalian expression vector is capable of directing expression of the nucleic acid preferentially in a particular cell type (e.g., tissue-specific regulatory elements are used to express the nucleic acid). Tissue-specific regulatory elements are known in the art. Non-limiting examples of suitable tissue-specific promoters include the albumin promoter (liver-specific; Pinkert et al. (1987) Genes Dev. 1:268-277), lymphoid-specific promoters (Calame and Eaton (1988) Adv. Immunol. 43:235-275), in particular promoters of T cell receptors (Winoto and Baltimore (1989) EMBO J. 8:729-733) and immunoglobulins (Banerji et al. (1983) Cell 33:729-740; Queen and Baltimore (1983) Cell 33:741-748), neuron-specific promoters (e.g., the neurofilament promoter; Byrne and Ruddle (1989) Proc. Natl. Acad. Sci. USA 86:5473-5477), pancreas-specific promoters (Edlund et al. (1985) Science 230:912-916), and mammary gland-specific promoters (e.g., milk whey promoter; U.S. Pat. No. 4,873,316 and European Application Publication No. 264,166). Developmentally-regulated promoters are also encompassed, for example the murine hox promoters (Kessel and Gruss (1990) Science 249:374-379) and the &agr;-fetoprotein promoter (Campes and Tilghman (1989) Genes Dev. 3:537-546).

[0156] The invention further provides a recombinant expression vector comprising a DNA molecule of the invention cloned into the expression vector in an antisense orientation. That is, the DNA molecule is operatively linked to a regulatory sequence in a manner which allows for expression (by transcription of the DNA molecule) of an RNA molecule which is antisense to ERG-LP mRNA. Regulatory sequences operatively linked to a nucleic acid cloned in the antisense orientation can be chosen which direct the continuous expression of the antisense RNA molecule in a variety of cell types, for instance viral promoters and/or enhancers, or regulatory sequences can be chosen which direct constitutive, tissue specific or cell type specific expression of antisense RNA. The antisense expression vector can be in the form of a recombinant plasmid, phagemid or attenuated virus in which antisense nucleic acids are produced under the control of a high efficiency regulatory region, the activity of which can be determined by the cell type into which the vector is introduced. For a discussion of the regulation of gene expression using antisense genes see Weintraub, H. et al., Antisense RNA as a molecular tool for genetic analysis, Reviews—Trends in Genetics, Vol. 1(1) 1986.

[0157] Another aspect of the invention pertains to host cells into which a recombinant expression vector of the invention has been introduced. The terms “host cell” and “recombinant host cell” are used interchangeably herein. It is understood that such terms refer not only to the particular subject cell but to the progeny or potential progeny of such a cell. Because certain modifications may occur in succeeding generations due to either mutation or environmental influences, such progeny may not, in fact, be identical to the parent cell, but are still included within the scope of the term as used herein.

[0158] A host cell can be any prokaryotic or eukaryotic cell. For example, an ERG-LP protein can be expressed in bacterial cells such as E. coli, insect cells, yeast or mammalian cells (such as Chinese hamster ovary cells (CHO) or COS cells). Other suitable host cells are known to those skilled in the art.

[0159] Vector DNA can be introduced into prokaryotic or eukaryotic cells via conventional transformation or transfection techniques. As used herein, the terms “transformation” and “transfection” are intended to refer to a variety of art-recognized techniques for introducing foreign nucleic acid (e.g., DNA) into a host cell, including calcium phosphate or calcium chloride co-precipitation, DEAE-dextran-mediated transfection, lipofection, or electroporation. Suitable methods for transforming or transfecting host cells can be found in Sambrook, et al. (Molecular Cloning: A Laboratory Manual. 2nd, ed, Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989), and other laboratory manuals.

[0160] For stable transfection of mammalian cells, it is known that, depending upon the expression vector and transfection technique used, only a small fraction of cells may integrate the foreign DNA into their genome. In order to identify and select these integrants, a gene that encodes a selectable marker (e.g., resistance to antibiotics) is generally introduced into the host cells along with the gene of interest. Preferred selectable markers include those which confer resistance to drugs, such as G418, hygromycin and methotrexate. Nucleic acid encoding a selectable marker can be introduced into a host cell on the same vector as that encoding an ERG-LP protein or can be introduced on a separate vector. Cells stably transfected with the introduced nucleic acid can be identified by drug selection (e.g., cells that have incorporated the selectable marker gene will survive, while the other cells die).

[0161] A host cell of the invention, such as a prokaryotic or eukaryotic host cell in culture, can be used to produce (i.e., express) an ERG-LP protein. Accordingly, the invention further provides methods for producing an ERG-LP protein using the host cells of the invention. In one embodiment, the method comprises culturing the host cell of invention (into which a recombinant expression vector encoding an ERG-LP protein has been introduced) in a suitable medium such that an ERG-LP protein is produced. In another embodiment, the method further comprises isolating an ERG-LP protein from the medium or the host cell.

[0162] The host cells of the invention can also be used to produce non-human transgenic animals. For example, in one embodiment, a host cell of the invention is a fertilized oocyte or an embryonic stem cell into which ERG-LP-coding sequences have been introduced. Such host cells can then be used to create non-human transgenic animals in which exogenous ERG-LP sequences have been introduced into their genome or homologous recombinant animals in which endogenous ERG-LP sequences have been altered. Such animals are useful for studying the function and/or activity of an ERG-LP and for identifying and/or evaluating modulators of ERG-LP activity. As used herein, a “transgenic animal” is a non-human animal, preferably a mammal, more preferably a rodent such as a rat or mouse, in which one or more of the cells of the animal includes a transgene. Other examples of transgenic animals include non-human primates, sheep, dogs, cows, goats, chickens, amphibians, etc. A transgene is exogenous DNA which is integrated into the genome of a cell from which a transgenic animal develops and which remains in the genome of the mature animal, thereby directing the expression of an encoded gene product in one or more cell types or tissues of the transgenic animal. As used herein, a “homologous recombinant animal” is a non-human animal, preferably a mammal, more preferably a mouse, in which an endogenous ERG-LP gene has been altered by homologous recombination between the endogenous gene and an exogenous DNA molecule introduced into a cell of the animal, e.g., an embryonic cell of the animal, prior to development of the animal.

[0163] A transgenic animal of the invention can be created by introducing an ERG-LP-encoding nucleic acid into the male pronuclei of a fertilized oocyte, e.g., by microinjection, retroviral infection, and allowing the oocyte to develop in a pseudopregnant female foster animal. The ERG-LP cDNA sequence of SEQ ID NO:1 can be introduced as a transgene into the genome of a non-human animal. Alternatively, a nonhuman homologue of a human ERG-LP gene, such as a mouse or rat ERG-LP gene, can be used as a transgene. Alternatively, an ERG-LP gene homologue, such as another ERG potassium channel family member, can be isolated based on hybridization to the ERG-LP cDNA sequences of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:9 SEQ ID NO:15 or SEQ ID NO:17 and used as a transgene. Intronic sequences and polyadenylation signals can also be included in the transgene to increase the efficiency of expression of the transgene. A tissue-specific regulatory sequence(s) can be operably linked to an ERG-LP transgene to direct expression of an ERG-LP protein to particular cells. Methods for generating transgenic animals via embryo manipulation and microinjection, particularly animals such as mice, have become conventional in the art and are described, for example, in U.S. Pat. Nos. 4,736,866 and 4,870,009, both by Leder et al., U.S. Pat. No. 4,873,191 by Wagner et al. and in Hogan, B., Manipulating the Mouse Embryo, (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1986). Similar methods are used for production of other transgenic animals. A transgenic founder animal can be identified based upon the presence of an ERG-LP transgene in its genome and/or expression of ERG-LP mRNA in tissues or cells of the animals. A transgenic founder animal can then be used to breed additional animals carrying the transgene. Moreover, transgenic animals carrying a transgene encoding an ERG-LP protein can further be bred to other transgenic animals carrying other transgenes.

[0164] To create a homologous recombinant animal, a vector is prepared which contains at least a portion of an ERG-LP gene into which a deletion, addition or substitution has been introduced to thereby alter, e.g., functionally disrupt, the ERG-LP gene. The ERG-LP gene can be a human gene (e.g., the cDNA of SEQ ID NO:6), but more preferably, is a non-human homologue of a human ERG-LP gene (e.g., a cDNA isolated by stringent hybridization with the nucleotide sequence of SEQ ID NO:4). For example, a mouse ERG-LP gene can be used to construct a homologous recombination vector suitable for altering an endogenous ERG-LP gene in the mouse genome. In a preferred embodiment, the vector is designed such that, upon homologous recombination, the endogenous ERG-LP gene is functionally disrupted (i.e., no longer encodes a functional protein; also referred to as a “knock out” vector). Alternatively, the vector can be designed such that, upon homologous recombination, the endogenous ERG-LP gene is mutated or otherwise altered but still encodes functional protein (e.g., the upstream regulatory region can be altered to thereby alter the expression of the endogenous ERG-LP protein). In the homologous recombination vector, the altered portion of the ERG-LP gene is flanked at its 5′ and 3′ ends by additional nucleic acid sequence of the ERG-LP gene to allow for homologous recombination to occur between the exogenous ERG-LP gene carried by the vector and an endogenous ERG-LP gene in an embryonic stem cell. The additional flanking ERG-LP nucleic acid sequence is of sufficient length for successful homologous recombination with the endogenous gene. Typically, several kilobases of flanking DNA (both at the 5′ and 3′ ends) are included in the vector (see e.g., Thomas, K. R. and Capecchi, M. R. (1987) Cell 51:503 for a description of homologous recombination vectors). The vector is introduced into an embryonic stem cell line (e.g., by electroporation) and cells in which the introduced ERG-LP gene has homologously recombined with the endogenous ERG-LP gene are selected (see e.g., Li, E. et al. (1992) Cell 69:915). The selected cells are then injected into a blastocyst of an animal (e.g., a mouse) to form aggregation chimeras (see e.g., Bradley, A. in Teratocarcinomas and Embryonic Stem Cells: A Practical Approach, E. J. Robertson, ed. (IRL, Oxford, 1987) pp. 113-152). A chimeric embryo can then be implanted into a suitable pseudopregnant female foster animal and the embryo brought to term. Progeny harboring the homologously recombined DNA in their germ cells can be used to breed animals in which all cells of the animal contain the homologously recombined DNA by germline transmission of the transgene. Methods for constructing homologous recombination vectors and homologous recombinant animals are described further in Bradley, A. (1991) Current Opinion in Biotechnology 2:823-829 and in PCT International Publication Nos.: WO 90/11354 by Le Mouellec et al.; WO 91/01140 by Smithies et al.; WO 92/0968 by Zijlstra et al.; and WO 93/04169 by Berns et al.

[0165] In another embodiment, transgenic non-humans animals can be produced which contain selected systems which allow for regulated expression of the transgene. One example of such a system is the cre/loxP recombinase system of bacteriophage P1. For a description of the cre/loxP recombinase system, see, e.g., Lakso et al. (1992) Proc. Natl. Acad. Sci. USA 89:6232-6236. Another example of a recombinase system is the FLP recombinase system of Saccharomyces cerevisiae (O'Gorman et al. (1991) Science 251:1351-1355. If a cre/loxP recombinase system is used to regulate expression of the transgene, animals containing transgenes encoding both the Cre recombinase and a selected protein are required. Such animals can be provided through the construction of “double” transgenic animals, e.g., by mating two transgenic animals, one containing a transgene encoding a selected protein and the other containing a transgene encoding a recombinase.

[0166] Clones of the non-human transgenic animals described herein can also be produced according to the methods described in Wilmut, I. et al. (1997) Nature 385:810-813 and PCT International Publication Nos. WO 97/07668 and WO 97/07669. In brief, a cell, e.g., a somatic cell, from the transgenic animal can be isolated and induced to exit the growth cycle and enter Go phase. The quiescent cell can then be fused, e.g., through the use of electrical pulses, to an enucleated oocyte from an animal of the same species from which the quiescent cell is isolated. The recontructed oocyte is then cultured such that it develops to morula or blastocyte and then transferred to pseudopregnant female foster animal. The offspring borne of this female foster animal will be a clone of the animal from which the cell, e.g., the somatic cell, is isolated.

[0167] IV. Pharmaceutical Compositions

[0168] The ERG-LP nucleic acid molecules, fragments of ERG-LP proteins, and anti-ERG-LP antibodies (also referred to herein as “active compounds”) of the invention can be incorporated into pharmaceutical compositions suitable for administration. Such compositions typically comprise the nucleic acid molecule, protein, or antibody and a pharmaceutically acceptable carrier. As used herein the language “pharmaceutically acceptable carrier” is intended to include any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, compatible with pharmaceutical administration. The use of such media and agents for pharmaceutically active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active compound, use thereof in the compositions is contemplated. Supplementary active compounds can also be incorporated into the compositions.

[0169] A pharmaceutical composition of the invention is formulated to be compatible with its intended route of administration. Examples of routes of administration include parenteral, e.g., intravenous, intradermal, subcutaneous, oral (e.g., inhalation), transdermal (topical), transmucosal, and rectal administration. Solutions or suspensions used for parenteral, intradermal, or subcutaneous application can include the following components: a sterile diluent such as water for injection, saline solution, fixed oils, polyethylene glycols, glycerine, propylene glycol or other synthetic solvents; antibacterial agents such as benzyl alcohol or methyl parabens; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid; buffers such as acetates, citrates or phosphates and agents for the adjustment of tonicity such as sodium chloride or dextrose. pH can be adjusted with acids or bases, such as hydrochloric acid or sodium hydroxide. The parenteral preparation can be enclosed in ampoules, disposable syringes or multiple dose vials made of glass or plastic.

[0170] Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, Cremophor EL™ (BASF, Parsippany, N.J.) or phosphate buffered saline (PBS). In all cases, the composition must be sterile and should be fluid to the extent that easy syringability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyetheylene glycol, and the like), and suitable mixtures thereof. The proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. Prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars, polyalcohols such as manitol, sorbitol, sodium chloride in the composition. Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent which delays absorption, for example, aluminum monostearate and gelatin.

[0171] Sterile injectable solutions can be prepared by incorporating the active compound (e.g., a fragment of an ERG-LP protein or an anti-ERG-LP antibody) in the required amount in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the active compound into a sterile vehicle which contains a basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum drying and freeze-drying which yields a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.

[0172] Oral compositions generally include an inert diluent or an edible carrier. They can be enclosed in gelatin capsules or compressed into tablets. For the purpose of oral therapeutic administration, the active compound can be incorporated with excipients and used in the form of tablets, troches, or capsules. Oral compositions can also be prepared using a fluid carrier for use as a mouthwash, wherein the compound in the fluid carrier is applied orally and swished and expectorated or swallowed. Pharmaceutically compatible binding agents, and/or adjuvant materials can be included as part of the composition. The tablets, pills, capsules, troches and the like can contain any of the following ingredients, or compounds of a similar nature: a binder such as microcrystalline cellulose, gum tragacanth or gelatin; an excipient such as starch or lactose, a disintegrating agent such as alginic acid, Primogel, or corn starch; a lubricant such as magnesium stearate or Sterotes; a glidant such as colloidal silicon dioxide; a sweetening agent such as sucrose or saccharin; or a flavoring agent such as peppermint, methyl salicylate, or orange flavoring.

[0173] For administration by inhalation, the compounds are delivered in the form of an aerosol spray from pressured container or dispenser which contains a suitable propellant, e.g., a gas such as carbon dioxide, or a nebulizer.

[0174] Systemic administration can also be by transmucosal or transdermal means. For transmucosal or transdermal administration, penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art, and include, for example, for transmucosal administration, detergents, bile salts, and fusidic acid derivatives. Transmucosal administration can be accomplished through the use of nasal sprays or suppositories. For transdermal administration, the active compounds are formulated into ointments, salves, gels, or creams as generally known in the art.

[0175] The compounds can also be prepared in the form of suppositories (e.g., with conventional suppository bases such as cocoa butter and other glycerides) or retention enemas for rectal delivery.

[0176] In one embodiment, the active compounds are prepared with carriers that will protect the compound against rapid elimination from the body, such as a controlled release formulation, including implants and microencapsulated delivery systems. Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid. Methods for preparation of such formulations will be apparent to those skilled in the art. The materials can also be obtained commercially from Alza Corporation and Nova Pharmaceuticals, Inc. Liposomal suspensions (including liposomes targeted to infected cells with monoclonal antibodies to viral antigens) can also be used as pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art, for example, as described in U.S. Pat. No. 4,522,811.

[0177] It is especially advantageous to formulate oral or parenteral compositions in dosage unit form for ease of administration and uniformity of dosage. Dosage unit form as used herein refers to physically discrete units suited as unitary dosages for the subject to be treated; each unit containing a predetermined quantity of active compound calculated to produce the desired therapeutic effect in association with the required pharmaceutical carrier. The specification for the dosage unit forms of the invention are dictated by and directly dependent on the unique characteristics of the active compound and the particular therapeutic effect to be achieved, and the limitations inherent in the art of compounding such an active compound for the treatment of individuals.

[0178] Toxicity and therapeutic efficacy of such compounds can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., for determining the LD50 (the dose lethal to 50% of the population) and the ED50 (the dose therapeutically effective in 50% of the population). The dose ratio between toxic and therapeutic effects is the therapeutic index and it can be expressed as the ratio LD50/ED50. Compounds which exhibit large therapeutic indices are preferred. While compounds that exhibit toxic side effects may be used, care should be taken to design a delivery system that targets such compounds to the site of affected tissue in order to minimize potential damage to uninfected cells and, thereby, reduce side effects.

[0179] The data obtained from the cell culture assays and animal studies can be used in formulating a range of dosage for use in humans. The dosage of such compounds lies preferably within a range of circulating concentrations that include the ED50 with little or no toxicity. The dosage may vary within this range depending upon the dosage form employed and the route of administration utilized. For any compound used in the method of the invention, the therapeutically effective dose can be estimated initially from cell culture assays. A dose may be formulated in animal models to achieve a circulating plasma concentration range that includes the IC50 (i.e., the concentration of the test compound which achieves a half-maximal inhibition of symptoms) as determined in cell culture. Such information can be used to more accurately determine useful doses in humans. Levels in plasma may be measured, for example, by high performance liquid chromatography.

[0180] The nucleic acid molecules of the invention can be inserted into vectors and used as gene therapy vectors. Gene therapy vectors can be delivered to a subject by, for example, intravenous injection, local administration (see U.S. Pat. No. 5,328,470) or by stereotactic injection (see e.g., Chen et al. (1994) Proc. Natl. Acad. Sci. USA 91:3054-3057). The pharmaceutical preparation of the gene therapy vector can include the gene therapy vector in an acceptable diluent, or can comprise a slow release matrix in which the gene delivery vehicle is imbedded. Alternatively, where the complete gene delivery vector can be produced intact from recombinant cells, e.g., retroviral vectors, the pharmaceutical preparation can include one or more cells which produce the gene delivery system.

[0181] The pharmaceutical compositions can be included in a container, pack, or dispenser together with instructions for administration.

[0182] V. Uses and Methods of the Invention

[0183] The nucleic acid molecules, proteins, protein homologues, and antibodies described herein can be used in one or more of the following methods: a) screening assays; b) predictive medicine (e.g., diagnostic assays, prognostic assays, monitoring clinical trials, and pharmacogenetics); and c) methods of treatment (e.g., therapeutic and prophylactic). As described herein, an ERG-LP protein of the invention has one or more of the following activities: (1) it can modulate the release of neurotransmitters, (2) it can modulate membrane excitability, (3) it can influence the resting potential of membranes, (4) it can modulate wave forms and frequencies of action potentials, (5) it can modulate thresholds of excitation, and (6) it can modulate processes which underlie learning and memory, such as integration of sub-threshold synaptic responses and the conductance of back-propagating action potentials, and, thus, can be used to, for example, (1) modulate the release of neurotransmitters, (2) modulate membrane excitability, (3) influence the resting potential of membranes, (4) modulate wave forms and frequencies of action potentials, (5) modulate thresholds of excitation, and (6) modulate processes which underlie learning and memory, such as integration of sub-threshold synaptic responses and the conductance of back-propagating action potentials.

[0184] The isolated nucleic acid molecules of the invention can be used, for example, to express ERG-LP protein (e.g., via a recombinant expression vector in a host cell in gene therapy applications), to detect ERG-LP mRNA (e.g., in a biological sample) or a genetic alteration in an ERG-LP gene, and to modulate ERG-LP activity, as described further below. The ERG-LP proteins can be used to treat disorders characterized by insufficient or excessive production of an ERG-LP substrate or production of ERG-LP inhibitors. In addition, the ERG-LP proteins can be used to screen for naturally occurring ERG-LP substrates, to screen for drugs or compounds which modulate ERG-LP activity, as well as to treat disorders characterized by insufficient or excessive production of ERG-LP protein or production of ERG-LP protein forms which have decreased or aberrant activity compared to ERG-LP wild type protein (e.g., CNS disorders such as neurodegenerative disorders, e.g., Alzheimer's disease, dementias related to Alzheimer's disease (such as Pick's disease), Parkinson's and other Lewy diffuse body diseases, multiple sclerosis, amyotrophic lateral sclerosis, progressive supranuclear palsy, epilepsy and Jakob-Creutzfieldt disease; psychiatric disorders, e.g., depression, schizophrenic disorders, korsakoffs psychosis, mania, anxiety disorders, or phobic disorders; learning or memory disorders, e.g., amnesia or age-related memory loss; neurological disorders, e.g., migraine; obesity; autonomic nervous system disorders; gastrointestinal disorders including, but not limited to, esophageal disorders such as atresia and fistulas, stenosis, achalasia, esophageal rings and webs, hiatal hernia, lacerations, esophagitis, diverticula, systemic sclerosis (scleroderma), varices, esophageal tumors such as squamous cell carcinomas and adenocarcinomas, stomach disorders such as diaphragmatic hernias, pyloric stenosis, gastritis, acute gastric erosion and ulceration, peptic ulcers, stomach tumors such as carcinomas and sarcomas, small intestine disorders such as congenital atresia and stenosis, diverticula, Meckel's diverticulum, pancreatic rests, ischemic bowel disease, infective enterocolitis, Crohn's disease, tumors of the small intestine such as carcinomas and sarcomas, disorders of the colon such as malabsorption, obstructive lesions such as hernias, megacolon, diverticular disease, melanosis coli, ischemic injury, hemorrhoids, angiodysplasia of right colon, inflammations of the colon such as ulcerative colitis, and tumors of the colon such as polyps and sarcomas; pain disorders, e.g, pain response elicited during various forms of tissue injury, e.g., inflammation, infection, and ischemia, usually referred to as hyperalgesia (described in, for example, Fields, H. L. (1987) Pain, New York:McGraw-Hill), and pain associated with muscoloskeletal disorders, e.g., joint pain; tooth pain; headaches; pain associated with malignancies, or pain associated with surgery; and cardiovascular disorders such as arteriosclerosis, ischemia reperfusion injury, restenosis, arterial inflammation, vascular wall remodeling, ventricular remodeling, rapid ventricular pacing, coronary microembolism, tachycardia, bradycardia, pressure overload, aortic bending, coronary artery ligation, vascular heart disease, atrial fibrilation, long-QT syndrome, congestive heart failure, sinus node disfunction, angina, heart failure, hypertension, atrial fibrillation, atrial flutter, dilated cardiomyopathy, idiopathic cardiomyopathy, myocardial infarction, coronary artery disease, coronary artery spasm, or arrhythmia. Moreover, the anti-ERG-LP antibodies of the invention can be used to detect and isolate ERG-LP proteins, regulate the bioavailability of ERG-LP proteins, and modulate ERG-LP activity.

[0185] A. Screening Assays:

[0186] The invention provides a method (also referred to herein as a “screening assay”) for identifying modulators, i.e., candidate or test compounds or agents (e.g., peptides, peptidomimetics, small molecules or other drugs) which bind to ERG-LP proteins, have a stimulatory or inhibitory effect on, for example, ERG-LP expression or ERG-LP activity, or have a stimulatory or inhibitory effect on, for example, the expression or activity of ERG-LP substrate.

[0187] In one embodiment, the invention provides assays for screening candidate or test compounds which are substrates of an ERG-LP protein or polypeptide or biologically active portion thereof. In another embodiment, the invention provides assays for screening candidate or test compounds which bind to or modulate the activity of an ERG-LP protein or polypeptide or biologically active portion thereof. The test compounds of the present invention can be obtained using any of the numerous approaches in combinatorial library methods known in the art, including: biological libraries; spatially addressable parallel solid phase or solution phase libraries; synthetic library methods requiring deconvolution; the ‘one-bead one-compound’ library method; and synthetic library methods using affinity chromatography selection. The biological library approach is limited to peptide libraries, while the other four approaches are applicable to peptide, non-peptide oligomer or small molecule libraries of compounds (Lam, K. S. (1997) Anticancer Drug Des. 12:145).

[0188] Examples of methods for the synthesis of molecular libraries can be found in the art, for example in: DeWitt et al. (1993) Proc. Natl. Acad. Sci. U.S.A. 90:6909; Erb et al. (1994) Proc. Natl. Acad. Sci. USA 91:11422; Zuckermann et al. (1994). J. Med. Chem. 37:2678; Cho et al. (1993) Science 261:1303; Carrell et al. (1994) Angew. Chem. Int. Ed. Engl. 33:2059; Carell et al. (1994) Angew. Chem. Int. Ed. Engl. 33:2061; and in Gallop et al. (1994) J. Med. Chem. 37:1233.

[0189] Libraries of compounds may be presented in solution (e.g., Houghten (1992) Biotechniques 13:412-421), or on beads (Lam (1991) Nature 354:82-84), chips (Fodor (1993) Nature 364:555-556), bacteria (Ladner U.S. Pat. No. 5,223,409), spores (Ladner U.S. Pat. No. '409), plasmids (Cull et al. (1992) Proc Natl Acad Sci USA 89:1865-1869) or on phage (Scott and Smith (1990) Science 249:386-390); (Devlin (1990) Science 249:404-406); (Cwirla et al. (1990) Proc. Natl. Acad. Sci. 87:6378-6382); (Felici (1991) J. Mol. Biol. 222:301-310); (Ladner supra.).

[0190] In one embodiment, an assay is a cell-based assay in which a cell which expresses an ERG-LP protein or biologically active portion thereof is contacted with a test compound and the ability of the test compound to modulate ERG-LP activity is determined. Determining the ability of the test compound to modulate ERG-LP activity can be accomplished by monitoring, for example, the release of a neurotransmitter form a cell which expresses ERG-LP. The cell, for example, can be of mammalian origin. Determining the ability of the test compound to modulate the ability of ERG-LP to bind to a substrate can be accomplished, for example, by coupling the ERG-LP substrate with a radioisotope or enzymatic label such that binding of the ERG-LP substrate to ERG-LP can be determined by detecting the labeled ERG-LP substrate in a complex. For example, compounds (e.g., ERG-LP substrates) can be labeled with 125I, 35S, 14C, or 3H, either directly or indirectly, and the radioisotope detected by direct counting of radioemmission or by scintillation counting. Alternatively, compounds can be enzymatically labeled with, for example, horseradish peroxidase, alkaline phosphatase, or luciferase, and the enzymatic label detected by determination of conversion of an appropriate substrate to product.

[0191] It is also within the scope of this invention to determine the ability of a compound (e.g., ERG-LP substrate) to interact with ERG-LP without the labeling of any of the interactants. For example, a microphysiometer can be used to detect the interaction of a compound with ERG-LP without the labeling of either the compound or the ERG-LP. McConnell, H. M. et al. (1992) Science 257:1906-1912. As used herein, a “microphysiometer” (e.g., Cytosensor) is an analytical instrument that measures the rate at which a cell acidifies its environment using a light-addressable potentiometric sensor (LAPS). Changes in this acidification rate can be used as an indicator of the interaction between a compound and ERG-LP.

[0192] In another embodiment, an assay is a cell-based assay comprising contacting a cell expressing an ERG-LP target molecule (e.g., an ERG-LP substrate) with a test compound and determining the ability of the test compound to modulate (e.g. stimulate or inhibit) the activity of the ERG-LP target molecule. Determining the ability of the test compound to modulate the activity of an ERG-LP target molecule can be accomplished, for example, by determining the ability of the ERG-LP protein to bind to or interact with the ERG-LP target molecule.

[0193] Determining the ability of the ERG-LP protein or a biologically active fragment thereof, to bind to or interact with an ERG-LP target molecule can be accomplished by one of the methods described above for determining direct binding. In a preferred embodiment, determining the ability of the ERG-LP protein to bind to or interact with an ERG-LP target molecule can be accomplished by determining the activity of the target molecule. For example, the activity of the target molecule can be determined by detecting induction of a cellular second messenger of the target (i.e., intracellular Ca2+, diacylglycerol, IP3, and the like), detecting catalytic/enzymatic activity of the target an appropriate substrate, detecting the induction of a reporter gene (comprising a target-responsive regulatory element operatively linked to a nucleic acid encoding a detectable marker, e.g., luciferase), or detecting a target-regulated cellular response.

[0194] In yet another embodiment, an assay of the present invention is a cell-free assay in which an ERG-LP protein or biologically active portion thereof is contacted with a test compound and the ability of the test compound to bind to the ERG-LP protein or biologically active portion thereof is determined. Preferred biologically active portions of the ERG-LP proteins to be used in assays of the present invention include fragments which participate in interactions with non-ERG-LP molecules, e.g., cyclic nucleotides, or fragments with high surface probability scores (see, for example, FIGS. 6 and 7). Binding of the test compound to the ERG-LP protein can be determined either directly or indirectly as described above. In a preferred embodiment, the assay includes contacting the ERG-LP protein or biologically active portion thereof with a known compound which binds ERG-LP to form an assay mixture, contacting the assay mixture with a test compound, and determining the ability of the test compound to interact with an ERG-LP protein, wherein determining the ability of the test compound to interact with an ERG-LP protein comprises determining the ability of the test compound to preferentially bind to ERG-LP or biologically active portion thereof as compared to the known compound.

[0195] In another embodiment, the assay is a cell-free assay in which an ERG-LP protein or biologically active portion thereof is contacted with a test compound and the ability of the test compound to modulate (e.g., stimulate or inhibit) the activity of the ERG-LP protein or biologically active portion thereof is determined. Determining the ability of the test compound to modulate the activity of an ERG-LP protein can be accomplished, for example, by determining the ability of the ERG-LP protein to bind to an ERG-LP target molecule by one of the methods described above for determining direct binding. Determining the ability of the ERG-LP protein to bind to an ERG-LP target molecule can also be accomplished using a technology such as real-time Biomolecular Interaction Analysis (BIA). Sjolander, S. and Urbaniczky, C. (1991) Anal. Chem. 63:2338-2345 and Szabo et al. (1995) Curr. Opin. Struct. Biol. 5:699-705. As used herein, “BIA” is a technology for studying biospecific interactions in real time, without labeling any of the interactants (e.g., BIAcore). Changes in the optical phenomenon of surface plasmon resonance (SPR) can be used as an indication of real-time reactions between biological molecules.

[0196] In an alternative embodiment, determining the ability of the test compound to modulate the activity of an ERG-LP protein can be accomplished by determining the ability of the ERG-LP protein to further modulate the activity of a downstream effector of an ERG-LP target molecule. For example, the activity of the effector molecule on an appropriate target can be determined or the binding of the effector to an appropriate target can be determined as previously described.

[0197] In yet another embodiment, the cell-free assay involves contacting an ERG-LP protein or biologically active portion thereof with a known compound which binds the ERG-LP protein to form an assay mixture, contacting the assay mixture with a test compound, and determining the ability of the test compound to interact with the ERG-LP protein, wherein determining the ability of the test compound to interact with the ERG-LP protein comprises determining the ability of the ERG-LP protein to preferentially bind to or modulate the activity of an ERG-LP target molecule.

[0198] The cell-free assays of the present invention are amenable to use of both soluble and/or membrane-bound forms of isolated proteins (e.g., ERG-LP proteins or biologically active portions thereof). In the case of cell-free assays in which a membrane-bound form an isolated protein is used (e.g., a potassium channel) it may be desirable to utilize a solubilizing agent such that the membrane-bound form of the isolated protein is maintained in solution. Examples of such solubilizing agents include non-ionic detergents such as n-octylglucoside, n-dodecylglucoside, n-dodecylmaltoside, octanoyl-N-methylglucamide, decanoyl-N-methylglucamide, Triton® X-100, Triton® X-114, Thesit®, Isotridecypoly(ethylene glycol ether)n, 3-[(3-cholamidopropyl)dimethylamminio]-1-propane sulfonate (CHAPS), 3-[(3-cholamidopropyl)dimethylamminio]-2-hydroxy-1-propane sulfonate (CHAPSO), or N-dodecyl=N,N-dimethyl-3-ammonio-1-propane sulfonate.

[0199] In more than one embodiment of the above assay methods of the present invention, it may be desirable to immobilize either ERG-LP or its target molecule to facilitate separation of complexed from uncomplexed forms of one or both of the proteins, as well as to accommodate automation of the assay. Binding of a test compound to an ERG-LP protein, or interaction of an ERG-LP protein with a target molecule in the presence and absence of a candidate compound, can be accomplished in any vessel suitable for containing the reactants. Examples of such vessels include microtitre plates, test tubes, and micro-centrifuge tubes. In one embodiment, a fusion protein can be provided which adds a domain that allows one or both of the proteins to be bound to a matrix. For example, glutathione-S-transferase/ERG-LP fusion proteins or glutathione-S-transferase/target fusion proteins can be adsorbed onto glutathione sepharose beads (Sigma Chemical, St. Louis, Mo.) or glutathione derivatized microtitre plates, which are then combined with the test compound or the test compound and either the non-adsorbed target protein or ERG-LP protein, and the mixture incubated under conditions conducive to complex formation (e.g., at physiological conditions for salt and pH). Following incubation, the beads or microtitre plate wells are washed to remove any unbound components, the matrix immobilized in the case of beads, complex determined either directly or indirectly, for example, as described above. Alternatively, the complexes can be dissociated from the matrix, and the level of ERG-LP binding or activity determined using standard techniques.

[0200] Other techniques for immobilizing proteins on matrices can also be used in the screening assays of the invention. For example, either an ERG-LP protein or an ERG-LP target molecule can be immobilized utilizing conjugation of biotin and streptavidin. Biotinylated ERG-LP protein or target molecules can be prepared from biotin-NHS (N-hydroxy-succinimide) using techniques known in the art (e.g., biotinylation kit, Pierce Chemicals, Rockford, Ill.), and immobilized in the wells of streptavidin-coated 96 well plates (Pierce Chemical). Alternatively, antibodies reactive with ERG-LP protein or target molecules but which do not interfere with binding of the ERG-LP protein to its target molecule can be derivatized to the wells of the plate, and unbound target or ERG-LP protein trapped in the wells by antibody conjugation. Methods for detecting such complexes, in addition to those described above for the GST-immobilized complexes, include immunodetection of complexes using antibodies reactive with the ERG-LP protein or target molecule, as well as enzyme-linked assays which rely on detecting an enzymatic activity associated with the ERG-LP protein or target molecule.

[0201] In another embodiment, modulators of ERG-LP expression are identified in a method wherein a cell is contacted with a candidate compound and the expression of ERG-LP mRNA or protein in the cell is determined. The level of expression of ERG-LP mRNA or protein in the presence of the candidate compound is compared to the level of expression of ERG-LP mRNA or protein in the absence of the candidate compound. The candidate compound can then be identified as a modulator of ERG-LP expression based on this comparison. For example, when expression of ERG-LP mRNA or protein is greater (statistically significantly greater) in the presence of the candidate compound than in its absence, the candidate compound is identified as a stimulator of ERG-LP mRNA or protein expression. Alternatively, when expression of ERG-LP mRNA or protein is less (statistically significantly less) in the presence of the candidate compound than in its absence, the candidate compound is identified as an inhibitor of ERG-LP mRNA or protein expression. The level of ERG-LP mRNA or protein expression in the cells can be determined by methods described herein for detecting ERG-LP mRNA or protein.

[0202] In yet another aspect of the invention, the ERG-LP proteins can be used as “bait proteins” in a two-hybrid assay or three-hybrid assay (see, e.g., U.S. Pat. No. 5,283,317; Zervos et al. (1993) Cell 72:223-232; Madura et al. (1993) J. Biol. Chem. 268:12046-12054; Bartel et al. (1993) Biotechniques 14:920-924; Iwabuchi et al. (1993) Oncogene 8:1693-1696; and Brent WO94/10300), to identify other proteins, which bind to or interact with ERG-LP (“ERG-LP-binding proteins” or “ERG-LP-bp”) and are involved in ERG-LP activity. Such ERG-LP-binding proteins are also likely to be involved in the propagation of signals by the ERG-LP proteins or ERG-LP targets as, for example, downstream elements of an ERG-LP-mediated signaling pathway. Alternatively, such ERG-LP-binding proteins are likely to be ERG-LP inhibitors.

[0203] The two-hybrid system is based on the modular nature of most transcription factors, which consist of separable DNA-binding and activation domains. Briefly, the assay utilizes two different DNA constructs. In one construct, the gene that codes for an ERG-LP protein is fused to a gene encoding the DNA binding domain of a known transcription factor (e.g., GAL-4). In the other construct, a DNA sequence, from a library of DNA sequences, that encodes an unidentified protein (“prey” or “sample”) is fused to a gene that codes for the activation domain of the known transcription factor. If the “bait” and the “prey” proteins are able to interact, in vivo, forming an ERG-LP-dependent complex, the DNA-binding and activation domains of the transcription factor are brought into close proximity. This proximity allows transcription of a reporter gene (e.g., LacZ) which is operably linked to a transcriptional regulatory site responsive to the transcription factor. Expression of the reporter gene can be detected and cell colonies containing the functional transcription factor can be isolated and used to obtain the cloned gene which encodes the protein which interacts with the ERG-LP protein.

[0204] This invention further pertains to novel agents identified by the above-described screening assays. Accordingly, it is within the scope of this invention to further use an agent identified as described herein in an appropriate animal model. For example, an agent identified as described herein (e.g., an ERG-LP modulating agent, an antisense ERG-LP nucleic acid molecule, an ERG-LP-specific antibody, or an ERG-LP-binding partner) can be used in an animal model to determine the efficacy, toxicity, or side effects of treatment with such an agent. Alternatively, an agent identified as described herein can be used in an animal model to determine the mechanism of action of such an agent. Furthermore, this invention pertains to uses of novel agents identified by the above-described screening assays for treatments as described herein.

[0205] B. Detection Assays

[0206] Portions or fragments of the cDNA sequences identified herein (and the corresponding complete gene sequences) can be used in numerous ways as polynucleotide reagents. For example, these sequences can be used to: (i) map their respective genes on a chromosome; and, thus, locate gene regions associated with genetic disease; (ii) identify an individual from a minute biological sample (tissue typing); and (iii) aid in forensic identification of a biological sample. These applications are described in the subsections below.

[0207] 1. Chromosome Mapping

[0208] Once the sequence (or a portion of the sequence) of a gene has been isolated, this sequence can be used to map the location of the gene on a chromosome. This process is called chromosome mapping. Accordingly, portions or fragments of the ERG-LP nucleotide sequences, described herein, can be used to map the location of the ERG-LP genes on a chromosome. The mapping of the ERG-LP sequences to chromosomes is an important first step in correlating these sequences with genes associated with disease.

[0209] Briefly, ERG-LP genes can be mapped to chromosomes by preparing PCR primers (preferably 15-25 bp in length) from the ERG-LP nucleotide sequences. Computer analysis of the ERG-LP sequences can be used to predict primers that do not span more than one exon in the genomic DNA, thus complicating the amplification process. These primers can then be used for PCR screening of somatic cell hybrids containing individual human chromosomes. Only those hybrids containing the human gene corresponding to the ERG-LP sequences will yield an amplified fragment.

[0210] Somatic cell hybrids are prepared by fusing somatic cells from different mammals (e.g., human and mouse cells). As hybrids of human and mouse cells grow and divide, they gradually lose human chromosomes in random order, but retain the mouse chromosomes. By using media in which mouse cells cannot grow, because they lack a particular enzyme, but human cells can, the one human chromosome that contains the gene encoding the needed enzyme, will be retained. By using various media, panels of hybrid cell lines can be established. Each cell line in a panel contains either a single human chromosome or a small number of human chromosomes, and a full set of mouse chromosomes, allowing easy mapping of individual genes to specific human chromosomes. (D'Eustachio P. et al. (1983) Science 220:919-924). Somatic cell hybrids containing only fragments of human chromosomes can also be produced by using human chromosomes with translocations and deletions.

[0211] PCR mapping of somatic cell hybrids is a rapid procedure for assigning a particular sequence to a particular chromosome. Three or more sequences can be assigned per day using a single thermal cycler. Using the ERG-LP nucleotide sequences to design oligonucleotide primers, sublocalization can be achieved with panels of fragments from specific chromosomes. Other mapping strategies which can similarly be used to map an ERG-LP sequence to its chromosome include in situ hybridization (described in Fan, Y. et al. (1990) Proc. Natl. Acad. Sci. USA, 87:6223-27), pre-screening with labeled flow-sorted chromosomes, and pre-selection by hybridization to chromosome specific cDNA libraries.

[0212] Fluorescence in situ hybridization (FISH) of a DNA sequence to a metaphase chromosomal spread can further be used to provide a precise chromosomal location in one step. Chromosome spreads can be made using cells whose division has been blocked in metaphase by a chemical such as colcemid that disrupts the mitotic spindle. The chromosomes can be treated briefly with trypsin, and then stained with Giemsa. A pattern of light and dark bands develops on each chromosome, so that the chromosomes can be identified individually. The FISH technique can be used with a DNA sequence as short as 500 or 600 bases. However, clones larger than 1,000 bases have a higher likelihood of binding to a unique chromosomal location with sufficient signal intensity for simple detection. Preferably 1,000 bases, and more preferably 2,000 bases will suffice to get good results at a reasonable amount of time. For a review of this technique, see Verma et al., Human Chromosomes: A Manual of Basic Techniques (Pergamon Press, New York 1988).

[0213] Reagents for chromosome mapping can be used individually to mark a single chromosome or a single site on that chromosome, or panels of reagents can be used for marking multiple sites and/or multiple chromosomes. Reagents corresponding to noncoding regions of the genes actually are preferred for mapping purposes. Coding sequences are more likely to be conserved within gene families, thus increasing the chance of cross hybridizations during chromosomal mapping.

[0214] Once a sequence has been mapped to a precise chromosomal location, the physical position of the sequence on the chromosome can be correlated with genetic map data. (Such data are found, for example, in V. McKusick, Mendelian Inheritance in Man, available on-line through Johns Hopkins University Welch Medical Library). The relationship between a gene and a disease, mapped to the same chromosomal region, can then be identified through linkage analysis (co-inheritance of physically adjacent genes), described in, for example, Egeland, J. et al. (1987) Nature, 325:783-787.

[0215] Moreover, differences in the DNA sequences between individuals affected and unaffected with a disease associated with the ERG-LP gene, can be determined. If a mutation is observed in some or all of the affected individuals but not in any unaffected individuals, then the mutation is likely to be the causative agent of the particular disease. Comparison of affected and unaffected individuals generally involves first looking for structural alterations in the chromosomes, such as deletions or translocations that are visible from chromosome spreads or detectable using PCR based on that DNA sequence. Ultimately, complete sequencing of genes from several individuals can be performed to confirm the presence of a mutation and to distinguish mutations from polymorphisms.

[0216] 2. Tissue Typing

[0217] The ERG-LP sequences of the present invention can also be used to identify individuals from minute biological samples. The United States military, for example, is considering the use of restriction fragment length polymorphism (RFLP) for identification of its personnel. In this technique, an individual's genomic DNA is digested with one or more restriction enzymes, and probed on a Southern blot to yield unique bands for identification. This method does not suffer from the current limitations of “Dog Tags” which can be lost, switched, or stolen, making positive identification difficult. The sequences of the present invention are useful as additional DNA markers for RFLP (described in U.S. Pat. No. 5,272,057).

[0218] Furthermore, the sequences of the present invention can be used to provide an alternative technique which determines the actual base-by-base DNA sequence of selected portions of an individual's genome. Thus, the ERG-LP nucleotide sequences described herein can be used to prepare two PCR primers from the 5′ and 3′ ends of the sequences. These primers can then be used to amplify an individual's DNA and subsequently sequence it.

[0219] Panels of corresponding DNA sequences from individuals, prepared in this manner, can provide unique individual identifications, as each individual will have a unique set of such DNA sequences due to allelic differences. The sequences of the present invention can be used to obtain such identification sequences from individuals and from tissue. The ERG-LP nucleotide sequences of the invention uniquely represent portions of the human genome. Allelic variation occurs to some degree in the coding regions of these sequences, and to a greater degree in the noncoding regions. It is estimated that allelic variation between individual humans occurs with a frequency of about once per each 500 bases. Each of the sequences described herein can, to some degree, be used as a standard against which DNA from an individual can be compared for identification purposes. Because greater numbers of polymorphisms occur in the noncoding regions, fewer sequences are necessary to differentiate individuals. The noncoding sequences of SEQ ID NO:1, SEQ ID NO:4, SEQ ID NO:7, SEQ ID NO:14 or SEQ ID NO:15 can comfortably provide positive individual identification with a panel of perhaps 10 to 1,000 primers which each yield a noncoding amplified sequence of 100 bases. If predicted coding sequences, such as those in SEQ ID NO:3, SEQ ID NO:6, SEQ ID NO:9, or SEQ ID NO:17 are used, a more appropriate number of primers for positive individual identification would be 500-2,000.

[0220] If a panel of reagents from ERG-LP nucleotide sequences described herein is used to generate a unique identification database for an individual, those same reagents can later be used to identify tissue from that individual. Using the unique identification database, positive identification of the individual, living or dead, can be made from extremely small tissue samples.

[0221] 3. Use of Partial ERG-LP Sequences in Forensic Biology

[0222] DNA-based identification techniques can also be used in forensic biology. Forensic biology is a scientific field employing genetic typing of biological evidence found at a crime scene as a means for positively identifying, for example, a perpetrator of a crime. To make such an identification, PCR technology can be used to amplify DNA sequences taken from very small biological samples such as tissues, e.g., hair or skin, or body fluids, e.g., blood, saliva, or semen found at a crime scene. The amplified sequence can then be compared to a standard, thereby allowing identification of the origin of the biological sample.

[0223] The sequences of the present invention can be used to provide polynucleotide reagents, e.g., PCR primers, targeted to specific loci in the human genome, which can enhance the reliability of DNA-based forensic identifications by, for example, providing another “identification marker” (i.e. another DNA sequence that is unique to a particular individual). As mentioned above, actual base sequence information can be used for identification as an accurate alternative to patterns formed by restriction enzyme generated fragments. Sequences targeted to noncoding regions of SEQ ID NO:1, SEQ ID NO:4, SEQ ID NO:7, SEQ ID NO:14 or SEQ ID NO:15 are particularly appropriate for this use as greater numbers of polymorphisms occur in the noncoding regions, making it easier to differentiate individuals using this technique. Examples of polynucleotide reagents include the ERG-LP nucleotide sequences or portions thereof, e.g., fragments derived from the noncoding regions of SEQ ID NO:1 or SEQ ID NO:4, having a length of at least 20 bases, preferably at least 30 bases.

[0224] The ERG-LP nucleotide sequences described herein can further be used to provide polynucleotide reagents, e.g., labeled or labelable probes which can be used in, for example, an in situ hybridization technique, to identify a specific tissue, e.g., brain tissue. This can be very useful in cases where a forensic pathologist is presented with a tissue of unknown origin. Panels of such ERG-LP probes can be used to identify tissue by species and/or by organ type.

[0225] In a similar fashion, these reagents, e.g., ERG-LP primers or probes can be used to screen tissue culture for contamination (i.e. screen for the presence of a mixture of different types of cells in a culture).

[0226] C. Predictive Medicine:

[0227] The present invention also pertains to the field of predictive medicine in which diagnostic assays, prognostic assays, and monitoring clinical trials are used for prognostic (predictive) purposes to thereby treat an individual prophylactically. Accordingly, one aspect of the present invention relates to diagnostic assays for determining ERG-LP protein and/or nucleic acid expression as well as ERG-LP activity, in the context of a biological sample (e.g., blood, serum, cells, tissue) to thereby determine whether an individual is afflicted with a disease or disorder, or is at risk of developing a disorder, associated with aberrant ERG-LP expression or activity. The invention also provides for prognostic (or predictive) assays for determining whether an individual is at risk of developing a disorder associated with ERG-LP protein, nucleic acid expression or activity. For example, mutations in an ERG-LP gene can be assayed in a biological sample. Such assays can be used for prognostic or predictive purpose to thereby phophylactically treat an individual prior to the onset of a disorder characterized by or associated with ERG-LP protein, nucleic acid expression or activity.

[0228] Another aspect of the invention pertains to monitoring the influence of agents (e.g., drugs, compounds) on the expression or activity of ERG-LP in clinical trials.

[0229] These and other agents are described in further detail in the following sections.

[0230] 1. Diagnostic Assays

[0231] An exemplary method for detecting the presence or absence of ERG-LP protein or nucleic acid in a biological sample involves obtaining a biological sample from a test subject and contacting the biological sample with a compound or an agent capable of detecting ERG-LP protein or nucleic acid (e.g., mRNA, genomic DNA) that encodes ERG-LP protein such that the presence of ERG-LP protein or nucleic acid is detected in the biological sample. A preferred agent for detecting ERG-LP mRNA or genomic DNA is a labeled nucleic acid probe capable of hybridizing to ERG-LP mRNA or genomic DNA. The nucleic acid probe can be, for example, a full-length ERG-LP nucleic acid, such as the nucleic acid of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO: 15 or SEQ ID NO:17, or a portion thereof, such as an oligonucleotide of at least 15, 30, 50, 100, 250 or 500 nucleotides in length and sufficient to specifically hybridize under stringent conditions to ERG-LP mRNA or genomic DNA. Other suitable probes for use in the diagnostic assays of the invention are described herein.

[0232] A preferred agent for detecting ERG-LP protein is an antibody capable of binding to ERG-LP protein, preferably an antibody with a detectable label. Antibodies can be polyclonal, or more preferably, monoclonal. An intact antibody, or a fragment thereof (e.g., Fab or F(ab′)2) can be used. The term “labeled”, with regard to the probe or antibody, is intended to encompass direct labeling of the probe or antibody by coupling (i.e., physically linking) a detectable substance to the probe or antibody, as well as indirect labeling of the probe or antibody by reactivity with another reagent that is directly labeled. Examples of indirect labeling include detection of a primary antibody using a fluorescently labeled secondary antibody and end-labeling of a DNA probe with biotin such that it can be detected with fluorescently labeled streptavidin. The term “biological sample” is intended to include tissues, cells and biological fluids isolated from a subject, as well as tissues, cells and fluids present within a subject. That is, the detection method of the invention can be used to detect ERG-LP mRNA, protein, or genomic DNA in a biological sample in vitro as well as in vivo. For example, in vitro techniques for detection of ERG-LP mRNA include Northern hybridizations and in situ hybridizations. In vitro techniques for detection of ERG-LP protein include enzyme linked immunosorbent assays (ELISAs), Western blots, immunoprecipitations and immunofluorescence. In vitro techniques for detection of ERG-LP genomic DNA include Southern hybridizations. Furthermore, in vivo techniques for detection of ERG-LP protein include introducing into a subject a labeled anti-ERG-LP antibody. For example, the antibody can be labeled with a radioactive marker whose presence and location in a subject can be detected by standard imaging techniques.

[0233] In one embodiment, the biological sample contains protein molecules from the test subject. Alternatively, the biological sample can contain mRNA molecules from the test subject or genomic DNA molecules from the test subject. A preferred biological sample is a serum sample isolated by conventional means from a subject.

[0234] In another embodiment, the methods further involve obtaining a control biological sample from a control subject, contacting the control sample with a compound or agent capable of detecting ERG-LP protein, mRNA, or genomic DNA, such that the presence of ERG-LP protein, mRNA or genomic DNA is detected in the biological sample, and comparing the presence of ERG-LP protein, mRNA or genomic DNA in the control sample with the presence of ERG-LP protein, mRNA or genomic DNA in the test sample.

[0235] The invention also encompasses kits for detecting the presence of ERG-LP in a biological sample. For example, the kit can comprise a labeled compound or agent capable of detecting ERG-LP protein or mRNA in a biological sample; means for determining the amount of ERG-LP in the sample; and means for comparing the amount of ERG-LP in the sample with a standard. The compound or agent can be packaged in a suitable container. The kit can further comprise instructions for using the kit to detect ERG-LP protein or nucleic acid.

[0236] 2. Prognostic Assays

[0237] The diagnostic methods described herein can furthermore be utilized to identify subjects having or at risk of developing a disease or disorder associated with aberrant ERG-LP expression or activity. For example, the assays described herein, such as the preceding diagnostic assays or the following assays, can be utilized to identify a subject having or at risk of developing a disorder associated with a misregulation in ERG-LP protein activity or nucleic acid expression, such as a CNS disorder. Alternatively, the prognostic assays can be utilized to identify a subject having or at risk for developing a disorder associated with a misregulation in ERG-LP protein activity or nucleic acid expression, such as a CNS disorder. Thus, the present invention provides a method for identifying a disease or disorder associated with aberrant ERG-LP expression or activity in which a test sample is obtained from a subject and ERG-LP protein or nucleic acid (e.g., mRNA or genomic DNA) is detected, wherein the presence of ERG-LP protein or nucleic acid is diagnostic for a subject having or at risk of developing a disease or disorder associated with aberrant ERG-LP expression or activity. As used herein, a “test sample” refers to a biological sample obtained from a subject of interest. For example, a test sample can be a biological fluid (e.g., serum), cell sample, or tissue.

[0238] Furthermore, the prognostic assays described herein can be used to determine whether a subject can be administered an agent (e.g., an agonist, antagonist, peptidomimetic, protein, peptide, nucleic acid, small molecule, or other drug candidate) to treat a disease or disorder associated with aberrant ERG-LP expression or activity. For example, such methods can be used to determine whether a subject can be effectively treated with an agent for a CNS disorder. Thus, the present invention provides methods for determining whether a subject can be effectively treated with an agent for a disorder associated with aberrant ERG-LP expression or activity in which a test sample is obtained and ERG-LP protein or nucleic acid expression or activity is detected (e.g., wherein the abundance of ERG-LP protein or nucleic acid expression or activity is diagnostic for a subject that can be administered the agent to treat a disorder associated with aberrant ERG-LP expression or activity).

[0239] The methods of the invention can also be used to detect genetic alterations in an ERG-LP gene, thereby determining if a subject with the altered gene is at risk for a disorder characterized by misregulation in ERG-LP protein activity or nucleic acid expression, such as a CNS disorder. In preferred embodiments, the methods include detecting, in a sample of cells from the subject, the presence or absence of a genetic alteration characterized by at least one of an alteration affecting the integrity of a gene encoding an ERG-LP-protein, or the mis-expression of the ERG-LP gene. For example, such genetic alterations can be detected by ascertaining the existence of at least one of 1) a deletion of one or more nucleotides from an ERG-LP gene; 2) an addition of one or more nucleotides to an ERG-LP gene; 3) a substitution of one or more nucleotides of an ERG-LP gene, 4) a chromosomal rearrangement of an ERG-LP gene; 5) an alteration in the level of a messenger RNA transcript of an ERG-LP gene, 6) aberrant modification of an ERG-LP gene, such as of the methylation pattern of the genomic DNA, 7) the presence of a non-wild type splicing pattern of a messenger RNA transcript of an ERG-LP gene, 8) a non-wild type level of an ERG-LP-protein, 9) allelic loss of an ERG-LP gene, and 10) inappropriate post-translational modification of an ERG-LP-protein. As described herein, there are a large number of assays known in the art which can be used for detecting alterations in an ERG-LP gene. A preferred biological sample is a tissue or serum sample isolated by conventional means from a subject.

[0240] In certain embodiments, detection of the alteration involves the use of a probe/primer in a polymerase chain reaction (PCR) (see, e.g., U.S. Pat. Nos. 4,683,195 and 4,683,202), such as anchor PCR or RACE PCR, or, alternatively, in a ligation chain reaction (LCR) (see, e.g., Landegran et al. (1988) Science 241:1077-1080; and Nakazawa et al. (1994) Proc. Natl. Acad. Sci. USA 91:360-364), the latter of which can be particularly useful for detecting point mutations in the ERG-LP-gene (see Abravaya et al. (1995) Nucleic Acids Res. 23:675-682). This method can include the steps of collecting a sample of cells from a subject, isolating nucleic acid (e.g., genomic, mRNA or both) from the cells of the sample, contacting the nucleic acid sample with one or more primers which specifically hybridize to an ERG-LP gene under conditions such that hybridization and amplification of the ERG-LP-gene (if present) occurs, and detecting the presence or absence of an amplification product, or detecting the size of the amplification product and comparing the length to a control sample. It is anticipated that PCR and/or LCR may be desirable to use as a preliminary amplification step in conjunction with any of the techniques used for detecting mutations described herein.

[0241] Alternative amplification methods include: self sustained sequence replication (Guatelli, J. C. et al., (1990) Proc. Natl. Acad. Sci. USA 87:1874-1878), transcriptional amplification system (Kwoh, D. Y. et al., (1989) Proc. Natl. Acad. Sci. USA 86:1173-1177), Q-Beta Replicase (Lizardi, P. M. et al. (1988) Bio-Technology 6:1197), or any other nucleic acid amplification method, followed by the detection of the amplified molecules using techniques well known to those of skill in the art. These detection schemes are especially useful for the detection of nucleic acid molecules if such molecules are present in very low numbers.

[0242] In an alternative embodiment, mutations in an ERG-LP gene from a sample cell can be identified by alterations in restriction enzyme cleavage patterns. For example, sample and control DNA is isolated, amplified (optionally), digested with one or more restriction endonucleases, and fragment length sizes are determined by gel electrophoresis and compared. Differences in fragment length sizes between sample and control DNA indicates mutations in the sample DNA. Moreover, the use of sequence specific ribozymes (see, for example, U.S. Pat. No. 5,498,531) can be used to score for the presence of specific mutations by development or loss of a ribozyme cleavage site.

[0243] In other embodiments, genetic mutations in ERG-LP can be identified by hybridizing a sample and control nucleic acids, e.g., DNA or RNA, to high density arrays containing hundreds or thousands of oligonucleotides probes (Cronin, M. T. et al. (1996) Human Mutation 7: 244-255; Kozal, M. J. et al. (1996) Nature Medicine 2: 753-759). For example, genetic mutations in ERG-LP can be identified in two dimensional arrays containing light-generated DNA probes as described in Cronin, M. T. et al. supra. Briefly, a first hybridization array of probes can be used to scan through long stretches of DNA in a sample and control to identify base changes between the sequences by making linear arrays of sequential overlapping probes. This step allows the identification of point mutations. This step is followed by a second hybridization array that allows the characterization of specific mutations by using smaller, specialized probe arrays complementary to all variants or mutations detected. Each mutation array is composed of parallel probe sets, one complementary to the wild-type gene and the other complementary to the mutant gene.

[0244] In yet another embodiment, any of a variety of sequencing reactions known in the art can be used to directly sequence the ERG-LP gene and detect mutations by comparing the sequence of the sample ERG-LP with the corresponding wild-type (control) sequence. Examples of sequencing reactions include those based on techniques developed by Maxam and Gilbert ((1977) Proc. Natl. Acad. Sci. USA 74:560) or Sanger ((1977) Proc. Natl. Acad. Sci. USA 74:5463). It is also contemplated that any of a variety of automated sequencing procedures can be utilized when performing the diagnostic assays ((1995) Biotechniques 19:448), including sequencing by mass spectrometry (see, e.g., PCT International Publication No. WO 94/16101; Cohen et al. (1996) Adv. Chromatogr. 36:127-162; and Griffin et al. (1993) Appl. Biochem. Biotechnol. 38:147-159).

[0245] Other methods for detecting mutations in the ERG-LP gene include methods in which protection from cleavage agents is used to detect mismatched bases in RNA/RNA or RNA/DNA heteroduplexes (Myers et al. (1985) Science 230:1242). In general, the art technique of “mismatch cleavage” starts by providing heteroduplexes of formed by hybridizing (labeled) RNA or DNA containing the wild-type ERG-LP sequence with potentially mutant RNA or DNA obtained from a tissue sample. The double-stranded duplexes are treated with an agent which cleaves single-stranded regions of the duplex such as which will exist due to basepair mismatches between the control and sample strands. For instance, RNA/DNA duplexes can be treated with RNase and DNA/DNA hybrids treated with S1 nuclease to enzymatically digesting the mismatched regions. In other embodiments, either DNA/DNA or RNA/DNA duplexes can be treated with hydroxylamine or osmium tetroxide and with piperidine in order to digest mismatched regions. After digestion of the mismatched regions, the resulting material is then separated by size on denaturing polyacrylamide gels to determine the site of mutation. See, for example, Cotton et al. (1988) Proc. Natl Acad Sci USA 85:4397; Saleeba et al. (1992) Methods Enzymol. 217:286-295. In a preferred embodiment, the control DNA or RNA can be labeled for detection.

[0246] In still another embodiment, the mismatch cleavage reaction employs one or more proteins that recognize mismatched base pairs in double-stranded DNA (so called “DNA mismatch repair” enzymes) in defined systems for detecting and mapping point mutations in ERG-LP cDNAs obtained from samples of cells. For example, the mutY enzyme of E. coli cleaves A at G/A mismatches and the thymidine DNA glycosylase from HeLa cells cleaves T at G/T mismatches (Hsu et al. (1994) Carcinogenesis 15:1657-1662). According to an exemplary embodiment, a probe based on an ERG-LP sequence, e.g., a wild-type ERG-LP sequence, is hybridized to a cDNA or other DNA product from a test cell(s). The duplex is treated with a DNA mismatch repair enzyme, and the cleavage products, if any, can be detected from electrophoresis protocols or the like. See, for example, U.S. Pat. No. 5,459,039.

[0247] In other embodiments, alterations in electrophoretic mobility will be used to identify mutations in ERG-LP genes. For example, single strand conformation polymorphism (SSCP) may be used to detect differences in electrophoretic mobility between mutant and wild type nucleic acids (Orita et al. (1989) Proc Natl. Acad. Sci USA: 86:2766, see also Cotton (1993) Mutat. Res. 285:125-144; and Hayashi (1992) Genet. Anal. Tech. Appl. 9:73-79). Single-stranded DNA fragments of sample and control ERG-LP nucleic acids will be denatured and allowed to renature. The secondary structure of single-stranded nucleic acids varies according to sequence, the resulting alteration in electrophoretic mobility enables the detection of even a single base change. The DNA fragments may be labeled or detected with labeled probes. The sensitivity of the assay may be enhanced by using RNA (rather than DNA), in which the secondary structure is more sensitive to a change in sequence. In a preferred embodiment, the subject method utilizes heteroduplex analysis to separate double stranded heteroduplex molecules on the basis of changes in electrophoretic mobility (Keen et al. (1991) Trends Genet 7:5).

[0248] In yet another embodiment the movement of mutant or wild-type fragments in polyacrylamide gels containing a gradient of denaturant is assayed using denaturing gradient gel electrophoresis (DGGE) (Myers et al. (1985) Nature 313:495). When DGGE is used as the method of analysis, DNA will be modified to insure that it does not completely denature, for example by adding a GC clamp of approximately 40 bp of high-melting GC-rich DNA by PCR. In a further embodiment, a temperature gradient is used in place of a denaturing gradient to identify differences in the mobility of control and sample DNA (Rosenbaum and Reissner (1987) Biophys Chem 265:12753).

[0249] Examples of other techniques for detecting point mutations include, but are not limited to, selective oligonucleotide hybridization, selective amplification, or selective primer extension. For example, oligonucleotide primers may be prepared in which the known mutation is placed centrally and then hybridized to target DNA under conditions which permit hybridization only if a perfect match is found (Saiki et al. (1986) Nature 324:163); Saiki et al. (1989) Proc. Natl Acad. Sci USA 86:6230). Such allele specific oligonucleotides are hybridized to PCR amplified target DNA or a number of different mutations when the oligonucleotides are attached to the hybridizing membrane and hybridized with labeled target DNA.

[0250] Alternatively, allele specific amplification technology which depends on selective PCR amplification may be used in conjunction with the instant invention. Oligonucleotides used as primers for specific amplification may carry the mutation of interest in the center of the molecule (so that amplification depends on differential hybridization) (Gibbs et al. (1989) Nucleic Acids Res. 17:2437-2448) or at the extreme 3′ end of one primer where, under appropriate conditions, mismatch can prevent, or reduce polymerase extension (Prossner (1993) Tibtech 11:238). In addition it may be desirable to introduce a novel restriction site in the region of the mutation to create cleavage-based detection (Gasparini et al. (1992) Mol. Cell Probes 6:1). It is anticipated that in certain embodiments amplification may also be performed using Taq ligase for amplification (Barany (1991) Proc. Natl. Acad. Sci USA 88:189). In such cases, ligation will occur only if there is a perfect match at the 3′ end of the 5′ sequence making it possible to detect the presence of a known mutation at a specific site by looking for the presence or absence of amplification.

[0251] The methods described herein may be performed, for example, by utilizing pre-packaged diagnostic kits comprising at least one probe nucleic acid or antibody reagent described herein, which may be conveniently used, e.g., in clinical settings to diagnose patients exhibiting symptoms or family history of a disease or illness involving an ERG-LP gene.

[0252] Furthermore, any cell type or tissue in which ERG-LP is expressed may be utilized in the prognostic assays described herein.

[0253] 3. Monitoring of Effects During Clinical Trials

[0254] Monitoring the influence of agents (e.g., drugs) on the expression or activity of an ERG-LP protein (e.g., the modulation of membrane excitability or resting potential) can be applied not only in basic drug screening, but also in clinical trials. For example, the effectiveness of an agent determined by a screening assay as described herein to increase ERG-LP gene expression, protein levels, or upregulate ERG-LP activity, can be monitored in clinical trials of subjects exhibiting decreased ERG-LP gene expression, protein levels, or downregulated ERG-LP activity. Alternatively, the effectiveness of an agent determined by a screening assay to decrease ERG-LP gene expression, protein levels, or downregulate ERG-LP activity, can be monitored in clinical trials of subjects exhibiting increased ERG-LP gene expression, protein levels, or upregulated ERG-LP activity. In such clinical trials, the expression or activity of an ERG-LP gene, and preferably, other genes that have been implicated in, for example, a potassium channel associated disorder can be used as a “read out” or markers of the phenotype of a particular cell.

[0255] For example, and not by way of limitation, genes, including ERG-LP, that are modulated in cells by treatment with an agent (e.g., compound, drug or small molecule) which modulates ERG-LP activity (e.g., identified in a screening assay as described herein) can be identified. Thus, to study the effect of agents on potassium channel associated disorders, for example, in a clinical trial, cells can be isolated and RNA prepared and analyzed for the levels of expression of ERG-LP and other genes implicated in the potassium channel associated disorder, respectively. The levels of gene expression (e.g., a gene expression pattern) can be quantified by northern blot analysis or RT-PCR, as described herein, or alternatively by measuring the amount of protein produced, by one of the methods as described herein, or by measuring the levels of activity of ERG-LP or other genes. In this way, the gene expression pattern can serve as a marker, indicative of the physiological response of the cells to the agent. Accordingly, this response state may be determined before, and at various points during treatment of the individual with the agent.

[0256] In a preferred embodiment, the present invention provides a method for monitoring the effectiveness of treatment of a subject with an agent (e.g., an agonist, antagonist, peptidomimetic, protein, peptide, nucleic acid, small molecule, or other drug candidate identified by the screening assays described herein) including the steps of (i) obtaining a pre-administration sample from a subject prior to administration of the agent; (ii) detecting the level of expression of an ERG-LP protein, mRNA, or genomic DNA in the preadministration sample; (iii) obtaining one or more post-administration samples from the subject; (iv) detecting the level of expression or activity of the ERG-LP protein, mRNA, or genomic DNA in the post-administration samples; (v) comparing the level of expression or activity of the ERG-LP protein, mRNA, or genomic DNA in the pre-administration sample with the ERG-LP protein, mRNA, or genomic DNA in the post administration sample or samples; and (vi) altering the administration of the agent to the subject accordingly. For example, increased administration of the agent may be desirable to increase the expression or activity of ERG-LP to higher levels than detected, i.e., to increase the effectiveness of the agent. Alternatively, decreased administration of the agent may be desirable to decrease expression or activity of ERG-LP to lower levels than detected, i.e. to decrease the effectiveness of the agent. According to such an embodiment, ERG-LP expression or activity may be used as an indicator of the effectiveness of an agent, even in the absence of an observable phenotypic response.

[0257] C. Methods of Treatment:

[0258] The present invention provides for both prophylactic and therapeutic methods of treating a subject at risk of (or susceptible to) a disorder or having a disorder associated with aberrant ERG-LP expression or activity. With regards to both prophylactic and therapeutic methods of treatment, such treatments may be specifically tailored or modified, based on knowledge obtained from the field of pharmacogenomics. “Pharmacogenomics”, as used herein, refers to the application of genomics technologies such as gene sequencing, statistical genetics, and gene expression analysis to drugs in clinical development and on the market. More specifically, the term refers the study of how a patient's genes determine his or her response to a drug (e.g., a patient's “drug response phenotype”, or “drug response genotype”.) Thus, another aspect of the invention provides methods for tailoring an individual's prophylactic or therapeutic treatment with either the ERG-LP molecules of the present invention or ERG-LP modulators according to that individual's drug response genotype. Pharmacogenomics allows a clinician or physician to target prophylactic or therapeutic treatments to patients who will most benefit from the treatment and to avoid treatment of patients who will experience toxic drug-related side effects.

[0259] 1. Prophylactic Methods

[0260] In one aspect, the invention provides a method for preventing in a subject, a disease or condition associated with an aberrant ERG-LP expression or activity, by administering to the subject an ERG-LP or an agent which modulates ERG-LP expression or at least one ERG-LP activity. Subjects at risk for a disease which is caused or contributed to by aberrant ERG-LP expression or activity can be identified by, for example, any or a combination of diagnostic or prognostic assays as described herein. Administration of a prophylactic agent can occur prior to the manifestation of symptoms characteristic of the ERG-LP aberrancy, such that a disease or disorder is prevented or, alternatively, delayed in its progression. Depending on the type of ERG-LP aberrancy, for example, an ERG-LP, ERG-LP agonist or ERG-LP antagonist agent can be used for treating the subject. The appropriate agent can be determined based on screening assays described herein.

[0261] 2. Therapeutic Methods

[0262] Another aspect of the invention pertains to methods of modulating ERG-LP expression or activity for therapeutic purposes. Accordingly, in an exemplary embodiment, the modulatory method of the invention involves contacting a cell with an ERG-LP or agent that modulates one or more of the activities of ERG-LP protein activity associated with the cell. An agent that modulates ERG-LP protein activity can be an agent as described herein, such as a nucleic acid or a protein, a naturally-occurring target molecule of an ERG-LP protein (e.g., an ERG-LP substrate), an ERG-LP antibody, an ERG-LP agonist or antagonist, a peptidomimetic of an ERG-LP agonist or antagonist, or other small molecule. In one embodiment, the agent stimulates one or more ERG-LP activities. Examples of such stimulatory agents include active ERG-LP protein and a nucleic acid molecule encoding ERG-LP that has been introduced into the cell. In another embodiment, the agent inhibits one or more ERG-LP activities. Examples of such inhibitory agents include antisense ERG-LP nucleic acid molecules, anti-ERG-LP antibodies, and ERG-LP inhibitors. These modulatory methods can be performed in vitro (e.g., by culturing the cell with the agent) or, alternatively, in vivo (e.g., by administering the agent to a subject). As such, the present invention provides methods of treating an individual afflicted with a disease or disorder characterized by aberrant expression or activity of an ERG-LP protein or nucleic acid molecule. In one embodiment, the method involves administering an agent (e.g., an agent identified by a screening assay described herein), or combination of agents that modulates (e.g., upregulates or downregulates) ERG-LP expression or activity. In another embodiment, the method involves administering an ERG-LP protein or nucleic acid molecule as therapy to compensate for reduced or aberrant ERG-LP expression or activity.

[0263] Stimulation of ERG-LP activity is desirable in situations in which ERG-LP is abnormally downregulated and/or in which increased ERG-LP activity is likely to have a beneficial effect. For example, stimulation of ERG-LP activity is desirable in situations in which an ERG-LP is downregulated and/or in which increased ERG-LP activity is likely to have a beneficial effect. Likewise, inhibition of ERG-LP activity is desirable in situations in which ERG-LP is abnormally upregulated and/or in which decreased ERG-LP activity is likely to have a beneficial effect.

[0264] 3. Pharmacogenomics

[0265] The ERG-LP molecules of the present invention, as well as agents, or modulators which have a stimulatory or inhibitory effect on ERG-LP activity (e.g., ERG-LP gene expression) as identified by a screening assay described herein can be administered to individuals to treat (prophylactically or therapeutically) potassium channel associated disorders (e.g, CNS disorders such as neurodegenerative disorders, e.g., Alzheimer's disease, dementias related to Alzheimer's disease (such as Pick's disease), Parkinson's and other Lewy diffuse body diseases, multiple sclerosis, amyotrophic lateral sclerosis, progressive supranuclear palsy, epilepsy, and Jakob-Creutzfieldt disease; psychiatric disorders, e.g., depression, schizophrenic disorders, korsakoff's psychosis, mania, anxiety disorders, or phobic disorders; learning or memory disorders, e.g., amnesia or age-related memory loss; neurological disorders; e.g., migraine; and obesity; autonomic nervous system disorders; gastrointestinal disorders including, but not limited to, esophageal disorders such as atresia and fistulas, stenosis, achalasia, esophageal rings and webs, hiatal hernia, lacerations, esophagitis, diverticula, systemic sclerosis (scleroderma), varices, esophageal tumors such as squamous cell carcinomas and adenocarcinomas, stomach disorders such as diaphragmatic hernias, pyloric stenosis, gastritis, acute gastric erosion and ulceration, peptic ulcers, stomach tumors such as carcinomas and sarcomas, small intestine disorders such as congenital atresia and stenosis, diverticula, Meckel's diverticulum, pancreatic rests, ischemic bowel disease, infective enterocolitis, Crohn's disease, tumors of the small intestine such as carcinomas and sarcomas, disorders of the colon such as malabsorption, obstructive lesions such as hernias, megacolon, diverticular disease, melanosis coli, ischemic injury, hemorrhoids, angiodysplasia of right colon, inflammations of the colon such as ulcerative colitis, and tumors of the colon such as polyps and sarcomas; pain disorders, e.g, pain response elicited during various forms of tissue injury, e.g., inflammation, infection, and ischemia, usually referred to as hyperalgesia (described in, for example, Fields, H. L. (1987) Pain, New York:McGraw-Hill), and pain associated with muscoloskeletal disorders, e.g., joint pain; tooth pain; headaches; pain associated with malignancies, or pain associated with surgery; and cardiovascular disorders such as arteriosclerosis, ischemia reperfusion injury, restenosis, arterial inflammation, vascular wall remodeling, ventricular remodeling, rapid ventricular pacing, coronary microembolism, tachycardia, bradycardia, pressure overload, aortic bending, coronary artery ligation, vascular heart disease, atrial fibrilation, long-QT syndrome, congestive heart failure, sinus node disfunction, angina, heart failure, hypertension, atrial fibrillation, atrial flutter, dilated cardiomyopathy, idiopathic cardiomyopathy, myocardial infarction, coronary artery disease, coronary artery spasm, or arrhythmia.) associated with aberrant ERG-LP activity. In conjunction with such treatment, pharmacogenomics (i.e., the study of the relationship between an individual's genotype and that individual's response to a foreign compound or drug) may be considered. Differences in metabolism of therapeutics can lead to severe toxicity or therapeutic failure by altering the relation between dose and blood concentration of the pharmacologically active drug. Thus, a physician or clinician may consider applying knowledge obtained in relevant pharmacogenomics studies in determining whether to administer an ERG-LP molecule or ERG-LP modulator as well as tailoring the dosage and/or therapeutic regimen of treatment with an ERG-LP molecule or ERG-LP modulator.

[0266] Pharmacogenomics deals with clinically significant hereditary variations in the response to drugs due to altered drug disposition and abnormal action in affected persons. See, for example, Eichelbaum, M. et al. (1996) Clin. Exp. Pharmacol. Physiol. 23(10-11) :983-985 and Linder, M. W. et al. (1997) Clin. Chem. 43(2):254-266. In general, two types of pharmacogenetic conditions can be differentiated. Genetic conditions transmitted as a single factor altering the way drugs act on the body (altered drug action) or genetic conditions transmitted as single factors altering the way the body acts on drugs (altered drug metabolism). These pharmacogenetic conditions can occur either as rare genetic defects or as naturally-occurring polymorphisms. For example, glucose-6-phosphate dehydrogenase deficiency (G6PD) is a common inherited enzymopathy in which the main clinical complication is haemolysis after ingestion of oxidant drugs (anti-malarials, sulfonamides, analgesics, nitrofurans) and consumption of fava beans.

[0267] One pharmacogenomics approach to identifying genes that predict drug response, known as “a genome-wide association”, relies primarily on a high-resolution map of the human genome consisting of already known gene-related markers (e.g., a “bi-allelic” gene marker map which consists of 60,000-100,000 polymorphic or variable sites on the human genome, each of which has two variants.) Such a high-resolution genetic map can be compared to a map of the genome of each of a statistically significant number of patients taking part in a Phase II/III drug trial to identify markers associated with a particular observed drug response or side effect. Alternatively, such a high resolution map can be generated from a combination of some ten-million known single nucleotide polymorphisms (SNPs) in the human genome. As used herein, a “SNP” is a common alteration that occurs in a single nucleotide base in a stretch of DNA. For example, a SNP may occur once per every 1000 bases of DNA. A SNP may be involved in a disease process, however, the vast majority may not be disease-associated. Given a genetic map based on the occurrence of such SNPs, individuals can be grouped into genetic categories depending on a particular pattern of SNPs in their individual genome. In such a manner, treatment regimens can be tailored to groups of genetically similar individuals, taking into account traits that may be common among such genetically similar individuals.

[0268] Alternatively, a method termed the “candidate gene approach”, can be utilized to identify genes that predict drug response. According to this method, if a gene that encodes a drugs target is known (e.g., an ERG-LP protein of the present invention), all common variants of that gene can be fairly easily identified in the population and it can be determined if having one version of the gene versus another is associated with a particular drug response.

[0269] As an illustrative embodiment, the activity of drug metabolizing enzymes is a major determinant of both the intensity and duration of drug action. The discovery of genetic polymorphisms of drug metabolizing enzymes (e.g., N-acetyltransferase 2 (NAT 2) and cytochrome P450 enzymes CYP2D6 and CYP2C19) has provided an explanation as to why some patients do not obtain the expected drug effects or show exaggerated drug response and serious toxicity after taking the standard and safe dose of a drug. These polymorphisms are expressed in two phenotypes in the population, the extensive metabolizer (EM) and poor metabolizer (PM). The prevalence of PM is different among different populations. For example, the gene coding for CYP2D6 is highly polymorphic and several mutations have been identified in PM, which all lead to the absence of functional CYP2D6. Poor metabolizers of CYP2D6 and CYP2C19 quite frequently experience exaggerated drug response and side effects when they receive standard doses. If a metabolite is the active therapeutic moiety, PM show no therapeutic response, as demonstrated for the analgesic effect of codeine mediated by its CYP2D6-formed metabolite morphine. The other extreme are the so called ultra-rapid metabolizers who do not respond to standard doses. Recently, the molecular basis of ultra-rapid metabolism has been identified to be due to CYP2D6 gene amplification.

[0270] Alternatively, a method termed the “gene expression profiling”, can be utilized to identify genes that predict drug response. For example, the gene expression of an animal dosed with a drug (e.g., an ERG-LP molecule or ERG-LP modulator of the present invention) can give an indication whether gene pathways related to toxicity have been turned on.

[0271] Information generated from more than one of the above pharmacogenomics approaches can be used to determine appropriate dosage and treatment regimens for prophylactic or therapeutic treatment an individual. This knowledge, when applied to dosing or drug selection, can avoid adverse reactions or therapeutic failure and thus enhance therapeutic or prophylactic efficiency when treating a subject with an ERG-LP molecule or ERG-LP modulator, such as a modulator identified by one of the exemplary screening assays described herein.

[0272] This invention is further illustrated by the following examples which should not be construed as limiting. The contents of Sequence Listing, figures and all references, patents and published patent applications cited throughout this application are incorporated herein by reference.

EXAMPLES

Example 1

Identification and Characterization of ERG-LP cDNAs

[0273] In this example, the identification and characterization of the genes encoding human and monkey ERG-LP1 and human ERG-LP2 are described.

[0274] Isolation of the Human and Monkey ERG-LP1 cDNA

[0275] The invention is based, at least in part, on the discovery of a human and a monkey gene encoding a novel protein, referred to herein as ERG-LP1. A partial cDNA sequence (jlkbc037e12) was identified in a monkey striatum library using the Sequence Explorer, which is 45% identical to the Drosophila ELK potassium channel (Accession Number U04246). Subsequently, a full length monkey clone (jlkba25d10) was identified in a monkey hippocampal library by analysis of a proprietary database using the Drosophila ELK potassium channel (Accession Number U04246) as a probe.

[0276] The sequence of the entire monkey clone was determined and found to contain an open reading frame of 1083 amino acids termed monkey “ERG-like protein 1” or ERG-LP1. The nucleotide sequence encoding the monkey ERG-LP1 protein is shown in FIG. 1 and is set forth as SEQ ID NO:1. The full length protein encoded by this nucleic acid comprises about 1083 amino acids and has the amino acid sequence shown in FIG. 1 and set forth as SEQ ID NO:2. The coding region (open reading frame) of SEQ ID NO:1 is set forth as SEQ ID NO:3. Clone jlkba25d10, comprising the entire coding region of monkey ERG-LP1 was deposited with the American Type Culture Collection (ATCC®), Rockville, Md., on ______, and assigned Accession No. ______.

[0277] The human ERG-LP1 was identified by searching a GenBank™ EST database. A human EST (IMAGE clone 37299) was identified with similarity to the 5′ end of the monkey jlkba25d10 clone. The sequence of the entire human clone was determined and found to contain an open reading frame of 290 amino acids termed human “ERG-like protein 1” or ERG-LP1. The nucleotide sequence encoding the human ERG-LP1 protein is shown in FIG. 5 and is set forth as SEQ ID NO:7. The partial length protein encoded by this nucleic acid comprises about 290 amino acids and has the amino acid sequence shown in FIG. 5 and set forth as SEQ ID NO:8. The coding region (open reading frame) of SEQ ID NO:7 is set forth as SEQ ID NO:9. Clone 37299, comprising the partial cDNA sequence of human ERG-LP1 was deposited with the American Type Culture Collection (ATCC®), Rockville, Md., on ______, and assigned Accession No. ______.

[0278] Isolation of the Human ERG-LP2 cDNA

[0279] The invention is further based, at least in part, on the discovery of a human gene encoding a novel protein, referred to herein as ERG-LP2. The human gene was discovered by analysis of a proprietary database using the potassium channel clone Flh37299 as a probe. Clone jlhbaa042h05 from a human brain library was identified. This clone was picked, plasmid was prepared and sequenced. BlastP searching (BLAST™ searching utilizing an amino acid sequence against a protein database), using the translation product (frame 1) of this sequence, revealed homology to proteins belonging to the potassium channel superfamily, e.g., the human ERG channel and the Drosophila ELK channel.

[0280] Initial sequencing of clone jlhbaa042h05 revealed an open reading frame of 542 amino acids termed “ERG-like protein 2” or ERG-LP2. The nucleotide sequence encoding the partial human ERG-LP2 protein is shown in FIG. 2 and is set forth as SEQ ID NO:4. The protein encoded by this nucleic acid comprises about 542 amino acids and has the amino acid sequence shown in FIG. 2 and set forth as SEQ ID NO:5. The coding region (open reading frame) of SEQ ID NO:4 is set forth as SEQ ID NO:6. Clone jlhbaa042h05, comprising the entire coding region of human ERG-LP2 was deposited with the American Type Culture Collection (ATCC®), Rockville, Md., on ______, and assigned Accession No. ______.

[0281] Additional sequencing of clone jlhbaa042h05 revealed a larger open reading frame of 1107 amino acids comprising full length human ERG-LP2. The nucleotide sequence of clone jlhbaa042h05 encompassing the full length human ERG-LP2 protein is set forth as SEQ ID NO:14. Nucleotides 196 to 1770 of SEQ ID NO:14 comprise one exon of human ERG-LP2, nucleotides 1771 to 2618 comprise an intron, and nucleotides 2619 to 4364 comprise a second exon of human ERG-LP2. Following splicing of the ERG-LP2 nucleotide sequence of SEQ ID NO:14, the nucleotide sequence encoding the full length human ERG-LP2 protein is shown in FIG. 8 and is set forth as SEQ ID NO:15. The full length protein encoded by this nucleic acid comprises about 1107 amino acids and has the amino acid sequence shown in FIG. 8 and set forth as SEQ ID NO:16. The coding region (open reading frame) of SEQ ID NO:15 is set forth as SEQ ID NO:17.

[0282] Analysis of Monkey ERG-LP1

[0283] A BLAST search (Altschul et al. (1990) J. Mol. Biol. 215:403) of the nucleotide and protein sequences of monkey ERG-LP1 revealed that ERG-LP1 is similar to the Drosophila ELK potassium channel protein (Accession Number U04246) and the human ERG potassium channel protein (Accession Number U04270). The mouse Melk2 protein has also been identified as a member of the ERG potassium channel family (Trudeau et al. (1999) J. Neuroscience, 19:2906-2918). An alignment of monkey ERG-LP1 and the human ERG potassium channel protein is presented in FIG. 3. Hydropathy plots have identified 6 transmembrane domains and a P-loop in this protein.

[0284] Analysis of Human ERG-LP2

[0285] A BLAST search (Altschul et al. (1990) J. Mol. Biol. 215:403) of the partial nucleotide and protein sequences of human ERG-LP2 revealed that ERG-LP2 is similar to the rat ERG potassium channel protein (Accession Number Z96106), the Drosophila ELK potassium channel protein (Accession Number U04246), and the human ERG potassium channel protein (Accession Number U04270). Relk1 is a rat protein that is also related to the ERG potassium channel family of proteins (Shi et al. (1998) J. Physiology, 511:675-682). An alignment of the partial human ERG-LP2 protein and the Drosophila ELK potassium channel protein is presented in FIG. 4. An alignment of the human ERG-LP2 protein and the rat Relk1 potassium channel protein is presented in FIG. 11. Hydropathy plots have identified 6 transmembrane domains in this protein.

[0286] Tissue Distribution of ERG-LP mRNA

[0287] This Example describes the tissue distribution of ERG-LP mRNA, as determined by Northern blot hybridization, PCR and in situ hybridization.

[0288] Northern blot hybridizations with the various RNA samples were performed under standard conditions and washed under stringent conditions, i.e., 0.2×SSC at 65° C. The DNA probe was radioactively labeled with 32P-dCTP using the Prime-It kit (Stratagene, La Jolla, Calif.) according to the instructions of the supplier. Filters containing human mRNA (MultiTissue Northern I and MultiTissue Northern II from Clontech, Palo Alto, Calif.) were probed in ExpressHyb hybridization solution (Clontech) and washed at high stringency according to manufacturer's recommendations. For the monkey ERG-LP1 gene, the probe was generated by PCR from the 3′ end of the gene. For the human ERG-LP2, the probe was generated from a region in the open reading frame which does not have any homology to the human ERG.

[0289] ERG-LP1 message was detected exclusively in the brain (expression was highest in cortical regions, hippocampus, caudate, and amygdala). The ERG-LP2 gene is expressed in the brain.

[0290] ERG-LP2 expression in normal human tissues was also assessed by PCR using the Taqman® system (PE Applied Biosystems) according to the manufacturer's instructions. ERG-LP2 was strongly expressed in the brain, moderately expressed in the testis and fetal kidney, and weakly expressed in the prostate, breast, liver, colon, fetal liver and fetal heart.

[0291] For in situ analysis, various tissues obtained from brains, e.g. rat or monkey brains, were first frozen on dry ice. Ten-micrometer-thick coronal sections of the tissues were postfixed with 4% formaldehyde in DEPC treated 1×phosphate-buffered saline at room temperature for 10 minutes before being rinsed twice in DEPC 1×phosphate-buffered saline and once in 0.1 M triethanolamine-HCl (pH 8.0). Following incubation in 0.25% acetic anhydride-0.1 M triethanolamine-HCl for 10 minutes, sections were rinsed in DEPC 2×SSC (1×SSC is 0.15M NaCl plus 0.015M sodium citrate). Tissue was then dehydrated through a series of ethanol washes, incubated in 100% chloroform for 5 minutes, and then rinsed in 100% ethanol for 1 minute and 95% ethanol for 1 minute and allowed to air dry.

[0292] Hybridizations were performed with 35S-radiolabeled (5×107 cpm/ml) cRNA probes. Probes were incubated in the presence of a solution containing 600 mM NaCl, 10 mM Tris (pH 7.5), 1 mM EDTA, 0.01% sheared salmon sperm DNA, 0.01% yeast tRNA, 0.05% yeast total RNA type X1, 1× Denhardt's solution, 50% formamide, 10% dextran sulfate, 100 mM dithiothreitol, 0.1% sodium dodecyl sulfate (SDS), and 0.1% sodium thiosulfate for 18 hours at 55° C.

[0293] After hybridization, slides were washed with 2×SSC. Sections were then sequentially incubated at 37° C. in TNE (a solution containing 10 mM Tris-HCl (pH 7.6), 500 mM NaCl, and 1 mM EDTA), for 10 minutes, in TNE with 10 &mgr;g of RNase A per ml for 30 minutes, and finally in TNE for 10 minutes. Slides were then rinsed with 2×SSC at room temperature, washed with 2×SSC at 50° C. for 1 hour, washed with 0.2×SSC at 55° C. for 1 hour, and 0.2×SSC at 60° C. for 1 hour. Sections were then dehydrated rapidly through serial ethanol-0.3 M sodium acetate concentrations before being air dried and exposed to Kodak Biomax MR scientific imaging film for 24 hours and subsequently dipped in NB-2 photoemulsion and exposed at 4° C. for 7 days before being developed and counter stained.

[0294] ERG-LP1 is expressed at higher levels in different regions of monkey and rat brain, including the cortex, caudate, hippocampus and cerebellum. ERG-LP1 transcripts are absent from the spinal cord, dorsal root ganglion and superior cervical ganglion in both the monkey and rat brain.

[0295] ERG-LP2 message is expressed at high levels in the monkey brain in a subpopulation of small neurons in the dorsal root ganglion. Lower levels of expression are found in neurons within the brain, spinal cord and in sympathetic neurons of the superior cervical ganglion. The ERG-LP2 gene is also expressed in human brain. Expression of ERG-LP2 in small neurons in the dorsal root ganglion and in sympathetic neurons of the superior cervical ganglion demonstrates a role for this channel in autonomic nervous system function and the perception of pain.

Example 2

Chromosome Mapping of the ERG-LP Genes

[0296] In this example, the mapping of the chromosomal location of the genes encoding human ERG-LP1 and ERG-LP2 using PCR screening of somatic cell hybrids is described. Techniques involved in chromosome mapping are described on pages 56-58.

[0297] Oligonucleotide primers for PCR were designed based on the sequence of the monkey ERG-LP1 gene (SEQ ID NO:1) and the human ERG-LP2 gene (SEQ ID NO: 4) as follows: 1 ERG-LP1 Forward: CAGAGTGAAGACAGGGTGGCG (SEQ ID NO:18) Reverse: TTCCTTGTCCTCAGGTCTCTGC (SEQ ID NO:19) ERG-LP2 Forward: TTTCACAATGCCAATTTGGATTGACCG (SEQ ID NO:20) Reverse: GCAGTCTGGGGTGTTTCTGG (SEQ ID NO:21)

[0298] These primers were used in PCR reactions to amplify somatic cell hybrid DNA samples, in duplicate, from the Genebridge 4 Radiation Hybrid Panel. The ERG-LP gene products were analyzed on 8% acrylamide gels, post-stained with SYBR Gold (1:10,000 dilution in 1×Tris-Borate-EDTA buffer), and scanned on a Molecular Dynamics 595 Fluorimager. Radiation hybrid linkage analysis was performed using the Map Manager QTb23 software package.

[0299] The ERG-LP1 gene was found to map to human chromosome 12q11-13, between markers WI-7107 and WI-6327. The ERG-LP2 gene mapped to human chromosome 3p21.3-24.3, between markers WI-4218 and RP_L15—1.

Example 3

Functional Expression of the Monkey ERG-LP1 Gene in CHO Cells

[0300] To express the monkey ERG-LP1 gene in CHO cells, the full length monkey ERG-LP1 gene in the pMet7 expression vector and transiently transfected into CHO cells using lipofectamine. Electrophysiological measurements were taken using a single electrode patch-clamp 48 hours after transfection. As shown in FIG. 12, with voltage steps from −60 mV to +50 mV in 10 mV increments from a holding potential of −80 mV, the CHO cells transfected with monkey ERG-LP1 displayed sustained outward currents (1-1.5 nA) with significant tail currents (250 pA). There was no evidence of inactivation during 500 msec voltage steps. The I-V curve was linear from −60 mV to +50 mV.

Example 4

Expression of Recombinant ERG-LP Protein in Bacterial Cells

[0301] In this example, ERG-LP is expressed as a recombinant glutathione-S-transferase (GST) fusion polypeptide in E. coli and the fusion polypeptide is isolated and characterized. Specifically, ERG-LP is fused to GST and this fusion polypeptide is expressed in E. coli, e.g., strain PEB199. Expression of the GST-ERG-LP fusion protein in PEB199 is induced with IPTG. The recombinant fusion polypeptide is purified from crude bacterial lysates of the induced PEB199 strain by affinity chromatography on glutathione beads. Using polyacrylamide gel electrophoretic analysis of the polypeptide purified from the bacterial lysates, the molecular weight of the resultant fusion polypeptide is determined.

Example 5

Expression of Recombinant ERG-LP Protein in COS Cells

[0302] To express the ERG-LP gene in COS cells, the pcDNA/Amp vector by Invitrogen Corporation (San Diego, Calif.) is used. This vector contains an SV40 origin of replication, an ampicillin resistance gene, an E. coli replication origin, a CMV promoter followed by a polylinker region, and an SV40 intron and polyadenylation site. A DNA fragment encoding the entire ERG-LP protein and an HA tag (Wilson et al. (1984) Cell 37:767) or a FLAG tag fused in-frame to its 3′ end of the fragment is cloned into the polylinker region of the vector, thereby placing the expression of the recombinant protein under the control of the CMV promoter.

[0303] To construct the plasmid, the ERG-LP DNA sequence is amplified by PCR using two primers. The 5′ primer contains the restriction site of interest followed by approximately twenty nucleotides of the ERG-LP coding sequence starting from the initiation codon; the 3′ end sequence contains complementary sequences to the other restriction site of interest, a translation stop codon, the HA tag or FLAG tag and the last 20 nucleotides of the ERG-LP coding sequence. The PCR amplified fragment and the pCDNA/Amp vector are digested with the appropriate restriction enzymes and the vector is dephosphorylated using the CIAP enzyme (New England Biolabs, Beverly, Mass.). Preferably the two restriction sites chosen are different so that the ERG-LP gene is inserted in the correct orientation. The ligation mixture is transformed into E. coli cells (strains HB101, DH5a, SURE, available from Stratagene Cloning Systems, La Jolla, Calif., can be used), the transformed culture is plated on ampicillin media plates, and resistant colonies are selected. Plasmid DNA is isolated from transformants and examined by restriction analysis for the presence of the correct fragment.

[0304] COS cells are subsequently transfected with the ERG-LP-pcDNA/Amp plasmid DNA using the calcium phosphate or calcium chloride co-precipitation methods, DEAE-dextran-mediated transfection, lipofection, or electroporation. Other suitable methods for transfecting host cells can be found in Sambrook, J., Fritsh, E. F., and Maniatis, T. Molecular Cloning: A Laboratory Manual. 2nd, ed., Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989. The expression of the ERG-LP polypeptide is detected by radiolabelling (35S-methionine or 35S-cysteine available from NEN, Boston, Mass., can be used) and immunoprecipitation (Harlow, E. and Lane, D. Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1988) using an HA specific monoclonal antibody. Briefly, the cells are labelled for 8 hours with 35S-methionine (or 35S-cysteine). The culture media are then collected and the cells are lysed using detergents (RIPA buffer, 150 mM NaCl, 1% NP-40, 0.1% SDS, 0.5% DOC, 50 mM Tris, pH 7.5). Both the cell lysate and the culture media are precipitated with an HA specific monoclonal antibody. Precipitated polypeptides are then analyzed by SDS-PAGE.

[0305] Alternatively, DNA containing the ERG-LP coding sequence is cloned directly into the polylinker of the pCDNA/Amp vector using the appropriate restriction sites. The resulting plasmid is transfected into COS cells in the manner described above, and the expression of the ERG-LP polypeptide is detected by radiolabelling and immunoprecipitation using an ERG-LP specific monoclonal antibody.

Equivalents

[0306] Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Such equivalents are intended to be encompassed by the following claims.

Claims

1. An isolated nucleic acid molecule selected from the group consisting of:

a) a nucleic acid molecule comprising a nucleotide sequence which is at least 60% homologous to the nucleotide sequence of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:9, the DNA insert of the plasmid deposited with ATCC as Accession Number ______ or ______, or a complement thereof;

b) a nucleic acid molecule comprising a fragment of at least 949 nucleotides of a nucleic acid comprising the nucleotide sequence of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:9 the DNA insert of the plasmid deposited with ATCC as Accession Number ______ or ______, or a complement thereof;

c) a nucleic acid molecule which encodes a polypeptide comprising an amino acid sequence at least about 40% homologous to the amino acid sequence of SEQ ID NO:2, SEQ ID NO:5, or SEQ ID NO:8 or an amino acid sequence encoded by the DNA insert of the plasmid deposited with ATCC as Accession Number ______ or ______;

d) a nucleic acid molecule which encodes a fragment of a polypeptide comprising the amino acid sequence of SEQ ID NO:2, SEQ ID NO:5, or SEQ ID NO:8 or the polypeptide encoded by the DNA insert of the plasmid deposited with ATCC as Accession Number ______ or ______, wherein the fragment comprises at least 15 contiguous amino acid residues of the amino acid sequence of SEQ ID NO:2, SEQ ID NO:5, or SEQ ID NO:8 or the polypeptide encoded by the DNA insert of the plasmid deposited with ATCC as Accession Number ______ or ______; and

e) a nucleic acid molecule which encodes a naturally occurring allelic variant of a polypeptide comprising the amino acid sequence of SEQ ID NO:2, SEQ ID NO:5, or SEQ ID NO:8 or an amino acid sequence encoded by the DNA insert of the plasmid deposited with ATCC as Accession Number ______ or ______, wherein the nucleic acid molecule hybridizes to a nucleic acid molecule comprising SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:7, or SEQ ID NO:9, under stringent conditions.

2. The isolated nucleic acid molecule of claim 1 which is selected from the group consisting of:

a) a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:9 or the DNA insert of the plasmid deposited with ATCC as Accession Number ______ or ______, or a complement thereof; and

b) a nucleic acid molecule which encodes a polypeptide comprising the amino acid sequence of SEQ ID NO:2, SEQ ID NO:5, or SEQ ID NO:8 or an amino acid sequence encoded by the DNA insert of the plasmid deposited with ATCC as Accession Number ______ or ______.

3. The nucleic acid molecule of claim 1 further comprising vector nucleic acid sequences.

4. The nucleic acid molecule of claim 1 further comprising nucleic acid sequences encoding a heterologous polypeptide.

5. A host cell which contains the nucleic acid molecule of claim 1.

6. The host cell of claim 5 which is a mammalian host cell.

7. A non-human mammalian host cell containing the nucleic acid molecule of claim 1.

8. An isolated polypeptide selected from the group consisting of:

a) a fragment of a polypeptide comprising the amino acid sequence of SEQ ID NO:2, SEQ ID NO:5, or SEQ ID NO:8 or the polypeptide encoded by the DNA insert of the plasmid deposited with ATCC as Accession Number ______ or ______, wherein the fragment comprises at least 15 contiguous amino acids of SEQ ID NO:2, SEQ ID NO:5, or SEQ ID NO:8 or the amino acid sequence encoded by the DNA insert of the plasmid deposited with ATCC as Accession Number ______ or ______;

b) a naturally occurring allelic variant of a polypeptide comprising the amino acid sequence of SEQ ID NO:2, SEQ ID NO:5, or SEQ ID NO:8 or an amino acid sequence encoded by the DNA insert of the plasmid deposited with ATCC as Accession Number ______ or ______, wherein the polypeptide is encoded by a nucleic acid molecule which hybridizes to a nucleic acid molecule comprising SEQ ID NO:1, SEQ ID NO:3 SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:9 under stringent conditions; and

c) a polypeptide which is encoded by a nucleic acid molecule comprising a nucleotide sequence which is at least 60% homologous to a nucleic acid comprising the nucleotide sequence of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:9 or the DNA insert of the plasmid deposited with ATCC as Accession Number ______ or ______.

d) a polypeptide comprising an amino acid sequence which is at least 40% homologous to the amino acid sequence of SEQ ID NO:2, SEQ ID NO:5, or SEQ ID NO:8, or the polypeptide encoded by the DNA insert of the plasmid deposited with ATCC as Accession Number ______ or ______.

9. The isolated polypeptide of claim 8 comprising the amino acid sequence of SEQ ID NO:2, SEQ ID NO:5, or SEQ ID NO:8 or an amino acid sequence encoded by the DNA insert of the plasmid deposited with ATCC as Accession Number ______ or ______.

10. The polypeptide of claim 8 further comprising heterologous amino acid sequences.

11. An antibody which selectively binds to a polypeptide of claim 8.

12. A method for producing a polypeptide selected from the group consisting of:

a) a polypeptide comprising the amino acid sequence of SEQ ID NO: 2, SEQ ID NO:5, or SEQ ID NO:8 or an amino acid sequence encoded by the DNA insert of the plasmid deposited with ATCC as Accession Number ______ or ______;

b) a fragment of a polypeptide comprising the amino acid sequence of SEQ ID NO:2, SEQ ID NO:5, or SEQ ID NO:8 or an amino acid sequence encoded by the DNA insert of the plasmid deposited with ATCC as Accession Number ______ or ______ wherein the fragment comprises at least 15 contiguous amino acids of SEQ ID NO:2, SEQ ID NO:5, or SEQ ID NO:8 or the amino acid sequence encoded by the DNA insert of the plasmid deposited with ATCC as Accession Number ______ or ______; and

c) a naturally occurring allelic variant of a polypeptide comprising the amino acid sequence of SEQ ID NO:2, SEQ ID NO:5, or SEQ ID NO:8 or an amino acid sequence encoded by the DNA insert of the plasmid deposited with ATCC as Accession Number ______ or ______, wherein the polypeptide is encoded by a nucleic acid molecule which hybridizes to a nucleic acid molecule comprising SEQ ID NO:1 SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:9 under stringent conditions;

comprising culturing the host cell of claim 5 under conditions in which the nucleic acid molecule is expressed.

13. A method for detecting the presence of a polypeptide of claim 8 in a sample comprising:

a) contacting the sample with a compound which selectively binds to the polypeptide; and

b) determining whether the compound binds to the polypeptide in the sample to thereby detect the presence of a polypeptide of claim 8 in the sample.

14. The method of claim 13, wherein the compound which binds to the polypeptide is an antibody.

15. A kit comprising a compound which selectively binds to a polypeptide of claim 8 and instructions for use.

16. A method for detecting the presence of a nucleic acid molecule in claim 1 in a sample comprising:

a) contacting the sample with a nucleic acid probe or primer which selectively hybridizes to the nucleic acid molecule; and

b) determining whether the nucleic acid probe or primer binds to a nucleic acid molecule in the sample to thereby detect the presence of a nucleic acid molecule of claim 1 in the sample.

17. The method of claim 16, wherein the sample comprises mRNA molecules and is contacted with a nucleic acid probe.

18. A kit comprising a compound which selectively hybridizes to a nucleic acid molecule of claim 1 and instructions for use.

19. A method for identifying a compound which binds to a polypeptide of claim 8 comprising:

a) contacting the polypeptide, or a cell expressing the polypeptide with a test compound; and

b) determining whether the polypeptide binds to the test compound.

20. The method of claim 19, wherein the binding of the test compound to the polypeptide is detected by a method selected from the group consisting of:

a) detection of binding by direct detection of test compound/polypeptide binding;

b) detection of binding using a competition binding assay; and

c) detection of binding using an assay for ERG-LP activity.

21. A method for modulating the activity of a polypeptide of claim 8 comprising contacting the polypeptide or a cell expressing the polypeptide with a compound which binds to the polypeptide in a sufficient concentration to modulate the activity of the polypeptide.

22. A method for identifying a compound which modulates the activity of a polypeptide of claim 8 comprising:

a) contacting a polypeptide of claim 8 with a test compound; and

b) determining the effect of the test compound on the activity of the polypeptide to thereby identify a compound which modulates the activity of the polypeptide.