Lectin compositions and methods for modulating an immune response to an antigen

Abstract

The present invention provides a fusion polypeptide which can bind to a cell surface binding moiety (e.g., a carbohydrate) and serve as a ligand for a cell surface polypeptide, as well as a vector comprising a nucleic acid encoding for such a fusion polypeptide, and a host cell comprising such nucleic acid. The present invention also provides a composition comprising an antigen bearing target and such a fusion polypeptide, as well as a composition comprising a virus or a cell and such a fusion polypeptide. The present invention further relates to a method of modulating an immune response in an animal using such compositions.

Description

RELATED APPLICATIONS

[0001] The present application is a divisional application to U.S. Utility Application with Ser. No. 10/645,000, filed Aug. 20, 2003, which claims priority to U.S. Provisional applications No. 60/404,823, filed Aug. 20, 2002 and No. 60/487,407, filed July 15, 2003, the entirety of each is hereby incorporated by reference.

BACKGROUND OF THE INVENTION

[0002] Typically, the specific modulation of an immune response to an antigen in a subject requires the administration of another substance, e.g. an adjuvant, in admixture with the antigen in order to initiate and/or direct the modulation. Traditional adjuvants, though, have a number of weaknesses. For example, many are crude, heterogeneous preparations. In addition, many are relatively weak immunomodulators, and some cause severe local inflammation that is unacceptable in humans. Purified soluble polypeptides, such as cytokines, have some advantages over crude adjuvants, but their value is limited because they diffuse away from the antigen upon administration. While certain cell-surface molecules may be potential immunomdulators as components of cell-based vaccines, their application generally involves gene transfer into the cells, which is often problematic.

[0003] The invention therefore fills heretofore unmet needs by providing molecules that can bind to antigen bearing targets, such as cells, viruses, and isolated antigens, and that can serve as immunomodulators when administered with an antigen bearing target. In addition, the invention provides compositions comprising these molecules and related methods. The compositions and methods of the invention are also useful for other applications, e.g. any application in which it is desirable to attach a biological effeector, such as a polypeptide ligand for a cell surface receptor, to a target structure, such as a virus or a cell.

SUMMARY OF THE INVENTION

[0004] The present invention relates to a multifunctional molecule, e.g. a fusion polypeptide, comprising a first part which is capable of binding to an antigen bearing target and a second part which is capable of binding to a cell. In a preferred embodiment, the first part is a first cell surface binding moiety and the second part is a second cell surface binding moiety. In this embodiment, the first cell surface binding moiety can attach to a virus or cell, e.g. a tumor cell, which comprises an antigen. It is also particularly preferred that the second cell surface binding moiety can bind to a cell-surface polypeptide, e.g. a non-immunoglobulin polypeptide, of an antigen presenting cell (APC). Thus, in some embodiments, a multifunctional molecule of the invention can serve as a bridge or link between an antigen bearing target and an APC.

[0005] As used herein an “antigen bearing target” is an entity which comprises an antigen. As used herein an “antigen bearing target” includes, for example, a whole cell which expresses an antigen a cell fraction comprising an antigen, a membrane fraction comprising an antigen, a virus comprising an antigen, a viral particle comprising an antigen, or an antigen, e.g. a polypeptide antigen, which may be free of any other cell-derived or virus-derived material. Cellular fractions may be prepared using methods known to those of skill in the art such as those taught in Cell Biology A Laboratory Handbook (Academic Press 1994 Editor J. E. Celis ISBN 0-12-164715-3)

[0006] The term “antigen” as used herein refers to a molecule against which a subject can initiate a humoral and/or cellular immune response. Antigens can be any type of biologic molecule including, for example, simple intermediary metabolites, sugars, lipids, and hormones as well as macromolecules such as complex carbohydrates, phospholipids, nucleic acids and proteins. Common categories of antigens include, but are not limited to, viral antigens, bacterial antigens, fungal antigens, protozoa and other parasitic antigens, tumor antigens, antigens involved in autoimmune disease, allergy and graft rejection, and other miscellaneous antigens. In the compositions and methods of the invention, it is preferred that the antigen is a polypeptide, e.g., one comprising at least seven amino acids.

[0007] As used herein, “antigen presenting cell” or “APC” refers to cells that ingest and present antigen to T cells. These cells include phagocytic leukocytes, macrophages, and dendritic cells, B lymphocytes, and endothelial cells. A “professional APC” is an APC that is constitutively able to activate a T lymphocyte. Professional APCs typically constitutively express class II major histocompatibility molecules and costimulatory molecules such as B7-1 and/or B7-2.

[0008] In one embodiment, the invention encompasses a multifunctional molecule, the first part of which is a lectin. Thus, the multifunctional molecule can bind to one or more carbohydrates of an antigen bearing target. In a preferred embodiment of the invention, the first part of the multifunctional molecule is a lectin and the second portion is a ligand for a cell surface protein (e.g., a ligand for a cell surface receptor). Preferably, the cell surface protein is a cell surface receptor of an APC. Ligands for a cell surface receptor include any ligand which will bind to a cell surface protein, and preferably include, but are not limited to, an opsonin, cytokine, adhesion molecule, counterreceptor of a T cell costimulatory molecule, a defensin, a ligand for a CD40 molecule, or a heat shock protein, or a portion of any of these ligands, including about (or at least about) 5, 8, 10, 12, 15, 20, 25, 35, 50, 60, 70, 80, 100, or 120 contiguous amino acids of such a ligand. Preferably, the multifunctional molecule which comprises first and second parts comprises an amino acid sequence which can bind to a cell surface protein (e.g., a cell surface receptor) including, but not limited to an adhesion molecule, a costimulatory molecule for a T cell, or a receptor for at least one of the following types of molecules: a cytokine, a defensin, a heat shock protein, a CD40 molecule, or an opsonin.

[0009] A cell surface protein (e.g., a cell surface receptor) useful in the present invention is any cell surface molecule which can bind the ligand portion of a multifunctional molecule of the invention. Preferably, the cell surface receptor is a CD40 molecule, a T cell costimulatory molecule, an adhesion molecule, or a receptor for a cytokine, a defensin, a heat shock protein, an opsonin, or an adhesion molecule. Cell surface proteins, useful in the invention include, but are not limited to the cell surface molecules identified by GenBank Accession number in Appendix I and II, or those cell surface molecules which are encoded by a nucleic acid molecule identified by GenBank Accession number in Appendix I or II.

[0010] The term “cytokine” as used herein refers to a polypeptide molecule that is naturally secreted by mammalian cells and that binds to a cell surface protein on a leukocyte, inducing a change (e.g., a change in the proliferative state, a change in the transcriptional profile or a change in the propensity to migrate) in the leukocyte (other than mere occupancy of the leukocyte's receptors for the cytokine). “Change” refers to at least about a 5% increase or decrease as compared to in the absence of a cytokine. The term “cytokine” also refers herein to a polypeptide molecule that is a ligand for a receptor for a naturally occurring cytokine.

[0011] Examples of cytokines which are useful in the methods and compositions of the invention include the following: GM-CSF, Il-2, IL-4, IL-6, IL-12, ligands for hematopoietin receptors, ligands for immunoglobulin superfamily receptors, ligands for interferon receptors, ligands for TNF receptors, and ligands for chemokine receptors. An antibody against a cytokine receptor can also be a cytokine.

[0012] In one embodiment of the invention, it is preferred that a cytokine comprised by a composition of the invention promote a Th1 immune response, i.e., the generation of T cells that express Th1 cytokines such as IL-2 and IFN-&ggr;. In another embodiment, it is preferred that a cytokine comprised by a composition of the invention promote a Th2 immune response, i.e., the generation of T cells that express Th2 cytokines such as IL-4 and IL-10.

[0013] “Engineered cytokines” as described herein are cytokines which comprise a heterologous cell surface binding moiety.

[0014] The term “opsonin” as used herein refers to naturally occurring and non-naturally occurring molecules which are capable, by virtue of being contemporaneously bound or attached to both an antigen-containing cell and an antigen-presenting cell (APC), of acting as a link or coupling agent (an adapter) between the antigen and the APC to allow more efficient binding, engulfment, and internalization of the antigen-containing cell by the APC. An opsonin useful according to the invention, also includes non-naturally occurring opsonins capable of binding to APCs via receptors that can bind naturally occurring opsonins.

[0015] The term “opsonin” as used herein can also refer to molecules which can be processed such that at least one product of the processing step or steps is capable of, by virtue of being contemporaneously bound or attached to both an antigen-containing cell and an APC, acting as a link or coupling agent to allow more efficient binding, engulfment, and internalization of other antigen-containing cells by the APC. An opsonin can also be any polypeptide chain of a multichain opsonin.

[0016] Examples of opsonins which are useful in the methods and compositions of the invention include the following: vitronectin, fibronectin, complement components such as C1q (including any of its component polypeptide chains A, B and C), complement fragments such as C3d, C3b and C4b, mannose binding protein, conglutinin, surfactant proteins A and D, C-reactive protein (CRP), alpha-2-macroglobulin, and immunoglobulins, for example, the Fc portion of an immunoglobulin.

[0017] “Innate opsonins” are opsonins of the innate immune system and are known in the art as secreted polypeptide molecules of the innate immune system and are believed to bind contemporaneously to an antigen and to the surface of an APC. They can thus act as “bridges”, and are thought, by virtue of this property, to promote internalization of antigens by APCs. The mode in which opsonins bind to antigens varies among opsonins, and can be covalent or noncovalent. In general, the antigen-binding moieties of innate opsonins differ from the antigen-binding moieties of immunoglobulins in that the former are relatively invariant among members of the same species, and do not undergo diversification during the ontogeny of an individual.

[0018] A molecule containing a naturally occurring APC-binding moiety shall be considered an opsonin if it contains a moiety through which it can be stably bound or attached to a cell such that the APC-binding moiety is located in the extracellular space, whether or not the opsonin molecule contains its natural antigen-binding domain.

[0019] “Engineered opsonins”, as described herein, include molecules in which a cell surface binding moiety is substituted for the natural antigen-binding domain of an opsonin or where a cell surface binding moiety is linked to the opsonin without modification or removal of the natural antigen-binding domain of the opsonin.

[0020] A “cell surface binding moiety” is a moiety through which a molecule can be stably bound to a cell surface, e.g. a cell wall, a polysaccharide capsule, or the lipid or protein component of a plasma membrane, or to the surface of a virus. Such moieties include but are not limited to crosslinking moieties and lipid moieties. It is preferred that the cell surface binding moiety bind to a cell by a means other than interaction of a polypeptide with its cognate cell-surface polypeptide. It is further preferred that the cell surface binding moiety comprise a non-polypeptide moiety. In a preferred embodiment, a lipid moiety is linked to the engineered molecule via a glycosylphosphatidylinositol (GPI) moiety. In another preferred embodiment, the lipid comprises a fatty acid, e.g. palmitate. In yet another preferred embodiment of the invention, the cell surface binding moiety is linked to an opsonin or an antigen-binding domain-truncated opsonin at the antigen-binding end of the opsonin. In another preferred embodiment, the multifunctional molecule comprises an idiotypic portion of an immunoglobulin which can bind to an APC. Preferably, the opsonin of an opsonin-enhanced cell is one of alpha' chain C3b or mannose binding protein.

[0021] If the opsonin is a fragment of C3, it is preferred hat it bind to CR1 with a greater affinity than to CR2. It is further preferred that the fragment of C3 not be a ligand for CR2. Preferably, the opsonin is neither C3bi, C3d, nor C3dg.

[0022] It is preferred that the opsonins bind to receptors that trigger phagocytosis and that are non-clonotypic and thus do not vary from cell to cell as, for example, clonotypic receptors do. Non-clonotypic receptors are present on cells which play a role in innate immunity, and include, e.g., non-idiotypic receptors. Examples of such receptors include CR1, CR2, CR3, CR4, and C1q receptor, receptors containing a component of the C1q receptor, collectin receptors, receptors for &agr;2m, receptors for CRP, and Fc receptors for immunoglobulins.

[0023] “Exogenous” refers to something which is introduced from or produced outside the cell.

[0024] “Endogenous” refers to something which is expressed or present naturally in a cell.

[0025] “Heterologous” refers to something which is not naturally expressed in a cell.

[0026] Preferably, the multifunctional molecule which comprises first and second parts can bind, via the second part, to the surface or plasma membrane of an antigen presenting cell (APC), i.e. a cell that can present antigen to a T cell, e.g. a cell that can activate a T cell, at least in part by presenting antigen to the T cell. The APC may be a leukocyte, e.g. a cell of monocytic lineage and/or a dendritic cell. Preferably, binding of the multifunctional molecule is independent of expression of an idiotype, e.g. a clonotypic determinant of an immunoglobulin, on the APC. Most preferably, the multifunctional molecule comprises a first end which can bind to a cell that comprises an antigen and a second end which can bind to a APC.

[0027] The multifunctional molecule may bind to an antigen bearing target cell by, e.g., inserting into the lipid portion of a cell membrane or by binding to a structure, e.g. a polypeptide or a carbohydrate, that is physically associated with the lipid portion of the membrane. The structure need not be directly in contact with the lipid portion of the membrane, but may be indirectly attached, e.g. a carbohydrate that is part of a cell-surface glycoprotein. Preferably the multifunctional molecule can bind via a first part to an antigen bearing target, preferably a mammalian cell that comprises an antigen, and via a second part to an APC. The invention also encompasses the use of a molecule that can bind via a first part to a virus or to a non-mammalian cell, e.g. a fungal or bacterial cell, and via a second part to an APC. In the latter cases, the first part may bind, e.g., to a component of a cell wall or a capsule.

[0028] In a preferred embodiment, the multifunctional molecule which comprises first and second parts comprises a first part which comprises a lectin and a second part that can bind to a leukocyte, e.g. an APC, e.g. a cell of monocytic lineage or a dendritic cell (which may itself be of monocytic lineage). A “lectin”, according to the invention, is a molecule or part of a molecule, e.g. an amino acid sequence, which can bind to a carbohydrate, e.g. a polysaccharide. Families of naturally occurring lectins include:

[0029] 1) Galectins, a rapidly growing family of animal lectins. All of them share galactose-specificity.

[0030] 2) Calcium-dependent (C-type) animal lectins, an extremely large family composed of members having diverse structures and functions.

[0031] 3) Among this C-type lectin family, selectins form a distinguishable subfamily by their specific function in leukocyte adhesion to endothelial cells through sialyl-LewisX recognition.

[0032] 4) Collectins, another subfamily of C-type lectins specific for mannose, which have a unique structure consisting of a C-type lectin domain and a collagen-like domain. They are involved in innate immunity.

[0033] 5) Invertebrates are known to contain various lectins in their body fluids, probably as body-protection factors. Recently, some lectins from an echinoderm were found to show hemolytic activity.

[0034] 6) Annexins, a group of proteins having affinity to lipids that were recently shown to be lectins showing binding to glycosaminoglycans.

[0035] 7) The legume lectin family, which consists of a large number of members, such as ConA, with variable saccharide specificity comparable to C-type lectins.

[0036] 8) Ricin, the first lectin investigated in Russia more than 100 years ago. It is now evident that the ricin family has many other homologous members which differ in either toxicity or sugar-binding specificities.

[0037] Thus, a multifunctional molecule of the invention may bind to one or more carbohydrates. Carbohydrates to which lectins may bind also include, for example, carbohydrates comprising lactose, D-mannose, D-glucose, D-fucose, L-fucose (e.g. alpha-L-fucose), D-galactose, blood group A oligosaccharides, blood group B oligosaccharides, saccharides comprising alpha-D-Gal(1->3)[alpha-Lfuc(1->2)]-beta-D-Gal(1->3/4-beta-D-GlcNAc, saccharides comprising alpha-sialyl[2->3]-lactose, alpha-D-mannosyl glycoconjugates, alpha-NeuNAc-[2->6]-Gal, alpha-NeuNAc-[2->6]-GalNAc, alpha-NeuNAc-[2->3]-Gal, N-acetyl-beta-D-glucosamine, terminal alpha-D-galactosyl residues, terminal beta-D-galactosyl residues, N-acetyllactosamine, terminal alpha-D-mannosyl residues, N-acetyl-beta-D-glucosamine, terminal N-acetyl-D-galactosamine, N-acetylneuraminic acid, and terminal alpha-D-galactosaminyl residues.

[0038] The multifunctional molecule which comprises a lectin may comprise, for example, the whole of a naturally occurring lectin or a portion of a naturally occurring lectin, e.g about (or at least about) 5, 8, 10, 12, 15, 20, 25, 35, 50, 60, 70, 80, 100, or 120 contiguous amino acids of a naturally occurring polypeptide lectin. In one embodiment the multifunctional molecule comprises a carbohydrate-binding domain of a naturally occurring lectin, i.e., a portion of a lectin that can bind to a carbohydrate in the absence of the remainder of the lectin. In another embodiment the lectin may be non-naturally occurring, e.g. identified from an artificial library of molecules or designed by modifying the structure of a naturally occurring lectin.

[0039] Lectins known as “hemagglutinins” bind to carbohydrates on erythrocytes, e.g. blood group antigens, and when incubated with these cells cause them to aggregate. The influenza virus hemagglutinin, for example, binds to sialic acid (as does the human parainfluenza virus 3 hemagglutinin/neuraminidase). There are at least 15 known influenza hemagglutinin subtypes, defined by their distinct antigenic properties. Any of these subtypes, designated, e.g., H1, H2, H3, H4, H5, H6, H7, H8, H9, H10, H11, H12, H13, H14, and H15, may provide a sequences useful in the compositions and methods of the invention. In one embodiment of the invention, the hemagglutinin is of a subtype from a virus that infects humans, e.g. H1, H2, or H3. In another embodiment, the hemagglutinin is of a subtype from a virus that does not infect humans, e.g. one of H4 through H15. Amino acid sequences can vary up to about 20% for influenza hemagglutinins within a given subtype, and can vary between about 30% and about 70% for influenza hemagglutinins from different subtypes.

[0040] Influenza hemagglutinin is expressed as a single polypeptide chain, designated HA0, which trimerizes post-translationally. HA0 is proteolytically cleaved to yield two domains, HA1 and HA2, which are disulfide-bonded to each other. HA1 comprises significant sialic acid binding activity, while HA2 is anchored to the viral membrane and facilitates fusion of this membrane with a host cell membrane. In preferred embodiments of the invention, the multifunctional molecule comprising first and second parts comprises an amino acid sequence of an HA1 domain.

[0041] The molecule may be a fusion polypeptide which comprises one or more amino acids interposed between the first and second parts which bind to cells, e.g. a fusion polypeptide which comprises a first amino acid sequence which can bind to an antigen bearing target and a second amino acid sequence which can bind to a leukocyte, and which further comprises at least one amino acid interposed between the first and second parts. The interposed amino acids may comprise, e.g., a linker sequence intended to lessen steric hindrance or other undesirable interactions between the aforementioned first and second parts. For, example, one such type of sequence takes the form (Gly3Ser)n. Additional useful linkers include, but are not limited to (Arg-Ala-Arg-Asp-Pro-Arg-Val-Pro-Val-Ala-Thr)1-5 (Xu et al., 1999, Proc. Natl. Acad. Sci. U.S.A. 96: 151-156), (Gly-Ser)n(Shao et al., 2000, Bioconjug. Chem. 11: 822-826), (Thr-Ser-Pro)n(Kroon et al., 2000, Eur. J. Biochem. 267: 6740-6752), (Gly-Gly-Gly)n (Kluczyk et al., 2000, Peptides 21: 1411-1420), and (Glu-Lys)n (Klyczyk et al., 2000, supra), wherein n is 1 to 15 (each of the preceding references is also incorporated herein by reference). In another embodiment, no amino acids are interposed between the first and second parts.

[0042] The present invention further provides a nucleic acid molecule, preferably a recombinant nucleic acid molecule which encodes a multifunctional polypeptide of the present invention. The nucleic acid molecule may be,for example, DNA, RNA, cDNA, or mRNA. The nucleic acid molecule may be naturally occuring or may be partially or wholly synthesized using techniques known to those of skill in the art. In a preferred embodiment, the nucleic acid molecule is a DNA molecule comprising a first nucleic acid sequence encoding a first amino acid sequence which can bind to an antigen bearing target, and a second nucleic acid sequence encoding a second amino acid sequence which can bind to a cell surface receptor on an APC.

[0043] The present invention still further provides a vector comprising the nucleic acid molecule encoding a multifunctional polypeptide of the invention, e.g. an expression vector suitable for expressing in a host cell, wherein the host cell is preferably a eukaryotic cell, more preferably an animal cell, more preferably a mammalian cell, and still more preferably a human cell. In another preferred embodiment the host cell is a yeast cell, e.g. Saccharomyces cerevesiae.

[0044] The invention also provides a host cell comprising a nucleic acid vector which comprises a sequence encoding the multifunctional molecule of the present invention. Preferably, the host cell is a eukaryotic cell, such as a yeast cell- or an animal cell, preferably a human cell. The host cell may also be a prokaryotic cell.

[0045] The invention also encompasses a molecule, e.g. a polypeptide, e.g. a fusion polypeptide, which comprises a first part that can bind to an antigen bearing target, e.g. a cell, e.g. a cell that comprises an antigen, and a second part that can bind to a cell, e.g. a leukocyte, e.g. an APC. The molecule may have any of the characteristics taught in the descriptions of methods and compositions herein. Preferably the first and second parts are heterologous to each other. The molecule may be, e.g., a recombinant polypeptide expressed in a mammalian cell, an insect cell, a plant cell, a yeast cell, or a bacterial cell.

[0046] The invention also encompasses a method of modulating an immune response in an animal comprising the step of expressing in an animal, e.g. expressing in a host cell of the animal, a multifunctional molecule of the invention, e.g. a polypeptide which comprises a first part that can bind to a antigen bearing target and a second part that can bind to a cell. According to the invention, “expressing in an animal” means “causing to be present in an animal”. When the molecule is a polypeptide, it is preferably expressed by introducing into the host cell, in vivo or ex vivo, a nucleic acid encoding the polypeptide. If the nucleic acid is introduced into the host cell ex vivo, the host cell may subsequently be administered to the animal. In a preferred embodiment, the method further comprises administering to the animal the antigen to which the immune response is modulated. For example, the antigen may be administered to the animal as part of a composition which further comprises a nucleic acid that encodes the multifunctional molecule. In another preferred embodiment, the antigen is already present in the animal at the time the multifunctional molecule is expressed. In yet another preferred embodiment, the antigen is administered to the animal after administration of the multifunctional molecule. In still other preferred embodiments, the antigen is expressed in the animal, e.g. by administering to the animal a composition comprising a nucleic acid encoding the antigen, either before or after expression of the multifunctional molecule in the animal. In another embodiment, nucleic acid sequences encoding the multifunctional molecule and the antigen are introduced into one or more host cells of the animal, e.g. by administering to the animal a composition comprising those nucleic acid sequences.

[0047] As used herein, the term “modulating an immune response” to a selected antigen using the methods and compositions of the invention means rendering the response more or less efficient, more or less rapid, greater or lesser in magnitude, and/or more or less easily induced than the response obtained from administration of a composition which is identical in every respect except that it does not comprise a multifunctional molecule of the invention. In a preferred embodiment, the response is between about 5 and 100%, or preferably between about 5 and 50% or more preferably between about 5 and 25% more or less efficient, more or less rapid, greater or lesser in magnitude, and/or more or less easily induced than the response obtained from administration of a composition which is identical in every respect except that it does not comprise a multifunctional molecule of the invention.

[0048] The term “modulate the immune response” may refer to stimulation/activation of an immune response to a selected antigen, or it may refer to suppression, elimination, or attenuation of an immune response to a selected antigen. In a preferred embodiment, modulating the immune response results in stimulation/activation of an immune response to a selected antigen by about at least 5%, or preferably between 5 and 50% or more preferably between 50 and 100%, as compared to an immune response in the absence of vaccination, or it may result in suppression, elimination, or attenuation of an immune response to a selected antigen by about at least 5%, or preferably between 5 and 50% or more preferably between 50 and 100%, as compared to an immune response in the absence of vaccination. In some cases, one immune response to an antigen (e.g. a Th1 response) may be increased while another immune response to the same antigen (e.g. a Th2 response) may be diminished.

[0049] The invention also encompasses a composition comprising a multifunctional molecule of the invention and antigen bearing target, e.g. a virus, a prion, or a cell. Preferably, when the antigen bearing target is a cell, the multifunctional molecule is exogenous to the cell. The multifunctional molecule may be heterologous to the cell. In one embodiment, the multifunctional molecule is expressed within the cell, e.g. from a recombinant nucleic acid within the cell. The invention also encompasses a cell comprising a nucleic acid encoding a multifunctional molecule of the invention. The multifunctional molecule may have any of the characteristics set forth herein. An antigen bearing target (e.g., a cell) useful in the invention includes, for example, malignant cells, benign tumor cells, lymphocytes, e.g. B or T lymphocytes which may be pathogenic and/or autoreactive, cells expressing an antigen from an exogenously introduced nucleic acid molecule, eukaryotic cells such as mammalian cells, human cells, fibroblasts, insect and fungal cells, and prokaryotic cells such as bacterial cells. Examples of viruses useful in the invention include, e.g., retroviruses such as human immunodeficiency viruses 1 and 2; herpesviruses such as herpes simplex viruses 1 and 2, cytomegalovirus, and varicella zoster virus; human papilloma virus; rabies virus; rotavirus; influenza viruses A, B, and C; hepatitis viruses A, B, C, and E or delta agent; adenoviruses; measles virus; mumps virus; polio virus; rubella virus; parainflunza viruses; coxsackie viruses A and B; variola virus; yellow fever virus; dengue and other hemorrhagic fever viruses; West Nile fever virus; Eastern equine encephalitis virus; Western equine encephalitis virus; Venezuelan equine encephalitis virus; Japanese encephalitis virus; rhinoviruses; and foot and mouth disease virus. Prions include the agents of scrapie, kuru, and bovine spongiform encephalitis. The cell, virus, or prion may be attenuated, i.e. rendered non-pathogenic, by, e.g,, killing, irradiation, chemical fixation, passaging in culture with selection for diminished pathogenicity, or genetic manipulation. Preferably, the composition further comprises a leukocyte, e.g. a monocyte, a cell of monocytic lineage, a macrophage, or a dendritic cell or another APC.

[0050] Preferably, in the inventive methods and compositions, the cell is substantially unable to divide in vitro. “Substantially unable to divide in vitro” means that the cell divides at a rate that is less than about 50% of the rate of division of corresponding cells which are not treated to prevent cell division. In a preferred embodiment, the cell divides at a rate that is less than about 30-50% of the rate of division of corresponding cells which are not treated to prevent cell division.

[0051] Preferably, the composition is substantially free of culture medium. As used herein, “culture medium” refers to medium that is used in cell culture containing at least 2% animal serum, such as fetal calf serum.

[0052] More particularly, the present invention provides a multifunctional molecule which is a fusion polypeptide comprising: a lectin which comprises at least about 10 contiguous amino acids of an influenza virus hemagglutinin, and at least about 5 contiguous amino acids of a naturally occurring GM-CSF molecule.

[0053] In one embodiment, the lectin is N-terminal to the contiguous amino acids of a naturally occurring GM-CSF molecule.

[0054] In an alternate embodiment, the lectin is C-terminal to the contiguous amino acids of a naturally occurring GM-CSF molecule.

[0055] In one embodiment, the lectin comprises at least about 10 contiguous amino acids of the HA1 domain of an influenza virus hemagglutinin.

[0056] In one embodiment, the lectin is the HA1 domain of an influenza virus hemagglutinin.

[0057] Preferably, the influenza virus hemagglutinin is a hemagglutinin of an influenza A virus. In other preferred embodiments the influenza virus hemagglutinin is a hemagglutinin of an influenza B or influenza C virus.

[0058] In one embodiment, the influenza virus hemagglutinin is of a subtype from a virus that infects humans. Preferably, the influenza virus hemagglutinin is of an H1 subtype. Still more preferably, the influenza virus hemagglutinin is from the influenza A strain PR/8/34.

[0059] In one embodiment, the influenza virus hemagglutinin is of an H2 subtype.

[0060] In one embodiment, the influenza virus hemagglutinin is of an H3 subtype.

[0061] In one embodiment, the influenza virus hemagglutinin is of a subtype from a virus that does not infect humans.

[0062] In one embodiment the fusion polypeptide comprises the entire amino acid sequence of a naturally occurring GM-CSF molecule.

[0063] Preferably, the GM-CSF molecule is a murine GM-CSF. Still more preferably, the GM-CSF molecule is a human GM-CSF.

[0064] In one aspect, the invention encompasses a method of reducing the number of metastases, e.g. tumor metastases, in a subject, e.g. a mammal, e.g. a human, comprising the step of administering to the subject any of the compositions described herein, e.g. a composition comprising a multifunctional molecule of the invention or a nucleic acid molecule encoding a multifunctional molecule of the invention. Typically, such a composition will further comprise an antigen associated with the disease, or a nucleic acid encoding such an antigen. The method may comprise any of the methods of administering a composition, modulating an immune response, or treating a disease described herein.

[0065] The invention provides, a method of reducing the number of metastasis in an animal comprising administering to said animal a composition comprising a cell comprising an antigen, said composition further comprising a fusion protein comprising a lectin and a ligand for a cell surface protein.

[0066] As used herein, a “metastasis” refers to a focus of disease that is caused by a malignent cell or infectious organism which has traveled from one site in a host to a second site in the host (e.g., from one site to a non-contiguous site; e.g., from a first organ to a second organ). More specifically, “metastasis” refers to a detectable focus of malignant tumor or infection that is derived from, and spread from, and is distinct from the primary site of disease. Accordingly, “metastases” refers to a plurality of foci either in a single organ or tissue in a subject, or in two or more organs or tissues in a subject. A “focus” as used herein may be at least a single malignant or infectious cell, or may be a detectable focus, which is detectable by one or more of the methods described hereinbelow. Metastases is said to be detected where a metastases is able to be detected by one of skill in the art using one or more of the assay methods described hereinbelow.

[0067] According to the invention, “reducing the number of metastases” may mean either causing there to be fewer (e.g., at least 10% fewer, 20%, 30%, 50%, 70%, 90%, and up to at least 100% fewer) metastases than expected (where the number or severity of metastases expected is based on the observations made in a set (e.g., more than one) or similar subjects which has not received the multifunctional molecule of the invention). In one embodiment “reducing the number of metastases” may encompass preventing metastases (e.g. a subject does not develop any detectable foci of disease), e.g. in a subject with a tumor, or causing one or more preexisting metastases to become undetectable, e.g. by radiologic, non-invasive imaging techniques, or other techniques as described herein. Those skilled in the art will recognize that a metastasis itself may become undetectable even though residual scarring or fibrosis may be detectable. Metastases may be, for example, to bone, brain, liver, lung, or spinal cord, or any other organ or tissue.

[0068] In another aspect, the invention encompasses a method of reducing the number of metastases in a population of subjects comprising the step of administering to one or more subjects any of the compositions described herein e.g. a composition comprising a multifunctional molecule of the invention or a nucleic acid molecule encoding a multifunctional molecule of the invention. Typically, such a composition will further comprise an antigen associated with the disease, or a nucleic acid encoding such an antigen. The method may comprise any of the methods of administering a composition, modulating an immune response, or treating a disease described herein.

[0069] In another aspect, the invention encompasses a method of reducing the size of a metastasis in a subject comprising the step of administering to the subject any of the compositions described herein, e.g. a composition comprising a multifunctional molecule of the invention or a nucleic acid molecule encoding a multifunctional molecule of the invention. Typically, such a composition will further comprise an antigen associated with the disease, or a nucleic acid encoding such an antigen. The method may comprise any of the methods of administering a composition, modulating an immune response, or treating a disease described herein. The “size” of a metastasis, as used herein refers to the one, two or three dimensional area encompassed by a metastasis, or alternatively, refers to the number of malignant or infectious cells present in a metastasis. The size of the metastasis, which may be measured by direct visualization or by noninvasive imaging, may be reduced by, e.g., at least about 10%, at least about 20%, 30%, 50%, 70%, 90%, and up to at least 100%.

[0070] The invention provides a method of reducing the size of a metastasis in an animal comprising administering to said animal a composition comprising a cell comprising an antigen, said composition further comprising a fusion protein comprising a lectin and a ligand for a cell surface protein.

[0071] In another aspect, the invention encompasses a method of reducing the average size of metastases in a subject comprising the step of administering to the subject any of the compositions described herein. The method may comprise any of the methods of administering a composition, modulating an immune response, or treating a disease described herein. According to the invention, “reducing the average size of metastases” may mean either causing metastases to be smaller on average than expected, e.g. by preventing one or more of them from growing to the expected size, or causing one or more preexisting metastases to become smaller, thus decreasing the mean size of the metastases. The average size of the metastases, which may be determined by direct visualization or by noninvasive imaging, may be reduced by, e.g., at least about 10%, at least about 20%, 30%, 50%, 70%, 90%, and up to at least 100%.

[0072] In another aspect, the invention encompasses a method of reducing the average size of metastases in a population comprising the step of administering to one or more subjects any of the compositions described herein, e.g. a composition comprising a multifunctional molecule of the invention or a nucleic acid molecule encoding a multifunctional molecule of the invention. The method may comprise any of the methods of administering a composition, modulating an immune response, or treating a disease described herein.

[0073] Thus, in another aspect the invention encompasses preventing or treating a disease in a subject by administering to the subject any of the compositions described herein, e.g. a composition comprising a multifunctional molecule of the invention or a nucleic acid molecule encoding a multifunctional molecule of the invention. Typically, such a composition will further comprise an antigen associated with the disease, or a nucleic acid encoding such an antigen. The disease may be, for example, a benign or malignant tumor, an infectious disease, an allergy, or an autoimmune disease. “Treating a disease” means decreasing morbidity or mortality associated with the disease in a patient or population afflicted with the disease. For example, survival, relapse-free survival, or disease-free survival may be prolonged by, e.g., at least about 10%, at least about 20%, 30%, 50%, 70%, 90%, and up to at least 100%, or the number of metastases may be reduced by, e.g., at least about 10%, at least about 20%, 30%, 50%, 70%, 90%, and up to at least 100%. For preventive applications, the incidence of the targeted disease may be reduced by, e.g., at least about 10%, at least about 20%, 30%, 50%, 70%, 90%, and up to at least 100%.

[0074] In yet another aspect, the invention encompasses a method of modulating an immune response to an antigen in a subject, e.g. a mammal, e.g. a human, comprising the steps of 1) administering to the subject a composition comprising the antigen and further comprising a multifunctional molecule of the invention and 2) administering to the subject a composition comprising the antigen and not comprising (i.e. free of) the multifunctional molecule administered in step 1. Generally, the two steps will be performed sequentially, e.g. at least 1 day apart, or at least 1 week apart, or at least 1 month apart, or at least 6 months apart, or at least 1 year apart. In one embodiment, the composition comprising the multifunctional molecule is administered to the subject prior to the composition which is free of the multifunctional molecule. In another embodiment, the composition which is free of the multifunctional molecule is administered to the subject prior to the composition which comprises the multifunctional molecule. The antigen of the composition may be comprised by an antigen bearing target such as a cell, a cell fraction, a virus, or a viral particle.

[0075] In yet another aspect, the invention encompasses a method of modulating an immune response to an antigen in a subject, e.g. a mammal, e.g. a human, comprising the steps of 1) administering to the subject a composition comprising the antigen and further comprising a nucleic acid molecule encoding a multifunctional molecule of the invention and 2) administering to the subject a composition comprising the antigen and not comprising (i.e. free of) the nucleic acid molecule administered in step 1. Again, the two steps will generally be performed sequentially, e.g. at least 1 day apart, or at least 1 week apart, or at least 1 month apart, or at least 6 months apart, or at least 1 year apart. In one embodiment, the composition comprising the nucleic acid molecule is administered to the subject prior to the composition which is free of the nucleic acid molecule. In another embodiment, the composition which is free of the nucleic acid molecule is administered to the subject prior to the composition which comprises the nucleic acid molecule. The antigen of the composition may be comprised by an antigen bearing target such as a cell, a cell fraction, a virus, or a viral particle. The nucleic acid molecule may be comprised by an expression vector.

[0076] In yet another aspect, the invention encompasses a method of modulating an immune response to an antigen in a subject, e.g. a mammal, e.g. a human, comprising the steps of 1) administering to the subject a composition comprising a nucleic acid molecule encoding the antigen and further comprising a multifunctional molecule of the invention and 2) administering to the subject a composition comprising a nucleic acid molecule encoding the antigen and not comprising (i.e. free of) the multifunctional molecule administered in step 1. Generally, the two steps will be performed sequentially, e.g. at least 1 day apart, or at least 1 week apart, or at least 1 month apart, or at least 6 months apart, or at least 1 year apart. In one embodiment, the composition comprising the multifunctional molecule is administered to the subject prior to the composition which is free of the multifunctional molecule. In another embodiment, the composition which is free of the multifunctional molecule is administered to the subject prior to the composition which comprises the multifunctional molecule. The antigen of the composition may be comprised by an antigen bearing target such as a cell, a cell fraction, a virus, or a viral particle. One or more of the nucleic acid molecules may be comprised by an expression vector.

[0077] In yet another aspect, the invention encompasses a method of modulating an immune response to an antigen in a subject, e.g. a mammal, e.g. a human, comprising the steps of 1) administering to the subject a composition comprising the antigen and further comprising a multifunctional molecule of the invention and 2) administering to the subject a composition comprising a nucleic acid molecule encoding the antigen and not comprising (i.e. free of) the multifunctional molecule administered in step 1. Generally, the two steps will be performed sequentially, e.g. at least 1 day apart, or at least 1 week apart, or at least 1 month apart, or at least 6 months apart, or at least 1 year apart. In one embodiment, the composition comprising the multifunctional molecule is administered to the subject prior to the composition which is free of the multifunctional molecule. In another embodiment, the composition which is free of the multifunctional molecule is administered to the subject prior to the composition which comprises the multifunctional molecule. The antigen of the composition may be comprised by an antigen bearing target such as a cell, a cell fraction, a virus, or a viral particle. The nucleic acid molecule may be comprised by an expression vector.

[0078] In yet another aspect, the invention encompasses a method of modulating an immune response to an antigen in a subject, e.g. a mammal, e.g. a human, comprising the steps of 1) administering to the subject a composition comprising a nucleic acid molecule encoding the antigen and further comprising a multifunctional molecule of the invention and 2) administering to the subject a composition comprising the antigen and not comprising (i.e. free of) the multifunctional molecule administered in step 1. Generally, the two steps will be performed sequentially, e.g. at least 1 day apart, or at least 1 week apart, or at least 1 month apart, or at least 6 months apart, or at least 1 year apart. In one embodiment, the composition comprising the multifunctional molecule is administered to the subject prior to the composition which is free of the multifunctional molecule. In another embodiment, the composition which is free of the multifunctional molecule is administered to the subject prior to the composition which comprises the multifunctional molecule. The antigen of the composition may be comprised by an antigen bearing target such as a cell, a cell fraction, a virus, or a viral particle. The nucleic acid molecule may be comprised by an expression vector.

[0079] In yet another aspect, the invention encompasses a method of modulating an immune response to an antigen in a subject, e.g. a mammal, e.g. a human, comprising the steps of 1) administering to the subject a composition comprising a nucleic acid molecule encoding the antigen and further comprising a nucleic acid molecule encoding a multifunctional molecule of the invention and 2) administering to the subject a composition comprising a nucleic acid molecule encoding the antigen and not comprising (i.e. free of) the nucleic acid molecule encoding the multifunctional molecule, which was administered in step 1. Again, the two steps will generally be performed sequentially, e.g. at least 1 day apart, or at least I week apart, or at least 1 month apart, or at least 6 months apart, or at least 1 year apart. In one embodiment, the composition comprising the nucleic acid molecule is administered to the subject prior to the composition which is free of the nucleic acid molecule encoding the multifunctional molecule. In another embodiment, the composition which is free of the nucleic acid molecule encoding the multifunctional molecule is administered to the subject prior to the composition which comprises the nucleic acid molecule encoding the multifunctional molecule. One or more of the nucleic acid molecules may be comprised by an expression vector.

[0080] In yet another aspect, the invention encompasses a method of modulating an immune response to an antigen in a subject, e.g. a mammal, e.g. a human, comprising the steps of 1) administering to the subject a composition comprising a nucleic acid molecule encoding the antigen and further comprising a nucleic acid molecule encoding a multifunctional molecule of the invention and 2) administering to the subject a composition comprising a nucleic acid molecule encoding the antigen and further comprising a multifunctional molecule of the invention. The multifunctional molecules of step 1 and step 2 may be the same or different. Again, the two steps will generally be performed sequentially, e.g. at least 1 day apart, or at least 1 week apart, or at least 1 month apart, or at least 6 months apart, or at least 1 year apart. In one embodiment, the composition comprising the nucleic acid molecule is administered to the subject prior to the composition which is free of the nucleic acid molecule encoding the multifunctional molecule. In another embodiment, the composition which is free of the nucleic acid molecule encoding the multifunctional molecule is administered to the subject prior to the composition which comprises the nucleic acid molecule encoding the multifunctional molecule. One or more of the nucleic acid molecules may be comprised by an expression vector.

[0081] In yet another aspect, the invention encompasses a method of modulating an immune response to an antigen in a subject, e.g. a mammal, e.g. a human, comprising the steps of 1) administering to the subject a composition comprising a nucleic acid molecule encoding the antigen and further comprising a multifunctional molecule of the invention and 2) administering to the subject a composition comprising a nucleic acid molecule encoding the antigen and further comprising a nucleic acid molecule encoding a multifunctional molecule of the invention. The multifunctional molecules of step 1 and step 2 may be the same or different. Again, the two steps will generally be performed sequentially, e.g. at least 1 day apart, or at least 1 week apart, or at least 1 month apart, or at least 6 months apart, or at least 1 year apart. In one embodiment, the composition comprising the nucleic acid molecule is administered to the subject prior to the composition which is free of the nucleic acid molecule encoding the multifunctional molecule. In another embodiment, the composition which is free of the nucleic acid molecule encoding the multifunctional molecule is administered to the subject prior to the composition which comprises the nucleic acid molecule encoding the multifunctional molecule. One or more of the nucleic acid molecules may be comprised by an expression vector.

[0082] The present invention encompasses a method of modulating an immune response in an animal comprising the step of administering a composition comprising a multifunctional molecule, e.g. a polypeptide, e.g. a fusion polypeptide, which comprises a first part that can bind to a antigen bearing target and a second part that can bind to a cell. In a preferred embodiment, the composition further comprises an antigen, an immune response to which is modulated by administration of the composition. The antigen may be, for example, a polypeptide (e.g. a recombinant polypeptide), a lipid (e.g. a glycolipid), or a carbohydrate (e.g. a polysaccharide or a component of a bacterial or fungal cell wall). The composition therefore comprises an antigen bearing target, whether, e.g., a homogeneous antigen or a heterogeneous structure such as a cell or a virus. When the antigen bearing target is a cell, it may be autologous, syngeneic, allogeneic, or xenogeneic to the animal. In other preferred embodiments, the antigen is already present in the animal at the time the molecule is administered, and/or the antigen is administered to the animal prior to administration of the molecule. In yet another preferred embodiment, the antigen is administered to the animal after administration of the molecule.

[0083] Preferably, the composition comprises multifunctional molecules which are not bound to an antigen bearing target. In a preferred embodiment, the composition further comprises an antigen bearing target, e.g. a cell. In one embodiment of the invention, the composition comprises multifunctional molecules, some of which are bound to a antigen bearing target, e.g. to the surface of a cell, and some of which are external to and not bound to any target. In another embodiment, the composition comprises a multifunctional molecule and further comprises a portion of a cell, e.g. a membrane fraction of a cell (i.e., an antigen bearing target). In yet another embodiment, the composition comprises a multifunctional molecule and further comprises a multiplicity of different molecules derived from a cell, as is found, e.g., in a cell lysate. Cells may be lysed, for example, by freezing and thawing, preferably repeatedly. In a preferred embodiment, the composition is cell-free.

[0084] The present invention further encompasses a method of vaccinating a mammal to a selected antigen comprising administering to the animal a vaccine composition comprising a multifunctional molecule of the invention comprising a first part which is a lectin, and a second part which is a ligand for a cell surface protein, e.g. a cell surface receptor of an APC. Preferably, the lectin can bind to an antigen bearing target which comprises the antigen.

[0085] In one embodiment, the invention provides a method of vaccinating a mammal to a selected antigen comprising removing at least one cell from the mammal, wherein the cell comprises the antigen, contacting the cell ex vivo with a multifunctional molecule comprising a first part which is a lectin and is capable of binding to at least one carbohydrate molecule on the surface of the antigen bearing cell, and a second part which is a ligand for a cell surface protein of an APC, so as to form an antigen bearing cell/multifunctional molecule complex; and placing the complex back into the mammal.

[0086] In a preferred embodiment, the composition comprises an antigen, an immune response to which is modulated by administration of the composition.

[0087] The invention provides a method of modulating an immune response to a selected antigen in a mammal comprising administering to said animal a composition comprising a cell comprising said antigen, and a multifunctional molecule comprising a lectin and a ligand for a cell surface protein.

[0088] The invention also relates to a method of vaccinating an animal to a selected antigen comprising removing at least one cell from said animal, wherein the cell comprises said antigen; contacting said cell ex vivo with a fusion polypeptide comprising a lecting and a ligand for a cell surface protein of an antigen presenting cell so as to form a complex; and placing said complex back in said animal.

[0089] The present invention provides a method for juxtaposing an APC with an antigen bearing target comprising: contacting an APC and antigen bearing target with a multifunctional molecule comprising a first part comprising a lectin which is able to bind to at least one carbohydrate moiety on the antigen bearing target and a second part comprising a ligand for a cell surface protein on the APC. Preferably, the multifunctional molecule is first contacted with the antigen bearing target and the resulting antigen bearing target/multifunctional molecule complex is subsequently contacted with the APC. In one embodiment the antigen bearing target is a cell from an animal comprising an antigen, and is contacted with the multifunctional molecule ex vivo under conditions which permit the binding of the lectin to at least one carbohydrate moiety of the cell. The resulting multifunctional molecule/antigen bearing cell complex is then administered back to the animal from which the antigen bearing cell was derived wherein it is able to bind to a cell surface receptor on an APC via the ligand portion of the multifunctional molecule, thereby juxtaposing the antigen bearing target and the APC.

[0090] “Juxtaposition”, in the context of the present invention, includes but is not limited to physical contact. An APC and antigen bearing target are “juxtaposed” with one another if they are sufficiently close for the APC to internalize the antigen bearing target. An APC and antigen bearing target are also “juxtaposed” if they are separated by no more that 20 &mgr;m, preferably no more than 10 &mgr;m, and still more preferably no more than 5 &mgr;m, and more preferably no more than 1 &mgr;m.

[0091] As used herein, “contacting” refers to admixing in vitro or in vivo.

[0092] The invention also encompasses a method of modulating an immune response to an antigen comprising contacting in vitro an antigen bearing target, a multifunctional molecule of the invention, and an APC and administering the resultant composition to a subject. In one embodiment the antigen bearing target/multifunctional molecule complex is contacted with an APC for a time sufficient to permit internalization of the antigen bearing target by the APC. In other embodiments the antigen bearing target/multifunctional molecule complex is contacted with an APC for a time that allows internalization of less than about 80%, less than about 60%, less than about 40%, less than about 20%, less than about 10%, or less than about 5% of the antigen bearing target by the APC. Methods for determining the amount of target internalized, e.g. by measuring the amount remaining outside the APC and subtracting from the starting amount, are well-known in the art. Preferably, the antigen bearing target/multifunctional molecule complex is contacted with an APC for less than about 10 minutes, less than about 30 minutes, less than about 60 minutes, less than about 90 minutes, less than about 120 minutes, or less than about 180 minutes.

[0093] As used herein, “time sufficient to permit internalization” refers to a period of time that is of a sufficient duration to allow internalization of the selected antigen or antigen bearing targtet by the APC (for example, no more than about fourteen days, or seven days, or five or three days, or as little as about 24, 12, 6, 3, 2 or 1 hour, or even as little as about 30, 20, 10, 5, or 1 minute).

[0094] The invention also encompasses a method of attaching a ligand for a cell surface polypeptide to an antigen bearing target comprising admixing the antigen bearing target with a multifunctional molecule which comprises the ligand. The invention also encompasses a method of attaching an amino acid sequence to an antigen bearing target comprising admixing the antigen bearing target with a fusion polypeptide which comprises the amino acid sequence and further comprises a lectin. The invention also encompasses a composition comprising an antigen bearing target admixed with a fusion polypeptide which comprises a first amino acid sequence which is not a lectin and a second amino acid sequence which comprises a lectin.

[0095] The invention also comprises methods of producing a multifunctional molecule of the invention in each of the following cell types: a yeast cell, a mammalian cell, a bacterial cell, an insect cell. Each of these methods comprises the step of introducing a nucleic acid encoding a multifunctional molecule into the respective cell type, as taught hereinbelow.

[0096] The invention also encompasses methods of detecting or quantifying a multifunctional molecule of the invention comprising contacting the multifunctional molecule with an antibody or other ligand that binds to the multifunctional molecule. Such methods include ELISA assays and flow cytometry, as described hereinbelow. Preferably, the multifunctional molecule to be detected or quantitated is bound to an antigen bearing target.

DETAILED DESCRIPTION

[0097] The present invention is based, in part, on the discovery that a multifunctional fusion protein comprising a first polypeptide which is a lectin and a second polypeptide which is a ligand of a cell surface receptor of an APC, can effectively target an antigen bearing target, such as a cell bearing an antigen of interest, to an APC, wherein the antigen is engulfed by the APC, and an appropriate immune response to the antigen is mounted by an animal to which the multifunctional molecule is administered.

[0098] Accordingly, the present invention provides a method for vaccinating a mammal comprising administering to the animal a vaccine composition comprising a multifunctional molecule of the invention comprising a first part which is a lectin and which can bind to a target bearing the antigen, and a second part which is a ligand for a cell surface protein of an APC. In one embodiment, the method comprises removing at least one cell from the mammal, wherein the cell comprises the antigen, contacting the cell ex vivo with a multifunctional molecule comprising a first part which is a lectin and is capable of binding to at lease one carbohydrate molecule on the surface of the antigen bearing cell, and a second part which is a ligand for a cell surface protein of an APC, so as to form an antigen bearing cell/multifunctional molecule complex; and placing the complex back into the mammal.

[0099] Multifunctional Molecules

[0100] The present invention encompasses a multifunctional molecule comprising a first part which can bind to an antigen bearing target, and a second part which is a ligand for a cell surface protein of a cell, e.g. an antigen presenting cell. Preferably, the first part which can bind to an antigen bearing target is a lectin which binds to at least one carbohydrate molecule present on the antigen bearing target. Preferably the lectin is an influenza hemagglutinin and binds to sialic acid residues present on the antigen bearing target. Preferably, the ligand of a cell surface protein of an antigen presenting cell is selected from an opsonin, a cytokine, a ligand for a CD40 molecule, an adhesion molecule, a defensin, a heat shock protein, or a counterreceptor for a T cell costimulatory molecule. Cell surface molecules which can act as receptors for the second part of the multifunctional molecule include CD40 molecules and specific receptors for an opsonin, a cytokine, an adhesion molecule, a defensin, a heat shock protein, or a counterreceptor for a T cell costimulatory molecule, and also include, but are not limited to the cell surface molecules listed in Apendix I and II.

[0101] Lectins

[0102] The multifunctional molecule which comprises first and second parts can comprise a first part which comprises a lectin and a second part that can bind to a leukocyte, e.g. an APC, e.g. a cell of monocytic lineage or a dendritic cell (which may itself be of monocytic lineage). A “lectin”, according to the invention, is a molecule or part of a molecule, e.g. an amino acid sequence, which can bind to a carbohydrate, e.g. a polysaccharide. Families of naturally occurring lectins include:

[0103] 1) Galectins, a rapidly growing family of animal lectins. All of them share galactose-specificity.

[0104] 2) Calcium-dependent (C-type) animal lectins, an extremely large family composed of members having diverse structures and functions.

[0105] 3) Among this C-type lectin family, selectins form a distinguishable subfamily by their specific function in leukocyte adhesion to endothelial cells through sialyl-LewisX recognition.

[0106] 4) Collectins, another subfamily of C-type lectins specific for mannose, which have a unique structure consisting of a C-type lectin domain and a collagen-like domain. They are involved in innate immunity.

[0107] 5) Invertebrates are known to contain various lectins in their body fluids, probably as body-protection factors. Recently, some lectins from an echinoderm were found to show hemolytic activity.

[0108] 6) Annexins, a group of proteins having affinity to lipids that were recently shown to be lectins showing binding to glycosaminoglycans.

[0109] 7) The legume lectin family, which consists of a large number of members, such as ConA, with variable saccharide specificity comparable to C-type lectins.

[0110] 8) Ricin, the first lectin investigated in Russia more than 100 years ago. It is now evident that the ricin family has many other homologous members which differ in either toxicity or sugar-binding specificities.

[0111] Thus, a multifunctional molecule of the invention may bind to one or more carbohydrates. Carbohydrates to which lectins may bind also include, for example, carbohydrates comprising lactose, D-mannose, D-glucose, D-fucose, L-fucose (e.g. alpha-L-fucose), D-galactose, blood group A oligosaccharides, blood group B oligosaccharides, saccharides comprising alpha-D-Gal(1->3)[alpha-Lfuc(1->2)]-beta-D-Gal(1->3/4-beta-D-GlcNAc, saccharides comprising alpha-sialyl-[2->3]-lactose, alpha-D-mannosyl glycoconjugates, alpha-NeuNAc-[2->6]-Gal, alpha-NeuNAc-[2->6]-GalNAc, alpha-NeuNAc-[2->3]-Gal, N-acetyl-beta-D-glucosamine, terminal alpha-D-galactosyl residues, terminal beta-D-galactosyl residues, N-acetyllactosamine, terminal alpha-D-mannosyl residues, N-acetyl-beta-D-glucosamine, terminal N-acetyl-D-galactosamine, N-acetylneuraminic acid, and terminal alpha-D-galactosaminyl residues.

[0112] The multifunctional molecule which comprises a lectin may comprise, for example, the whole of a naturally occurring lectin or a portion of a naturally occurring lectin, e.g about (or at least about) 5, 8, 10, 12, 15, 20, 25, 35, 50, 60, 70, 80, 100, or 120 contiguous amino acids of a naturally occurring polypeptide lectin. In one embodiment the multifunctional molecule comprises a carbohydrate-binding domain of a naturally occurring lectin, i.e., a portion of a lectin that can bind to a carbohydrate in the absence of the remainder of the lectin. In another embodiment the lectin may be non-naturally occurring, e.g. identified from an artificial library of molecules or designed by modifying the structure of a naturally occurring lectin.

[0113] Lectins known as “hemagglutinins” bind to carbohydrates on erythrocytes, e.g. blood group antigens, and when incubated with these cells cause them to aggregate. The influenza virus hemagglutinin, for example, binds to sialic acid. There are at least 15 known influenza hemagglutinin subtypes, defined by their distinct antigenic properties. Any of these subtypes, designated, e.g., H1, H2, H3, H4, H5, H6, H7, H8, H9, H10, H11, H12, H13, H14, and H15, may provide amino acid sequences useful in the compositions and methods of the invention. In one embodiment of the invention, the hemagglutinin is of a subtype from a virus that infects humans, e.g. H1, H2, or H3. In another embodiment, the hemagglutinin is of a subtype from a virus that does not infect humans, e.g. one of H4 through H15. Amino acid sequences can vary up to about 20% for influenza hemagglutinins within a given subtype, and can vary between about 30% and about 70% for influenza hemagglutinins from different subtypes. Methods for determining amino acid sequence homology are known to those of skill in the art. Examples of other software that can perform sequence comparisons to determine the % identity between hemagglutanin variants (or variants of any portion of the multifunctional molecules disclosed herein) include, but are not limited to, the BLAST package (Ausubel et al., 1995, Short Protocols in Molecular Biology, 3rd Edition, John Wiley & Sons), FASTA (Atschul et al., 1990, J. Mol. Biol., 403-410) and the GENEWORKS suite of comparison tools. Both BLAST and FASTA are available for offline and online searching.

[0114] Although the final % homology can be measured in terms of identity, the alignment process itself is typically not based on an all-or-nothing pair comparison. Instead, a scaled similarity score matrix is generally used that assigns scores to each pairwise comparison based on chemical similarity or evolutionary distance. An example of such a matrix commonly used is the BLOSUM62 matrix the default matrix for the BLAST suite of programs. GCG Wisconsin programs generally use either the public default values or a custom symbol comparison table if supplied. It is preferred to use the public default values for the GCG package, or in the case of other software, the default matrix, such as BLOSUM62.

[0115] Advantageously, the BLAST algorithm is employed, with parameters set to default values. The BLAST algorithm is described in detail in Altschul et al., (1990) J. Mol. Biol. 215:403-410, which is incorporated herein by reference. The search parameters are defined as follows, and can be advantageously set to the defined default parameters.

[0116] Advantageously, “substantial identity” when assessed by BLAST equates to sequences which match with an EXPECT value of at least about 7, preferably at least about 9 and most preferably 10 or more. The default threshold for EXPECT in BLAST searching is usually 10.

[0117] BLAST (Basic Local Alignment Search Tool) is the heuristic search algorithm employed by the programs blastp, blastn, blastx, tblastn, and tblastx; these programs ascribe significance to their findings using the statistical methods of Karlin and Altschul (Karlin and Altschul 1990, Proc. Natl. Acad. Sci. USA 87:2264-68; Karlin and Altschul, 1993, Proc. Natl. Acad. Sci. USA 90:5873-7) with a few enhancements. The BLAST programs are tailored for sequence similarity searching, for example to identify homologues to a query sequence. For a discussion of basic issues in similarity searching of sequence databases, see Altschul et al (1994) Nature Genetics 6:119-129.

[0118] The five BLAST programs available through the National Institutes of Health (NIH;

[0119] Bethesda, Md.) perform the following tasks: blastp compares an amino acid query sequence against a protein sequence database; blastn compares a nucleotide query sequence against a nucleotide sequence database; blastx compares the six-frame conceptual translation products of a nucleotide query sequence (both strands) against a protein sequence database; tblastn compares a protein query sequence against a nucleotide sequence database dynamically translated in all six reading frames (both strands); tblastx compares the six-frame translations of a nucleotide query sequence against the six-frame translations of a nucleotide sequence database.

[0120] BLAST uses the following search parameters:

[0121] HISTOGRAM—Display a histogram of scores for each search; default is yes. (See parameter H in the BLAST Manual).

[0122] DESCRIPTIONS—Restricts the number of short descriptions of matching sequences reported to the number specified; default limit is 100 descriptions. (See parameter V in the manual page).

[0123] EXPECT—The statistical significance threshold for reporting matches against database sequences; the default value is 10, such that 10 matches are expected to be found merely by chance, according to the stochastic model of Karlin and Altschul (1990). If the statistical significance ascribed to a match is greater than the EXPECT threshold, the match will not be reported. Lower EXPECT thresholds are more stringent, leading to fewer chance matches being reported. Fractional values are acceptable. (See parameter E in the BLAST Manual).

[0124] CUTOFF—Cutoff score for reporting high-scoring segment pairs. The default value is calculated from the EXPECT value (see above). HSPs are reported for a database sequence only if the statistical significance ascribed to them is at least as high as would be ascribed to a lone HSP having a score equal to the CUTOFF value. Higher CUTOFF values are more stringent, leading to fewer chance matches being reported. (See parameter S in the BLAST Manual). Typically, significance thresholds can be more intuitively managed using EXPECT.

[0125] ALIGNMENTS—Restricts database sequences to the number specified for which high-scoring segment pairs (HSPs) are reported; the default limit is 50. If more database sequences than this happen to satisfy the statistical significance threshold for reporting (see EXPECT and CUTOFF below), only the matches ascribed the greatest statistical significance are reported. (See parameter B in the BLAST Manual).

[0126] MATRIX—Specify an alternate scoring matrix for BLASTP, BLASTX, TBLASTN and TBLASTX. The default matrix is BLOSUM62 (Henikoff & Henikoff, 1992). The valid alternative choices include: PAM40, PAM120, PAM250 and IDENTITY. No alternate scoring matrices are available for BLASTN; specifying the MATRIX directive in BLASTN requests returns an error response.

[0127] STRAND—Restrict a TBLASTN search to just the top or bottom strand of the database sequences; or restrict a BLASTN, BLASTX or TBLASTX search to just reading frames on the top or bottom strand of the query sequence.

[0128] FILTER—Mask off segments of the query sequence that have low compositional complexity, as determined by the SEG program of Wootton & Federhen (1993) Computers and Chemistry 17:149-163, or segments consisting of short-periodicity internal repeats, as determined by the XNU program of Claverie & States (1993) Computers and Chemistry 17:191-201, or, for BLASTN, by the DUST program of Tatusov and Lipman (NIH). Filtering can eliminate statistically significant but biologically uninteresting reports from the blast output (e.g., hits against common acidic-, basic- or proline-rich regions), leaving the more biologically interesting regions of the query sequence available for specific matching against database sequences.

[0129] Low complexity sequence found by a filter program is substituted using the letter “N” in nucleotide sequence (e.g., “NNNNNNNNNNNNN”) and the letter “X” in protein sequences (e.g., “XXXXXXXXX”).

[0130] Filtering is only applied to the query sequence (or its translation products), not to database sequences. Default filtering is DUST for BLASTN, SEG for other programs.

[0131] It is not unusual for nothing at all to be masked by SEG, XMU, or both, when applied to sequences in SWISS-PROT, so filtering should not be expected to always yield an effect. Furthermore, in some cases, sequences are masked in their entirety, indicating that the statistical significance of any matches reported against the unfiltered query sequence should be suspect.

[0132] NCBI-gi—Causes NCBI gi identifiers to be shown in the output, in addition to the accession and/or locus name.

[0133] Most preferably, sequence comparisons are conducted using the simple BLAST search algorithm provided by the NIH. In some embodiments of the present invention, no gap penalties are used when determining sequence identity.

[0134] Influenza hemagglutinin is expressed as a single polypeptide chain, designated HA0, which trimerizes post-translationally. HA0 is proteolytically cleaved to yield two domains, HA1 and HA2, which are disulfide-bonded to each other. HA1 comprises significant sialic acid binding activity, while HA2 is anchored to the viral membrane and facilitates fusion of this membrane with a host cell membrane. In preferred embodiments of the invention, the multifunctional molecule comprising first and second parts comprises an amino acid sequence of an HA1 domain.

[0135] Additional examples of lectin molecules useful in the present invention include, but are not limited to, those lectins shown in Table 1, and variants thereof having at least 50%, 70%, 90%, and up to 99% sequence homology with the sequences of the lectins shown in Table 1. 1 TABLE 1 KEY NAME ABBREVIATION CLASS LECTIN CODE [1] / . . . / . . . Quail Intestinal . LECa.Ggg.Sss.xx.Xxxx. Lectin. [2] / . . . / . . . Porcine Heart Lectin . LECa.Ggg.Sss.xx.Xxxx. (PHL). [3] / . . . / . . . Hepatic beta- S-lectin or GLTa.Ggg.Sss.xx.Xxxx. galactoside binding Galectin. lectins. [4] / . . . / . . . Mammalian Brain S-lectin or GLTa.Ggg.Sss.xx.Xxxx. Beta-Galactoside- Galectin. binding Lectin. [5] Aaptos papillata. . . LECi.Ada.Pap.xx.Xxxx. [6] Abelmoschus . . LECp.Abe.Esc.xx.Xxxx. esculentus. [7] Abramis brana. . . LECp.Abr.Bra.xx.Xxxx. [8] Abrus precatorius. APA; APA-A; APA- beta-trefoil lectin LECp.AbrPre.se.Cga1 C;Abrin. (APA); Type 2 (abrin) RIP. LECp.AbrPre.se.Cga2 (APA). [10] Achatina fulica. Achatina fulica Cold . LECi.Ach.ful.xx.Xsi1. Aggltutinin; achatinin-H. [13] Actinomyces . . LECf.Act.Vis.xx.Xga1. viscosus. [14] Adenia digitata. Modeccin. Type 2 RIP. LECp.AdeDig.ro.Cga1. [15] Adenia volksensii. Volkensin. Type 2 RIP. LECp.AdeVol.ro.Cga1. [16] Aegilops . Hevein domain LECp.Aeg.Gen.se.Hch1. geniculata. lectin, chitin binding. [19] Aegopodium APA. . LECp.Aeg.Pod.rh.Hga1. podagraria. [20] Aeromonas . . LECb.Aer.Sal.xx.Xxxx. salmonicida. [21] Afzelia africana. . . LECz.Afz.Afr.xx.Xxxx. [22] Agardhiella tenera. . . LECz.Aga.Ten.xx.Xxxx. [23] Agaricales. . . LECz.Aga.sss.xx.Xxxx. [24] Agaricus bisporus ABA-I, ABA-II. . LECf.Aga.Bis.xx.Xga1. ABA-III, ABA-IV. [25] Agaricus blazei. . . LECf.Aga.Bla.xx.Xxxx. [26] Agaricus . . LECf.Aga.Cam.xx.Xxxx. campestris. [27] Agaricus edulis. . . LECf.Aga.Edu.xx.Xxxx. [28] Agrobacterium . . LECu.Agr.Rad.xx.Xxxx. radiobacter. [29] Agrocybe aegerita. . . LECf.Agr.Aeg.xx.Xxxx. [30] Agropyrum AREL, ARLL. Hololectin, LECp.Agr.Rep.se.Hch1 repens. Monocot (AREL) mannose-binding LECp.Agr.Rep.le.Hch1 lectins. (ARLL). [31] Aleuria aurantia. . . LECf.Ale.Aur.xx.Xfu1. [32] Allium AAA. Monocot LECp.All.Asc.bu.Hma1. ascalonicum. mannose-binding lectins. [36] Allium cepa. ACA. Monocot LECp.All.Cep.bu.Hma1. mannose-binding lectins. [37] Allium moly. AMA. Monocot LECp.All.Mol.bu.Hma1. mannose-binding lectins. [38] Allium porrum. APA. Monocot LECp.All.Por.le.Hma1. mannose-binding lectins. [39] Allium sativum. ASA. Monocot LECp.All.Sat.bu.Hma1 Mannose-binding (ASA-I) lectin. LECp.All.Sat.bu.Hma1 (ASA-I) LECp.All.Sat.bu.Hma1 (ASA-I) LECp.All.Sat.bu.Hma1 (ASA-I) LECp.All.Sat.bu.Hma2 (ASA-II) LECp.All.Sat.le.Hma1 (ASA-III) LECp.All.Sat.ro.Hma1 (ASA-IV). [40] Allium ursinum. AUA-I, AUA-II. Monocot LECp.All.Urs.bu.Hma1 AUA-III, AUA-Ir, Mannose-binding (AUA-I) AUA-L, AUA-Iir. lectin. LECp.All.Urs.bu.Hma2 (AUA-II) LECp.All.Urs.le.Hma1 (AUA-L) LECp.All.Urs.ro.Hma1 (AUA-Ir) LECp.All.Urs.ro.Hma2 (AUA-IIr). [42] Allium vineale. AVA. Monocot LECp.All.Vin.bu.Hma1. Mannose-binding lectin. [43] Allomyrina . . LECi.All.Dic.xx.Xxxx. dichotoma. [44] Alocasia indica. . . LECp.Alo.Ind.tu.Hcu1. [45] Aloe arborescens. Aloctin, AAA. AAA: Monocot LECp.Alo.Arb.le.? Mannose-binding (Aloctin-A) proteins Aloctin, LECp.Alo.Arb.le.Hma1 A: u. (AAA). [46] Amaranthus ACA, Amaranthin, beta-trefoil lectin. LECp.Ama.Cau.se.Hga1. caudatus. ACL. Amaranthin group. [47] Amaranthus . Amaranthin LECp.Ama.Cru.se.Hga1. cruentus. group. [48] Amaranthus AHML, Amaranthin. Amaranthin LECp.Ama.Hyp.xx.Xga11. hypochondriacus. group. [49] Amaranthus . Amaranthin LECp.Ama.se.Hga1. leucocarpus. group. [50] Amaranthus ASL. Amaranthin LECp.Ama.Spi.se.Hga1. spinosus. group. [51] Amphicarpaea ABrA. Legume lectins. LECp.Amp.Bra.se.Hma1. bracteata. [52] Anadara granosa. Anadarin MS. . LECi.Ana.Gra.xx.Xsi1. [53] Anguilla anguilla. AAL. . LECi.Ang.Ang.xx.Xfu1. [54] Anthocidaris . Novel, unique LECi.Ant.Cra.xx.Xxxx. crassispina. lectin class. [55] Anthocidaris . . LECi.Ant.Cra.xx.Xxxx. crassispina Ovum. [57] Apium graveolens. . . LECp.Api.Gra.xx.Xxxx. [58] Aplysia . . LECi.Apl.Dac.xx.Xxxx. dactylomela. [59] Aplysia depilans. . . LECi.Apl.Dep.xx.Xga1. [60] Aplysina archeria. . . LECu.Apl.Arc.xx.Xxxx. [61] Arachis hypogea. PNA, GNL, MNL, All Arachnis LECp.Ara.Hyp.se.Hga1 PRA-I, PRA-II. lectins are classed (PNA) as legume lectins. LECp.Ara.Hyp.no.Hga1 (GNL) LECp.Ara.Hyp.se.Hga1 (MNL) LECp.Ara.Hyp.se.Hga1 (PRA-I) LECp.Ara.Hyp.se.Hga1 (PRA-II). [62] Araucaria Lectin I, Lectin II. . LECp.Ara.Bra.se.Hmg1 brasiliensis. (Lectin I) LECp.Ara.Bra.se.Hmg2 (Lectin II). [63] Arion . . LECi.Ari.Emp.xx.Xxxx. empiricorum. [64] Arisaema ACA. . LECp.Ari.Con.tu.Hcu1. consanguineum. [65] Arisaema ACmA. . LECz.Ari.Cur.tu.Hcu1. curvatum. [66] Arthrobotrys AOL. . LECf.Art.Oli.xx.Xxxx. oligospora. [68] Artocarpus hirsuta. . . LECp.Art.Hir.xx.Xxxx. [69] Artocarpus incisa. . . LECp.Art.Inc.xx.Xxxx. [70] Artocarpus Jacalin, AIA, KM+, beta-prism plant LECp.Art.Int.se.Hga1. integrifolia. Artocarpin. lectin, Jacalin- related lectins. [71] Artocarpus Artocarpin, ALA-I, Jacalin-related LECp.Art.Lak.se.Hga1. lakoocha. ALA-II. lectins. [72] Arum maculatum. AMA. Monocot binding LECp.Aru.Mac.tu.Hma1. lectins. [73] Ascaris . . LECi.Asc.Lum.xx.Xxxx. lumbricoides. [74] Asparagus . . LECp.Asp.Off.xx.Xxxx. officinalis. [75] Bacillus . . LECb.Bac.Pols.xx.Xxxx. polymyxa. [76] Bacterioides . . LECb.Bac.Fra.xx.Xxxx. fragilis. [77] Bandeiraea BS-I, BS-I-A4, BS-I- . LECp.Ban.Sim.xx.Xxxx. simplicifolia. B4, BS-II. [78] Basidiomycotina. . . LECf.Bas.Sss.xx.Xxxx. [79] Bauhinia purpurea. BPA. Legume lectin. LECp.Bau.Pur.se.Hga1. [80] Bauhinia . . LECz.Bau.Tom.xx.Xxxx. tomentosa. [81] Beauveria . . LECf.Bea.Bas.xx.Xsi1. bassiana. [82] Beta vulgaris. . . LECp.Bet.Vul.xx.Xxxx. [83] Beta vulgaris. . . LECp.Bet.Vul.xx.Xxxx. [84] Biomphalaria BGL-I, BGL-II. . LECp.Bio.Gla.xx.Xxxx. glabrata. [85] Biomphalaria . . LECi.Bio.Gla.xx.Xxxx. glabrata. [86] Birgus latro. . . LECz.Bir.Lat.xx.Xxxx. [87] Blaberus BDL1, BDL2, BDL3. . LECi.Bla.Dis.xx.Xxxx. discoidalis. [88] Bordetella Pertussis toxin 1PRT. . LECz.Ggg.Sss.xx.Xxxx. pertussis. [89] Bos Taurus. Mannose 6-phosphate P-lectin. LECa.Bos.Tau.xx.Xxxx. receptor (1C39). [90] Bos taurus. Bovine Conglutinin. C-lectin or LECa.Bos.Tau.xx.Xxxx. Collectin. [91] Bos taurus. Bovine collectin-43 C-lectin or Leca.Bos.Tau.xx.Xxxx. (CL-43). Collectin. [92] Botryllus . S-lectin. LECi.Bot.Sch.xx.Xxxx. schlosseri. [93] Botrytis cinerea. . . LECz.Bot.Cin.xx.Xxxx. [94] Bowringia. BMA. Legume lectins. LECp.Bow.Mil.se.Hmg1. milbraedii. [95] Brachypodium BsyL. Chitin-binding LECp.Bra.Syl.se.Hch1. sylvaticum. lectins. [96] Bradyrhizobium . . LECp.Bra.Jap.xx.Xga1. japonicum. [97] Branchiostoma . . LECi.Bra.Lan.xx.Xxxx. lanceolatum. [98] Brassica . . LECp.Bra.Cam.xx.Xxxx. campetsris. [99] Brassica . . LECp.Bra.Nap.xx.Xxxx. napobrassica. [100] Brassica napus. . . LECp.Bra.Nap.xx.Xxxx. [101] Bryonia dioica. BDA. . LECp.Bry.Dio.tu.Hga1. [113] Cancer . . LECi.Can.Ant.xx.Xsi1. antennarius. [114] Candida albican Adhesins. . LECf.Can.Alb.xx.Xfu1. adhesin. [115] Canna generalis. . . LECp.Can.Gen.rh.Hma1. [116] Capnocytophaga . . LECu.Cap.Gin.xx.Xxxx. gingivalis Actinomyces Israelii Coaggregation agglutinin. [117] Capsicum annum. . . LECp.Cap.Ann.xx.Xxxx. [118] Caragana CAA-I, CAA-II. . LECp.Car.Arb.se.Hga1 arborescens. (CAA-I) LECp.Car.Arb.se.Hga2 (CAA-II). [119] Carcharhinus . . LECa.Car.Spr.xx.Xxxx. springeri. [120] Carcinoscorpious L10; carcinoscorpin. . LECi.Car.Rot.xx.Xsi1. rotundacauda. [121] Carica papya. . . LECp.Car.Pap.xx.Xxxx. [123] Carum carvia. . . LECp.Car.Car.xx.Xxxx. [124] Carybdea alata . . LECi.Car.Ala.xx.Xxxx. Hemolysin. [125] Castanea crenata. CCA. . LECp.Cas.Cre.xx.Xxxx. [126] Cepaea hortensis. CHA-I. . LECi.Cep.Hor.xx.Xxxx. [127] Channa punctatus. . . LECa.Cha.Pun.xx.Xxxx. [129] Chelidonium . . LECp.Che.Maj.se.Hch1. majus. [132] Chicorium . . LECp.Chi.Int.xx.Xxxx. intybus. [133] Cholla opuntia. . . LECp.Cho.Opu.xx.Xxxx. [134] Cicer arietinum. CAA. . LECp.Cic.Ari.se.Hcu1. [135] Cinachyrella . . LECi.Cin.All.xx.Xxxx. alloclada. [136] Cinnamonum . . LECp.Cin.Cam.xx.Xxxx. camphora. [137] Citrullus vulgaris. . . LECp.Cit.Vul.xx.Xxxx. [139] Citrus aurantium. . . LECp.Cit.Aur.se.Cnd1. [140] Citrus aurantium. . . LECp.Cit.Aur.xx.Xxxx. [141] Citrus medica. . . LECp.Cit.Med.xx.Xxxx. [142] Cladrastis lutea. CLA-I, CLA-II. . LECp.Cla.Lut.ba.Hmg1 (CLA-I) LECp.Cla.Lut.ba.Hmg2 (CLA-II). [143] Clerodendron CTA. . LECp.Cle.Tri.fr.Hga1. trichotomum. [144] Clitocyba . . LECf.Cli.Neb.xx.Xxxx. nebularis. [145] Clivia miniata. CMA. . LECp.Cli.Min.le.Hma1. [146] Clostridium . . LECb.Clo.Bot.xx.Xxxx. botulinum. [147] Clostridium tetani. Tetanus toxin . LECb.Ggg.Sss.xx.Xxxx. (1A8D). [148] Clupea harengus. . . LECa.Clu.Har.xx.Xxxx. [149] Coccinia grandis. CIA. . LECp.Coc.Gra.fr.Hch1. [151] Cocus nucifera. . . LECp.Coc.Nuc.xx.Xxxx. [152] Codium fragilis. . . LECu.Cod.Fra.xx.Xxxx. [153] Cofea arabica. . . LECp.Cof.Ara.xx.Xxxx. [154] Colchicum CAA. . LECp.Col.Aut.bu.Hcu1. autumnale. [155] Collybia velutipes. . . LECf.Col.Vels.xx.Xxxx. [156] Colocasia CEA. . LECp.Col.Esc.tu.Hma1. esculentum. [157] Conger myriaster. Congerin I, Congerin S-lectin. LECi.Con.Myr.xx.Xga1. II. [159] Conidiobolus . . LECf.Con.Obs.xx.Xga1. obscurus. [160] Coprinus cinereus. Cg1, Cg2. Galectin. LECf.Cop.Cin.xx.Xxxx. [161] Corbicula . . LECi.Cor.Flu.xx.Xxxx. fluminea Hemolysin. [163] Corylus avellania. . . LECp.Cor.Ave.xx.Xxxx. [164] Cratylia mollis. . . LECz.Cra.Mol.xx.Xxxx. [165] Crenomytilus CGL. . LECi.Cre.Gra.xx.Xxxx. grayanus. [166] Crocus sativum. . . LECp.Cro.Sat.bu.Hma1. [167] Crocus vernus. CVA. . LECp.Cro.Ver.xx.Xxxx. [169] Crotalaria striata. . . LECp.Cro.Str.se.Hga1. [170] Crotolaria . . LECz.Cro.Aeg.xx.Xxxx. aegyptica. [171] Crotolaria falcata. . . LECz.Cro.Fal.xx.Xxxx. [172] Crotolaria juncea. . . LECp.Cro.Jun.se.Hga1. [174] Croton tiglium. . . LECp.Cro.Tig.se.Hcu1. [175] Cucumaria CEL-III. . LECi.Cuc.Ech.xx.Xxxx. echinata. [176] Cucumis . . LECp.Cuc.Cat.xx.Xxxx. catalupensis. [177] Cucumis melo. . . LECp.Cuc.Mel.xx.Xch1. [178] Cucumis sativus. . . LECp.Cuc.Sat.xx.Xch1. [180] Cucurbita ficifolia. . . LECp.Cuc.Fic.xx.Xxxx. [181] Cucurbita maxima. CMA, PP2. . LECp.Cuc.Max.ps.Hch1. [182] Cucurbita pepe. . . LECp.Cuc.Pep.xx.Xxxx. [183] Cucurbita pepo. CPA. . LECp.Cuc.Pep.fr.Hch1. [184] Cucurbita sativus. . . LECp.Cuc.Sat.xx.Xxxx. [185] Cydonia oblonja. . . LECp.Cyd.Obl.xx.Xxxx. [186] Cymbidium . . LECz.Cym.Hyb.le.Hma1. hybrid. [187] Cyphomandra . . LECp.Cyp.Bet.xx.Xxxx. betacea. [188] Cytisis CMA-I, CMA-II. . LECp.Cyt.Mul.se.Hch1 multiflorus. (CMA-I) LECp.Cyt.Mul.se.Hfu1 (CMA-II). [189] Cytisus scoparius. CSA-I, CSA-II, . LECp.Cyt.Sco.se.Hga1 CMH-I, CMH-II. (CS-I) LECp.Cyt.Sco.se.Hga2 (CS-II). [190] Cytisus . . LECp.Cyt.Ses.se.Hch1 sessilfolius. (CSA-I) LECp.Cyt.Ses.se.Hga1 (CSA-II). [191] Dacrymycetales. . . LECz.Dac.sss.xx.Xxxx. [192] Dalbergia. . . LECz.Dal.sss.xx.Xxxx. [193] Datura innoxia. . . LECp.Dat.Inn.xx.Xxxx. [194] Datura DSA. Chitin-binding LECp.Dat.Str.se.Hch1. stramonium. lectins. [195] Daucus carrota. . . LECp.Dau.Car.xx.Xxxx. [196] Dendroaspis JML, Jameson's . LECi.Den.Jam.xx.Xga1. jamesoni. Mamba Venon. [198] Deuteromycetes. . . LECz.Deu.sss.xx.Xxxx. [199] Dicolea lehmani. . . LECz.Dio.Leh.xx.Xxxx. [200] Dictyostelium Discoidin I. . LECu.Dic.Dis.xx.Xxxx. discoideum. [201] Dictyostelium Purpurin. . LECu.Dic.Pur.xx.Xxxx. purpureum. [202] Didemnum DTL, DCL-I, DCL- . LECi.Did.Sss.xx.Xga1. candidum. II. [203] Dieffenbachia . . LECp.Dif.Seq.xx.Xxxx. sequina. [204] Dioclea . Legume lectin. LECp.Dio.Gra.xx.Xxxx. grandifolia. [205] Dioclea DLL-I, DLL-II, Legume lectin. LECp.Dio.Gui.xx.Xmg1. guianensis. DLL-III. [206] Dioclea virgata. . Legume lectin. LECz.Dio.Vir.xx.Xxxx. [207] Dolichos biflorus. DBA-S, DBA-R, Legume lectin. LECp.Dol.Bif.se.Hga1 DB-58, DB-57, (DBA) DB46. LECp.Dol.Bif.pl.Hcu1 (DB58) LECp.Dol.Bif.pl.Hcu2 (DB57) LECp.Dol.Bif.ro.?ga1 (DB46). [208] Drosophila. . . LECi.Dro.Meg.xx.Xxxx. [209] Dumasia. . . LECz.Dum.sss.xx.Xxxx. [210] Echinocereus . . LECp.Echi.Eng.xx.Xxxx. engelmanii. [211] Echis EMS 16. . LECi.Ech.Mul.xx.Xxxx. multisquamatus. [212] Electrophorus Electrolectin. . LECi.Ele.Ele.xx.Xxxx. electricus. [213] Elymus . Hevein domain LECp.Ely.Can.se.Hch1. canadensis. lectin, chitin binding. [223] Erythrina velutina. . . LECp.Ery.Vel.xx.Xxxx. [224] Escherichia coli. Pili mannose-specific Verotoxin-1: LECb.Ech.Col.xx.Xxxx. FimH adhesin ADP-ribosylating (1QUN),. toxins. [225] Euhadra . . LECz.Euh.Cal.xx.Xxxx. callizoma. [226] Euphorbia . . LECp.Eup.Sss.xx.Xxxx. characias. [227] Euphorbia . . LECp.Eup.Het.xx.Xga1. heterophylla. [228] Evonymus . . LECp.Evo.Eur.se.Hcu1. europaea. [229] Falcata japonica. . . LECp.Fal.Jap.se.Hga1. [230] Ficus cunia. . . LECp.Fic.Cun.xx.Xxxx. [231] Flammulina . . LECf.Fla.Vel.xx.Xxxx. veltipes. [232] Fomes . . LECz.Fom.Fom.xx.Xxxx. fomentarius. [233] Fragaria vesca. . . LECp.Fra.Ves.xx.Xxxx. [234] Fucus serratus. . . LECu.Fuc.Ser.xx.Xxxx. [235] Fucus vesiculosis. . . LECu.Fuc.Ves.xx.Xxxx. [236] Galactia tashiroi. . . LECp.Gal.Tas.se.Hga1. [237] Galactia . . LECp.Gal.Ten.se.Hga1. tenuiflora. [238] Galanthus nivalis. . Monocot lectin. LECp.Gal.Niv.bu.Hma1. [239] Galleria . . LECi.Gal.Mel.xx.Xxxx. mellonella. [240] Gallus gallus. GGL. S-lectin or GLTa.Gal.Gal.xx.Xxxx. Galectin. [241] Gallus gallus. Chicken Hepatic . LECa.Gal.Gal.xx.Xxxx. lectins (CHL). [242] Gallus gallus. Chicken egg . LECa.Gal.Gal.xx.Xxxx. agglutinins. [243] Gallus gallus. Chicken Beta- S-lectin or LECa.Gal.Gal.xx.Xxxx. galactoside-Binding Galectin. lectins. [244] Gallus gallus. Chicken Serum C-lectin or LECa.Gal.Gal.xx.Xxxx. Mannose-Binding Collectin. Protein. [245] Gallus gallus. Chicken Liver C-lectin or LECa.Gal.Gal.xx.Xxxx. Mannose-Binding Collectin. Protein. [246] Gallus gallus. Chicken Thymic S-lectin or GLTa.Gal.Gal.xx.Xxxx. Electrolectin (CTE). Galectin. [247] Gallus gallus. Chick Embryonic S-lectin or GLTa.Gal.Gal.xx.Xxxx. Skin Lectins. Galectin. [248] Genypterus . . LECi.Epi.Tre.xx.Xxxx. blacodes. [249] Geodia cydonium. . . LECi.Geo.Cyd.xx.Xga1. [250] Giardia lambia Taglin. . LECu.Gia.Lam.xx.Xxxx. Surface lectin. [251] Gliricida sepium. Lectin A, Lectin B. . LECp.Gli.Sep.se.Hga1 (Lectin A) LECp.Gli.Sep.se.Hga2 (Lectin B). [252] Glossina . . LECi.Glo.Lon.xx.Xxxx. longipennis lectin. [253] Glycine max. SBA. Legume lectin. LECp.Gly.Max.se.Hga1. [254] Gonatanthus . . LECz.Gon.Pum.ti.Hcu1. pumilus. [256] Grateulopia . . LECu.Gra.Fil.xx.Xxxx. filicina. [257] Griffithsia . . LECu.Gri.Flo.xx.Xxxx. flosculosa. [258] Griffonia GS-I-A4-, GS-I-A4, Legume lectin. LECp.Gri.Sim.se.Hga1 Simplicifolia GS-I-B4, GS-II, GS- (GS-I-A4) lectins. IV. LECp.Gri.Sim.se.Hga2 (GS-I-B4) LECp.Gri.Sim.se.Hch1 (GS-II) LECp.Gri.Sim.se.Hfu1 (GS- IV) LECp.Gri.Sim.le.Hga1 (GS-I-A4) LECp.Gri.Sim.le.Hga2 (GS- I-B4) LECp.Gri.Sim.le.Hch1 (GS- II) LECp.Gri.Sim.le.Hfu1 (GS-IV). [260] Grifola frondosa. GFL. . LECf.Gri.Fro.xx.Xga1. [261] Haemonchus . . LECz.Xxx.Xxx.xx.Xxxx. contortus. [262] Halidrys siliquosa. . . LECu.Hal.Sil.xx.Xxxx. [263] Halimeda opuntia. . . LECu.Hal.Opu.xx.Xxxx. [264] Halocynthia . . LECi.Hal.Pyr.xx.Xxxx. pyriformis. [265] Halocynthia . . LECi.Hal.Ror.xx.Xga1. roretzi. [266] Haynaldia villosa. . Hevein domain LECp.Hay.Vil.se.Hch1. lectin, chitin binding. [269] Helianthus annus. . beta-prism plant LECp.Hel.Ann.xx.Xxxx. lectin. [270] Helianthus HTA. Jacalin-related LECp.Hel.Tub.tu.Hmmm1. tuberosus. lectins. [271] Helicobacter HP-SAL. . LECb.Hel.Pyl.xx.Xxxx. pylori. [272] Helix aspersa. . . LECi.Hel.Asp.xx.Xxxx. [273] Helix pomatia. HPA. . LECi.Hel.Pom.xx.Xxxx. [274] Herpetomonas. . . LECz.Her.xx.Xxxx. [276] Heteranthelium . Hevein domain LECp.Het.Pil.se.Hch1. piliferum. lectin, chitin binding. [277] Heterometrus . . LECi.Het.gra.xx.Xsi1. granulomanus. [279] Hevea brasiliensis. HBA, Hevein. Chitin-binding LECp.Hev.Bra.la.Mch1. lectin with hevein domain. [280] Hippeastrum HHA. Monocot lectin. LECp.Hip.Hyb.bu.Hma1. hybrid. [281] Hippopus Tridacnin. C-lectin. LECi.Hip.Hip.xx.Xxxx. hippopus. [282] Hizoctonia solani. . . LECz.Hiz.Sol.xx.Xxxx. [283] Hohenbuehelia . . LECf.Hoh.Ser.xx.Xxxx. serotina. [284] Homarus HAA. . LECi.Hom.Ame.xx.Xxxx. americanus. [285] Homo sapiens. P-selectin (1KJD). C-lectin. LECh.Hom.Sap.xx.Xxxx. [286] Homp sapiens. Human Mannose C-lectin. LECh.Hom.Sap.xx.Xxxx. Binding Protein (MBP) (1HUP). [287] Homo sapiens. Gut Mucus Anti- . LECh.Hom.Sap.xx.Xxxx. Salmonella Lectin. [288] Homo sapiens. Human Membrane . LECh.Hom.Sap.xx.Xxxx. Lectins (HKML, HCCML). [289] Homo sapiens. Human Synovial . LECh.Hom.Sap.xx.Xxxx. Tissue Lectins. [290] Homo sapiens. Human Placenta . LECh.Hom.Sap.xx.Xxxx. Lectins (HPL-H, HPL-BG). [291] Homo sapiens. Human Brain . LECh.Hom.Sap.xx.Xxxx. Galactoside-binding Lectin. [292] Homo sapiens. Human 14-kDa . LECh.Hom.Sap.xx.Xxxx. Lectins. [293] Homo sapiens. Human Core-specific . LECh.Hom.Sap.xx.Xxxx. Lectin (HCSL). [294] Homo sapiens. Cell Membrane . LECh.Hom.Sap.xx.Xxxx. Lectins. [295] Homo sapiens. Tumoricidal . LECh.Hom.Sap.xx.Xga1. Macrophage Lectin. [296] Homo sapiens. Tumor-associated . LECa.Ggg.Sss.xx.Xxxx. Vertebrate Lectin. [297] Homo sapiens. Human Conglutinin- . LECh.Hom.Sap.xx.Xxxx. like Protein. [298] Homo sapiens. Mannose-Specific . LECh.Hom.Sap.xx.Xma1. Endocytosis Receptor. [299] Homo sapiens. Human Penultimate . LECh.Hom.Sap.xx.Xxxx. Galactose Lectin. [300] Homo sapiens. Thrombospondin. . LECh.Hom.Sap.xx.Xxxx. [301] Homo sapiens. Tetranectin. . LECh.Hom.Sap.xx.Xxxx. [302] Homo sapiens. Human Dendritic . LECh.Hom.Sap.xx.Xxxx. Cell Immunoreceptor. (DCIR). [303] Homo sapiens. Human Seminal . LECh.Hom.Sap.xx.Xxxx. Lectin (HSL). [304] Homo sapiens. Charcot-Leyden S-lectin or GLTh.Hom.Sap.xx.Xxxx. crystal protein Galectin. (1LCL). [305] Homo sapiens. Galectin II L-14-II Proto S-lectin or GLTh.Hom.Sap.xx.Xxxx. (1HLC). Galectin. [306] Homo sapiens. Human Lung C-lectin or GLTh.Hom.Sap.xx.Xxxx. Surfactant Protein Collectin. (1B08). [307] Homo sapiens. Galectin III. Chimera S-lectin GLTh.Hom.Sap.xx.Xxxx. or Galectin. [308] Homo sapiens. Galectin VII, hGal-7. Proto S-lectin or GLTh.Hom.Sap.xx.Xxxx. Galectin. [309] Homo sapiens. Pentraxin (1CRV). Pentraxin,S- GLTh.Hom.Sap.xx.Xxxx. lectin or Galectin. [310] Homo sapiens. Sialoadhesin. I-lectin. LECz.Ggg.Sss.xx.Xxxx. [311] Homo sapiens. Serum Amyloid P Pentraxin. LECh.Hom.Sap.xx.Xxxx. Component. [312] Homo sapiens. E-Selectin (1ESL). C-lectin. SELh.Hom.Sap.xx.Xxxx. [313] Homo sapiens. L-Selectin (1KJB). C-lectin. SELh.Hom.Sap.xx.Xxxx. [314] Homo sapiens. C-Reactive protein Pentraxin, S- GLTh.Hom.Sap.xx.Xxxx. (1CRV). lectin or Galectin. [315] Homo sapiens. Galectin XII. S-lectin or GLTh.Hom.Sap.xx.Xxxx. Galectin. [316] Homo sapiens. Galectin I. Proto S-lectin or GLTh.Hom.Sap.xx.Xxxx. Galectin. [317] Homo sapiens. Galectin IX, Tandem Repeat GLTh.Hom.Sap.sr.Xxxx. Ecalectin. S-lectin or Galectin. [318] Homo sapiens. Galectin VIII. Tandem Repeat GLTh.Hom.Sap.xx.Xxxx. S-lectin or Galectin. [319] Homo sapiens. Galectin IV. Tandem Repeat GLTh.Hom.Sap.xx.Xxxx. S-lectin or Galectin. [320] Homo sapiens. Alpha-1/Beta-1 Integrin A (or I) INTh.Hom.Sap.xx.Xxxx. integrin. domain. [321] Homo sapiens. Alpha-2/Beta-1 Integrin A (or I) INTh.Hom.Sap.xx.Xxxx. integrin. domain. [322] Homo sapiens. Alpha-3/Beta-1 Integrin A (or I) INTh.Xxx.Xxx.xx.Xxxx. integrin. domain. [323] Homo sapiens. Alpha-4/Beta-1 Integrin A (or I) INTh.Xxx.Xxx.xx.Xxxx. integrin. domain. [338] Homo sapiens. Alpha-5/Beta-8 Integrin A (or I) INTh.Hom.Sap.xx.Xxxx. integrin. domain. [339] Homo sapiens. Alpha-4/Beta-7 Integrin. INTh.Hom.Sap.xx.Xxxx. Integrin. [340] Homo sapiens. Alpha-E/Beta-7. Integrin INTh.Hom.Sap.xx.Xxxx. [341] Homo sapiens. Mucosal addressin Addressin. LECh.Xxx.Xxx.xx.Xxxx. cell adhesion molecule-1 (MADCAM-1). [342] Homo sapiens. Vascular Adhesion . LECh.Xxx.Xxx.xx.Xxxx. Molecule (VCAM-1. [343] Homo sapiens. P-Selectin. Selectin. SELh.Xxx.Xxx.xx.Xxxx. [344] Homo sapiens. Intercellular Addressin?. LECh.Xxx.Xxx.xx.Xxxx. Adhesion Molecule (ICAM-1, ICAM-2). [345] Homo sapiens. Peripheral Lymph Addressin. LECh.Xxx.Xxx.xx.Xxxx. Node Addressin (PNAd). [346] Homo sapiens. Vascular Adhesion . LECh.Xxx.Xxx.xx.Xxxx. Protein (VAP-1). [347] Homo sapiens. LFA-3. Addressin?. LECh.Xxx.Xxx.xx.Xxxx. [348] Homo sapiens. Versican. Soluble C-lectin LECh.Xxx.Xxx.xx.Xxxx. (‘Lecticans’). [349] Homo sapiens. Aggrecan. Soluble C-lectin LECh.Xxx.Xxx.xx.Xxxx. (‘Lecticans’). [350] Homo sapiens. Neurocan. Soluble C-lectin LECh.Xxx.Xxx.xx.Xxxx. (‘Lecticans’). [351] Homo sapiens. Brevican. Soluble C-lectin LECh.Xxx.Xxx.xx.Xxxx. (‘Lecticans’). [352] Homo sapiens. Annexin V. Annexin. ANNh.Hom.Sap.xx.Xxx5. [353] Homo sapiens. Annexin II. Annexin. ANNh.Hom.Sap.xx.Xxx2. [354] Homo sapiens. Annexin IV. Annexin. ANNh.Hom.Sap.xx.Xxx4. [355] Homo sapiens. Annexin I Annexin. ANNh.Hom.Sap.xx.Xxx1. (Lipocortin-1), ANX1. [356] Homo sapiens. Annexin VII, . ANNh.Hom.Sap.xx.Xxx7. Synexin. [357] Homo sapiens. Activated Leukocyte . LECh.Hom.Sapxx. Adhesion Molecule (ALCAM). [358] Homo sapiens. E-cadherin. . CDHh.Hom.Sap.xx.XxxE. [360] Homo sapiens. N-cadherin. . CDHh.Hom.Sap.xx.XxxN. (uvomorulin). [361] Homo sapiens. VE-cadherin . CDHh.Hom.Sap.xx.XxxVE. (Vascular Endothelial Cadherin). [362] Homo sapiens. P-cadherin. . CDHh.Hom.Sap.xx.XxxP. [363] Homo sapiens. Annexin XI (CAP- . ANNh.Hom.Sap.xx.Xxx9. 50). [364] Homo sapiens. Endothelial Cell- . CDHh.Hom.Sapxxx. Selective Adhesion Molecule (ESAM). [365] Homo sapiens. ELAM-1. . CDHh.Xxx.Xxx.xx.Xxxx. [366] Homo sapiens. GMP-140. . CDHh.Xxx.Xxx.xx.Xxxx. [367] Homo sapiens. Cutaneous . LECh.Xxx.Xxx.xx.Xxxx. Lymphocyte Antigen (CLA). [369] Homo sapiens. Lymphocyte . LECh.Xxx.Xxx.xx.Xxxx. Function-Associated Antigen-1 (LFA-1). [370] Homo sapiens. Very Late Antigen 4 . LECh.Xxx.Xxx.xx.Xxxx. (VLA-4). [371] Hordeum vulgare. HVA. . LECp.Hor.Vul.se.Hch1. [372] Hura crepitans. HCA. Type 2 RIP. LECp.Hur.Cre.se.Cga1 (HCA) LECp.Hur.Cre.la.Cga1. [373] Hygrophorus . . LECf.Hyg.Hyp.xx.Xxxx. hypothejus. [374] Hypnea . . LECu.Hyp.Cer.xx.Xxxx. cervicornis. [375] Hyptos . . LECz.Hyp.Sua.xx.Xxxx. suaveolens. [376] Iberis amara. . . LECp.Ibe.Ama.xx.Xxxx. [377] Influenza virus. Hemagglutinin. Hemagglutinin. LECv.Inf.Vir.xx.Xxxx. [378] Ipomoea batatas. . . LECp.Ipo.Bat.xx.Xxxx. [379] Iris hollandica. . . LECp.Iri.Hol.xx.Xxxx. [380] Iris hybrid. IRA. Type 2 RIP. LECp.Iri.Hyb.bu.Cga1. [381] Juglans regia. . . LECp.Jug.Reg.xx.Xxxx. [382] Klyveromyces . . LECz.Kly.Bul.xx.Xxxx. bulgaricus. [383] Kuehneromyces . . LECu.Kue.Mut.xx.Xxxx. mutabilis. [384] Labiaceae . . LECp.Lab.Ori.xx.Xxxx. origanum. [385] Lablab purpureus. DLA, LPA. Legum lectin. LECp.Lab.Pur.se.Hmg1. [386] Laburnum LAA-I, LAA-II. Legume lectin. LECp.Lab.Alp.se.Hch1 alpinum. (LAA-I) LECp.Lab.Alp.se.Hga1 (LAA-II). [387] Laccaria . . LECz.Lac.Ame.xx.Xxxx. amethystina. [389] Lachesis huta. BML. . LECi.Lac.Jut.xx.Xxxx. [390] Lactarius LDL. . LECf.Lac.Del.xx.Xgal1. deliciosus. [391] Lactarius . . LECz.Lac.Lig.xx.Xxxx. lignyotus. [392] Lactuca scariole. PLA-I, PLA-II. . LECa.Lac.Sca.xx.Xxxx. [393] Laelia autumnalis. . . LECp.Lae.Aut.xx.Xxxx. [394] Laetiporus PSL. . LECf.Lae.Sul.xx.Xxxx. sulfureus. [395] Lathyrus cicera. LcLI, LcLII. . LECp.Lat.Cic.xx.Xxxx. [396] Lathyrus nissolia. . . LECp.Lat.Nis.xx.Xxxx. [397] Lathyrus ochrus. LOL-I, LOL-II. Legume lectin. LECp.Lat.Och.xx.Xxxx. [398] Lathyrus odoratus. . . LECp.Lat.Odo.xx.Xxxx. [399] Lathyrus silvestris. . . LECp.Lat.Sil.xx.Xxxx. [400] Lathyrus . . LECp.Lat.Tub.xx.Xxxx. tuberosus. [401] Lens culinaris. LCA, LcH. Legume lectins. LECp.Len.Cul.se.Hmg1. [402] Lepidium . . LECp.Lep.Sat.xx.Xxxx. sativuum. [403] Leptonychotes . . LECz.Lep.Wed.xx.Xxxx. weddelli. [404] Leptospermum LAA. . LECp.Lep.Arc.xx.Xxxx. archinoides. [405] Leucojum. . . LECz.Leu.sss.xx.Xxxx. [406] Leucojum LAA. Monocot LECp.Leu.Aes.bu.Hma1. aestivum. mannose-binding lectins. [407] Leucojum vernum. LVA. Monocot LECp.Leu.Ver.bu.Hma1. mannose-binding lectins. [408] Limulus Limulin. Pentraxin. LECi.Lim.Pol.xx.Xsi1. polyphemus. [409] Liocarcinus . . LECi.Lio.Dep.xx.Xxxx. depurator. [410] Listeria ovata. LOA, LOMBP. Monocot LECp.Lis.Ova.le.Hma1 mannose binding (LOA) proteins. LECp.Lis.Ova.le.Mma1 (LMOBP). [411] Litchi chinensis. LCL. . LECp.Lit.Chi.xx.Xxxx. [412] Lonchocarpus . Legume lectin. LECp.Lon.Cap.se.Hga1. capassa. [413] Lontonis bainesii. . Legum lectins. LECp.Lon.Bai.se.Hga1 LECp.Lon.Bai.ro.Hga1. [414] Lophocereus . . LECp.Lop.Sho.xx.Xxxx. shoTi. [415] Lotus LTA. Legume lectins. LECp.Lot.Tet.se.Hfu1. tetragonolobus. [416] Luffa acutangula. LAA. Cucurbtaceae LECp.Luf.Acu.fr.Hch1. phloem lectins. [417] Lumbricus EW29. . LECi.Lum.Ter.xx.Xxxx. terrestris. [418] Lycopersicon LEA, TL, LEL. Chitin-binding LECp.Lyc.Esc.fr.Hch1. esculentum. lectins. [419] Lycoris aurea. . Monocot LECp.Lyc.Aur.bu.Hma1. mannose-binding lectins. [420] Maackia MALb, MAHb, Legume lectins. LECp.Maa.Amu.se.Hsi1 amurensis. MAL, MAHs. (MAHs, MAH) LECp.Maa.Amu.se.Hsi2 (MAHs, MAH) LECp.Maa.Amu.ba.Hsi1 (MAHb) LECp.Maa.Amu.ba.Hsi1 (MALb). [421] Machaerocereus MEA-I, MEA-II. ?. LECp.Mac.Eru.st.Hga1. eruca. [422] Machaerocereus . Hevein domain LECp.Mac.Gum.xx.Xxxx. gummosus. lectin, chitin binding. [423] Maclura pomifera. MPA. beta-prism plant LECi.Mac.Pom.xx.Xxxx. lectin. [424] Macrobdella LL1-63. . LECi.Mac.Dec.xx.Xxxx. decora. [425] Macrobrachium MrL. . LECi.Mac.Ros.xx.Xxxx. rosenbergii. [426] Macrotyloma . . LECp.Mac.Axi.xx.Xxxx. axillare. [427] Malus officinalis. . . LECp.Mal.Off.xx.Xxxx. [428] Manduca sexta. Immulectin. C-lectin. LECi.Man.Sex.xx.Xxxx. [429] Mangifera indica. MIA. . LECp.Man.Ind.xx.Xxxx. [430] Marah . . LECp.Mar.Mac.xx.Xxxx. macrocarpus. [431] Marasmius . . LECf.Mar.Ore.xx.Xxxx. oreades. [432] Medicago sativa. . . LECp.Med.Sat.xx.Xxxx. [433] Medicago . . LECp.Med.Tru.xx.Xxxx. truncatula. [434] Megabalanus rosa. . . LECi.Mag.Ros.xx.Xxxx. [435] Megapitaria . . LECi.Meg.Squ.xx.Xxxx. squalida. [436] Melanoleuca . . LECf.Mel.Mel.xx.Xxxx. melaleuca. [437] Melastiza chateri. . . LECf.Mel.Cha.xx.Xxxx. [438] Mesocricetus . Pentraxin. LECz.Ggg.Sss.xx.Xxxx. auratus. [474] Orchidaceae. . . LECp.Orc.Sss.xx.Xxxx. [475] Ornithodoros Dorin-M. . LECi.Orn.Mou.xx.Xxxx. moubata. [476] Oryza sativa. OSA. Chitin binding LECp.Ory.Sat.see.Hch1. lectins. [477] Oscillatoria . . LECu.Osc.Aga.xx.Xxxx. agardhii. [478] Otala lactea. . . LECi.Ota.Lac.xx.Xxxx. [480] Pachydereus . . LECp.Pac.Pri.se.Hch1. pringleii. [481] Pacifastacus . . LECi.Pac.Len.xx.Xxxx. leniusculus. [482] Palmaria palmata. . . LECz.Pal.Pal.xx.Xxxx. [483] Paracentrotus . . LECi.Par.Liv.xx.Xxxx. lividus. [484] Parkia . . LECp.Par.Big.xx.Xxxx. biglandulosa. [485] Parkia discolor. . . LECz.Par.Dis.xx.Xxxx. [486] Parkia . . LECz.Par.Pla.xx.Xxxx. platycephala. [487] Parkia speciosa. . . LECp.Park.Spe.xx.Xxxx. [488] Paxillus . . LECz.Pax.Atr.xx.Xxxx. atrotomentosus. [489] Paxillus . . LECf.Pax.Pan.Sss.xx.Xxxx. panuoides. [490] Penaeus . . LECp.Pen.Cal.xx.Xxxx. californiensis. [492] Penaeus . . LECi.Pen.Sty.xx.Xxxx. stylirostris. [494] Penaeus vannamei. . . LECi.Pen.Van.xx.Xxxx. [495] Perca fluviatilis. . . LECa.Per.Flu.xx.Xxxx. [496] Peresea gratissima. . . LECz.Per.Gra.xx.Xxxx. [497] Persea americana. PAA. . LECp.Per.Ame.xx.Xxxx. [498] Petromyzon . . LECz.Pet.Mar.xx.Xxxx. marinus. [499] Petrosecinum . . LECp.Pet.Hor.xx.Xxxx. hortense. [500] Peziza badia. . . LECp.Pez.Bad.xx.Xxxx. [501] Phage p22. Phage P22 . LECb.Ggg.Sss.xx.Xxxx. TailspikeProteins (1TSP). [502] Phalera flavescens. PFA. . LECi.Pha.Fla.xx.Xxxx. [503] Phallus impudicus. . . LECf.Pha.Imp.xx.Xxxx. [504] Phallusia . . LECi.Pha.Mam.xx.Xxxx. mamillata. [505] Phaseolus . Legume lectins. LECp.Pha.Acu.se.Hcu1 acutifolius. (erythroagglutinin) LECp.Pha.Acu.se.Hcu2 (lymphoagglutinin). [506] Phaseolus aureus. . . LECp.Pha.Aur.xx.Xxxx. [507] Phaseolus PCA. Legume lectin. LECp.Pha.Coc.se.Hcu1 coccineus. (PCA) LECp.Pha.Coc.se.Hcu2. [508] Phaseolus . . LECp.Pha.Coc.xx.Xxxx. coccineus. [509] Phaseolus PLA, LBA, LBL. Legume lectins. LECp.Pha.Lim.se.Hga1. limenesis. [510] Phaseolus lunatus. . . LECp.Pha.Lun.se.Xxxx. [511] Phaseolus PHA-E, PHA-L. Legume lectin. LECp.Pha.Vul.xx.Xxxx. vulgaris. [512] Phaseolus GNIL, GNpL, GNsL. . LECp.Pha.Vul.xx.Xxxx. vulgaris. [513] Phaseolus Pinto III. . LECa.Pha.Vul.xx.Xxxx. vulgaris. [514] Phaseolus . . LECp.Pha.Vul.xx.Xxxx. vulgaris. [515] Phaseolus . . LECp.Pha.Vul.xx.Xxxx. vulgaris. [516] Phaseolus . . LECp.Pha.Vul.xx.Xxxx. vulgaris. [517] Phaseolus . . LECp.Pha.Vul.xx.Xxxx. vulgaris. [518] Phaseolus . . LECp.Pha.Vul.xx.Xxxx. vulgaris. [519] Phaseolus . . LECp.Pha.Vul.xx.Xxxx. vulgaris. [520] Phlomis . . LECz.Phl.Fru.xx.Xxxx. fructicosa. [521] Pholiota aurivella. PAA. . LECf.Ggg.Sss.xx.Xxxx. [522] Pholiota squarrosa. . . LECf.Pho.Squ.xx.Xxxx. [524] Phoradendron . . LECz.Pjo.Cal.xx.Xxxx. californicum. [525] Phragmites. . . LECz.Phr.sss.xx.Xxxx. [526] Phragmites . . LECp.Phr.Aus.xx.Xxxx. austalis. [527] Physalia physalis. Physalitoxin. . LECi.Phy.Phy.xx.Xxxx. [528] Physalis angulata. PA-VII-A, PA-VII-B . LECz. Phy.Ang.xx.Xxxx. and PA-VII-C. [529] Physarum . . LECu.Phy.Pol.xx.Xxxx. polycephalum. [530] Phytolacca PWM, Pa-1, Pa-2 . LECp.Phy.Ame.ro.Hch1(Pa- americana. (PL-A) Pa-3, Pa-4 1) (PL-C), Pa-5. LECp.Phy.Ame.ro.Hch2(Pa- 2) LECp.Phy.Ame.ro.Hch3(Pa- 3) LECp.Phy.Ame.ro.Hch4(Pa- 4) LECp.Phy.Ame.ro.Hch5(Pa- 5) LECp.Phy.Ame.ro.Hch6(PL- B). [531] Pimenta . . LECp.Pim.Off.xx.Xxxx. officinalis. [532] Pisum sativum. PSA, PsA. Legume lectins. LECp.Pis.Sat.se.Hmg1 (PSA, PsA) LECp.Pis.Sat.ro.Hmg1. [533] Plecoglossus PAL. . LECa.Ple.Alt.xx.Xxxx. altivelis. [535] Pleurocybella . . LECf.Ggg.Sss.xx.Xxxx. porrigens. [536] Pleurotus . . LECf.Ple.Ost.xx.Xxxx. ostreatus. [537] Plumaria elegans. . . LECu.Plu.Ele.xx.Xxxx. [538] Polyandrocarpa . C-lectin. LECi.Pol.Mis.xx.Xga1. misakiensis. [539] Polygonum . . LECp.Pol.Mul.xx.Xxxx. multiformum. [540] Polyomavirus. 1VPN. . LECV.Pol.Vir.xx.Xxxx. [541] Polyporus . . LECf.Pol.Fom.xx.Xxxx. fomentarius. [542] Polyporus . . LECf.Pol.Squ.xx.Xxxx. squamosus. [543] Polysphondylium . . LECu.Pol.Pal.xx.Xxxx. pallidum. [544] Potamon . . LECi.Pot.Pot.xx.Xxxx. potamios. [545] Prunus Americana. . . LECp.Pru.Ame.xx.Xxxx. [546] Prunus avium. . . LECp.Pru.Avi.xx.Xxxx. [547] Psathyrostachys . Hevein domain LECp.Psa.Jun.se.Hch1. juncea. lectin, chitin binding. [548] Pseudomonas . . LECb.Pse.Aer.xx.Xga1. aeruginosa. [549] Pseudomonas . . LECb.Pse.Apl.xx.Xxxx. aplysia. [550] Psophocarpus PTL-I (WBA-I), . LECp.Pso.Tet.se.Hga1 tetragonolobus. PTL-II (WBA-II), (PTL-I) WBTL, L-I, L-II. LECp.Pso.Tet.se.Hga2 (PTL-II) LECp.Pso.Tet.ro.Hga1 (WBTL) LECp.Pso.Tet.so.Hga2 LECp.Pso.Tet.le.Hga1 (L-I) LECp.Pso.Tet.le.Hga2 (L- II). [551] Ptilota serrata. . . LECu.Pxx.Ser.xx.Xxxx. [552] Punica granatum. . . LECp.Pun.Gra.xx.Xxxx. [553] Rana catesbeiana. . Lectins LECa.Ran.Cat.xx.Xxxx. Displaying RNase Activity (Leczymes). [554] Rana catesbeiana cSBL. Lectins LECa.Ran.Cat.xx.Xxxx. ovum lectin. Displaying RNase Activity (Leczymes). [555] Rana japonica. jSBL. Lectins LECa.Ran.Jap.xx.Xxxx. Displaying RNase Activity (Leczymes). [557] Rana . . LECa.Ran.Nig.xx.Xxxx. nigromaculata. [558] Raphanus sativus. . . LECp.Rap.Sat.xx.Xxxx. [559] Ratus norvegicus. Mannan Binding C-lectin or LECa.Rat.Nor.xx.Xxxx. Protein (MBP-A). Collectin. [560] Ratus ratus. Rat peritioneal . LECa.Rat.Rat.xx.Xfu1 macrophage lectin. LECa.Rat.Rat.xx.Xga1. [561] Ratus ratus. . . LECa.Rat.Rat.xx.Xxxx. [562] Ratus ratus. Galectin II. S-lectin or GLT2.Rat.Rat.xx.Xxxx. Galectin. [563] Ratus ratus. Galectin IV. Tandem Repeat GLTa.Rat.Rat.xx.Xxxx. S-lectin or Galectin. [564] Rheum . . LECp.Rhe.Rhas.xx.Xxxx. rhapontium. [565] Ribes rubrum. . . LECp.Rib.Rubs.xx.Xxxx. [566] Ricinus RCA-I, RCA-II, beta-trefoil lectin. LECp.Ric.Com.se.Cga1 communis. Ricin. (Ricin D) LECp.Ric.Com.se.Cga2 (Ricin E) LECp.Ric.Com.se.Cga2 (RCA, RSL). [567] Robinia RPA-I, RCA-III. . LECp.Rob.Pse.se.Hcu1 pseudoacacia. (RPsA-I) LECp.Rob.Pse.se.Hcu2 (RPsA-II) LECp.Rob.Pse.se.Hcu1 (RPbA-I) LECp.Rob.Pse.se.Hcu2 (RPbA-II). [568] Rubus fructicosus. RFA. ?. LECp.Rub.Fru.tc.Xga1. [569] Rubus idaeus. . . LECp.Rub.Ida.xx.Xxxx. [570] Rutilus rutilus. . . LECv.Rut.Rut.xx.Xxxx. [571] Salmo gairdneri. . . LECa.Sal.Gai.xx.Xxxx. [572] Salmo salar v. . . LECa.Sal.Sal.xx.Xma1. Atlantica. [573] Salmo salar v. . . LECa.Sal.Sal.xx.Xxxx. Chinook. [574] Salmo trutta. . . LECa.Sal.Tru.xx.Xxxx. [618] Tetragonolobus . . LECp.Tet.Pur.xx.Xxxx. pupurea. [619] Thermopsis. . . LECz.The.sss.xx.Xxxx. [621] Toxopneustes . C-lectin. LECi.Xxx.Xxx.xx.Xxxx. pileolu. [622] Trichoderma. . . LECf.Tri.Sss.xx.Xxxx. [623] Tricholoma . . LECf.Tri.Mon.xx.Xxxx. mongolicum. [624] Tricholomataceae . . LECf.Tri.Sss.xx.Xxxx. 93-138. [625] Tricholomataceae . . LECz.Tri.Sss.xx.Xxxx. 93-34. [626] Trichosanthes TJA-II, TJA-I, TK-I, . LECp.Tri.Jap.xx.Xxxx. japonica. TK-II. [627] Trifolium repens. . . LECp.Tri.Rep.xx.Xxxx. [628] Triticum WGA. Hevein domain LECp.Tri.Aes.se.Hch1. aestivium. lectin, chitin binding lectin. [629] Tulipa gesneriana. TGA. . LECp.Tul.Ges.xx.Xxxx. [630] Udotea petiolata. . . LECp.Udo.Pet.xx.Xxxx. [631] Ulex europaeus. UEA-I, UEA-II, Legume lectin. LECp.Ule.Eur.xx.Xxxx. UEA-III. [632] Ulva lactuca. . . LECu.Ulv.Lac.xx.Xxxx. [633] Ulva laetevirens. . . LECu.Ulv.Lae.xx.Xxxx. [635] Ulva rigida. . . LECz.Ulv.Rig.xx.Xxxx. [637] Urtica dioica. UDA. Chitin-binding LECp.Urt.Dio.rh.Hch1. lectins. [638] Vaejovis . . LECi.Vae.Con.xx.Xxxx. confuscius. [639] Vatairea VML. . LECp.Vat.Mac.xx.Xxxx. macrocarpa. [640] Vibrio . . LECb.Vib.Alg.xx.Xch1. alginolyticus. [641] Vibrio chlolera. VPCV; Chitovibrin. . LECb.Vib.Cho.xx.Xxxx. [642] Vicia cracca. . . LECp.Vic.Cra.xx.Xxxx. [643] Vicia ervilia. . . LECp.Vic.Erv.xx.Xxxx. [644] Vicia faba. VFA, Favin. Legume lectin. LECp.Vic.Fab.xx.Xxxx. [645] Vicia graminea. VGA. . LECp.Vic.Gra.xx.Xxxx. [646] Vicia hyrcanica. . . LECp.Vic.Hyr.xx.Xxxx. [647] Vicia sativa. . . LECp.Vic.Sat.xx.Xxxx. [648] Vicia unijuga. VUA. . LECp.Vic.Unj.xx.Xxxx. [649] Vicia villosa. VVA-A4, VVL-A4. Legume lectin. LECp.Vic.Vil.xx.Xxxx. [650] Vigna radiata. MBL-I, MBL-II. . LECp.Vig.Rad.xx.Xxxx. [651] Vigna unguiculata. . . LECp.Vig.Ung.xx.Xxxx. [652] Viscum album. ML-I, ML-II, ML-III, Beta-trefoil lectin LECp.Vis.Alb.pl.Cga1 Viscumin, (ML-I). (ML-I, viscumin) VisAlbCBA. LECp.Vis.Alb.pl.Cga2 (ML-II, viscumin) LECp.Vis.Alb.pl.Cga3 (ML-III, VAA-II) LECp.Vis.Alb.pl.Hch1 (VisAlbCBA). [653] Vitis vinifera. . . LECp.Vit.Vin.xx.Xxxx. [654] Volvariella VVL. . LECf.Vol.Vol.xx.Xxxx. volvacea. [655] Wistaria WFA. . LECp.Wis.Flo.xx.Xxxx. floribunda. [656] Wistaria . . LECp.Wis.Flo.xx.Xxxx. floribunda. [657] Wistaria sinensis. . . LECp.Wis.Sin.xx.Xxxx. [658] Wistaris . . LECz.Wis.Bra.xx.Xxxx. brachbotrys. [659] Xanthosoma . . LECp.Xan.Sag.xx.Xxxx. sagittifolium. [660] Xenopus laevis . . LECa.Xen.Lae.xx.Xga1. ovum. [661] Xeromus . . LECz.Xer.Chr.xx.Xxxx. chrysenteron. [662] Xylaria . . LECf.Xyl.Pol.xx.Xxxx. polymorpha. [663] Zea mays. ZMA-I, ZMA-II, . LECp.Zea.May.xx.Xxxx. ZMEA. [664] Cannabis sativa. CSA. . LECp.CanSat.se.Glu. [665] Smilax glabra. Sarparilla. . LECp.SmiGla.rh.xxx. [666] Trichosanthes Snake gourd. . . anguina.

[0136] Lectin codes take the following form: 2 LLLx.Ggg.Sss.ti.TspN

[0137] An explanation of each index variable follows.

[0138] LLL refers to the general category of agglutinin. At this point six general categories are recognized: lectins (LEC), integrins (INT), cadherins (CDH), annexins (ANN), selectins (SEL) and galectins (GLT). The x value refers to the taxonomic groups of the agglutinin, Table 1 summarizes these categories: 3 Category Taxonomic group LECa, GLTa Lectin or galectin from higher animal, typically vertebrates. LECh, GLTh Lectin or galectin from humans LECi, GLTi Lectin or galectin from invertebrates LECp. Plant lectins LECf. Lectin from fungi LECu. Lectin from unicellular organisms LECb. Lectin from Bacteria LECv. Viral lectins

[0139] Ggg stands for the three first letters of the plant genus name (in Latin).

[0140] Sss stands for the three first letters of the plant species name (in Latin).

[0141] ti refers to the tissue from which the lectin has been isolated. Table 2 summarizes the indices used for the various tissues: 4 Tissue, cell or organ Taxonomic grouping Index Bark Plant Ba Bulb Plant Bu Cell membrane Bacteria, Unicellular Cm Epidermis Human, vertebrates Ep Fruit Plant Fr Hemolymph Invertebrates He Latex Plant La Leaf Plant Le Nodule Plant No Organ or cell type Human, vertebrates, Oc Invertebrates Phloem sap Plant Ps Rhizome Plant Rh Root Plant Ro Seed Plant Se Serum or plasma Human, vertebrates, Sr Invertebrates Spores or fruiting bodies Fungi Sp Stem Plant St Tentacles Invertebrates Te Tuber Plant Tu Whole body homogenate Invertebrates Wb Venom Invertebrates Ve Undefined Human, vertebrates, Un Invertebrates, Bacteria, Unicellular, Virus, Fungal

[0142] T refers to the lectin subtype. Hololectins, merolectins, chimerolectins and superlectins are indicated by the letters H, M, C and S, respectively.

[0143] sp refers to the specificity group. Each group is indicated by the index given in Table 3: 5 Specificity Index of group Mannose-binding lectins ma Mannose/maltose-binding mm lectins Mannose/glucose-binding mg lectins GlcNAc/(GlcNAc)-binding ch lectins Gal/GalNAc-binding lectins ga Fucose-binding lectins fu Sialic acid-binding lectins si Lectins with a complex but co known specificity Lectins with a complex and cu unknown specificity Lectins with a dual specificity du Lectins with an undetermined nd specificity

[0144] Lipids

[0145] A multifunctional molecule of the invention can also be a molecule that comprises a first part which comprises a lipid and a second part which comprises an amino acid sequence which can bind to a cell surface molecule, e.g. a cell surface molecule of an APC. The attachment of a lipid, e.g. a long-chain fatty acid, to a molecule, e.g. a polypeptide, can permit the complex to become stably associated with the plasma membrane when the complex is admixed with a cell (Nagarajan et al, 1995, J Immunol Methods 184:241-51; McHugh et al, 1995, PNAS 92:8059-63; van den Berg et al, 1995, J Cell Biol, 131:669-77). This is believed to occur through intercalation of the lipid into the membrane. A convenient method of producing a lipid-associated polypeptide comprises expressing, in a suitable host cell, a nucleic acid encoding, in part, a signal sequence directing the post-translational addition of a GPI moiety. Using recombinant DNA technology, a naturally non-GPI linked protein can be expressed as a GPI-linked protein by constructing a nucleic acid that encodes the protein linked to a heterologous GPI signal sequence. Nucleotide sequences encoding GPI signal sequences useful for this purpose include, for example, those comprised by decay accelerating factor (e.g., sequences encoding amino acid sequence “22” in Table 1 of Bucht and Hjalmarsson, 1996, Biochim Biophys Acta 1292:223-32; sequences encoding signal sequences disclosed in Caras et al, U.S. Pat. No. 5,109,113); brevican (e.g., nt 1982-2047 of Genbank accession number X86406), mesothelin (e.g., nt 1858-1983 of Genbank U40434), coccidioides immitis antigen 2 (e.g., sequences encoding amino acids 172-194 of NCBI Entrez protein database accession #1256444, Zhu et al, 1996, Gene 181:121-5), acetylcholinesterase (e.g., sequences encoding the peptide “HC” as described in Duval et al, 1992, EMBO J 11:3255-61; (e.g., sequences encoding amino acid sequence “19” in Table 1 of Bucht and Hjalmarsson, 1996, Biochim Biophys Acta 1292:223-32)), human folate receptors alpha and beta (e.g., sequences encoding amino acids 230-257 of NCBI Entrez protein database accession #182416 or amino acids 228-255 of NCBI Entrez protein database accession #1655592, Yan and Ratnam, 1995, Biochemistry 34:14594-600), 5′ nucleotidase (e.g., sequences encoding amino acids 547-570 or 547-574 of NCBI Entrez protein database accession #404502, Furukawa et al, 1994, Biochim Biophys Acta 1190:273-8; (e.g., sequences encoding amino acid sequences “5” or “6” in Table 1 of Bucht and Hjalmarsson, 1996, Biochim Biophys Acta 1292:223-32)), CD59 (e.g. encoded by nt 393-473 of Genbank U48255; sequences encoding amino acid sequence “20” in Table 1 of Bucht and Hjalmarsson, 1996, Biochim Biophys Acta 1292:223-32; sequences encoding amino acids 74-101 of FIG. 2 of Powell et al, 1997, J Immunol 158:1692-1702), T-cadherin (e.g., sequences encoding the 76 C-terminal amino acids of chick T cadherin as described by Koller and Ranscht, 1996, J Biol Chem 271:30061-7), aminopeptidase P (e.g., sequences encoding amino acids 649-673 of NCBI Entrez protein database accession #1517942, Hyde et al, 1996, Biochem J 319:197-201), carboxypeptidase M, CD16B, Thy1, carbonic anhydrase IV (e.g., sequences encoding amino acids 284-312 of NCBI Entrez protein database accession #179791, Okuyama et al, 1995, Arch Biochem Biophys 320:315-22), placental alkaline phosphatase (e.g., sequences encoding amino acids 498-529 of NCBI Entrez protein database accession #178464, Oda et al, 1994, Biochem J 301:577-83), neuronal glycoprotein F3, carcinoembryonic antigen (e.g., sequences encoding amino acid sequence “28” in Table 1 of Bucht and Hjalmarsson, 1996, Biochim Biophys Acta 1292:223-32), MRC-OX45 (e.g., sequences encoding amino acid sequence “2” in Table 1 of Bucht and Hjalmarsson, 1996, Biochim Biophys Acta 1292:223-32), RT 6.2 (e.g., sequences encoding amino acid sequence “3” in Table 1 of Bucht and Hjalmarsson, 1996, Biochim Biophys Acta 1292:223-32), D. discoideum prespore-specific antigen (e.g., sequences encoding amino acid sequence “4” in Table 1 of Bucht and Hjalmarsson, 1996, Biochim Biophys Acta 1292:223-32), microsomal dipeptidase (e.g., sequences encoding amino acid sequence “8” in Table 1 of Bucht and Hjalmarsson, 1996, Biochim Biophys Acta 1292:223-32), CAMPATH-1 (e.g., sequences encoding amino acid sequence “9” in Table 1 of Bucht and Hjalmarsson, 1996, Biochim Biophys Acta 1292:223-32), T. brucei PARP (e.g., sequences encoding amino acid sequence “10” in Table 1 of Bucht and Hjalmarsson, 1996, Biochim Biophys Acta 1292:223-32), T. brucei VSG Mit 118a (e.g., sequences encoding amino acid sequence “11 ” in Table 1 of Bucht and Hjalmarsson, 1996, Biochim Biophys Acta 1292:223-32), T. brucei VSG Mit 117a (e.g., sequences encoding amino acid sequence “12” in Table 1 of Bucht and Hjalmarsson, 1996, Biochim Biophys Acta 1292:223-32), T. brucei VSG MITat 1.1000 BC (e.g., sequences encoding amino acid sequence “13” in Table 1 of Bucht and Hjalmarsson, 1996, Biochim Biophys Acta 1292:223-32), T. brucei VSG MITat 1.5b (e.g., sequences encoding amino acid sequence “14” in Table 1 of Bucht and Hjalmarsson, 1996, Biochim Biophys Acta 1292:223-32), T. brucei VSG ILTat 1.1 (e.g., sequences encoding amino acid sequence “15” in Table 1 of Bucht and Hjalmarsson, 1996, Biochim Biophys Acta 1292:223-32), T. brucei VSG TxTat 1 (e.g., sequences encoding amino acid sequence “16” in Table 1 of Bucht and Hjalmarsson, 1996, Biochim Biophys Acta 1292:223-32), T. brucei VSG Mit 221 (e.g., sequences encoding amino acid sequence “17” in Table 1 of Bucht and Hjalmarsson, 1996, Biochim Biophys Acta 1292:223-32), prion proteins (e.g., sequences encoding amino acid sequence “18” in Table 1 of Bucht and Hjalmarsson, 1996, Biochim Biophys Acta 1292:223-32), urokinase receptor (e.g., sequences encoding amino acid sequence “21” in Table 1 of Bucht and Hjalmarsson, 1996, Biochim Biophys Acta 1292:223-32), T. congolense VSG YNat 1.1 (e.g., sequences encoding amino acid sequence “23” in Table 1 of Bucht and Hjalmarsson, 1996, Biochim Biophys Acta 1292:223-32), S. cerevesiae GAS-1 (e.g., sequences encoding amino acid sequence “24” in Table 1 of Bucht and Hjalmarsson, 1996, Biochim Biophys Acta 1292:223-32), Thy-1 (e.g., sequences encoding amino acid sequences “25” or “26” in Table 1 of Bucht and Hjalmarsson, 1996, Biochim Biophys Acta 1292:223-32), L. major PSP (e.g., sequences encoding amino acid sequence “29” in Table 1 of Bucht and Hjalmarsson, 1996, Biochim Biophys Acta 1292:223-32), D. discoideum contact site A glycoprotein (e.g., sequences encoding the 25 C-terminal amino acids as described in Barth et al, 1996, Biochem J 317:533-40)CD24, and synthetic sequences (e.g. as described by Coyne et al, 1993, J Biol Chem 268:6689-93).

[0146] GPI-linked polypeptides can be extracted from cells using the following method. 5×106 cells are spun down and frozen at −80° C. The pellet is thawed in 14 ml of 0.15M NaCl/10 mM Tris 7.4/0.1 mM primaquine/2% Trito X-114 with stirring at 0° C. for 1 h, then centrifuged at 8800 g at 0° C. for 10 min. The supernatant is maintained at −20° C. overnight, thawed at room temperature, and then placed at 32° C. for 12 min. It is then centrifuged at 3000 g for 3 min at 32° C. The top layer is decanted and 11 ml of cold Buffer A (0.15M NaCl/10 mM Tris 7.4/0.1 mM primaquine/0.06% Triton X-114) is added to the bottom layer. This is incubated on ice for 10 min. The 12 min 32° C. incubation, 32° C. 3000 g centrifugation, decanting of top layer, and addition of 11 ml cold Buffer A to bottom layer are repeated. The solution is centrifuged at 18000 g for 10 min at 0° C. The 12 min 32° C. incubation, 32° C. 3000 g centrifugation, and decanting of top layer are repeated. 3 vol of cold acetone are added to the final bottom phase. The solution is centrifuged at 12,000 RPM for 30 min, the supernatant removed, and the protein pellet containing the GPI fraction dried under vacuum. Specific proteins can be purified by methods well-known to those skilled in the art, e.g. immunoaffinity purification.

[0147] Another method of producing a lipid-linked polypeptide is to chemically link the polypeptide to a fatty acid such as palmitate. 1.5 mg/ml of the polypeptide is suspended in PBS, pH 7.8, containing 0.3% deeoxycholic acid, 0.1% sodium bicarbonate, and 0.1% sodium azide. The optimal final pH of the solution is 7.6-8.0. The mixture is warmed to 37° C. and the N-hydroxysuccinimide ester of palmitic acid (Research Organics, Cleveland, Ohio) is added to a final concentration of 0.1 mg/ml. The solution is incubated overnight at room temperature. The polypeptide is purified by passage through a 16×250 mm Sephadex G-75 chromatography column equilibrated with 0.15% deoxycholic acid in PBS, pH 7.6.

[0148] Crosslinking Moieties Useful According to the Invention

[0149] Another convenient method of linking a ligand to an antigen bearing target is to use a crosslinking agent. A “crosslinking agent” is a chemical entity that can react with functional groups on at least two other molecules, e.g. two polypeptides or a polypeptide and a lipid, such that upon reaction with the crosslinking agent the two molecules become covalently linked. Thus, a ligand for CD40 can be crosslinked to a molecule on the surface of a cell.

[0150] A wide variety of crosslinking agents, both bifunctional and polyfunctional, are known in the art and are commercially available, e.g. from Sigma (St. Louis, Mo.). These include, for example, S-acetylmercaptosuccinic anhydride, S-acetylthioglycolic acid N-hydroxysuccinimide ester, S-acetylthiopropionic acid N-hydroxysuccinimide ester, adipic acid dihydrazide, 4-azidobenzoic acid N-hydroxysuccinimide ester, N-(5-azido-2-nitrobenzyloxy)succinimide, 6-(4-azido-2-nitrophenylamino)hexanoic acid N-hydroxysuccinimide ester, p-azidophenacyl bromide, N-(4-azidophenylthio)phthalimide, 4-azidosalicylic acid N-hydroxysuccinimide ester, bromoacetic acid N-hydroxysuccinimide ester, 1,4-butanediol diglycidyl ether, carbonyl-bis(L-methionine p-nitrophenyl ester), 2-diazo-3,3,3-trifluoropropionic acid p-nitrophenyl ester, diethyl malonimidate, 1,5-difluoro-2,4-dinitrobenzene, 4,4′-diisothiocyanatostilbene-2,2′-disulfonic acid, dimethyl adipimidate, dimethyl 3,3′-dithiobispropionimidate, dimethyl pimelimidate, dimethyl suberimidate, 4,4′-dithiobisphenyl azide, dithiobis(propionic acid N-hydroxysuccinimide ester), ethylene glycol bis-(succinic acid N-hydroxysuccinimide ester), 4-fluoro-3-nitrophenyl azide, bis-(4-fluoro-3-nitrophenyl) sulfone, p-formylbenzoic acid N-hydroxysuccinimide ester, glutaraldehyde, 2-iminothiolane, 6-(iodoacetamido)caproic acid N-hydroxysuccinimide ester, iodoacetic acid N-hydroxysuccinimide ester, 3-malemidoacetic acid N-hydroxysuccinimide ester, 3-malemidobenzoic acid N-hydroxysuccinimide ester, 4-(N-malemido)benzophenone, gamma-malemidobutyric acid N-hydroxysuccinimide ester, epsilon-malemidocaproic acid N-hydroxysuccinimide ester, 4-(N-malemidomethyl)cyclohexanecarboxylic acid N-hydroxysuccinimide ester, 4-(N-malemidomethyl)cyclohexanecarboxylic acid 3-sulfo-N-hydroxysuccinimide ester, beta-malemidopropionic acid N-hydroxysuccinimide ester, N,N′-bis(3-malemidopropionyl)-2-hydroxy-1,3-propanediamine, 1,4-phenylene diisothiocyanate, N,N′-o-phenylene dimalemide, N,N′-p-phenylene dimalemide, polyoxyethylene bis(glycidyl ether), bis(polyoxyethylene bis(glycidyl ether)), polyoxyethylene bis(imidazolylcarbonyl), bis(polyoxyethylene bis(imidazolylcarbonyl)), polyoxyethylene bis(p-nitrophenyl carbonate), 3-(2-pyridyldithio)propionic acid N-hydroxysuccinimide ester, suberic acid bis(N-hydroxysuccinimide) ester, succinic acid malemidoethyl N-hydroxysuccinimide ester, 1,5bis(succinimidooxycarbonyloxy)-pentane, and bis(N-succinimidyl) carbonate.

[0151] Ligands of a Cell Surface Protein

[0152] The multifunctional molecules of the present invention comprise one part which is a lectin and is capable of binding to at least one carbohydrate molecule on an antigen bearing target, and a second part comprising a ligand for a cell surface protein of an antigen presenting cell. The ligand can be any ligand which binds to one or more of the cell surface molecules indicated by GenBank Accession number in Appendix I or II. More preferably, however, the ligand includes, but is not limited to an opsonin, a cytokine, a heat shock protein, an adhesion molecule. a defensin, or a counterreceptor for a T cell costimulatory molecule; or a portion of any of these molecules, e.g., about (or at least about) 5, 8, 10, 12, 15, 20, 25, 35, 40, 50, 60, 70, 80, 100, or 120 contiguous amino acid residues, up to the full length of such a molecule.

[0153] Cytokines Useful According to the Invention

[0154] The term “cytokine” as defined hereinabove refers to a polypeptide molecule that is naturally secreted by mammalian cells and that binds to a cell surface receptor on a leukocyte. The term “cytokine” also refers herein to a polypeptide molecule that is a ligand for a receptor for a naturally occurring cytokine. Unlike an opsonin, a cytokine does not naturally contemporaneously bind an antigen and a cell-surface receptor.

[0155] Leukocytes which bear receptors for cytokines include, for example, monocytes, macrophages, dendritic cells, neutrophils, eosinophils, basophils, platelets, lymphocytes, T lymphocytes, B lymphocytes, NK cells, myeloma cells, lymphoma cells, and leukemic cells.

[0156] Without being bound by any one mechanism, it is believed that cell-surface associated cytokines provide an advantage over freely diffusible cytokines by allowing stable juxtaposition of the cytokine to the cell, thus increasing the concentration of cytokine in the vicinity of the cell.

[0157] Preferred cytokines are non-rodent cytokines, e.g primate, e.g. human cytokines.

[0158] Some cytokines can be regarded as belonging to one or more families of cytokines based on structural and/or functional properties. One such family consists of the interleukins. Interleukins are structurally diverse, but share the property of both being expressed by and acting on leukocytes. Examples of interleukins include IL-1 (e.g. polypeptides encoded by Genbank Accession No. M15330, M28983, E04743, M15131) IL-2 (e.g. polypeptides encoded by Genbank Accession No. E01108, K02797), IL-3 (e.g. polypeptides encoded by Genbank Accession No. A02046, M14743), IL-4 (e.g. polypeptides encoded by M13982, M25892), IL-5 (e.g. polypeptides encoded by X06270, J03478), IL-6 (e.g. polypeptides encoded by E02772, M20572), IL-7 (e.g. polypeptides encoded by J04156, M29054-29057), IL-8 (e.g. polypeptides encoded by M28130), IL-9 (e.g. sequences disclosed in Kelleher et al, Blood. 1991; 77: 1436-1441, Immunogenetics 1990;31(4):265-270), IL-10 (e.g. polypeptides encoded by M84340, U16720), IL-11 (e.g. sequences disclosed in Paul et al, Proc Natl Acad Sci USA. 1990; 87: 7512-7516, Morris et al, Exp Hematol. 1996; 24: 1369-1376), IL-12 (e.g. polypeptides encoded by Genbank Accession No. M86671, S82412; Genbank protein P29459, P29460), IL-13 (e.g. polypeptides encoded by U31120, L13028), IL-14 (e.g. sequences disclosed in Ambrus et al, Proceedings of the National Academy of Science (USA) 1993; 90: 6330-4), IL-15 (e.g. polypeptides encoded by AF031167, U22339), IL-16 (e.g. polypeptides encoded by AF006001, M90391), IL-17 (e.g. polypeptides encoded by U32659, U43088), IL-18 (e.g. polypeptides encoded by D49949, D49950), IL-19 (e.g. polypeptides encoded by AY040367), IL-20 (e.g. polypeptides encoded by NM02130, NM018724), IL-21 (e.g. polypeptides encoded by AF254069, AF254070), IL-22 (e.g. polypeptides encoded by AF279437), IL-23 (e.g. polypeptides encoded by AF301619, AF301620, AY055379 [p19 alpha chain combines with IL-12 p40 chain to form IL-23]), IL-24 (e.g. polypeptides encoded by AF276916, NM053095), IL-25 (e.g. polypeptides encoded by NM080837), TNF-alpha (e.g. polypeptides encoded by M16441, Y00467), and GM-CSF (e.g. polypeptides encoded by X03019, M11220) and their homologues among species. Nucleotide sequences encoding homologues will hybridize to each other under moderate- to high-stringency conditions.

[0159] Another family consists of the hematopoietins. Members of this family comprise helical regions, known as helices A, B, C, and D. Helices A and B and helices C and D run roughly parallel to each other, respectively. Examples of hematopoietins include IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-9, IL-11, IL-12, IL-13, IL-15, GM-CSF, G-CSF (e.g. polypeptides encoded by Genbank Accession No. E01219, M13926), oncostatin M (e.g. polypeptides encoded by Genbank Accession No. D31942, sequences disclosed in Malik et al, Mol Cell Biol 1989, 9:2847-2853), LIF (e.g. polypeptides encoded by Genbank Accession No. X13967, X06381), CNTF (e.g. polypeptides encoded by Genbank Accession No. U05342, X60542), and their homologues among species. Nucleotide sequences encoding homologues will hybridize to each other under moderate- to high-stringency conditions.

[0160] Human IL2 is a protein of 133 amino acids (15.4 kDa) with a slightly basic pI. Murine and human IL2 display a homology of approximately 65%. IL2 is synthesized as a precursor protein of 153 amino acids with the first 20 amino-terminal amino acids functioning as a hydrophobic secretory signal sequence. The protein contains a single disulfide bond (positions Cys58/105) essential for biological activity.

[0161] IL2 is O-glycosylated at threonine at position 3. Variants with different molecular masses and charges are due to variable glycosylation. Non-glycosylated IL2 is also biologically active. Glycosylation appears to promote elimination of the factor by hepatocytes.

[0162] A dimeric form of human IL2, produced by the action of a transglutaminase isolated from regenerating fish optic nerves, has been shown to be a cytotoxic factor for rat brain oligodendrocytes in culture.

[0163] The human IL2 gene contains four exons. The IL2 gene maps to human chromosome 4q26-28 (murine chromosome 3). The homology of murine and human IL2 is 72% at the nucleotide level in the coding region.

[0164] The biological activities of IL2 are mediated by a membrane receptor that is expressed almost exclusively on activated, but not on resting, T-cells at densities of 4-12×103 receptors/cell. Activated B-cells and resting mononuclear leukocytes rarely express this receptor. The expression of the IL2 receptor is modulated by IL5 and IL6. Three different types of IL2 receptors are distinguished that are expressed differentially and independently. The high affinity IL2 receptor (Kdis˜10 pM) constitutes approximately 10% of all IL2 receptors expressed by a cells. This receptor is a membrane receptor complex consisting of the two subunits IL2R-alpha (TAC antigen=T-cell activation antigen; p55) and IL2R-beta (p75; CD122) as the ligand binding domains and a gamma chain as a signaling component. p75 is expressed constitutively on resting T-lymphocytes, NK-cells, and a number of other cell types while the expression of p55 is usually observed only after cell activation. p55 is, however, synthesized constitutively by a number of tumor cells and by HTLV-1-infected cells.

[0165] IL2 receptor expression of monocytes is induced by IFN-gamma, so that these cells become tumor-cytotoxic. In T-cells the expression of p75 can be reduced by IL3. An intermediate affinity IL2 receptor (Kdis=100 pM) consists of the p75 subunit and a gamma chain (see below) while a low affinity receptor (Kdis=10 nM) is formed by p55 alone.

[0166] p55 (e.g. polypeptides encoded by Genbank Accession No. X01057) has a length of 251 amino acids with an extracellular domain of 219 amino acids an a very short cytoplasmic domain of 13 amino acids. The p55 gene maps to human chromosome 10p14-p15.

[0167] p75 (e.g. polypeptides encoded by Genbank Accession No. M26062, M28052) has a length of 525 amino acids with an extracellular domain of 214 amino acids and a cytoplasmic domain of 286 amino acids. The p75 gene contains 10 exons and has a length of approximately 24 kb. It maps to human chromosome 22q11.2-q12 and to murine chromosome 15 (band E).

[0168] A third 64 kDa subunit of the IL2 receptor, designated gamma, has been described (e.g. polypeptides encoded by Genbank Accession No. D13821, D11086). Murine and human gamma subunits of the receptor have approximately 70% sequence identity at the nucleotide and amino acid levels. This subunit is required for the generation of high and intermediate affinity IL2 receptors but does not bind IL2 by itself. These two receptor types consist of an alpha-beta-gamma heterotrimer and a beta-gamma heterodimer, respectively. The gene encoding the gamma subunit of the IL2 receptor maps to human chromosome Xq13, spans approximately 4.2 kb and contains eight exons. The gamma subunit of the IL2 receptor has been shown recently to be a component of the receptors for IL4 and IL7. It is also believed to be a component of the IL13 receptor.

[0169] The amino acids at positions 267-317 lying directly adjacent to the transmembrane region of p75 are involved in IL2-mediated signal transduction. In addition the IL2 receptor is associated with a number of other proteins (p22, p40, p100) which are thought to be involved in mediating conformational changes in the receptor chains, receptor-mediated endocytosis, and further signal transduction processes. One of the identified proteins is the 95 kDa cell adhesion molecule ICAM-1 which probably focuses IL2 receptors at regions of cell-to-cell contacts and thus may mediate paracrine activities, for example, during IL2-mediated stimulation of T-cells. Another protein associated with p75 is a tyrosine-specific protein kinase called lck. The observation that proliferation of cells induced by IL2 is inhibited by specific inhibitors of protein tyrosine kinases in an lck negative cell line suggests that other kinases may also be associated with IL2 receptors. Two such kinases, called fyn and lyn, have been identified. In addition, IL2 receptor signaling may also be mediated by vav.

[0170] Activated lymphocytes continuously secrete a 42 kDa fragment of the TAC antigen. This fragment circulates in the serum and plasma and functions as a soluble IL2 receptor (sIL2R). The concentrations of this soluble receptor vary markedly in different pathological situations, for example, infections, autoimmune diseases, leukemias, or after organ transplantation. Levels may increase up to 100-fold. The levels of sIL2R appear to correlate with the severity of HIV-induces diseases and may be of diagnostic value also in other settings.

[0171] Mouse and human IL2 both cause proliferation of T-cells of the homologous species at high efficiency. Human IL2 also stimulates proliferation of mouse T-cells at similar concentrations, whereas mouse IL2 stimulates human T-cells at a lower (sixfold to 170-fold) efficiency.

[0172] IL2 is a growth factor for all subpopulations of T-lymphocytes. It is an antigen-unspecific proliferation factor for T-cells that induces cell cycle progression in resting cells and thus allows clonal expansion of activated T-lymphocytes. This effect is modulated by hormones such as prolactin.

[0173] IL2 also promotes the proliferation of activated B-cells also this requires the presence of additional factors, for example, IL4.

[0174] Due to its effects on T-cells and B-cells IL2 is a central regulator of immune responses. It also plays a role in anti-inflammatory reactions, in hematopoiesis and in tumor surveillance. IL2 stimulates the synthesis of IFN-gamma in peripheral leukocytes and also induces the secretion of IL1, TNF-alpha and TNF-beta.

[0175] It is believed that he induction of the secretion of tumoricidal cytokines apart from the activity in the expansion of LAK cells (lymphokine-activated killer cells) are probably the main factors responsible for the antitumor activity of IL2.

[0176] IL2 can be assayed in bioassays employing cell lines that respond to the factor (e.g., ATH8, CT6, CTLL-2, FDCPmix, HT-2, NKC3, TALL-103). Specific ELISA assays for IL2 and enzyme immunoassays for the soluble receptor are also available. The soluble receptor can be detected also by employing biotinylated IL2 and flow-through cytometry or ELISA assays.

[0177] IL2 displays significant anti-tumor activity for a variety of tumor cell types since it supports the proliferation and clonal expansion of T-cells that specifically attack certain tumors. IL2 is increasingly used to treat patients with cancers refractory to conventional treatment. Combination therapy with systemically administered IL2 has resulted in long-term remissions in 30% of patients with metastatic renal cell carcinoma, for which there is no standard treatment. Objective and long-lived clinical responses have been documented also in a proportion of patients with melanoma or acute myeloid leukemia.

[0178] High dose systemic IL2 therapy is also associated with a great number of unwanted toxic side-effects. IL2 has additional effects on other components of the cellular immune system, including B-cells and macrophages, and induces the secretion of other soluble mediators, including TNF-alpha, TNF-beta, and IFN-gamma. These effects may contribute to the antitumor activity of IL2 as well as to its dose-related toxicity.

[0179] The transduction of murine tumor cells with a functional IL2 gene has been shown to lead to the rejection of the genetically modified cells by syngeneic hosts. Altered tumor cells expressing IL2 also increase systemic immunity.

[0180] Human IL4 is a protein of 129 amino acids (20 kDa) that is synthesized as a precursor containing a hydrophobic secretory signal sequence of 24 amino acids. IL4 is glycosylated at two arginine residues (positions 38 and 105) and contains six cysteine residues involved in disulfide bond formation. The disulfide bonds are essential for biological activity. Some glycosylation variants of IL4 have been described that differ in their biological activities. A comparison of murine and human IL4 shows that both proteins only diverge at positions 91-128.

[0181] An IL4 variant, Y124D, in which Tyr124 of the recombinant human protein is substituted by an aspartic acid residue, binds with high affinity to the IL4 receptor (Kd=310 pM). This variant is a powerful antagonist for the IL4 receptor system. It retains no detectable proliferative activity for T-cells and competitively inhibits IL4-dependent T-cell proliferation (K(i)=620 pM). The existence of this mutant demonstrates that high affinity binding and signal generation can be uncoupled efficiently in a ligand. Y124D also acts as a powerful antagonist for the IL13 receptor.

[0182] The human IL4 gene contains four exons and has a length of approximately 10 kb. It maps to chromosome 5q23-31. The murine gene maps to chromosome 11. The IL4 gene is in close proximity to other genes encoding hematopoietic growth factors (e.g., GM-CSF, M-CSF, IL3, IL5). The distance between the IL4 and the IL5 gene is approximately 90-240 kb.

[0183] At the nucleotide level the human and the murine IL4 gene display approximately 70% homology. The 5′ region of the IL4 contains several sequence elements, designated CLE (conserved lymphokine element), that are binding sites for transcription factors controlling the expression of this and other genes. A sequence motif, called P sequence (CGAAAATTTCC; SEQ ID NO: 1) in the 5′ region of the human IL4 gene (positions -79--69) is the binding site for a nuclear factor, called NF(P), mediating the response to T-cell activation signals.

[0184] The biological activities of IL4 are mediated by a specific receptor (Kdis=20-100 pM) which is expressed at densities of 100-5000 copies/cell (e.g. polypeptides encoded by Genbank Accession No. M29854, X52425). The extracellular domain of the IL4 receptor is related to the receptors for erythropoietin (Epo), IL6, and the beta chain of the IL2 receptor. It has been given the name CD124.

[0185] The cDNA for the murine IL4 receptor encodes a transmembrane protein of 810 amino acids (including a secretory signal sequence). This receptor has a large intracellular domain of 553 amino acids. The human receptor has an extracellular domain of 207 amino acids, a transmembrane domain of 24 residues, and a large intracellular domain of 569 amino acids.

[0186] The IL4 receptor has been shown recently to contain the gamma subunit of the IL2 receptor as a signaling component. This gamma subunit is also associated with the receptors for IL4 and IL7 and probably also of IL13. Two forms of the receptor have been described, one of which is secreted. The secreted receptor only contains the extracellular IL4 binding domain and is capable of blocking IL4 activities. An IL4 binding protein (IL4-BP) that binds IL4 with the same affinity as the IL4 receptor has been shown also to be a soluble IL4 receptor variant. These soluble receptors probably function as physiological regulators of cytokine activities by inhibiting receptor binding or act as transport proteins. Soluble receptors or binding proteins have been described also for IL1 (IL1 receptor antagonist), IL2, IL6, IL7, TNF-alpha, IGF, and IFN-gamma.

[0187] The biological activities of IL4 are species-specific; mouse IL4 is inactive on human cells and human IL4 is inactive on murine cells. IL4 promotes the proliferation and differentiation of activated B-cells, the expression of class II MHC antigens, and of low-affinity IgE receptors in resting B-cells. IL4 enhances expression of class II MHC antigens on B-cells. It can promote their capacity to respond to other B-cell stimuli and to present antigens for T-cells. This may be one way to promote the clonal expansion of specific B-cells and the immune system may thus be able to respond to very low concentrations of antigens. The production of IL4 by non-B non-T-cells is stimulated if these cells interact with other cells via their Fc receptors for IgE or IgG. This effect can be enhanced by IL3. IL2 and PAF (platelet activating factor) induce the synthesis of IL4 while TGF-beta inhibits it.

[0188] IL3 antagonizes the IL2-induced effects in B-cells and causes a slow decrease of the expression of IL2 receptors, thus inhibiting the proliferation of human B-cells stimulated by IL2. In activated B-cells IL4 stimulates the synthesis of IgG1 and IgE and inhibits the synthesis of IgM, IgG3, IgG2a and IgG2b. This isotype switching induced by IL4 in B-cells is antagonized by IFN-gamma. The growth of multiple myelomas can be suppressed by IL4 which inhibits the synthesis of IL6, a myeloma growth factor. IL4 also inhibits the synthesis of IL6 in human alveolar macrophages.

[0189] Pretreatment of macrophages with IL4 prevents the production of IL1, TNF-alpha and prostaglandins in response to activation of the cells by bacterial endotoxins or IFN-gamma.

[0190] IL4 synergises with Epo and G-CSF/Epo in the generation of colonies containing granulocytes or erythroid progenitor cells in a colony formation assay.

[0191] The classical detection method for IL4 is a B-cell costimulation assay measuring the enhanced proliferation of stimulated purified B-cells. IL4 can be detected also in bioassays, employing IL4-responsive cells (e.g., BALM-4; BCL1; CT.4S; CTL44; CTLL-2; Da; FDCPmix ; HT-2; L4; L138.8A; MO7E; MC/9; NFS-60; Ramos, Sez627, TF-1; TS1). A specific detection method for human IL4 is the induction of CD23 in a number of B-cell lines with CD23 detected either by flow-through cytometry or by a fluorescence immunoassay. An immunoassay that allows rapid determination of the rate of IL4 production under conditions preventing consumption/degradation is cytokine immunotrapping.

[0192] IL4 inhibits the growth of colon and mammary carcinomas. It has been shown to augment the development of LAK cells. The transduction of murine tumor cells with a functional IL4 gene has been shown to lead to the rejection of the genetically modified cells by syngeneic hosts. Altered tumor cells expressing IL4 also increase systemic immunity. Mice vaccinated with transduced cells reject a subsequent challenge of non-transduced cells, and, in some cases, a pre-existing tumor.

[0193] Human IL6 is a protein of 185 amino acids glycosylated at positions 73 and 172. It is synthesized as a precursor protein of 212 amino acids. Monocytes express at least five different molecular forms of IL6 with molecular masses of 21.5-28 kDa. They mainly differ by post-translational alterations such as glycosylation and phosphorylation.

[0194] IL6 isolated from various cell types shows some microheterogeneity in its N terminus. A 42-45 kDa form has been observed in plasma that is probably complexed with a carrier protein, alpha-2-macroglobulin (&agr;2M). Murine and human IL6 show 65% sequence homology at the DNA level and 42% homology at the protein level.

[0195] IL6 is a member of a family of cytokines which also includes LIF, CNTF, Oncostatin M, IL11, and CT-1. All known members of the IL6 cytokine family induce hepatic expression of acute phase proteins.

[0196] A stable and highly bioactive designer cytokine consisting of a fusion protein between IL6 and a soluble IL6 receptor, designated H-IL6, has been used for human hematopoietic progenitor cell expansion and is useful in cases in which cells do not respond to IL6 but require a stable complex consisting of IL6 and a soluble IL6 receptor.

[0197] The human IL6 gene has a length of approximately 5 kb and contains five exons. It maps to human chromosome 7p21-p14 between the markers D7S135 and D7S370. The murine gene maps to chromosome 5. The nucleotide sequences of IL6 and G-CSF genes resemble each other in a way suggesting a possible evolutionary relationship.

[0198] The IL6 receptor (e.g. polypeptides encoded by Genbank Accession No. M20566, E03515) is expressed on T-cells, mitogen-activated B-cells, peripheral monocytes and some macrophage- and B-cell-derived tumor cell types. It is not expressed in resting B-cells but is in resting T-cells. In hepatocytes the IL6 receptor expression is enhanced after treatment with IL6 or IL1. In several cell types the expression of the IL6 receptor is also enhanced by glucocorticoids. The IL6 receptor gene maps to human chromosome 1q21.

[0199] The IL6 receptor is a strongly glycosylated protein of 80 kDa and a length of 449 amino acids. It has been designated CD126. It is synthesized as a precursor of 468 amino acids. The molecular structure resembles that of receptors for M-CSF, PDGF and IL1 in that the receptor contains an immunoglobulin-like sequence domain in the aminoterminal region of the extracellular receptor domain.

[0200] The intracellular domain of the IL6 receptor has a length of approximately 82 amino acids and does not show any homology to other proteins involved in intracellular signal transduction. Two different forms of the receptor have been described that bind IL6 with different affinities (Kdis=10−9 and 10−11 M) and most likely arise by post-translational modification of the same receptor protein. Biological activities of IL6 have been found also at concentrations of 10−13-10−15 M suggesting either the existence of other high-affinity receptor conformations or the existence of further receptor molecules with higher affinities.

[0201] IL6 receptor-mediated signal transduction involves protein kinase C and also adenylate cyclase.

[0202] The complex formed between IL6 and its receptor associates with a transmembrane glycoprotein, gp130 (918 amino acids; cytoplasmic domain of 277 amino acids), that is involved in signal transduction. Binding of IL6 to its receptor leads to disulfide-linked homodimerization of gp130 and the associated activation of a tyrosine kinase as the first step of signal transduction. gp130 is expressed also in cells that do not express IL6 receptors. It has been found to be a component of other receptors, including those for IL11, LIF, Oncostatin M, and CNTF, and CT-1. This explains why LIF, CNTF, and IL6 share many biological activities although the factors themselves are not related to each other. A factor resembling STAT proteins, termed LIL factor, has been found to be involved in signaling pathways of IL6, and also of IL1 and bacterial lipopolysaccharides.

[0203] A soluble form of the IL6 receptor (IL6R-SUP (IL6 receptor soluble urinary protein)) has been described also that also interacts with gp130. These soluble receptors probably function as physiological regulators of cytokine activities by inhibiting receptor binding or act as transport proteins. Similar soluble receptors or binding proteins have been described also for IL1 (IL1ra, IL1 receptor antagonist), IL2, IL4, IL7, TNF-alpha, IGF, and IFN-gamma.

[0204] Some cells, including hematopoietic progenitor cells and neuronal cells, are only responsive towards a combination of IL6 and soluble IL6 receptor but not to IL6 alone.

[0205] Human IL6 is biologically active in monkeys, rats, and mice. Murine IL6 is not active in human cells. The plethora of biological activities is exemplified by the many different acronyms under which IL6 has been described. IL6 is a pleiotropic cytokine influencing antigen-specific immune responses and inflammatory reactions. It is one of the major physiological mediators of cute phase reaction. In hepatocytes IL6 in combination with glucocorticoids induces the synthesis of metallothioneins and increases intracellular zinc levels, thus preventing CCL4-induced hepatotoxicity. IL6 is a neurotrophic factor for cholinergic neurons that promotes their survival in culture. Some neuronal cell lines can be induced to differentiate by IL6.

[0206] IL6, like IL1, stimulates the synthesis of ACTH (Corticotropin) in the pituitary. Glucocorticoids synthesized in response to ACTH inhibit the production of IL6, IL1 and TNF in vivo, thus establishing a sort of negative feedback loop between the immune system and neuroendocrine functions. In astrocytes IL6 induces the synthesis of Nerve Growth Factor (NGF).

[0207] IL6 is a B-cell differentiation factor in vivo and in vitro and an activation factor for T-cells. In the presence of IL2 IL6 induces the differentiation of mature and immature T-cells into cytotoxic T-cells. IL6 also induces the proliferation of thymocytes and probably plays a role in the development of thymic T-cells.

[0208] IL6 is capable of inducing the final maturation of B-cells into immunoglobulin-secreting plasma cells if the cells have been pre-activated by IL4. In B-cells IL6 stimulates the secretion of antibodies to such a degree that serum IgG1 levels can rise 120-400-fold.

[0209] IL6 at concentrations of only 0.002 ng/mL is one of the major autocrine growth modulator for many human myelomas. The growth of these cells can be inhibited by monoclonal antibodies directed against IL6. It can be inhibited also by the introduction of antisense oligonucleotides against IL6 or by IL4. The growth-inhibitory effects of corticosteroids on myeloma cells is probably due to the steroid-induced reduction in the expression of IL6. The growth of human IL6 dependent myeloma cells can be inhibited also by IFN-gamma. IL6 may also function as an autocrine growth modulator for other tumor types, some of which have been found to secrete IL6 constitutively. IL6 has been shown to be an autocrine modulator of growth for in vitro cervical tumor cell growth. On the other hand IL6 blocks the growth of some solid tumors such as mammary carcinomas, cervical carcinomas, human lung cancer cell lines, histiocytic lymphomas, and melanomas.

[0210] IL6 and IL3 synergise in vitro in promoting the proliferation of multipotent hematopoietic progenitor cells. IL6 is also a thrombopoietin that induces the maturation of megakaryocytes in vitro and increases platelet counts in vivo. In murine, but not in human bone marrow cultures IL6 shows activities resembling those of GM-CSF.

[0211] Plasmacytoma cells produce IL6 and also the IL6 receptor. It has been suggested that these cells are stimulated in an autocrine fashion. A paracrine mechanism involving the presence of two different cell populations, one producing the factor and the other expressing the receptor, has been described also.

[0212] IL6 can be detected in bioassays employing IL6 responsive cell lines (e.g., 7TD1; B9; CESS, KPMM2, KT-3; M1, MH60-BSF-2, MO7E; Mono Mac 6; NFS-60; PIL-6; SKW6-C14; T1165; XG-1). IL6 can be assayed also by its activity as a hybridoma growth factor. Sensitive immunoassays and calorimetric tests are also available. An ELISA assay exists for detecting the receptor-associated gp130 protein.

[0213] In combination with other cytokines (for example, IL2) IL6 may be useful in the treatment of some tumor types. The transduction of murine tumor cells with a functional IL6 gene has been shown to lead to the rejection of the genetically modified cells by syngeneic hosts. Altered tumor cells expressing IL6 also increase systemic immunity. Mice vaccinated with transduced cells reject a subsequent challenge of non-transduced cells, and, in some cases, a pre-existing tumor.

[0214] Human IL10 is a homodimeric protein with subunits having a length of 160 amino acids. Human IL10 shows 73% amino acid homology with murine IL10. The human IL10 contains four exons. It is closely related to the product of the BCRF-1 gene (Bam HI C fragment rightward reading frame) of Epstein-Barr virus (84% homology at the protein level). These two proteins are more closely related to each other than human and murine IL10. BCRF-1 has therefore also been called viral IL10 (vIL10). The human IL10 gene maps to chromosome 1. The human IL10 shows 81% homology with murine IL10 at the nucleotide level.

[0215] A receptor has been identified on murine and human cells by using radiolabeled IL10 (e.g. polypeptides encoded by Genbank Accession No. L12120, U00672). Mouse IL10 is capable of blocking binding of human IL10 to mouse but not human cells. The murine IL10 receptor has been cloned. This receptor is a protein of approximately 110 kDa that binds murine IL10 specifically. This receptor is structurally related to receptors for IFN.

[0216] IL10 inhibits the synthesis of a number of cytokines such as IFN-gamma, IL2 and TNF-beta in Th1 subpopulations of T-cells but not of Th2 cells. This activity is antagonized by IL4. The inhibitory effect on IFN-gamma production is indirect and appears to be the result of a suppression of IL12 synthesis by accessory cells. In the human system, IL10 is produced by, and down-regulates the function of, Th1 and Th2 cells. In macrophages stimulated by bacterial lipopolysaccharides IL10 inhibits the synthesis of IL1, IL6 and TNF-alpha by promoting, among other things, the degradation of cytokine mRNA. It also leads to an inhibition of antigen presentation. In human monocytes IFN-gamma and IL10 antagonize each other's production and function. IL10 has been shown also to be a physiologic antagonist of IL12.

[0217] IL10 also inhibits mitogen- or anti-CD3-induced proliferation of T-cells in the presence of accessory cells and reduces the production of IFN-gamma and IL2. Exogenous IL2 and IL4 inhibit the proliferation-inhibitory effect but do not influence the production of IFN-gamma. In LPS-stimulated macrophages IFN-gamma increases the synthesis of IL6 by inhibiting the production of IL10. IL10 appears to be responsible for most or all of the ability of Th2 supernatants to inhibit cytokine synthesis by Th1 cells.

[0218] IL10 inhibits secretion of Ig by T-cell-independent antigens induced by IL5 but not that induced by IL2.

[0219] Murine Ly-1 B cells are the principal source of IL10. In contrast to other B-cells, Ly-1 B-cells express greatly elevated constitutive and inducible levels of IL10. These cells also have the distinctive property of continuous self-replenishment. The continuous treatment of newborn mice with anti-IL10 antibodies leads to a depletion of the Ly-1 B-cells while maintaining a normal population of splenic B-cells. These mice also contain greatly reduced serum immunoglobulin M levels and are also impaired in their antibody responses to specific antigens. IL10 is therefore a regulator of Ly-1 B-cell development. The mechanism of Ly-1 B-cell depletion appears to involve the increased production of IFN-gamma since co-administration of neutralizing anti-IFN-gamma antibodies substantially restores the number of peritoneal-resident Ly-1 B-cells in these mice.

[0220] IL10 is also a costimulator for the growth of mature and immature thymocytes (together with IL2, IL4 and IL7) and functions as a cytotoxic T-cell differentiation factor, promoting a higher number of IL2-activated cytotoxic T-lymphocyte precursors to proliferate and differentiate into cytotoxic effector cells. IL10 sustains viability of B-cells in vitro and also stimulates B-cells and promotes their differentiation. It enhances the expression of MHC class II antigens on B-cells whereas it inhibits MHC class II expression on monocytes. In B-cells activated via their antigen receptors or via CD40 IL10 induces the secretion of IgG, IgA and IgM. This effect is synergised by IL4 while the synthesis of immunoglobulins induced by IL10 is antagonized by TGF-beta. The activation of macrophages can be prevented by IL10.

[0221] It has been shown that human IL10 is a potent and specific chemoattractant for human T-lymphocytes. The chemotactic activity is directed towards cells expressing CD8 and not towards CD4 (+)cells. IL10 also inhibits the chemotactic response of CD4 (+)cells, but not of CD8 (+)cells, towards IL8. IL10 can be detected with a sensitive ELISA assay. The murine mast cell line D36 can be used to bioassay human IL10. The intracellular factor can be detected also by flow cytometry.

[0222] The introduction of an IL10 expression vector into CHO cells has been used to analyze the consequences of local IL10 production in vivo. These altered cells were no longer tumorigenic in nude mice or severe combined immunodeficient SCID mice and also suppressed the growth of equal numbers of co-injected normal CHO cells. While normal CHO tumors are usually substantially infiltrated by macrophages, these were virtually absent within CHO-IL10 tumor tissues, suggesting that IL10 indirectly suppresses tumor growth of certain tumors by inhibiting infiltration of macrophages which may provide tumor growth promoting activity.

[0223] Human IL12 is a heterodimeric 70 kDa glycoprotein consisting of a 40 kDa subunit (p40, 306 amino acids; 10% carbohydrate) and a 35 kDa subunit (p35, 197 amino acids; 20% carbohydrate) linked by disulfide bonds that are essential for the biological activity of IL12. p40 contains 10 cysteines and a binding site for heparin; p35 contains 7 cysteines.

[0224] The two subunits of IL12 are not related to any other known proteins. p40 shows some homology with the extracellular domain of the receptor for IL6, and p35 appears to be a homologue of IL6.

[0225] Bioactive murine and human IL12 fusion proteins combining the two IL12 subunits in a single molecule have been described. This designer cytokine retains antitumor activity in vivo. Flexi 12, a single chain protein retaining all of the biological characteristics of the dimeric recombinant IL12, has also been described.

[0226] The gene encoding the p40 subunit of IL12 (IL12B) maps to human chromosome 5q31-q33 in the same region that also harbors other cytokine genes. The gene encoding the p35 subunit of IL12 (IL12A) maps to human chromosome 3p12-q13.2. The expression of the two genes is regulated independently of each other.

[0227] The IL12 receptor appears to be a single protein of approximately 110 kDa (e.g. polypeptides encoded by Genbank Accession No. U03187, U23922, U64198, U64199). Up to 1000-9000 high affinity IL12 receptors/cell are expressed on peripheral blood mononuclear cells activated by various T-cell mitogens or by IL2. IL12 receptors are present on activated T-cells expressing CD4 and CD8 and on activated CD56 positive natural killer cells. Resting peripheral blood mononuclear cells, tonsillar B-cells, or tonsillar B-cells activated by anti-IgM/Dx, anti-IgM/Dx+IL2, or SAC+IL2 do not express the receptor. High affinity IL12 receptors are expressed constitutively on a transformed marmoset NK-like cell line, HVS.SILVA 40.

[0228] Binding of IL12 to its receptor can be prevented by monoclonal antibodies directed against the p40 subunit which therefore contains the binding site. The p40 subunit of IL12 shows homology with the extracellular domain of the IL6 receptor. A virus-encoded homologue of the p40 subunit is EBV-induced gene-3.

[0229] Human IL12 is not active in murine lymphocytes. Hybrid heterodimers consisting of murine p35 and human p40 subunits retain bioactivity on murine cells; however, the combination of human p35 and murine p40 is completely inactive on murine cells. Murine IL12 is active on both murine and human lymphocytes. The p40 subunit of murine IL12 subunit p40 (IL12p40) has been shown to specifically antagonize the effects of the IL12 heterodimer in different assay systems and to function as an endogenous specific inhibitor for the IL12 heterodimer.

[0230] IL12 stimulates the proliferation of human lymphoblasts activated by phytohemagglutinin. IL12 activates NK-cells positive for CD56, and this activity is blocked by antibodies specific for TNF-alpha. IL12 promotes specific allogenic CTL reactions. IL12 synergizes also with anti-CD3 antibodies and with allogeneic stimulation in mixed lymphocyte cultures in inducing T-cell proliferation.

[0231] In peripheral lymphocytes of the Th1 type IL12 induces the synthesis of IFN-gamma and IL2, and TNF. TNF-alpha also appears to be involved in mediating the effects of IL12 on natural killer cells since the effects of IL12 are inhibited by an antibody directed against TNF-alpha. IL12 and TNF-alpha are costimulators for IFN-gamma production with IL12 maximizing the IFN-gamma response; the production of IL12, TNF, and IFN-gamma is inhibited by IL10. In Th2 helper cells IL12 reduces the synthesis of IL4, IL5, and IL10.

[0232] IL12 synergises with suboptimal amounts of IL2 in promoting the proliferation of mononuclear cells in the peripheral blood and in promoting the generation of LAK cells (lymphokine activated killer cells). Picomolar concentrations of IL12 are as effective as nanomolar concentrations of IL2 in augmenting the cytolytic activity of natural killer cells expanded in vivo by IL2. IL12 also acts as a co-mitogen and potentiates the proliferation of resting peripheral cells induced by IL2.

[0233] IL12 enhances myelopoiesis of primitive bone marrow progenitor cells induced by SCF (stem cell factor) and synergizes with colony stimulating factors to induce proliferation. IL12 also has synergistic effects on more committed bone marrow progenitors, synergising with IL3, IL11, or IL3 plus SCF.

[0234] IL12 is of potential clinical interest since it allows the reduction of doses of IL2 required for the generation of LAK cells (lymphokine-activated killer cells). IL12 has been shown to inhibit the growth of a variety of experimental tumors in vivo and to have antiangiogenic effects in vivo, which are, at least in part, mediated by IFN-gamma. IL12 therefore seems to be a potential candidate also for the treatment of angiogenesis-dependent malignancies.

[0235] IL19 and IL10 share 21 percent amino acid identity and are probably homologs. In monocytes treatment with bacterial lipopolysaccharides induces the synthesis of IL19 and this effect is potentiated in the presence of IL4 or IL13 but is unaffected by IFN-gamma. GM-CSF directly induces IL19 gene expression in monocytes. IL19 has been shown to bind to the IL20 receptor complex (Dumoutier L et al Cutting edge: STAT activation by IL-19, IL-20 and mda-7 through IL-20 receptor complexes of two types. Journal of Immunology 167(7): 3545-9 (2001); Gallagher G et al Cloning, expression and initial characterization of interleukin-19 (IL-19), a novel homologue of human interleukin-10 (IL-10). Genes Immun 1(7): 442-50 (2000)).

[0236] IL20 is structurally related to IL10. IL20 appears to be an autocrine factor for keratinocytes that regulates their participation in inflammation. Overexpression of IL20 in transgenic mice causes neonatal lethality with skin abnormalities characterized by an impairment of epidermal differentiation (Blumberg H et al Interleukin 20: discovery, receptor identification, and role in epidermal function. Cell 104(1): 9-19 (2001); Dumoutier L et al Cutting edge: STAT activation by IL-19, IL-20 and mda-7 through IL-20 receptor complexes of two types. Journal of Immunology 167(7): 3545-9 (2001); Rich B E and Kupper T S Cytokines: IL-20—a new effector in skin inflammation. Current Biology 11(13): R531-4 (2001)).

[0237] An IL20 receptor has been identified to consist of two orphan class 2 cytokine receptor subunits. The receptor is expressed in skin and its expression is upregulated dramatically in psoriatic skin. Engagement of the receptor in a keratinocyte cell line involves signaling by one member of the STAT proteins, STAT3.

[0238] The IL20 receptor complex has been shown to bind also IL19 and IL24.

[0239] IL21 has been isolated by Parrish-Novak et al from a cDNA library derived from activated CD3 (+)T-cells in a search for the ligand of a type-1 cytokine receptor isolated previously. The cDNA encodes a secreted protein of 131 amino acids protein most closely related to IL2 and IL15. The IL21 gene maps to human chromosome 4q26-q27 near the IL2 gene. IL21 mRNA is expressed in CD4 (+) but not in CD8 (+) T-cells after cell activation. It is not expressed also in B-cells and monocytes (Asao H et al Cutting edge: the common gamma-chain is an indispensable subunit of the IL-21 receptor complex. Journal of Immunology 167(1):1-5 (2001); Ozaki K et al Cloning of a type I cytokine receptor most related to the IL-2 receptor beta chain. Proceedings of the National Academy of Science (USA) 97: 11439-11444 (2000); Parrish-Novak J et al Interleukin 21 and its receptor are involved in NK cell expansion and regulation of lymphocyte function. Nature 408: 57-63 (2000)).

[0240] IL21 stimulates proliferation of B-cell stimulated by crosslinking of the CD40 antigen. It inhibits proliferation stimulated by IL4 plus anti-IgM. IL21 augments stimulation of the proliferation of naive (CD45RA (+)) but not memory (CD45RO (+)) T-cells mediated by engagement of CD3. IL21 stimulates the proliferation of bone marrow progenitor cells and the expression of the NK-cell marker CD56 in the presence of IL15.

[0241] The IL21 receptor has been isolated by Parrish-Novak et al and found to be expressed by CD23 (+)B-cells, B-cell lines, a T-cell leukemia line, and NK-cell lines. The receptor gene has been mapped to human chromosome 16p12. The same receptor has been isolated by Ozaki et al, who called it NILR (novel interleukin receptor). The receptor (538 amino acids) is most closely related to human IL2 beta receptor. The receptor contains a WSXWS motif in the extracellular region, typical of type-1 cytokine receptors. The receptor is expressed on NK-cells, T-cells, and B-cell lines.

[0242] The common gamma chain, which is an indispensable subunit of the functional receptor complexes for IL2, IL4, IL7, IL9, and IL15 has been shown also to be part of the IL21 receptor complex. The functional signalling complex activates Janus kinases JAK1, JAK3, and the STAT proteins STAT1, and STAT3 (Asao et al).

[0243] IL22 (180 amino acids including a signal sequence ; 25 kDa; also called IL-TIF) was identified by a cDNA subtraction method as a gene induced specifically by IL9 in mouse T lymphocytes. The protein shows limited homology with IL10 (22 percent amino acid identity). Human and murine IL-TIF proteins share 79 percent amino acid identity.

[0244] The murine and human IL-TIF genes both consist of 6 exons. The human single-copy gene maps to chromosome 12q15 (90 Kb from the IFN-gamma gene, and 27 Kb from the AK155 gene encoding another IL10-related cytokine. In mice the gene is located also in the same region as the IFN-gamma gene. In BALB/c and DBA/2 mice the gene is a single copy gene. In C57B1/6, FVB and 129 mice the gene is duplicated. The two copies, termed IL-TIF-alpha and IL-TIF-beta show 98 percent nucleotide identity in the coding region and differ by a deletion of 658 nucleotide in IL-TIF-beta. This gene may be inactive.

[0245] Expression of IL-TIF is induced by IL9 in thymic lymphomas, T-cells, and mast cells, and by lectins in freshly isolated splenocytes. IL-TIF expression in T-cells does not require protein synthesis, and depends on the activation Janus kinases and STAT proteins. IL-TIF is expressed constitutively in thymus and brain.

[0246] In HepG2 human hepatoma cells IL-TIF up-regulates the production of acute phase proteins. IL-TIF also acts as a pro-inflammatory cytokine in vivo because injection of the protein also induces the synthesis of acute phase proteins. Synthesis of IL-TIF is induced rapidly after injection of bacterial lipopolysaccharides. In contrast to IL10, IL22 does not inhibit the production of pro-inflammatory cytokines by monocytes in response to bacterial lipopolysaccharides. It also does not impair IL10 function on monocytes. IL-TIF has some inhibitory effects on IL4 production from Th2 T-helper cells.

[0247] IL10 and IL-TIF utilise a common receptor subunit. Antibodies directed against the beta chain of the IL10 receptor block the induction of acute phase proteins by IL-TIF. The functional IL-TIF receptor complex consists of two receptor chains. One chain has been identified as the orphan receptor CRF2-4 that is expressed in normal liver and kidney. The other chain is the IL10 receptor-2, the second chain of the IL10 receptor complex. Monkey COS expressing CRF2-9 alone respond to IL-TIF. In hamster cells both chains must be expressed to yield functional IL-TIF receptors. Although both receptor chains can bind IL-TIF independently binding of IL-TIF to the receptor complex is greater. This sharing of receptor subunits is similar to the shared use of the common gamma chain by cytokines such as IL2, IL4, IL7, IL9, and IL15. Some cell lines that do not respond to IL10 respond to IL-TIF by activation of STAT-1, STAT-3, and STAT-5.

[0248] A soluble secreted receptor (231 amino acids), designated IL22BP [IL22 binding protein ] has been described (Kotenko et al). The protein demonstrates 34 percent amino acid identity with the extracellular domain of the IL22R1 chain and is known also as CRF2-10. The gene maps to human chromosome 6q24, 35 kb from the IFN-gamma R1 gene. It is expressed in various tissues with maximal expression in breast, lungs, and colon. The protein binds IL-TIF and inhibits its activity, blocking its interaction with the cell surface IL22 receptor complex and thus acting as a natural cytokine antagonist. IL22BP also blocks induction of the suppressors of cytokine signaling-3 (SOCS-3) gene expression by IL22 in HepG2 cells (Dumoutier L et al Cloning and characterization of IL-10-related T cell-derived inducible factor (IL-TIF), a novel cytokine structurally related to IL-10 and inducible by IL-9. Journal of Immunology 164(4): 1814-1819 (2000); Dumoutier L et al Human interleukin-10-related T cell-derived inducible factor: molecular cloning and functional characterization as an hepatocyte-stimulating factor. Proceedings of the National Academy of Science (USA) 97(18): 10144-9 (2000); Dumoutier L et al IL-TIF/IL-22: genomic organization and mapping of the human and mouse genes. Genes Immun 1(8): 488-494 (2000); Dumoutier L et al Cloning and characterization of il-22 binding protein, a natural antagonist of il-10-related t cell-derived inducible factor/il-22. Journal of Immunology 166(12): 7090-5 (2001); Kotenko S V et al Identification, cloning, and characterization of a novel soluble receptor that binds IL-22 and neutralizes its activity. Journal of Immunology 166(12): 7096-7103 (2001); Kotenko S V et al Identification of the functional interleukin-22 (IL-22) receptor complex: the IL-10R2 chain (IL-10Rbeta) is a common chain of both the IL-10 and IL-22 (IL-10-related T cell-derived inducible factor, IL-TIF) receptor complexes. Journal of Biological Chemistry 276(4): 2725-32 (2001); Xie M H et al Interleukin (IL)-22, a novel human cytokine that signals through the interferon receptor-related proteins CRF2-4 and IL-22R. Journal of Biological Chemistry 275(40): 31335-9 (2000)).

[0249] IL-23 is the name given to a factor that is composed of the p40 subunit of IL12 (IL12B) and another protein of 19 kDa, designated p19. p19 is structurally related to IL6, G-CSF , and the p35 subunit of IL12. In databanks the p19 subunit is found also under the acronym SGRF (IL6 G-CSF related factor).

[0250] p19 by itself is biologically inactive while the complex of p19 with p40 is active. The active complex is secreted by dendritic cells after cell activation.

[0251] Mouse memory T-cells (CD4 (+) CD45 Rb(low)) proliferate in response to IL23 but not in response to IL12. Human IL23 has been shown to stimulate the production of IFN-gamma by PHA blast T-cells and memory T-cells. It also induces proliferation of both cell types.

[0252] IL23 binds to the beta-1 subunit but not to the beta-2 subunit of the IL12 receptor, activating one of the STAT proteins, STAT4, in PHA blast T-cells.

[0253] Expression of p19 in transgenic mice leads to runting, systemic inflammation , infertility, and death before 3 months of age. The animals show high serum concentrations of the pro-inflammatory cytokines TNF-alpha and IL1. The number of circulating neutrophils is increased. Acute phase proteins are expressed constitutively. Animals expressing p19 specifically in the liver do not show these abnormalities. Expression of p19 is most likely due to hematopoietic cells as bone marrow transplantation of cells expressing p19 causes the same phenotype as that observed in the transgenic animals (Oppmann B et al Novel p19 protein engages IL-12p40 to form a cytokine, IL-23, with biological activities similar as well as distinct from IL-12. Immunity 13(5): 715-25 (2000); Wiekowski M T et al Ubiquitous Transgenic Expression of the IL-23 Subunit p19 Induces Multiorgan Inflammation, Runting, Infertility, and Premature Death. Journal of Immunology 166(12): 7563-70 (2001)).

[0254] IL24 is a name given to a protein that is known also as ST16 [suppression of tumorigenicity-16] and MDA-7 [melanoma differentiation-associated gene 7]. The rat counterpart of IL24 has been identified as mob-5 or C49a. The murine counterpart is FISP.

[0255] MDA-7 protein (206 amino acids) was identified initially as a melanoma differentiation-associated cDNA in a study using cultured human melanoma cells that lose proliferative capacity and terminally differentiate in response to human IFN-beta and mezerein. The expression of MDA-7 is upregulated as a consequence of terminal differentiation. H0-1 and C8161 human melanoma cells engineered to express MDA-7 show reduces growth and do not form colonies in a colony formation assay. MDA-7 selectively suppresses the growth of human breast cancer cells by promoting cell death by apoptosis. Ectopic expression of MDA-7 by means of a replication defective adenovirus results in growth suppression and induction of apoptosis in a broad spectrum of additional cancers, including melanoma, glioblastoma multiforme, osteosarcoma and carcinomas of the breast, cervix, colon, lung, nasopharynx and prostate. No apparent harmfull effects are observed after expression of MDA-7 in normal epithelial or fibroblast cells.

[0256] In human hematopoietic cells MDA-7 expression is induced during megakaryocyte differentiation in response to treatment with TPA (12-O-tetradecanoyl-phorbol-13-acetate).

[0257] The human MDA-7 gene maps to chromosome 1q32 and is tightly linked (within a region of 195 kb) to the genes encoding IL10, IL19, and IL20.

[0258] The receptor for IL24 has been identified as the IL20 receptor complex. This receptor also binds to IL19 (Blumberg H et al Interleukin 20: discovery, receptor identification, and role in epidermal function. Cell 104(1): 9-19 (2001); Dumoutier L et al Cutting edge: STAT activation by IL-19, IL-20 and mda-7 through IL-20 receptor complexes of two types. Journal of Immunology 167(7): 3545-9 (2001); Huang E Y et al Genomic structure, chromosomal localization and expression profile of a novel melanoma differentiation associated (mda-7) gene with cancer specific growth suppressing and apoptosis inducing properties. Oncogene 20(48): 7051-63 (2001); Jiang H et al Subtraction hybridization identifies a novel melanoma differentiation associated gene, mda-7, modulated during human melanoma differentiation, growth and progression. Oncogene 11: 2477-2486 (1995); Jiang H et al The melanoma differentiation associated gene mda-7 suppresses cancer cell growth. Proceedings of the National Academy of Science (USA) 93: 9160-9165 (1996); Su Z et al The cancer growth suppressor gene mda-7 selectively induces apoptosis in human breast cancer cells and inhibits tumor growth in nude mice. Proceedings of the National Academy of Science (USA) 95: 14400-14405 (1998)).

[0259] IL25 (also known as SF20) has been identified in a search for factors that stimulate cell proliferation. The factor is secreted by bone marrow stromal cells

[0260] The IL25 receptor has been identified as mouse thymic shared antigen-1 (TSA-1). Enforced expression of the receptor in one of the factor-dependent cell lines, BaF3, which does not express the receptor, causes cell proliferation. FDCP2 cells, which express the receptor, also proliferate in response to SF20/IL25. In both cases proliferation is abolished by specific blocking antibodies directed against the receptor.

[0261] SF20/IL-25 has no detectable myelopoietic activity but supports proliferation of cells in the lymphoid lineage (Tulin E E et al SF20/IL-25, a Novel Bone Marrow Stroma-Derived Growth Factor That Binds to Mouse Thymic Shared Antigen-1 and Supports Lymphoid Cell Proliferation. Journal of Immunology 167(11): 6338-47 (2001)).

[0262] The members of the TNF ligand superfamily (TNFalpha, TNF-beta, LT beta, CD27 ligand, CD30 ligand, CD40 ligand, CD95 ligand, 4 1BB, OX40 ligand, TRAIL) share common biological activities, but some properties are shared by only some ligands, while others are unique. Human TNF-alpha is a non-glycosylated protein of 17 kDa and a length of 157 amino acids. Murine TNF-alpha is N-glycosylated. Homology with TNF-beta is approximately 30%. TNF-alpha forms dimers and trimers. The 17 kDa form of the factor is produced by processing of a precursor protein of 233 amino acids. A TNF-alpha converting enzyme has been shown to mediate this conversion. A transmembrane form of 26 kDa has been described also.

[0263] TNF-alpha contains a single disulfide bond that can be destroyed without altering the biological activity of the factor. Mutations Ala84 to Val and Val91 to Ala reduce the cytotoxic activity of the factor almost completely. These sites are involved in receptor binding. The deletion of 7 N-terminal amino acids and the replacement of Pro8Ser9Asp10 by ArgLysArg yields a mutated factor with an approximately 10-fold enhanced antitumor activity and increased receptor binding, as demonstrated by the L-M cell assay, while at the same time reducing the toxicity.

[0264] The gene has a length of approximately 3.6 kb and contains four exons. The primary transcript has a length of 2762 nucleotides and encodes a precursor protein of 233 amino acids. The aminoterminal 78 amino acids function as a presequence. The human gene maps to chromosome 6p23-6q12. It is located between class I HLA region for HLA-B and the gene encoding complement factor C. The gene encoding TNF-beta is approximately 1.2 kb downstream of the TNF-alpha gene. However, both genes are regulated independently. The two genes also lie close to each other on murine chromosome 17.

[0265] Approximately 500-10000 high-affinity receptors (Ka=2.5×10−9 M) for TNF-alpha are expressed on all somatic cell types with the exception of erythrocytes. Two receptors of 55 kDa (TNF-R1; new designation: CD120a) (e.g. polypeptides encoded by Genbank Accession No. X55313) and 75 kDa (TNF-R2; new designation: CD120b) (e.g. as described in Goodwin R G et al (1991) Molecular Cellular Biology 11: 3020-6) have been described. One receptor is a glycosylated protein of 455 amino acids that contains an extracellular domain of 171 and a cytoplasmic domain of 221 amino acids. Sequence homologies in the cysteine-rich domains of the extracellular portion reveal that the receptor is related to the low-affinity receptor of NGF and to human cell surface antigen CD40.

[0266] Deletion analysis in the C-terminal intracellular region of the 55 kDa receptor, TNF-R1 has revealed the existence of a so-called death domain, which is involved in signaling processes leading to programmed cell death. The death domain of TNF-R1 interacts with a variety of other signaling adaptor molecules, including TRADD, and RIP.

[0267] The two known receptors bind both TNF-alpha and TNF-beta. p55 is expressed particularly on cells susceptible to the cytotoxic action of TNF. p75 is also present on many cell types, especially those of myeloid origin (a virus-encoded homologue of the receptor subunit is EBV-induced gene-6). It is strongly expressed on stimulated T-cells and B-lymphocytes. The differential activities of TNF on various cell types, i.e. growth-promoting and growth-inhibiting activities, are probably mediated by the differential expression and/or regulation of multiple receptors in combination with other distinct receptor-associated proteins. p55 appears to play a critical role in host defenses against microorganisms and their pathogenic factors.

[0268] A third receptor subtype is expressed in normal human liver. It binds TNF-alpha but not TNF-beta. Some viruses contain genes encoding secreted proteins with TNF binding properties that are closely homologous to the p55 and p75 TNF receptors. Differential effects of the two receptor subtypes have been found also in TNF-mediated adhesion of leukocytes to the endothelium. It appears that engagement of the p55 receptor specifically leads to the induction of the cellular adhesion molecules ICAM-1, E-selectin, V-CAM-1, and CD44, while engagement of both the p55 and the p75 receptor induces expression of alpha-2 integrin.

[0269] Truncated soluble forms of the receptor have been found also. The soluble forms, in particular the soluble extracellular domain of the p60 receptor, block the antiproliferative effects of TNF and, therefore, may modulate the harmful effects of TNF.

[0270] Receptor densities are reduced by IL1 and tumor promoters such as phorbol esters. The expression of TNF-alpha receptor density is induced by IFN-alpha, IFN-beta, and IFN-gamma.

[0271] Signal transducers that associate with the cytoplasmic domains of members of the TNF receptor superfamily comprise TRAF (Tumor necrosis factor receptor-associated factors).

[0272] Human TNF-alpha is active on murine cells with a slightly reduced specific activity. In general, TNF-alpha and TNF-beta display similar spectra of biological activities in in-vitro systems, although TNF-beta is often less potent or displays apparent partial agonist activity.

[0273] TNF-alpha shows a wide spectrum of biological activities. It causes cytolysis and cytostasis of many tumor cell lines in vitro. Sensitive cells die within hours after exposure to picomolar concentrations of the factor and this involves, at least in part, mitochondria-derived second messenger molecules serving as common mediators of TNF cytotoxic and gene-regulatory signaling pathways. The factor induces hemorrhagic necrosis of transplanted tumors. Within hours after injection TNF-alpha leads to the destruction of small blood vessels within malignant tumors. The factor also enhances phagocytosis and cytotoxicity in neutrophilic granulocytes and also modulates the expression of many other proteins, including fos, myc, IL1 and IL6.

[0274] The 26 kDa form of TNF is found predominantly on activated monocytes and T-cells. It is also biologically active and mediates cell destruction by direct cell-to-cell contacts.

[0275] The chemotactic properties of fMLP (Formyl-Met-Leu-Phe) for neutrophils are enhanced by TNF-alpha. TNF-alpha induces the synthesis of a number of chemoattractant cytokines, including IP-10, JE, KC, in a cell-type and tissue-specific manner.

[0276] TNF-alpha is a growth factor for normal human diploid fibroblasts. It promotes the synthesis of collagenase and prostaglandin E2 in fibroblasts. It may also function as an autocrine growth modulator for human chronic lymphocytic leukemia cells in vivo and has been described to be an autocrine growth modulator for neuroblastoma cells. The autocrine growth-promoting activity is inhibited by IL4.

[0277] In resting macrophages TNF induces the synthesis of IL1 and prostaglandin E2. It also stimulates phagocytosis and the synthesis of superoxide dismutase in macrophages. TNF activates osteoclasts and thus induces bone resorption.

[0278] In leukocyte and lymphocyte progenitors TNF stimulates the expression of class I and II HLA and differentiation antigens, and the production of IL1, colony stimulating factors, IFN-gamma, and arachidonic acid metabolism. It also stimulates the biosynthesis of collagenases in endothelial cells and synovial cells.

[0279] IL6 suppresses the synthesis of IL1 induced by bacterial endotoxins and TNF, and the synthesis of TNF induced by endotoxins.

[0280] The neurotransmitter SP (substance P) induces the synthesis of TNF and IL1 in macrophages. IL1, like IL6, stimulates the synthesis of ACTH (corticotropin) in the pituitary. Glucocorticoids synthesized in response to ACTH in turn inhibit the synthesis of IL6, IL1 and TNF in vivo, thus establishing a negative feedback loop between the immune system and neuroendocrine functions.

[0281] TNF-alpha enhances the proliferation of T-cells induced by various stimuli in the absence of IL2. Some subpopulations of T-cells only respond to IL2 in the presence of TNF-alpha. In The presence of IL2 TNF-alpha promotes the proliferation and differentiation of B-cells.

[0282] The functional capacities of skin Langerhans cells are also influenced by TNF-alpha. These cells are not capable of initiating primary immune responses such as contact sensibilisation. They are converted into immunostimulatory dendritic cells by GM-CSF and also IL1. These cells therefore are a reservoir for immunologically immature lymphoid dendritic cells. The enhanced ability of maturated Langerhans cells to process antigens is significantly reduced by TNF-alpha.

[0283] Although TNF-alpha is also required for normal immune responses the overexpression has severe pathological consequences. TNF-alpha is the major mediator of cachexia observed in tumor patients (hence its name, cachectin). TNF is also responsible for some of the severe effects during Gram-negative sepsis.

[0284] TNF-alpha can be detected in bioassays involving cell lines that respond to it (e.g., BT-20, CT6, EL4; PK15; L929; L-M; MO7E; T1165; WEHI-3B). TNF-alpha can be detected also by a sensitive sandwich enzyme immunoassay, ELISA, an immunoradiometric assay (IRMA), and by an assay designated RELAY (receptor-mediated label-transfer assay). Intracellular factor is detected by two color immunofluorescence flow cytometry. Higuchi et al have described an assay based on the release of tritiated thymidine from cells undergoing apoptosis after treatment with either TNF-alpha or TNF-beta. IFN-alpha, IFN-beta, IFN-gamma, TGF-beta, IL4, LIF and GM-CSF have been shown not to interfere with this assay.

[0285] In contrast to chemotherapeutic drugs TNF specifically attacks malignant cells. Extensive preclinical studies have documented a direct cytostatic and cytotoxic effect of TNF-alpha against subcutaneous human xenografts and lymph node metastases in nude mice, as well as a variety of immunomodulatory effects on various immune effector cells, including neutrophils, macrophages, and T-cells. Single- and multiple-dose phase I studies have confirmed that TNF can be administered safely to patients with advanced malignancies in a dose range associated with anticancer effect without concomitant serious toxicities such as shock and cachexia. However, clinical trials on the whole have unfortunately so far failed to demonstrate significant improvements in cancer treatment, with TNF-induced systemic toxicity being a major limitation for the use of TNF as an antineoplastic agent in most cases. The combined use of TNF and cytotoxic or immune modulatory agents, particularly IFN-gamma and possibly IL2, may be of advantage in the treatment of some tumors. In some cases intratumoral application of TNF has been found to be of advantage in tumor control.

[0286] Some mutant forms of TNF-beta with selective activity on the p55 receptor have been described recently. It has been shown that activation of the p55 receptor is sufficient to trigger cytotoxic activity towards transformed cells. Some of these mutants have been described to retain their antitumor activity in nude mice carrying transplanted human tumors.

[0287] TNF can also be used to increase the aggressiveness of lymphokine-activated killer cells. Studies with an experimental fibrosarcoma metastasis model have shown that TNF induces significant enhancement of the number of metastases in the lung. It has been suggested that low doses of endogenous TNF or administration of TNF during cytokine therapy may enhance the metastatic potential of circulating tumor cells. The transduction of murine tumor cells with a functional TNF-alpha gene has been shown to lead to the rejection of the genetically modified cells by syngeneic hosts.

[0288] The interferons are a family of cytokines that induce a virus-nonspecific antiviral state in target cells. Binding of an interferon to its receptor induces new protein synthesis which, in turn, results in the inactivation of initiation factor eIF-2. The inactivation is thought to contribute to the antiviral state induced by the interferons. Interferons also induce pathways that activate intracellular endonucleases which degrade viral mRNA. Many interferons also possess immunomodulatory activities, such as activation of macrophages and lymphocytes. Examples of interferons include IFN-gamma (e.g. polypeptides encoded by Genbank Accession No. K01900, J00209, M12350, J00213, J00216, J00214, M11003, M11026, M34913, M54886, X01974, L38698, M13710, K01238, M13660, M68944, X01972, X01971, X01973, X01969), IFN-gamma (e.g. polypeptides encoded by Genbank Accession No.M28622, X14029, X14455, K00020, J00218, E00171, X04430, A09363, M27327, M16656, M25460, K03196), IFN-gamma e.g. polypeptides encoded by Genbank Accession No. A34532, X87308, E00756, K00083), IFN-gamma e.g. polypeptides encoded by Genbank Accession No. X58822, A12140), bovine trophoblast protein-1 (IFN-gamma) e.g. polypeptides encoded by Genbank Accession No. M31556, M31557, M31558), and their homologues among species. Human IFN-gamma and IFN-gamma are thought to bind to a common receptor (e.g. polypeptides encoded by Genbank Accession No. X60459, M89641) which is distinct from the receptor for IFN-gamma (e.g. polypeptides encoded by Genbank Accession No. J03143, M28233).

[0289] At least 23 different variants of IFN-alpha are known. The individual proteins have molecular masses between 19-26 kDa and consist of proteins with lengths of 156-166 and 172 amino acids. All IFN-alpha subtypes possess a common conserved sequence region between amino acid positions 115-151 while the amino-terminal ends are variable. Many IFN-alpha subtypes differ in their sequences at only one or two positions. Naturally occurring variants also include proteins truncated by 10 amino acids at the carboxy-terminal end. Disulfide bonds are formed between cysteines at positions 1/98 and 29/138. The disulfide bond 29/138 is essential for biological activity while the 1/98 bond can be reduces without affecting bioactivity.

[0290] Human IFN-beta is a glycoprotein (approximately 20% sugar moiety) of 20 kDa and has a length of 166 amino acids. Glycosylation is not required for biological activity in vitro. The protein contains a disulfide bond Cys31/141) required for biological activity. At the DNA level IFN-beta displays 34% sequence homology with IFN-beta-2 and approximately 30% homology with other IFN-alpha subtypes. In contrast to IFN-gamma IFN-beta is stable at pH2.

[0291] Human IFN-gamma is a dimeric protein with subunits of 146 amino acids. The protein is glycosylated at two sites. The pI is 8.3-8.5. IFN-gamma is synthesized as a precursor protein of 166 amino acids including a secretory signal sequence of 23 amino acids. Two molecular forms of the biologically active protein of 20 and 25 kDa have been described. Both of them are glycosylated at position 25. The 25 kDa form is also glycosylated at position 97. The observed differences of natural IFN-gamma with respect to molecular mass and charge are due to variable glycosylation patterns. 40-60 kDa forms observed under non-denaturing conditions are dimers and tetramers of IFN-gamma.

[0292] Members of the CSF family of cytokines allow the growth and differentiation of bone marrow cells immobilized on soft agar or methylcellulose. While hematopoietic progenitor cells can be maintained only for short periods of time in the absence of such factors, their presence allows the development of colonies containing erythroid cells, neutrophils, eosinophils, macrophages, and/or megakaryocytes, depending on the particular factor. The biochemical analysis of various activities stimulating colony formation supporting the growth and development of these cell types revealed that there existed many different and distinct factors of this sort.

[0293] Many of these factors are either N- or O-glycosylated. Glycosylation has been shown to enhance the solubility, stability and resistance to proteolytic enzymes. It does not appear to be required for the full spectrum of biological activities of these factors. The genes encoding many of the human colony stimulating factors have been cloned and mapped. Some of the genes are in close vicinity but they do not show great homology among each other with the exception of some conserved regions.

[0294] Colony stimulating factors are produced by many different cell types, including, for example, B-lymphocytes, epithelial cells, fibroblasts, endothelial cells, macrophages, Stromal cell line, T-lymphocytes. They are synthesized as precursor molecules containing a classical hydrophobic secretory signal sequence of approximately 25-32 amino acids. The secreted factors have an extremely high specific biological activity are active at very low concentrations (1-100 pM). These factors are absolutely required for the proliferation of hematopoietic progenitor cells. The concentrations required for mere maintenance of viability are usually orders of magnitude lower than those required to induce cell proliferation or to elicit specific functional activities of the cells.

[0295] The names of the individual factors usually indicate the cell types that respond to these factors. The classical colony stimulating factors include M-CSF (e.g. polypeptides encoded by Genbank Accession No. E03235, M64592, U22386, X05010) (macrophage-specific), G-CSF (granulocyte-specific), GM-CSF (macrophage/granulocyte-specific), IL3 (multifunctional) and MEG-CSF (e.g. polypeptides encoded by Genbank Accession No.D86370, U70136) (megakaryocyte-specific). G-CSF and M-CSF are lineage-specific while GM-CSF and IL3 are multifunctional hematopoietic growth factors acting on earlier stages of differentiation of hematopoietic progenitor cells.

[0296] Human GM-CSF is a monomeric protein of 127 amino acids with two glycosylation sites. The protein is synthesized as a precursor of 144 amino acids, which included a hydrophobic secretory signal sequence at the aminoterminal end. The sugar moiety is not required for the full spectrum of biological activities. Non-glycosylated and glycosylated GM-CSF show the same activities in vitro. Fully glycosylated GM-CSF is biologically more active in vivo than the non-glycosylated protein. The different molecular weight forms of GM-CSF (14 kDa, 35 kDa) described in the literature are the result of varying degrees of glycosylation. GM-CSF contains four cysteine residues (positions 54/96 and 88/121).

[0297] A comparison of the protein sequence of GM-CSF with those of the other colony stimulating factors reveals that they are not strongly homologous to each other. Human and murine GM-CSF display 60% homology at the protein level and 70% at the nucleotide level. The two factors do not, however, cross-react immunologically. GM-CSF can be associated with the extracellular matrix of cells as a complex with heparan sulfate proteoglycans. This allows storage of the factor in a biologically inactive form. The exact mechanism by which the factor is eventually released from these depots is not known.

[0298] The human gene has a length of approximately 2.5 kb and contains four exons. The distance between the GM-CSF gene and the IL3 gene is approximately 9 kb. The human GM-CSF gene maps to chromosome 5q22-31 in the vicinity of other genes encoding hematopoietic growth factors (M-CSF, IL3, IL4, IL5) and the gene encoding the M-CSF receptor. The 5′ region of the GM-CSF gene contains several sequence elements known as CLE (conserved lymphokine element). They function as binding sites for transcription factors, modulating the expression of the GM-CSF gene.

[0299] GM-CSF receptors are expressed at densities of several 100 to several 1000 copies/cell on the cell surface of myeloid cells. The receptor is expressed also on non-hematopoietic cells such as endothelial cells and small cell lung carcinoma cells. In receptor-positive cell lineages the receptor density decreases with increasing degrees of maturation.

[0300] The receptor shows significant homologies with other receptors for hematopoietic growth factors, including IL2-beta, IL3, IL6, IL7, Epo and the prolactin receptors. One cloned subunit of the GM-CSF receptor (GM-R alpha, 45 kDa) binds GM-CSF with low affinity (e.g. polypeptides encoded by Genbank Accession No. SEG_HUMGRAS). The second subunit (GM-R beta, 120 kDa) does not bind GM-CSF. GM-R alpha is a protein of 400 amino acids that contains only a short cytoplasmic domain of 54 amino acids. The high affinity GM-CSF receptor is formed by the aggregation of the two receptor subunits. The GM-R beta subunit of the receptor (e.g. polypeptides encoded by Genbank Accession No. SEG_MUSAIC2B, M59941) is also a constituent of other cytokine receptor systems. It is a component of the high affinity receptors for IL3 and IL5, both of which also contain a cytokine-specific subunit (AIC2A ).

[0301] Human GM-CSF is not active on murine cells and vice versa. GM-CSF was isolated initially as a factor stimulating the growth of macrophage/granulocyte-containing colonies in soft agar cultures (colony formation assay). GM-CSF is indispensable for the growth and development of granulocyte and macrophage progenitor cells. It stimulates myeloblasts and monoblasts and triggers irreversible differentiation of these cells. GM-CSF synergises with Epo in the proliferation of erythroid and megakaryocytic progenitor cells. In combination with another colony stimulating factor, M-CSF, one observes the phenomenon of synergistic suppression, i.e., the combination of these two factors leads to a partial suppression of the generation of macrophage-containing cell colonies.

[0302] For some types of blast cells from patients with acute myeloid leukemia GM-CSF acts as an autocrine mediator of growth. GM-CSF is a strong chemoattractant for neutrophils. It enhances microbicidal activity, oxidative metabolism, and phagocytotic activity of neutrophils and macrophages. It also improves the cytotoxicity of these cells. GM-CSF displays a less pronounced specificity than, for example, G-CSF. It stimulates the proliferation and differentiation of neutrophilic, eosinophilic, and monocytic lineages. It also functionally activates the corresponding mature forms, enhancing, for example, the expression of certain cell surface adhesion proteins (CD-11A, CD-11C). The overexpression of these proteins could be one explanation for the observed local accumulation of granulocytes at sites of inflammation. In addition, GM-CSF also enhances expression of receptors for fMLP (Formyl-Met-Leu-Phe) which is a stimulator of neutrophil activity.

[0303] At pico to nanomolar concentrations GM-CSF is chemotactic for eosinophils and also influences the chemotactic behavior of these cells in response to other chemotactic factors.

[0304] In granulocytes GM-CSF stimulates the release of arachidonic acid metabolites and the increased generation of reactive oxygen species. The activation of the Na+/H+ antiport system leads to a rapid alkalization of the cytosol. Phagocytotic activities of neutrophil granulocytes and the cytotoxicity of eosinophils is also enhanced considerably by GM-CSF. Since GM-CSF is produced by cells (T-lymphocytes, tissue macrophages, endothelial cells, mast cells) present at sites of inflammatory responses it can be assumed that it is an important mediator for inflammatory reactions.

[0305] The functional state of Langerhans cells of the skin is also influenced by GM-CSF. These cells are not capable of initiating primary immune responses, for example, contact sensibilization. They are converted to highly potent immunostimulatory dendritic cells by GM-CSF (and also IL1). Langerhans cells therefore form an in situ reservoir for immunologically immature lymphoid dendritic cells. The maturation of these cells which is seen as an increased ability to process antigens, can be down-regulated by TNF-alpha.

[0306] At nanomolar concentrations GM-CSF induces the expression of complement C3a receptors on basophils. Cells which normally do not respond to C3a and which have been activated by GM-CSF degranulate in response to the C3a stimulus. This is accompanied by the release of histamine and leukotriene C4. This process may be of significance in hypersensitivity reactions associated with inflammatory responses (T-lymphocytes, tissue macrophages, endothelial cells, mast cells). GM-CSF has been shown also to be a potent inducer of trophoblast interferon (TP-1).

[0307] GM-CSF synergises with some other cytokines, including IL1, IL3 and G-CSF. GM-CSF and G-CSF must act in concert to allow the development of neutrophil-containing colonies in vitro.

[0308] IL3 by itself only negligibly expands the number of circulating blood cells; a subsequent dose of GM-CSF, however, significantly increases cell numbers, probably because IL3 first leads to an expansion of those cells capable of responding to GM-CSF.

[0309] The observations that most IL3-dependent cell lines can also grow in the presence of GM-CSF and IL4 and that several synergistic effects are observed between GM-CSF and IL4 suggest that these three factors perform similar functions in controlling the growth of cells. There are some indications that the mechanism of signal transduction contains at least some common factors.

[0310] Experiments with tyrosine-specific protein kinases encoded by an oncogene have shown that the expression of this kinase activity in factor-dependent cells abolishes their dependence on GM-CSF, IL3 and IL4. The exact mechanism by which these factors regulate the proliferation and differentiation of cells is still unknown.

[0311] The consequences of a deregulated expression of GM-CSF have been studied in transgenic mice harboring a constitutively expressed GM-CSF gene. The overexpression of the transgene encoding GM-CSF leads to pathological alterations in the retina and causes blindness and also causes muscle deterioration. These mice are characterized by a very pronounced increase in activated macrophages. In addition, the overexpression of GM-CSF leads to the activation of mature macrophages secreting large amounts of IL1 and TNF, suggesting that these cytokines may be responsible for some aspects of the transgenic mouse disease.

[0312] Histopathological examination demonstrates a pronounced increase in the progenitor cell population of the monocytic lineage. GM-CSF-transgenic animals usually die within months from the massive tissue damage resulting from the overexpression of these factors. Similar results have been obtained with mice possessing a bone marrow manipulated to overexpress GM-CSF by transformation with suitable retrovirus vectors. These findings do not seem to be of clinical significance, though. The long-term treatment of primates and mice with GM-CSF has shown that life-threatening complications do not occur.

[0313] The biological consequences of GM-CSF gene disruption have been studied in mice generated from ES cells carrying a targeted deletion of the gene. Mice homozygous for a targeted disruption of the GM-CSF gene are characterized by an unimpaired steady-state hematopoiesis, demonstrating that GM-CSF is not essential for maintaining normal levels of the major types of mature hematopoietic cells and their precursors in blood, marrow, and spleen.

[0314] Most GM-CSF-deficient mice are superficially healthy and fertile but develop abnormal lungs. GM-CSF-deficient mice develop a progressive accumulation of surfactant lipids and proteins in the alveolar space, the defining characteristics of the idiopathic human disorder pulmonary alveolar proteinosis. Extensive lymphoid hyperplasia associated with lung airways and blood vessels is found also. These results demonstrate an unexpected, critical role for GM-CSF in pulmonary homeostasis.

[0315] Transgenic mice homozygous for null mutations of the gene encoding the common beta subunit (beta C) of the GM-CSF, IL3, and IL5 receptor complexes exhibit normal development and survive to young adult life. They develop pulmonary peribronchovascular lymphoid infiltrates and areas resembling alveolar proteinosis. Eosinophil numbers in peripheral blood and bone marrow of homozygous deletion mutants are reduced, while other hematological parameters are normal. Bone marrow cells from homozygous deletion mutants do not show high-affinity binding of GM-CSF, while cells from heterozygous animals show an intermediate number of high-affinity receptors. In clonal cultures of bone marrow cells derived from homozygous deletion mutants, even high concentrations of GM-CSF and IL5 do not stimulate colony formation in the colony formation assay. Differences in the systemic clearance and distribution of GM-CSF between mutant and wild-type littermates are not observed.

[0316] Nishinakamura et al have crossed beta-c mutant mice with mice deficient for IL3. The double-mutant mice lacking all IL3, GM-CSF, and IL5 functions are apparently normally fertile. The animals show the same reduced numbers of eosinophils and a lack of eosinophilic response to parasites as beta-c mutant mice. The immune response of the double mutant mice to Listeria monocytogenes is normal. Hematopoietic recovery after treatment with fluorouracil is also normal. These findings suggest the existence of alternative mechanism to produce blood cells that do not depend on the presence of IL3, GM-CSF, and IL5.

[0317] GM-CSF can be assayed in a colony formation assay by the development of colonies containing macrophages, neutrophils, eosinophils, and megakaryocytes. GM-CSF is also detected in specific bioassays with cells lines that depend in their growth on the presence of GM-CSF or that respond to this factor (e.g., AML-193; B6SUt-A; BAC1.2F5; BCL1; Da; FDCP1; GF-D8; GM/SO; IC-2; MO7E ; NFS-60; PT-18; TALL-103; TF-1; UT-7).

[0318] GM-CSF can be employed for the physiological reconstitution of hematopoiesis in all diseases characterized either by an aberrant maturation of blood cells or by a reduced production of leukocytes. The main and most important clinical application of GM-CSF is probably the treatment of life-threatening neutropenia following chemo and/or radiotherapy, which is markedly reduced under GM-CSF treatment. GM-CSF can be used also to correct chemotherapy-induced cytopenias and to counteract cytopenia-related predisposition to infections and hemorrhages.

[0319] In order to avoid potential complications following the administration of GM-CSF careful clinical monitoring is required in certain patient groups, for example those with myelodysplastic syndrome, acute myeloid leukemia, inflammatory disease, autoimmune thrombocytopenia or malfunctional immunological responsiveness.

[0320] Several studies have demonstrated that the use of GM-CSF enhances tolerance to cytotoxic drug treatment and can be used to prevent dose reductions necessitated by the side effects of cytotoxic drug treatment. GM-CSF treatment frequently permits to increase the doses of cytotoxic drugs per course. These studies have also revealed a significantly reduced morbidity under GM-CSF treatment.

[0321] The transduction of murine tumor cells with a functional GM-CSF gene has been shown to lead to the rejection of the genetically modified cells by syngeneic hosts. Moreover, vaccination with GM-CSF transduced tumor cells prevents growth of a subsequent inoculum of wild-type syngeneic tumor cells.

[0322] The chemokine family of cytokines consists of relatively small, structurally similar polypeptides that induce chemotaxis in leukocytes. Chemokines have molecular masses of 8-10 kDa and show approximately 20-50% sequence homology among each other at the protein level. The proteins also share common gene structures and tertiary structures. All chemokines possess a number of conserved cysteine residues involved in intramolecular disulfide bond formation.

[0323] According to the chromosomal locations of individual genes two different subfamilies of chemokines are distinguished. Members of the alpha-chemokines are referred to also as the 4q chemokine family because the genes encoding members of this family map to human chromosome 4q12-21. The first two cysteine residues of members of this family are separated by a single amino acids and these proteins, therefore, are called also C-X-C chemokines. This subfamily includes 9E3 (e.g. Genbank protein P08317), AMCF (e.g. polypeptides encoded by Genbank Accession No. M99367, M99368), beta-thromboglobulin (e.g. as disclosed in Begg G S et al (1978), Biochemistry 17: 1739-44), CINC family members (e.g. polypeptides encoded by Genbank Accession No. D21095), ENA-78 (e.g. polypeptides encoded by Genbank Accession No. X78686), eotaxin (e.g. polypeptides encoded by Genbank Accession No. U46572, U40672), GCP-2 (e.g. polypeptides encoded by Genbank Accession No. Y08770, U83303), IL8, IP-10 (e.g. polypeptides encoded by Genbank Accession No. L07417, X02530), KC (e.g. polypeptides encoded by Genbank Accession No. J04596), LIX (e.g. polypeptides encoded by Genbank Accession No. U27267), mig (e.g. polypeptides encoded by Genbank Accession No. M34815, Z24725), MGSA (e.g. polypeptides encoded by Genbank Accession No. X12510), mob-1 (e.g. polypeptides encoded by Genbank Accession No. U17035), NAP-2 (as described in Clark-Lewis I et al (1991) Biochemistry 30: 3128-35, Cohen A B et al (1992) American Journal of Physiology 263: L249-56), NAP-3 (as described in: Schröder J M et al (1991) Journal of Experimental Medicine 171: 1091-100), NAP-4 (as described in Schröder J M et al (1990) Biochemical and Biophysical Research Communications 172: 898-904), PBSF (SDF) (e.g. polypeptides encoded by Genbank Accession No. D21072, U16752, D50645), and PF4 (e.g. polypeptides encoded by Genbank Accession No. M25897).

[0324] IL8, MGSA, mouse KC, MIP-2 (e.g. polypeptides encoded by Genbank Accession No. X65647 and as described in Blum S et al Three human homologues of a murine gene encoding an inhibitor of stem cell proliferation. DNA Cell Biol. 9: 589-602 (1990); Clements J M et al Biological and structural properties of MIP-1 alpha expressed in yeast. Cytokine 4: 76-82 (1992); Devatelis G et al Cloning and characterization of a cDNA for murine macrophage inflammatory protein (MIP), a novel monokine with inflammatory and chemokinetic properties. Journal of Experimental Medicine 167: 1939-44 (1988) (erratum in JEM 170: 2189 (1989)); Farber J M A macrophage mRNA selectively induced by gamma-interferon encodes a member of the platelet factor 4 family of cytokines. Proceedings of the National Academy of Science (USA) 87: 5238-42 (1990); Haskill S et al Identification of three related human GRO genes encoding cytokine functions. Proceedings of the National Academy of Science (USA) 87: 7732-6 (1990); Poltorak A N et al (1995) Journal of Inflammation 45(3): 207-19; Rossi D L et al (1997) Journal of Immunology 158(3): 1033-1036; Sherry B et al (1988) Journal of Experimental Medicine 168: 2251-9; Tekamp-Olson P et al (1990) Journal of Experimental Medicine 172: 911-9; Wolpe S D et al (1989) Proceedings of the National Academy of Science (USA) 86: 612-16; Wolpe S D et al (1989) FASEB Journal 3: 2565-73), NAP-2, ENA-78, and GCP-2 comprise a subgroup of the human C-X-C-chemokines defined by the conserved ELR sequence motif (glutamic acid-leucine-arginine) immediately preceding the first cysteine residue near the amino-terminal end. Chemokines with an ELR sequence motif have been found to chemoattract and activate primarily neutrophils. Chemokines without the ELR sequence motif appear to chemoattract and activate monocytes, dendritic cells, T-cells, NK-cells, B-lymphocytes, basophils, and eosinophils.

[0325] Members of the beta-chemokines or 17q chemokine family map to human chromosome 17q11-32 (murine chromosome 11). The first two cysteine residues are adjacent and, therefore, these proteins are called also C-C chemokines. This subfamily includes ACT-2 (e.g. polypeptides encoded by Genbank Accession No. J04130), C10 (e.g. as described in Berger M S et al (1993) DNA Cell Biol. 12: 839-47; Berger M S et al (1996) 8: 439-447), CCF18 (e.g. as described in Hara T et al (1995) Journal of Immunology 155: 5352-8), DC-CK1 (e.g. as described in Adema G J et al (1997) Nature 387: 713-717), ELC (e.g. polypeptides encoded by Genbank Accession No. AB000887, AF059208), Eotaxin-2 (e.g. as described in Forssmann U et al (1997) Journal of Experimental Medicine 185: 2171-2176), Exodus (e.g. polypeptides encoded by Genbank Accession No. U64197, U88320, U88321, U88322), FIC (e.g. polypeptides encoded by Genbank Accession No. L04694), GDCF and GDCF-2 (e.g. as described in Kuratsu J et al (1989) Journal of the National Cancer Institute 81: 347-51; Yoshimura T et al (1989) Journal of Experimental Medicine 169: 1449-59; Yoshimura T et al (1989) Journal of Immunology 142: 1956-62), HC-21 (e.g. as described in Chang H C & Reinherz E L (1989) European Journal of Immunology 19:1045-1051), HCC-1 (e.g. polypeptides encoded by Genbank Accession No. Z49270), I-309 (e.g. polypeptides encoded by Genbank Accession No. M57502), JE (e.g. polypeptides encoded by Genbank Accession No. AF058786, M28226), LAG-1 (lymphocyte activation gene-1) (e.g. polypeptides encoded by Genbank Accession No. X53683), LARC D86955), LD78 E03130, E03131, MARC (e.g. as described in Thirion S et al (1994) Biochemical and Biophysical Research Communications 201: 493-499), MCAF M24545 and as described in Apella E et al (1990) Progress in Clinical and Biological Research 349: 405-17), MCP-1 (e.g. polypeptides encoded by Genbank Accession No. X14768), MCP-2 (e.g. polypeptides encoded by Genbank Accession No. Y16645), MCP-3 (e.g. polypeptides encoded by Genbank Accession No. X72308, S71251), MCP-4 (e.g. polypeptides encoded by Genbank Accession No. X98306), MCP-5 (e.g. polypeptides encoded by Genbank Accession No. U50712), MIP (macrophage inflammatory protein) (e.g. polypeptides encoded by Genbank Accession No. U77180, U77035, U49513, M35590), MRP-2 (e.g. as described in Youn B S et al (1995) Journal of Immunology 155: 2661-7), RANTES SDF (e.g. polypeptides encoded by Genbank Accession No. M21121, M77747), TARC (e.g Genbank protein Accession No. Q92583).

[0326] In addition there are several other factors that are related to chemokines but that either have not been assigned yet to one of the two chemokine groups or that do not possess the classical features of either of the two chemokine groups (for example, ATAC (e.g. polypeptides encoded by Genbank Accession No. X86474), Ltn (e.g. polypeptides encoded by Genbank Accession No. U15607, U23772), SCM-1 (e.g. polypeptides encoded by Genbank Accession No. D63789, D63790, D43769). These have been referred to as C-type chemokines or gamma-chemokines.

[0327] Yet another group of chemokines has been identified that comprises neurotactin (e.g. polypeptides encoded by Genbank Accession No. AF010586, which is characterized by a CX(3)C cysteine signature motif. The existence of clearly defined subgroups of chemokines on the basis of structural and functional properties illustrates the importance of chemoattractant diversity in the regulation of leukocyte movement through the body.

[0328] The biological activities of chemokines are mediated by specific receptors and also by receptors with overlapping ligand specificities that bind several of these proteins which always belong either to the C-C-chemokines or the group of C-X-C-chemokines. Chemokine receptors belong to the large group of G-protein-coupled seven transmembrane domain receptors which contain seven hydrophobic alpha-helical segments that transverse the membrane. These receptors form a structurally related group within the superfamily of G-protein-coupled receptors which mediate signalling via heterotrimeric G-proteins.

[0329] The receptors that bind C-X-C chemokines are designated CXCR followed by a number (e.g., CXCR-1 (e.g. polypeptides encoded by Genbank Accession No. L19591),CXCR-2 (e.g. polypeptides encoded by Genbank Accession No. M94582), CXCR-3 (e.g. polypeptides encoded by Genbank Accession No. X95876), CXCR-4 (e.g. polypeptides encoded by Genbank Accession No. D87747, AF025375) while those binding C-C chemokines are designated CCR followed by a number (e.g., CCR-1 (e.g. polypeptides encoded by Genbank Accession No.L09230, U29678), CCR-2 (e.g. polypeptides encoded by Genbank Accession No. U29677, U95626), CCR-3 (e.g. polypeptides encoded by Genbank Accession No. U51241), CCR-4 (e.g. polypeptides encoded by Genbank Accession No. X90862, X85740), CCR-5 (e.g. polypeptides encoded by Genbank Accession No. U54994, U83327), CCR-6 (e.g. polypeptides encoded by Genbank Accession No. U95626), CCR-7 (e.g. polypeptides encoded by Genbank Accession No. L31581), CCR-8 (e.g. polypeptides encoded by Genbank Accession No. Z98206, U45983). Viral chemokine receptor homologues include ECRF-3, EBI-1 (EBV-induced gene-1), and US28.

[0330] It is now assumed that the combinatorial effects of multiple chemokines and other mediators are responsible for the cellular composition at inflammatory sites. In addition, many chemokines also directly activate cells. Some of them activate granulocytes and/or monocytes and cause respiratory bursts, degranulation, and the release of lysosomal enzymes. Others prime immune cells to respond to sub-optimal amounts of other inflammatory mediators. Yet others have been shown to be potent histamine releasing factors for basophils. It has been proposed that erythrocytes through their promiscuous chemokine receptor play an important role in regulating the chemokine network. Chemokines bound to the erythrocyte receptor are known to be inaccessible to their normal target cells. This appears to provide a sink for superfluous chemokines and may serve to limit the systemic effects of these mediators without disrupting localized processes taking place at the site of inflammation.

[0331] Certain C-C chemokines exhibit biological activities other than mere chemotaxis. Some chemokines have been shown to be capable of inducing the proliferation and activation of killer cells known as CHAK (C-C-chemokine-activated killer), which are similar to cells activated by IL2.

[0332] Another particularly useful cytokine according to the invention is flt-3 ligand (e.g.,polypeptides encoded by Genbank Accession Nos. U04806, U04807, U03858, L23636, U29874, U29875, U44024). This cytokine binds to the flt-3 tyrosine kinase (e.g., polypeptides encoded by Genbank Accession Nos. Z26652, X59398). The human flt-3 ligand also stimulates the proliferation of cells expressing murine flt-3 receptors.

[0333] The effects of flt-3 ligand are synergized by coexpression of G-C SF, GM-CSF, M-CSF, IL3, PIXY-321, and SCF. In combination with SCF and IL3 flt-3 ligand can cause expansion of cells with the marker spectrum CD34 (+)CD38 (−). Alone flt-3 ligand supports the survival of precursor cell types in the lineage of blood-forming cells such as CFU-GM, CFU-GEMM, and the very primitive high proliferative potential colony-forming cells. flt-3 ligand only has marginal effects on erythroid and megakaryocyte progenitor cells.

[0334] In the mouse, flt-3 ligand potently enhances growth of various types of progenitor/precursor cells in synergy with G-CSF, GM-CSF, M-CSF, IL3, IL6, IL7, IL11, IL12 and SCF. flt-3 ligand supports growth of LTC-IC (long-term culture-initiating cells). The ability of flt-3 ligand to promote the survival of hematopoietic progenitor cells is abrogated by TGF-beta and counteracted by TNF-alpha.

[0335] A study of the expression of functional flt-3 receptor and the responses to the ligand in AML (acute myeloid leukemia) and ALL (acute lymphoblastic leukemia) shows a considerable heterogeneity. BCP-ALL in particular fails to proliferate in the presence of flt-3 ligand despite strong expression of surface flt-3 receptor.

[0336] It has been shown that in patients with aplastic anemia and in cancer patients with chemotherapy-induced transient suppression of hematopoiesis, serum levels of flt-3 ligand fluctuate in an inverse relationship to the degree of bone marrow failure. flt-3 ligand levels in serum inversely correlate with the colony forming ability in vitro of bone marrow precursors from patients with aplastic anemia. flt-3 ligand treatment of mice challenged with syngeneic fibrosarcoma cells has been shown to result in complete tumor regression and in decreased tumor growth rates.

[0337] Antitumor cytokines are especially useful in the methods and compositions of the invention. According to the invention, an “antitumor cytokine” is a cytokine that can limit the growth or metastasis of tumor cells in vitro or in vivo, or can prolong the survival of a tumor-bearing animal, when either admixed with the cells or administered to the animal. The cytokine can be formulated as a solution in a biologically compatible buffer, e.g. PBS, and admixed with tumor cells in vitro. The concentration of cytokine may be from about the picomolar range to about the micromolar range. An antitumor cytokine will, for example, reduce the growth rate of the cells, e.g. by at least 10% compared to buffer alone, or inhibit metastatic properties of the cells, as may be evidenced by, e.g., increased cell adhesiveness or decreased ability to invade an extracellular matrix substrate, such as an artificial basement membrane. Alternatively, an antitumor cytokine may inhibit the growth or metastasis of a tumor in vivo, or may prolong the survival of a tumor-bearing animal. To evaluate the in vivo antitumor effects of a cytokine, the cytokine may be formulated in a pharmaceutically acceptable carrier and administered, e.g., by intravenous, intratumoral, or intraperitoneal injection. The cytokine may also be administered in association with cells, such as tumor cells that express or are coated with the cytokine.

[0338] Assays for Bioactivity

[0339] According to the invention, it is preferred that a cytokine be “bioactive”, “highly bioactive”, “extremely bioactive”, “natively bioactive”, or “suprabioactive”. Different levels of bioactivity relate to the ability to induce a change in a leukocyte (other than mere occupancy of the leukocyte's receptors for the cytokine). According to the invention, all naturally occuring cytokines are natively bioactive. Many types of assay can demonstrate the bioactivity of a non-naturally occurring cytokine. For example, a cytokine may be shown to induce survival and/or proliferation of a particular cell type. As another example, a cytokine may change the concentration of an intracellular second messenger, such as cAMP, arachidonic acid, calcium ions, or inositol triphosphate. The following are examples of assays for bioactivity:

[0340] Assay 1

[0341] Each well of one or more 60-well Lux microtiter trays is loaded with 200 FDC-P1 cells in 10 ul Dulbecco's modified Eagle's medium with a final concentration of 10% newborn calf serum. Cytokine in a concentration in at most the micromolar range is added to each well in a volume of 5 ul. The tray is incubated for 48 h at 37° C. in 10% CO2 Viable cell counts are performed. The average number of viable cells/well is counted. This assay is useful, for example, for identifying bioactivity mediated through a murine GM-CSF receptor.

[0342] Assay 2

[0343] Cytokine sample and a recombinant standard identical to a naturally occurring cytokine are each diluted serially in complete RPMI-10 in 96-well flat-bottom microtiter plates. Each dilution is plated in triplicate. CT.4S cells in active log-phase growth are collected, washed at least twice in complete RPMI-10, and resuspended in complete RPMI-10 at 1×105 cells/ml. 50 ul of the cell suspension is added to each well of the plate, which is then incubated for 24 h at 37° C. in 5% CO2. Tritiated thymidine is added to each well and the plate is incubated for an additional 24 h. The cells are then harvested and tritium incorporation is measured by liquid scintillation counting.. This assay is useful, for example, for identifying bioactivity mediated through an IL-4 receptor.

[0344] Assay 3 (Colony Formation Assay)

[0345] Agar (4% w/v) is melted in sterile water by boiling 3 min. The agar is then cooled to 42° C. and added to 42° C. RPMI-15 to a final concentration of 0.4%. The solution is maintained at 42° C. Femurs are removed from young mice using sterile technique. Marrow is collected by flushing the opened ends of the bones with sterile Hank's Balanced Salt Solution (HBSS) using a syringe equipped with a 23G needle. Marrow is placed in a 15 ml tissue culture tube and vortexed into a cell suspension. Bone fragments are allowed to settle for 5 min, and the supernatant suspension is removed. The suspension is adjusted to 7.5×106 nucleated cells/ml and diluted 1:100 by adding the 42° C. RPMI with 0.4% agar. 2-fold serial dilutions of cytokine are added to 35 mm tissue culture dishes in a volume <=0.2 ml. Control dishes have no cytokine added. 1 ml warm cell suspension is added to each dish and the agar is allowed to set at room temperature. The cultures are incubated for 5-7 days at 37° C. in 5% CO2. Colony formation is then evaluated by microscopy. The average number of colonies of a given type (or aggregate number of colonies of given different types) on the cytokine plates and the average number on the control plates is counted.. This assay is useful, for example, for identifying bioactivity mediated through CSF receptors.

[0346] Assay 4

[0347] Cytokine is diluted serially in RPMI 1640/25 mM HEPES/1% BSA. 25 ul of each dilution is plated in triplicate in a multiwell chemotaxis chamber bottom. Wells containing medium alone serve as negative controls and wells containing chemotaxis-inducing naturally occurring cytokine serve as positive controls. A polycarbonate membrane is placed over the chamber bottom and the chamber is assembled. 50 ul of peripheral blood mononuclear cells at 1.5×106 cells/ml in the RPMI/HEPES/BSA is added to each of the upper wells of the chamber. The chamber is incubated for 90 min at 37° C. in 5% CO2. The membrane is removed, washed, and stained. Migrated cells in 3-5 random fields of each well are counted by microscopy.

[0348] Assay 5

[0349] Naturally-occurring cytokine reference standard is diluted to 2 ng/ml in a 17×100 mm tube using supplemented medium. 3 further 5-fold serial dilutions are also prepared. Serial dilutions of cytokine are prepared in 17×100 mm tubes from 2 ng/ml to 20 pg/ml. 50 ul of PHA-activated human lymphoblasts 4×105 cells/ml in supplemental medium is added to each well of a 96-well flat-bottom microtiter plate. 50 ul of each dilution of reference standard or cytokine is added to triplicate wells. Negative control wells receive 50 ul of supplemented media alone. The plate is incubated for 48 h at 37° C. in 5% CO2 and the cells are labeled with tritiated thymidine. Incorporation is measured by liquid scintillation counting.. This assay is useful, for example, for identifying bioactivity mediated through an IL-12 receptor.

[0350] Assay 6

[0351] In another assay for bioactivity, an immunocompetent animal is vaccinated with on the order of 104-108 irradiated cytokine-transduced or cytokine-coated tumor cells, and challenged with on the order of 1 live wild-type tumor cells (in any temporal sequence). Readouts of the assay are survival, tumor onset, or number of metastases.

[0352] Further examples of cytokine assays can be found, e.g., in: Callard R E et al Assay for human B cell growth and differentiation factors. in: Clemens M J et al (eds) Lymphokines and Interferons. A practical Approach, pp. 345-64, IRL Press, Oxford 1987; Coligan J E et al Current protocols in immunology. Grene and Wiley-Interscience, New York 1991); Dotsika E N Assays for mediators affecting cellular immune functions. Current Opinion in Immunology 2: 932-5 (1989); Feldmann M et al Cytokine assays: role in evaluation of the pathogenesis of autoimmunity. Immunological Reviews 119: 105-123 (1991); Guiguet M et al Misinterpretation of the biological activity of cytokine-containing preparations attributable to unrecognized interacting components. Analytical Biochemistry 247(2): 441-442 (1997); Hamblin A S & O'Garra A Assays for interleukins and other related factors. In: Lymphocytes, a practical approach, Klaus G G B (edt), pp. 209-28, IRL Press, Oxford, (1987); Laska E M & Meisner M J Statistical methods and applications of bioassay. Annu. Rev. Pharmacol. Toxicol. 27: 385-97 (1987); Mosman T R & Fong T A T Specific assays for cytokine production by T cells Journal of Immunological Methods 116: 151-8 (1989); Newton R C & Uhl J Assays relevant to the detection and quantitation of cytokines and their inhibitors. Modern Methods in Pharmacol. 5: 83-99 (1989); Thorpe R et al Detection and measurement of cytokines. Blood Rev. 6: 133-48 (1992); van Zoelen E J The use of biological assays for detection of polypeptide growth factors. Progress in Growth Factor Research 2: 131-52 (1990); Winstanley F P Cytokine bioassay. In: Gallagher G et al (eds) Tumor Immunobiology, A practical Approach. Oxford University Press, pp. 179-303 (1993); Wadha M et al Quantitative biological assays for individual cytokines. In: Balkwill F R (edt) Cytokines, A practical approach. Oxford University press, pp. 309-330 (1991)

[0353] According to the invention, if a non-naturally occurring cytokine gives a readout in a bioactivity assay that is at least 10% but not more than 29% (to the nearest 1%) of the readout yielded by an equimolar amount of a naturally occurring cytokine (the latter giving a positive result in the assay), then the non-naturally occurring cytokine is “bioactive”. According to the invention, if a non-naturally occurring cytokine gives a readout in a bioactivity assay that is at least 30% but not more than 49% (to the nearest 1%) of the readout yielded by an equimolar amount of a naturally occurring cytokine (the latter giving a positive result in the assay), then the non-naturally occurring cytokine is “highly bioactive”. According to the invention, if a non-naturally occurring cytokine gives a readout in a bioactivity assay that is at least 50% but not more than 69% (to the nearest 1%) of the readout yielded by an equimolar amount of a naturally occurring cytokine (the latter giving a positive result in the assay), then the non-naturally occurring cytokine is “extremely bioactive”. According to the invention, if a non-naturally occurring cytokine gives a readout in a bioactivity assay that is at least 70% but not more than 100% (to the nearest 1%) of the readout yielded by an equimolar amount of a naturally occurring cytokine (the latter giving a positive result in the assay), then the non-naturally occurring cytokine is “natively bioactive”. According to the invention, if a non-naturally occurring cytokine gives a readout in a bioactivity assay that is greater than 100% of the readout yielded by an equimolar amount of a naturally occurring cytokine (the latter giving a positive result in the assay), then the non-naturally occurring cytokine is “suprabioactive”.

[0354] Ligands for CD40 Useful According to the Invention

[0355] Nucleotide sequences encoding the CD40 proteins of various species are provided by, e.g., Genbank Accession Nos. Y10507, M83312, and U57745. Human CD40 is a transmembrane glycoprotein with a length of 277 amino acids (48 kDa). CD40 is a phosphoprotein and can be expressed as a homodimer. A soluble form of CD40 (28 kDa) has also been described. CD40 protein is expressed on all B-lymphocytes during various stages of development, activated T-cells and monocytes, follicular dendritic cells, thymic epithelial cells, and various carcinoma cell lines. It is expressed on most mature B-cell malignancies and on some early B-cell acute lymphocytic leukemias. CD40 has been demonstrated on the majority of myeloma cell lines and myeloma cells from patients with plasma cell dyscrasia.

[0356] Induction of CD40 mRNA and enhancement of cell surface protein expression in primary human monocytes is observed after treatment with GM-CSF , IL3, or IFN-garnma. The human CD40 gene maps to chromosome 20.

[0357] CD40 has been proposed to play a role in the development of memory cells. It also plays a role in cell activation, functioning as a competence factor and progression factor. Crosslinking of the CD40 antigen (in combination with cytokines such as IL4 and IL5) leads to B-cell proliferation and induces immunoglobulin class switching from IgM to the synthesis of IgG, IgA, and IgE in the absence of activated T-cells. CD40 is one of the obligatory signals required for commitment of naive B-cells to IgA secretion; the mechanism of IgA induction requires the cooperation of IL10 and TGF-beta. Soluble CD40 inhibits T-cell-dependent B-cell proliferation.

[0358] Monoclonal antibodies against CD40 mediate a variety of effects on B-lymphocytes, including induction of intercellular adhesion (via CD11a/CD18 (LFA-1)), short- and long-term proliferation, differentiation and enhanced tyrosine phosphorylation of proteins. Germinal center centrocytes are prevented from undergoing cell death by apoptosis by activation through CD40 and antigen receptors.

[0359] In human resting B-cells expression of CD40 is induced by IL4. Treatment of human B-cells with IL6 leads to the phosphorylation of the intracellular CD40 domain. CD40 does not, however, function as a receptor for IL6. In activated human B-cells the synthesis of IL6 is induced by treatment of the cells with monoclonal antibodies directed against CD40, suggesting that CD40 participates in signal transduction mechanisms dependent on IL6.

[0360] Some limited sequence homologies have been found with receptors for Nerve Growth Factor, TNF-alpha and CD27 and it has been assumed that CD40 may be involved also in modulating the biological activity of these and other cytokines.

[0361] CD40 has biological functions also in non-immune cells although these are still largely unknown. CD40 ligation has been shown to induce cell death by apotosis in transformed cells of mesenchymal and epithelial origin. In part these processes are mediated through the death domain present in the cytoplasmic domain of CD40.

[0362] A particularly useful ligand for CD40 is CD 154. CD 154 (“CD40 ligand”; human protein 29.3 kDa, 261 amino acids) is a member of the TNF family of proteins. The human protein shows 82.8% and 77.4% identity at the cDNA and protein level, respectively, with a similar protein isolated from murine EL4 thymoma cells. Both proteins are the ligands for the CD40 cell surface antigen expressed on resting B-cells. The human gene encoding CD154 maps to chromosome Xq26.3-q27. Nucleotide sequences encoding the native CD40 ligands of various species are provided by, e.g., Genbank Accession Nos. X67878, X96710, X68550, X65453, Z48469, and L07414. Amino acid sequences of the CD154 molecules of various species are provided, e.g., by Entrez protein database Accession Nos. 1705713, 231718, 560693, 3047129, 116000, 1518170, 38412, 109639, 1083014, 38484, and 37270.

[0363] CD154 is naturally synthesized as a transmembrane polypeptide. Nevertheless, a biologically active soluble fragment of human CD154 has been described (Pietravalle et al, 1996, J Biol Chem 271:5965-5967.) Mazzei et al (1995, J Biol Chem 270:7025-7028) identified a biologically active soluble fragment of CD154 as a homotrimer of polypeptides consisting of amino acids Glu 108 through Leu 261 of intact transmembrane CD154. Graf et al (1995, Eur J Immunol 25:1749) describe another active fragment consisting of the C-terminal fragment produced by proteolyttic cleavage at Met 113. Aruffo et al disclose soluble forms of CD154 and their use to stimulate B cells in vitro in U.S. Pat. No. 5,540,926. In the present invention, particularly useful ligands for CD40 include polypeptides that comprise a sequence as set forth in SEQ ID NO. 2 of the '926 patent, from amino acid residues 47 to 261. These residues are comprised by the extracellular domain of human CD154.

[0364] Another particularly useful type of ligand for CD40 is an antibody to CD40. Examples of such antibodies include the monoclonal antibodies designated product numbers MCA1143 and MCA1590 of Harlan Bioproducts for Science (Indianapolis, Ind.); monoclonal antibodies designated catalog numbers P61640F (produced by clone 14G7), P42374M (produced by clone MAB89), P61046M (produced by clone BL-C4), and P54486M (produced by clone B-B20) of Biodesign International (Kennebunk, Me.); monoclonal antibody designated catalog number 05-422 (produced by clone 626.1) of Upstate Biotechnology (Lake Placid, N.Y.); monoclonal antibody designated catalog number 3601 (produced by clone S2C6) of Mabtech (Nacka, Sweden); monoclonal antibodies designated catalog numbers RDI-CBL486 (produced by clone BB20), RDI-M1691clb (produced by clone CLB-14G7), RDI-mCD40-323 (produced by clone 3/23) of Research Diagnostics (Flanders, N.J.); monoclonal antibodies described in Schwabe et al, 1997, Hybridoma 16:217-226; monoclonal antibodies described in Bjorck et al, 1994, Immunology 83:430-437; monoclonal antibody G28-5 described by Ledbetter et al, 1994, Circ Shock 44:67-72; and monoclonal antibodies described in Buske et al, 1997, Exp Hematol 25:329-337.

[0365] Opsonins Useful According to the Invention

[0366] As defined hereinabove, “opsonin” refers to naturally occurring and non-naturally occurring molecules which bind to both antigens and antigen presenting cells (APCs), such as, for example, phagocytic leukocytes (including monocytes and macrophages), dendritic cells (for example, Langerhans cells of the skin), B lymphocytes and, in humans, endothelial cells, or molecules which can be processed such that at least one product of the processing step or steps can bind to both antigens and antigen presenting cells (APCs), such as, for example, phagocytic leukocytes, dendritic cells, B lymphocytes, and, in humans, endothelial cells.

[0367] Without being bound to any one mechanism of action, it is believed that opsonin-enhanced cells provide a beneficial effect according to the invention because the opsonin portion acts as a link or coupling agent between the antigen and the APC to allow more efficient binding, engulfmnent, and internalization of the antigen. In addition, the opsonin itself can be internalized with the antigen. “Internalization” refers to the cellular uptake of a molecule such that it is brought into the cytoplasm or a compartment within the cytoplasm of the cell. Phagocytosis is a process by which a molecule is internalized by a cell.

[0368] Preferred opsonins are non-rodent opsonins, e.g., primate, e.g., human, opsonins. Opsonins useful according to the invention bind to receptors on APCs (e.g., phagocytic leukocytes, e.g., macrophages and other cells of the phagocytic system) such as receptors on cells which play a role in innate immunity, as described herein.

[0369] Some sets of opsonins can be regarded as structurally and functionally similar. For example, one family comprises fragments of complement components C3 and C4. These two components are highly structurally homologous, and each possesses an intramolecular thiolester bond that is broken when a peptide (C3a or C4a respectively) is proteolytically cleaved from the native molecule. Disruption of the thiolester makes available a chemical structure that can form an ester linkage with an antigen. The moiety of C3 on which this ester bond resides, i.e. the non-C3a moiety, is designated C3b, and C4b is the analogous product of C4 cleavage. C3b can be further proteolysed by proteins such as factor I to yield fragments such as C3bi and C3d, which also remain linked to the antigen via the ester bond.

[0370] There are four structurally unique proteins that are known to function as high affinity receptors for biologically active, membrane-bound fragments of C3 and/or C4. CR1 is the major receptor for the C3b fragment of C3 and C4b fragment of C4. It is expressed on monocytes and monocyte-derived APCs, among other cell types. CR2 is the major receptor for the fragment of C3 known as C3d, and is expressed on, e.g., mature B lymphocytes, but not on cells of monocytic lineage. The major role of CR2 on B lymphocytes is believed to be direct costimulation of B cells in concert with their cognate antigens. CR3 is expressed primarily by neutrophils and monocytes and is also expressed on FDC, Kupffer cells, and NK cells. CR3 is a C3 fragment receptor with a primary specificity for C3bi. CR3 has been proposed as an important organizer of cytoskeletal events necessary for adhesive interactions and membrane reorganization during processes such as phagocytosis.

[0371] CR4 is a member of the beta2 integrin family, and its alpha chain is structurally similar to the alpha chain of CR3 and LFA-1. Its primary physiologic ligands are believed to be C3d and C3d,g;, however, its biologic activities are less well understood than CR3.

[0372] Another example of a family of innate opsonins is the collectins, a group of collagenous C-type lectins that comprises complement component C1q, mannose binding protein, surfactant proteins A and D, and conglutinin. Each molecule comprises a lectin domain that can bind to an antigen, and a collagenous domain that can bind to receptors on phagocytic mononuclear cells, including receptors that are wholly or partially identical to the C1q receptor (Nepomuceno et al, Immunity 6:11 '9-29; Tenner et al, Immunity 3:485-93; Guan et al, J Immunol 152:4005-16; Geertsma et al, Am J Physiol 267:L578-84; Miyamura et al, Biochem J 300:237-42; Malhotra et al, J Exp Med 172:955-9; Malhotra et al, Biochem J 293:15-19). Most known collectins comprise multiple polypeptide chains, in some cases homomeric and in others heteromeric, that are assembled post-translationally, in part by covalent cross-linkage of hydroxyproline and hydroxylysine residues. Collectins are demonstrated to be opsonins in, for example, Pikaar et al, J Infect Dis 172:481-9; Alvarez-Dominguez et al, Infection & Immunity 61:3664-72; Kuhlman et al, J Exp Med 169:1733-45; and Geertsma et al, op cit.

[0373] Among the other innate opsonins useful according to the invention are C-reactive protein (CRP), alpha-2 macroglobulin, and fibronectin. CRP, a member of the pentraxin family of molecules, binds to receptors on cells of monocytic lineage and has been shown to be an opsonin (Tebo and Mortenson, J Immunol 144:231-8; Holzer et al, J Immunol 133:1424-30). Alpha-2 macroglobulin, like C3 and C4, comprises an internal thiolester bond that can be disrupted when the molecule is proteolysed. Such disruption allows covalent binding of the molecule to an antigen, and binding of alpha-2 macroglobulin to an APC can promote uptake of the conjugate. Fibronectin binds to the alpha 5 beta 1 integrin and can also bind to various antigens, allowing it to function as an opsonin (Cosio, J Lab Clin Med 103:613-9; Czop and Austen, J Immunol 129:2678-81).

[0374] Immunoglobulins (antibodies) can function as opsonins by binding antigens via their variable regions and APCs via their constant regions. Typically, an immunoglobulin comprises two heavy chains which are covalently bound to each other and each of which is bound to one light chain. These heterotetramers can further assemble into higher-order structures, such as the pentamers of IgM. Both heavy and light chain variable regions can contribute to the structure of the antigen binding site, whereas the APC binding site is located on the heavy chain constant region. Recombinant single-chain antibodies have also been described. APC receptors for immunoglobulins include Fc alpha, Fc gamma, Fc epsilon, and Fc mu receptors for IgA, IgG, IgE, and IgM, respectively.

[0375] Opsonins that are naturally expressed by multicellular eukaryotic organisms are secreted. The latter characteristic distinguishes opsonins from adhesion molecules. A non-naturally occurring molecule containing a naturally occurring APC-binding moiety shall be considered an opsonin if it contains a moiety through which it can be stably bound or attached to a cell such that the APC-binding moiety is located in the extracellular space, whether or not the molecule contains an antigen-binding moiety of a naturally occurring antigen. Moieties through which molecules can be stably bound to a cell include crosslinking moieties, transmembrane sequences, and lipid moieties. The preparation of proteins containing these sequences or moieties is well-known to one of skill in the art.

[0376] An “APC binding moiety of an opsonin” is a sequence or domain of an opsonin which when included in a chimeric molecule permits binding of the chimeric molecule to a receptor that is physiologically expressed on an APC with an affinity at least in the nanomolar range.

[0377] There are a number of examples of opsonin fragments that comprise APC binding moieties. Such a fragment may be any length so long as it retains an APC binding function; for example, it may be about 40 amino acids, 100 amino acids, 150 amino acids, 500 amino acids, 800 amino acids, or even as long as 3000 amino acids. For example, Las Holtet et al, 1994, FEBS Lett 344:242 describe a carboxy-terminal fragment of human &agr;2m (val1299-ala1451) that binds with high affinity to the &agr;2m receptor. Fragments comprising amino acids 1314-1451 of human &agr;2m and the corresponding domain of rat &agr;2m also bind to &agr;2m receptors, albeit with 1-2% of the affinities of native &agr;2m (Van Leuven et al, 1986, J Biol Chem 261:11369; Enghild et al, 1989, Biochemistry 28:1406; Salvesen et al, 1992, FEBS Lett 313:198; Sottrup-Jensen et al, 1986, FEBS Lett 205:20).

[0378] Becherer and Lambris, 1988, J Biol Chem 263:14586 describe fragments of C3b that bind to CR1, e.g., C3c, fragments of C3 generated by elastase treatment and comprising the N-terminal of the alpha' chain of C3b, and a synthetic peptide comprising the 42 N-terminal amino acids of the C3b alpha' chain. A binding sequence in C3 for CR3 has also been described (Wright et al, 1987, PNAS 84:4235).

[0379] “Collagen stalks” of C 1q, which are N-terminal fragments obtained by pepsin digestion, bind to the C1q receptor (Reid, 1981, Methods Enzymol 80:16; Malhotra et al, 1993, Biochem J 293:15). Malhotra et al, ibid., also provide evidence that an APC binding moiety of conglutinin is comprised by its 55 N-terminal amino acids. Ezekowitz (U.S. Pat. No. 5,270,199) offers a putative APC binding site in human mannose binding protein consisting of nucleotides 370-438 of FIG. 2 in the '199 Patent. In addition, by homology with conglutinin, exon 1 disclosed in the '199 Patent may comprise an APC binding moiety.

[0380] An APC binding moiety of IgG comprises the CH2 domain and the lower hinge region, including residues 234-237, as described by Canfield and Morrison, 1991, J Exp Med 173:1483-91; Lund et al, 1991, J Immunol 147:2657-62; and Sarmay et al, 1992, Mol Immunol, 29:633-9.

[0381] Examples of opsonins which can be used in the compositions and methods of the invention include fibronectin (e.g., Genbank accessions X02761, K00799, K02273, X82402, X00307, X00739), CRP (e.g., Genbank accessions X17496, M11880, M11881, M11882), complement components such as C1q (e.g., Genbank accessions X66295, M22531, X03084, X58861, and Swiss-Prot accessions P02747, P02745), complement fragments such as C3b and C3d (e.g., Genbank accessions K02782, K02765), mannose binding protein (e.g., Genbank accessions S42292, S42294, X15422), conglutinin (e.g., Genbank accession X71774), alpha-2-macroglobulin (e.g., Genbank accessions M93264, M11313), and surfactant proteins A (e.g., Genbank accessions M68519, S48768) and D (e.g., Genbank accessions L40156, X65018, S38981), immunoglobulins, and their homologues among species. 6 TABLE 2 Exemplary Opsonin, APC binding moiety/APC receptor pairs useful according to the invention. Exemplary APC Binding Opsonin Moiety Receptor &agr;-2 Val(1299)-Ala(1451) of &agr;-2m receptor, CD91 macroglobulin human &agr;-2m C3b 42 N-terminal amino acids CR1 of the &agr;′ chain of human C3b C3bi C3bi CR2, CR3 C3d C3d CR2, CR4 C1q Collagen stalks Collectin receptor (Reid, 1981, Methods (Nepomuceno et al., 1997, Enzymol. 80: 16) Immunity 6: 119), CD93 Conglutinin 55 N-terminal amino acids Collectin receptor of bovine conglutinin MBP 1. Polypeptide encoded by Collectin receptor, CD35, nt 370-438 of FIG. 2, CD14 U.S. Pat. No. 5,270,199 2. Polypeptide encoded by Econ . . . I of FIG. 2, U.S. Pat. No. 5,270,199 CRP CRP CRP receptor, Fc&ggr;RI, Fc&ggr;RIIa (CD32) Fibronectin Fibronectin &agr;5b1 integrin IgG CH2 domain plus lower Fc&ggr;RI, Fc&ggr;RII, Fc&ggr;RIII hinge including amino acids 234-237, as described by Lund et al., 1991, J. Immunol. 147: 2657 Surfactant Surfactant Protein A Collectin receptor, CD14 Protein A Surfactant Surfactant Protein D Protein D

[0382] Determination of Opsonicity According to the Invention

[0383] A given naturally occurring opsonin is considered useful according to the invention if it is determined to possess opsonicity according to one or more of the following assays, and if it is a secreted molecule.

[0384] Assay 1

[0385] In one assay of opsonicity, as described by O'Rear and Ross in Current Protocols in Immunology, 1994, John Wiley & Sons, pp. 13.4.5-9, SRBC bound via a physiologically occurring linkage to the candidate opsonin molecule are obtained. APCs from the species to which the candidate opsonin is native are suspended at 4×66/ml in ice-cold HBSS with 1% (w/v) Cohn fraction of BSA. If the candidate opsonin is a fragment of C3, the APCs are freshly drawn, uncultivated peripheral blood monocytes. SRBC linked to the candidate opsonin or control SRBC (identical to the former but not linked to the candidate opsonin) are suspended in the same solution at 2×108/ml. 100 ul of SRBC suspension and 100 ul of APC suspension are mixed in a 10×75 mm plastic tube. The tube is rotated at 40 rpm at 37° C. for 2-20 min. A small drop of the suspension is placed on a slide, covered with a coverslip, and allowed to stand for 5-10 min. Excess fluid can be removed by pressure on the coverslip, and the coverslip can be sealed to the slide, e.g. with clear nail polish. The slide is examined microscopically, and the percentage of APCs visibly adherent to 4 or more SRBCs is determined. If the percentage is 50% or greater when there are up to 4×104 candidate opsonin molecules/SRBC′, the candidate opsonin can be an opsonin.

[0386] Assay 2 (For Protease-activated Candidate Opsonin)

[0387] Candidate opsonin or radiolabeled Candidate opsonin is treated with a 1.5-3 fold molar excess of protease (0.05 M triethanolamine-0.1 M NaCl, pH 8.0, room temperature overnight). In this assay, the protease can serve as the antigen or an excess of another antigen can be added. Prior to binding studies, the candidate opsonin-antigen complex is dialyzed against HBSS (4° C.).

[0388] Candidate opsonin-antigen complex binding to monocytes is measured by incubating labeled ligand at a concentration up to 1.0 M with (1.5-4.0)×106 monocytes in 200 ml volume on ice. Nonspecific binding of radiolabeled ligands is determined in the presence of a 100-fold molar excess labeled candidate opsonin-antigen complex. The unbound ligand is separated from the cells and cell-bound ligand by rapid vacuum filtration on glass fiber filters. Studies are performed on ice to avoid potential complications due to endocytosis. Binding constarts and the number of sites per cell are determined by analysis and by nonlinear curve fit. If candidate opsonin-antigen complex affinity for a monocyte binding site is in at least the nanomolar range, the candidate opsonin is an opsonin.

[0389] Assay 3

[0390] Part I

[0391] To directly evaluate whether candidate opsonin is bound to the surface of P. carinii, immunoelectron microscopy is performed. P. carinii are isolated from bronchoaveolar lavage (BAL) of moribund infected rats using TBS with 1 mM calcium to preserve surface-bound candidate opsonin. Isolated organisms are fixed in periodate-lysine-paraformaldehyde buffer and embedded in Lowacryl mounting medium (Ted Pella, Inc., Redding, Calif.). Ultrathin sections are obtained, blocked with normal goat serum (2%) for 1 h, and incubated with either rabbit anti-candidate opsonin or nonimmune rabbit IgG (25 mg/ml) overnight. After washing, the sections are subsequently incubated with goat and rabbit IgG conjugated to 15 nM colloidal gold (Amersham Corp., Arlington Heights, Ill.). The sections are washed again and examined on a transmission electron microscope (model 6400: JEOL USA, Inc., Peabody, Mass.).

[0392] Part II

[0393] The attachment of P. carinii to cultured alveolar macrophages in the presence or absence of antibody to the candidate opsonin or with the addition of purified candidate is quantified as follows. Adherence of P. carinii to alveolar macrophages is assayed by 51 Cr-labeling the organisms. P. carinii are isolated from infected rats with TBS containing 1 mM calcium to prevent loss of surface-bound candidate opsonin. The organisms are radiolabeled by incubation for 8 h at 37° C. in 2 ml of DME containing 20% FCS and 200 mCi of 51Cr-sodium chromate (New England Nuclear). Normal alveolar macrophages are lavaged from healthy rats and plated in tissue culture plates (1×105) cells/well) which are been precoated with normal rat IgG (100 mg/ml×60 min) in order to ensure firm adherence of the macrophages. After 1 h, the macrophages are gently washed with HBSS to remove nonadherent cells. >95% of macrophages are adherent after this wash. 51Cr-P. carinii (1×106) containing surface-associated candidate opsonin are added to the macrophages and incubated at 37° C. for an additional hour. Subsequently, nonadherent P. carinii are removed by washing. The macrophage monolayers containing adherent P. carinii are solubilized in 1 N NaOH and quantified. Adherence of P. carinii is defined as: percentage of adherence=(A/A+B)×100, where A=51Cr-P. carinii associated with the monolayer, and B=unattached 51Cr-P. carinii. To assess the effect of candidate opsonin on the attachment of P. carinii to alveolar macrophage lung cells in culture, P. carinii adherence assays are conducted in the presence or absence of a polyclonal rabbit antibody generated against the candidate opsonin (100 mg/ml).

[0394] If candidate opsonin binding to P. carinii is apparent in Part I and if, in Part II, % adherence is diminished in the presence of anti-candidate opsonin with statistical significance of P<0.05, the candidate opsonin is an opsonin.

[0395] Assay 4

[0396] Association of bacteria with adherent monocytes is measured as follows. Endotoxin level in the modified PBS and in all buffers used is below 50 pg/ml as determined by the Limulus assay. 5×103 monocytes in modified PBS are allowed to adhere to the wells of a Terasaki plate for 2 h at 37° C. After nonadherent cells are removed by three washes with PBS, 5×104 FITC-labeled bacteria in 0.5 ml buffer with or without 10-50 micrograms/ml of candidate opsonin are added. A bacteria-to-monocyte ratio of 10:1 to 50:1 is used. After 30 min of incubation at 37° C. in the dark, the nonadherent bacteria are removed by five washes with warm PBS. Assays are performed in quadruplicate; in each well, the number of bacteria associated with 3 100 monocytes is counted under a flourescence microscope using ×400 magnification. Results are expressed as the number of bacteria associated with 100 monocytes. If this number with candidate opsonin can be at least twice that without candidate opsonin, the candidate opsonin is an opsonin.

[0397] Assay 5

[0398] Part I

[0399] About 1×107 to 6×107 bacteria per ml are incubated (20 min, 0° C.) with 10 mcg/ml of 125I-candidate opsonin in a total volume of 0.7 ml. of PBS aliquots, 100 ml, of the reaction mixtures are layered over 150 ml of an oil cushion (60% dibutyl phthalate, 40% dioctyl phthalate [Eastman Kodak Co., Rochester, N.Y.]), and the mixtures are centrifuged (10,000×g, 60 s, 4° C.). The tip of the tube, containing the cell pellet, is cut with a Mozart razor blade, and the radioactivity is counted.

[0400] Part II

[0401] APCs are plated in 96-well tissue culture plates (Costar, Cambridge, Mass.) at 2×105 cells per ml the evening before use. 2×106 bacteria per well (0.1 ml per well) are added to the culture plates with or without 100 mcg/ml of candidate opsonin. The plates are then centrifuged at 1,000×g for 7 min. After 15 min at 37° C. to allow the uptake of bacteria, free bacteria are removed by several washes with cold PBS. They are then incubated (45 min, 37° C.) in RPMI 1640 plus an amount of antibiotic that, when present in the culture for 45 min, kills all extracellular bacteria. The end of this incubation period is considered time zero. Monolayers are washed three times with Hanks' balanced saline solution, and the same volume of RPMI 1640 (R0) is added. The cells are lysed by using several cycles of freezing and thawing. The number (CFU) of viable bacteria per well is determined by quantitative plate counts on blood agar plates (Columbia blood agar; Becton Dickinson, San Jose, Calif.) after 24 h of incubation. Each result is given as the mean of three determinations.

[0402] If, in Part I, candidate opsonin-treated bacterial pellet has >75 KCPM and this incorporation can be inhibited by unlabeled candidate opsonin, and if in Part II the CFU with candidate opsonin is greater than without (P<0.05), the candidate opsonin can be an opsonin.

[0403] Assay 6

[0404] 200 &mgr;l of GHBSS (Hanks Balanced Salt Solution) +0.1% of gelatin containing 10 m mol CaCl2) containing 107 bacteria is prepared. The bacteria are then incubated at 4° C. with 20-100 &mgr;g/ml of candidate opsonin. Binding assays are done in the presence or absence of a competitive inhibitor. After incubation for 30 minutes, the bacteria are washed five times in a GHBSS+10 mmol CaCl2 at room temperature in a microfuge at 1,300 g for 3 minutes. Thereafter, a 1:1,000 dilution of rabbit anti-candidate opsonin antiserum is incubated with the bacteria for 1 h in PBS+5% FCS and 10 mmol CaCl2 and then the bacteria are washed three times in GHBSS+10 mmol CaCl2 plus 0.05% Tween 20. Binding of anti-serum to bacteria is detected by a 1:1,000 dilution of goat anti-rabbit IgG conjugated to rhodamine (Fisher Pharmaceuticals, Orangeburg, N.Y.). After incubation, the bacteria are washed five times in GHBSS+10 mmol CaCl2 plus 0.05% Tween 20, smeared onto glass slides and allowed to air dry. Thereafter bacteria are fixed with 100% ice cold methanol for 5 minutes. Negative controls included the absence of candidate opsonin and no first step antibody. Numerous fields of triplicate assays are examined by fluorescence microscopy.

[0405] Part II Association of Radiolabeled Bacteria with Cells.

[0406] 107 radiolabeled bacteria are resuspended in 200 &mgr;l of GHBSS+10 mmol CaCl2 and are incubated with or without candidate opsonin ranging from 2 &mgr;g/ml to 40 &mgr;g/ml at 4° C. for 30 min. The bacteria are then washed three times in GHBSS+10 mmol CaCl2 for 3 min at room temperature in a microfuge at 1,300 g, resuspended in 50 &mgr;l of GHBSS and added to a 1-ml suspension containing on the order of 106 APCs (GHBSS). The bacteria and APCs are gently rocked at 37° C. for 20 min and thereafter the unattached bacteria are removed by five washes using differential centrifugation at 82 g in a microfuge. Before the last wash, an aliquot from each sample is plated on a Labtek slide and cells are adhered for 10 min, fixed in methanol, stained with Giemsa, and scored by light microscopy. To score the cells plated on the Labtek slides, at least 400 cells are counted. The phagocytic index represented the number of attached or ingested particles per 100 PMNs. The pellet from above containing cells and radiolabeled bacteria is then lysed in 100 &mgr;l PBS+0.5% Triton X-100 and the radioactivity is measured in a scintillation counter. If, in Part I, specific binding of candidate opsonin to bacteria is evident, and in Part II the specific uptake of bacteria, in cpm, is more than three times greater with candidate opsonin than without, the candidate opsonin can be an opsonin.

[0407] Assay 7

[0408] Part I

[0409] To investigate binding to L donovani promastigotes cultures are seeded at 5×105 parasites ml−1. At regular time points up to 9 days, a fraction of parasites are counted, washed, and resuspended in 1% BSA, 0.5 mM Ca2+. 0.05% NaN3, Tris-buffered saline (TBS), (10 mM Tris-HCl, 0.15 M NaCl, pH 8.0) (diluent) to 2×105 ml. Fifty microliters of this suspension are then added to 200-&mgr;l microfuge tubes containing 70 &mgr;l 5 &mgr;g/ml radiolabled candidate opsonin (0.12 &mgr;Ci/&mgr;g) in diluent without EDTA, which had been layered over 150 &mgr;l of a dinonyl phthalate/dibutyl phthalate (40:60 v/v) oil mixture. Parasites are incubated for 1 h and centrifuged through the oil layer, the cell pellet is cut off, and associated candidate is detected by gamma counting. Each assay is performed in triplicate. The concentration dependency of candidate binding to promastigotes is also measured as above, using an activity of 0.045 &mgr;Ci/&mgr;g and a twofold dilution series from 60 to 0.015 &mgr;g/ml candidate.

[0410] Part II

[0411] APCs are plated out at 1×106 cells/well on glass coverslips in a 24-well tissue culture plate. Cells are incubated in RPMI 1640 (Life Technologies) supplemented with 10% PCS, 1 mM glutamine, 200 U/ml penicillin and 200 &mgr;g/ml streptomycin in a humidified incubator at 37° C. After 24 h, nonadherent cells are removed and remaining cells are used after 6 days. Promastigotes are incubated with or without candidate at 30 &mgr;g/ml in RPMI 1640 for 1 h and then washed three times before adding to the APC cultures at 106/well. Promastigotes are allowed to infect APCs for 1 h, then cells are washed, fixed with methanol, and Geimsa stained (BDH, Poole, Dorset, U.K.) before counting. The percentage of APCs infected and the number of parasites/100 macrophages is determined from quadruplicate cultures.

[0412] If in Part I the affinity of candidate opsonin for parasites is at least in the nanomolar range and in Part II the number of parasites taken up/100 APCs is, with candidate opsonin, at least twice that without candidate opsonin, the candidate opsonin can be an opsonin.

[0413] Assay 8

[0414] Part I

[0415] Portions (0.5 ml) of [35S] methionine-labeled culture medium containing 5 percent fetal calf serum and the candidate opsonin are incubated for 30 minutes at room temperature with 0.1 ml or 0.2 ml of a 10 percent suspension of a microorganism). The microorganisms tested may include, for example, Salmonella typhimurium, Bacillus subtilis, Staphylococcus aureus, Escherichia coli, and Saccharomyces cerevisiae. Bound proteins are released by boiling in buffer containing 2 percent SDS and 0.1 M dithiothreitol and are analyzed on a 5 percent SDS gel.

[0416] Part II

[0417] Fixed bacteria (0.1 ml; 10 percent by volume; 1010 organisms per millileter), labeled with [3H]thymidine, are incubated with 0.1 ml of serum with or without depletion of the candidate opsonin. After being washed with PBS, the bacteria are incubated with on the order of 1×107 APCs in a final volume of 0.9 ml PBS containing divalent cations. At intervals 0.2 ml is removed to ice-cold PBS with N-ethyimaleimide (2 mM) to block further endocytosis, and the cells are washed (at about 100 g for 10 seconds)

[0418] If in Part I a band corresponding to the candidate opsonin is apparent, and if in Part II the CPM after 6-10 min of incubation is at least three times greater for undepleted samples with serum than with depleted serum, the candidate opsonin can be an opsonin.

[0419] In lieu of results form Parts I of assays 3, 5, 6, 7, 8, a candidate opsonin that satisfies Part II of an assay can be an opsonin if it can bind to the antigen of the assay with an affinity in at least the nanomolar range.

[0420] Assay 9

[0421] SRBC coated with at least 1.2×104 molecules/cell of a fragment of C3 are prepared as described by O'Rear and Ross in Current Protocols in Immunology, 1994, John Wiley & Sons, pp. 13.4.5-9. 250 ul of monocytes at 2×105 cells/ml of RPMI with 10% fetal calf serum are added to each well of an 8-well glass tissue culture plate and incubated at 37° C., 5% CO2 for 3 h. The monocytes are washed twice with HBSS, and 50 ul of the SRBC at 1.5×108/ml of DVBS2+ are added to each well. The plate is centrifuged at 50 g for 5 min and then incubated at 37° C., 5% CO2 for 3 h. The walls are washed twice with HBSS, fixed with 0.5% glutaraldehyde, and stained with Giemsa stain. If >40% of the monocytes form rosettes with at least 1 SRBC as determined by light microscopy, the candidate can be an opsonin.

[0422] Heat Shock Proteins Useful in the Invention

[0423] Heat shock proteins (HSPs) are associated in cells with a broad spectrum of peptides, polypeptides, denatured proteins and antigens with which they form complexes. Such HSP-peptide complexes have been described as being useful in vaccines against cancers and infectious diseases by Srivastava et al., “Heat shock protein-peptide complexes in cancer immunotherapy” in Current Opinion in Immunology (1994), 6:728-732; Srivastava, “Peptide-Binding Heat Shock Proteins in the Endoplasmic Reticulum” in Advances in Cancer Research (1993), 62:153-177. The HSP-peptide complexes appear to work as vaccines, because they may function as antigen carrying and presentation molecules. The development of vaccines using such antigens has been described by Baltz, “Vaccines in the treatment of Cancer” in Am. J Health-Syst. Pharm. (1995), 52:2574-2585. The antigenicity of heat shock proteins appears to derive not from the heat shock protein itself, but from the associated peptides, see Udono et al., “Heat Shock Protein 70-associated Peptides Elicit Specific Cancer Immunity” in J. Exp. Med. (1993), 178:1391-1396; Srivastava et al., “Heat shock proteins transfer peptides during antigen processing and CTL priming” in Immunogenetics (1994), 39:93-98; Srivastava, “A Critical Contemplation on the Roles of Heat Shock Proteins in Transfer of Antigenic Peptides During Antigen Presentation” in Behring Inst. Mitt. (1994), 94:37-47. HSPs appear to be part of the process by which peptides are transported to the Major Histocompatibility Complex (MHC) molecules for surface presentation.

[0424] A number of different HSPs have been shown to exhibit immunogenicity, and are useful in the present invention, including, but not limited to: gp96, hsp90, hsp100, hsp60, hsp 25 and hsp70, see Udono et al., supra. and Udono et al., “Comparison of Tumor-Specific immunogenicity of Stress-Induced Proteins gp96, hsp90, and hsp 70” in Journal of Immunology (1994), 5398-5403; gp96 and grp94, Li et al., “Tumor rejection antigen gp96/grp94 is an ATPase: implications for protein folding and antigen presentation” in The EMBO Journal, Vol. 12, No. 8 (1993), 3143-3151; and gp96, hsp90 and hsp70, Blachere et al., “Heat Shock Protein Vaccines Against Cancer” in Journal Of Immunotherapy (1993), 14:352-356.

[0425] Heat shock proteins may be purified for use in the present invention using a procedure employing DE52 ionexchange chromatography followed by affinity chromatography on ATP-agarose, see Welch et al., “Rapid Purification of Mammalian 70,000-Dalton Stress Proteins: Affinity of the Proteins for Nucleotides” in Molecular and Cellular Biology (June 1985), 1229-1237.

[0426] Adhesion Molecules Useful in the Invention

[0427] Adhesion molecules useful in the present invention include any cell-surface protein which is involved in bediating the recognition and adhesion of cell sto their substrate and to other cells. Cellular adhesion molecules can be divided into two primary classes: Ca2+ dependent (cadherins) and Ca2+ independent.

[0428] There are over a dozen different types of Ca2+ dependent adhesion molecules called cadherins. Most cadherins are single-pass transmembrane glycoproteins composed of about 700-750 amino acid residues. The large extracellular part of the molecule is usually folded into five domains, each containing about 100 amino acid residues. Four of these domains contain presumptive Ca2+ binding sites. Cadherins are often present in the cell membrane as dimers.

[0429] Cadherens useful in the present invention include, but are not limited to cadherin E, cadherin N, cadherin BR, cadherin P, cadherin R, cadherin M, cadherin VE, cadherin T&H, cadherin OB, cadherin K, cadherin 7, cadherin 8, cadherin KSP, cadherin LI, cadherin 18, fibroblast 1, cadherin, fibroblast 2, cadherin, fibroblast 3, cadherin 23, desmocollin 1, desmocollin 2, desmoglein 1, desmoglein 2, desmoglein 3, and protocadherin 1, 2, 3, 7, 8, and 9.

[0430] The remaining adhesion molecules are Ca2+ independent, and, like the cadherins, may be used as ligands of a cell surface protein on an APC in the present invention. General classes of adhesion molecules as well as specific adhesion molecules useful in the present invention are shown below in Table 3. 7 TABLE 3 Selectins L-selectin; E-selectin; P-selectin Integrins &agr;1&bgr;1; &agr;2&bgr;1; &agr;3&bgr;1; &agr;4&bgr;1; &agr;5&bgr;1; &agr;6&bgr;1; &agr;7&bgr;1; &agr;8&bgr;1; &agr;9&bgr;1; &agr;v&bgr;1; &agr;L&bgr;2; &agr;M&bgr;2; &agr;X&bgr;2; &agr;IIb&bgr;3; &agr;v&bgr;3; &agr;6&bgr;4; &agr;v&bgr;5; &agr;v&bgr;6; &agr;v&bgr;7; &agr;IEL&bgr;7; &agr;11 Immunoglobulin Neural Specific: Adhesion molecule on glia (AMOG); L1CAM; Myelin- Superfamily associated glycoprotein (MAG); Myelin-oligodendrocyte glycoprotein (MOG); NCAM-1 (CD-56); NrCAM; OBCAM; P0protein; PMP-22protein; Neurofascin; NgCAM Systemic IgCAMS: ALCAM; Basigin (CD147); BL-CAM (CD22); CD44; ICAM-1 (CD54); ICAM-3 (CD50); Lymphocyte function antigen-2 (LFA- 2); LFA-3 (CD58; MHC molecules; MAdCAM-1; PECAM (CD31); T-cell receptor; VACM-1 Other Adhesion Agrin; CD34; GlyCAM-1; Oligodendrocyte-myelin glycoprotein (OMGP) Molecules

[0431] Defensins Useful in the Invention

[0432] In one embodiment, the portion of the multifunctional molecule which is a ligand of a cell surface protein of an APC is a defensin. Defensins are a large family of broad-spectrum antimicrobial peptides, identified originally in leukocytes of rabbits and humans. Defensins, cationic, polar peptides (30-35 aa, 3-4 kDa), are distinguished by a conserved tri-disulfide and largely beta sheet structure. When expressed at the cell surface, defensins have been hypothesized to function as a biocheical barrier against microbial invection by inhibiting colonization of the epithelium by a wide range of pathogenic microorganisms. Defensins useful in the present invention include, but are not limited to human alpha defensins 1-6, human neutrophil peptides 1-4, human beta defensin 1 and 2, and rat beta defeinsin 1 and 2.

[0433] Counter-receptors of T Cell Co-stimulatory Molecules of the Invention

[0434] In one embodiment of the invention the portion of the multifunctional molecule which is a ligand of a cell surface protein of an APC is a counter-receptor of a T cell co-stimulatory molecule. Costimulation is defined as a signaling pathway that does more than simply augment antigen receptor-proximal activation events, but that intersects with antigen-specific signals synergistically to allow lymphocyte activation. Accordingly, a counter-receptor of a co-stimulatory molecule, useful in the present invention includes, but is not limited to a receptor for one or more of B7-1, B7-2, ICOS:B7h, PD-1:PD-L1/PD-L2, CD48, CD40 ligand, and OX40. Counter-receptors useful in the present invention include, but are not limited to CD28, CTLA-4, ICOS, PD-1, members of the TNF receptor family, CD40, the major B cell costimulatory molecule, as well as OX-40, 4-1BB, CD30, and CD27.

[0435] Peptide Linkers

[0436] In one embodiment, the multifunctional molecule is a fusion polypeptide which comprises one or more amino acids interposed between the first and second parts which bind to cells, e.g. a fusion polypeptide which comprises a first amino acid sequence which can bind to an antigen bearing target and a second amino acid sequence which can bind to a leukocyte, and which further comprises at least one amino acid interposed between the first and second parts. The interposed amino acids may comprise, e.g., a linker sequence intended to lessen steric hindrance or other undesirable interactions between the aforementioned first and second parts. For, example, one such type of sequence takes the form (GlyxSer)n, wherein n is an integer from between 1 and 15, and x is an integer between 1 and 10. Additional useful linkers include, but are not limited to (Arg-Ala-Arg-Asp-Pro-Arg-Val-Pro-Val-Ala-Thr)1-5 (Xu et al., 1999, Proc. Natl. Acad. Sci. U.S.A. 96: 151-156), (Gly-Ser)n (Shao et al., 2000, Bioconjug. Chem. 11: 822-826), (Thr-Ser-Pro)n (Kroon et al., 2000, Eur. J. Biochem. 267: 6740-6752), (Gly-Gly-Gly)n (Kluczyk et al., 2000, Peptides 21: 1411-1420), and (Glu-Lys)n (Klyczyk et al., 2000, supra), wherein n is 1 to 15 (each of the preceding references is also incorporated herein by reference). In another embodiment, no amino acids are interposed between the first and second parts.

[0437] Antigens Useful According to the Invention

[0438] 1. Viral Antigens

[0439] Examples of viral antigens include, but are not limited to, retroviral antigens such as retroviral antigens from the human immunodeficiency virus (HIV) antigens such as gene products of the gag, pol, and env genes, the Nef protein, reverse transcriptase, and other HIV components; hepatitis viral antigens such as the S. M, and L proteins of hepatitis B virus, the pre-S antigen of hepatitis B virus, and other hepatitis, e.g., hepatitis A, B. and C, viral components such as hepatitis C viral RNA; influenza viral antigens such as hemagglutinin and neuraminidase and other influenza viral components; measles viral antigens such as the measles virus fusion protein and other measles virus components; rubella viral antigens such as proteins E1 and E2 and other rubella virus components; rotaviral antigens such as VP7sc and other rotaviral components; cytomegaloviral antigens such as envelope glycoprotein B and other cytomegaloviral antigen components; respiratory syncytial viral antigens such as the RSV fusion protein, the M2 protein and other respiratory syncytial viral antigen components; herpes simplex viral antigens such as immediate early proteins, glycoprotein D, and other herpes simplex viral antigen components; varicella zoster viral antigens such as gpI, gpII, and other varicella zoster viral antigen components; Japanese encephalitis viral antigens such as proteins E, M-E, M-E-NS 1, NS 1, NS 1-NS2A, 80% E, and other Japanese encephalitis viral antigen components; rabies viral antigens such as rabies glycoprotein, rabies nucleoprotein and other rabies viral antigen components. See Fundamental Virology, Second Edition, e's. Fields, B. N. and Knipe, D. M. (Raven Press, New York, 1991) for additional examples of viral antigens.

[0440] 2. Bacterial Antigens

[0441] Bacterial antigens which can be used in the compositions and methods of the invention include, but are not limited to, pertussis bacterial antigens such as pertussis toxin, filamentous hemagglutinin, pertactin, FIM2, FIM3, adenylate cyclase and other pertussis bacterial antigen components; diptheria bacterial antigens such as diptheria toxin or toxoid and other diphtheria bacterial antigen components; tetanus bacterial antigens such as tetanus toxin or toxoid and other tetanus bacterial antigen components; streptococcal bacterial antigens such as M proteins and other streptococcal bacterial antigen components; gram-negative bacilli bacterial antigens such as lipopolysaccharides and other gram-negative bacterial antigen components; Mycobacterium tuberculosis bacterial antigens such as mycolic acid, heat shock protein 65 (HSP65), the 30 kDa major secreted protein, antigen 85A and other mycobacterial antigen components; Helicobacter pylori bacterial antigen components; pneumococcal bacterial antigens such as pneumolysin, pneumococcal capsular polysaccharides and other pneumococcal bacterial antigen components; hemophilus influenza bacterial antigens such as capsular polysaccharides and other hemophilus influenza bacterial antigen components; anthrax bacterial antigens such as anthrax protective antigen and other anthrax bacterial antigen components; rickettsiae bacterial antigens such as romps and other rickettsiae bacterial antigen component. Also included with the bacterial antigens described herein are any other bacterial, mycobacterial, mycoplasmal, rickettsial, or chlamydial antigens.

[0442] 3. Fungal Antigens

[0443] Fungal antigens which can be used in the compositions and methods of the invention include, but are not limited to, candida fungal antigen components; histoplasma fungal antigens such as heat shock protein 60 (HSP60) and other histoplasma fungal antigen components; cryptococcal fungal antigens such as capsular polysaccharides and other cryptococcal fungal antigen components; coccidiodes fungal antigens such as spherule antigens and other coccidiodes fungal antigen components; and tinea fungal antigens such as trichophytin and other coccidiodes fungal antigen components.

[0444] 4. Parasite Antigens

[0445] Examples of protozoa and other parasitic antigens include, but are not limited to, plasmodium falciparum antigens such as merozoite surface antigens, sporozoite surface antigens, circumsporozoite antigens, gametocyte/gamete surface antigens, blood-stage antigen pf 1 55/RESA and other plasmodial antigen components; toxoplasma antigens such as SAG-1, p30 and other toxoplasma antigen components; schistosomae antigens such as glutathione-S-transferase, paramyosin, and other schistosomal antigen components; leishmania major and other leishmaniae antigens such as gp63, lipophosphoglycan and its associated protein and other leishmanial antigen components; and trypanosoma cruzi antigens such as the 75-77 kDa antigen, the 56 kDa antigen and other trypanosomal antigen components.

[0446] 5. Tumor Antigens.

[0447] Tumor antigens which can be used in the compositions and methods of the invention include, but are not limited to, telomerase components; multidrug resistance proteins such as P-glycoprotein; MAGE-1, alpha fetoprotein, carcinoembryonic antigen, mutant p53, immunoglobulins of B-cell derived malignancies, fusion polypeptides expressed from genes that have been juxtaposed by chromosomal translocations, human chorionic gonadotrpin, calcitonin, tyrosinase, papillomavirus antigens, gangliosides or other carbohydrate-containing components of melanoma or other tumor cells. It is contemplated by the invention that antigens from any type of tumor cell can be used in the compositions and methods described herein.

[0448] 6. Antigens Relating to Autoimmunity.

[0449] Antigens involved in autoimmune diseases, allergy, and graft rejection can be used in the compositions and methods of the invention. For example, an antigen involved in any one or more of the following autoimmune diseases or disorders can be used in the present invention: diabetes mellitus, arthritis (including rheumatoid arthritis, juvenile rheumatoid arthritis, osteoarthritis, psoriatic arthritis), multiple sclerosis, myasthenia gravis, systemic lupus erythematosis, autoimmune thyroiditis, dermatitis (including atopic dermatitis and eczematous dermatitis), psoriasis, Sjogren's Syndrome, including keratoconjunctivitis sicca secondary to Sjogren's Syndrome, alopecia areata, allergic responses due to arthropod bite reactions, Crohn's disease, aphthous ulcer, iritis, conjunctivitis, keratoconjunctivitis, ulcerative colitis, asthma, allergic asthma, cutaneous lupus erythematosus, scleroderma, vaginitis, proctitis, drug eruptions, leprosy reversal reactions, erythema nodosum leprosum, autoimmune uveitis, allergic encephalomyelitis, acute necrotizing hemorrhagic encephalopathy, idiopathic bilateral progressive sensorineural hearing loss, aplastic anemia, pure red cell anemia, idiopathic thrombocytopenia, polychondritis, Wegener's granulomatosis, chronic active hepatitis, Stevens-Johnson syndrome, idiopathic sprue, lichen planus, Crohn's disease, Graves ophthalmopathy, sarcoidosis, primary biliary cirrhosis, uveitis posterior, and interstitial lung fibrosis. Examples of antigens involved in autoimmune disease include glutamic acid decarboxylase 65 (GAD 65), native DNA, myelin basic protein, myelin proteolipid protein, acetylcholine receptor components, thyroglobulin, and the thyroid stimulating hormone (TSH) receptor. Examples of antigens involved in allergy include pollen antigens such as Japanese cedar pollen antigens, ragweed pollen antigens, rye grass pollen antigens, animal derived antigens such as dust mite antigens and feline antigens, histocompatiblity antigens, and penicillin and other therapeutic drugs. Examples of antigens involved in graft rejection include antigenic components of the graft to be transplanted into the graft recipient such as heart, lung, liver, pancreas, kidney, and neural graft components. An antigen can also be an altered peptide ligand useful in treating an autoimmune disease.

[0450] Examples of miscellaneous antigens which can be can be used in the compositions and methods of the invention include endogenous hormones such as luteinizing hormone, follicular stimulating hormone, testosterone, growth hormone, prolactin, and other hormones, drugs of addiction such as cocaine and heroin, and idiotypic fragments of antigen receptors such as Fab-containing portions of an anti-leptin receptor antibody.

[0451] Determination of Binding of a Multifunctional Molecule to a Antigen Bearing Target or APC

[0452] Multiple techniques are known to those of skill in the art for detecting protein-protein binding. That is, the binding of a multifunctional molecule of the invention to either or both of an antigen bearing target and an APC.

[0453] The association between the multifunctional molecule and an antigen bearing target and/or an APC may be measured for example by Fluorescent Resonance Energy Transfer (FRET), wherein one peptide (i.e., the multifunctional molecule) comprises a fluorescent label moiety, and the antigen bearing target or APC harbours a second such moiety, and where excitation at an appropriate wavelength may result in absorption of photons by one label, followed by FRET, and emission at a second wavelength characteristic of the second fluorophore, this emission being measured and corresponding to the amount of antigen bearing target or APC which is associated with the multifunctional molecule. Alternatively, this association may be measured in one of many other ways which are described more fully below.

[0454] A “fluorescent tag” or “fluorescent group” refers to either a fluorophore or a fluorescent protein or fluorescent fragment thereof, or refers to a fluorescent amino acid such as tryptophan which may be incorporated into a polypeptide. “Fluorescent protein” refers to any protein which fluoresces when excited with appropriate electromagnetic radiation. This includes proteins whose amino acid sequences are either natural or engineered.

[0455] It is additionally preferred that the fluorophores comprise fluorescein and tetramethylrhodamine or another suitable pair. In another preferred embodiment, the label comprises two different fluorescent proteins. It is preferred that fluorescent proteins comprise any protein selected from the group consisting of green fluorescent protein (GFP), blue fluorescent protein, red fluorescent protein and other engineered forms of GFP.

[0456] Preferably, the polypeptide comprises a cysteine amino acid through which the label is attached via a covalent bond. More preferably, the label may be attached via a primary amine group such as via a lysine residue. As will be apparent to a person skilled in the art, it is preferable to avoid using the same chemistry for both labelling and immobilising polypeptides of the invention. For example, if the polypeptide is immobilised via cysteine residues, the label is advantageously attached via lysine residues.

[0457] Preferably, the measuring is performed by fluorescent resonance energy transfer (FRET), fluorescence anisotropy or fluorescence correlation spectroscopy, or by measuring the binding of a fluorescent partner polypeptide to an imnobilised polypeptide. Techniques for performing such measurements are well known to those of skill in the art.

[0458] It is preferred that the fluorescence emitting means comprise two different fluorophores, and particularly preferred that the fluorophores comprise fluorescein and tetramethylrhodamine or another suitable pair.

[0459] As used herein with regard to fluorescent labels for use in FRET, the term “appropriate combination” refers to a choice of reporter labels such that the emission wavelength spectrum of one (the “donor” moiety) is within the excitation wavelength spectrum of the other (the “acceptor” moiety).

[0460] Methods of detection without use of label are known in the art. These include detection using surface plasmon resonance to detect changes in the mass of, for example the multifunctional molecule, which would occur if binding of the partner polypeptide increased or decreased. Such measurements may be made for example using a BIACORE machine. In this embodiment, the multifunctional molecule is immobilized on a solid support prior to contacting the molecule with the antigen bearing moiety and/or APC.

[0461] In addition to the above methods, one technique for determing the binding of a multifunctional molecule of the invention to an antigen bearing moiety and/or and APC involves the use of antibodies specifically directed to the multifunctional molecule. Briefly, antigen bearing cells, for example, are incubated with the multifunctional molecule of the invention in RPMI 1640, or other suitable buffer, for 1-4 hours at 37° C. with shaking. The cells are then washed in PBS containing 2% FBS, or other cell culture serum. The antigen bearing cells are then incubated with, for example, an FITC labeled anti- multifunctional molecule antibody for 1 hour at 4° C. After additional washing in PBS, the cells are analyzed by flow cytometry, wherein the identification of labeled cells is indicative of the binding of the multifunctional molecule of the invention to the antigen bearing cell.

[0462] Preparation of a Cell Containing a Recombinant Nucleic Acid According to the Invention

[0463] In one embodiment of the present invention, a nucleic acid molecule encoding a multifluctional molecule of the present invention is introduced into a host cell capable of expressing the nucleic acid molecule so as to produce the multifunctional molecule. In one embodiment, the host cell is permitted to express the nucleic acid ex vivo. In an alternate embodiment, the host cell is transfected with the nucleic acid molecule encoding the multifunctional molecule, and then placed back into the host animal from which it was obtained, wherein the multifunctional polypeptide molecule is expressed in vivo in the host animal.

[0464] Host cells are transfected, as taught herein, via conventional methods well-known in the art. Suitable methods for transforming or transfecting host cells can be found in Sambrook et al. (Molecular Cloning: A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press (1989)), and other laboratory manuals. Additional examples of methods of introducing nucleic acid molecules encoding multifunctional molecules are described below. The cells containing the introduced nucleic acid molecules encoding, for example, multifunctional molecule and/or an antigen, can themselves be administered to a subject (as the antigen) according to the methods of the invention, e.g., in a vaccine composition.

[0465] A. Introduction of Naked Nucleic Acid into Cells

[0466] 1. Transfection mediated by DEAE-dextran: Naked nucleic acid can be introduced into cells by forming a mixture of the nucleic acid and DEAE-dextran and incubating the mixture with the cells. A dimethylsulfoxide or chloroquine shock step can be added to increase the amount of nucleic acid uptake. DEAE-dextran transfection is only applicable to in vitro modification of cells and can be used to introduce nucleic acid transiently into cells but is not preferred for creating stably transfected cells. Thus, this method can be used for short term production of a gene product but is not a method of choice for long-term production of a gene product. Protocols for DEAE-dextran-mediated transfection can be found in Current Protocols in Molecular Biology, Ausubel, F. M. et al. (e's.) Greene Publishing Associates, (1989), Section 9.2 and in Molecular Cloning: A Laboratory Manual. 2nd Edition. Sambrook et al. Cold Spring Harbor Laboratory Press, (1989), Sections 16.41-16.46 or other standard laboratory manuals.

[0467] 2. Electroporation: Naked nucleic acid can also be introduced into cells by incubating the cells and the nucleic acid together in an appropriate buffer and subjecting the cells to a high-voltage electric pulse. The efficiency with which nucleic acid is introduced into cells by electroporation is influenced by the strength of the applied field, the length of the electric pulse, the temperature, the conformation and concentration of the nucleic acid and the ionic composition of the media. Electroporation can be used to stably (or transiently) transfect a wide variety of cell types and is only applicable to in vitro modification of cells. Protocols for electroporating cells can be found in Current Protocols in Molecular Biology, Ausubel, F. M. et al. (e's.) Greene Publishing Associates, (1989), Section 9.3 and in Molecular Cloning: A Laboratory Manual, 2nd Edition, Sambrook et al. Cold Spring Harbor Laboratory Press, (1989), Sections 16.54-16.55 or other standard laboratory manuals.

[0468] 3. Liposome-mediated transfection (“lipofection”): Naked nucleic acid can be introduced into cells by mixing the nucleic acid with a liposome suspension containing cationic lipids. The nucleic acid/liposome complex is then incubated with cells. Liposome mediated transfection can be used to stably (or transiently) transfect cells in culture in vitro. Protocols can be found in Current Protocols in Molecular Biology, Ausubel, F. M. et al. (e's.) Greene Publishing Associates, (1989), Section 9.4 and other standard laboratory manuals. Additionally, gene delivery in vivo has been accomplished using liposomes. See for example Nicolau et al. (1987) Meth. Enz. 149:157-176; Wang and Huang (1987) Proc. Natl. Acad Sci. SA 84:7851-785S; Brigham et al. (1989) Am. J. Med. Sci. 298:278; and Gould-Fogerite et al. (1989) Gene 84:429-438.

[0469] 4. Direct Injection: Naked nucleic acid can be introduced into cells by directly injecting the nucleic acid into the cells. For an in vitro culture of cells, nucleic acid can be introduced by microinjection. Since each cell is microinjected individually, this approach is very labor intensive when modifying large numbers of cells. However, a situation wherein microinjection is a method of choice is in the production of transgenic animals (discussed in greater detail below). In this situation, the nucleic acid is stably introduced into a fertilized oocyte which is then allowed to develop into an animal. The resultant animal contains cells carrying the nucleic acid introduced into the oocyte. Direct injection has also been used to introduce naked nucleic acid into cells in vivo (see e.g., Acsadi et al. (1991) Nature 332: 815-818; Wolff et al. (1990) Science 247:1465-1468). A delivery apparatus (e.g., a “gene gun”) for injecting DNA into cells in vivo can be used. Such an apparatus is commercially available (e.g., from BioRad).

[0470] 5. Receptor-Mediated DNA Uptake: Naked nucleic acid can also be introduced into cells by complexing the nucleic acid to a cation, such as polylysine, which is coupled to a ligand for a cell-surface receptor (see for example Wu, G. and Wu, C. H. (1988) J. Biol. Chem 263:14621; Wilson et al. (1992) J. Biol. Chem. 267:963-967; and U.S. Pat. No. 5,166,320). Binding of the nucleic acid-ligand complex to the receptor facilitates uptake of the nucleic acid by receptor-mediated endocytosis. Receptors to which a nucleic acid-ligand complex have targeted include the transferrin receptor and the asialoglycoprotein receptor. A nucleic acid-ligand complex linked to adenovirus capsids which naturally disrupt endosomes, thereby releasing material into the cytoplasm can be used to avoid degradation of the complex by intracellular lysosomes (see for example Curiel et al. (1991) Proc. Natl. Acad. Sci. USA 88:8850; Cristiano et al. (1993) Proc. Natl. Acad. Sci USA 90:2122-2126). Receptor-mediated nucleic acid uptake can be used to introduce nucleic acid into cells either in vitro or in vivo and, additionally, has the added feature that nucleic acid can be selectively targeted to a particular cell type by use of a ligand which binds to a receptor selectively expressed on a target cell of interest.

[0471] Generally, when naked nucleic acid is introduced into cells in culture (e.g., by one of the transfection techniques described above) only a small fraction of cells (about 1 out of 105) typically integrate the transfected nucleic acid into their genomes (i.e., the nucleic acid is maintained in the cell episomally). Thus, in order to identify cells which have taken up exogenous nucleic acid, it is advantageous to transfect nucleic acid encoding a selectable marker into the cell along with the nucleic acid(s) of interest. Preferred selectable markers include those which confer resistance to drugs such as G418, hygromycin and methotrexate. Alternatively, a selectable marker maybe one which emits a detectable signal upon expression such as green fluorescen protein or blue fluorescent protein. Selectable markers may be introduced on the same plasmid as the gene(s) of interest or may be introduced on a separate plasmid.

[0472] B. Viral-Mediated Gene Transfer

[0473] A preferred approach for introducing nucleic acid encoding a gene product into a cell is by use of a viral vector containing nucleic acid, e.g. a cDNA, encoding the gene product. Infection of cells with a viral vector has the advantage that a large proportion of cells receive the nucleic acid, which can obviate the need for selection of cells which have received the nucleic acid. Additionally, molecules encoded within the viral vector, e.g., by a cDNA contained in the viral vector, are expressed efficiently in cells which have taken up viral vector nucleic acid and viral vector systems can be used either in vitro or in vivo.

[0474] 1. Retroviruses: Defective retroviruses are well characterized for use in gene transfer for gene therapy purposes (for a review see Miller, A. D. (1990) Blood 76:271). A recombinant retrovirus can be constructed having a nucleic acid encoding a gene product of interest inserted into the retroviral genome. Additionally, portions of the retroviral genome can be removed to render the retrovirus replication defective. The replication defective retrovirus is then packaged into virions which can be used to infect a target cell through the use of a helper virus by standard techniques. Protocols for producing recombinant retroviruses and for infecting cells in vitro or in vivo with such viruses can be found in Current Protocols in Molecular Biology, Ausubel, F. M. et al. (eds.) Greene Publishing Associates, (1989), Sections 9.10-9.14 and other standard laboratory manuals. Examples of suitable retroviruses include pLJ, pZIP, pWE and pEM which are well known to those skilled in the art. Examples of suitable packaging virus lines include (&phgr;Crip, (&phgr;Cre, —2, and _Am. Retroviruses have been used to introduce a.variety of genes into many different cell types, including epithelial cells, endothelial cells, lymphocytes, myoblasts, hepatocytes, bone marrow cells, in vitro and/or in vivo (see for example Eglitis, et al. (1985) Science 230:1395-1398; Danos and Mulligan (1988) Proc. Natl. Acad. Sci. USA 85:6460-6464; Wilson et al. (1988) Proc. Natl. Acad. Sci. USA 85:3014-3018; Armentano et al. (1990) Proc. Natl. Acad. Sci. USA 87:6141-6145; Huber et al. (1991) Proc. Natl. Acad. Sci. USA 88:8039-8043; Ferry et al. (1991) Proc. Natl. Acad Sci. USA 88:8377-8381; Chowdhury et al. (1991) Science 254:1802-1805; van Beusechem et al. (1992) Proc. Natl. Acad Sci. USA 89:7640-7644; Kay et al. (1992) Human Gene Therapy 3:641-647; Dai et al. (1992) Proc. Natl. Acad Sci. USA89:10892-10895; Hwu et al. (1993) J. Immunol. 150:4104-115; U.S. Patent No. 4,868,116; U.S. Pat. No. 4,980,286; PCT Application WO 89/07136; PCT Application WO 89/02468; PCT Application WO 89/05345; and PCT Application WO 92/07573). Retroviral vectors require target cell division in order for the retroviral genome (and foreign nucleic acid inserted into it) to be integrated into the host genome to stably introduce nucleic acid into the cell. Thus, it may be necessary to stimulate replication of the target cell.

[0475] 2. Adenoviruses: The genome of an adenovirus can be manipulated such that it encodes and expresses a gene product of interest but is inactivated in terms of its ability to replicate in a normal lytic viral life cycle. See for example Berkner et al. (1988) BioTechniques 6:616; Rosenfeld et al. (1991) Science 252:431-434; and Rosenfeld et al. (1992) Cell 68:143-155. Suitable adenoviral vectors derived from the adenovirus strain Ad type 5 dl324 or other strains of adenovirus (e.g., Adz, Ad3, Ad7 etc.) are well known to those skilled in the art. Recombinant adenoviruses are advantageous in that they do not require dividing cells to be effective gene delivery vehicles and can be used to infect a wide variety of cell types, including airway epithelium (Rosenfeld et al. (1992) cited supra), endothelial cells (Lemarchand et al. (1992) Proc. Natl. Acad. Sci. USA 89:6482-6486), hepatocytes (Herz and Gerard (1993) Proc. Natl. Acad. Sci. USA 90:2812-2816) and muscle cells (Quantin et al. (1992) Proc. Natl. Acad. Sci. USA 89:2581-2584). Additionally, introduced adenoviral nucleic acid (and foreign DNA contained therein) is not integrated into the genome of a host cell but remains episomal, thereby avoiding potential problems that can occur as a result of insertional mutagenesis in situations where introduced nucleic acid becomes integrated into the host genome (e.g., retroviral DNA). Moreover, the carrying capacity of the adenoviral genome for foreign DNA is large (up to 8 kilobases) relative to other gene delivery vectors (Berkner et al. cited supra; Haj-Ahmand and Graham (1986) J. Virol. 57:267). Most replication-defective adenoviral vectors currently in use are deleted for all or parts of the viral E1 and E3 genes but retain as much as 80% of the adenoviral genetic material.

[0476] 3. Adeno-Associated Viruses: Adeno-associated virus (AAV) is a naturally occurring defective virus that requires another virus, such as an adenovirus or a herpes virus, as a helper virus for efficient replication and a productive life cycle. (For a review see Muzyczka et al. Curr. Topics in Micro. and Immunol. (1992) 158:97-129). It is also one of the few viruses that may integrate its DNA into non-dividing cells, and exhibits a high frequency of stable integration (see for example Flotte et al. (1992) Am. J. Respir. Cell. Mol. Biol. 7:349-356; Samulski et al. (1989) J. Virol. 63:3822-3828; and McLaughlin et al. (1989) J. Virol 62:1963-1973). Vectors containing as little as 300 base pairs of AAV can be packaged and can integrate. Space for exogenous nucleic acid is limited to about 4.5 kb. An AAV vector such as that described in Tratschin et al. (1985) Mol. Cell. Biol. 5:3251-3260 can be used to introduce nucleic acid into cells. A variety of nucleic acids have been introduced into different cell types using AAV vectors (see for example Hermonat et al. (1984) Proc. Natl. Acad. Sci. USA 81 :6466-6470; Tratschin et al. (1985) Mol. Cell. Biol. 4:2072-2081; Wondisford et al. (1988) Mol. Endocrinol. 2:32-39; Tratschin et al. (1984) J. Virol.51:611-619; and Flotte et al. (1993) J. Biol. Chem. 268:3781-3790).

[0477] The efficacy of a particular expression vector system and method of introducing nucleic acid into a cell can be assessed by standard approaches routinely used in the art. For example, nucleic acid introduced into a cell can be detected by a filter hybridization technique (e.g., Southern blotting) and RNA produced by transcription of introduced nucleic acid can be detected, for example, by Northern blotting, RNase protection or reverse transcriptase-polymerase chain reaction (RI-PCR). The gene product can be detected by an appropriate assay, for example by immunological detection of a produced protein, such as with a specific antibody, or by a functional assay to detect a functional activity of the gene product, such as an enzymatic assay. If the gene product of interest to be expressed by a cell is not readily assayable, an expression system can first be optimized using a reporter gene linked to the regulatory elements and vector to be used. The reporter gene encodes a gene product which is easily detectable and, thus, can be used to evaluate the efficacy of the system. Standard reporter genes used in the art include genes encoding beta-galactosidase, chloramphenicol acetyl transferase, luciferase and human growth hormone.

[0478] Cells Useful According to the Invention

[0479] The invention provides for host cells transfected with nucleic acid constructs encoding a multifunctional molecule of the invention. Host cells useful in the invention include but are not limited to the following.

[0480] A host cell can be any cell which is able to act as a carrier for an antigen according to the invention and thus may be a nucleated cell or a procaryotic cell into which nucleic acid can be artificially introduced. Procaryotic cells useful according to the invention include bacterial cells. Eucaryotic (nucleated) cells useful according to the invention include cells of a yeast, fungus, cells of a parasite and mammalian cells. Mammalian cells useful according to the invention include but are not limited to fibroblasts, including specialized mesenchymal cells such as a synoviocytes; keratinocytes, epithelial cells, endothelial cells, leukocytes and tumor cells.

[0481] Cell lines useful according to the invention include but are not limited to B16, CMS-5 fibrosarcoma cells, Cosi cells and CHO cells, TS/A, Lewis lung carcinoma, RENCA, Dunning rat prostate carcinoma, and cell lines included in the catalogue of the American Type Culture Collection (Manassas, Va.).

[0482] Host cells comprising a nucleic acid molecule encoding a multifunctional molecule of the invention can be prepared from pathogenic cells according to the invention. Pathogenic cells include tumor cells (e.g. B16 cells, CMS-5 fibrosarcoma cells, and cells derived from the tumors included in the section entitled “Tumors for which the Invention is Useful”), and cells derived from pathogenic bacterium, pathogenic fungus, pathogenic virus, pathogenic parasite, or a pathogenic arthropod.

[0483] Methods of Detecting Expression from an Artificially Introduced Recombinant Nucleic Acid Sequence

[0484] The invention provides for methods of detecting a protein (e.g., a multifunctional molecule) that is expressed from a recombinant nucleic acid molecule that has been artificially introduced into a cell.

[0485] Preparation of Antibodies

[0486] Antibodies specific for a protein useful according to the invention (e.g., a multifunctional molecule) are useful for protein purification, and for the detection of expression of these proteins from cells into which a recombinant nucleic acid molecule expressing these proteins has been artificially introduced. By antibody, we include constructions using the binding (variable) region of such an antibody, and other antibody modifications. Thus, an antibody useful in the invention may comprise a whole antibody, an antibody fragment, a polyfunctional antibody aggregate, or in general a substance comprising one or more specific binding sites from an antibody. The antibody fragment may be a fragment such as an Fv, Fab or F(ab′)2 fragment or a derivative thereof, such as a single chain Fv fragment. The antibody or antibody fragment may be non-recombinant, recombinant or humanized. The antibody may be of an immunoglobulin isotype, e.g., IgG, IgM, and so forth. In addition, an aggregate, polymer, derivative and conjugate of an immunoglobulin or a fragment thereof can be used where appropriate.

[0487] Although a protein product (or fragment or oligopeptide thereof) of a protein according to the invention (e.g., a multifunctional molecule according to the invention) that is useful for the production of antibodies does not require biological activity, it must be antigenic. Antibodies may be directed to any portion of the multifunctional molecule of the invention. For example, an antibody may be directed to the lecting portion of the multifunctional molecule or to the ligand portion of the multifunctional molecule. Peptides used to induce specific antibodies may have an amino acid sequence consisting of at least five amino acids and preferably at least 10 amino acids. Preferably, they should be identical to a region of the natural protein and may contain the entire amino acid sequence of a small, naturally occurring molecule. Short stretches of amino acids corresponding to the protein product of a recombinant nucleic acid encoding a protein useful according to the invention (e.g., a multifunctional molecule according to the invention) may be fused with amino acids from another protein such as keyhole limpet hemocyanin or GST, and antibody will be produced against the chimeric molecule. Procedures well known in the art can be used for the production of antibodies to the protein products of recombinant nucleic acids of the invention.

[0488] For the production of antibodies, various hosts including goats, rabbits, rats, mice etc . . . may be immunized by injection with the protein products (or any portion, fragment, or oligonucleotide thereof which retains immunogenic properties) of the recombinant nucleic acid molecules encoding proteins useful according to the invention. Depending on the host species, various adjuvants may be used to increase the immunological response. Such adjuvants include but are not limited to Freund's, mineral gels such as aluminum hydroxide, and surface active substances such as lysolecithin, pluronic polyols, polyanions, peptides, oil emulsions, keyhole limpet hemocyanin, and dinitrophenol. BCG (bacilli Calmette-Guerin) and Corynebacterium parvum are potentially useful human adjuvants.

[0489] I. Polyclonal Antibodies.

[0490] The antigen protein may be conjugated to a conventional carrier in order to increase its immunogenicity, and an antiserum to the peptide-carrier conjugate will be raised. Coupling of a peptide to a carrier protein and immunizations may be performed as described (Dymecki et al., 1992, J. Biol. Chem., 267: 4815). The serum can be titered against protein antigen by ELISA (below) or alternatively by dot or spot blotting (Boersma and Van Leeuwen, 1994, J. Neurosci. Methods, 51: 317). At the same time, the antiserum may be used in tissue sections prepared as described. A useful serum will react strongly with the appropriate peptides by ELISA, for example, following the procedures of Green et al., 1982, Cell, 28: 477.

[0491] 2. Monoclonal Antibodies.

[0492] Techniques for preparing monoclonal antibodies are well known, and monoclonal antibodies may be prepared using a candidate antigen (e.g., a mulispecific molecule or a lectin whose level is to be measured or which is to be either inactivated or affinity-purified, preferably bound to a carrier, as described by Amnheiter et al., 1981, Nature, 294;278.

[0493] Monoclonal antibodies are typically obtained from hybridoma tissue cultures or from ascites fluid obtained from animals into which the hybridoma tissue was introduced.

[0494] Monoclonal antibody-producing hybridomas (or polyclonal sera) can be screened for antibody binding to the target protein.

[0495] 3. Antibody Detection Methods

[0496] Particularly preferred immunological tests rely on the use of either monoclonal or polyclonal antibodies and include enzyme-linked immunoassays (ELISA), immunoblotting and immunoprecipitation (see Voller, 1978, Diagnostic Horizons, 2:1, Microbiological Associates Quarterly Publication, Walkersville, Md.; Voller et al., 1978, J. Clin. Pathol., 31: 507; U.S. Reissue Pat. No. 31,006; UK Patent 2,019,408; Butler, 1981, Methods Enzymol., 73: 482; Maggio, E. (ed.), 1980, Enzyme Immunoassay, CRC Press, Boca Raton, Fla.) or radioimmunoassays (RIA) (Weintraub, B., Principles of radioimmunoassays, Seventh Training Course on Radioligand Assay Techniques, The Endocrine Society, March 1986, pp. 1-5, 46-49 and 68-78). For analysing tissues for the presence or absence of a protein produced by a recombinant nucleic acid encoding a protein useful according to the invention (e.g., multifunctional molecule or portion thereof), immunohistochemistry techniques may be used. It will be apparent to one skilled in the art that the antibody molecule may have to be labelled to facilitate easy detection of a target protein. Techniques for labelling antibody molecules are well known to those skilled in the art (see Harlow and Lane, 1989, Antibodies, Cold Spring Harbor Laboratory).

[0497] Determining Whether an Immune Response is Modulated According to the Invention

[0498] The multifunctional molecules described herein are useful according to the invention to modulate an immune response in a mammalian, preferably a human, to an antigen or antigens contained in the antigen bearing target which is bound to the lectin portion of the multifunctional molecule. In one embodiment, a composition comprising a multifunctional molecule bound to an antigen bearing target is administered to an animal, preferably a human. The second portion of the multifunctional molecule comprising a ligand for a cell-surface molecule of an APC targets the composition to antigen presenting cells in the animal to which the composition has been administered. The antigen bearing target is taken up (i.e., ingested or phagocytosed) by antigen presenting cells. Alternatively, the multifunctional molecule/antigen bearing target complex is contacted with antigen presenting cells in vitro under conditions which allow phagocytosis, wherein the APCs are subsequently returned to the host organinsm from which they were derived.

[0499] The present invention thus provides a method for modulating an immune response in an mammal comprising administering to the mammal a composition comprising at least a multifunctional molecule as described herein. In one embodiment, the composition further comprises an antigen bearing target. In a further embodiment, the composition still further comprises an APC.

[0500] An “immune response” refers to stimulation/activation of a selected response involving the immune system, or suppression, elimination, or attenuation of a selected response. In a preferred embodiment, an immune response refers to stimulation/activation of a selected response involving the immune system by about at least 5%, or preferably between 5 and 50% or more preferably between 50 and 100% or at least 100% or greater, or suppression, elimination, or attenuation of a selected response by about at least 5%, or preferably between 5 and 50% or more preferably between 50 and 100% or at least 100% or greater, as compared to control cells that are not CD 40-ligand enhanced cells. Thus, to modulate an immune response means that the desired response is more efficient, more rapid, greater in magnitude, and/or more easily induced than when an antigen bearing target is contacted with an APC in the absence of a multifunctional molecule. Different immune responses in the subject may be modulated differentially, e.g., the cellular immune response may be selectively enhanced while the humoral response may be selectively attenuated, and vice versa.

[0501] The following in vitro and in vivo assays are useful for determining whether an immune response is modulated according to the invention. The assays described in detail below measure stimulation or suppression of cellular or humoral immune responses to an antigen. The antigens referred to in the following assays are representative. It will be apparent to one of skill in the art that an immune response to a selected antigen useful according to the invention may be measured using one or more of the following assays by adapting the assay to that antigen.

[0502] I. Detection of Increased Phagocytosis

[0503] The following assay may be used in order to determine whether opsonin-enhanced cells stimulate phagocytosis by antigen presenting cells.

[0504] Phagocytosis is examined using monocytes that have been adhered at 37° for 30 min in RPMI without added FCS. Sheep erythrocytes are incubated with an opsonin, or its precursor, under conditions such that there are no more than 300 of such molecules, on average, are deposited on each erythrocyte. If a precursor is used, coated erythrocytes are then processed to convert all precursors to the actual candidate molecule (e.g., See Carlo et al., J. Immunol. 123:523-8(1979)). Fresh monocytes are isolated from the subject, and 5×104-1×105 of these cells suspended in 0.25-0.5 ml of RPMI medium with 1% BSA. This aliquot is placed in a tissue culture well and incubated for 30 min at 37° C. An excess of coated erythrocytes, suspended at 1.2×108 cells/ml, is overlain on the monocytes, the plate is centrifuged for 5 min at 50 g, and incubated for 30 min at 37° C. Non-ingested material is removed in two hypotonic lysis steps using ice-cold lysing buffer before fixing and staining the adherent cells, and examining the cells under light microscopy. Phagocytosis is quantified by determining the percentage of 100 monocytes ingesting one or more target cells, and the total number of ingested E/100 monocyptes (PI) is recorded. Stimulation of phagocytosis according to the invention is indicated by a phagocytic index of equal to or greater than 40.

[0505] Another assay for phagocytosis is as follows: Cells of the murine macrophage line are harvested and suspended in DMEM-10 at 4×105/ml. 2.0 ml of this suspension is aliquoted into individual 3.5 cm cell culture plates, and the dishes incubated at 37° C. in 5% CO2 overnight. Target cells, as well as control cells, are harvested on the same day as the macrophages, washed in PBS, and resuspended 2 min in PKH26 dye (a 2 &mgr;M solution in lml of the supplied diluent) at 5×106 cells/ml. The fluorescent PKH26 dye emits in the red spectrum when excited, whereas the FITC label that is used for the phagocytes emits in the green spectrum. PKH26 is stable in the endosomal/lysosomal compartment of phagocytes. The dyed target cells are washed 3 times with PBS and cultured overnight to allow leaching of PKH26 out into the medium. This minimizes leakage of dye during the assay. The following day the target cells are harvested, washed 3 times with PBS, and resuspended in serum-free DMEM at 5×105/ml. The phagocytic cells are rinsed vigorously with PBS on the culture plates in order to remove serum, and 2 ml of target cells is added to each plate After 0, 2, 4, or 8 h, the plates are rinsed 3 times with PBS to remove all non-adhered cells and the remaining cells are incubated with 2 mM EDTA to release them from the plate. The released cells are washed with 1% FBS/PBS, and suspending in 100 &mgr;l of the same buffer. 2 &mgr;g anti-phagocyte (e.g. anti-CR3) antibody is added and the cells placed on ice for 25 min. The cells are washed 3 times with 1% FBS/PBS, resuspended in 100 &mgr;l of this solution, and stained with a 1:25 dilution of FITC-conjugated secondary IgG for 25 min on ice. Cells are washed 3 times and resuspended in 500 &mgr;l % FBS/PBS, then analyzed on a Becton Dickinson FACScan with CellQuest software.

[0506] FL-1 (green) fluorescence is used to gate phagocytes. The FL-2 (red) fluorescence of these cells, which reflects internalization of PKH26-labeled target cells, is then measured. Phagocytosis induced by, e.g., an opsonin is indicated by the difference between mean FL-2 fluorescence of macrophages incubated with opsonin-coated versus non-opsonin-coated target cells. Use of an opsonin will increase mean FL-2 fluorescence by, e.g. at least 10%., or enough to obtain a p value less than or equal to 0.05 by student t-test.

[0507] II. Amplification of the Immune Response Usually Involves Proliferation of Particular Subpopulations of Lymphoid Cells that are Normally in the Resting State.

[0508] Proliferative assays have the following applications in clinical studies: (1) Assessment of overall immunologic competence of T cells or B cells as manifested in their ability to respond to polyclonal proliferation signals such as mitogens or anti-CD3 antibodies. Defects in the proliferation may be indicative of fundamental cellular immunologic defect. Low proliferation is often found as a nonspecific secondary effect of chronic disease. (2) Assessment of an individual's response to specific antigens, where low responses are indicative of general or specific immunologic defect. (3) Determination of MHC compatibility by the mixed lymphocyte reaction (MLR).

[0509] In addition, proliferative assays are useful for estimating lymphokine production, investigating signal transduction, and assessing growth factor requirements (e.g., lymphokines) for T or B cells. The procedure outlined here measures incorporation of [3H]thymidine into DNA, which usually correlates well with cell growth as measured by changes in cell number. However, when the activation stimulus is toxic, as with chemical activators such as ionomycin plus phorbol myristate acetate (PMA), the burst of new DNA synthesis following activation may not be accompanied with a net increase in viable cells, and, in fact, a decline in cell number may be observed. In this instance, [3H]thymidine incorporation in DNA is more indicative of initial cell stimulation than estimation of cell number. In addition, [3H]thymidine incorporation provides information on cell populations, not on individual cells. Alternate methods, such as flow cytometry may be used for studies requiring that type of information.

[0510] Assay For Antigen-Induced T Cell Proliferation

[0511] This protocol is designed to test the proliferation of T cells in response to a specific antigen—tetanus toxoid. It can be modified to test T cell proliferation in response to any protein or polysaccharide antigen. Materials: (T cell suspension, autologous antigen-presenting cell suspension (non-T cells), Tetanus toxoid solution (Connaught or State Laboratory Institute of Massachusetts)). (1) Count T cells and adjust to 1×106 cells/ml with complete RPMI-10 AB. (2) Treat antigen- presenting cells with mitomycin C (or irradiate with 2500 rad) as in step 2 of one-way MLR protocol. Adjust concentration of antigen-presenting cells to 2×105 cells/ml.

[0512] Antigen-presenting cells can consist of autologous non-T cells or autologous monocytes/macrophages. (3) Add 100 ul T cell suspension and 50 ul antigen-presenting cell population to wells; mix just before dispensing. (4) Add 50 ul tetanus toxoid solution to give final concentrations of 0, 1, 5, 10, and 20 ug/ml. Prepare three wells for each dilution. (5) Incubate 6 days in a humidified 37° C., 5% CO2 incubator. (6) Pulse with [3H]thymidine and harvest as described in support protocol.

[0513] Assay For Lymphokine-Dependent Cell Proliferation

[0514] This protocol assays the lymphokine-dependent proliferation of a lymphocyte population, in this case, the IL-4 dependent proliferation of B cells. Materials: (Tonsil B cell suspension, Anti-IgM cross-linked to Sepharose beads (Bio-Rad), 10,000 U/ml human rIL-4 (Genzyme) in complete RPMI-10). (1) Count tonsil B cells and adjust concentration to 1×106 cells/ml with complete RPMI-10. (2) Dispense 100 ul of tonsil B cells into each well. Prepare three wells for each experimental condition. (3) Dilute 10,000 U/ml rIL-4 solution 1:10, 1:100, and 1:1000. Add 20 ul of the stock or dilution to appropriate wells to yield 1000 U/ml, 100 U/ml, 10 U/ml, and 1 U/ml. Include a control well with no rIL-4. (4) Pipet anti-IgM beads into appropriate wells.

[0515] Determine the optimal concentration of beads with pilot experiments. It is best to include several concentrations of beads in each experiment to “bracket” the optimal dose. Prepare wells with tonsil B cells and IL-4 dilutions alone, anti-IgM beads alone, culture medium alone, and all the combinations of IL-4 and anti-IgM bead dilutions. (5) Increase the volume of each well to 200 ul with complete RPMI-10 as necessary. (6) Culture 5 days in a humidified 37° C., 5% CO2 incubator. (7) Pulse with [3H]thymidine and harvest as described in support protocol.

[0516] [3H]Thymidine Pulse And Harvest Of Cell Cultures

[0517] This protocol is used in conjunction with the preceding protocols to complete the [3H] thymidine incorporation assay. (1) Add 20 ul of 50 uCi/ml [3H]thymidine to each culture (1.0 uCi) at a fixed time before terminating the culture (usually 6 or 18 hr). (2) Harvest cell cultures using an automated multiwell harvester that aspirates cells, lyses cells, and transfers DNA onto filter paper, while allowing unincorporated [3H]thymidine to wash out. Fill and aspirate each row of the microtiter plate ten times to ensure complete cell transfer and complete removal of unincorporated thymidine. Wash each filter strip with 100% ethanol to facilitate drying. Transfer to scintillation vials. For semiautomated harvester, transfer filter dots for each well into scintillation counting vials. For manual transfer, dry filters under lamp and transfer to scintillation vial with forceps. Add scintillation fluid to each vial. (3) Count samples in scintillation counter until standard deviation is less than 2%. Calculate mean cpm for background cultures and for each experimental condition. There should be less than 20% variation in replicate cultures.

[0518] III. Induction and Measurement of in vitro Antibody Responses

[0519] The capacity of the human immune system to mount an antibody response following in vivo immunization with a protein or polysaccharide antigen is a revealing indication of the overall integrity of both the B and T cell arms of the immune system. As such, in vivo immunization followed by measurement of the antibody response is an appropriate test of immune function in the various acquired and congenital immunodeficiencies and in a host of other conditions affecting the immune system. The following procedures are for in vivo immunization and for the measurement of the subsequent immune response using an ELISA technique.

[0520] Immuno-Enzymetric Assay for Cytokines Using NIP- and HRPO-Labeled Antibodies

[0521] This protocol describes an immunonoenzymetric assay for cytokines using a heterogeneous, noncompetitive immunoassay reaction in which the cytokine is immobilized by a coating antibody bound to a microtiter plate. Unbound material is washed free, and detection is carried out using a different anti-cytokine antibody labeled with the hapten nitroiodophenyl (NSP). This is in turn detected by a horseradish peroxidase (HRPO) conjugate of an anti-NIP antibody, which is revealed with the chromogenic substrate ABTS. In this noncompetitive immunoassay, the immunoassay signal (A405) increases as a direct function of the amount of cytokine present in the sample. Antibodies are prepared as described in Current Protocols in Immunology, 1995, 6.20.2-6.20.10.

[0522] Coat assay plate. (1) Using a multichannel pipettor, transfer 100 ul of an appropriate dilution of coating antibody into all wells of the assay plate that are to be used. (2) Seal plates with microtiter plate sealer or Parafilm and incubate 2 hr. At 37° C. Prepare samples and standards in preparation plate. (3) Dilute each sample (or aliquot of conditioned medium) to be assayed with an equal volume of immunoassay diluent. (4) Pipet less than or equal to 1 ml of each diluted sample to be assayed into the upper chamber of a separate Spin-X microfiltration device. Microcentifuge 5 min. At 10,000 rpm and save the filtrates that collect in the lower chambers. (5) Add 65 ul of each diluted sample to the appropriate well of a preparation plate (i.e., a separate 96-well microtiter plate). (6) Thaw an aliquot of cytokine standard at room temperature and make sure that it is well mixed. Pipet 130 ul into the well of the preparation plate representing the highest concentration on the standard curve. Transfer 65 ul from this well into the next, then continue performing serial 1:1 dilutions in immunoassay diluent so that 65 ul of each concentration represented on the standard curve is placed in appropriate well of the preparation plate. (7) Thaw an aliquot of calibrator at room temperature (if used). Dilute with an equal volume of immunoassay diluent, then pipet 65 ul of diluted calibrator into appropriate well or wells of preparation plate.

[0523] Incubate with coating antibody. (8) Remove coated assay plate from incubator. Dip in 2-liter beaker filled with 1×wash buffer, then invert over sink and flick to remove liquid. Repeat two more times, then bang dry on paper towel. (9) Transfer 50 ul of solution from each well of preparation plate to corresponding well of the assay plate using multichannel pipettor. (10) Seal plate with microtiter plate sealer or Parafilm and incubate 2 hr. at room temperature.

[0524] Incubate with detecting antibody. (11) Dilute NIP-labeled detecting antibody specific to cytokine of interest to 1 ug/ml in detecting buffer. (12) Wash assay plate as in step 8. (13) Add 75 ul diluted detecting antibody from step 11 to all wells of assay plate, including unused outer walls. (14) Reseal plate with microtiter plate sealer or Parafilm and incubate 1 hr. at room temperature.

[0525] Incubate with HRPO-conjugated anti-NIP antibody. (15) Dilute HRPO-conjugated anti-NIP Mab 1:3000 in detecting buffer. (16) Wash assay plate as in step 8. (17) Add 75 ul of diluted HRPO-labeled anti-NIP antibody from step 15 to all wells of assay plate. (18) Reseal plate with microtiter plate sealer or Parafilm and incubate 1 hr. at room temperature.

[0526] Incubate with chromogenic substrate. (19) Wash assay plate as in step 8. (20) Add 100 ul ABTS substrate working solutions to all wells of assay plate. Cover plate and incubate at room temperature until color development reaches desired level (generally until A405 for wells containing the highest concentration of standard is between 1.5 and 2). This protocol usually produces an assay that can be read after 30 to 60 min.

[0527] Read plate and analyze data. (21) Using microtiter plate reader with computer interface, measure absorbance in all wells at 405 nm in single-wavelength mode or at 405 and 650 nm in dual-wavelength mode. (22) Fit standard data to a curve described by a first-degree (linear), second degree (quadratic), or four-parameter (nonlinear) mathematical function using curve-fitting software. (23) Interpolate absorbance data from unknown cytokine samples to fitted standard curve, and calculate cytokine concentrations.

[0528] IV. Induction of an in vivo Antibody Response Provides an Approach to the Evaluation of the Overall Integrity of the Immune System.

[0529] In the protocols presented here, diptheria and tetanus toxoids are used as representative protein antigens and pneumococcal polysaccharides are used as representative polysaccharide antigens because of their safety and availability. It should be noted, however, that the responses elicited by these antigens are likely to be secondary responses because of past vaccination or natural exposure. To obtain a primary response, an unusual antigen such as keyhole limpet hemocyanin should be used.

[0530] When antigens are administered by the intramuscular or subcutaneous route, as they are here, a “systemic” immune response is induced and measurement of circulating antibody is most appropriate. It is, however, sometimes of interest to evaluate “local” or mucosal immune responses. In this case, the antigen is given either intranasally to stimulate respiratory lymphoid tissue or orally to stimulate gastrointestinal lymphoid tissue and bronchial washings or intestinal fluids, rather than blood, is assayed for antibody content; in addition, antigens are used that are more appropriate for stimulation of the local/mucosal response (i.e., influenza virus antigen for respiratory responses and cholera toxin for gastrointestinal responses).

[0531] In assaying the in vivo antibody response, it is important to determine responses to both protein and polysaccharide antigens because these antigens stimulate different components of the immune system. In this regard, the major antibody response to protein antigen is composed of IgG1 and IgG3 subclass antibodies, whereas the major antibody response to polysaccharide antigen is composed of IgG2 subclass antibody.

[0532] A variety of immunoassay techniques have been used to measure antibody responses in materials obtained after in vivo immunization. Of these, the ELISA assay is perhaps the most useful because it yields a stable, easily measurable, reproducible, and safe readout.

[0533] Induction of in vivo Antibody Responses to Protein/Polysaccharide Antigens

[0534] In this protocol antigens are administered by the intramuscular or subcutaneous route and serum is collected for measurement of responses. (1) Draw preimmunized blood sample, allow blood to clot, and separate serum from clot by centrifugation. Store serum at −20° C. to −70° C. in appropriately labeled plastic tubes. (2) Inject 0.5 ml of toxoid mixture into an appropriately prepared intramuscular site (deltoid or thigh), taking care not to inject material intravenously. (3) Inject 0.5 ml polyvalent pneumococcal vaccine into an appropriately prepared subcutaneous site, taking care not to inject material intravenously. (4) Draw post-immunization blood samples at desired intervals, usually at 1, 2, and 3 weeks. Separate serum and store at −20° C. to −70° C. (5) After all serum samples are collected, assay samples for presence of antibodies using ELISA.

[0535] The ELISA offers a rapid, sensitive, reproducible, nonradioactive method for measuring in vivo antibody responses to a variety of antigens, including protein and polysaccharide antigens in sera obtained from individuals vaccinated with tetanus and diphtheria boosters and the polyvalent pneumococcal polysaccharide vaccine. Assays specific for tetanus, diphtheria and the pneumococcal polysaccharide types I, II, and III are detailed in Current Protocols in Immunology, 1995, Vols. 6 and 7.

[0536] Assay Using Tumor Rejection

[0537] In another assay for immunomodulation, an immunocompent animal is vaccinated with on the order of 104-108 irradiated cytokine-coated tumor cells, and challenged with on the order of 104-108 live wild-type tumor cells (in any temporal sequence). If survival or tumor onset in these animals differs from that of animal vaccinated, using identical parameters, with irradiated non-cytokine coated cells instead of opsonin-enhanced cells, immunomodulation has occurred. For example, if at least 10% of the animals in the test group survive 100% longer than mean survival in the control group, the test is positive. As another example, onset of tumors in 20% of the test animals might be 50% later than mean onset in the control animals.

[0538] Dosage and Administration

[0539] The invention encompasses methods of modulating an immune response in a mammal to a selected antigen, the method comprising administering to a mammal a therapeutic amount of a composition comprising a multifunctional molecule as described herein, or a composition comprising a multifunctional molecule of the invention and an antigen bearing target, or administering a composition comprising a therapeutic amount of APCs which have been contacted with a multifunctional molecule and antigen bearing target in vitro.

[0540] Compositions described herein may be prepared as injectables, either as liquid solutions or suspensions; solid forms suitable for solution in or suspension in, liquid prior to infection can also be prepared. The preparation can also be emulsified, or encapsulated in liposomes. The active immunogenic ingredients are often mixed with carriers which are pharmaceutically acceptable and compatible with the active ingredient. The term “pharmaceutically acceptable carrier” refers to a carrier that does not cause an allergic reaction or other untoward effect in subjects to whom it is administered. As used herein, a “pharmaceutically acceptable carrier” does not include culture medium, or any solution containing about 0.2-2% serum or greater. Suitable pharmaceutically acceptable carriers include, for example, one or more of water, saline, phosphate buffered saline, dextrose, glycerol, ethanol, or the like and combinations thereof. In addition, if desired, the vaccine can contain minor amounts of auxiliary substances such as wetting or emulsifying agents, pH buffering agents, and/or adjuvants which enhance the effectiveness of the vaccine. Examples of adjuvants which may be effective include but are not limited to: aluminum hydroxide, N-acetyl-muramyl-L-threonyl-D-isoglutamine (thr-MDP), N-acetyl-nor-muramyl-L-alanyl-D-isoglutamine (CGP 11637, referred to as nor-MDP), N-acetylmuramyl-L-alanyl-D-isoglutaminyl-alanine-2-1′-2′-dipalmitoyl-sn-glycero-3-hydroxyphosphoryloxy)-ethylamine (COP) 19835A, referred to as MTP-PE), and RIBI, which contains three components extracted from bacteria, monophosporyl lipid A, trehalose dimycolate and cell wall skeleton (MPL+TDM+CWS) in a 2% squalene/Tween 80 emulsion. Other examples of adjuvants include DDA (dimethyldioctadecylammonium bromide), Freund's complete and incomplete adjuvants and QuilA. In addition, immune modulating substances such as lymphokines (e.g., IFN-, IL-2 and IL-12) or synthetic IFN-inducers such as poly I:C can be used in combination with adjuvants described herein.

[0541] Compositions of the invention can be administered parenterally, by injection, for example, either subcutaneously or intramuscularly. Additional formulations which are suitable for other modes of administration include suppositories, and in some cases, oral formulations or formulations suitable for distribution as aerosols. In the case of the oral formulations, the manipulation of T-cell subsets employing adjuvants, antigen packaging, or the addition of individual cytokines to various formulations can result in improved oral vaccines with optimized immune responses. For suppositories, traditional binders and carriers may include, for example, polyalkylene glycols or triglycerides; such suppositories may be formed from mixtures containing the active ingredient in the range of 0.5% to 10%, preferably 1%-2%. Oral formulations include such normally employed excipients as, for example, pharmaceutical grades of mannitol, lactose, starch magnesium stearate, sodium saccharine, cellulose, magnesium carbonate, and the like. These compositions take the form of solutions, suspensions, tablets, pills, capsules, sustained release formulations or powders and contain 10%-95% of active ingredient, preferably 25-70%.

[0542] The compositions of the invention can be formulated into the vaccine compositions as neutral or salt forms. Pharmaceutically acceptable salts include the acid addition salts (formed with free amino groups of the peptide) and which are formed with inorganic acids such as, for example, hydrochloric or phosphoric acids, or with organic acids such as acetic, oxalic, tartaric, maleic, and the like. Salts formed with the free carboxyl groups can also be derived from inorganic bases such as, for example, sodium, potassium, ammonium, calcium, or ferric hydroides, and such organic bases as isopropylamine, trimethylamine, 2-ethylamino ethanol, histidine, procaine, and the like.

[0543] Any cellular component of such vaccine compositions can, in preparation for inclusion in such compositions, be subjected to treatments which involve attenuation or inactivation of the cells of the vaccine, including, for example, exposure to ionizing radiation, which can inhibit cell division, antiproliferative agents such as cyclophosphamide, cytochalasin D, or colchicine, or killing with or without fixation.

[0544] The compositions, including antigen bearing targets and APCs are administered in a manner compatible with the dosage formulation, and in such amount as will be prophylactically and/or therapeutically effective. The quantity to be administered depends on the subject to be treated, including, e.g., capacity of the subject's immune system to synthesize antibodies, and the degree of protection desired. Suitable dose ranges are on the order of several hundred micrograms active ingredient per vaccination with a preferred range from about 0.1 &mgr;g to 1000 &mgr;g, such as in the range from about 1 &mgr;g to 300 &mgr;g, and preferably in the range from about 10 &mgr;g to 50 &mgr;g. Suitable regiments for initial administration and booster shots are also variable but are typified by an initial administration followed by subsequent inoculations or other administrations. Precise amounts of active ingredient required to be administered depend on the judgment of the practitioner and may be peculiar to each subject. It will be apparent to those of skill in the art that the therapeutically effective amount of cells of this invention will depend, inter alia, upon the administration schedule, the unit dose of antigen administered, whether the cells are administered in combination with other therapeutic agents, the immune status and health of the recipient, and the therapeutic activity of the particular composition.

[0545] The compositions can be given in a single dose schedule, or preferably in a multiple dose schedule. A multiple dose schedule is one in which a primary course of vaccination can include 1-10 separate doses, followed by other doses given at subsequent time intervals required to maintain and or reinforce the immune response, for example, at 1-4 months for a second dose, and if needed, a subsequent dose(s) after several months. Periodic boosters at intervals of 1-5 years, usually 3 years, are preferable to maintain the desired levels of protective immunity. The course of the immunization can be followed by in vitro proliferation assays of peripheral blood lymphocytes (PBLs) co-cultured with ESAT6 or ST-CF, and by measuring the levels of IFN-released from the primed lymphocytes. The assays can be performed using conventional labels, such as radionucleotides, enzymes, fluorescent labels and the like. These techniques are known to one skilled in the art and can be found in U.S. Pat. Nos. 3,791,932, 4,174,384 and 3,949,064, which are hereby incorporated by reference.

[0546] Tumors for Which the Invention is Applicable

[0547] The invention contemplates treatment of tumors including but not limited to the following:

[0548] Melanomas, squamous cell tumors, basal cell carcinomas, astrocytomas, gliomas, glioblastoma multiforme, meningiomas, ependymomas, schwannomas, neuroblastomas, retinoblastomas, meningiomas, glomus tumors, sarcomas, including, e.g., osteosarcomas, Ewing's sarcomas, chondrosarcomas, myosarcomas, synovial cell sarcomas, fibrosarcomas, spindle cell tumors, angiosarcomas, primitive neuroectodermal cell tumors, and Kaposi's sarcomas, lymphomas, acute and chronic leukemias, tumors of the head and neck, nasopharyngeal carcinomas, carcinomas of the pharynx, laryngeal carcinomas, carcinomas of the thyroid, carcinomas of the parathyroids, thymomas, esophageal carcinomas, gastric carcinomas, tumors of the small bowel, carcinomas of the colon and rectum, mesotheliomas, lung carcinomas, including adenocarcinomas, squamous cell carcinomas, bronchoalveolar carcinomas, and small cell tumors, pancreatic carcinomas, islet cell and non-islet cell tumors, carcinomas of the breast, cardiac myxomas, pituitary tumors, carcinoid tumors, hepatomas, cholangiocarcinomas, hepatoblastomas, renal cell carcinomas, nephroblastomas, Wilms' tumors, adrenal carcinomas, pheochromocytomas, germ cell tumors, choriocarcinomas, ovarian carcinomas, testicular tumors, seminomas, endometrial tumors, carcinomas of the prostate, carcinomas of the seminal vesicles, vaginal tumors, carcinomas of the penis, hydatiform moles, carcinomas of the gall bladder, and carcinomas of the urinary bladder.

[0549] Subjects for Treatment According to the Invention

[0550] The present invention provides a method for reducing the size and/or number of metastases in a subject. The method comprises administering to the subject a vaccine composition comprising a multifunctional molecule of the invention. A “subject” as used herein, may refer to an organism of the Kingdom animalia, preferably a mammal, and still more preferably a human. A “subject”, according to the invention may also be an animal in need of anti-metastases therapy, e.g., a patient with malignant metastases to one or more organs or tissues, e.g., a human patient with lung or lymph node metastases. A “subject”, according to the invention may also be an animal model of metastases, in which the animal is manipulated, either genetically, or by injection of malignant cells, or by other methods known to those of skill in the art, to simulate the appearance of foci of malignant cells or infected cells which are observed in a similar animal with naturally occurring metastases. The generation of animal models of metastasis is well known in the art, and examples of such models may be found in, for example, Ryan MH et al., J Immunol. 2001;167:4286-92; Specht J M et al., J Exp Med. 1997;186:1213-21; Nakanishi et al., Tumour Biol. 2003 24:70-6; Wang et al., Int J Gastrointest Cancer, 2001;29(1):37-46; Muralidharan et al., J Clin Laser Med Surg. 2003 21(2):75-83; Tanaka et al., Chest 2003, 123(4):1248-53; Huang et al., Clin Exp Metastasis 2002;19(4):359; and Irvine K R et al., J Immunol. 1996;156:238-45. One of skill in the art would be able to readily adapt the animal models of metastasis known in the art to generate a metastasis model of interest for any given application.

[0551] Detection of Metastases

[0552] The present invention provides a method of reducing the number and/or size of metastases in a subject comprising administering to a subject, a multifunctional molecule as described herein. One of skill in the art will recognize that the detection and measurement of metastases is routine in the art and may be accomplished using well established methods. For example, metastases may be detected using gross examination of a subject, such as exploratory surgery (e.g., laparotomy). Alternatively, metastases may be detected, measure, and/or observed using less invasive techniques and methods such as thorascopy, mediastinoscopy, and laparoscopy. One of skill in the art may also detect the presence of metastases using imaging techniques known to those of skill in the art. Such techniques include, but are not limited to radiographic imaging, computerized tomography (CT scan), magnetic resonance imaging (MRI), positron emission tomography (PET scan), single photon excitation (SPECT), and radionuclide scintigraphy (e.g., bone scan). The sensitivity of many of the above imaging methods may be enhanced, as known by those of skill in the art by injection or IV administration of contrast agents (e.g., iodine or barium) to a subject to be imaged. Additional methods for assessing the presence of, or detecting, or measuring metastasis is through the use of gross or histological pathologic examination (i.e., in which a tissue sample is removed from a subject an examined at eaither or both of the gross anatomical level, or at the histological or ultrastructural level according to methods which are well known in the art). The above methods for the detection, measurement, and imaging of metastases are known to those of skill in the art and may be adapted according to the knowledge in the art to particular tissues, organs, or cells which one of skill in the art wishes to asses according to the methods of the invention. More detailed descriptions of such methods may be found in the art, for example, the Oxford Textbook of Oncology, 2nd Ed., New York, Oxford University Press, 2002.

[0553] According to the invention, metastasis is detected if any amount of metastasis is detected in a subject. That is, upon the detection of even a single foci in a subject, metastasis may be said to have been detected. Preferably, metastasis is detected as plural metastatic foci, in one or preferably one or more organs in a subject.

[0554] Transgenic Animals According to the Invention

[0555] A nucleic acid molecule encoding a multifunctional molecule as described herein can be used to produce nonhuman transgenic animals, and cells of such transgenic animals can be isolated and used in a vaccine formulation in animal or human vaccination.

[0556] For example, in one embodiment, a nucleic acid molecule is introduced into a fertilized oocyte or an embryonic stem cell. Such cells can then be used to create non-human transgenic animals in which exogenous nucleic acid molecules encoding the polypeptides of the invention have been introduced into their genome or homologous recombinant animals in which endogenous nucleic acid molecules have been altered. Such animals are useful for studying the function and/or activity of the molecules of the invention and for identifying and/or evaluating modulators of the activity of the molecules of the invention. As used herein, a “transgenic animal” is a non-human animal, prefers mammal, more preferably a mouse, in which one or more of the cells of the animal includes a transgene. A transgene is exogenous nucleic acid which is integrated into the genome of a cell from which a transgenic animal develops and which remains in the genome of the mature animal, thereby directing the expression of an encoded gene product in one or more cell types or tissues of the transgenic animal.

[0557] A transgenic animal of the invention can be created by introducing nucleic acid molecules encoding the polypeptides described herein (i.e., a multifunctional molecule) into the male pronuclei of a fertilized oocyte, e.g., by microinjection, and allowing the oocyte to develop in a pseudopregnant female foster animal. Intronic sequences and polyadenylation signals can also be included in the transgene to increase the efficiency of expression of the transgene. A tissue-specific regulatory sequence(s) can be operably linked to the transgene to direct expression of a polypeptide of the invention to particular cells. Methods for generating transgenic animals via embryo manipulation and microinjection, particularly animals such as mice, have become conventional in the art and are described, for example, in U.S. Pat. Nos. 4,736,866 and 4,870,009, both by Leder et al., U.S. Pat. No. 4,873,191 by Wagner et al. and in Hogan, B., Manipulating the Mouse Embryo, (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1986). Similar methods are used for production of other transgenic animals. A transgenic founder animal can be identified based upon the presence of the nucleic acid molecule of the invention, e.g., the transgene in its genome and/or expression of the transgene mRNA in tissues or cells of the animals. A transgenic founder animal can then be used to breed additional animals carrying the transgene. Moreover, transgenic animals carrying a transgene encoding polypeptides of the invention can further be bred to other transgenic animals carrying other transgenes.

[0558] The invention is further illustrated by the following exemplifications which should not be construed as being further limiting.

EXAMPLES

Example 1

[0559] Cloning of a Murine GM-CSF Fused to the S. cerevesiae Gas1 GPI Modification Signal Sequence

[0560] The starting point for producing a yeast expression vector was the pUC19-GM-CSF-mammalian GPI signal sequence plasmid (pUC19-GM-CSF-GPI). This plasmid encodes murine GM-CSF (upstream) fused in-frame to the human Thy-1 GPI modification signal sequence (downstream). The following two oligonucleotides were purchased from Midland Certified Reagent Company (Midland, Tex.): 8 GTX-5 5′pAATTCCGCGCCGGCACAGTGCTCAGAGACAAACTGGTCAAGTGTGAG GGCATCAGCCTGCTGGCTCAGAACACCTCGTGGCTGCTGCTGCTCCTGCT GTCCCTCTCCCTCCTCCAGGCCACGGATTTCATGTCCCTGTGACTGGGTA C3′

[0561] GTX-5 comprises:

[0562] a. Sequences at the 5′ end suitable for ligating to an EcoRI site (bases 1-5)

[0563] b. An NgoM1 site for creating an in-frame chimeric coding sequence (bases 9-14)

[0564] c. The coding sequence for the GPI modification sequence of human Thy-1 (Genbank Accession No. M11749) (bases 15-137)

[0565] d. A termination codon (bases 138-140)

[0566] e. Sequences at the 3′ end for ligating to a KpnI site (bases 144-148) 9 GTX-6 5′pCCAGTCACAGGGACATGAAATCCGTGGCCTGGAGGAGGGAGAGGGAC AGCAGGAGCAGCAGCAGCCACGAGGTGTTCTGAGCCAGCAGGCTGATGCC CTCACACTTGACCAGTTTGTCTCTGAGCACTGTGCCGGCGCGG3′

[0567] This oligonucleotide is complementary to GTX-5, except for staggered ends.

[0568] GTX-5 and GTX-6 were dissolved in individual tubes in sterile water at a final concentration of 1 microgram/lambda. GTX-5 and GTX-6 were mixed at a final concentration of 100 ng/lambda and allowed to anneal for 60 minutes at room temperature.

[0569] The GTX-5: GTX-6 double stranded oligonucleotide was then cloned into the plasmid pUC19. Four micrograms of pUC19 DNA was digested with EcoRI and KpnI. After electrophoresis, the linear DNA was purified from a 0.7% agarose gel using a Qiagen (Santa Clarita, Calif.) gel purification kit according to instructions provided by the manufacturer. 100 ng of the GTX-5: GTX-6 oligonucleotide was ligated to 200 ng of the EcoRI-KpnI digested pUC19 in a final volume of 20 microliters at room temperature for 60 minutes.

[0570] The plasmid was transformed into competent AG-1 cells, which were purchased from Stratagene. Transformed E. coli were inoculated onto LB-amp plates. Bacterial colonies grown on LB plates containing ampicillin (100 micrograms/ml) were picked and inoculated into one ml of LB with amp and grown overnight at 37° with shaking.

[0571] Plasmid DNA was isolated using a standard alkaline lysis miniprep protocol and DNA was digested with EcoRI and KpnI. DNA was electrophoresed on 1.6% agarose gels stained with ethidium bromide, and colonies containing an EcoRI-KpnI fragment of approximately 148 bp were thus identified. Positive colonies were inoculated into 100 ml of LB with ampicillin and grown overnight. Plasmid DNA was again purified using kits purchased from Qiagen.

[0572] The nucleotide sequence of a Thy-GPI positive clone, designated pUC-GPI21, was sequenced, confirming its identity.

[0573] The GM-CSF coding sequence was amplified by PCR from a mouse lung cDNA library purchased from Clontech. PCR was performed for 35 cycles using pfu polymerase and the following primers: 10 Upstream 5′CCGAATTCATGTGGCTGCAGAATTTACTTTTCCTGGGCATTGTGGTCT AC3′ Downstream 5′CAGCCGGCTTTTTGGACTGGTTTTTTGCATTCAAAGGGGATATCAGTC AG3′

[0574] PCR parameters were denaturation at 90° for 1 minute, annealing at 60° for 1 minute, and extension at 72° for 1 minute.

[0575] The GM-CSF chain PCR product was purified after electrophoresis through a 1% agarose gel. The DNA band was excised and the DNA fragment purified using a kit purchased from Qiagen.

[0576] The purified GM-CSF DNA fragment was digested with EcoRI and NgoM1. After digestion, the reaction mix was extracted with phenol:chloroform (1:1) followed by chloroform. The aqueous phase was adjusted to 0.3M sodium acetate pH 5.2 and the DNA was precipitated with 2 volumes of ethanol at −80° for 2 hours. The DNA was pelleted by centriftigation, ethanol was removed, and the pellet was rinsed with 70% ethanol. The pellet was dried under vacuum.

[0577] The GM-CSF DNA was resuspended in sterile water and ligated to pUC19-GPI21 that had been digested with EcoRI-NgoM1. Ligation was for one hour at room temperature. PUC19 GPI 21 ligated to GM-CSF DNA was used to transform competent AG-1 cells. Transformed AG-1 cells were selected on LB plates with ampicillin. Plasmid DNA was isolated and analyzed as above. Restriction digests were performed to confirm the pUC19 GPI-GM-CSF chimeric construct. The DNA from several positive clones was isolated and sequenced.

[0578] This plasmid was digested with NgoMIV and KpnI, and the larger resulting fragment isolated after electrophoresis through a 1% agarose gel.

[0579] The 280 bp GPI modification signal sequence from the yeast protein Gas1 was amplified by PCR from the yeast cosmid clone C9952 (ATCC). This PCR employed pfu polymerase and the primers: 11 Upstream Primer 5′GTAGCCGGCGCTAGCTCGGGGTCTTCTTCCAAGTCTA Downstream Primer 5′TACGGTACCCCTAGGCCACAATGAAATAAGATACCATACC3′

[0580] These primers add a 5′ NgoMIV site and a 3′ KpnI site to the Gas1 fragment. 12 Conditions for PCR were: Denaturation 90° one minute Annealing 60° one minute Extension 72° one minute Cycles 25

[0581] The PCR product was purified after electrophoresis through a 1% agarose gel and digested with NgoM IV and KpnI. The Gas1 GPI signal sequence was then ligated into the pUC19-GM-CSF-GPI plasmid prepared above so that the Gasl signal sequence was fused in-frame downstream of the GM-CSF sequence, replacing the Thy-1 sequence. This vector is termed pUC19-GMCSF-Gas1.1. The resultant plasmid was then transformed into AG-1 competent E. coli (Stratagene) and plasmid clones were isolated by alkaline lysis mini-prep. Plamids were then screened for inserts by restriction digest. DNA from a positive clone was sequenced to confirm the identity of the GAS1 coding region.

[0582] A yeast expression plasmid for GPI-GM-CSF was then generated utilizing the pITY-4 vector, which was kindly provided by Dr. K. Dane Wittrup (University of Illinois). This plasmid stably integrates into the yeast genome and allows high-level expression of heterologous genes. Features of pITY-4 include: a delta sequence (LTR of Ty element) that enables multiple integration events by homologous recombination; a neo/kanamycin resistance gene that provides for selection in E.coli and tunable selection in yeast; the Gal1 promoter for high-level inducible transcription; a unique EagI cloning site; a synthetic Pre-Pro sequence optimized for efficient secretion of expressed genes; the alpha factor termination sequence; and an origin of replication for propagation in E.coli. In this system, yeast are grown in dextrose-containing media for 3 days, then are switched to media containing galactose to induce transcription of genes inserted downstream of the Gal1 promoter.

[0583] The GMCSF-Gas1 insert described above was amplified by PCR from pUC19-GMCSF-Gas1.1 using pfu polymerase and the primers: 13 Upsteam 5′TACGGCCGGCACCCACCCGCTCACCC3′ Downstream 5′TACGGCCGCCACAATGAAAATAAGATACCAT3′

[0584] These primers add EagI sites at both ends for cloning into the pITY-4 plasmid. 14 Conditions for PCR were: Denaturation 90° one minute Annealing 60° one minute Extension 72° one minute Cycles 25

[0585] The PCR product was purified after electrophoresis through a 1% agarose gel and digested with EagI. The EagI-flanked GMCSF-Gas1 fragment was ligated into EagI-digested pITY-4 and used to transform E.coli AGI cells. E. coli were then grown on kanamycin-containing LB plates (100 ug/ml). Plasmids from kanamycin resistant colonies were purified by mini-prep and mapped by restriction digests for presence and correct orientation of inserts. The identity of a positive clone was confirmed by sequencing. This plasmid is termed pITY-GMCSF-Gas1.1.

Example 2

[0586] Expression of Murine GM-CSF Fused to the Gas1 GPI Modification Signal Sequence in Yeast

[0587] A 50 ml culture of the E.coli clone containing pITY-GMCSF-Gas1.1 was grown in LB with 100 ug/ml kanamycin and the plasmid purified using a Midi-Prep Kit from Qiagen. The S. cerevesiae strain BJ5464 (ATCC) was then transformed with pITY-GMCSF-Gas1.1 using a lithium acetate (LiAc) protocol. A 10 ml overnight culture of BJ5464 in YPD (Per liter: 20 g Bactotryptone, 10 g yeast extract, 20 g dextrose) was used to inoculate a 100 ml flask. Yeast were grown for 3 hours at 30° and then harvested by centrifugation at 12,000×g for 2 minutes at room temperature. Cells were washed with sterile water and centrifuged again. The cells were resuspended in 1.0 ml of 100 mM LiAc, transferred to a 1.5 ml microfuge tube and centrifuged in an Eppendorf microfuge at top speed for 15 seconds. The cells were then resuspended in 0.5 ml of 100 mM LiAc and 50 uL samples were aliquoted to individual tubes. The cells were pelleted. 240 uL of PEG (50% w/v), 36 uL 1.0M LiAc, 5 uL (10 mg/ml) boiled carrier DNA (salmon sperm DNA, Sigma), and 2 ug plasmid in 75 uL water, were then added in that order. After the addition of plasmid, the tube was vortexed, incubated at 300 for 30 minutes and heat-shocked at 42° for 15 minutes. The cells were then pelleted, resuspended in sterile water and plated on YPD plates containing 1 mg/ml G418.

[0588] Individual colonies of G418-resistant yeast were picked and grown in one ml of YPD with 1 mg/ml G418 for 3 days. The cells were then pelleted by centrifugation in a microfuge and the YPD (dextrose-containing, galactose-free) media was replaced with YPG (20 g bactotryptone, 10 g yeast extract, 20 g galactose per liter) with 1 mg/ml G418. Yeast were grown in YPG for 3 days to allow full induction of transcription from the Gall promoter. After induction, cells were pelleted, washed with TN (0.15M NaCl, 25 mM Tris pH 7.4) and lysed in TN containing 20 mM octyl glucopyranoside (OGP), 1 mM PMSF, and 1 ug/ml each aprotinin, leupeptin and pepstatin. Yeast were lysed by vortexing with acid-washed glass beads (425-600 microns, Sigma). Insoluble material was pelleted and the supernatant assayed using a murine GM-CSF ELISA (Endogen). A colony expressing high levels of GPI-GM-CSF was identified. Based on standard curve of soluble GMCSF, we estimate expression to be approximately 25 ug/L, a significant improvement over mammalian expression and sufficient for in vivo experiments. This yeast clone is designated SC-GM-GPI.

[0589] One of the advantages of stably integrating vectors for expression in yeast is that, after the initial cloning and colony isolation, antibiotic maintenance is no longer required. To confirm this, cells were grown with and without G418 and tested for GPI-GM-CSF expression. We have seen no decrease in expression levels in the absence of G418 over 8 months.

[0590] To produce GPI-GM-CSF on a scale suitable for in vitro and in vivo functional characterization, 500 ml of YPD was inoculated with SC-GM-GPI and grown for three days at 30° with shaking. Cells were pelleted by centrifugation at 12,000×g for 2 minutes at room temperature and transferred to an equal volume of YPG for an additional three days of growth. Cells were then pelleted, washed with TN and lysed in 25 ml of TN containing 20 mM OGP, 1 mM PMSF, and lug/ml each aprotinin, leupeptin and pepstatin. Cells were then lysed by vortexing with acid washed glass beads, 20 g/ 500 ml culture, (425-600 microns, Sigma). Insoluble material was pelleted at 8,000×g for 10 minutes at room temperature and the soluble material was applied to an immunoaffinity column of anti-murine GMCSF monoclonal antibody (Endogen) linked to cyanogen bromide-activated Sepharose 4B (Sigma). Coupling of the monoclonal to the Sepharose was performed according to the manufacturer's instructions. Efficiency of coupling was monitored using OD280 and binding of murine GM-CSF to immobolized antibody was confirmed using commercially available, recombinant cytokine.

[0591] Soluble yeast-derived material was applied to the column and allowed to flow by gravity.

[0592] The column was washed sequentially with: (a) 20 volumes of TN with 1% Triton X-100; (b) 5 volumes of 50 mM Tris pH 8.0, 1 mM OGP; (c) 20 volumes TN with 1 mM OGP. Bound material was then eluted with 10 volumes of 0.15M NaCl, 25 mM Tris pH 2.5 with 1 mM OGP. Eluted material was neutralized with 1/200 volume of 1.5M Tris pH8.8. The purified material was concentrated using a Microsep 3K centrifugal device (Pall Gelman Laboratory). Yields of GPI-GM-CSF were determined by ELISA (Endogen) to be 25 ug/L of culture. Final concentration was adjusted to 40 ug/ml by addition of 0.15 M NaCl, 25 mM Tris pH 7.4 with 1 mM OGP.

[0593] Purified GPI-GM-CSF was analyzed by stained gel and western blot. Approximately 1 ug of purified GPI-GM-CSF or recombinant soluble murine GM-CSF. per lane were electrophoresed. Gels were then stained with silver nitrate using the Sigma silver staining kit according to the manufacturer's directions (Sigma). For western blots, gels were transferred to Protran BA83 (Schleicher and Schuell) using an Owl Scientific electric transblotter and blocked with TBS (Tris Buffered Saline) containing 0.05% Tween 20 and 2% nonfat dry milk overnight at room temperature. The blot was then incubated with primary antibody (rat monoclonal anti-murine GMCSF, Endogen) at 1:5000 dilution in blocking buffer for 2 hours at room temperature. The blot was washed with TBS-0.05% Tween 20, and incubated with a secondary antibody, alkaline phosphatase conjugated goat anti-rat IgG (Sigma) at 1: 10,000 for 1 hour at room temperature. After washing, color was developed with NBT-BCIP (Sigma). A single dominant band migrating at approximately the same rate as a recombinant soluble GM-CSF standard was clearly present on both the gel and the blot (the molecular weight of the GPI moiety is only approximately 1500 compared to approximately 14,000 for the protein moiety]. Given the immunoreactivity with anti-GM-CSF and the ability of this material to bind to tumor cell membranes, these bands appear to represent GPI-GM-CSF. While some high molecular weight material, possibly representing aggregates, is visible in the blot, this material is not visible in the less sensitive silver stain, indicating that it is present in lower amount than the dominant band.

Example 3

[0594] Attachment of Murine GM-CSF Fused to the Gas1 GPI Modification Signal Sequence to Cells

[0595] Wild type CMS-5 murine fibrosarcoma cells grown in DMEM, 10% FBS, Pen-Strep were harvested, washed twice with RPMI 1640 (Life Technologies) and resuspended in RPMI 1640 at a concentration of 5×105 cells/ml. 0.9 ml aliquots of the cell suspension were dispensed to Eppendorf siliconized microfuge tubes. Each aliquot received either 1 ug of purified GPI-GM-CSF prepared as in Example 2, 1 ug of soluble recombinant murine GM-CSF (Intergen, supplied as lyophilized powder and reconstituted at 40 ug/ml in the same buffer as GPI-GM-CSF), or media alone. Cells were then incubated for 3 hours at 37° C. with shaking and then washed 3 times with PBS containing 2% FBS.

[0596] For detection of GPI-GM-CSF by flow cytometry, cells were incubated with a rat anti-murine GM-CSF monoclonal antibody (Endogen) for one hour at 4° C. The cells were then washed 3 times with PBS containing 2% FBS, and incubated with FITC-labeled goat anti-rat IgG antibody (Sigma) for one hour at 4° C., and again washed 3 times with PBS containing 2% FBS. The cells were analyzed by flow cytometry on a Becton-Dickinson Facscalibur. Decoration with GPI-GM-CSF caused an approximately 10-fold increase in peak and mean FL-1 fluorescence relative to cells incubated with media alone. In contrast, cells incubated with soluble GM-CSF had virtually the same profile as the negative control cells. This data indicates that GPI-GM-CSF, but not soluble recombinant GM-CSF, can bind to tumor cells.

[0597] GPI-GM-CSF attached to CMS-5 cells was also detected and quantitated by ELISA. CMS-5 cells were harvested and washed as described above. 1×106 cells in 1 ml of RPMI 1640 were incubated with 1 ug of purified GPI-GM-CSF. After incubation for 2 hours at 37° C., the cells were washed 3 times with PBS containing 2% FBS. The cell pellet was lysed with 50 microliters of PBS containing 0.15% deoxycholate and the detergent subsequently diluted by the addition of 200 microliters of PBS. The material was serially diluted with PBS and amounts of GM-CSF determined using an ELISA kit (Endogen) against a soluble, recombinant GM-CSF standard provided by the manufacturer. Based on this data, the mean number of GPI-GM-CSF molecules incorporated/cell over five experiments was 37,000+/−33,000. The large standard deviation was due to one experiment in which the number of molecules/cell was 66,000. Excluding this experiment, the mean was 29,500+/−4,500.

[0598] “Decoration” of B16 murine melanoma cells with GPI-GM-CSF was also quantitated by ELISA. Decoration and ELISA were performed exactly as described for CMS-5 cells. The mean number of molecules/cell over three experiments was 21,000+/−11,500.

Example 4

[0599] Stability of Murine GM-CSF Fused to the Gas1 GPI Modification Signal Sequence on Cells

[0600] To study the stability of incorporated GPI-GM-CSF on cells, CMS-5 cells were harvested and decorated as described above in Example 3. After decoration, the cells were washed 3 times with PBS containing 2% FBS and then resuspended at 4×106 cells/ml in RPMI 1640. The cells were irradiated at 3500 rads from a 137Cs source. The cells were then incubated at 37° C. in 5% CO2 and aliquots were removed at hourly intervals, washed three times, and lysed in 50 ul PBS with 0.15% deoxycholate. 200 ul of PBS was then added to dilute the deoxycholate. Cell-associated GM-CSF was measured by ELISA. Even at 6 hours, cells showed only about a 20% loss of cell-surface GPI-GM-CSF. After 6 hours, viability of irradiated cells (both decorated and non-decorated) as measured by microscopic inspection with trypan blue staining was significantly compromised. However, in vivo data (see below) indicates that both cell-surface retention of GPI-GM-CSF and post-irradiation cellular viability are sufficient to sustain a biological effect.

Example 5

[0601] Bioactivity of Murine GM-CSF Fused to the Gas1 GPI Modification Signal Sequence to Cells

[0602] The bioactivity of GPI-GM-CSF was assayed by determining the molecule's ability to support the proliferation of the FDC-P1 cell line, a murine bone-marrow derived, GM-CSF dependent cell line. Proliferation of FDC cells was measured with the Biotrak Cell Proliferation ELISA (Amersham Pharmacia), an assay that utilizes the thymidine analogue 5-bromo-2′-deoxyuridine (BrdU). WEHI cells (ATCC) were grown in Iscove MEM, 10% FBS, Penicillin-streptomycin, as a source of conditioned media for FDC-P1 cells. FDC-P1 cells were grown in DMEM, 10% FBS, Penicillin-streptomycin with 25% WEHI conditioned media, harvested, and washed 3 times with DMEM, 10% FBS, Penicillin-streptomycin. The cells were resuspended at 1×105/ml in DMEM, 10% FBS, Penicillin-streptomycin and 100 uL was aliquoted to individual wells of a 96 well microtitre plate. Groups, done in triplicate, were as follows:

[0603] A. Media-No Cells

[0604] B. FDC-PI Cells-Unstimulated

[0605] C. FDC-P1 Cells+10 ng soluble GM-CSF

[0606] D. FDC-PI Cells+10 ng GM-CSF as GPI-GM-CSF (as determined by ELISA against GM-CSF standard)

[0607] E. FDC-PI Cells+10 ng GPI-GM-CSF (as in “D”) denatured by extraction of the protein with chloroform:methanol (3:1) followed by acetone precipitation and resuspension.

[0608] All protein solutions were diluted to 100 ng/ml in 0.15M NaCl, 25 mM Tris pH 7.4 with 1 mM OGP, so that the volume added to each well was 100 uL.

[0609] The non-isotopic proliferation assay was performed according to the manufacturer's instructions. The plated cells were grown for two days at 37° C. in 5% CO2. On day 3, 10 ul of the BrdU solution was added to individual wells and the cells incubated for 3 more hours. The plate was then centrifuged at 300×g for 10 minutes and the supernatant removed. The plate was dried by incubating at 60° C. for one hour. The plate was then fixed and blocked according to the manufacturer's instructions. The fixed cells were then incubated with peroxidase-labelled anti-BrdU for 90 minutes. The wells were then washed and color developed with TMB according to the manufacturer's instructions. In two experiments, GPI-GM-CSF consistently sustained proliferation at a level somewhat (about 25%) higher than did soluble recombinant GM-CSF, indicating that GPI-GM-CSF is suprabioactive. The effect of GPI-GM-CSF was not due to the GPI moiety alone, since denatured GPI-GM-CSF did not support proliferation. The GPI moiety remained linked to the protein after denaturation, since the protein was still able to decorate cells as demonstrated by ELISA, which recognizes linear epitopes on GM-CSF.

Example 6

[0610] Effective Immunization with Cells Admixed with GPI-GM-CSF

[0611] These experiments included mice vaccinated with:

[0612] (a) Wild-type cells (WT)

[0613] (b) Cells incubated with soluble GM-CSF-Unwashed (total GM-CSF in dose: 1 microgram)

[0614] (c) Cells decorated with GPI-GM-CSF-Unbound GPI-GM-CSF Washed off Following Incubation (total GPI-GM-CSF in dose: 0.74 nanograms by ELISA [mean of 2 experiments; 73 and 75 ng individually)

[0615] (d) Cells decorated with GPI-GM-CSF-Unwashed (total GM-CSF in dose: 1 microgram)

[0616] GPI-GM-CSF mass and concentration values are expressed in terms of equivalence to GM-CSF as determined by ELISA against a soluble GM-CSF standard.

[0617] CMS-5 cells were grown to 70% confluence in DMEM, 10% FBS, Penicillin-streptomycin, harvested trypsinization, and washed 3 times with RPMI 1640. Viability was determined by trypan blue staining of an aliquot and the cells were then resuspended at a concentration of 4×106 cells/ml a 1 ul aliquots dispensed into siliconized microfuge tubes. The cells were incubated with 1 ug GPI-GM-CSF or 1 ug soluble recombinant murine GM-CSF per 106 cells for 3 hours at 37° C. “Washed” groups were then washed 3 times with PBS, 2% FBS and resuspended at 4×106 cells/ml in RPMI 1640. An aliquot of the washed GPI-GM-CSF decorated cells was removed and the amount of cell-associated GM-CSF measured by ELISA as described above. There were approximately 31,000 and 32,000 GPI-GM-CSF molecules/cell in the washed decorated groups in the two experiments, respectively.

[0618] The cells were irradiated at 3500 rads from a 137Cs source. 8-10 week-old female Balb/c mice (which are syngeneic for CMS-5) were anesthetized by metofane inhalation and vaccinated subcutaneously in the left inguinal fold with 1×106 cells in 0.25 ml. Seven days later, wild-type CMS-5 cells at 70% confluence were harvested and washed 3 times in HBSS. Viability was determined by trypan blue staining of an aliquot and cells were adjusted to 4×106/ml in HBSS. The previously vaccinated mice were then injected subcutaneously behind the neck, under metofane anesthesia, with 2×106 live, wild-type CMS-5 cells in 0.5 ml HBSS.

[0619] Tumor development was assessed daily by palpation and visual inspection. “Onset” was defined as the first day on which a tumor mass was both palpable and visible. The observer was blinded to the vaccine received by each set of mice to ensure against bias. Mice were sacrificed by CO2 asphyxiation when tumors become unwieldy. Experiments were terminated 70 days after tumor challenge, as planned in advance.

[0620] Data is pooled from three experiments for GPI-GM-CSF unwashed, soluble GM-CSF, and wild-type vaccine groups. Data for these groups includes that from undepleted controls in a lymphocyte subset depletion experiment. Data for the GPI-GM-CSF washed group is pooled from two experiments, since this group was not included in the initial depletion experiment. The depletion experiment had 4 mice/group, and the other experiments had 5/group. In terms of total mouse numbers, n=14 for GPI-GM-CSF unwashed; 10 for GPI-GM-CSF washed; 14 for soluble GM-CSF unwashed; and 14 for WT. Approximate percentages of mice surviving tumor-free to day 70 after challenge were: WT, 15%; soluble GM-CSF, 50%; GPI-GM-CSF washed, 60%; GPI-GM-CSF unwashed, 85%. Thus, even though the GPI-GM-CSF washed vaccine contained over a thousand-fold less GM-CSF than the unwashed soluble, administration of cells decorated with GPI-GM-CSF was more effective. Furthermore, the GPI-GM-CSF unwashed vaccine, in which some molecules were not attached to a cell, was even more effective.

Example 7

[0621] Cloning and Expression of Human GM-CSF Fused to the Gas1 GPI Modification Signal Sequence

[0622] Human GM-CSF is amplified by PCR from a human T cell cDNA library (Clontech) using Pfu polymerase (Stratagene). The following primers are used: 15 Upstream 5′GCGAATCCCGGCCGGCACCCGCCCGCTCGCCCAGCCCC Downstream 5′CAGCCGGCCTCCTGGACTGGCTCCCAGCAGTC

[0623] The upstream primer contains EcoR1 and Eag1 restriction sites immediately preceding the first amino acid found in the mature human GM-CSF protein. Since expression in S. cerevisiae utilizes a yeast leader sequence, cloning of the human GM-CSF begins at the N terminus of the mature protein. Each downstream primer omits the native stop codon to allow in-frame ligation to the sequence encoding the Gas1 GPI modification signal. The downstream primer contains an NgoM IV restriction site, consistent with restriction sites used in other constructs.

[0624] PCR parameters are denaturation at 97° C. for 1 minute, 16 annealing  at 56° C. for 1 minute, and extension  at 72° C. for 2 minutes.

[0625] PCR is performed for the least number of cycles yielding a visible band on agarose gel electrophoresis. After amplification, the reaction mix is allowed to cool at 4° for 10 minutes.

[0626] The PCR product is isolated by electrophoresis through a 1% agarose gel and eluted from the excised agarose band using a commercially available kit (Qiagen). The purified hGM-CSF DNA fragment is digested with EcoR1 and NgoM IV and ligated to the (murine) pUC19 GM-CSF-GPI plasmid that has been digested with EcoR1 and NgoM IV. This replaces the murine GM-CSF with its human counterpart. The pUC19-hGM-CSF GPI plasmid is then transformed into competent AG-1 E. coli cells, 30 colonies are picked for mini-culture, and plasmid clones are isolated and purified using commercially available kits (Qiagen). Positive clones are identified by restriction enzyme test digest and agarose gel electrophoresis. Positive E. coli colonies are grown overnight in maxi-culture and their plasmids purified using Qiagen maxi-prep kits. Inserts are sequenced.

[0627] To clone GM-CSF GAS1g into the pITY-4 expression vector, PCR of this construct from the pUC19 vector is performed. The primers are: 17 5′TACGGCCGGCACCCGCCCGCTCGCCCAGCCCC 3′TACGGCCGCCACAATGAAAATAAGATACCAT

[0628] The upstream primer has an EagI site immediately preceding the first codon of the mature GM-CSF. This removes the mammalian secretion signal and allows for in-frame ligation to the yeast signal sequence. The same restriction site can be used as for the mouse construct because it is absent in the human sequence. The downstream primer appends an EagI site at the 3′ end. PCR is performed using Pfu polymerase for 25 cycles. Conditions for PCR are: denaturation 90° one minute, annealing 60° one minute, extension 72° one minute. After amplification, the reaction mix is allowed to cool at 4° for 10 minutes.

[0629] The PCR product is isolated by electrophoresis through a 1% agarose gel and eluted from the excised agarose band using a commercially available kit (Qiagen). The purified GM-CSF GAS1g DNA fragment is digested with EagI, ligated to pITY-4, and transformed into AG-1 chemically competent bacteria (Stratagene). 30 colonies are picked for mini-culture and plasmid clones are isolated and purified using commercially available kits (Qiagen). Positive clones are identified by restriction enzyme test digest and agarose gel electrophoresis. Positive E. coli colonies are grown overnight in maxi-culture and their plasmids purified using Qiagen maxi-prep kits. Inserts are sequenced.

[0630] The GPI-human GM-CSF molecule is expressed in S. cerevesiae as described for the murine molecule in Example 2. Immunoaffinity purification is performed as described in Example 2, substituting an anti-human GM-CSF antibody for the anti-murine GM-CSF antibody. ELISA to detect and quantitate the molecule, whether in isolation or bound to an antigen bearing target, is performed using an anti-human GM-CSF monoclonal antibody, as is flow cytometry on cells decorated with the molecule.

Example 8

[0631] Cloning of GM-CSF/Influenza Hemagglutinin Chimeric Proteins

[0632] pUC19 GMCSF-K-GAS1.1

[0633] pUC19 GM-CSF-K-HA was cloned starting with pUC19 GM-CSF-K-Gas1.1, which we produced in our laboratory. This plasmid includes a sequence that encodes murine GM-CSF fused to a downstream glycosylphosphatidylinositol modification sequence derived from the yeast GAS1 protein (the latter obtained from Dr. D. Wittrup, University of Illinois). A linker sequence is interposed between the GM-CSF and GAS1 portions. To insert the linker sequence, the plasmid pUC19 GMCSF-Gas1.1, also previously produced in our lab, was digested with NgoM IV and NheI. These restriction enzymes cut at the 3′ end of the GM-CSF molecule and at the 5′ end of the Gas1.1 sequence, respectively. The resulting plasmid was purified after electrophoresis through agarose gel using a kit manufactured by Qiagen. The following oligonucleotides were purchased: 18 5′ CCGGCACTAGTGGCGGAGGGGGCTCCGGCGGCGGGGGCAGCG 5′ CTAGCGCTGCCCCCGCCGCCGGCGCCCCCTCCGCCACTAGTG

[0634] The synthetic oligonucleotides contain:

[0635] 1. 5′ overhang that anneals to NgoM IV digested plasmid DNA

[0636] 2. 3′ overhang that anneals to Nhe I digested plasmid DNA

[0637] 3. DNA sequence coding for the peptide GGGGSGGGGS where G stands for glycine and S stands for serine. This 10 amino acid sequence (G4S)2 is designed to insert a kink/spacer in the protein between the GMCSF and the Gas1.1moieties.

[0638] 4. Spel site to allow confirmation of cloning of the small fragment and for further manipulations.

[0639] The two oligonucleotides were mixed in equimolar concentrations, boiled for 2 minutes and allowed to anneal at room temperature. The oligonucelotide was ligated into the NgoM IV-Nhe I digested plasmid and the plasmid was used to transform the E.coli strain AG-1. Transformants were selected on LB plates containing 100 ug/ml ampicillin. Plasmid DNA was isolated, digested with Spe I, and electrophoresed on agarose gels to confirm the presence of the (G4S)2 sequence.

[0640] pUC19 GM-CSF-K-hemagglutinin (HA)

[0641] The plasmid pUC19 GM-CSF-K-HA was produced, which encodes a chimeric protein containing (from amino terminal to carboxy terminal): (1) murine GM-CSF; (2) the (G4S)2 linker described above; and (3) the HA1 domain of the H1 HA from the A/PR/8/34 influenza A isolate. The HA1 sequence used (amino acids 18 to 344 of the HA precursor) omits the N-terminal leader sequence and the downstream HA2 domain. A termination codon was added after amino acid 344.

[0642] pUC19 GM-CSF-K-Gas1.1. was digested with Nhe I and Kpn I. Nhe I cuts at the 5′ end of the Gas1.1 coding sequence and Kpn I cuts at the 3′ end of the Gas1.1 coding sequence, respectively. The resulting plasmid with the GPI coding region removed, was purified after electrophoresis through agarose gel using a kit manufactured by Qiagen. The HA1 coding sequence was cloned by PCR from a plasmid encoding the HA gene of the A/PR/8/34 strain of influenza. The HA1 sequence used begins at amino acid 18, the start of the mature protein, i.e. lacking the secretion signal sequence. The 3′ end corresponds to amino acid 344, eliminating the transmembrane region and substituting a termination codon. Primers for PCR of the HA1 sequence were as follows: 19 Upstream HA1 Primer 5′ ATGCTAGCGACACAATATGTATAGGC Downstream HA1 Primer 5′ ATGGTACCCGGCCGTTATCATCTGGATTGAATGGACGG

[0643] 20 Conditions for PCR were: Denaturation 90° one minute Annealing 60° one minute Extension 72° one minute

[0644] PCR was performed for 20 cycles using vent polymerase.

[0645] Following PCR, the product was electrophoresed through a 1.0% agarose gel and the HA1 cDNA was extracted from the gel using a Qiagen kit according to the manufacturer's instructions. The purified HA1 DNA fragment was digested with Nhe I and Kpn I. To make the fusion protein, the purified Nhe I-Kpn I HA fragment was ligated into the pUC19 GM-CSF-K-Gas1.1 vector that had been digested with Nhe I and Kpn I to remove the Gas1.1 coding region. The DNA was used to transform E.coli AG1 and transformants selected on LB-ampicillin plates. Plasmid DNA from individual colonies was isolated and digested with restriction enzymes. Restriction digests identified a pUC19 GM-CSF-K-HA plasmid.

[0646] The pUC19 GM-CSF-K-HA plasmid was purified according to the manufacturer's instructions using a kit purchased from Qiagen.

Example 9

[0647] Cloning of GM-CSF-K-HA into Yeast Expression Vector

[0648] PCR of pUC19 GM-CSF-K-HA was used to isolate a DNA fragment encoding GM-CSF-K-HA for cloning into a yeast expression vector. The PCR product contains Eag I cloning sites for in frame insertion into the yeast expression vector. 21 Upstream Primer 5′ TACGGCCGGCACCCACCCGCTCACCC Downstream Primer 5′ ATGGTACCCGGCCGTTATCATCTGGATTGAATGGACGG

[0649] 22 Conditions for PCR were: Denaturation 90° one minute Annealing 60° one minute Extension 72° one minute

[0650] PCR was performed for 20 cycles using vent polymerase.

[0651] Following PCR, the product was electrophoresed through a 1.0% agarose gel and the GM-CSF-K-HA gene was extracted from the gel using a Qiagen kit according to the manufacturers instructions. The purified DNA fragment was digested with Eag I and ligated to the yeast expression vector ITK that had been digested with Eag I. The ITK vector is designed for (1) replication in E.coli and (2) expression of genes in the yeast Saccharomyces cerevisiae after stable integration using homologous recombination. The vector contains:

[0652] 1. Sequences for replication of the plasmid in E.coli

[0653] 2. Yeast Gal promoter for expression of heterologous genes in yeast grown in media containing galactose.

[0654] 3. PrePro—Synthetic DNA sequence, optimized for secretion and signal sequence cleavage of distal genes in yeast.

[0655] 4. Unique Eag I site for cloning genes to be expressed.

[0656] 5. Alpha terminator—DNA sequence for efficient termination of proximal genes.

[0657] 6. Delta sequence that allows for stable integration of the plasmid by recombination with endogenous delta sequences in the yeast chromosome.

[0658] 7. Antibiotic resistance gene allowing for selection in E.coli with kanamycin and selection in yeast with G418.

[0659] This plasmid was used to transform E.coli strain AG-1. Transformants were selected by growth on LB plates containing 100 ug/ml kanamycin. Individual colonies were grown in LB media containing kanamycin and plasmids were purified. Restriction digests determined orientation of inserts. The resulting plasmid ITK GM-CSF-K-HA was purified using a kit purchased from Qiagen according to the manufacturer's instructions.

Example 10

[0660] Expression of GM-CSF-K-HA in Yeast

[0661] The purified plasmid was linearized with Mfe 1 and used to transform the yeast strain Saccharomyces cerevisiae WDHY131 using lithium acetate (LiAc). A 10 ml culture of S.cerevisiae grown to saturation at 30° in YPD media (per liter/20 g Bactotryptone; 20 g dextrose; 10 g yeast extract) was used to inoculate 100 ml of YPD. The culture was grown at 30° with shaking for 3 hours. The yeast were harvested by centrifugation at 11,000×g for 2 minutes and resuspended in 25 ml of sterile water. The yeast were centrifuged as above and resuspended in 1.0 ml of 100 mM lithium acetate and transferred to a 1.5 ml microfuge tube. The yeast were pelleted by centrifugation at 12,000×g for 15 seconds and the supernatant removed. The cells were resuspended in 0.5 ml of 100 mM LiAc. 50 uL of cell suspension was added to individual microfuge tubes and centrifuged as above. Supernatant was removed.

[0662] Transformation mix added to the yeast pellet consisted of: 240 uL PEG (50% w/v); 36 uL 1.0 M LiAc; 5 uL single stranded DNA (10 mg/ml) and 1 ug of linearized ITK GM-CSF-K-HA in 75 uL of water. The mixture was vortexed to resuspend the cell pellet and incubated at 30° for 30 minutes. The cells were then shocked at 42° for 15 minutes, centrifuged to pellet cells and resuspended in 0.5 ml of YPD. Yeast were incubated in YPD media for 3 hours and plated on YPD plates containing 2 mg/ml G418. Plates were grown at 30° for 3 days until individual colonies appeared. To screen for expression of GM-CSF-K-HA, individual colonies were grown in 1 ml of YPD media at 30° for 2 days. The cells were centrifuged at 8,000×g for 2 minutes and the YPD media removed and replaced with 1 ml of YPG media (per liter/20 g Bactotryptone; 20 g galactose; 10 g yeast extract) for induction from the ga1 promoter. Yeast were grown in YPG media for 2 days. At this time, an aliquot was removed and cells were pelleted. The supernatant was tested for GM-CSF expression using an ELISA kit purchased from Endogen. Protocol was according to the manufacturer. A high-expressing yeast clone secreting the chimeric protein GM-CSF-K-HA was identified. Based on standard curve of soluble GMCSF, expression level was approximately 2.4 mg/L of GM-CSF moiety.

Example 11

[0663] Production of pUC19 HA (hemagglutinin)-K-GM-CSF

[0664] The plasmid pUC19 HA-K-GM-CSF was also produced, which encodes a chimeric protein containing (from amino terminal to carboxy terminal): (1) an HA1 domain (2) K, the (G4S)2 linker described above, and (3) murine GM-CSF, The HA1 begins at the amino terminus of the mature protein, amino acid 18, eliminating the leader sequence. The 3′ end terminates at amino acid 344. The (G4S)2 has been added to supply a flexible linker. The GM-CSF begins at amino acid 18 of the GM-CSF protein, corresponding to the first amino acid of the mature protein.

[0665] The HA-K sequence was first cloned by PCR of the HA1 coding sequence from a plasmid encoding the HA gene of the A/PR/8/34 strain of influenza. 23 Upstream Primer 5′ CTGAATTCCGGCCGGACACAATATGTATAGGC Downstream Primer 5′ ATGGTACCGCTGCCCCCGCCGCCGGAGCCCCCTCCGCCACTTCTGGATTGAATGGACGGAAT

[0666] The oligonucleotides for PCR generate a nucleic acid with:

[0667] 1. A 5′ EcoRI site at the amino terminus of the mature HA

[0668] 2. The (G4S)2 linker at the carboxy terminus of the HA1 domain (amino acid 344 of the HA precursor)

[0669] 3. A Kpn I site distal to the end of the (G4S)2 sequence 24 Conditions for PCR were: Denaturation 90° one minute Annealing 60° one minute Extension 72° one minute

[0670] PCR was performed for 20 cycles using vent polymerase.

[0671] Following PCR, the product was electrophoresed through a 1.0% agarose gel and the HA1-K DNA was extracted from the gel using a Qiagen kit according to the manufacturer's instructions. The purified HA-K DNA fragment was digested with EcoRI and Kpn I and the fragment was cloned into pUC19 that had been digested with EcoRI and KpnI. The plasmid was used to transform E.coli AG-1 to ampr. Individual colonies were picked and grown in LB-amp. The identity of plasmids with the correct insert was determined by restriction mapping. The resulting plasmid termed pUC19 HA-K was purified using a Qiagen kit according to the manufacturer's instructions.

[0672] The GM-CSF fragment was cloned by PCR. 25 Upstream Primer 5′ ACGGTACCGCACCCACCCGCTCACCCATC Downstream Primer 5′ TAGGATCCCGGCCGTCATTTTTGGACTGGTTTTTTGCACG

[0673] The PCR primers generate a GM-CSF fragment with

[0674] 1. 5′ KpnI site that allows in frame translation from the (G4S)2 portion of the HA-K molecule to the start of the mature GM-CSF molecule at amino acid 18.

[0675] 2. A termination codon at the 3′ end of the GM-CSF

[0676] 3. 3′ BamHI site 26 Conditions for PCR were: Denaturation 90° one minute Annealing 60° one minute Extension 72° one minute

[0677] PCR was performed for 20 cycles using vent polymerase.

[0678] Following PCR, the product was electrophoresed through a 1.0% agarose gel and the GM-CSF gene was extracted from the gel using a Qiagen kit according to the manufacturer's instructions. The purified fragment was digested with Kpn I and BamHI and the fragment was ligated into pUC19 HA-K plasmid that had been digested with KpnI and BamHI.. The plasmid was used to transform E.coli AG-1 to ampr. Individual colonies were picked and grown in LB-amp. The identity of plasmids with the correct insert was determined by restriction mapping. The resulting plasmid termed pUC19 HA-K-GM-CSF was purified using a Qiagen kit according to the manufacturer's instructions.

Example 12

[0679] Cloning of HA-K-GM-CSF into Yeast Expression Vector

[0680] PCR of pUC19 HA-K-GM-CSF was used to generate a DNA fragment encoding HA-K-GM-CSF for cloning into a yeast expression vector. The PCR product contains Eag I cloning sites for in-frame insertion into the yeast expression vector. 27 Upstream Primer 5′ CTGAATTCCGGCCGGACACAATATGTATAGGC Downstream Primer 5′ TAGGATCCCGGCCGTCATTTTTGGACTGGTTTTTTGCACG

[0681] 28 Conditions for PCR were: Denaturation 90° one minute Annealing 60° one minute Extension 72° one minute

[0682] PCR was performed for 20 cycles using vent polymerase.

[0683] Following PCR, the product was electrophoresed through a 1.0% agarose gel and the HA-K-GM-CSF gene was extracted from the gel using a Qiagen kit according to the manufacturers instructions. The purified DNA fragment was digested with Eag I and ligated to the yeast expression vector ITK, that had been digested with Eag I. The ITK vector is designed for (1) replication in E.coli and (2) expression of genes in the yeast Saccharomyces cerevisiae after stable integration using homologous recombination. The vector contains:

[0684] 1. Sequences for replication of the plasmid in E.coli

[0685] 2. Yeast Gal promoter for expression of heterologous genes in media containing galactose.

[0686] 3. PrePro—Synthetic DNA sequence, optimized for secretion and signal sequence cleavage of distal genes in yeast.

[0687] 4. Unique Eag I site for cloning genes to be expressed.

[0688] 5. Alpha terminator—DNA sequence for efficient termination of proximal genes.

[0689] 6. Delta sequence that allows for stable integration of the plasmid by recombination with endogenous delta sequences in the yeast chromosome.

[0690] 7. Antibiotic resistance gene allowing for selection in E.coli with kanamycin and selection in yeast with G418.

[0691] This plasmid was used to transform E.coli strain AG-1. Transformants were selected by growth on LB plates containing 100 ug/ml kanamycin. Individual colonies were grown in LB media containing kanamycin and plasmids were purified. Restriction digests determined orientation of inserts. The resulting plasmid ITK HA-K-GM-CSF was purified using a kit purchased from Qiagen according to the manufacturer's instructions.

[0692] The purified plasmid was linearized with Mfe 1 and used to transform the yeast strain Saccharomyces cerevisiae WDHY131 using lithium acetate (LiAc). A 10 ml culture of S.cerevisiae grown to saturation at 30° C. in YPD media (per liter/20 g Bactotryptone; 20 g dextrose; 10 g yeast extract) was used to inoculate 100 ml of YPD. The culture was grown at 30° C. with shaking for 3 hours. The yeast were harvested by centrifugation at 11,000×g for 2 minutes and resuspended in 25 ml of sterile water. The yeast were centrifuged as above and resuspended in 1.0 ml of 100 mM lithium acetate and transferred to a 1.5 ml microfuge tube. The yeast were pelleted by centrifugation at 12,000×g for 15 seconds and the supernatant removed. The cells were resuspended in 0.5 ml of 100 mM LiAc. 50 uL of cell suspension was added to individual microfuge tubes and centrifuged as above. Supernatant was removed. Transformation mix added to the yeast pellet consisted of: 240 uL PEG (50% w/v); 36 uL 1.0 M LiAc; 5 uL single stranded DNA (10 mg/ml) and 1 ug of linearized ITK HA-K-GM-CSF in 75 uL of water. The mixture was vortexed to resuspend the cell pellet and incubated at 30° for 30 minutes. The cells were then shocked at 42° C. for 15 minutes, centrifuged to pellet cells and resuspended in 0.5 ml of YPD. Yeast were incubated in YPD media for 3 hours and plated on YPD plates containing 2 mg/ml G418. Plates were grown at 30° C. for 3 days until individual colonies appeared. To screen for expression of HA-K-GM-CSF, individual colonies were grown in 1 ml of YPD media at 30° C. for 2 days. The cells were centrifuged at 8,000×g for 2 minutes and the YPD media removed and replaced with 1 ml of YPG media (per liter/20 g Bactotryptone; 20 g galactose; 10 g yeast extract) for induction from the ga1 promoter. Yeast were grown in YPG media for 2 days. At this time, an aliquot was removed and cells were pelleted. The supernatant was tested for GM-CSF expression using an ELISA kit purchased from Endogen. The protocol was according to the manufacturer.

[0693] A colony expressing high levels of the chimeric protein was identified. Based on standard curve of soluble GMCSF, expression level is approximately 2.0 mg/L of soluble material. There is no decrease in expression levels in the absence of G418.

Example 13

[0694] Scale Up Purification of GM-CSF-K-HA

[0695] For scaled-up purification of the chimeric protein, yeast were inoculated into 500 ml of YPD and grown for three days at 30° C. Cells were pelleted by centrifugation at 12,000×g for 2 minutes and transferred to an equal volume of YPG for an additional three days of growth. The cells were then pelleted by centrifugation at 12,000×g for 2 minutes and the supernatant collected. The soluble material was applied to an immunoaffinity column of anti-murine GMCSF monoclonal antibody (Endogen) linked to cyanogen bromide-activated Sepharose 4B (Sigma). Coupling of the monoclonal to the Sepharose was performed according to the manufacturer. Efficiency of coupling was monitored using OD280 and of binding of GMCSF to immobolized antibody was tested using soluble, commercially available material.

[0696] Soluble yeast-derived material was applied to the column and allowed to flow by gravity. The column was washed with: (a) 20 volumes of 0.15M NaCl, 25 mM Tris pH 7.4 (TN) (b) 5 volumes of 50 mM Tris pH 8.0 (c) 20 volumes TN. Bound material was then eluted with 10 volumes of 0.15 M NaCl, 25 mM Tris pH 2.5. Eluted material was neutralized with 1/200 volume of 1.5M Tris pH8.8. The purified material was concentrated using a Microsep 3K centrifugal devise (Pall Gelman Laboratory). Yields of chimeric protein were determined by ELISA (Endogen) according to the manufacturer's instructions.

[0697] Purified GM-CSF-K-HA

[0698] Purified GM-CSF-K-HA was analyzed by western blot. Approximately 1 ug of GM-K-HA per lane was electrophoresed along with soluble GMCSF. For western blot, gels were transferred to Protran BA83 (Schleicher and Schuell), blocked with TBS (Tris Buffered Saline) containing 0.05% Tween 20 and 2% Nonfat Dry Milk. The blot was incubated with primary antibody (rat monoclonal anti-murine GMCSF, Endogen) at 1:5000 dilution in blocking buffer for 2 hours at room temperature. The blot was washed with TBS-0.05% Tween 20. Secondary antibody, alkaline phosphatase conjugated anti-rat IgG (Sigma) was incubated at 1:10,000 for 1 hour at room temperature.

Example 14

[0699] Decoration of Cells with GM-K-HA

[0700] Purified GM-CSF-K-HA was used to decorate CMS 5 murine fibrosarcoma cells. CMS 5 cells were grown in DMEM, 10% FBS, Penicillin-streptomycin, harvested by trypsinization and washed 3 times with RPMI 1640 (Gibco). Cells were diluted to 1×106/ml in RPMI 1640 and 0.9 ml were aliquoted to siliconized tubes. Cells were incubated for 2 hours at 37° C. with shaking and then washed 3 times with PBS containing 2% FBS. Primary antibody, rat anti-murine GMCSF monoclonal, was incubated for one hour at 4° C. Cells were washed as above, treated with FITC labeled anti-rat antibody (Sigma), and incubated for one hour at 4° C. After additional washing, the cells were analyzed by flow cytometry, which confirmed the presence of GM-CSF-K-HA on the surface of the tumor cells.

Example 15

[0701] Quantitation of GM-CSF-K-HA on the Cell Surface of CMS 5 Cells After Decoration

[0702] CMS 5 cells were harvested and washed as described above. 1×106 cells in 1 ml of RPMI 1640 were incubated with 1 ug of purified GM-K-HA. After incubation for 15 min, 30 min, 1 hour, or 2 hours at 4° C., room temperature, or 37° C., the cells were washed 3 times with PBS containing 2% FBS. The cell pellet was lysed with 50 microliters of PBS containing 0.15% deoxycholate and the detergent subsequently diluted by the addition of 200 microliters of PBS. The material was serially diluted with PBS and tested by ELISA (Endogen). Based on the amount of GM-CSF detected in the cell lysates, it was possible to quantitate the average number of GM-CSF molecules associated with each cell. For example, after a 15 min incubation at 4° C., 58,700 molecules were present per cell. After a 15 min incubation at room temperature, 25,700 molecules were present per cell. After a 15 min incubation at 37° C., 17,200 molecules were present per cell.

Example 16

[0703] Effective Immunization with Tumor Cells Admixed with GM-CSF/Hemagglutinin Fusion Polypeptides

[0704] CMS-5 murine fibrosarcoma cells were grown to 70% confluence in DMEM, 10% FBS, Penicillin-streptomycin, harvested by trypsinization, and washed 3 times with RPMI 1640. Viability was determined by trypan blue staining of an aliquot and the cells were then resuspended at a concentration of 4×106 cells/ml and 1 ml aliquots dispensed into siliconized microfuge tubes. The cells were incubated with 1 ug (microgram) murine GM-CSF-K-HA or 10 ng (nanograms) HA-K-murine GM-CSF per 106 cells for 3 hours at 37° C. Cells were then washed 3 times with RPMI 1640 and resuspended at 4×106 cells/ml in RPMI 1640. An aliquot of the cells was removed and the amount of cell-associated GM-CSF measured by ELISA as described above. There were approximately 20,240 and 18,000 molecules/cell in the GM-CSF-K-HA and HA-K-GM-CSF groups, respectively. Cells for a control vaccine, to be administered without a molecule of the invention (or any other immunomodulator), were prepared in parallel.

[0705] The cells were irradiated at 3500 rads from a 137Cs source. 8 week-old female Balb/c mice (which are syngeneic for CMS-5) were anesthetized by metofane inhalation and vaccinated subcutaneously in the left inguinal fold with 1×106 cells in 0.25 ml. Each mouse received cells from only one vaccine type. Seven days later, wild-type CMS-5 cells at 70% confluence were harvested and washed 3 times in HBSS. Viability was determined by trypan blue staining of an aliquot and cells were adjusted to 4×106/ml in HBSS. The previously vaccinated mice were then injected subcutaneously behind the neck, under metofane anesthesia, with 2×106 live, wild-type CMS-5 cells in 0.5 ml HBSS. The groups receiving the HA-K-GM-CSF and control vaccines each consisted of 5 mice, whereas the group receiving the GM-CSF-K-HA vaccine consisted of 4 mice because 1 mouse failed to awaken from anesthesia.

[0706] Tumor development was assessed daily by palpation and visual inspection. The observer was blinded to the vaccine received by each set of mice to ensure against bias. Mice were sacrificed by CO2 asphyxiation when tumors become unwieldy. All mice that had received the control vaccine developed tumors within 18 days after challenge with live tumor cells. In contrast, 100% of mice that had received the GM-CSF-K-HA vaccine and 60% of mice that had received the HA-K-GM-CSF vaccine remained tumor-free at the end of the experiment, 40 days after challenge. Thus, immunization with a composition comprising tumor cells and a molecule of the invention confers significantly longer tumor-free survival than immunization with a composition comprising tumor cells but not comprising a molecule of the invention.

Example 17

[0707] Cloning of Human GM-CSF-K-HA

[0708] pUC19 human GM-CSF-K-HA (hGM-CSF-K-HA) is cloned starting with pUC19 GM-CSF-K-HA. pUC19 GM-CSF-K-HA. is digested with EcoRI and NgoM IV. EcoRI cuts at the 5′ end of the murine GM-CSF coding sequence and Ngo M IV cuts at the 3′ end of the murine GM-CSF molecule. The resulting plasmid with the murine GM-CSF coding region removed is purified after electrophoresis through agarose gel using a kit manufactured by Qiagen. The human GM-CSF coding segment is generated by PCR from a commercially available human cDNA library (Clontech). The human sequence begins at amino acid 18, the start of the mature protein, i.e. lacking the secretory signal sequence. The 3′ end corresponds to amino acid 144, eliminating the endogenous termination codon. 29 Upstream hGM-CSF Primer 5′ GCGAATTCCGGCCGGCACCCGCCCGCTCGCCCAGC Downstream hGM-CSF Primer 5′ TAGCCGGCCTCCTGGACTGGCTCCCAGCA

[0709] 30 Conditions for PCR are: Denaturation 90° one minute Annealing 60° one minute Extension 72° one minute

[0710] PCR is performed for 20 cycles using vent polymerase.

[0711] Following PCR, the product is electrophoresed through a 1.0% agarose gel and the hGM-CSF gene is extracted from the gel using a Qiagen kit according to the manufacturer's instructions. The purified hGM-CSF DNA fragment is digested with Eco RI and NgoM IV and ligated into the pUC19 murine GM-CSF-K-HA vector that has been digested with EcoRI and NgoM IV to remove the murine GM-CSF sequence. The DNA is used to transform E.coli AG1 and transformants are selected on LB-ampicillin plates. Plasmid DNA from individual colonies is isolated and digested with restriction enzymes to identify clone harboring a pUC19 hGM-CSF-K-HA plasmid.

[0712] The pUC19 hGM-CSF-K-HA plasmid is purified according to the manufacturer's instructions using a kit purchased from Qiagen. PCR of pUC19 hGM-CSF-K-HA is used to generate a DNA fragment encoding hGM-CSF-K-HA for cloning into a yeast expression vector. The PCR product contains Eag I cloning sites for in frame insertion into the yeast expression vector. 31 Upstream Primer 5′ GCGAATTCCGGCCGGCACCCGCCCGCTCGCCCAGC Downstream Primer 5′ ATGGTACCCGGCCGTTATCATCTGGATTGAATGGACGG

[0713] 32 Conditions for PCR are: Denaturation 90° one minute Annealing 60° one minute Extension 72° one minute

[0714] PCR is performed for 20 cycles using vent polymerase.

[0715] Following PCR the product is electrophoresed through a 1.0% agarose gel and the hGM-CSF-K-HA gene is extracted from the gel using a Qiagen kit according to the manufacturer's instructions. The purified DNA fragment is digested with Eag I and ligated to the yeast expression vector ITK that has been digested with Eag I. The ITK vector is designed for (1) replication in E.coli and (2) expression of genes in the yeast Saccharomyces cerevisiae after stable integration using homologous recombination. The vector contains:

[0716] 1. Sequences for replication of the plasmid in E.coli

[0717] 2. Yeast Gal promoter for expression of heterologous genes in yeast grown in media containing galactose.

[0718] 3. PrePro—Synthetic DNA sequence, optimized for secretion and signal sequence cleavage of distal genes in yeast.

[0719] 4. Unique Eag I site for cloning genes to be expressed.

[0720] 5. Alpha terminator—DNA sequence for efficient termination of proximal genes.

[0721] 6. Delta sequence that allows for stable integration of the plasmid by recombination with endogenous delta sequences in the yeast chromosome.

[0722] 7. Antibiotic resistance gene allowing for selection in E.coli with kanamycin and selection in yeast with G418.

[0723] This plasmid is used to transform E.coli strain AG-1. Transformants are selected by growth on LB plates containing 100 ug/ml kanamycin. Individual colonies are grown in LB media containing kanamycin and plasmids are purified. Restriction digests determine orientation of inserts. The resulting plasmid ITK hGM-CSF-K-HA is purified using a kit purchased from Qiagen according to the manufacturer's instructions.

[0724] The purified plasmid is linearized with Mfe 1 and used to transform the yeast strain Saccharomyces cerevisiae WDHY131 using lithium acetate (LiAc). A 10 ml culture of S.cerevisiae grown to saturation at 30° in YPD media (per liter/20 g Bactotryptone; 20 g dextrose; 10 g yeast extract) is used to inoculate 100 ml of YPD. The culture is grown at 30° with shaking for 3 hours. The yeast are harvested by centrifugation at 11,000×g for 2 minutes and resuspended in 25 ml of sterile water. The yeast are centrifuged as above and resuspended in 1.0 ml of 100 mM lithium acetate and transferred to a 1.5 ml microfuge tube. The yeast are pelleted by centrifugation at 12,000×g for 15 seconds and the supernatant removed. The cells are resuspended in 0.5 ml of 100 mM LiAc. 50 uL of cell suspension is added to individual microfuge tubes and centrifuged as above. Supernatant is removed. Transformation mix added to the yeast pellet consists of: 240 uL PEG (50% w/v); 36 uL 1.0 M LiAc; 5 uL single stranded DNA (10 mg/ml) and 1 ug of linearized ITK hGM-CSF-K-HA in 75 uL of water. The mixture is vortexed to resuspend the cell pellet and incubated at 30° for 30 minutes. The cells are then shocked at 42° for 15 minutes, centrifuged to pellet, and resuspended in 0.5 ml of YPD. Yeast are incubated in YPD media for 3 hours and plated on YPD plates containing 2 mg/ml G418. Plates are grown at 30° for 3 days until individual colonies appear.

[0725] To screen for expression of hGM-CSF-K-HA, individual colonies are grown in 1 ml of YPD media at 30° for 2 days. The cells are centrifuged at 8,000×g for 2 minutes and the YPD media removed and replaced with 1 ml of YPG media (per liter/20 g Bactotryptone; 20 g galactose; 10 g yeast extract) for induction from the ga1 promoter. Yeast are grown in YPG media for 2 days. An aliquot is then removed and the cells are pelleted. The supernatant is tested for hGM-CSF expression using an ELISA kit purchased from Endogen. Protocol is according to the manufacturer.

Example 18

[0726] Reduction of Metastases in a Mouse Model

[0727] B16F10 murine melanoma cells were harvested and washed three times in PBS. Cells were then suspended at 5×105 viable cells/ml in PBS, with viability determined by staining an aliquot of cells with Trypan blue. 100 ul of this suspension was injected into the tail veins of 8-10 week old female C57BL/6 mice. On day 1 or day 3 after tumor challenge, mice were immunized with 1×106 irradiated B16F10 cells subcutaneously in the left inguinal fold. Groups (3 mice each) received either cells alone, cells mixed with 1 ug soluble recombinant murine GM-CSF (Serologicals Corp.), or cells mixed with 1 ug of a multifunctional molecule of the invention comprising murine GM-CSF at the N terminus, a (Gly4Ser)2 flexible linker, and the HA1 domain of influenza A/PR/8/34 hemagglutinin at the C terminus. The latter composition comprised both free and cell-bound multifunctional molecule.

[0728] Mice were sacrificed on day 12, the thoracic cavity opened with dissecting scissors, and the lungs removed en bloc by tracheal transection. Metastases were enumerated with a hand lens. In the mice immunized 1 day after challenge, the average number of metastases/mouse was as follows: 33 Cells alone: 30.00 Cells + GM-CSF: 14.33 Cells + multifunctional molecule: 0.67

[0729] In the mice immunized 3 days after challenge, the average number of metastases/mouse was as follows: 34 Cells alone: 36.33 Cells + GM-CSF: 10.33 Cells + multifunctional molecule: 1.00

[0730] Thus, administration of the composition comprising a multifunctional molecule of the invention was able to effectively reduce metastases and treat disease.

Example 19

[0731] GM-CSF-HA1-Mediated Protection Against Tumor Challenge in vivo

[0732] As an allogeneic tumor vaccine model, C57BL/6 mice (haplotype b) were immunized with C3H (haplotype k)-derived K1735 melanoma cells, followed by challenge with C57BL/6-derived B16F10 melanoma cells. K1735 cells were grown to 70% confluence in DMEM with 10% FBS and penicillin-streptomycin, harvested by trypsinization, and washed 3 times with RPMI 1640. Viability was determined by trypan blue staining of an aliquot and the cells were then resuspended at a concentration of 4×106 cells/ml for K1735. One ml aliquots were then dispensed into siliconized microfuge tubes. The cells were incubated with 1 ug mGM-CSF-HA1 (a fusion polypeptide consisting of murine GM-CSF at the N terminus, a (Gly4Ser)2 linker, and the HA1 domain of influenza A/PR/8/34) per 106 cells for 2 hours at 4° C. An aliquot of the cells was removed for measurement of cell-associated GM-CSF by ELISA. Mean cell-associated GM-CSF across two experiments was approximately 60,000. Cells that were not admixed with any polypeptide and, in one experiment, cells mixed with 1 ug soluble murine GM-CSF (Serologicals Corp.) were prepared in parallel as control vaccines.

[0733] The cells were irradiated at 3500 rads from a 137Cs source. 8 week-old female C57BL/6 mice were anesthetized by metofane inhalation and vaccinated subcutaneously in the left inguinal fold with or 1×106 cells in 0.25 ml RPMI, along with a total of 1 ug GM-CSF-HA1 (including bound and free fusion polypeptide). Each mouse received cells from only one vaccine type. Seven days later, B16F10 cells, as appropriate, at 70% confluence were harvested and washed 3 times in HBSS. Viability was determined by trypan blue staining of an aliquot and cells were adjusted in HBSS to 1×105/ml. The previously vaccinated mice were then challenged subcutaneously behind the neck, under metofane anesthesia, with 0.5 ml of the B16F10 cell suspension.

[0734] Tumor development was assessed daily by palpation and visual inspection. “Onset” was defined as the first day on which a tumor mass was both palpable and visible. The observer was blinded to the vaccine received by each set of mice to ensure against bias. Mice were sacrificed by CO2 asphyxiation when tumors become unwieldy. Experiments were terminated 70 days after tumor challenge, as planned in advance.

[0735] In pooled results from two experiments, 70 days after challenge, 7/10 mice that had been vaccinated with cells admixed with fusion polypeptide remained tumor-free. In contrast, 10/10 mice that had been vaccinated with cells alone developed tumors, as did 4/5 mice vaccinated with cells admixed with soluble murine GM-CSF.

[0736] Other Embodiments

[0737] The foregoing examples demonstrate experiments performed and contemplated by the present inventors in making and carrying out the invention. It is believed that these examples include a disclosure of techniques which serve to both apprise the art of the practice of the invention and to demonstrate its usefulness. It will be appreciated by those of skill in the art that the techniques and embodiments disclosed herein are preferred embodiments only that in general numerous equivalent methods and techniques may be employed to achieve the same result.

[0738] All of the references identified hereinabove, are hereby expressly incorporated herein by reference to the extent that they describe, set forth, provide a basis for or enable compositions and/or methods which may be important to the practice of one or more embodiments of the present inventions.

[0739] Appendix I

[0740] 4: BC025704 Homo sapiens, leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 5, clone MGC:34418 IMAGE:5223581, mRNA, complete cds gi|19344005|gb|BC025704.1|[19344005]

[0741] 5: BC025713 Homo sapiens, T-cell receptor interacting molecule, clone MGC:34314 IMAGE:5227396, mRNA, complete cds gi|19343996|gb|BC025713.1|[19343996]

[0742] 6: BC025722 Homo sapiens, adenosine A2b receptor, clone MGC:34640 IMAGE:5198898, mRNA,complete cds gi|19343938|gb|BC025722.1|[19343938]

[0743] 7: BC025717 Homo sapiens, chemokine (C-C motif) receptor-like 2, clone MGC:34104 IMAGE:5228561, mRNA, complete cds gi|19343936|gb|BC025717.1|[19343936]

[0744] 8: BC025695 Homo sapiens, endothelial differentiation, lysophosphatidic acid G-protein-coupled receptor, 4, clone MGC:34227 IMAGE:5209267, mRNA, complete cds gi|19343926|gb|BC025695.1|[19343926]

[0745] 9: BC025727 Homo sapiens, Similar to T cell receptor alpha locus, clone MGC:34712 IMAGE:5201547, mRNA, complete cds gi|9343616|gb|BC025727.1|[19343616]

[0746] 10: BC025691 Homo sapiens, interleukin 2 receptor, beta, clone MGC:34584 IMAGE:5207833, mRNA, complete cds gi|19343610|gb|BC025691.1|[19343610]

[0747] 11: AF474992 Homo sapiens G protein-coupled receptor SNSR6 gene, complete cds gi|19338917|gb|AF474992.1|[19338917]

[0748] 12: AF474991 Homo sapiens G protein-coupled receptor SNSR5 gene, complete cds gi|19338915|gb|AF474991.1|[19338915]

[0749] 13: AF474990 Homo sapiens G protein-coupled receptor SNSR4 gene, complete cds gi|19338913|gb|AF474990.1|[19338913]

[0750] 14: AF474989 Homo sapiens G protein-coupled receptor SNSR3 gene, complete cds gi|19338911|gb|AF474989.1|[19338911]

[0751] 15: AF474988 Homo sapiens G protein-coupled receptor SNSR2 gene, complete cds gi|19338909|gb|AF474988.1|[19338909]

[0752] 71: AF453877 Homo sapiens neuronal nicotinic receptor beta 4 subunit precursor, gene, exon 1 and partial cds gi|18042122|gb|AF453877.1|[18042122]

[0753] 73: U62556 Homo sapiens chemokine receptor-like protein (TER1) gene, complete cds gi|1468978|gb|U62556.1|HSU62556[1468978]

[0754] 74: AF449218 Homo sapiens 43kDa acetylcholine receptor-associated protein (RAPSN) mRNA, complete cds gi|19310212|gb|AF449218.1|[19310212]

[0755] 84: AJ437349 Homo sapiens partial mRNA for T-cell receptor beta chain (V14-D-J-C) (TCRB gene), clone 11 gi|19262919|emb|AJ437349.1|HSA437349[19262919]

[0756] 85: AJ011371 Homo sapiens mRNA for serotonin 4 receptor, splice variant h5-HT4(e) gi|3646277|emb|AJ011371.1|HSAJ1371[3646277]

[0757] 88: BC025294 Homo sapiens, Similar to toll-like receptor 4, clone IMAGE:4868078, mRNA gi|19263693|gb|BC025294.1|[19263693]

[0758] 89: BM875542 ij54d02.y1 Human insulinoma Homo sapiens cDNA clone IMAGE:5634842 5′ similar to TR:000559 000559 RECEPTOR-BINDING CANCER ANTIGEN EXPRESSED ON SISO CELLS ;, mRNA sequence gi|19243208|gb|BM875542.1|BM875542[19243208]

[0759] 99: AY059419 Homo sapiens killer-cell immunoglobulin-like receptor (KIR3DL1) mRNA, KIR3DL1*011 allele, partial cds gi|19224338|gb|AY059419.1|[19224338]

[0760] 100: AY059418 Homo sapiens killer-cell immunoglobulin-like receptor (KIR3DL2) mRNA, KIR3DL2*010 allele, partial cds gi|19224336|gb|AY059418.1|[19224336]

[0761] 101: AY059417 Homo sapiens killer-cell immunoglobulin-like receptor KIR3DL1/2v mRNA, partial cds gi|19224334|gb|AY059417.1|[19224334]

[0762] 102: AY059420 Homo sapiens killer-cell immunoglobulin-like receptor (KIR3DL2) mRNA,KIR3DL2*012 allele, partial cds gi|19224332|gb|AY059420.1|[19224332]

[0763] 103: AC079385 Homo sapiens 12q BAC RP11-482D24 (Roswell Park Cancer Institute Human BAC Library) complete sequence gi|14670063|gb|AC079385.18|[14670063]

[0764] 104: AC078889 Homo sapiens 12q BAC RP11-335I12 (Roswell Park Cancer Institute Human BAC Library) complete sequence gi|11072039|gb|AC078889.20|[11072039]

[0765] 105: AC010168 Homo sapiens 12p12-31.7-32.2 BAC RP11-174G6 (Rosewell Park Cancer Institute Human Bac Library) complete sequence gi|6855156|gb|AC010168.6|[6855156]

[0766] 106: U14188 Homo sapiens LERK-4 (EPLG4) mRNA, complete cds gi|642834|gb|U14188.1|HSU14188[642834]

[0767] 107: U14187 Homo sapiens LERK-3 (EPLG3) mRNA, complete cds gi|642832|gb|U14187.1|HSU14187[642832]

[0768] 108: U15637 Homo sapiens CD40 binding protein (CD40BP) mRNA, complete cds gi|595910|gb|U15637.1|HSU15637[595910]

[0769] 109: AF262304 Homo sapiens clone 7 CC chemokine receptor 3-like mRNA, partial sequence, alternatively spliced gi|19171650|gb|AF262304.1|[19171650]

[0770] 110: AF262303 Homo sapiens clone 6 CC chemokine receptor 3 (CCR3) mRNA, partial cds gi|19171648|gb|AF262303.1|[19171648]

[0771] 111: AF262302 Homo sapiens clone 5 CC chemokine receptor 3 (CCR3) mRNA, partial cds gi|19171646|gb|AF262302.1|[19171646]

[0772] 112: AF262301 Homo sapiens clone 4 CC chemokine receptor 3 (CCR3) mRNA, partial cds gi|19171644|gb|AF262301.1|[19171644]

[0773] 113: AF262300 Homo sapiens clone 2 CC chemokine receptor 3 (CCR3) mRNA, partial cds gi|19171642|gb|AF262300.1|[19171642]

[0774] 114: AF262299 Homo sapiens clone 1 CC chemokine receptor 3 (CCR3) mRNA, partial cds gi|19171640|gb|AF262299.1|[19171640]

[0775] 118: AF247361 Homo sapiens CC chemokine receptor 3 (CCR3) gene, complete cds gi|19110542|gb|AF247361.1|[19110542]

[0776] 122: AF416619 Homo sapiens prolactin receptor short isoform 1a (PRLR) mRNA, complete cds, alternatively spliced gi|16506717|gb|AF416619.1|[16506717]

[0777] 123: AF416618 Homo sapiens prolactin receptor short isoform 1b (PRLR) mRNA, complete cds, alternatively spliced gi|16506715|gb|AF416618.1|[16506715]

[0778] 125: AJ303165 Homo sapiens partial gene for putative transmembrane receptor gi|13162199|emb|AJ303165.1|HSA303165[13162199]

[0779] 126: NM—017451 Homo sapiens BAI1-associated protein 2 (BAIAP2) transcript variant 2, mRNA gi|9257198|ref|NM—017451.1|[9257198]

[0780] 127: NM—017450 Homo sapiens BAI1-associated protein 2 (BAIAP2) transcript variant 1, mRNA gi|9257196|ref|NM—017450.1|[9257196]

[0781] 128: NM—006340 Homo sapiens BAI1-associated protein 2 (BAIAP2) transcript variant 3, mRNA gi|5453564|ref|NM—006340.1|[5453564]

[0782] 131: AF350881 Homo sapiens channel kinase 2 (CHAK2) mRNA, complete cds gi|18860923|gb|AF350881.2|[18860923]

[0783] 132: AF022044 Homo sapiens natural killer cell receptor KIR3DS1 variant mRNA, complete cds gi|2760894|gb|AF022044.1|[2760894]

[0784] 133: AF034773 Homo sapiens natural killer cell inhibitory receptor (KIR2DL4) mRNA, variant 3,complete cds gi|2739181|gb|AF034773.1|[2739181]

[0785] 134: AF034772 Homo sapiens natural killer cell inhibitory receptor (KIR2DL4) mRNA, variant 2,complete cds gi|2739179|gb|AF034772.1|[2739179]

[0786] 135: AF034771 Homo sapiens natural killer cell inhibitory receptor (KIR2DL4) mRNA, variant 1,complete cds gi|2739177|gb|AF034771.1|[2739177]

[0787] 136: AF022047 Homo sapiens natural killer cell inhibitory receptor KIR2DS3 variant mRNA,complete cds gi|2738966|gb|AF022047.1|[2738966]

[0788] 137: AF022046 Homo sapiens natural killer cell inhibitory receptor KIR2DS1 variant mRNA,complete cds gi|2738964|gb|AF022046.1|[2738964]

[0789] 138: AF022045 Homo sapiens natural killer cell receptor KIR2DL1 variant mRNA, complete cds gi|2738962|gb|AF022045.1|[2738962]

[0790] 139: U56255 Homo sapiens CW-1 mRNA, complete cds gi|1399688|gb|U56255.1|HSU56255[1399688]

[0791] 140: AJ422056 Homo sapiens partial GRM5 gene for metabotrophic glutamate receptor, exon 1A gi|19069804|emb|AJ422056.1|HSA422056[19069804]

[0792] 141: AY028912 Homo sapiens ectodysplasin A receptor associated death domain (EDARADD) gene,exon 7 and complete cds, alternatively spliced gi|19067944|gb|AY028912.1|AY028906S7[19067944]

[0793] 142: AY028911 Homo sapiens ectodysplasin A receptor associated death domain (EDARADD) gene,exon 6 gi|19067943|gb|AY028911.1|AY028906S6[19067943]

[0794] 143: AY028910 Homo sapiens ectodysplasin A receptor associated death domain (EDARADD) gene,exon 5 gi|19067942|gb|AY028910.1|AY028906S5[19067942]

[0795] 144: AY028909 Homo sapiens ectodysplasin A receptor associated death domain (EDARADD) gene,exon 4 gi|1906794|gb|AY028909.1|AY028906S4[19067941]

[0796] 145: AY028908 Homo sapiens ectodysplasin A receptor associated death domain (EDARADD) gene,exon 3 gi|19067940|gb|AY028908.1|AY028906S3[19067940]

[0797] 146: AY028907 Homo sapiens ectodysplasin A receptor associated death domain (EDARADD) gene, exon 2 gi|19067939|gb|AY028907.1|AY028906S2[19067939]

[0798] 147: AY028906 Homo sapiens-ectodysplasin A receptor associated death domain (EDARADD) gene, exon 1 gi|9067938|gb|AY028906.1|AY028906S1[19067938]

[0799] 148: AH010677 Homo sapiens ectodysplasin A receptor associated death domain (EDARADD) gene, complete cds, alternatively spliced gi|19067937|gb|AH010677.1|SEG_AY028906S[19067937]

[0800] 149: AY028913 Homo sapiens ectodysplasia A receptor associated death domain A (EDARADD) mRNA, complete cds; alternatively spliced gi|19067935|gb|AY028913.1|[19067935]

[0801] 150: BM735809 06E08 Canine Brain cDNA Library Canis familiaris cDNA 5′ similar to Homo sapiens glycine receptor, beta, mRNA sequence gi|19057142|gb|BM735809.1|BM735809[19057142]

[0802] 151: BM735756 06A09 Canine Brain cDNA Library Canis familiaris cDNA 5′ similar to Homo sapiens glycine receptor, beta subunit, mRNA sequence gi|19057089|gb|BM735756.1|BM735756[19057089]

[0803] 152: BM735711 10E11 Canine Brain cDNA Library Canis familiaris cDNA 5′ similar to Homo sapiens protein tyrosine phosphatase, receptor-type, Z polypeptide 1, mRNA sequence gi|19057044|gb|BM735711.1|BM735711[19057044]

[0804] 155: AC007165 Homo sapiens BAC clone RP11-451C2 from 2, complete sequence gi|19033999|gb|AC007165.4|[19033999]

[0805] 156: AF245699 Homo sapiens type 1 angiotensin II receptor (AGTR1) gene, complete cds gi|7862074|gb|AF245699.1|[7862074]

[0806] 157: BC024229 Homo sapiens, prostaglandin E receptor 3 (subtype EP3), clone MGC:27302 IMAGE:4660371, mRNA, complete cds gi|18999476|gb|BC024229.1|[18999476]

[0807] 176: AJ417555 Homo sapiens partial mRNA for killer cell immunoglobulin receptor (KIR2DS4 gene), strain 4053 gi|18958228|emb|AJ417555.1|HSA417555[18958228]

[0808] 177: AJ417554 Homo sapiens partial mRNA for killer cell immunoglobulin receptor (KIR2DS4 gene), strain 3321 gi|18958226|emb|AJ417554.1|HSA417554[18958226]

[0809] 179: NM—003877 Homo sapiens STAT induced STAT inhibitor-2 (STATI2), mRNA gi|18921206|ref|NM—003877.2|[18921206]

[0810] 180: NM—017662 Homo sapiens transient receptor potential cation channel, subfamily M, member 6(TRPM6), mRNA gi|18921092|ref|NM—017662.3|[18921092]

[0811] 191: NM—016148 Homo sapiens SH3 and multiple ankyrin repeat domains 1 (SHANK1), mRNA gi|11968151|ref|NM—016148.1|[11968151]

[0812] 193: NM—017729 Homo sapiens epidermal growth factor receptor pathway substrate 8 related protein 1 (EPS8R1), mRNA gi|8923231|ref|NM—017729.1|[8923231]

[0813] 195: M13824 Homo sapiens T cell receptor gamma chain variable region (TCRG) gene, partial cds gi|339169|gb|M13824.1|HUMTCGXL[339169]

[0814] 196: M12960 Homo sapiens T-cell receptor gamma-chain J1, partial cds gi|339144|gb|M12960.1|HUMTCGJB[339144]

[0815] 197: M13823 Homo sapiens T cell receptor gamma chain (TCRG) gene, partial cds gi|292736|gb|M13823.1|HUMTCGXK[292736]

[0816] 198: L12398 Homo sapiens dopamine receptor D4 (DRD4) mRNA, complete cds gi|291945|gb|L12398.1|HUMD4C[291945]

[0817] 199: M86383 Homo sapiens nicotinic acetylcholine receptor alpha 3 subunit precursor, mRNA,complete cds gi|177897|gb|M86383.1|HUMA3NARSP[177897]

[0818] 202: NM—012245 Homo sapiens SKI-interacting protein (SNW1), mRNA gi|18860912|ref|NM—012245.2|[18860912]

[0819] 203: NM—006750 Homo sapiens syntrophin, beta 2 (dystrophin-associated protein A1, 59kD, basiccomponent 2) (SNTB2), transcript variant 1, mRNA gi|18860911|ref|NM—006750.2|[18860911]

[0820] 204: NM—130845 Homo sapiens syntrophin, beta 2 (dystrophin-associated protein A1, 59kD, basic component 2) (SNTB2), transcript variant 2, mRNA gi|18860909|ref|NM—130845.1|[18860909]

[0821] 205: NM—002846 Homo sapiens protein tyrosine phosphatase, receptor type, N (PTPRN), mRNA gi|18860905|ref|NM—002846.2|[18860905]

[0822] 206: NM—002845 Homo sapiens protein tyrosine phosphatase, receptor type, M (PTPRM), mRNA gi|18860903|ref|NM—002845.2|[18860903]

[0823] 207: NM—002844 Homo sapiens protein tyrosine phosphatase, receptor type, K (PTPRK), mRNA gi|18860901|ref|NM—002844.2|[18860901]

[0824] 208: NM—002843 Homo sapiens protein tyrosine phosphatase, receptor type, J (PTPRJ), mRNA gi|18860899|ref|NM—002843.2|[18860899]

[0825] 209: NM—002841 Homo sapiens protein tyrosine phosphatase, receptor type, G (PTPRG), mRNA gi|18860897|ref|NM—002841.2|[18860897]

[0826] 210: NM—130440 Homo sapiens protein tyrosine phosphatase, receptor type, F (PTPRF), transcript variant 2, mRNA gi|18860895|ref|NM—130440.1|[18860895]

[0827] 211: NM—130393 Homo sapiens protein tyrosine phosphatase, receptor type, D (PTPRD), transcript variant 4, mRNA gi|18860893|ref|NM—130393.1|[18860893]

[0828] 212: NM—130392 Homo sapiens protein tyrosine phosphatase, receptor type, D (PTPRD), transcript variant 3, mRNA gi|18860891|ref|NM—130392.1|[18860891]

[0829] 213: NM—130391 Homo sapiens protein tyrosine phosphatase, receptor type, D (PTPRD), transcript variant 2, mRNA gi|18860889|ref|NM—130391.1|[18860889]

[0830] 214: NM—003682 Homo sapiens MAP-kinase activating death domain (MADD), transcript variant 4,mRNA gi|18860876|ref|NM—003682.2|[18860876]

[0831] 215: NM—130476 Homo sapiens MAP-kinase activating death domain (MADD), transcript variant 8, mRNA gi|18860874|ref|NM—130476.1|[18860874]

[0832] 216: NM—130475 Homo sapiens MAP-kinase activating death domain (MADD), transcript variant 7, mRNA gi|18860872|ref|NM—130475.1|[18860872]

[0833] 217: NM—002840 Homo sapiens protein tyrosine phosphatase, receptor type, F (PTPRF), transcript variant 1, mRNA gi|18860871|ref|NM—002840.2|[18860871]

[0834] 218: NM—130474 Homo sapiens MAP-kinase activating death domain (MADD), transcript variant 6,mRNA gi|18860869|ref|NM—130474.1|[18860869]

[0835] 219: NM—130473 Homo sapiens MAP-kinase activating death domain (MADD), transcript variant 5,mRNA gi|18860867|ref|NM—130473.1|[18860867]

[0836] 220: NM—130472 Homo sapiens MAP-kinase activating death domain (MADD), transcript variant 3,mRNA gi|18860865|ref|NM—130472.1|[18860865]

[0837] 221: NM—130471 Homo sapiens MAP-kinase activating death domain (MADD), transcript variant 2,mRNA gi|18860863|ref|NM—130471.1|[18860863]

[0838] 222: NM—130470 Homo sapiens MAP-kinase activating death domain (MADD), transcript variant 1, mRNA gi|18860861|ref|NM—130470.1|[18860861]

[0839] 223: NM—006504 Homo sapiens protein tyrosine phosphatase, receptor type, E (PTPRE), transcript variant 1, mRNA gi|18860860|ref|NM—006504.2|[18860860]

[0840] 224: NM—130435 Homo sapiens protein tyrosine phosphatase, receptor type, E (PTPRE), transcript variant 2, mRNA gi|18860858|ref|NM—130435.1|[18860858]

[0841] 225: AJ431177 Homo sapiens mRNA for WIRE protein gi|18857713|emb|AJ431177.1|HSA431177[18857713]

[0842] 226: NM—006474 Homo sapiens lung type-I cell membrane-associated glycoprotein (T1A-2), mRNA gi|18767663|ref|NM—006474.2|[18767663]

[0843] 228: NM—006794 Homo sapiens G protein-coupled receptor 75 (GPR75), mRNA gi|5803024|ref|NM—006794.1|[5803024]

[0844] 229: NM—002842 Homo sapiens protein tyrosine phosphatase, receptor type, H (PTPRH), mRNA gi|4506312|ref|NM—002842.1|[4506312]

[0845] 230: NM—002839 Homo sapiens protein tyrosine phosphatase, receptor type, D (PTPRD), transcript variant 1, mRNA gi|4506308|ref|NM—002839.1|[4506308]

[0846] 231: BC024145 Homo sapiens, TNF receptor-associated factor 1, clone MGC:10353 IMAGE:3832475,mRNA, complete cds gi|18848176|gb|BC024145.1|[18848176]

[0847] 232: AF469756 Homo sapiens clone S9 interleukin-1 receptor type I (IL1R1) gene, partial sequence gi|18846656|gb|AF469756.1|[18846656]

[0848] 233: AF469755 Homo sapiens clone S8 interleukin-1 receptor type I (IL1R1) gene, partial sequence gi|18846655|gb|AF469755.1|[18846655]

[0849] 234: AF469754 Homo sapiens clone S7 interleukin-1 receptor type I (IL1R1) gene, partial sequence gi|18845036|gb|AF469754.1|[18845036]

[0850] 237: AF416711 Homo sapiens Fc-gamma receptor IIc5 mRNA, partial cds gi|18765992|gb|AF416711.1|[18765992]

[0851] 238: NM—023068 Homo sapiens sialoadhesin (SN), mRNA gi|18765743|ref|NM—023068.2|[18765743]

[0852] 239: NM—004782 Homo sapiens synaptosomal-associated protein, 29kD (SNAP29), mRNA gi|18765736|ref|NM—004782.2|[18765736]

[0853] 240: NM—130798 Homo sapiens synaptosomal-associated protein, 23kD (SNAP23), transcript variant 2, mRNA gi|18765730|ref|NM—130798.1|[18765730]

[0854] 241: NM—003825 Homo sapiens synaptosomal-associated protein, 23kD (SNAP23), transcript variant 1, mRNA gi|18765728|ref|NM—003825.2|[18765728]

[0855] 245: AF439409 Homo sapiens G-protein-coupled receptor kinase 7 (GRK7) mRNA, GRK7-S allele,complete cds gi|17933258|gb|AF439409.1|[17933258]

[0856] 246: NM—032211 Homo sapiens lysyl oxidase-like 4 (LOXL4), mRNA gi|16933522|ref|NM—032211.4|[16933522]

[0857] 247: AF411122 Homo sapiens importin 4 mRNA, complete cds gi|18700634|gb|AF411122.1|[18700634]

[0858] 289: NM—130441 Homo sapiens C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 11 (CLECSF11), mRNA gi|18466805|ref|NM—130441.1|[18466805]

[0859] 290: NM—030876 Homo sapiens olfactory receptor, family 5, subfamily V, member 1 (OR5V1), mRNA gi|14495550|ref|NM—030876.2|[14495550]

[0860] 291: NM—032732 Homo sapiens hypothetical protein MGC10763 (IL17RL), mRNA gi|14249349|ref|NM—032732.1|[14249349]

[0861] 292: NM—030959 Homo sapiens olfactory receptor, family 12, subfamily D, member 3 (OR12D3), mRNA gi|13624334|ref|NM—030959.1|[13624334]

[0862] 294: NM—018844 Homo sapiens B-cell receptor-associated protein BAP29 (BAP29), mRNA gi|9994198|ref|NM—018844.1|[9994198]

[0863] 295: NM—002825 Homo sapiens pleiotrophin (heparin binding growth factor 8, neurite growth-promoting factor 1) (PTN), mRNA gi|18656935|ref|NM—002825.2|[18656935]

[0864] 299: NM—016372 Homo sapiens seven transmembrane domain orphan receptor (TPRA40), mRNA gi|7705964|ref|NM—016372.1|[7705964]

[0865] 300: NM—014288 Homo sapiens integrin beta 3 binding protein (beta3-endonexin) (ITGB3BP), mRNA gi|7657205|ref|NM—014288.1|[7657205]

[0866] 301: L43588 Homo sapiens T cell antigen receptor mRNA, partial cds gi|18654191|gb|L43588.1|HUMTCARF[18654191]

[0867] 318: U77589 Homo sapiens MHC class II HLA-DQ-alpha chain (HLA-DQA1) mRNA, HLA-DQA1*0104 allele, complete cds gi|1916744|gb|U77589.1|HSU77589[1916744]

[0868] 319: AF410465 Homo sapiens importin 9 mRNA, complete cds gi|15529702|gb|AF410465.1|[15529702]

[0869] 320: AF332759 Homo sapiens partially duplicated CHRNA7 gene, hybrid intron A/4 and partial exon 5 gi|13345792|gb|AF332759.1|[13345792]

[0870] 321: AF332758 Homo sapiens alpha-7 nicotinic cholinergic receptor subunit (CHRNA7) gene, partial intron 4 and partial cds gi|13345790|gb|AF332758.1|[13345790]

[0871] 322: NM—003744 Homo sapiens numb homolog (Drosophila) (NUMB), mRNA gi|18644887|ref|NM—003744.2|[18644887]

[0872] 323: NM—003681 Homo sapiens pyridoxal (pyridoxine, vitamin B6) kinase (PDXK), mRNA gi|18644884|ref|NM—003681.2|[18644884]

[0873] 324: NM—080706 Homo sapiens transient receptor potential cation channel, subfamily V, member 1(TRPV1), transcript variant 3, mRNA gi|18375670|ref|NM—080706.1|[18375670]

[0874] 325: NM—080705 Homo sapiens transient receptor potential cation channel, subfamily V, member 1(TRPV1), transcript variant 4, mRNA gi|18375668|ref|NM—080705.1|[18375668]

[0875] 326: NM—080704 Homo sapiens transient receptor potential cation channel, subfamily V, member 1(TRPV1), transcript variant 1, mRNA gi|18375666|ref|NM—080704.1|[18375666]

[0876] 327: NM—018727 Homo sapiens transient receptor potential cation channel, subfamily V, member 1(TRPV1), transcript variant 2, mRNA gi|18375664|ref|NM—018727.3|[18375664]

[0877] 328: NM—080819 Homo sapiens G protein-coupled receptor 78 (GPR78), mRNA gi|18201873|ref|NM—080819.1|[18201873]

[0878] 329: NM—080738 Homo sapiens EDAR-associated death domain (EDARADD), mRNA gi|18152768|ref|NM—080738.1|[18152768]

[0879] 330: NM—080491 Homo sapiens GRB2-associated binding protein 2 (GAB2), transcript variant 1,mRNA gi|18105041|ref|NM—080491.1|[18105041]

[0880] 331: NM—012296 Homo sapiens GRB2-associated binding protein 2 (GAB2), transcript variant 2,mRNA gi|18105040|ref|NM—012296.2|[18105040]

[0881] 332: NM—032027 Homo sapiens beta-amyloid binding protein precursor (BBP), mRNA gi|17738309|ref|NM—032027.2|[17738309]

[0882] 333: NM—057159 Homo sapiens endothelial differentiation, lysophosphatidic acid G-protein-coupled receptor, 2 (EDG2), transcript variant 2, mRNA gi|16950637|ref|NM—057159.1|[16950637]

[0883] 334: NM—001401 Homo sapiens endothelial differentiation, lysophosphatidic acid G-protein-coupled receptor, 2 (EDG2), transcript variant 1, mRNA gi|16950635|ref|NM—001401.2|[16950635]

[0884] 335: NM—007070 Homo sapiens FKBP-associated protein (FAP48), transcript variant 2, mRNA gi|16933538|ref|NM—007070.2|[16933538]

[0885] 336: NM—053274 Homo sapiens FKBP-associated protein (FAP48), transcript variant 1, mRNA gi|16933536|ref|NM—053274.1|[16933536]

[0886] 337: NM—003726 Homo sapiens src family associated phosphoprotein 1 (SCAP1), mRNA gi|16753209|ref|NM—003726.2|[16753209]

[0887] 338: NM—033632 Homo sapiens F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)(FBXW7), transcript variant 1, mRNA gi|16117780|ref|NM—033632.1|[16117780]

[0888] 339: NM—018315 Homo sapiens F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)(FBXW7), transcript variant 2, mRNA gi|16117778|ref|NM—018315.2|[16117778]

[0889] 340: NM—021203 Homo sapiens APMCF1 protein (APMCF1), mRNA gi|14917112|ref|NM—021203.2|[14917112]

[0890] 341: NM—002927 Homo sapiens regulator of G-protein signalling 13 (RGS13), mRNA gi|14589857|ref|NM—002927.2|[14589857]

[0891] 344: NM—020167 Homo sapiens neuromedin U receptor 2 (NMU2R), mRNA gi|9910461|ref|NM—020167.1|[9910461]

[0892] 346: AF190052 Homo sapiens interleukin 1 receptor type I (IL1R1) gene, exon 1C sequence gi|9719300|gb|AF190052.1|[9719300]

[0893] 347: NM—018965 Homo sapiens triggering receptor expressed on myeloid cells 2 (TREM2), mRNA gi|9507202|ref|NM—018965.1|[9507202]

[0894] 348: NM—018643 Homo sapiens triggering receptor expressed on myeloid cells 1 (TREM1), mRNA gi|8924261|ref|NM—018643.1|[8924261]

[0895] 349: NM—018647 Homo sapiens tumor necrosis factor receptor superfamily, member 19 (TNFRSF19),mRNA gi|8924251|ref|NM—018647.1|[8924251]

[0896] 350: NM—018695 Homo sapiens erbb2 interacting protein (ERBB2IP), mRNA gi|8923908|ref|NM—018695.1|[8923908]

[0897] 351: NM—017636 Homo sapiens transient receptor potential cation channel, subfamily M, member 4(TRPM4), mRNA gi|8923048|ref|NM—017636.1|[8923048]

[0898] 353: NM—016559 Homo sapiens PXR2b protein (PXR2b), mRNA gi|7706670|ref|NM—016559.1|[7706670]

[0899] 354: NM—016382 Homo sapiens natural killer cell receptor 2B4 (CD244), mRNA gi|7706528|ref|NM—016382.1|[7706528]

[0900] 357: NM—015986 Homo sapiens cytokine receptor-like factor 3 (CRLF3), mRNA gi|7705331|ref|NM—015986.1|[7705331]

[0901] 358: NM—014815 Homo sapiens KIAA0130 gene product (KIAA0130), mRNA gi|7661929|ref|NM—014815.1|[7661929]

[0902] 359: NM—014053 Homo sapiens FLVCR protein (FLVCR), mRNA gi|7661707|ref|NM—014053.1|[7661707]

[0903] 360: NM—014478 Homo sapiens calcitonin gene-related peptide-receptor component protein (CGRP-RCP), mRNA gi|7656976|ref|NM—014478.1|[7656976]

[0904] 361: NM—012470 Homo sapiens transportin-SR (TRN-SR), mRNA gi|6912733|ref|NM—012470.1|[6912733]

[0905] 362: NM—007357 Homo sapiens low density lipoprotein receptor defect C complementing (LDLC),mRNA gi|6678675|ref|NM—007357.1|[6678675]

[0906] 366: NM—005162 Homo sapiens angiotensin receptor-like 2 (AGTRL2), mRNA gi|6031157|ref|NM—005162.2|[6031157]

[0907] 367: NM—005501 Homo sapiens integrin, alpha 3 (antigen CD49C, alpha 3 subunit of VLA-3 receptor) (ITGA3), transcript variant b, mRNA gi|6006010|ref|NM—005501.1|[6006010]

[0908] 370: NM—007053 Homo sapiens natural killer cell receptor, immunoglobulin superfamily member(BY55), mRNA gi|5901909|ref|NM—007053.1|[5901909]

[0909] 371: NM—006653 Homo sapiens suc1-associated neurotrophic factor target 2 (FGFR signalling adaptor) (SNT-2), mRNA gi|5730058|ref|NM—006653.1|[5730058]

[0910] 374: NM—005761 Homo sapiens plexin C1 (PLXNC1), mRNA gi|5032222|ref|NM—005761.1|[5032222]

[0911] 375: NM—005866 Homo sapiens sigma receptor (SR31747 binding protein 1) (SR-BP1), mRNA gi|5032116|ref|NM—005866.1|[5032116]

[0912] 377: NM—005506 Homo sapiens CD36 antigen (collagen type I receptor, thrombospondin receptor)-like 2 (lysosomal integral membrane protein II) (CD36L2), mRNA gi|5031630|ref|NM—005506.1|[5031630]

[0913] 379: NM—004799 Homo sapiens MAD, mothers against decapentaplegic homolog (Drosophila)interacting protein, receptor activation anchor (MADHIP), transcript variant 3,mRNA gi|4759059|ref|NM—004799.1|[4759059]

[0914] 380: NM—004292 Homo sapiens ras inhibitor (RIN1), mRNA gi|4759039|ref|NM—004292.1|[4759039]

[0915] 381: NM—004828 Homo sapiens lymphocyte antigen 95 (activating NK-receptor; NK-p44) (LY95), mRNA gi|4758693|ref|NM—004828.1|[4758693]

[0916] 382: NM—004767 Homo sapiens endothelin type b receptor-like protein 2 (ET(B)R-LP-2), mRNA gi|4758309|ref|NM—004767.1|[4758309]

[0917] 383: NM—004440 Homo sapiens EphA7 (EPHA7), mRNA gi|475828|ref|NM—004440.1|[4758281]

[0918] 384: NM—003999 Homo sapiens oncostatin M receptor (OSMR), mRNA gi|4557039|ref|NM—003999.1|[4557039]

[0919] 386: NM—003305 Homo sapiens transient receptor potential cation channel, subfamily C, member 3(TRPC3), mRNA gi|4507686|ref|NM—003305.1|[4507686]

[0920] 388: NM—003626 Homo sapiens protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF),interacting protein (liprin), alpha 1 (PPFIA1), mRNA gi|4505982|ref|NM—003626.1|[4505982]

[0921] 389: NM—003876 Homo sapiens putative receptor protein (PMI), mRNA gi|4505900|ref|NM—003876.1|[4505900]

[0922] 390: NM—003559 Homo sapiens phosphatidylinositol-4-phosphate 5-kinase, type II, beta (PIP5K2B),mRNA gi|4505818|ref|NM—003559.1|[4505818]

[0923] 391: NM—003629 Homo sapiens phosphoinositide-3-kinase, regulatory subunit, polypeptide 3 (p55,gamma) (PIK3R3), mRNA gi|4505804|ref|NM—003629.1|[4505804]

[0924] 392: NM—003676 Homo sapiens degenerative spermatocyte homolog, lipid desaturase (Drosophila)(DEGS), mRNA gi|4505192|ref|NM—003676.1|[4505192]

[0925] 393: NM—002270 Homo sapiens karyopherin (importin) beta 2 (KPNB2), mRNA gi|4504906|ref|NM—002270.1|[4504906]

[0926] 394: NM—002204 Homo sapiens integrin, alpha 3 (antigen CD49C, alpha 3 subunit of VLA-3 receptor) (ITGA3), transcript variant a, mRNA gi|4504746|ref|NM—002204.1|[4504746]

[0927] 395: NM—001560 Homo sapiens interleukin 13 receptor, alpha 1 (IL13RA1), mRNA gi|4504646|ref|NM—001560.1|[4504646]

[0928] 396: NM—000842 Homo sapiens glutamate receptor, metabotropic 5 (GRM5), mRNA gi|4504142|ref|NM—000842.1|[4504142]

[0929] 397: NM—001883 Homo sapiens corticotropin releasing hormone receptor 2 (CRHR2), mRNA gi|4503044|ref|NM—001883.1|[4503044]

[0930] 398: NM—001873 Homo sapiens carboxypeptidase E (CPE), mRNA gi|4503008|ref|NM—001873.1|[4503008]

[0931] 400: L29395 Homo sapiens v-erbB-related protein gene, partial cds gi|459807|gb|L29395.1|HUMERBB[459807]

[0932] 401: L08584 Homo sapiens T cell receptor beta chain (TCRB) mRNA, partial cds gi|307497|gb|L08584.1|HUMTCVB7A[307497]

[0933] 403: NM—015638 Homo sapiens chromosome 20 open reading frame 188 (C20orf188), mRNA gi|18158415|ref|NM—015638.1|[18158415]

[0934] 405: NM—054032 Homo sapiens G protein-coupled receptor MRGX4 (MRGX4), mRNA gi|16876454|ref|NM—054032.1|[16876454]

[0935] 406: NM—054031 Homo sapiens G protein-coupled receptor MRGX3 (MRGX3), mRNA gi|16876452|ref|NM—054031.1|[16876452]

[0936] 407: NM—054030 Homo sapiens G protein-coupled receptor MRGX2 (MRGX2), mRNA gi|16876450|ref|NM—054030.1|[16876450]

[0937] 408: NM—052931 Homo sapiens activating NK receptor (KALI), mRNA gi|16418406|ref|NM—052931.1|[16418406]

[0938] 409: NM—032871 Homo sapiens tumor necrosis factor receptor superfamily, member 19-like(TNFRSF19L), mRNA gi|14249611|ref|NM—032871.1|[14249611]

[0939] 410: NM—032553 Homo sapiens putative purinergic receptor (FKSG79), mRNA gi|14211848|ref|NM—032553.1|[14211848]

[0940] 411: NM—025179 Homo sapiens plexin A2 (PLXNA2), mRNA gi|13378152|ref|NM—025179.1|[13378152]

[0941] 413: NM—021249 Homo sapiens sorting nexin 6 (SNX6), mRNA gi|13027619|ref|NM—021249.1|[13027619]

[0942] 414: NM—014045 Homo sapiens DKFZP564C1940 protein (DKFZP564C1940), mRNA gi|13027587|ref|NM—014045.1|[13027587]

[0943] 415: NM—080923 Homo sapiens protein tyrosine phosphatase, receptor type, C (PTPRC), transcript variant 4, mRNA gi|18641365|ref|NM—080923.1|[18641365]

[0944] 416: NM—080922 Homo sapiens protein tyrosine phosphatase, receptor type, C (PTPRC), transcript variant 3, mRNA gi|18641363|ref|NM—080922.1|[18641363]

[0945] 417: NM—080921 Homo sapiens protein tyrosine phosphatase, receptor type, C (PTPRC), transcript variant 2, mRNA gi|18641361|ref|NM—080921.1|[18641361]

[0946] 418: NM—130386 Homo sapiens collectin sub-family member 12 (COLEC12), transcript variant I,mRNA gi|18641359|ref|NM—130386.1|[18641359]

[0947] 419: NM—030781 Homo sapiens collectin sub-family member 12 (COLEC12), transcript variant II, mRNA gi|18641357|ref|NM—030781.2|[18641357]

[0948] 420: NM—002838 Homo sapiens protein tyrosine phosphatase, receptor type, C (PTPRC), transcript variant 1, mRNA gi|18641346|ref|NM—002838.2|[18641346]

[0949] 421: NM—130770 Homo sapiens 5-hydroxytryptamine receptor 3 subunit C (HTR3C), mRNA gi|18640739|ref|NM—130770.1|[18640739]

[0950] 430: BD010218 Novel hemopoietin receptor protein, NR12 gi|18638591|dbj|BD010218.1|[18638591]

[0951] 431: BD010217 Novel hemopoietin receptor protein, NR12 gi|18638590|dbj|BD010217.1|[18638590]

[0952] 432: BD010216 Novel hemopoietin receptor protein, NR12 gi|18638589|dbj|BD010216.1|[18638589]

[0953] 433: BD010215 Novel hemopoietin receptor protein, NR12 gi|18638588|dbj|BD010215.1|[18638588]

[0954] 434: BD010214 Novel hemopoietin receptor protein, NR12 gi|18638587|dbj|BD010214.1|[18638587]

[0955] 435: BD010125 Peptide leukotriene receptor gi|18638498|dbj|BD010125.1|[18638498]

[0956] 436: BD010114 Novel receptor and gene encoding the same gi|18638487|dbj|BD010114.1|[18638487]

[0957] 437: BD010057 Novel G protein coupled receptor protein and its DNA gi|18638430|dbj|BD010057.1|[18638430]

[0958] 438: BD010056 Novel G protein coupled receptor protein and its DNA gi|18638429|dbj|BD010056.1|[18638429]

[0959] 439: BD010055 Novel G protein coupled receptor protein and its DNA gi|18638428|dbj|BD010055.1|[18638428]

[0960] 440: BD010054 Novel G protein coupled receptor protein and its DNA gi|18638427|dbj|BD010054.1|[18638427]

[0961] 441: BD010053 Novel G protein coupled receptor protein and its DNA gi|18638426|dbj|BD010053.1|[18638426]

[0962] 442: BD010052 Novel G protein coupled receptor protein and its DNA gi|18638425|dbj|BD010052.1|[18638425]

[0963] 443: BD010051 Novel G protein coupled receptor protein and its DNA gi|18638424|dbj|BD010051.1|[18638424]

[0964] 444: BD010050 Novel G protein coupled receptor protein and its DNA gi|18638423|dbj|BD010050.1|[18638423]

[0965] 445: BD010049 Novel G protein coupled receptor protein and its DNA gi|18638422|dbj|BD010049.1|[18638422]

[0966] 446: BD010046 Novel G protein coupled receptor protein and its DNA gi|18638419|dbj|BD010046.1|[18638419]

[0967] 447: BD010035 Novel G protein coupled receptor protein and its DNA gi|18638408|dbj|BD010035.1|[18638408]

[0968] 448: BD010034 Novel G protein coupled receptor protein and its DNA gi|18638407|dbj|BD010034.1|[18638407]

[0969] 449: BD010028 Novel G protein coupled receptor protein and its DNA gi|18638401|dbj|BD010028.1|[18638401]

[0970] 450: BD010022 Novel G protein coupled receptor protein and its DNA gi|18638395|dbj|BD010022.1|[18638395]

[0971] 451: BD009263 GABAA receptor subunit epsilon-related protein gi|18637636|dbj|BD009263.1|[18637636]

[0972] 452: BD009262 GABAA receptor subunit epsilon-related protein gi|18637635|dbj|BD009262.1|[18637635]

[0973] 453: BD009261 GABAA receptor subunit epsilon-related protein gi|18637634|dbj|BD009261.1|[18637634]

[0974] 454: BD009260 GABAA receptor subunit epsilon-related protein gi|18637633|dbj|BD009260.1|[18637633]

[0975] 455: BD006753 Human G protein chemokine receptor HDGNR10 gi|18635124|dbj|BD006753.1|[18635124]

[0976] 460: E51301 Novel G protein-coupled receptor protein and gene of said G protein-coupled receptor protein gi|18633577|dbj|E51301.1|[18633577]

[0977] 461: E51300 Novel G protein-coupled receptor protein and gene of said G protein-coupled receptor protein gi|18633576|dbj|E51300.1|[18633576]

[0978] 462: E51299 Novel G protein-coupled receptor protein and gene of said G protein-coupled receptor protein gi|18633575|dbj|E51299.1|[18633575]

[0979] 463: E51298 Novel G protein-coupled receptor protein and gene of said G protein-coupled receptor protein gi|18633574|dbj|E51298.1|[18633574]

[0980] 464: E51297 Novel G protein-coupled receptor protein and gene of said G protein-coupled receptor protein gi|18633573|dbj|E51297.1|[18633573]

[0981] 465: E51296 Novel G protein-coupled receptor protein and gene of said G protein-coupled receptor protein gi|18633572|dbj|E51296.1|[18633572]

[0982] 466: E50838 Novel G protein-coupled receptor gi|18633543|dbj|E50838.1|[18633543]

[0983] 467: E50837 Novel G protein-coupled receptor gi|18633542|dbj|E50837.1|[18633542]

[0984] 468: E50836 Novel G protein-coupled receptor gi|18633541|dbj|E50836.1|[18633541]

[0985] 469: E50835 Novel G protein-coupled receptor gi|18633540|dbj|E50835.1|[18633540]

[0986] 470: E50834 Novel G protein-coupled receptor gi|18633539|dbj|E50834.1|[18633539]

[0987] 471: E50833 Novel G protein-coupled receptor gi|18633538|dbj|E50833.1|[18633538]

[0988] 490: BD003056 Novel G protein-coupled receptor protein and DNA thereof gi|18631017|dbj|BD003056.1|[18631017]

[0989] 491: E55122 Novel G protein-coupled receptor and the G protein-coupled receptor gene gi|18629753|dbj|E55122.1|[18629753]

[0990] 492: E55121 Novel G protein-coupled receptor and the G protein-coupled receptor gene gi|18629752|dbj|E55121.1|[18629752]

[0991] 493: E55120 Novel G protein-coupled receptor and the G protein-coupled receptor gene gi|18629751|dbj|E55120.1|[18629751]

[0992] 494: E55119 Novel G protein-coupled receptor and the G protein-coupled receptor gene gi|18629750|dbj|E55119.1|[18629750]

[0993] 495: E55118 Novel G protein-coupled receptor and the G protein-coupled receptor gene gi|18629749|dbj|E55118.1|[18629749]

[0994] 496: E55117 Novel G protein-coupled receptor and the G protein-coupled receptor gene gi|18629748|dbj|E55117.1|[18629748]

[0995] 497: E49128 Novel G protein-conjugated receptor protein gi|18629265|dbj|E49128.1|[18629265]

[0996] 498: E49127 Novel G protein-conjugated receptor protein gi|18629264|dbj|E49127.1|[18629264]

[0997] 499: E49126 Novel G protein-conjugated receptor protein gi|18629263|dbj|E49126.1|[18629263]

[0998] 500: E49125 Novel G protein-conjugated receptor protein gi|18629262|dbj|E49125.1|[18629262]

[0999] 501: D21847 Human mRNA for T cell receptor alpha chain TcHST2Va7, V segment, J segment and C region gi|431140|dbj|D21847.1|HUMTCHST24[431140]

[1000] 502: D21846 Human mRNA for T cell receptor beta chain HPBL3xVb20, V segment, D segment, J segment and C region gi|431139|dbj|D21846.1|HUMHPBL3X3[431139]

[1001] 503: D21845 Human mRNA for T cell receptor alpha chain HPBL3xVa7, V segment, J segment and C region gi|431138|dbj|D21845.1|HUMHPBL3X2[431138]

[1002] 504: D21844 Human mRNA for T cell receptor alpha chain HPBL(-)Va7, V segment, J segment and C region gi|431137|dbj|D21844.1|HUMCHPBL1[431137]

[1003] 505: D13083 Human mRNA for T-cell receptor beta-chain V region, partial cds, clone WBDM19C gi|407766|dbj|D13083.1|HUMVB73B[407766]

[1004] 506: D13085 Human mRNA for T-cell receptor beta-chain V region, partial cds, clone WBDM28A gi|407764|dbj|D13085.1|HUMVB69B[407764]

[1005] 507: D13088 Human TCRBV2.3a mRNA for T-cell receptor beta-chain V region, partial cds gi|407762|dbj|D13088.1|HUMVB23A[407762]

[1006] 508: D13087 Human TCRBV2.1c mRNA for T-cell receptor beta-chain V region, partial cds gi|407760|dbj|D13087.1|HUMVB21C[407760]

[1007] 509: D13082 Human mRNA for T-cell receptor beta-chain V region, partial cds, clone WBDM17A gi|407758|dbj|D13082.1|HUMVB21AA[407758]

[1008] 510: D13086 Human TCRBV20.1a mRNA for T-cell receptor beta-chain V region, partial cds gi|407756|dbj|D13086.1|HUMVB201A[407756]

[1009] 511: D13084 Human TCRBV12.5a mRNA for T-cell receptor beta-chain V region, partial cds gi|407754|dbj|D13084.1|HUMVB125A[407754]

[1010] 512: D13073 Human TCRAVN1 mRNA for T-cell receptor alpha-chain V region, partial cds gi|407752|dbj|D13073.1|HUMVAN1[407752]

[1011] 513: D13079 Human TCRAV8.1a mRNA for T-cell receptor alpha-chain V region, partial cds gi|407750|dbj|D13079.1|HUMVA81A[407750]

[1012] 514: D13069 Human TCRAV5.1a mRNA for T-cell receptor alpha-chain V region, partial cds gi|407748|dbj|D13069.1|HUMVA51A[407748]

[1013] 515: D13078 Human TCRAV2.5a mRNA for T-cell receptor alpha-chain V region, partial cds gi|407746|dbj|D13078.1|HUMVA25A[407746]

[1014] 516: D13072 Human mRNA for T-cell receptor alpha-chain V-J-C, partial cds, clone WADM13D gi|407744|dbj|D13072.1|HUMVA221AJ[407744]

[1015] 517: D13076 Human TCRAV21.1a mRNA for T-cell receptor alpha-chain V region, partial cds gi|407742|dbj|D13076.1|HUMVA211A[407742]

[1016] 518: D13071 Human mRNA for T-cell receptor alpha-chain V region, partial cds, clone WADM11H gi|407740|dbj|D13071.1|HUMVA171A[407740]

[1017] 519: D13074 Human TCRAV14.1a mRNA for T-cell receptor alpha-chain V region, partial cds gi|407738|dbj|D13074.1|HUMVA141A[407738]

[1018] 520: D13070 Human TCRAV1.3a mRNA for T-cell receptor alpha-chain V region, partial cds gi|407736|dbj|D13070.1|HUMVA13A[407736]

[1019] 521: D13077 Human TCRAV1.2a mRNA for T-cell receptor alpha-chain V region, partial cds gi|407734|dbj|D13077.1|HUMVA12A[407734]

[1020] 522: D13075 Human TCRAV10.1a mRNA for T-cell receptor alpha-chain V region, partial cds gi|407732|dbj|D13075.1|HUMVA101A[407732]

[1021] 523: D13081 Human mRNA for T-cell receptor alpha-chain J segment, partial cds, clone WADM36G gi|407730|dbj|D13081.1|HUMJAAC17[407730]

[1022] 524: D13080 Human mRNA for T-cell receptor alpha-chain J segment, partial cds, clone WADM36A gi|407728|dbj|D13080.1|HUMJAAB19[407728]

[1023] 525: D16584 Homo sapiens mRNA for T cell receptor beta chain, N-terminal gi|391732|dbj|D16584.1|HUMTCRB17[391732]

[1024] 526: D16586 Homo sapiens mRNA for T cell receptor alpha chain, N-terminal gi|391731|dbj|D16586.1|HUMTCRA17[391731]

[1025] 527: D16585 Homo sapiens mRNA for T cell receptor alpha chain, N-terminal gi|391730|dbj|D16585.1|HUMTCRA32[391730]

[1026] 528: NM—003268 Homo sapiens toll-like receptor 5 (TLR5), mRNA gi|19718736|ref|NM—003268.3|[19718736]

[1027] 529: NM—003265 Homo sapiens toll-like receptor 3 (TLR3), mRNA gi|19718735|ref|NM—003265.2|[19718735]

[1028] 530: NM—003264 Homo sapiens toll-like receptor 2 (TLR2), mRNA gi|19718733|ref|NM—003264.2|[19718733]

[1029] 531: NM—003263 Homo sapiens toll-like receptor 1 (TLR1), mRNA gi|19718732|ref|NM—003263.2|[19718732]

[1030] 534: NM—020350 Homo sapiens angiotensin II, type I receptor-associated protein (ATRAP), mRNA gi|19705427|ref|NM—020350.2|[19705427]

[1031] 535: AY081843 Homo sapiens GnRH receptor II 5TM mRNA, complete cds gi|19697895|gb|AY081843.1|[19697895]

[1032] 539: NM—016511 Homo sapiens C-type lectin-like receptor-1 (LOC51267), mRNA gi|7706062|ref|NM—016511.1|[7706062]

[1033] 540: NM—016509 Homo sapiens C-type lectin-like receptor-2 (LOC51266), mRNA gi|7706060|ref|NM—016509.1|[7706060]

[1034] 546: AL713657 Homo sapiens mRNA; cDNA DKFZp547G1215 (from clone DKFZp547G1215) gi|19584339|emb|AL713657.1|HSM802985[19584339]

[1035] 547: AJ438313 Homo sapiens partial mRNA for KIT protein gi|19571549|emb|AJ438313.1|HSA438313[19571549]

[1036] 575: AF390036 Homo sapiens FCRLd mRNA, partial cds gi|16611715|gb|AF390036.1|[16611715]

[1037] 576: AF329495 Homo sapiens FCRLe mRNA, complete cds gi|16506270|gb|AF329495.1|[16506270]

[1038] 577: AF329494 Homo sapiens FCRLc1 mRNA, complete cds gi|16506268|gb|AF329494.1|[16506268]

[1039] 578: AF329493 Homo sapiens FCRLb mRNA, complete cds gi|16506266|gb|AF329493.1|[16506266]

[1040] 579: AF329491 Homo sapiens FCRLc2 mRNA, complete cds gi|16506262|gb|AF329491.1|[16506262]

[1041] 580: AF329489 Homo sapiens FCRLa mRNA, complete cds gi|16506258|gb|AF329489.1|[16506258]

[1042] 582: AB060695 Homo sapiens TLR5 mRNA for Toll-like receptor 5, complete cds gi|13810567|dbj|AB060695.1|[13810567]

[1043] 583: AJ276429 Homo sapiens mRNA for 19A protein gi|12619176|emb|AJ276429.2|HSA276429[12619176]

[1044] 584: AL136801 Homo sapiens mRNA; cDNA DKFZp434K0220 (from clone DKFZp434K0220); complete cds gi|12053114|emb|AL136801.1|HSM801769[12053114]

[1045] 585: AL136652 Homo sapiens mRNA; cDNA DKFZp564O1762 (from clone DKFZp564O1762); complete cds gi|12052829|emb|AL136652.1|HSM801622[12052829]

[1046] 587: AB012911 Homo sapiens mRNA for Frizzled-6, complete cds gi|3062802|dbj|AB012911.1|[3062802]

[1047] 589: AY071862 Homo sapiens crinkled (CR) mRNA, complete cds gi|19568064|gb|AY071862.1|[19568064]

[1048] 596: NM—133169 Homo sapiens osteoclast-associated receptor (OSCAR), transcript variant 2, mRNA gi|19557667|ref|NM—133169.1|[19557667]

[1049] 597: NM—133168 Homo sapiens osteoclast-associated receptor (OSCAR), transcript variant 3, mRNA gi|19557663|ref|NM—133168.1|[19557663]

[1050] 598: NM—130771 Homo sapiens osteoclast-associated receptor (OSCAR), transcript variant 1, mRNA gi|19557659|ref|NM—130771.1|[19557659]

[1051] 599: AF426461 Homo sapiens FREB mRNA, complete cds gi|18056674|gb|AF426461.1|[18056674]

[1052] 600: AF428134 Homo sapiens T-cell receptor beta-chain (TCRVb13.1-Jb1.5) mRNA, partial cds gi|16566700|gb|AF428134.1|[16566700]

[1053] 601: AF428133 Homo sapiens T-cell receptor beta-chain (TCRVb13.1-Jb1.2) mRNA, partial cds gi|16566697|gb|AF428133.1|[16566697]

[1054] 602: AF428132 Homo sapiens T-cell receptor beta-chain (TCRVb8.1-Jb2.3) mRNA, partial cds gi|16566694|gb|AF428132.1|[16566694]

[1055] 603: AF428131 Homo sapiens T-cell receptor beta-chain (TCRVb8.2-Jb2.7) mRNA, partial cds gi|16566691|gb|AF428131.1|[16566691]

[1056] 604: AF428130 Homo sapiens T-cell receptor beta-chain (TCRVb8.1-Jb2.3) mRNA, partial cds gi|16566688|gb|AF428130.1|[16566688]

[1057] 605: AF428129 Homo sapiens T-cell receptor beta-chain (TCRVb7.1-Jb1.2) mRNA, partial cds gi|16566685|gb|AF428129.1|[16566685]

[1058] 606: AF428128 Homo sapiens T-cell receptor beta-chain (TCRVb7.2-Jb1.6) mRNA, partial cds gi|16566682|gb|AF428128.1|[16566682]

[1059] 607: AF428127 Homo sapiens T-cell receptor beta-chain (TCRVb7.1-Jb1.2) mRNA, partial cds gi|16566679|gb|AF428127.1|[16566679]

[1060] 608: AF428126 Homo sapiens T-cell receptor beta-chain (TCRVb7.2-Jb1.2) mRNA, partial cds gi|16566676|gb|AF428126.1|[16566676]

[1061] 609: AF428125 Homo sapiens T-cell receptor beta-chain (TCRVb7.1-Jb1.5) mRNA, partial cds gi|16566673|gb|AF428125.1|[16566673]

[1062] 611: AF242456 Homo sapiens interleukin 13 receptor alpha 1-binding protein-1 mRNA, complete cds gi|19548138|gb|AF242456.1|[19548138]

[1063] 616: S57283 Homo sapiens endothelin ET-B receptor mRNA, complete cds gi|298321|gb|S57283.1|[298321]

[1064] 617: L14854 Homo sapiens T cell receptor TCR-beta D38 (TCRB) mRNA, partial cds gi|292794|gb|L14854.1|HUMTCRD38[292794]

[1065] 618: NM—024080 Homo sapiens transient receptor potential cation channel, subfamily M, member 8 (TRPM8), mRNA gi|13129071|ref|NM—024080.1|[13129071]

[1066] 619: AY069961 Homo sapiens lymphocyte effector toxicity activation ligand (LETAL) mRNA, complete cds gi|19525539|gb|AY069961.1|[19525539]

[1067] 620: U43901 Homo sapiens 37 kD laminin receptor precursor/p40 ribosome associated protein (LAMR1) gene, complete cds; and E2 small nuclear RNA gene, complete sequence gi|19483807|gb|U43901.2|HSU43901[19483807]

[1068] 621: NM—021044 Homo sapiens desert hedgehog homolog (Drosophila) (DHH), mRNA gi|19482157|ref|NM—021044.1|[19482157]

[1069] 622: AC078860 Homo sapiens 12q BAC RP11-186F10 (Roswell Park Cancer Institute Human BAC Library) complete sequence gi|13491193|gb|AC078860.19|[13491193]

[1070] 623: AC003683 Homo sapiens x BAC RP1-147H15 (Roswell Park Cancer Institute Human BAC Library) complete sequence gi|13489135|gb|AC003683.2|[13489135]

[1071] 624: AC007397 Homo sapiens 12p13 BAC RPCI11-439G16 (Roswell Park Cancer Institute Human BAC Library) complete sequence gi|5685879|gb|AC007397.21|[5685879]

[1072] 625: AC007784 Homo sapiens 12p13 BAC RPCI11-1092P21 (Roswell Park Cancer Library Human BAC Library) complete sequence gi|559703|gb|AC007784.7|[5597031]

[1073] 627: AF451730 Homo sapiens isolate R5255 T cell receptor delta chain (TRD@) mRNA, partial cds gi|19401669|gb|AF451730.1|[19401669]

[1074] 628: AF451729 Homo sapiens isolate Q5252 T cell receptor delta chain (TRD@) mRNA, partial cds gi|19401667|gb|AF451729.1|[19401667]

[1075] 629: AF451728 Homo sapiens isolate P5739 T cell receptor delta chain (TRD@) mRNA, partial cds gi|19401665|gb|AF451728.1|[19401665]

[1076] 630: AF451727 Homo sapiens isolate P5742 T cell receptor delta chain (TRD@) mRNA, partial cds gi|9401663|gb|AF451727.1|[19401663]

[1077] 631: AF451726 Homo sapiens isolate P5738 T cell receptor delta chain (TRD@) mRNA, partial cds gi|19401661|gb|AF451726.1|[19401661]

[1078] 632: AF451725 Homo sapiens isolate 0581 T cell receptor delta chain (TRD@) mRNA, partial cds gi|19401658|gb|AF451725.1|[19401658]

[1079] 633: AF451724 Homo sapiens isolate N505 T cell receptor delta chain (TRD@) mRNA, partial cds gi|19401656|gb|AF451724.1|[19401656]

[1080] 634: AF451723 Homo sapiens isolate N504 T cell receptor delta chain (TRD@) mRNA, partial cds gi|19401653|gb|AF451723.1|[19401653]

[1081] 635: AF451722 Homo sapiens isolate P5729 T cell receptor delta chain (TRD@) mRNA, partial cds gi|19401650|gb|AF451722.1|[19401650]

[1082] 636: AF451721 Homo sapiens isolate P5728 T cell receptor delta chain (TRD@) mRNA, partial cds gi|19401647|gb|AF451721.1|[19401647]

[1083] 637: AF451720 Homo sapiens isolate O268 T cell receptor delta chain (TRD@) mRNA, partial cds gi|19401645|gb|AF451720.1|[19401645]

[1084] 638: AF451719 Homo sapiens isolate O38 T cell receptor delta chain (TRD@) mRNA, partial cds gi|19401642|gb|AF451719.1|[19401642]

[1085] 639: AF451718 Homo sapiens isolate O37 T cell receptor delta chain (TRD@) mRNA, partial cds gi|19401640|gb|AF451718.1|[19401640]

[1086] 640: AF449218 Homo sapiens 43 kDa acetylcholine receptor-associated protein (RAPSN) mRNA, complete cds gi|19310212|gb|AF449218.1|[19310212]

[1087] 644: BC025704 Homo sapiens, leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 5, clone MGC:34418 IMAGE:5223581, mRNA, complete cds gi|19344005|gb|BC025704.1|[19344005]

[1088] 645: BC025713 Homo sapiens, T-cell receptor interacting molecule, clone MGC:34314 IMAGE:5227396, mRNA, complete cds gi|19343996|gb|BC025713.1|[19343996]

[1089] 646: BC025722 Homo sapiens, adenosine A2b receptor, clone MGC:34640 IMAGE:5198898, mRNA, complete cds gi|19343938|gb|BC025722.1|[19343938]

[1090] 647: BC025717 Homo sapiens, chemokine (C-C motif) receptor-like 2, clone MGC:34104 IMAGE:5228561, mRNA, complete cds gi|19343936|gb|BC025717.1|[19343936]

[1091] 648: BC025695 Homo sapiens, endothelial differentiation, lysophosphatidic acid G-protein-coupled receptor, 4, clone MGC:34227 IMAGE:5209267, mRNA, complete cds gi|19343926|gb|BC025695.1|[19343926]

[1092] 650: BC025691 Homo sapiens, interleukin 2 receptor, beta, clone MGC:34584 IMAGE:5207833, mRNA, complete cds gi|19343610|gb|BC025691.1|[19343610]

[1093] 651: AF474992 Homo sapiens G protein-coupled receptor SNSR6 gene, complete cds gi|19338917|gb|AF474992.1|[19338917]

[1094] 652: AF474991 Homo sapiens G protein-coupled receptor SNSR5 gene, complete cds gi|19338915|gb|AF474991.1|[19338915]

[1095] 653: AF474990 Homo sapiens G protein-coupled receptor SNSR4 gene, complete cds gi|19338913|gb|AF474990.1|[19338913]

[1096] 654: AF474989 Homo sapiens G protein-coupled receptor SNSR3 gene, complete cds gi|19338911|gb|AF474989.1|[19338911]

[1097] 655: AF474988 Homo sapiens G protein-coupled receptor SNSR2 gene, complete cds gi|19338909|gb|AF474988.1|[19338909]

[1098] 656: AF474987 Homo sapiens G protein-coupled receptor SNSR1 gene, complete cds gi|19338907|gb|AF474987.1|[19338907]

[1099] 695: AF453877 Homo sapiens neuronal nicotinic receptor beta 4 subunit precursor, gene, exon 1 and partial cds gi|18042122|gb|AF453877.1|[18042122]

[1100] 697: U62556 Homo sapiens chemokine receptor-like protein (TER1) gene, complete cds gi|1468978|gb|U62556.1|HSU62556[1468978]

[1101] 698: AJ011371 Homo sapiens mRNA for serotonin 4 receptor, splice variant h5-HT4(e) gi|3646277|emb|AJ011371.1|HSAJ1371[3646277]

[1102] 712: AY059419 Homo sapiens killer-cell immunoglobulin-like receptor (KIR3DL1) mRNA, KIR3DL1*011 allele, partial cds gi|19224338|gb|AY059419.1|[19224338]

[1103] 713: AY059418 Homo sapiens killer-cell immunoglobulin-like receptor (KIR3DL2) mRNA, KIR3DL2*010 allele, partial cds gi|19224336|gb|AY059418.1|[19224336]

[1104] 714: AY059417 Homo sapiens killer-cell immunoglobulin-like receptor KIR3DL1/2v mRNA, partial cds gi|19224334|gb|AY059417.1|[19224334]

[1105] 715: AY059420 Homo sapiens killer-cell immunoglobulin-like receptor (KIR3DL2) mRNA, KIR3DL2*012 allele, partial cds gi|19224332|gb|AY059420.1|[19224332]

[1106] 716: AC079385 Homo sapiens 12q BAC RP11-482D24 (Roswell Park Cancer Institute Human BAC Library) complete sequence gi|14670063|gb|AC079385.18|[14670063]

[1107] 717: AC078889 Homo sapiens 12q BAC RP11-335I12 (Roswell Park Cancer Institute Human BAC Library) complete sequence gi|11072039|gb|AC078889.20|[11072039]

[1108] 718: AC010168 Homo sapiens 12p12-31.7-32.2 BAC RP11-174G6 (Rosewell Park Cancer Institute Human Bac Library) complete sequence gi|6855156|gb|AC010168.6|[6855156]

[1109] 719: U14188 Homo sapiens LERK-4 (EPLG4) mRNA, complete cds gi|642834|gb|U14188.1|HSU14188[642834]

[1110] 720: U14187 Homo sapiens LERK-3 (EPLG3) mRNA, complete cds gi|642832|gb|U14187.1|HSU14187[642832]

[1111] 721: U15637 Homo sapiens CD40 binding protein (CD40BP) mRNA, complete cds gi|595910|gb|U15637.1|HSU15637[595910]

[1112] 722: AF262304 Homo sapiens clone 7 CC chemokine receptor 3-like mRNA, partial sequence, alternatively spliced gi|19171650|gb|AF262304.1|[19171650]

[1113] 723: AF262303 Homo sapiens clone 6 CC chemokine receptor 3 (CCR3) mRNA, partial cds gi|19171648|gb|AF262303.1|[19171648]

[1114] 724: AF262302 Homo sapiens clone 5 CC chemokine receptor 3 (CCR3) mRNA, partial cds gi|19171646|gb|AF262302.1|[19171646]

[1115] 725: AF262301 Homo sapiens clone 4 CC chemokine receptor 3 (CCR3) mRNA, partial cds gi|19171644|gb|AF262301.1|[19171644]

[1116] 726: AF262300 Homo sapiens clone 2 CC chemokine receptor 3 (CCR3) mRNA, partial cds gi|19171642|gb|AF262300.1|[19171642]

[1117] 727: AF262299 Homo sapiens clone 1 CC chemokine receptor 3 (CCR3) mRNA, partial cds gi|19171640|gb|AF262299.1|[19171640]

[1118] 729: AF247361 Homo sapiens CC chemokine receptor 3 (CCR3) gene, complete cds gi|19110542|gb|AF247361.1|[19110542]

[1119] 730: AF247360 Homo sapiens CC chemokine receptor 3 (CCR3) gene, promoter region and partial sequence gi|19110541|gb|AF247360.1|[19110541]

[1120] 731: AF247359 Homo sapiens CC chemokine receptor 3 (CCR3) gene, promoter region and partial sequence gi|19110540|gb|AF247359.1|[19110540]

[1121] 733: AF416619 Homo sapiens prolactin receptor short isoform 1a (PRLR) mRNA, complete cds, alternatively spliced gi|6506717|gb|AF416619.1|[16506717]

[1122] 734: AF416618 Homo sapiens prolactin receptor short isoform 1b (PRLR) mRNA, complete cds, alternatively spliced gi|16506715|gb|AF416618.1|[16506715]

[1123] 736: AJ303165 Homo sapiens partial gene for putative transmembrane receptor gi|13162199|emb|AJ303165.1|HSA303165[13162199]

[1124] 738: AF350881 Homo sapiens channel kinase 2 (CHAK2) mRNA, complete cds gi|18860923|gb|AF350881.2|[18860923]

[1125] 739: AF022044 Homo sapiens natural killer cell receptor KIR3DS1 variant mRNA, complete cds gi|2760894|gb|AF022044.1|[2760894]

[1126] 740: AF034773 Homo sapiens natural killer cell inhibitory receptor (KIR2DL4) mRNA, variant 3, complete cds gi|2739181|gb|AF034773.1|[2739181]

[1127] 741: AF034772 Homo sapiens natural killer cell inhibitory receptor (KIR2DL4) mRNA, variant 2, complete cds gi|2739179|gb|AF034772.1|[2739179]

[1128] 742: AF034771 Homo sapiens natural killer cell inhibitory receptor (KIR2DL4) mRNA, variant 1, complete cds gi|2739177|gb|AF034771.1|[2739177]

[1129] 743: AF022047 Homo sapiens natural killer cell inhibitory receptor KIR2DS3 variant mRNA, complete cds gi|2738966|gb|AF022047.1|[2738966]

[1130] 744: AF022046 Homo sapiens natural killer cell inhibitory receptor KIR2DS1 variant mRNA, complete cds gi|2738964|gb|AF022046.1|[2738964]

[1131] 745: AF022045 Homo sapiens natural killer cell receptor KIR2DL1 variant mRNA, complete cds gi|2738962|gb|AF022045.1|[2738962]

[1132] 746: U56255 Homo sapiens CW-1 mRNA, complete cds gi|1399688|gb|U56255.1|HSU56255[1399688]

[1133] 747: AJ422056 Homo sapiens partial GRM5 gene for metabotrophic glutamate receptor, exon 1A gi|19069804|emb|AJ422056.1|HSA422056[19069804]

[1134] 748: AY028912 Homo sapiens ectodysplasin A receptor associated death domain (EDARADD) gene, exon 7 and complete cds, alternatively spliced gi|19067944|gb|AY028912.1|AY028906S7[19067944]

[1135] 749: AY028911 Homo sapiens ectodysplasin A receptor associated death domain (EDARADD) gene, exon 6 gi|19067943|gb|AY028911.1|AY028906S6[19067943]

[1136] 750: AY028910 Homo sapiens ectodysplasin A receptor associated death domain (EDARADD) gene, exon 5 gi|19067942|gb|AY028910.1|AY028906S5[19067942]

[1137] 751: AY028909 Homo sapiens ectodysplasin A receptor associated death domain (EDARADD) gene, exon 4 gi|19067941|gb|AY028909.1|AY028906S4[19067941]

[1138] 752: AY028908 Homo sapiens ectodysplasin A receptor associated death domain (EDARADD) gene, exon 3 gi|19067940|gb|AY028908.1|AY028906S3[19067940]

[1139] 753: AY028907 Homo sapiens ectodysplasin A receptor associated death domain (EDARADD) gene, exon 2 gi|19067939|gb|AY028907.1|AY028906S2[19067939]

[1140] 754: AY028906 Homo sapiens ectodysplasin A receptor associated death domain (EDARADD) gene, exon 1 gi|19067938|gb|AY028906.1|AY028906S1[19067938]

[1141] 755: AH010677 Homo sapiens ectodysplasin A receptor associated death domain (EDARADD) gene, complete cds, alternatively spliced gi|19067937|gb|AH010677.1|SEG_AY028906S[19067937]

[1142] 756: AY028913 Homo sapiens ectodysplasia A receptor associated death domain A (EDARADD) mRNA, complete cds; alternatively spliced gi|19067935|gb|AY028913.1|[19067935]

[1143] 757: BM735809 06E08 Canine Brain cDNA Library Canis familiaris cDNA 5′ similar to Homo sapiens glycine receptor, beta, mRNA sequence gi|19057142|gb|BM735809.1|BM735809[19057142]

[1144] 758: BM735756 06A09 Canine Brain cDNA Library Canis familiaris cDNA 5′ similar to Homo sapiens glycine receptor, beta subunit, mRNA sequence gi|19057089|gb|BM735756.1|BM735756[19057089]

[1145] 759: BM735711 10E11 Canine Brain cDNA Library Canis familiaris cDNA 5′ similar to Homo sapiens protein tyrosine phosphatase, receptor-type, Z polypeptide 1, mRNA sequence gi|19057044|gb|BM735711.1|BM735711[19057044]

[1146] 762: AC007165 Homo sapiens BAC clone RP11-451C2 from 2, complete sequence gi|19033999|gb|AC007165.4|[19033999]

[1147] 763: AF245699 Homo sapiens type 1 angiotensin II receptor (AGTR1) gene, complete cds gi|7862074|gb|AF245699.1|[7862074]

[1148] 764: BC024229 Homo sapiens, prostaglandin E receptor 3 (subtype EP3), clone MGC:27302 IMAGE:4660371, mRNA, complete cds gi|18999476|gb|BC024229.1|[18999476]

[1149] 783: AJ417555 Homo sapiens partial mRNA for killer cell immunoglobulin receptor (KIR2DS4 gene), strain 4053 gi|18958228|emb|AJ417555.1|HSA417555[18958228]

[1150] 784: AJ417554 Homo sapiens partial mRNA for killer cell immunoglobulin receptor (KIR2DS4 gene), strain 3321 gi|18958226|emb|AJ417554.1|HSA417554[18958226]

[1151] 786: NM—003877 Homo sapiens STAT induced STAT inhibitor-2 (STATI2), mRNA gi|18921206|ref|NM—003877.2|[18921206]

[1152] 787: NM—017662 Homo sapiens transient receptor potential cation channel, subfamily M, member 6 (TRPM6), mRNA gi|18921092|ref|NM—017662.3|[18921092]

[1153] 788: NM—133181 Homo sapiens epidermal growth factor receptor pathway substrate 8 related protein 3 (EPS8R3), mRNA gi|18874727|ref|NM—133181.1|[18874727]

[1154] 802: M13823 Homo sapiens T cell receptor gamma chain (TCRG) gene, partial cds gi|292736|gb|M13823.1|HUMTCGXK[292736]

[1155] 803: L12398 Homo sapiens dopamine receptor D4 (DRD4) mRNA, complete cds gi|291945|gb|L12398.1|HUMD4C[291945]

[1156] 804: M86383 Homo sapiens nicotinic acetylcholine receptor alpha 3 subunit precursor, mRNA, complete cds gi|177897|gb|M86383.1|HUMA3NARSP[177897]

[1157] 805: NG—000019 Homo sapiens chorionic gonadotropin beta region (CGB@) on chromosome 19 gi|18860921|ref|NG—000019.2|[18860921]

[1158] 807: NM—012245 Homo sapiens SKI-interacting protein (SNW1), mRNA gi|18860912|ref|NM—012245.2|[18860912]

[1159] 808: NM—006750 Homo sapiens syntrophin, beta 2 (dystrophin-associated protein A1, 59kD, basic component 2) (SNTB2), transcript variant 1, mRNA gi|18860911|ref|NM—006750.2|[18860911]

[1160] 809: NM—130845 Homo sapiens syntrophin, beta 2 (dystrophin-associated protein A1, 59kD, basic component 2) (SNTB2), transcript variant 2, mRNA gi|18860909|ref|NM—130845.1|[18860909]

[1161] 810: NM—002846 Homo sapiens protein tyrosine phosphatase, receptor type, N (PTPRN), mRNA gi|18860905|ref|NM—002846.2|[18860905]

[1162] 811: NM—002845 Homo sapiens protein tyrosine phosphatase, receptor type, M (PTPRM), mRNA gi|18860903|ref|NM—002845.2|[18860903]

[1163] 812: NM—002844 Homo sapiens protein tyrosine phosphatase, receptor type, K (PTPRK), mRNA gi|18860901|ref|NM—002844.2|[18860901]

[1164] 813: NM—002843 Homo sapiens protein tyrosine phosphatase, receptor type, J (PTPRJ), mRNA gi|18860899|ref|NM—002843.2|[18860899]

[1165] 814: NM—002841 Homo sapiens protein tyrosine phosphatase, receptor type, G (PTPRG), mRNA gi|18860897|ref|NM—002841.2|[18860897]

[1166] 815: NM—130440 Homo sapiens protein tyrosine phosphatase, receptor type, F (PTPRF), transcript variant 2, mRNA gi|18860895|ref|NM—130440.1|[18860895]

[1167] 816: NM—130393 Homo sapiens protein tyrosine phosphatase, receptor type, D (PTPRD), transcript variant 4, mRNA gi|18860893|ref|NM—130393.1|[18860893]

[1168] 817: NM—130392 Homo sapiens protein tyrosine phosphatase, receptor type, D (PTPRD), transcript variant 3, mRNA gi|18860891|ref|NM—130392.1|[18860891]

[1169] 818: NM—130391 Homo sapiens protein tyrosine phosphatase, receptor type, D (PTPRD), transcript variant 2, mRNA gi|18860889|ref|NM—130391.1|[18860889]

[1170] 819: NM—003682 Homo sapiens MAP-kinase activating death domain (MADD), transcript variant 4, mRNA gi|18860876|ref|NM—003682.2|[18860876]

[1171] 820: NM—130476 Homo sapiens MAP-kinase activating death domain (MADD), transcript variant 8, mRNA gi|18860874|ref|NM—130476.1|[18860874]

[1172] 821: NM—130475 Homo sapiens MAP-kinase activating death domain (MADD), transcript variant 7, mRNA gi|18860872|ref|NM—130475.1|[18860872]

[1173] 822: NM—002840 Homo sapiens protein tyrosine phosphatase, receptor type, F (PTPRF), transcript variant 1, mRNA gi|18860871|ref|NM—002840.2|[18860871]

[1174] 823: NM—130474 Homo sapiens MAP-kinase activating death domain (MADD), transcript variant 6, mRNA gi|18860869|ref|NM—130474.1|[18860869]

[1175] 824: NM—130473 Homo sapiens MAP-kinase activating death domain (MADD), transcript variant 5, mRNA gi|18860867|ref|NM—130473.1|[18860867]

[1176] 825: NM—130472 Homo sapiens MAP-kinase activating death domain (MADD), transcript variant 3, mRNA gi|18860865|ref|NM—130472.1|[18860865]

[1177] 826: NM—130471 Homo sapiens MAP-kinase activating death domain (MADD), transcript variant 2, mRNA gi|18860863|ref|NM—130471.1|[18860863]

[1178] 827: NM—130470 Homo sapiens MAP-kinase activating death domain (MADD), transcript variant 1, mRNA gi|18860861|ref|NM—130470.1|[18860861]

[1179] 828: NM—006504 Homo sapiens protein tyrosine phosphatase, receptor type, E (PTPRE), transcript variant 1, mRNA gi|18860860|ref|NM—006504.2|[18860860]

[1180] 829: NM—130435 Homo sapiens protein tyrosine phosphatase, receptor type, E (PTPRE), transcript variant 2, mRNA gi|18860858|ref|NM—130435.1|[18860858]

[1181] 830: AJ431177 Homo sapiens mRNA for WIRE protein gi|8857713|emb|AJ431177.1|HSA431177[18857713]

[1182] 831: NM—006474 Homo sapiens lung type-I cell membrane-associated glycoprotein (T1A-2), mRNA gi|18767663|ref|NM—006474.2|[18767663]

[1183] 833: NM—006794 Homo sapiens G protein-coupled receptor 75 (GPR75), mRNA gi|5803024|ref|NM—006794.1|[5803024]

[1184] 834: NM—002842 Homo sapiens protein tyrosine phosphatase, receptor type, H (PTPRH), mRNA gi|4506312|ref|NM—002842.1|[4506312]

[1185] 835: NM—002839 Homo sapiens protein tyrosine phosphatase, receptor type, D (PTPRD), transcript variant 1, mRNA gi|4506308|ref|NM—002839.1|[4506308]

[1186] 836: BC024145 Homo sapiens, TNF receptor-associated factor 1, clone MGC:10353 IMAGE:3832475, mRNA, complete cds gi|18848176|gb|BC024145.1|[18848176]

[1187] 837: AF469756 Homo sapiens clone S9 interleukin-1 receptor type I (IL1R1) gene, partial sequence gi|18846656|gb|AF469756.1|[18846656]

[1188] 838: AF469755 Homo sapiens clone S8 interleukin-1 receptor type I (IL1R1) gene, partial sequence gi|18846655|gb|AF469755.1|[18846655]

[1189] 839: AF469754 Homo sapiens clone S7 interleukin-1 receptor type I (IL1R1) gene, partial sequence gi|8845036|gb|AF469754.1|[18845036]

[1190] 841: BM565570 ih27b03.x1Human insulinoma Homo sapiens cDNA clone IMAGE: 3′ similar to SW:FCEG_HUMAN P30273 HIGH AFFINITY IMMUNOGLOBULIN EPSILON RECEPTOR GAMMA-SUBUNIT PRECURSOR ;, mRNA sequence gi|18825852|gb|BM565570.1|BM565570[18825852]

[1191] 842: AF416711 Homo sapiens Fc-gamma receptor IIc5 mRNA, partial cds gi|18765992|gb|AF416711.1|[18765992]

[1192] 843: NM—023068 Homo sapiens sialoadhesin (SN), mRNA gi|18765743|ref|NM—023068.2|[18765743]

[1193] 844: NM—004782 Homo sapiens synaptosomal-associated protein, 29kD (SNAP29), mRNA gi|18765736|ref|NM—004782.2|[18765736]

[1194] 845: NM—130798 Homo sapiens synaptosomal-associated protein, 23kD (SNAP23), transcript variant 2, mRNA gi|18765730|ref|NM—130798.1|[18765730]

[1195] 846: NM—003825 Homo sapiens synaptosomal-associated protein, 23kD (SNAP23), transcript variant 1, mRNA gi|18765728|ref|NM—003825.2|[18765728]

[1196] 850: AF439409 Homo sapiens G-protein-coupled receptor kinase 7 (GRK7) mRNA, GRK7-S allele, complete cds gi|17933258|gb|AF439409.1|[17933258]

[1197] 851: NM—032211 Homo sapiens lysyl oxidase-like 4 (LOXL4), mRNA gi|16933522|ref|NM—032211.4|[16933522]

[1198] 852: AF411122 Homo sapiens importin 4 mRNA, complete cds gi|18700634|gb|AF411122.1|[18700634]

[1199] 894: NM—130441 Homo sapiens C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 11 (CLECSF11), mRNA gi|18466805|ref|NM—130441.1|[18466805]

[1200] 895: NM—030876 Homo sapiens olfactory receptor, family 5, subfamily V, member 1 (OR5V1), mRNA gi|14495550|ref|NM—030876.2|[14495550]

[1201] 896: NM—032732 Homo sapiens hypothetical protein MGC10763 (IL17RL), mRNA gi|14249349|ref|NM—032732.1|[14249349]

[1202] 897: NM—030959 Homo sapiens olfactory receptor, family 12, subfamily D, member 3 (OR12D3), mRNA gi|13624334|ref|NM—030959.1|[13624334]

[1203] 898: NM—018842 Homo sapiens insulin receptor tyrosine kinase substrate (LOC55971), mRNA gi|10047119|ref|NM—018842.1|[10047119]

[1204] 899: NM—018844 Homo sapiens B-cell receptor-associated protein BAP29 (BAP29), mRNA gi|9994198|ref|NM—018844.1|[9994198]

[1205] 900: NM—002825 Homo sapiens pleiotrophin (heparin binding growth factor 8, neurite growth-promoting factor 1) (PTN), mRNA gi|18656935|ref|NM—002825.2|[18656935]

[1206] 904: NM—016372 Homo sapiens seven transmembrane domain orphan receptor (TPRA40), mRNA gi|7705964|ref|NM—016372.1|[7705964]

[1207] 905: NM—014288 Homo sapiens integrin beta 3 binding protein (beta3-endonexin) (ITGB3BP), mRNA gi|7657205|ref|NM—014288.1|[7657205]

[1208] 906: L43588 Homo sapiens T cell antigen receptor mRNA, partial cds gi|18654191|gb|L43588.1|HUMTCARF[18654191]

[1209] 907: AB050954 Homo sapiens irs-2 gene for insulin receptor substrate-2, partial cds gi|18652856|dbj|AB050954.1|[18652856]

[1210] 923: U77589 Homo sapiens MHC class II HLA-DQ-alpha chain (HLA-DQA1) mRNA, HLA-DQA1*0104 allele, complete cds gi|1916744|gb|U77589.1|HSU77589[1916744]

[1211] 924: AF410465 Homo sapiens importin 9 mRNA, complete cds gi|15529702|gb|AF410465.1|[15529702]

[1212] 925: AF332759 Homo sapiens partially duplicated CHRNA7 gene, hybrid intron A/4 and partial exon 5 gi|13345792|gb|AF332759.1|[13345792]

[1213] 926: AF332758 Homo sapiens alpha-7 nicotinic cholinergic receptor subunit (CHRNA7) gene, partial intron 4 and partial cds gi|13345790|gb|AF332758.1|[13345790]

[1214] 927: NM—003744 Homo sapiens numb homolog (Drosophila) (NUMB), mRNA gi|18644887|ref|NM—003744.2|[18644887]

[1215] 928: NM—003681 Homo sapiens pyridoxal (pyridoxine, vitamin B6) kinase (PDXK), mRNA gi|18644884|ref|NM—003681.2|[18644884]

[1216] 929: NM—080706 Homo sapiens transient receptor potential cation channel, subfamily V, member 1 (TRPV1), transcript variant 3, mRNA gi|18375670|ref|NM—080706.1|[18375670]

[1217] 930: NM—080705 Homo sapiens transient receptor potential cation channel, subfamily V, member 1 (TRPV1), transcript variant 4, mRNA gi|18375668|ref|NM—080705.1|[18375668]

[1218] 931: NM—080704 Homo sapiens transient receptor potential cation channel, subfamily V, member 1 (TRPV1), transcript variant 1, mRNA gi|18375666|ref|NM—080704.1|[18375666]

[1219] 932: NM—018727 Homo sapiens transient receptor potential cation channel, subfamily V, member 1 (TRPV1), transcript variant 2, mRNA gi|18375664|ref|NM—018727.3|[18375664]

[1220] 933: NM—080819 Homo sapiens G protein-coupled receptor 78 (GPR78), mRNA gi|18201873|ref|NM—080819.1|[18201873]

[1221] 934: NM—080738 Homo sapiens EDAR-associated death domain (EDARADD), mRNA gi|18152768|ref|NM—080738.1|[18152768]

[1222] 935: NM—080491 Homo sapiens GRB2-associated binding protein 2 (GAB2), transcript variant 1,mRNA gi|18105041|ref|NM—080491.1|[18105041]

[1223] 936: NM—012296 Homo sapiens GRB2-associated binding protein 2 (GAB2), transcript variant 2,mRNA gi|18105040|ref|NM—012296.2|[18105040]

[1224] 937: NM—032027 Homo sapiens beta-amyloid binding protein precursor (BBP), mRNA gi|17738309|ref|NM—032027.2|[17738309]

[1225] 938: NM—057159 Homo sapiens endothelial differentiation, lysophosphatidic acid G-protein-coupled receptor, 2 (EDG2), transcript variant 2, mRNA gi|16950637|ref|NM—057159.1|[16950637]

[1226] 939: NM—001401 Homo sapiens endothelial differentiation, lysophosphatidic acid G-protein-coupled receptor, 2 (EDG2), transcript variant 1, mRNA gi|16950635|ref|NM—001401.2|[16950635]

[1227] 940: NM—007070 Homo sapiens FKBP-associated protein (FAP48), transcript variant 2, mRNA gi|16933538|ref|NM—007070.2|[16933538]

[1228] 941: NM—053274 Homo sapiens FKBP-associated protein (FAP48), transcript variant 1, mRNA gi|16933536|ref|NM—053274.1|[16933536]

[1229] 942: NM—003726 Homo sapiens src family associated phosphoprotein 1 (SCAP1), mRNA gi|16753209|ref|NM—003726.2|[16753209]

[1230] 943: NM—033632 Homo sapiens F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)(FBXW7), transcript variant 1, mRNA gi|16117780|ref|NM—033632.1|[16117780]

[1231] 944: NM—018315 Homo sapiens F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)(FBXW7), transcript variant 2, mRNA gi|16117778|ref|NM—018315.2|[16117778]

[1232] 945: NM—021203 Homo sapiens APMCF1 protein (APMCF1), mRNA gi|14917112|ref|NM—021203.2|[14917112]

[1233] 946: NM—002927 Homo sapiens regulator of G-protein signalling 13 (RGS13), mRNA gi|14589857|ref|NM—002927.2|[14589857]

[1234] 949: NM—020167 Homo sapiens neuromedin U receptor 2 (NMU2R), mRNA gi|9910461|ref|NM—020167.1|[9910461]

[1235] 950: NM—020149 Homo sapiens Meisi, myeloid ecotropic viral integration site 1 homolog 2 (mouse)(MEIS2), mRNA gi|9910355|ref|NM—020149.1|[9910355]

[1236] 951: AF190052 Homo sapiens interleukin 1 receptor type I (IL1R1) gene, exon 1C sequence gi|9719300|gb|AF190052.1|[9719300]

[1237] 952: NM—018965 Homo sapiens triggering receptor expressed on myeloid cells 2 (TREM2), mRNA gi|9507202|ref|NM—018965.1|[9507202]

[1238] 953: NM—018643 Homo sapiens triggering receptor expressed on myeloid cells 1 (TREM1), mRNA gi|8924261|ref|NM—018643.1|[8924261]

[1239] 954: NM—018647 Homo sapiens tumor necrosis factor receptor superfamily, member 19 (TNFRSF19),mRNA gi|8924251|ref|NM—018647.1|[8924251]

[1240] 955: NM—018695 Homo sapiens erbb2 interacting protein (ERBB2IP), mRNA gi|8923908|ref|NM—018695.1|[8923908]

[1241] 956: NM—017636 Homo sapiens transient receptor potential cation channel, subfamily M, member 4(TRPM4), mRNA gi|8923048|ref|NM—017636.1|[8923048]

[1242] 958: NM—016559 Homo sapiens PXR2b protein (PXR2b), mRNA gi|7706670|ref|NM—016559.1|[7706670]

[1243] 959: NM—016382 Homo sapiens natural killer cell receptor 2B4 (CD244), mRNA gi|7706528|ref|NM—016382.1|[7706528]

[1244] 962: NM—015986 Homo sapiens cytokine receptor-like factor 3 (CRLF3), mRNA gi|7705331|ref|NM—015986.1|[7705331]

[1245] 963: NM—014815 Homo sapiens KIAA0130 gene product (KIAA0130), mRNA gi|7661929|ref|NM—014815.1|[7661929]

[1246] 964: NM—014053 Homo sapiens FLVCR protein (FLVCR), mRNA gi|7661707|ref|NM—014053.1|[7661707]

[1247] 965: NM—014478 Homo sapiens calcitonin gene-related peptide-receptor component protein(CGRP-RCP), mRNA gi|7656976|ref|NM—014478.1|[7656976]

[1248] 966: NM—012470 Homo sapiens transportin-SR (TRN-SR), mRNA gi|6912733|ref|NM—012470.1|[6912733]

[1249] 967: NM—007357 Homo sapiens low density lipoprotein receptor defect C complementing (LDLC), mRNA gi|6678675|ref|NM—007357.1|[6678675]

[1250] 969: NM—007324 Homo sapiens MAD, mothers against decapentaplegic homolog (Drosophila)interacting protein, receptor activation anchor (MADHIP), transcript variant 1, mRNA gi|6552338|ref|NM—007324.1|[6552338]

[1251] 970: NM—007323 Homo sapiens MAD, mothers against decapentaplegic homolog (Drosophila)interacting protein, receptor activation anchor (MADHIP), transcript variant 2,mRNA gi|6552336|ref|NM—007323.1|[6552336]

[1252] 971: NM—005162 Homo sapiens angiotensin receptor-like 2 (AGTRL2), mRNA gi|6031157|ref|NM—005162.2|[6031157]

[1253] 972: NM—005501 Homo sapiens integrin, alpha 3 (antigen CD49C, alpha 3 subunit of VLA-3 receptor) (ITGA3), transcript variant b, mRNA gi|6006010|ref|NM—005501.1|[6006010]

[1254] 975: NM—007053 Homo sapiens natural killer cell receptor, immunoglobulin superfamily member(BY55), mRNA gi|5901909|ref|NM—007053.1|[5901909]

[1255] 978: NM—006254 Homo sapiens protein kinase C, delta (PRKCD), mRNA gi|5453969|ref|NM—006254.1|[5453969]

[1256] 979: NM—005761 Homo sapiens plexin C1 (PLXNC1), mRNA gi|5032222|ref|NM—005761.1|[5032222]

[1257] 980: NM—005866 Homo sapiens sigma receptor (SR31747 binding protein 1) (SR-BP1), mRNA gi|5032116|ref|NM—005866.1|[5032116]

[1258] 982: NM—005506 Homo sapiens CD36 antigen (collagen type I receptor, thrombospondin receptor)-like 2 (lysosomal integral membrane protein II) (CD36L2), mRNA gi|5031630|ref|NM—005506.1|[5031630]

[1259] 984: NM—004799 Homo sapiens MAD, mothers against decapentaplegic homolog (Drosophila)interacting protein, receptor activation anchor (MADHIP), transcript variant 3, mRNA gi|4759059|ref|NM—004799.1|[4759059]

[1260] 985: NM—004292 Homo sapiens ras inhibitor (RIN1), mRNA gi|4759039|ref|NM—004292.1|[4759039]

[1261] 986: NM—004828 Homo sapiens lymphocyte antigen 95 (activating NK-receptor; NK-p44) (LY95), mRNA gi|4758693|ref|NM—004828.1|[4758693]

[1262] 987: NM—004767 Homo sapiens endothelin type b receptor-like protein 2 (ET(B)R-LP-2), mRNA gi|4758309|ref|NM—004767.1|[4758309]

[1263] 988: NM—004440 Homo sapiens EphA7 (EPHA7), mRNA gi|4758281|ref|NM—004440.1|[4758281]

[1264] 989: NM—003999 Homo sapiens oncostatin M receptor (OSMR), mRNA gi|4557039|ref|NM—003999.1|[4557039]

[1265] 990: NM—003904 Homo sapiens zinc finger protein 259 (ZNF259), mRNA gi|4508020|ref|NM—003904.1|[4508020]

[1266] 991: NM—003305 Homo sapiens transient receptor potential cation channel, subfamily C, member 3(TRPC3), mRNA gi|4507686|ref|NM—003305.1|[4507686]

[1267] 992: NM—003804 Homo sapiens receptor (TNFRSF)-interacting serine-threonine kinase 1 (RIPK1), mRNA gi|4506538|ref|NM—003804.1|[4506538]

[1268] 993: NM—003626 Homo sapiens protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF),interacting protein (liprin), alpha 1 (PPFIA1), mRNA gi|4505982|ref|NM—003626.1|[4505982]

[1269] 994: NM—003876 Homo sapiens putative receptor protein (PMI), mRNA gi|4505900|ref|NM—003876.1|[4505900]

[1270] 995: NM—003559 Homo sapiens phosphatidylinositol-4-phosphate 5-kinase, type II, beta (PIP5K2B),mRNA gi|4505818|ref|NM—003559.1|[4505818]

[1271] 996: NM—003629 Homo sapiens phosphoinositide-3-kinase, regulatory subunit, polypeptide 3 (p55,gamma) (PIK3R3), mRNA gi|4505804|ref|NM—003629.1|[4505804]

[1272] 997: NM—003676 Homo sapiens degenerative spermatocyte homolog, lipid desaturase (Drosophila)(DEGS), mRNA gi|4505192|ref|NM—003676.1|[4505192]

[1273] 998: NM—002270 Homo sapiens karyopherin (importin) beta 2 (KPNB2), mRNA gi|4504906|ref|NM—002270.1|[4504906]

[1274] 999: NM—002204 Homo sapiens integrin, alpha 3 (antigen CD49C, alpha 3 subunit of VLA-3 receptor) (ITGA3), transcript variant a, mRNA gi|4504746|ref|NM—002204.1|[4504746]

[1275] 1000: NM—001560 Homo sapiens interleukin 13 receptor, alpha 1 (IL13RA1), mRNA gi|4504646|ref|NM—001560.1|[4504646]

[1276] sapiens AND receptor NOT similar NOT non-receptor NOT nuclear NOT receptor-associated NOT “thyroid hormone” NOT “steroid receptor”

[1277] 779: NM—000842 Homo sapiens glutamate receptor, metabotropic 5 (GRM5), mRNA gi|4504142|ref|NM—000842.1|[4504142]

[1278] 780: NM—001883 Homo sapiens corticotropin releasing hormone receptor 2 (CRHR2), mRNA gi|4503044|ref|NM—001883.1|[4503044]

[1279] 781: NM—001873 Homo sapiens carboxypeptidase E (CPE), mRNA gi|4503008|ref|NM—001873.1|[4503008]

[1280] 783: L29395 Homo sapiens v-erbB-related protein gene, partial cds gi|459807|gb|L29395.1|HUMERBB[459807]

[1281] 784: L08584 Homo sapiens T cell receptor beta chain (TCRB) mRNA, partial cds gi|307497|gb|L08584.1|HUMTCVB7A[307497]

[1282] 786: NM—015638 Homo sapiens chromosome 20 open reading frame 188 (C20orf188), mRNA gi|18158415|ref|NM—015638.1|[18158415]

[1283] 787: NM—058167 Homo sapiens ubiquitin conjugating enzyme 6 (Ubc6p), mRNA gi|17157996|ref|NM—058167.1|[17157996]

[1284] 788: NM—054032 Homo sapiens G protein-coupled receptor MRGX4 (MRGX4), mRNA gi|16876454|ref|NM—054032.1|[16876454]

[1285] 789: NM—054031 Homo sapiens G protein-coupled receptor MRGX3 (MRGX3), mRNA gi|16876452|ref|NM—054031.1|[16876452]

[1286] 790: NM—054030 Homo sapiens G protein-coupled receptor MRGX2 (MRGX2), mRNA gi|16876450|ref|NM—054030.1|[16876450]

[1287] 791: NM—052931 Homo sapiens activating NK receptor (KALI), mRNA gi|16418406|ref|NM—052931.1|[16418406]

[1288] 792: NM—032871 Homo sapiens tumor necrosis factor receptor superfamily, member 19-like (TNFRSF19L), mRNA gi|14249611|ref|NM—032871.1|[14249611]

[1289] 793: NM—032553 Homo sapiens putative purinergic receptor (FKSG79), mRNA gi|14211848|ref|NM—032553.1|[14211848]

[1290] 794: NM—025179 Homo sapiens plexin A2 (PLXNA2), mRNA gi|13378152|ref|NM—025179.1|[13378152]

[1291] 795: NM—024419 Homo sapiens Phosphatidylglycerophosphate Synthase (PGS1), mRNA gi|13259369|ref|NM—024419.1|[13259369]

[1292] 796: NM—021249 Homo sapiens sorting nexin 6 (SNX6), mRNA gi|13027619|ref|NM—021249.1|[13027619]

[1293] 797: NM—014045 Homo sapiens DKFZP564C1940 protein (DKFZP564C1940), mRNA gi|13027587|ref|NM—014045.1|[13027587]

[1294] 798: NM—080923 Homo sapiens protein tyrosine phosphatase, receptor type, C (PTPRC), transcript variant 4, mRNA gi|18641365|ref|NM—080923.1|[18641365]

[1295] 799: NM—080922 Homo sapiens protein tyrosine phosphatase, receptor type, C (PTPRC), transcript variant 3, mRNA gi|18641363|ref|NM—080922.1|[18641363]

[1296] 800: NM—080921 Homo sapiens protein tyrosine phosphatase, receptor type, C (PTPRC), transcript variant 2, mRNA gi|18641361|ref|NM—080921.1|[18641361]

[1297] 801: NM—130386 Homo sapiens collectin sub-family member 12 (COLEC12), transcript variant I, mRNA gi|18641359|ref|NM—130386.1|[18641359]

[1298] 802: NM—030781 Homo sapiens collectin sub-family member 12 (COLEC12), transcript variant II, mRNA gi|18641357|ref|NM—030781.2|[18641357]

[1299] 803: NM—002838 Homo sapiens protein tyrosine phosphatase, receptor type, C (PTPRC), transcript variant 1, mRNA gi|18641346|ref|NM—002838.2|[18641346]

[1300] 804: NM—130770 Homo sapiens 5-hydroxytryptamine receptor 3 subunit C (HTR3C), mRNA gi|18640739|ref|NM—130770.1|[18640739]

[1301] 813: BD010218 Novel hemopoietin receptor protein, NR12 gi|18638591|dbj|BD010218.1|[18638591]

[1302] 814: BD010217 Novel hemopoietin receptor protein, NR12 gi|18638590|dbj|BD010217.1|[18638590]

[1303] 815: BD010216 Novel hemopoietin receptor protein, NR12 gi|18638589|dbj|BD010216.1|[18638589]

[1304] 816: BD010215 Novel hemopoietin receptor protein, NR12 gi|18638588|dbj|BD010215.1|[18638588]

[1305] 817: BD010214 Novel hemopoietin receptor protein, NR12 gi|18638587|dbj|BD010214.1|[18638587]

[1306] 818: BD010125 Peptide leukotrien receptor gi|18638498|dbj|BD010125.1|[18638498]

[1307] 819: BD010114 Novel receptor and gene encoding the same gi|18638487|dbj|BD010114.1|[18638487]

[1308] 820: BD010057 Novel G protein coupled receptor protein and its DNA gi|18638430|dbj|BD010057.1|[18638430]

[1309] 821: BD010056 Novel G protein coupled receptor protein and its DNA gi|18638429|dbj|BD010056.1|[18638429]

[1310] 822: BD010055 Novel G protein coupled receptor protein and its DNA gi|18638428|dbj|BD010055.1|[18638428]

[1311] 823: BD010054 Novel C protein coupled receptor protein and its DNA gi|18638427|dbj|BD010054.1|[18638427]

[1312] 824: BD010053 Novel G protein coupled receptor protein and its DNA gi|18638426|dbj|BD010053.1|[18638426]

[1313] 825: BD010052 Novel G protein coupled receptor protein and its DNA gi|18638425|dbj|BD010052.1|[18638425]

[1314] 826: BD010051 Novel G protein coupled receptor protein and its DNA gi|18638424|dbj|BD010051.1|[18638424]

[1315] 827: BD010050 Novel G protein coupled receptor protein and its DNA gi|18638423|dbj|BD010050.1|[18638423]

[1316] 828: BD010049 Novel G protein coupled receptor protein and its DNA gi|18638422|dbj|BD010049.1|[18638422]

[1317] 829: BD010046 Novel G protein coupled receptor protein and its DNA gi|18638419|dbj|BD010046.1|[18638419]

[1318] 830: BD010035 Novel G protein coupled receptor protein and its DNA gi|18638408|dbj|BD010035.1|[18638408]

[1319] 831: BD010034 Novel G protein coupled receptor protein and its DNA gi|18638407|dbj|BD010034.1|[18638407]

[1320] 832: BD010028 Novel G protein coupled receptor protein and its DNA gi|18638401|dbj|BD010028.1|[18638401]

[1321] 833: BD010022 Novel G protein coupled receptor protein and its DNA gi|18638395|dbj|BD010022.1|[18638395]

[1322] 834: BD009263 GABAA receptor subunit epsilon-related protein gi|18637636|dbj|BD009263.1|[18637636]

[1323] 835: BD009262 GABAA receptor subunit epsilon-related protein gi|18637635|dbj|BD009262.1|[18637635]

[1324] 836: BD009261 GABAA receptor subunit epsilon-related protein gi|18637634|dbj|BD009261.1|[18637634]

[1325] 837: BD009260 GABAA receptor subunit epsilon-related protein gi|18637633|dbj|BD009260.1|[18637633]

[1326] 838: BD006753 Human G protein chemokine receptor HDGNR10 gi|18635124|dbj|BD006753.1|[18635124]

[1327] 843: E51301 Novel G protein-coupled receptor protein and gene of said G protein-coupled receptor protein gi|18633577|dbj|E51301.1|[18633577]

[1328] 844: E51300 Novel G protein-coupled receptor protein and gene of said G protein-coupled receptor protein gi|18633576|dbj|E51300.1|[18633576]

[1329] 845: E51299 Novel G protein-coupled receptor protein and gene of said G protein-coupled receptor protein gi|18633575|dbj|E51299.1|[18633575]

[1330] 846: E51298 Novel G protein-coupled receptor protein and gene of said G protein-coupled receptor protein gi|18633574|dbj|E51298.1|[18633574]

[1331] 847: E51297 Novel G protein-coupled receptor protein and gene of said G protein-coupled receptor protein gi|18633573|dbj|E51297.1|[18633573]

[1332] 848: E51296 Novel G protein-coupled receptor protein and gene of said G protein-coupled receptor protein gi|18633572|dbj|E51296.1|[18633572]

[1333] 849: E50838 Novel G protein-coupled receptor gi|18633543|dbj|E50838.1|[18633543]

[1334] 850: E50837 Novel G protein-coupled receptor gi|18633542|dbj|E50837.1|[18633542]

[1335] 851: E50836 Novel G protein-coupled receptor gi|18633541|dbj|E50836.1|[18633541]

[1336] 852: E50835 Novel G protein-coupled receptor gi|18633540|dbj|E50835.1|[18633540]

[1337] 853: E50834 Novel G protein-coupled receptor gi|18633539|dbj|E50834.1|[18633539]

[1338] 854: E50833 Novel G protein-coupled receptor gi|18633538|dbj|E50833.1|[18633538]

[1339] 873: BD003056 Novel G protein-coupled receptor protein and DNA thereof gi|18631017|dbj|BD003056.1|[18631017]

[1340] 874: E55122 Novel G protein-coupled receptor and the G protein-coupled receptor gene gi|18629753|dbj|E55122.1|[18629753]

[1341] 875: E55121 Novel G protein-coupled receptor and the G protein-coupled receptor gene gi|18629752|dbj|E55121.1|[18629752]

[1342] 876: E55120 Novel G protein-coupled receptor and the G protein-coupled receptor gene gi|18629751|dbj|E55120.1|[18629751]

[1343] 877: E55119 Novel G protein-coupled receptor and the G protein-coupled receptor gene gi|18629750|dbj|E55119.1|[18629750]

[1344] 878: E55118 Novel G protein-coupled receptor and the G protein-coupled receptor gene gi|18629749|dbj|E55118.1|[18629749]

[1345] 879: E55117 Novel G protein-coupled receptor and the G protein-coupled receptor gene gi|18629748|dbj|E55117.1|[18629748]

[1346] 880: E49128 Novel G protein-conjugated receptor protein gi|18629265|dbj|E49128.1|[18629265]

[1347] 881: E49127 Novel G protein-conjugated receptor protein gi|18629264|dbj|E49127.1|[18629264]

[1348] 882: E49126 Novel G protein-conjugated receptor protein gi|18629263|dbj|E49126.1|[18629263]

[1349] 883: E49125 Novel G protein-conjugated receptor protein gi|18629262|dbj|E49125.1|[18629262]

[1350] 884: E49124 Novel G protein-conjugated receptor protein gi|18629261|dbj|E49124.1|[18629261]

[1351] 885: E49123 Novel G protein-conjugated receptor protein gi|18629260|dbj|E49123.1|[18629260]

[1352] 887: E58499 Novel G protein-coupled receptor protein, DNA and utilization thereof gi|18628416|dbj|E58499.1|[18628416]

[1353] 888: E58495 Novel G protein-coupled receptor protein, DNA and utilization thereof gi|18628412|dbj|E58495.1|[18628412]

[1354] 889: E58494 Novel G protein-coupled receptor protein, DNA and utilization thereof gi|18628411|dbj|E58494.1|[18628411]

[1355] 890: E58488 Novel G protein-coupled receptor protein, DNA and utilization thereof gi|18628405|dbj|E58488.1|[18628405]

[1356] 891: E58485 Novel G protein-coupled receptor protein, DNA and utilization thereof gi|18628402|dbj|E58485.1|[18628402]

[1357] 892: E58484 Novel G protein-coupled receptor protein, DNA and utilization thereof gi|18628401|dbj|E58484.1|[18628401]

[1358] 893: E58479 Novel G protein-coupled receptor protein, DNA and utilization thereof gi|18628396|dbj|E58479.1|[18628396]

[1359] 902: E43451 Novel protein G-coupled receptor protein and DNA thereof gi|18627717|dbj|E43451.1|[18627717]

[1360] 903: E43450 Novel protein G-coupled receptor protein and DNA thereof gi|18627716|dbj|E43450.1|[18627716]

[1361] 904: E41270 Novel G protein-conjugate receptor protein and its DNA gi|18627502|dbj|E41270.1|[18627502]

[1362] 905: E41269 Novel G protein-conjugate receptor protein and its DNA gi|18627501|dbj|E41269.1|[18627501]

[1363] 906: E41268 Novel G protein-conjugate receptor protein and its DNA gi|18627500|dbj|E41268.1|[18627500]

[1364] 907: E40003 Novel G protein-conjugate receptor protein and its DNA gi|18627119|dbj|E40003.1|[18627119]

[1365] 908: E40000 Novel G protein-conjugate receptor protein and its DNA gi|18627116|dbj|E40000.1|[18627116]

[1366] 909: E39999 Novel G protein-conjugate receptor protein and its DNA gi|18627115|dbj|E39999.1|[18627115]

[1367] 910: E39824 Novel guanosine triphospate (GTP)-binding protein-conjugate receptor protein gi|18627105|dbj|E39824.1|[18627105]

[1368] 911: E39817 Novel guanosine triphospate (GTP)-binding protein-conjugate receptor protein gi|18627098|dbj|E39817.1|[18627098]

[1369] 912: E39816 Novel guanosine triphospate (GTP)-binding protein-conjugate receptor protein gi|18627097|dbj|E39816.1|[18627097]

[1370] 913: E39815 Novel guanosine triphospate (GTP)-binding protein-conjugate receptor protein gi|18627096|dbj|E39815.1|[18627096]

[1371] 929: E34464 Novel Toll-like receptor and gene thereof gi|18624350|dbj|E34464.1|[18624350]

[1372] 930: E33807 Human splice mutant CXCR4B of CXCR4 chemokine receptor gi|18624164|dbj|E33807.1|[18624164]

[1373] 931: E33806 Human splice mutant CXCR4B of CXCR4 chemokine receptor gi|18624163|dbj|E33806.1|[18624163]

[1374] 941: E63757 Human nurse cell receptor gene gi|18622844|dbj|E63757.1|[18622844]

[1375] 942: E63756 Human nurse cell receptor gene gi|18622843|dbj|E63756.1|[18622843]

[1376] 943: E63754 Human nurse cell receptor gene gi|18622841|dbj|E63754.1|[18622841]

[1377] 944: E49275 Novel G protein-conjugated receptor protein and DNA thereof gi|18622037|dbj|E49275.1|[18622037]

[1378] 945: E44151 Novel G protein-coupled receptor protein and DNA thereof gi|18622012|dbj|E44151.1|[18622012]

[1379] 946: E44032 Novel G protein-coupled receptor protein and DNA and ligand of the same gi|18621998|dbj|E44032.1|[18621998]

[1380] 947: AX350990 Sequence 24 from Patent WO0190358 gi|18616366|emb|AX350990.1|[18616366]

[1381] 948: AX350988 Sequence 22 from Patent WO0190358 gi|18616364|emb|AX350988.1|[18616364]

[1382] 949: AX350984 Sequence 18 from Patent WO0190358 gi|18616360|emb|AX350984.1|[18616360]

[1383] 950: AX350982 Sequence 16 from Patent WO0190358 gi|18616358|emb|AX350982.1|[18616358]

[1384] 951: AX350981 Sequence 15 from Patent WO0190358 gi|18616357|emb|AX350981.1|[18616357]

[1385] 952: AX350979 Sequence 13 from Patent WO0190358 gi|18616355|emb|AX350979.1|[18616355]

[1386] 953: AX350975 Sequence 9 from Patent WO0190358 gi|18616351|emb|AX350975.1|[18616351]

[1387] 954: AX350973 Sequence 7 from Patent WO0190358 gi|18616349|emb|AX350973.1|[18616349]

[1388] 955: AX350969 Sequence 3 from Patent WO0190358 gi|18616345|emb|AX350969.1|[18616345]

[1389] 956: AX350967 Sequence 1 from Patent WO0190358 gi|18616343|emb|AX350967.1|[18616343]

[1390] 957: NM—005608 Homo sapiens protein tyrosine phosphatase, receptor type, C-associated protein (PTPRCAP), mRNA gi|5032004|ref|NM—005608.1|[5032004]

[1391] 958: XM—012097 Homo sapiens olfactory receptor, family 6, subfamily A, member 1 (OR6A1), mRNA gi|18605332|ref|XM—012097.3|[18605332]

[1392] 959: XM—090173 Homo sapiens olfactory receptor, family 5, subfamily L, member 2 (OR5L2), mRNA gi|18605181|ref|XM—090173.1|[18605181]

[1393] 960: XM—055369 Homo sapiens pro-oncosis receptor inducing membrane injury gene (PORIMIN), mRNA gi|18604484|ref|XM—055369.2|[18604484]

[1394] 961: XM—041961 Homo sapiens PYK2 N-terminal domain-interacting receptor 1 (NIR1), mRNA gi|18604126|ref|XM—041961.2|[18604126]

[1395] 962: XM—040037 Homo sapiens adrenergic, beta, receptor kinase 1 (ADRBK1), mRNA gi|18604053|ref|XM—040037.3|[18604053]

[1396] 963: XM—045532 Homo sapiens olfactory receptor, family 51, subfamily E, member 2 (OR51E2), mRNA gi|18603788|ref|XM—045532.2|[18603788]

[1397] 964: XM—091465 Homo sapiens olfactory receptor, family 4, subfamily D, member 1 (OR4D1), mRNA gi|18603196|ref|XM—091465.1|[18603196]

[1398] 965: XM—036784 Homo sapiens phosphatidylserine receptor (KIAA0585), mRNA gi|18603024|ref|XM—036784.3|[18603024]

[1399] 966: XM—036728 Homo sapiens ryanodine receptor 3 (RYR3), mRNA gi|18602746|ref|XM—036728.3|[18602746]

[1400] 967: XM—084025 Homo sapiens complement component 5 receptor 1 (C5a ligand) (C5R1), mRNA gi|18601827|ref|XM—084025.1|[18601827]

[1401] 968: XM—009107 Homo sapiens KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 1 (KDELR1), mRNA gi|18601740|ref|XM—009107.6|[18601740]

[1402] 969: XM—027883 Homo sapiens protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 3 (PPFIA3), mRNA gi|18601690|ref|XM—027883.2|[18601690]

[1403] 970: XM—027904 Homo sapiens Fc fragment of IgG, receptor, transporter, alpha (FCGRT), mRNA gi|18601656|ref|XM—027904.4|[18601656]

[1404] 971: XM—049229 Homo sapiens dopamine receptor interacting protein (DRIP78), mRNA gi|18601498|ref|XM—049229.3|[18601498]

[1405] 972: XM—040709 Homo sapiens prostaglandin F2 receptor negative regulator (PTGFRN), mRNA gi|18601130|ref|XM—040709.2|[18601130]

[1406] 973: XM—003091 Homo sapiens G protein-coupled receptor 105 (GPR105), mRNA gi|18600688|ref|XM—003091.5|[18600688]

[1407] 975: XM—010533 Homo sapiens interleukin 12 receptor, beta 2 (IL12RB2), mRNA gi|18600602|ref|XM—010533.4|[18600602]

[1408] 976: NT—006318 Homo sapiens chromosome 4 working draft sequence segment gi|18600353|ref|NT—006318.7|Hs4—6475[18600353]

[1409] 977: XM—039145 Homo sapiens cholinergic receptor, nicotinic, alpha polypeptide 3 (CHRNA3), mRNA gi|18597785|ref|XM—039145.3|[18597785]

[1410] 978: XM—039151 Homo sapiens cholinergic receptor, nicotinic, beta polypeptide 4 (CHRNB4), mRNA gi|18597777|ref|XM—039151.2|[18597777]

[1411] 979: XM—007392 Homo sapiens G protein-coupled receptor 65 (GPR65), mRNA gi|18597722|ref|XM—007392.4|[18597722]

[1412] 980: XM—007315 Homo sapiens receptor-interacting serine-threonine kinase 3 (RIPK3), mRNA gi|18597625|ref|XM—007315.2|[18597625]

[1413] 981: NT—024675 Homo sapiens chromosome 15 working draft sequence segment gi|18597616|ref|NT—024675.7|Hs15—24831[18597616]

[1414] 982: XM—051711 Homo sapiens prostaglandin D2 receptor (DP) (PTGDR), mRNA gi|18597012|ref|XM—051711.2|[18597012]

[1415] 983: XM—007337 Homo sapiens kinectin 1 (kinesin receptor) (KTN1), mRNA gi|18596970|ref|XM—007337.7|[18596970]

[1416] 984: XM—096782 Homo sapiens putative leukocyte platelet-activating factor receptor (HUMNPIIY20), mRNA gi|18596920|ref|XM—096782.1|[18596920]

[1417] 985: XM—055898 Homo sapiens nerve growth factor receptor (TNFRSF16) associated protein 1 (NGFRAP1), mRNA gi|18596422|ref|XM—055898.3|[18596422]

[1418] 986: XM—018505 Homo sapiens G protein-coupled receptor 23 (GPR23), mRNA gi|18594906|ref|XM—018505.3|[18594906]

[1419] 987: XM—096288 Homo sapiens G protein-coupled receptor 64 (GPR64), mRNA gi|18594854|ref|XM—096288.1|[18594854]

[1420] 988: XM—096154 Homo sapiens angiotensin receptor-like 2 (AGTRL2), mRNA gi|18593950|ref|XM—096154.1|[18593950]

[1421] 989: XM—015620 Homo sapiens nogo receptor (NOGOR), mRNA gi|18593698|ref|XM—015620.5|[18593698]

[1422] 990: XM—048563 Homo sapiens interferon gamma receptor 2 (interferon gamma transducer 1) (IFNGR2), mRNA gi|18593096|ref|XM—048563.2|[18593096]

[1423] 991: XM—086754 Homo sapiens coxsackie virus and adenovirus receptor (CXADR), mRNA gi|18592977|ref|XM—086754.1|[18592977]

[1424] 992: XM—056242 Homo sapiens protein C receptor, endothelial (EPCR) (PROCR), mRNA gi|18592822|ref|XM—056242.3|[18592822]

[1425] 993: XM—097415 Homo sapiens leukocyte receptor cluster (LRC) member 8 (LENG8), mRNA gi|18591238|ref|XM—097415.1|[18591238]

[1426] 994: XM—044314 Homo sapiens leukocyte immunoglobulin-like receptor, subfamily A (without TM domain), member 4 (ILT7), mRNA gi|18591234|ref|XM—044314.4|[18591234]

[1427] 995: XM—092068 Homo sapiens olfactory receptor, family 7, subfamily C, member 1 (OR7C1), mRNA gi|18591224|ref|XM—092068.1|[18591224]

[1428] 996: XM—084042 Homo sapiens egf-like module containing, mucin-like, hormone receptor-like sequence 2 (EMR2), mRNA gi|18591222|ref|XM—084042.1|[18591222]

[1429] 997: XM—012893 Homo sapiens endothelial differentiation, lysophosphatidic acid G-protein-coupled receptor, 4 (EDG4), mRNA gi|18591032|ref|XM—012893.5|[18591032]

[1430] 998: XM—103288 Homo sapiens polycythemia rubra vera 1; cell surface receptor (PRV1), mRNA gi|18590882|ref|XM—103288.1|[18590882]

[1431] 999: XM—046103 Homo sapiens protein tyrosine phosphatase, receptor type, S (PTPRS), mRNA gi|18590850|ref|XM—046103.3|[18590850]

[1432] 1000: XM—047633 Homo sapiens thromboxane A2 receptor (TBXA2R), mRNA gi|18590817|ref|XM—047633.2|[18590817]

[1433] 1001: XM—030637 Homo sapiens G protein-coupled receptor kinase 7 (GPRK7), mRNA gi|18590749|ref|XM—030637.3|[18590749]

[1434] 1002: XM—086017 Homo sapiens plasminogen activator, urokinase receptor (PLAUR), mRNA gi|18590707|ref|XM—086017.1|[18590707]

[1435] 1003: XM—029455 Homo sapiens ryanodine receptor 1 (skeletal) (RYR1), mRNA gi|18590460|ref|XM—029455.2|[18590460]

[1436] 1004: XM—085976 Homo sapiens leukocyte receptor cluster (LRC) member 3 (LENG3), mRNA gi|18590428|ref|XM—085976.1|[18590428]

[1437] 1005: XM—084028 Homo sapiens killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 1 (KIR3DL1), mRNA gi|18590419|ref|XM—084028.1|[18590419]

[1438] 1006: XM—097304 Homo sapiens leukocyte receptor cluster (LRC) member 1 (LENG1), mRNA gi|18590235|ref|XM—097304.1|[18590235]

[1439] 1007: XM—050582 Homo sapiens leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 3 (LILRB3), mRNA gi|18590233|ref|XM—050582.3|[18590233]

[1440] 1008: XM—041258 Homo sapiens leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 2 (LILRB2), mRNA gi|18590231|ref|XM—041258.3|[18590231]

[1441] 1009: XM—050236 Homo sapiens leukocyte receptor cluster (LRC) member 4 (LENG4), mRNA gi|18590224|ref|XM—050236.3|[18590224]

[1442] 1010: XM—48346 Homo sapiens insulin receptor (INSR), mRNA gi|18590185|ref|XM—048346.3|[18590185]

[1443] 1011: XM—044591 Homo sapiens G protein-coupled receptor 108 (GPR108), mRNA gi|18590160|ref|XM—044591.3|[18590160]

[1444] 1012: XM—085864 Homo sapiens endothelial differentiation, sphingolipid G-protein-coupled receptor, 8 (EDG8), mRNA gi|18589990|ref|XM—085864.1|[18589990]

[1445] 1013: XM—044320 Homo sapiens poliovirus receptor-related 2 (herpesvirus entry mediator B) (PVRL2), mRNA gi|18589873|ref|XM—044320.4|[18589873]

[1446] 1014: XM—012671 Homo sapiens olfactory receptor, family 1, subfamily E, member 2 (OR1E2), mRNA gi|18588331|ref|XM—012671.5|[18588331]

[1447] 1015: XM—085745 Homo sapiens somatostatin receptor 2 (SSTR2), mRNA gi|18588314|ref|XM—085745.1|[18588314]

[1448] 1016: XM—008646 Homo sapiens cytokine receptor-like factor 3 (CRLF3), mRNA gi|18588105|ref|XM—008646.5|[18588105]

[1449] 1017: XM—008509 Homo sapiens purinergic receptor P2X, ligand-gated ion channel, 5 (P2RX5), mRNA gi|18587692|ref|XM—008509.6|[18587692]

[1450] 1018: XM—030851 Homo sapiens G protein-coupled receptor kinase-interactor 1 (GIT1), mRNA gi|18587652|ref|XM—030851.2|[18587652]

[1451] 1019: XM—048233 Homo sapiens autocrine motility factor receptor (AMFR), mRNA gi|18585872|ref|XM—048233.3|[18585872]

[1452] 1020: NT—010280 Homo sapiens chromosome 15 working draft sequence segment gi|18584150|ref|NT—010280.8|Hs15—10437[18584150]

[1453] 1021: XM—039208 Homo sapiens gamma-aminobutyric acid (GABA) A receptor, gamma 3 (GABRG3), mRNA gi|18584141|ref|XM—039208.5|[18584141]

[1454] 1022: XM—030709 Homo sapiens transient receptor potential cation channel, subfamily M, member 7 (TRPM7), mRNA gi|18583756|ref|XM—030709.3|[18583756]

[1455] 1023: XM—085103 Homo sapiens G protein-coupled receptor (G2A), mRNA gi|18583332|ref|XM—085103.1|[18583332]

[1456] 1024: XM—040854 Homo sapiens bradykinin receptor B2 (BDKRB2), mRNA gi|18582977|ref|XM—040854.2|[18582977]

[1457] 1025: XM—007275 Homo sapiens bradykinin receptor B1 (BDKRB1), mRNA gi|18582976|ref|XM—007275.4|[18582976]

[1458] 1027: XM—083897 Homo sapiens Epstein-Barr virus induced gene 2 (lymphocyte-specific G protein-coupled receptor) (EBI2), mRNA gi|18581588|ref|XM—083897.1|[18581588]

[1459] 1029: XM—062656 Homo sapiens C-type lectin-like receptor (CLEC-6), mRNA gi|18580484|ref|XM—062656.2|[18580484]

[1460] 1031: XM—084785 Homo sapiens protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 2 (PPFIA2), mRNA gi|18579245|ref|XM—084785.1|[18579245]

[1461] 1032: XM—043322 Homo sapiens peroxisome receptor 1 (PXR1), mRNA gi|18579222|ref|XM—043322.3|[18579222]

[1462] 1033: XM—090117 Homo sapiens olfactory receptor, family 8, subfamily G, member 2 (ORBG2), mRNA gi|18578560|ref|XM—090117.1|[18578560]

[1463] 1034: XM—090109 Homo sapiens olfactory receptor, family 8, subfamily G, member 1 (OR8G1), mRNA gi|18578546|ref|XM—090109.1|[18578546]

[1464] 1035: XM—035095 Homo sapiens cortical thymocyte receptor (X. laevis CTX) like (CTXL), mRNA gi|18578508|ref|XM—035095.4|[18578508]

[1465] 1036: XM—084690 Homo sapiens olfactory receptor, family 8, subfamily B, member 8 (OR8B8), mRNA gi|18578501|ref|XM—084690.1|[18578501]

[1466] 1037: XM—012064 Homo sapiens glutamate receptor, ionotropic, kainate 4 (GRIK4), mRNA gi|18578454|ref|XM—012064.6|[18578454]

[1467] 1039: XM—031348 Homo sapiens glutamate receptor, metabotropic 5 (GRMS), mRNA gi|18577875|ref|XM—031348.2|[18577875]

[1468] 1040: XM—089965 Homo sapiens olfactory receptor, family 10, subfamily A, member 3 (OR10A3), mRNA gi|18577828|ref|XM—089965.1|[18577828]

[1469] 1041: NT—030791 Homo sapiens chromosome 11 working draft sequence segment gi|18577645|ref|NT—030791.2|Hs11—31047[18577645]

[1470] 1042: XM—006549 Homo sapiens G protein-coupled receptor 48 (GPR48), mRNA gi|18577644|ref|XM—006549.5|[18577644]

[1471] 1043: XM—054215 Homo sapiens purinergic receptor P2Y, G-protein coupled, 2 (P2RY2), mRNA gi|18577261|ref|XM—054215.4|[18577261]

[1472] 1044: XM—038024 Homo sapiens protein tyrosine phosphatase, receptor type, J (PTPRJ), mRNA gi|18577179|ref|XM—038024.4|[18577179]

[1473] 1045: XM—049296 Homo sapiens GDNF family receptor alpha 1 (GFRA1), mRNA gi|18576832|ref|XM—049296.4|[18576832]

[1474] 1046: XM—005781 Homo sapiens protein tyrosine phosphatase, receptor type, E (PTPRE), mRNA gi|18576581|ref|XM—005781.5|[18576581]

[1475] 1047: XM—011904 Homo sapiens cubilin (intrinsic factor-cobalamin receptor) (CUBN), mRNA gi|18576082|ref|XM—011904.6|[18576082]

[1476] 1048: XM—005969 Homo sapiens G protein-coupled receptor kinase 5 (GPRK5), mRNA gi|18575440|ref|XM—005969.6|[18575440]

[1477] 1049: XM—089569 Homo sapiens VPS10 domain receptor protein SORCS 1 (SORCS1), mRNA gi|18574995|ref|XM—089569.1|[18574995]

[1478] 1050: XM—005830 Homo sapiens mannose receptor, C type 1 (MRC1), mRNA gi|18574297|ref|XM—005830.7|[18574297]

[1479] 1051: XM—005747 Homo sapiens tachykinin receptor 2 (TACR2), mRNA gi|18574167|ref|XM—005747.5|[18574167]

[1480] 1052: XM—043613 Homo sapiens glutamate receptor, ionotropic, delta 1 (GRID1), mRNA gi|18574031|ref|XM—043613.4|[18574031]

[1481] 1053: XM—028830 Homo sapiens transient receptor potential cation channel, subfamily M, member 6 (TRPM6), mRNA gi|18573768|ref|XM—028830.3|[18573768]

[1482] 1054: XM—095961 Homo sapiens olfactory receptor, family 2, subfamily K, member 2 (OR2K2), mRNA gi|18573486|ref|XM—095961.1|[18573486]

[1483] 1055: XM—096286 Homo sapiens receptor tyrosine kinase-like orphan receptor 2 (ROR2), mRNA gi|18573067|ref|XM—096286.1|[18573067]

[1484] 1056: XM—095815 Homo sapiens olfactory receptor, family 1, subfamily J, member 5 (OR1J5), mRNA gi|18572435|ref|XM—095815.1|[18572435]

[1485] 1057: XM—095814 Homo sapiens olfactory receptor, family 1, subfamily J, member 4 (OR1J4), mRNA gi|18572433|ref|XM—095814.1|[18572433]

[1486] 1059: XM—011695 Homo sapiens leptin receptor overlapping transcript-like 1 (LEPROTL1), mRNA gi|18570296|ref|XM—011695.3|[18570296]

[1487] 1061: XM—088035 Homo sapiens transient receptor potential cation channel, subfamily V, member 6 (TRPV6), mRNA gi|18565882|ref|XM—088035.1|[18565882]

[1488] 1062: XM—004696 Homo sapiens EphB6 (EPHB6), mRNA gi|18565881|ref|XM—004696.5|[18565881]

[1489] 1063: XM—096245 Homo sapiens olfactory receptor, family 2, subfamily H, member 3 (OR2H3), mRNA gi|18564780|ref|XM—096245.1|[18564780]

[1490] 1064: XM—084200 Homo sapiens olfactory receptor, family 11, subfamily A, member 1 (OR11A1), mRNA gi|18563692|ref|XM—084200.1|[18563692]

[1491] 1065: XM—084190 Homo sapiens olfactory receptor, family 2, subfamily A, member 4 (OR2A4), mRNA gi|18563106|ref|XM—084190.1|[18563106]

[1492] 1066: XM—004341 Homo sapiens opioid receptor, mu 1 (OPRM1), mRNA gi|18562969|ref|XM—004341.6|[18562969]

[1493] 1067: XM—084185 Homo sapiens dopamine receptor D1 (DRD1), mRNA gi|18561988|ref|XM—084185.1|[18561988]

[1494] 1069: XM—049570 Homo sapiens dioxin receptor repressor (AHRR), mRNA gi|18560847|ref|XM—049570.4|[18560847]

[1495] 1070: XM—084176 Homo sapiens coagulation factor II (thrombin) receptor-like 1 (F2RL1), mRNA gi|18560787|ref|XM—084176.1|[18560787]

[1496] 1071: NT—029289 Homo sapiens chromosome 5 working draft sequence segment gi|18560495|ref|NT—029289.4|Hs5—29448[18560495]

[1497] 1072: XR—000069 Homo sapiens neuropeptide Y receptor Y6 (psuedogene) (NPY6R), misc RNA gi|18560235|ref|XR—000069.1|[18560235]

[1498] 1073: NT—025716 Homo sapiens chromosome 5 working draft sequence segment gi|18560224|ref|NT—025716.6|Hs5—25872[18560224]

[1499] 1074: XM—094306 Homo sapiens gamma-aminobutyric acid (GABA) A receptor, alpha 1 (GABRA1), mRNA gi|18560222|ref|XM—094306.1|[18560222]

[1500] 1075: XM—096226 Homo sapiens interleukin 7 receptor (IL7R), mRNA gi|18560176|ref|XM—096226.1|[18560176]

[1501] 1076: XM—031131 Homo sapiens leukemia inhibitory factor receptor (LIFR), mRNA gi|18559952|ref|XM—031131.2|[18559952]

[1502] 1077: XM—011222 Homo sapiens gamma-aminobutyric acid (GABA) A receptor, beta 2 (GABRB2), mRNA gi|18559788|ref|XM—011222.6|[18559788]

[1503] 1078: XM—003519 Homo sapiens gamma-aminobutyric acid (GABA) A receptor, beta 1 (GABRB1), mRNA gi|18558473|ref|XM—003519.3|[18558473]

[1504] 1079: XM—038446 Homo sapiens melatonin receptor 1A (MTNR1A), mRNA gi|18558343|ref|XM—038446.2|[18558343]

[1505] 1080: XM—084160 Homo sapiens gamma-aminobutyric acid (GABA) A receptor, alpha 2 (GABRA2), mRNA gi|18558328|ref|XM—084160.1|[18558328]

[1506] 1081: XM—011169 Homo sapiens neuropeptide Y receptor Y2 (NPY2R), mRNA gi|18558281|ref|XM—011169.3|[18558281]

[1507] 1082: XM—044120 Homo sapiens fibroblast growth factor receptor 3 (achondroplasia, thanatophoric dwarfism) (FGFR3), mRNA gi|18558241|ref|XM—044120.2|[18558241]

[1508] 1083: NT—030654 Homo sapiens chromosome 4 working draft sequence segment gi|18557828|ref|NT—030654.2|Hs4—30910[18557828]

[1509] 1084: NT—030650 Homo sapiens chromosome 4 working draft sequence segment gi|18557822|ref|NT—030650.2|Hs4—30906[18557822]

[1510] 1085: XM—011173 Homo sapiens glutamate receptor, ionotropic, delta 2 (GRID2), mRNA gi|18557816|ref|XM—011173.4|[18557816]

[1511] 1086: NT—029955 Homo sapiens chromosome 4 working draft sequence segment gi|18557687|ref|NT—029955.3|Hs4—30210[18557687]

[1512] 1087: NT—025693 Homo sapiens chromosome 4 working draft sequence segment gi|18557505|ref|NT—025693.3|Hs4—25849[18557505]

[1513] 1088: NM—019841 Homo sapiens transient receptor potential cation channel, subfamily V, member 5 (TRPV5), mRNA gi|17505199|ref|NM—019841.2|[17505199]

[1514] 1089: NT—030778 Homo sapiens chromosome 10 working draft sequence segment gi|17489667|ref|NT—030778.1|Hs10—31034[17489667]

[1515] 1090: NT—010591 Homo sapiens chromosome 16 working draft sequence segment gi|17487829|ref|NT—010591.6|Hs16—10748[17487829]

[1516] 1091: NT—030889 Homo sapiens chromosome X working draft sequence segment gi|17486981|ref|NT—030889.1|HsX—31145[17486981]

[1517] 1092: XM—066104 Homo sapiens G protein-coupled receptor 73-like 1 (GPR73L1), mRNA gi|17484462|ref|XM—066104.1|[17484462]

[1518] 1093: XM—056414 Homo sapiens killer cell immunoglobulin-like receptor, two domains, long cytoplasmic tail, 4 (KIR2DL4), mRNA gi|17483039|ref|XM—056414.2|[17483039]

[1519] 1094: XM—053166 Homo sapiens somatostatin receptor-interacting protein (SSTRIP), mRNA gi|17482811|ref|XM—053166.3|[17482811]

[1520] 1096: XM—008489 Homo sapiens acetyl LDL receptor; SREC=scavenger receptor expressed by endothelial cells (SREC), mRNA gi|17481055|ref|XM—008489.7|[17481055]

[1521] 1097: XM—044091 Homo sapiens cholinergic receptor, nicotinic, alpha polypeptide 7 (CHRNA7), mRNA gi|17477913|ref|XM—044091.2|[17477913]

[1522] 1098: NT—010258 Homo sapiens chromosome 15 working draft sequence segment gi|17477780|ref|NT—010258.7|Hs15—10415[17477780]

[1523] 1099: XM—038336 Homo sapiens neurotrophic tyrosine kinase, receptor, type 3 (NTRK3), mRNA gi|17477779|ref|XM—038336.2|[17477779]

[1524] 1101: XM—027181 Homo sapiens transient receptor potential cation channel, subfamily V, member 4 (TRPV4), mRNA gi|17475007|ref|XM—027181.2|[17475007]

[1525] 1102: XM—047362 Homo sapiens Glutamate receptor interacting protein (GRIP1), mRNA gi|17474492|ref|XM—047362.3|[17474492]

[1526] 1104: XM—006372 Homo sapiens aryl hydrocarbon receptor interacting protein (AIP), mRNA gi|17472888|ref|XM—006372.4|[17472888]

[1527] 1105: XM—004893 Homo sapiens receptor (calcitonin) activity modifying protein 3 (RAMP3), mRNA gi|17464777|ref|XM—004893.4|[17464777]

[1528] 1107: XM—004559 Homo sapiens discoidin domain receptor family, member 1 (DDR1), mRNA gi|17464405|ref|XM—004559.5|[17464405]

[1529] 1108: XM—004237 Homo sapiens insulin-like growth factor 2 receptor (IGF2R), mRNA gi|17463326|ref|XM—004237.4|[17463326]

[1530] 1109: XM—051214 Homo sapiens type 1 tumor necrosis factor receptor shedding aminopeptidase regulator (ARTS-1), mRNA gi|17462792|ref|XM—051214.2|[17462792]

[1531] 1110: XM—059645 Homo sapiens neuropeptide Y receptor Y1 (NPY1R), mRNA gi|17462720|ref|XM—059645.1|[17462720]

[1532] 1111: XM—044493 Homo sapiens cholecystokinin B receptor (CCKBR), mRNA gi|17461537|ref|XM—044493.2|[17461537]

[1533] 1112: XM—048562 Homo sapiens interferon (alpha, beta and omega) receptor 1 (IFNAR1), mRNA gi|17460140|ref|XM—048562.3|[17460140]

[1534] 1113: XM—040307 Homo sapiens low density lipoprotein receptor defect B complementing (LDLB), mRNA gi|17459160|ref|XM—040307.2|[17459160]

[1535] 1114: XM—046949 Homo sapiens glutamate receptor, ionotropic, N-methyl D-aspartate 2C (GRIN2C), mRNA gi|17457940|ref|XM—046949.3|[17457940]

[1536] 1115: XM—050937 Homo sapiens galanin receptor 1 (GALR1), mRNA gi|17457665|ref|XM—050937.2|[17457665]

[1537] 1116: XM—058224 Homo sapiens protein tyrosine phosphatase, receptor type, M (PTPRM), mRNA gi|17457059|ref|XM—058224.1|[17457059]

[1538] 1117: XM—059877 Homo sapiens scavenger receptor cysteine rich domain containing, group B (4 domains) (SRCRB4D), mRNA gi|17452620|ref|XM—059877.1|[17452620]

[1539] 1118: XM—030074 Homo sapiens corticotropin releasing hormone receptor 2 (CRHR2), mRNA gi|17451624|ref|XM—030074.2|[17451624]

[1540] 1119: XM—036899 Homo sapiens paired immunoglobulin-like receptor alpha (PILR(ALPHA)), mRNA gi|17450024|ref|XM—036899.2|[17450024]

[1541] 1120: XM—040292 Homo sapiens glutamate receptor, ionotropic, AMPA 1 (GRIA1), mRNA gi|17447971|ref|XM—040292.3|[17447971]

[1542] 1121: XM—003913 Homo sapiens integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor) (ITGA2), mRNA gi|17447767|ref|XM—003913.5|[17447767]

[1543] 1122: XM—052621 Homo sapiens VPS10 domain receptor protein (SORCS2), mRNA gi|17447359|ref|XM—052621.2|[17447359]

[1544] 1123: XM—011186 Homo sapiens platelet-derived growth factor receptor, alpha polypeptide (PDGFRA), mRNA gi|17446713|ref|XM—011186.5|[17446713]

[1545] 1124: XM—037260 Homo sapiens coagulation factor II (thrombin) receptor (F2R), mRNA gi|17446698|ref|XM—037260.3|[17446698]

[1546] 1125: XM—068231 Homo sapiens G protein-coupled receptor 78 (GPR78), mRNA gi|17446518|ref|XM—068231.1|[17446518]

[1547] 1126: XM—003896 Homo sapiens growth hormone receptor (GHR), mRNA gi|17446516|ref|XM—003896.5|[17446516]

[1548] 1127: XM—003883 Homo sapiens prolactin receptor (PRLR), mRNA gi|17446302|ref|XM—003883.4|[17446302]

[1549] 1128: XM—003423 Homo sapiens toll-like receptor 6 (TLR6), mRNA gi|17443462|ref|XM—003423.5|[17443462]

[1550] 1129: XM—050674 Homo sapiens kinase insert domain receptor (a type III receptor tyrosine kinase) (KDR), mRNA gi|17443063|ref|XM—050674.2|[17443063]

[1551] 1130: XM—016537 Homo sapiens low density lipoprotein receptor-related protein 8, apolipoprotein e receptor (LRP8), mRNA gi|17438001|ref|XM—016537.4|[17438001]

[1552] 1131: XM—050512 Homo sapiens activin A receptor, type I (ACVR1), mRNA gi|17437640|ref|XM—050512.3|[17437640]

[1553] 1132: XM—011248 Homo sapiens adrenergic, alpha-1B-, receptor (ADRA1B), mRNA gi|17437111|ref|XM—011248.5|[17437111]

[1554] 1133: XM—057299 Homo sapiens very large G protein-coupled receptor 1 (VLGR1), mRNA gi|17436651|ref|XM—057299.2|[17436651]

[1555] 1134: XM—042825 Homo sapiens luteinizing hormone/choriogonadotropin receptor (LHCGR), mRNA gi|17433844|ref|XM—042825.3|[17433844]

[1556] 1135: XM—039993 Homo sapiens fms-related tyrosine kinase 1 (vascular endothelial growth factor/vascular permeability factor receptor) (FLT1), mRNA gi|16188964|ref|XM—039993.2|[16188964]

[1557] 1136: XM—028642 Homo sapiens integrin, alpha 5 (fibronectin receptor, alpha polypeptide) (ITGA5), mRNA gi|16186750|ref|XM—028642.2|[16186750]

[1558] 1137: XM—057337 Homo sapiens cholinergic receptor, muscarinic 1 (CHRM1), mRNA gi|16184321|ref|XM—057337.1|[16184321]

[1559] 1138: XM—006447 Homo sapiens interleukin 10 receptor, alpha (IL10RA), mRNA gi|16183626|ref|XM—006447.5|[16183626]

[1560] 1139: XM—057984 Homo sapiens G protein-coupled receptor 51 (GPR51), mRNA gi|16181083|ref|XM—057984.1|[16181083]

[1561] 1140: XM—057452 Homo sapiens toll-like receptor 4 (TLR4), mRNA gi|16179752|ref|XM—057452.1|[16179752]

[1562] 1141: XM—051505 Homo sapiens opioid receptor, kappa 1 (OPRK1), mRNA gi|16179331|ref|XM—051505.2|[16179331]

[1563] 1142: XM—027651 Homo sapiens tumor necrosis factor receptor superfamily, member 10b (TNFRSF10B), mRNA gi|16178146|ref|XM—027651.2|[16178146]

[1564] 1144: XM—028141 Homo sapiens killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 2 (KIR3DL2), mRNA gi|16176785|ref|XM—028141.2|[16176785]

[1565] 1145: XM—004872 Homo sapiens atrophin-1 interacting protein 1; activin receptor interacting protein 1 (KIAA0705), mRNA gi|16175845|ref|XM—004872.6|[16175845]

[1566] 1146: XM—057372 Homo sapiens tumor necrosis factor receptor superfamily, member 5 (TNFRSF5), mRNA gi|16174074|ref|XM—057372.1|[16174074]

[1567] 1147: XM—056391 Homo sapiens BAFF receptor (BAFFR), mRNA gi|16168558|ref|XM—056391.1|[16168558]

[1568] 1148: XM—054949 Homo sapiens transient receptor potential cation channel, subfamily V, member 2 (TRPV2), mRNA gi|16165271|ref|XM—054949.1|[16165271]

[1569] 1149: XM—009219 Homo sapiens endothelial differentiation, G-protein-coupled receptor 6 (EDG6), mRNA gi|16163259|ref|XM—009219.5|[16163259]

[1570] 1150: XM—057188 Homo sapiens transient receptor potential cation channel, subfamily M, member 4 (TRPM4), mRNA gi|16162857|ref|XM—057188.1|[16162857]

[1571] 1151: XM—033762 Homo sapiens growth factor receptor-bound protein 10 (GRB10), mRNA gi|16162156|ref|XM—033762.2|[16162156]

[1572] 1152: XM—037256 Homo sapiens protein tyrosine phosphatase, receptor type, N polypeptide 2 (PTPRN2), mRNA gi|16162004|ref|XM—037256.2|[16162004]

[1573] 1153: XM—007662 Homo sapiens transient receptor potential cation channel, subfamily M, member 1 (TRPM1), mRNA gi|16161643|ref|XM—007662.6|[16161643]

[1574] 1154: XM—011327 Homo sapiens hepatitis A virus cellular receptor 1 (HAVCR-1), mRNA gi|16159892|ref|XM—011327.4|[16159892]

[1575] 1155: XM—034331 Homo sapiens endothelin receptor type A (EDNRA), mRNA gi|16158485|ref|XM—034331.2|[16158485]

[1576] 1156: XM—002212 Homo sapiens follicle stimulating hormone receptor (FSHR), mRNA gi|16158251|ref|XM—002212.4|[16158251]

[1577] 1157: XM—003736 Homo sapiens G protein-coupled receptor kinase 6 (GPRK6), mRNA gi|16157601|ref|XM—003736.4|[16157601]

[1578] 1158: XM—038350 Homo sapiens platelet-derived growth factor receptor, beta polypeptide (PDGFRB), mRNA gi|16157449|ref|XM—038350.2|[16157449]

[1579] 1159: XM—003789 Homo sapiens colony stimulating factor 1 receptor, formerly McDonough feline sarcoma viral (v-fms) oncogene homolog (CSF1R), mRNA gi|16157447|ref|XM—003789.4|[16157447]

[1580] 1160: XM—054659 Homo sapiens olfactory receptor, family 3, subfamily A, member 3 (OR3A3), mRNA gi|15314104|ref|XM—054659.1|[15314104]

[1581] 1161: XM—054658 Homo sapiens olfactory receptor, family 1, subfamily E, member 1 (OR1E1), mRNA gi|15314100|ref|XM—054658.1|[15314100]

[1582] 1162: XM—006275 Homo sapiens membrane-spanning 4-domains, subfamily A, member 1 (MS4A2), mRNA gi|15311761|ref|XM—006275.4|[15311761]

[1583] 1163: XM—012695 Homo sapiens growth factor receptor-bound protein 7 (GRB7), mRNA gi|15310219|ref|XM—012695.4|[15310219]

[1584] 1164: XM—045812 Homo sapiens G protein-coupled receptor 72 (GPR72), mRNA gi|15308293|ref|XM—045812.2|[15308293]

[1585] 1165: XM—033995 Homo sapiens histamine H4 receptor (HRH4), mRNA gi|15305825|ref|XM—033995.2|[15305825]

[1586] 1166: XM—036978 Homo sapiens tumor necrosis factor receptor superfamily, member 11a, activator of NFKB (TNFRSF11A), mRNA gi|15305343|ref|XM—036978.2|[15305343]

[1587] 1167: XM—015355 Homo sapiens protein tyrosine phosphatase, receptor type, R (PTPRR), mRNA gi|15304370|ref|XM—015355.2|[15304370]

[1588] 1168: XM—006738 Homo sapiens CD36 antigen (collagen type I receptor, thrombospondin receptor)-like 1 (CD36L1), mRNA gi|15303296|ref|XM—006738.5|[15303296]

[1589] 1169: XM—049255 Homo sapiens Fc fragment of IgE, low affinity II, receptor for (CD23A) (FCER2), mRNA gi|15302967|ref|XM—049255.2|[15302967]

[1590] 1170: XM—008930 Homo sapiens coagulation factor II (thrombin) receptor-like 3 (F2RL3), mRNA gi|15302724|ref|XM—008930.4|[15302724]

[1591] 1171: NT—029418 Homo sapiens chromosome 12 working draft sequence segment gi|15302021|ref|NT—029418.1|Hs12—29577[15302021]

[1592] 1173: XM—054004 Homo sapiens glutamate receptor, metabotropic 1 (GRM1), mRNA gi|15299786|ref|XM—054004.1|[15299786]

[1593] 1174: XM—046588 Homo sapiens G protein-coupled receptor slt (SLT), mRNA gi|15299770|ref|XM—046588.2|[15299770]

[1594] 1175: XM—032592 Homo sapiens VPS10 domain receptor protein SORCS 3 (SORCS3), mRNA gi|15299687|ref|XM—032592.2|[15299687]

[1595] 1176: XM—054157 Homo sapiens G protein-coupled receptor 35 (GPR35), mRNA gi|15298180|ref|XM—054157.1|[15298180]

[1596] 1177: XM—042907 Homo sapiens bone morphogenetic protein receptor, type IB (BMPR1B), mRNA gi|15296528|ref|XM—042907.2|[15296528]

[1597] 1178: XM—033031 Homo sapiens peroxisome proliferative activated receptor, gamma, coactivator (PPARGC1), mRNA gi|15295682|ref|XM—033031.2|[15295682]

[1598] 1179: XM—003708 Homo sapiens gamma-aminobutyric acid (GABA) A receptor, pi (GABRP), mRNA gi|15294866|ref|XM—003708.5|[15294866]

[1599] 1180: XM—008189 Homo sapiens CMRF35 leukocyte immunoglobulin-like receptor (CMRF35), mRNA gi|14785569|ref|XM—008189.4|[14785569]

[1600] 1182: XM—033305 Homo sapiens lymphotoxin beta receptor (TNFR superfamily, member 3) (LTBR), mRNA gi|14784387|ref|XM—033305.1|[14784387]

[1601] 1183: XM—004350 Homo sapiens cannabinoid receptor 1 (brain) (CNR1), mRNA gi|14783266|ref|XM—004350.4|[14783266]

[1602] 1184: XM—004285 Homo sapiens peroxisome proliferative activated receptor, delta (PPARD), mRNA gi|14782955|ref|XM—004285.4|[14782955]

[1603] 1185: XM—042636 Homo sapiens inositol 1,4,5-triphosphate receptor, type 3 (ITPR3), mRNA gi|14782869|ref|XM—042636.1|[14782869]

[1604] 1187: XM—050142 Homo sapiens integrin, alpha M (complement component receptor 3, alpha; also known as CD11b (p170), macrophage antigen alpha polypeptide) (ITGAM), mRNA gi|14779440|ref|XM—050142.1|[14779440]

[1605] 1188: XM—037826 Homo sapiens adrenergic, beta, receptor kinase 2 (ADRBK2), mRNA gi|14777914|ref|XM—037826.1|[14777914]

[1606] 1189: XM—036497 Homo sapiens olfactory receptor, family 1, subfamily F, member 2 (OR1F2), mRNA gi|14777865|ref|XM—036497.1|[14777865]

[1607] 1190: XM—036891 Homo sapiens purinergic receptor P2X-like 1, orphan receptor (P2RXL1), mRNA gi|14777537|ref|XM—036891.1|[14777537]

[1608] 1191: XM—007986 Homo sapiens apolipoprotein B48 receptor (APOB48R), mRNA gi|14777420|ref|XM—007986.4|[14777420]

[1609] 1192: XM—047456 Homo sapiens melanocortin 1 receptor (alpha melanocyte stimulating hormone receptor) (MC1R), mRNA gi|14776693|ref|XM—047456.1|[14776693]

[1610] 1193: XM—030214 Homo sapiens glutamate receptor, ionotropic, N-methyl D-aspartate 2A (GRIN2A), mRNA gi|14776459|ref|XM—030214.1|[14776459]

[1611] 1194: XM—049959 Homo sapiens chemokine (C-C motif) receptor 7 (CCR7), mRNA gi|14775963|ref|XM—049959.1|[14775963]

[1612] 1196: XM—048049 Homo sapiens G protein-coupled receptor 56 (GPR56), mRNA gi|14775189|ref|XM—048049.1|[14775189]

[1613] 1197: XM—046488 Homo sapiens glucagon receptor (GCGR), mRNA gi|14775175|ref|XM—046488.1|[14775175]

[1614] 1198: XM—040635 Homo sapiens purinergic receptor P2X, ligand-gated ion channel, 1 (P2RX1), mRNA gi|14774341|ref|XM—040635.1|[14774341]

[1615] 1199: XM—018451 Homo sapiens cholinergic receptor, nicotinic, beta polypeptide 1 (muscle) (CHRNB1), mRNA gi|14773487|ref|XM—018451.2|[14773487]

[1616] 1201: XM—008432 Homo sapiens integrin, alpha 3 (antigen CD49C, alpha 3 subunit of VLA-3 receptor) (ITGA3), mRNA gi|14773206|ref|XM—008432.4|[14773206]

[1617] 1202: XM—047339 Homo sapiens opiate receptor-like 1 (OPRL1), mRNA gi|14772199|ref|XM—047339.1|[14772199]

[1618] 1203: XM—006349 Homo sapiens angiotensin receptor-like 1 (AGTRL1), mRNA gi|14771894|ref|XM—006349.2|[14771894]

[1619] 1204: XM—46182 Homo sapiens purinergic receptor P2X, ligand-gated ion channel, 3 (P2RX3), mRNA gi|14771633|ref|XM—046182.1|[14771633]

[1620] 1205: XM—006312 Homo sapiens sortilin-related receptor, L(DLR class) A repeats-containing (SORL1), mRNA gi|14771251|ref|XM—006312.4|[14771251]

[1621] 1206: XM—012936 Homo sapiens protein tyrosine phosphatase, receptor type, T (PTPRT), mRNA gi|14770881|ref|XM—012936.3|[14770881]

[1622] 1207: XM—040842 Homo sapiens cullin 5 (CUL5), mRNA gi|14770334|ref|XM—040842.1|[14770334]

[1623] 1208: XM—045103 Homo sapiens G protein coupled receptor interacting protein, complement-c1q tumor necrosis factor-related (ZSIG37), mRNA gi|14770190|ref|XM—045103.1|[14770190]

[1624] 1209: XM—040699 Homo sapiens transient receptor potential cation channel, subfamily C, member 6 (TRPC6), mRNA gi|14770156|ref|XM—040699.1|[14770156]

[1625] 1210: XM—040922 Homo sapiens interleukin 13 receptor, alpha 2 (IL13RA2), mRNA gi|14769890|ref|XM—040922.1|[14769890]

[1626] 1211: XM—028854 Homo sapiens cholinergic receptor, nicotinic, alpha polypeptide 4 (CHRNA4), mRNA gi|14769881|ref|XM—028854.1|[14769881]

[1627] 1212: XM—028783 Homo sapiens opioid growth factor receptor (OGFR), mRNA gi|14769761|ref|XM—028783.1|[14769761]

[1628] 1213: XM—050577 Homo sapiens leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 7 (ILT11), mRNA gi|14769454|ref|XM—050577.1|[14769454]

[1629] 1215: XM—045929 Homo sapiens purinergic receptor P2X, ligand-gated ion channel, 4 (P2RX4), mRNA gi|14768232|ref|XM—045929.1|[14768232]

[1630] 1216: XM—006929 Homo sapiens complement component 3a receptor 1 (C3AR1), mRNA gi|14765892|ref|XM—006929.2|[14765892]

[1631] 1217: XM—030897 Homo sapiens angiotensin receptor 2 (AGTR2), mRNA gi|14765825|ref|XM—030897.1|[14765825]

[1632] 1218: XM—037563 Homo sapiens G protein-coupled receptor 54 (GPR54), mRNA gi|14765555|ref|XM—037563.1|[14765555]

[1633] 1219: XM—045549 Homo sapiens FGF receptor activating protein 1 (FRAG1), mRNA gi|14765112|ref|XM—045549.1|[14765112]

[1634] 1220: XM—045706 Homo sapiens toll-like receptor 8 (TLR8), mRNA gi|14764423|ref|XM—045706.1|[14764423]

[1635] 1221: XM—013100 Homo sapiens G protein-coupled receptor 34 (GPR34), mRNA gi|14764061|ref|XM—013100.3|[14764061]

[1636] 1222: XM—012862 Homo sapiens cargo selection protein (mannose 6 phosphate receptor binding protein) (TIP47), mRNA gi|14764025|ref|XM—012862.3|[14764025]

[1637] 1223: XM—035037 Homo sapiens low density lipoprotein receptor-related protein 4 (LRP4), mRNA gi|14763920|ref|XM—035037.1|[14763920]

[1638] 1224: XM—050707 Homo sapiens activin A receptor type II-like 1 (ACVRL1), mRNA gi|14763806|ref|XM—050707.1|[14763806]

[1639] 1225: XM—036573 Homo sapiens low density lipoprotein receptor-related protein 3 (LRP3), mRNA gi|14763070|ref|XM—036573.1|[14763070]

[1640] 1226: XM—012843 Homo sapiens protein tyrosine phosphatase, receptor type, H (PTPRH), mRNA gi|14762603|ref|XM—012843.3|[14762603]

[1641] 1227: XM—006789 Homo sapiens protein tyrosine phosphatase, receptor type, B (PTPRB), mRNA gi|14762249|ref|XM—006789.4|[14762249]

[1642] 1229: XM—034808 Homo sapiens interleukin 1 receptor accessory protein-like 2 (IL1RAPL2), mRNA gi|14760985|ref|XM—034808.1|[14760985]

[1643] 1230: XM—006747 Homo sapiens inositol 1,4,5-triphosphate receptor, type 2 (ITPR2), mRNA gi|14760648|ref|XM—006747.4|[14760648]

[1644] 1231: XM—015921 Homo sapiens putative chemokine receptor; GTP-binding protein (HM74), mRNA gi|14760439|ref|XM—015921.2|[14760439]

[1645] 1232: XM—009008 Homo sapiens egf-like module containing, mucin-like, hormone receptor-like sequence 1 (EMR1), mRNA gi|14759169|ref|XM—009008.4|[14759169]

[1646] 1233: XM—028274 Homo sapiens prostaglandin 12 (prostacyclin) receptor (IP) (PTGIR), mRNA gi|14758807|ref|XM—028274.1|[14758807]

[1647] 1234: XM—007123 Homo sapiens 5-hydroxytryptamine (serotonin) receptor 2A (HTR2A), mRNA gi|14757796|ref|XM—007123.4|[14757796]

[1648] 1235: XM—049518 Homo sapiens intercellular adhesion molecule 1 (CD54), human rhinovirus receptor (ICAM1), mRNA gi|14756651|ref|XM—049518.1|[14756651]

[1649] 1236: XM—049496 Homo sapiens purinergic receptor P2Y, G-protein coupled, 11 (P2RY11), mRNA gi|14756601|ref|XM—049496.1|[14756601]

[1650] 1237: XM—007577 Homo sapiens cholinergic receptor, nicotinic, alpha polypeptide 5 (CHRNA5), mRNA gi|14756537|ref|XM—007577.2|[14756537]

[1651] 1238: XM—006636 Homo sapiens glutamate receptor, ionotropic, N-methyl D-aspartate 2B (GRIN2B), mRNA gi|14756111|ref|XM—006636.4|[14756111]

[1652] 1239: XM—044309 Homo sapiens poliovirus receptor (PVR), mRNA gi|14755769|ref|XM—044309.1|[14755769]

[1653] 1240: XM—004134 Homo sapiens 5-hydroxytryptamine (serotonin) receptor 1E (HTR1E), mRNA gi|14755675|ref|XM—004134.4|[14755675]

[1654] 1241: XM—033838 Homo sapiens chemokine (C-C motif) receptor 6 (CCR6), mRNA gi|14755122|ref|XM—033838.1|[14755122]

[1655] 1242: XM—031082 Homo sapiens formyl peptide receptor-like 1 (FPRL1), mRNA gi|14754918|ref|XM—031082.1|[14754918]

[1656] 1243: XM—028205 Homo sapiens glucagon-like peptide 1 receptor (GLP1R), mRNA gi|14754205|ref|XM—028205.1|[14754205]

[1657] 1244: XM—051710 Homo sapiens prostaglandin E receptor 2 (subtype EP2), 53kD (PTGER2), mRNA gi|14753577|ref|XM—051710.1|[14753577]

[1658] 1245: XM—048918 Homo sapiens met proto-oncogene (hepatocyte growth factor receptor) (MET), mRNA gi|14752543|ref|XM—048918.1|[14752543]

[1659] 1246: XM—045352 Homo sapiens receptor-interacting serine-threonine kinase 2 (RIPK2), mRNA gi|14751723|ref|XM—045352.1|[14751723]

[1660] 1247: XM—049463 Homo sapiens fibroblast growth factor receptor 1 (fms-related tyrosine kinase 2, Pfeiffer syndrome) (FGFR1), mRNA gi|14750712|ref|XM—049463.1|[14750712]

[1661] 1248: XM—033240 Homo sapiens leukotriene b4 receptor (chemokine receptor-like 1) (LTB4R), mRNA gi|14750696|ref|XM—033240.1|[14750696]

[1662] 1249: XM—46720 Homo sapiens gamma-aminobutyric acid (GABA) receptor, rho 1 (GABRR1), mRNA gi|14750531|ref|XM—046720.1|[14750531]

[1663] 1250: XM—050434 Homo sapiens interferon gamma receptor 1 (IFNGR1), mRNA gi|14750131|ref|XM—050434.1|[14750131]

[1664] 1251: XM—035832 Homo sapiens cholinergic receptor, nicotinic, beta polypeptide 3 (CHRNB3), mRNA gi|14749978|ref|XM—035832.1|[14749978]

[1665] 1252: XM—034142 Homo sapiens CD36 antigen (collagen type I receptor, thrombospondin receptor) (CD36), mRNA gi|14749875|ref|XM—034142.1|[14749875]

[1666] 1253: XM—030066 Homo sapiens growth hormone releasing hormone receptor (GHRHR), mRNA gi|14749610|ref|XM—030066.1|[14749610]

[1667] 1254: XM—007383 Homo sapiens G protein-coupled receptor 68 (GPR68), mRNA gi|14748827|ref|XM—007383.2|[14748827]

[1668] 1255: XM—004117 Homo sapiens 5-hydroxytryptamine (serotonin) receptor 1B (HTR1B), mRNA gi|14747779|ref|XM—004117.2|[14747779]

[1669] 1256: XM—036123 Homo sapiens transient receptor potential cation channel, subfamily M, member 3 (TRPM3), mRNA gi|14743665|ref|XM—036123.1|[14743665]

[1670] 1257: XM—011817 Homo sapiens muscle, skeletal, receptor tyrosine kinase (MUSK), mRNA gi|14742818|ref|XM—011817.3|[14742818]

[1671] 1258: XM—044653 Homo sapiens epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian) (EGFR), mRNA gi|14741797|ref|XM—044653.1|[14741797]

[1672] 1259: XM—033529 Homo sapiens G protein-coupled receptor 85 (GPR85), mRNA gi|14741568|ref|XM—033529.1|[14741568]

[1673] 1260: XM—011916 Homo sapiens pancreatic polypeptide receptor 1 (PPYR1), mRNA gi|14740172|ref|XM—011916.2|[14740172]

[1674] 1261: XM—005486 Homo sapiens neurotrophic tyrosine kinase, receptor, type 2 (NTRK2), mRNA gi|14740022|ref|XM—005486.4|[14740022]

[1675] 1262: XM—042740 Homo sapiens region containing Sulfonylurea receptor; KIAA1674 (LOC142781), mRNA gi|14739341|ref|XM—042740.1|[14739341]

[1676] 1263: XM—045386 Homo sapiens very low density lipoprotein receptor (VLDLR), mRNA gi|14736403|ref|XM—045386.1|[14736403]

[1677] 1264: XM—004002 Homo sapiens hyaluronan-mediated motility receptor (RHAMM) (HMMR), mRNA gi|14734503|ref|XM—004002.4|[14734503]

[1678] 1265: XM—034451 Homo sapiens olfactory receptor, family 7, subfamily A, member 120 (OR7E120), mRNA gi|14733406|ref|XM—034451.1|[14733406]

[1679] 1266: XM—029284 Homo sapiens cholecystokinin A receptor (CCKAR), mRNA gi|14733138|ref|XM—029284.1|[14733138]

[1680] 1267: XM—052171 Homo sapiens 5-hydroxytryptamine (serotonin) receptor 4 (HTR4), mRNA gi|14732310|ref|XM—052171.1|[14732310]

[1681] 1268: XM—042695 Homo sapiens fibroblast growth factor receptor-like 1 (FGFRL1), mRNA gi|14728655|ref|XM—042695.1|[14728655]

[1682] 1269: XM—041933 Homo sapiens Ig superfamily receptor LNIR (LNIR), mRNA gi|14723974|ref|XM—041933.1|[14723974]

[1683] 1270: XM—032738 Homo sapiens glycine receptor, alpha 1 (startle disease/hyperekplexia, stiff man syndrome) (GLRA1), mRNA gi|14722750|ref|XM—032738.1|[14722750]

[1684] 1271: XM—032682 Homo sapiens gamma-aminobutyric acid (GABA) A receptor, alpha 6 (GABRA6), mRNA gi|14722636|ref|XM—032682.1|[14722636]

[1685] 1272: XM—017228 Homo sapiens low density lipoprotein-related protein 1 (alpha-2-macroglobulin receptor) (LRP1), mRNA gi|13654580|ref|XM—017228.1|[13654580]

[1686] 1273: XM—008538 Homo sapiens aryl hydrocarbon receptor interacting protein-like 1 (AIPL1), mRNA gi|13653245|ref|XM—008538.3|[13653245]

[1687] 1274: XM—007046 Homo sapiens vitamin D (1,25-dihydroxyvitamin D3) receptor (VDR), mRNA gi|13653215|ref|XM—007046.3|[13653215]

[1688] 1275: XM—007751 Homo sapiens gamma-aminobutyric acid (GABA) A receptor, beta 3 (GABRB3), mRNA gi|13653090|ref|XM—007751.3|[13653090]

[1689] 1276: XM—007719 Homo sapiens paired basic amino acid cleaving enzyme (furin, membrane associated receptor protein) (PACE), mRNA gi|13652501|ref|XM—007719.2|[13652501]

[1690] 1277: XM—010296 Homo sapiens transient receptor potential cation channel, subfamily C, member 5 (TRPC5), mRNA gi|13652451|ref|XM—010296.2|[13652451]

[1691] 1278: XM—006950 Homo sapiens tumor necrosis factor receptor superfamily, member 1A (TNFRSF1A), mRNA gi|13652420|ref|XM—006950.3|[13652420]

[1692] 1279: XM—008206 Homo sapiens receptor (calcitonin) activity modifying protein 2 (RAMP2), mRNA gi|13652390|ref|XM—008206.3|[13652390]

[1693] 1280: XM—013114 Homo sapiens interleukin 1 receptor accessory protein-like 1 (IL1RAPL1), mRNA gi|13652318|ref|XM—013114.2|[13652318]

[1694] 1281: XM—015989 Homo sapiens interleukin 9 receptor (IL9R), mRNA gi|13652206|ref|XM—015989.1|[13652206]

[1695] 1282: XM—006934 Homo sapiens arginine vasopressin receptor 1A (AVPR1A), mRNA gi|13652044|ref|XM—006934.3|[13652044]

[1696] 1283: XM—012441 Homo sapiens gamma-aminobutyric acid (GABA) A receptor, alpha 5 (GABRA5), mRNA gi|13651536|ref|XM—012441.2|[13651536]

[1697] 1284: XM—008193 Homo sapiens putative receptor protein (PMI), mRNA gi|13650873|ref|XM—008193.2|[13650873]

[1698] 1285: XM—009108 Homo sapiens glutamate receptor, ionotropic, N-methyl D-aspartate 2D (GRIN2D), mRNA gi|13650682|ref|XM—009108.3|[13650682]

[1699] 1286: XM—015505 Homo sapiens AXL receptor tyrosine kinase (AXL), mRNA gi|13650099|ref|XM—015505.1|[13650099]

[1700] 1287: XM—006145 Homo sapiens dopamine receptor D4 (DRD4), mRNA gi|13647063|ref|XM—006145.2|[13647063]

[1701] 1288: XM—009803 Homo sapiens transient receptor potential cation channel, subfamily M, member 2 (TRPM2), mRNA gi|13646881|ref|XM—009803.3|[13646881]

[1702] 1289: XM—004030 Homo sapiens adrenergic, beta-2-, receptor, surface (ADRB2), mRNA gi|13645597|ref|XM—004030.2|[13645597]

[1703] 1290: XM—011703 Homo sapiens tumor necrosis factor receptor superfamily, member 10a (TNFRSF10A), mRNA gi|13644652|ref|XM—011703.2|[13644652]

[1704] 1291: XM—003986 Homo sapiens gamma-aminobutyric acid (GABA) A receptor, gamma 2 (GABRG2), mRNA gi|13643024|ref|XM—003986.2|[13643024]

[1705] 1292: XM—004253 Homo sapiens gamma-aminobutyric acid (GABA) receptor, rho 2 (GABRR2), mRNA gi|13642452|ref|XM—004253.2|[13642452]

[1706] 1293: XM—006233 Homo sapiens glutamate receptor, ionotrophic, AMPA 4 (GRIA4), mRNA gi|13639643|ref|XM—006233.3|[13639643]

[1707] 1294: XM—005384 Homo sapiens RAR-related orphan receptor B (RORB), mRNA gi|13639481|ref|XM—005384.3|[13639481]

[1708] 1295: XM—004988 Homo sapiens aryl hydrocarbon receptor (AHR), mRNA gi|13631520|ref|XM—004988.2|[13631520]

[1709] 1296: XM—011364 Homo sapiens lymphocyte antigen 95 (activating NK-receptor; NK-p44) (LY95), mRNA gi|13630600|ref|XM—011364.2|[13630600]

[1710] 1297: XM—009612 Homo sapiens neurotensin receptor 1 (high affinity) (NTSR1), mRNA gi|13630500|ref|XM—009612.2|[13630500]

[1711] 1298: XM—003417 Homo sapiens CD36 antigen (collagen type I receptor, thrombospondin receptor)-like 2 (lysosomal integral membrane protein II) (CD36L2), mRNA gi|13630130|ref|XM—003417.3|[13630130]

[1712] 1299: XM—007817 Homo sapiens tumor necrosis factor receptor superfamily, member 17 (TNFRSF17), mRNA gi|13627219|ref|XM—007817.3|[13627219]

[1713] 1300: XM—012949 Homo sapiens complement component 1, q subcomponent, receptor 1 (C1QR1), mRNA gi|12742414|ref|XM—012949.1|[12742414]

[1714] 1301: XM—009594 Homo sapiens somatostatin receptor 4 (SSTR4), mRNA gi|12742412|ref|XM—009594.2|[12742412]

[1715] 1302: XM—008512 Homo sapiens vanilloid receptor subtype 1 (VR1), mRNA gi|12740624|ref|XM—008512.2|[12740624]

[1716] 1303: XM—006931 Homo sapiens oxidised low density lipoprotein (lectin-like) receptor 1 (OLR1), mRNA gi|12737735|ref|XM—006931.2|[12737735]

[1717] 1304: XM—006933 Homo sapiens C-type lectin-like receptor-1 (LOC51267), mRNA gi|12737731|ref|XM—006933.2|[12737731]

[1718] 1305: XM—004438 Homo sapiens interleukin 20 receptor, alpha (IL20RA), mRNA gi|12732139|ref|XM—004438.2|[12732139]

[1719] 1306: XM—003692 Homo sapiens 5-hydroxytryptamine (serotonin) receptor 1A (HTR1A), mRNA gi|12731011|ref|XM—003692.2|[12731011]

[1720] 1307: XM—010228 Homo sapiens G protein-coupled receptor 50 (GPR50), mRNA gi|12719157|ref|XM—010228.2|[12719157]

[1721] 1308: XM—009082 Homo sapiens low density lipoprotein receptor (familial hypercholesterolemia) (LDLR), mRNA gi|11525992|ref|XM—009082.1|[11525992]

[1722] 1309: XM—006296 Homo sapiens cholinergic receptor, muscarinic 4 (CHRM4), mRNA gi|11437838|ref|XM—006296.1|[11437838]

[1723] 1310: NT—009784 Homo sapiens chromosome 12 working draft sequence segment gi|11436706|ref|NT—009784.1|Hs12—9941[11436706]

[1724] 1311: XM—003386 Homo sapiens gonadotropin-releasing hormone receptor (GNRHR), mRNA gi|11435615|ref|XM—003386.1|[11435615]

[1725] 1312: NT—024131 Homo sapiens chromosome 10 working draft sequence segment gi|11430625|ref|NT—024131.1|Hs10—24287[11430625]

[1726] 1313: XM—009373 Homo sapiens formyl peptide receptor-like 2 (FPRL2), mRNA gi|11426996|ref|XM—009373.1|[11426996]

[1727] 1314: XM—008520 Homo sapiens cholinergic receptor, nicotinic, epsilon polypeptide (CHRNE), mRNA gi|11426945|ref|XM—008520.1|[11426945]

[1728] 1315: XM—009140 Homo sapiens G protein-coupled receptor 4 (GPR4), mRNA gi|11425489|ref|XM—009140.1|[11425489]

[1729] 1316: XM—008279 Homo sapiens adenosine A2b receptor (ADORA2B), mRNA gi|11425432|ref|XM—008279.1|[11425432]

[1730] 1317: XM—010321 Homo sapiens glycine receptor, alpha 2 (GLRA2), mRNA gi|11421007|ref|XM—010321.1|[11421007]

[1731] 1318: XM—004808 Homo sapiens taste receptor, type 2, member 4 (TAS2R4), mRNA gi|11420322|ref|XM—004808.1|[11420322]

[1732] 1319: XM—004807 Homo sapiens taste receptor, type 2, member 5 (TAS2R5), mRNA gi|11420320|ref|XM—004807.1|[11420320]

[1733] 1320: XM—011092 Homo sapiens glycine receptor, alpha 3 (GLRA3), mRNA gi|18556859|ref|XM—011092.4|[18556859]

[1734] 1321: XM—003324 Homo sapiens transient receptor potential cation channel, subfamily C, member 3 (TRPC3), mRNA gi|18556760|ref|XM—003324.5|[18556760]

[1735] 1322: XM—011068 Homo sapiens macrophage stimulating 1 receptor (c-met-related tyrosine kinase) (MST1R), mRNA gi|18556611|ref|XM—011068.4|[18556611]

[1736] 1323: XM—011064 Homo sapiens protein tyrosine phosphatase, receptor type, G (PTPRG), mRNA gi|18556526|ref|XM—011064.7|[18556526]

[1737] 1324: XM—003207 Homo sapiens glutamate receptor, metabotropic 2 (GRM2), mRNA gi|18556346|ref|XM—003207.5|[18556346]

[1738] 1325: XM—036436 Homo sapiens interleukin 1 receptor accessory protein (IL1RAP), mRNA gi|18555803|ref|XM—036436.4|[18555803]

[1739] 1326: XM—031246 Homo sapiens roundabout, axon guidance receptor, homolog 2 (Drosophila) (ROBO2), mRNA gi|18555796|ref|XM—031246.2|[18555796]

[1740] 1327: XM—003226 Homo sapiens vasoactive intestinal peptide receptor 1 (VIPR1), mRNA gi|18555693|ref|XM—003226.7|[18555693]

[1741] 1328: NT—005824 Homo sapiens chromosome 3 working draft sequence segment gi|18555677|ref|NT—005824.7|Hs3—5981[18555677]

[1742] 1329: XM—093692 Homo sapiens RYK receptor-like tyrosine kinase (RYK), mRNA gi|18555675|ref|XM—093692.1|[18555675]

[1743] 1332: NT—005564 Homo sapiens chromosome 3 working draft sequence segment gi|18555104|ref|NT—005564.8|Hs3—5721[18555104]

[1744] 1333: XM—010943 Homo sapiens inositol 1,4,5-triphosphate receptor, type 1 (ITPR1), mRNA gi|18554594|ref|XM—010943.7|[18554594]

[1745] 1334: XM—052730 Homo sapiens transferrin receptor (p90, CD71) (TFRC), mRNA gi|18553906|ref|XM—052730.3|[18553906]

[1746] 1335: XM—032666 Homo sapiens calcium-sensing receptor (hypocalciuric hypercalcemia 1, severe neonatal hyperparathyroidism) (CASR), mRNA gi|18553576|ref|XM—032666.3|[18553576]

[1747] 1336: XM—002686 Homo sapiens interleukin 1 receptor, type I (IL1R1), mRNA gi|18553052|ref|XM—002686.6|[18553052]

[1748] 1337: XM—002596 Homo sapiens protein tyrosine phosphatase, receptor type, N (PTPRN), mRNA gi|18552617|ref|XM—002596.6|[18552617]

[1749] 1338: XM—087110 Homo sapiens macrophage receptor with collagenous structure (MARCO), mRNA gi|18552038|ref|XM—087110.1|[18552038]

[1750] 1340: XM—087047 Homo sapiens G protein-coupled receptor 66 (GPR66), mRNA gi|18551251|ref|XM—087047.1|[18551251]

[1751] 1341: XM—086954 Homo sapiens G protein-coupled receptor 45 (GPR45), mRNA gi|18549982|ref|XM—086954.1|[18549982]

[1752] 1342: XM—029434 Homo sapiens toll-like receptor 5 (TLR5), mRNA gi|18549454|ref|XM—029434.2|[18549454]

[1753] 1344: XM—089355 Homo sapiens LDL receptor adaptor protein (ARH), mRNA gi|18549097|ref|XM—089355.1|[18549097]

[1754] 1346: XM—086483 Homo sapiens Fc fragment of IgG, low affinity IIa, receptor for (CD32) (FCGR2A), mRNA gi|18548731|ref|XM—086483.1|[18548731]

[1755] 1347: XM—046751 Homo sapiens protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 4 (PPFIA4), mRNA gi|18548679|ref|XM—046751.3|[18548679]

[1756] 1348: XM—001821 Homo sapiens glutamate receptor, ionotropic, kainate 3 (GRIK3), mRNA gi|18548332|ref|XM—001821.7|[18548332]

[1757] 1349: XM—002205 Homo sapiens colony stimulating factor 3 receptor (granulocyte) (CSF3R), mRNA gi|18548330|ref|XM—002205.2|[18548330]

[1758] 1350: XM—033690 Homo sapiens protein tyrosine phosphatase, receptor type, U (PTPRU), mRNA gi|18548204|ref|XM—033690.2|[18548204]

[1759] 1351: XM—001795 Homo sapiens lamin B receptor (LBR), mRNA gi|18548051|ref|XM—001795.6|[18548051]

[1760] 1352: XM—058179 Homo sapiens natural killer cell receptor 2B4 (CD244), mRNA gi|18547600|ref|XM—058179.3|[18547600]

[1761] 1353: XM—086356 Homo sapiens cannabinoid receptor 2 (macrophage) (CNR2), mRNA gi|18547399|ref|XM—086356.1|[18547399]

[1762] 1354: XM—001499 Homo sapiens endothelial differentiation, sphingolipid G-protein-coupled receptor, 1 (EDG1), mRNA gi|18547249|ref|XM—001499.5|[18547249]

[1763] 1355: NT—031737 Homo sapiens chromosome 1 working draft sequence segment gi|18547126|ref|NT—031737.1|Hs1—31908[18547126]

[1764] 1356: XM—010608 Homo sapiens G-protein coupled receptor 88 (GPR88), mRNA gi|18547116|ref|XM—010608.6|[18547116]

[1765] 1357: XM—089029 Homo sapiens olfactory receptor, family 2, subfamily L, member 2 (OR2L2), mRNA gi|18547000|ref|XM—089029.1|[18547000]

[1766] 1358: XM—089028 Homo sapiens olfactory receptor, family 2, subfamily L, member 1 (OR2L1), mRNA gi|18546996|ref|XM—089028.1|[18546996]

[1767] 1359: XM—089016 Homo sapiens olfactory receptor, family 1, subfamily C, member 1 (OR1C1), mRNA gi|18546895|ref|XM—089016.1|[18546895]

[1768] 1360: XM—001289 Homo sapiens xenotropic and polytropic retrovirus receptor (XPR1), mRNA gi|18546688|ref|XM—001289.7|[18546688]

[1769] 1361: XM—049849 Homo sapiens tumor necrosis factor receptor superfamily, member 14 (herpesvirus entry mediator) (TNFRSF14), mRNA gi|18546661|ref|XM—049849.3|[18546661]

[1770] 1362: XM—001667 Homo sapiens natural killer cell receptor, immunoglobulin superfamily member (BY55), mRNA gi|18546631|ref|XM—001667.5|[18546631]

[1771] 1364: XM—086285 Homo sapiens leucine-rich repeat-containing G protein-coupled receptor 6 (LGR6), mRNA gi|18546477|ref|XM—086285.1|[18546477]

[1772] 1365: XM—016748 Homo sapiens protein tyrosine phosphatase, receptor type, C (PTPRC), mRNA gi|18546353|ref|XM—016748.4|[18546353]

[1773] 1366: XM—088942 Homo sapiens olfactory receptor, family 2, subfamily M, member 4 (OR2M4), mRNA gi|18546222|ref|XM—088942.1|[18546222]

[1774] 1367: XM—086242 Homo sapiens receptor tyrosine kinase-like orphan receptor 1 (ROR1), mRNA gi|18546174|ref|XM—086242.1|[18546174]

[1775] 1368: XM—086232 Homo sapiens G protein-coupled receptor 61 (GPR61), mRNA gi|18546070|ref|XM—086232.1|[18546070]

[1776] 1369: XM—042739 Homo sapiens cadherin, EGF LAG seven-pass G-type receptor 2 (flamingo homolog, Drosophila) (CELSR2), mRNA gi|18546045|ref|XM—042739.2|[18546045]

[1777] 1370: XM—002008 Homo sapiens complement component (3d/Epstein Barr virus) receptor 2 (CR2), mRNA gi|18545768|ref|XM—002008.6|[18545768]

[1778] 1371: XM—052013 Homo sapiens polymeric immunoglobulin receptor (PIGR), mRNA gi|18545758|ref|XM—052013.2|[18545758]

[1779] 1372: XM—001320 Homo sapiens low density lipoprotein receptor defect C complementing (LDLC), mRNA gi|18545223|ref|XM—001320.4|[18545223]

[1780] 1373: NT—030585 Homo sapiens chromosome 1 working draft sequence segment gi|18544898|ref|NT—030585.2|Hs1—30841[18544898]

[1781] 1374: XM—084053 Homo sapiens complement component (3b/4b) receptor 1, including Knops blood group system (CR1), mRNA gi|18544845|ref|XM—084053.1|[18544845]

[1782] 1376: XM—039685 Homo sapiens putative G-protein coupled receptor (SH120), mRNA gi|17488963|ref|XM—039685.3|[17488963]

[1783] 1377: XM—001687 Homo sapiens adenosine A1 receptor (ADORA1), mRNA gi|17488879|ref|XM—001687.5|[17488879]

[1784] 1378: XM—002700 Homo sapiens cytochrome c oxidase subunit VIIa polypeptide 2 like (COX7A2L), mRNA gi|17462137|ref|XM—002700.3|[17462137]

[1785] 1379: XM—002673 Homo sapiens calcitonin receptor-like (CALCRL), mRNA gi|17447546|ref|XM—002673.5|[17447546]

[1786] 1380: XM—001924 Homo sapiens transforming growth factor, beta receptor III (betaglycan, 300kD) (TGFBR3), mRNA gi|17446897|ref|XM—001924.6|[17446897]

[1787] 1381: XM—001744 Homo sapiens tumor necrosis factor receptor superfamily, member 8 (TNFRSF8), mRNA gi|17444362|ref|XM—001744.6|[17444362]

[1788] 1382: XM—054837 Homo sapiens tumor necrosis factor receptor superfamily, member 1B (TNFRSF1B), mRNA gi|17444359|ref|XM—054837.2|[17444359]

[1789] 1383: XM—037011 Homo sapiens T-cell receptor interacting molecule (TRIM), mRNA gi|17438759|ref|XM—037011.2|[17438759]

[1790] 1384: NT—022773 Homo sapiens chromosome 4 working draft sequence segment gi|17438611|ref|NT—022773.6|Hs4—22929[17438611]

[1791] 1385: XM—051522 Homo sapiens G protein-coupled receptor (RDC1), mRNA gi|17437231|ref|XM—051522.2|[17437231]

[1792] 1386: NT—029249 Homo sapiens chromosome 2 working draft sequence segment gi|17436701|ref|NT—029249.2|Hs2—29408[17436701]

[1793] 1387: XM—050043 Homo sapiens gamma-aminobutyric acid (GABA) A receptor, alpha 4 (GABRA4), mRNA gi|17436698|ref|XM—050043.2|[17436698]

[1794] 1388: XM—001857 Homo sapiens platelet-activating factor receptor (PTAFR), mRNA gi|17435918|ref|XM—001857.3|[17435918]

[1795] 1389: XM—001630 Homo sapiens prostaglandin F receptor (FP) (PTGFR), mRNA gi|17434349|ref|XM—001630.5|[17434349]

[1796] 1390: XM—058183 Homo sapiens activating NK receptor (KALI), mRNA gi|16165765|ref|XM—058183.1|[16165765]

[1797] 1391: XM—003177 Homo sapiens oxytocin receptor (OXTR), mRNA gi|16164840|ref|XM—003177.5|[16164840]

[1798] 1392: XM—001778 Homo sapiens ryanodine receptor 2 (cardiac) (RYR2), mRNA gi|16161568|ref|XM—001778.6|[16161568]

[1799] 1393: XM—039118 Homo sapiens phospholipase A2 receptor 1, 180kD (PLA2R1), mRNA gi|16160858|ref|XM—039118.2|[16160858]

[1800] 1394: NT—005791 Homo sapiens chromosome 3 working draft sequence segment gi|16159942|ref|NT—005791.5|Hs3—5948[16159942]

[1801] 1395: NT—029941 Homo sapiens chromosome 3 working draft sequence segment gi|16158541|ref|NT—029941.1|Hs3—30196[16158541]

[1802] 1396: XM—056760 Homo sapiens tumor necrosis factor receptor superfamily, member 9 (TNFRSF9), mRNA gi|16158007|ref|XM—056760.1|[16158007]

[1803] 1397: XM—010871 Homo sapiens adrenergic, alpha-2B-, receptor (ADRA2B), mRNA gi|16157882|ref|XM—010871.5|[16157882]

[1804] 1398: XM—055737 Homo sapiens interleukin 6 receptor (IL6R), mRNA gi|16157271|ref|XM—055737.1|[16157271]

[1805] 1399: XM—043563 Homo sapiens insulin receptor-related receptor (INSRR), mRNA gi|15299156|ref|XM—043563.2|[15299156]

[1806] 1400: XM—001466 Homo sapiens protein tyrosine phosphatase, receptor type, F (PTPRF), mRNA gi|15299050|ref|XM—001466.5|[15299050]

[1807] 1401: XM—002888 Homo sapiens activin A receptor, type IIB (ACVR2B), mRNA gi|15298060|ref|XM—002888.3|[15298060]

[1808] 1402: XM—049427 Homo sapiens interleukin 5 receptor, alpha (IL5RA), miRNA gi|15297287|ref|XM—049427.2|[15297287]

[1809] 1404: XM—047502 Homo sapiens chemokine (C-X3-C) receptor 1 (CX3CR1), mRNA gi|15295593|ref|XM—047502.2|[15295593]

[1810] 1405: XM—041048 Homo sapiens chemokine (C-C motif) receptor 8 (CCR8), mRNA gi|15295589|ref|XM—041048.2|[15295589]

[1811] 1406: XM—052155 Homo sapiens adenosine A3 receptor (ADORA3), mRNA gi|14739381|ref|XM—052155.1|[14739381]

[1812] 1407: XM—002926 Homo sapiens chemokine (C-C motif) receptor-like 2 (CCRL2), mRNA gi|14736663|ref|XM—002926.3|[14736663]

[1813] 1408: XM—030397 Homo sapiens chemokine (C-C motif) receptor 5 (CCR5), mRNA gi|14736645|ref|XM—030397.1|[14736645]

[1814] 1409: XM—040605 Homo sapiens interleukin 17B receptor (IL17BR), mRNA gi|14735848|ref|XM—040605.1|[14735848]

[1815] 1410: XM—003199 Homo sapiens growth hormone secretagogue receptor (GHSR), mRNA gi|14735283|ref|XM—003199.4|[14735283]

[1816] 1411: XM—041399 Homo sapiens glutamate receptor, metabotropic 7 (GRM7), mRNA gi|14734683|ref|XM—041399.1|[14734683]

[1817] 1412: XM—039011 Homo sapiens integrin, alpha 4 (antigen CD49D, alpha 4 subunit of VLA-4 receptor) (ITGA4), mRNA gi|14733147|ref|XM—039011.1|[14733147]

[1818] 1413: XM—033709 Homo sapiens opioid receptor, delta 1 (OPRD1), mRNA gi|14732044|ref|XM—033709.1|[14732044]

[1819] 1414: XM—033469 Homo sapiens transforming growth factor, beta receptor II (70-80kD) (TGFBR2), mRNA gi|14732004|ref|XM—033469.1|[14732004]

[1820] 1415: XM—017782 Homo sapiens ectodysplasin 1, anhidrotic receptor (EDAR), mRNA gi|14731094|ref|XM—017782.2|[14731094]

[1821] 1416: XM—002475 Homo sapiens insulin receptor substrate 1 (IRS1), mRNA gi|14730385|ref|XM—002475.4|[14730385]

[1822] 1417: XM—051470 Homo sapiens angiotensin receptor 1 (AGTR1), mRNA gi|14729512|ref|XM—051470.1|[14729512]

[1823] 1418: XM—001542 Homo sapiens 5-hydroxytryptamine (serotonin) receptor 1D (HTR1D), mRNA gi|14726872|ref|XM—001542.4|[14726872]

[1824] 1419: XM—052382 Homo sapiens histamine receptor H1 (HRH1), mRNA gi|14726259|ref|XM—052382.1|[14726259]

[1825] 1420: XM—032349 Homo sapiens interleukin 22 receptor (IL22R), mRNA gi|14725224|ref|XM—032349.1|[14725224]

[1826] 1421: XM—002792 Homo sapiens APMCF1 protein (APMCF1), mRNA gi|14720925|ref|XM—002792.4|[14720925]

[1827] 1422: XM—045070 Homo sapiens immunoglobulin superfamily receptor translocation associated 2 (IRTA2), mRNA gi|14720460|ref|XM—045070.1|[14720460]

[1828] 1423: XM—045067 Homo sapiens immunoglobulin superfamily receptor translocation associated 1 (IRTA1), mRNA gi|14720452|ref|XM—045067.1|[14720452]

[1829] 1425: XM—002685 Homo sapiens interleukin 1 receptor-like 2 (IL1RL2), mRNA gi|12728885|ref|XM—002685.2|[12728885]

[1830] 1426: XM—002624 Homo sapiens G protein-coupled receptor 75 (GPR75), mRNA gi|11430331|ref|XM—002624.1|[11430331]

[1831] 1427: XM—001907 Homo sapiens G protein-coupled receptor 25 (GPR25), mRNA gi|11425714|ref|XM—001907.1|[11425714]

[1832] 1428: XM—001543 Homo sapiens G protein-coupled receptor 52 (GPR52), mRNA gi|11423045|ref|XM—001543.1|[11423045]

[1833] 1429: NM—016113 Homo sapiens transient receptor potential cation channel, subfamily V, member 2 (TRPV2), mRNA gi|7706766|ref|NM—016113.1|[7706766]

[1834] 1430: NM—002837 Homo sapiens protein tyrosine phosphatase, receptor type, B (PTPRB), mRNA gi|18491009|ref|NM—002837.2|[18491009]

[1835] 1431: NM—017625 Homo sapiens intelectin (ITLN), mRNA gi|8923027|ref|NM—017625.1|[8923027]

[1836] 1432: NM—000651 Homo sapiens complement component (3b/4b) receptor 1, including Knops blood group system (CR1), transcript variant S, mRNA gi|18490997|ref|NM—000651.2|[18490997]

[1837] 1433: NM—000573 Homo sapiens complement component (3b/4b) receptor 1, including Knops blood group system (CR1), transcript variant F, mRNA gi|18490996|ref|NM—000573.2|[18490996]

[1838] 1435: BC022501 Homo sapiens, neurotensin receptor 2, clone MGC:26447 IMAGE:4792730, mRNA, complete cds gi|18490911|gb|BC022501.1|[18490911]

[1839] 1436: BC022447 Homo sapiens, angiotensin receptor 1, clone MGC:25987 IMAGE:4799755, mRNA, complete cds gi|18490885|gb|BC022447.1|[18490885]

[1840] 1437: BC022317 Homo sapiens, T cell receptor delta diversity 3, clone MGC:22624 IMAGE:4732634, mRNA, complete cds gi|18490613|gb|BC022317.1|[18490613]

[1841] 1438: BC022304 Homo sapiens, receptor (calcitonin) activity modifying protein 3, clone MGC:22548 IMAGE:4717934, mRNA, complete cds gi|18490610|gb|BC022304.1|[18490610]

[1842] 1439: BC022496 Homo sapiens, glutamate receptor, metabotropic 3, clone MGC:26392 IMAGE:4792430, mRNA, complete cds gi|18490393|gb|BC022496.1|[18490393]

[1843] 1440: BC022511 Homo sapiens, endothelin receptor type A, clone MGC:26548 IMAGE:4812050, mRNA, complete cds gi|18490297|gb|BC022511.1|[18490297]

[1844] 1441: BC022502 Homo sapiens, glycine receptor, beta, clone IMAGE:4792516, mRNA gi|18490294|gb|BC022502.1|[18490294]

[1845] 1442: BC022449 Homo sapiens, gamma-aminobutyric acid (GABA) A receptor, beta 1, clone MGC:25991 IMAGE:4797401, mRNA, complete cds gi|18490266|gb|BC022449.1|[18490266]

[1846] 1443: BC022295 Homo sapiens, oxidised low density lipoprotein (lectin-like) receptor 1, clone MGC:22491 IMAGE:4722086, mRNA, complete cds gi|18490152|gb|BC022295.1|[18490152]

[1847] 1444: BC022279 Homo sapiens, CMRF35 leukocyte immunoglobulin-like receptor, clone MGC:22395 IMAGE:4692025, mRNA, complete cds gi|18490142|gb|BC022279.1|[18490142]

[1848] 1448: AH011463 Homo sapiens chromosome 7 map 7q22 gi|18483169|gb|AH011463.1|SEG_AF461188S[18483169]

[1849] 1449: AF453828 Homo sapiens G protein-coupled receptor affecting testicular descent (GREAT) mRNA, complete cds gi|18483167|gb|AF453828.1|[18483167]

[1850] 1450: AY072912 Homo sapiens coxsackie-adenovirus-receptor isoform CAR4/7 (CXADR) mRNA, complete cds; alternatively spliced gi|18482481|gb|AY072912.1|[18482481]

[1851] 1451: AY072911 Homo sapiens coxsackie-adenovirus-receptor isoform CAR3/7 (CXADR) mRNA, complete cds; alternatively spliced gi|18482479|gb|AY072911.1|[18482479]

[1852] 1452: AY072910 Homo sapiens soluble coxsackie-adenovirus-receptor isoform CAR2/7 (CXADR) mRNA, complete cds; alternatively spliced gi|18482477|gb|AY072910.1|[18482477]

[1853] 1453: NM—020399 Homo sapiens PDZ/coiled-coil domain binding partner for the rho-family GTPase TC10 (PIST), mRNA gi|9966876|ref|NM—020399.1|[9966876]

[1854] 1454: NM—017935 Homo sapiens hypothetical protein FLJ20706 (BANK), mRNA gi|8923635|ref|NM—017935.1|[8923635]

[1855] 1455: NM—002438 Homo sapiens mannose receptor, C type 1 (MRC1), mRNA gi|4505244|ref|NM—002438.1|[4505244]

[1856] 1456: AF321913 Homo sapiens histamine H3 receptor isoform 4 (HRH3) mRNA, complete cds, alternatively spliced gi|18461386|gb|AF321913.1|[18461386]

[1857] 1457: AF321912 Homo sapiens histamine H3 receptor isoform 3 (HRH3) mRNA, complete cds, alternatively spliced gi|18461384|gb|AF321912.1|[18461384]

[1858] 1458: AF321911 Homo sapiens histamine H3 receptor isoform 2 (HRH3) mRNA, complete cds, alternatively spliced gi|18461382|gb|AF321911.1|[18461382]

[1859] 1459: AF321910 Homo sapiens histamine H3 receptor isoform 1 (HRH3) mRNA, complete cds, alternatively spliced gi|18461380|gb|AF321910.1|[18461380]

[1860] 1460: NM—080841 Homo sapiens protein tyrosine phosphatase, receptor type, A (PTPRA), transcript variant 3, mRNA gi|18450370|ref|NM—080841.1|[18450370]

[1861] 1461: NM—080840 Homo sapiens protein tyrosine phosphatase, receptor type, A (PTPRA), transcript variant 2, mRNA gi|18450368|ref|NM—080840.1|[18450368]

[1862] 1462: NM—002836 Homo sapiens protein tyrosine phosphatase, receptor type, A (PTPRA), transcript variant 1, mRNA gi|18450367|ref|NM—002836.2|[18450367]

[1863] 1463: NM—023915 Homo sapiens,G protein-coupled receptor 87 (GPR87), mRNA gi|13236505|ref|NM—023915.1|[13236505]

[1864] 1464: NM—003029 Homo sapiens SHC (Src homology 2 domain containing) transforming protein 1 (SHC1), mRNA gi|10835030|ref|NM—003029.1|[10835030]

[1865] 1465: NM—018490 Homo sapiens G protein-coupled receptor 48 (GPR48), mRNA gi|8923700|ref|NM—018490.1|[8923700]

[1866] 1466: NM—006065 Homo sapiens signal-regulatory protein beta 1 (SIRPB1), mRNA gi|5174678|ref|NM—006065.1|[5174678]

[1867] 1467: NM—003667 Homo sapiens G protein-coupled receptor 49 (GPR49), mRNA gi|4504378|ref|NM—003667.1|[4504378]

[1868] 1468: NM—080816 Homo sapiens signal-regulatory protein beta 2 (SIRPB2), transcript variant 2, mRNA gi|18426908|ref|NM—080816.1|[18426908]

[1869] 1469: NM—018556 Homo sapiens signal-regulatory protein beta 2 (SIRPB2), transcript variant 1, mRNA gi|18426907|ref|NM—018556.2|[18426907]

[1870] 1470: NM—080914 Homo sapiens asialoglycoprotein receptor 2 (ASGR2), transcript variant 3, mRNA gi|18426876|ref|NM—080914.1|[18426876]

[1871] 1471: NM—080913 Homo sapiens asialoglycoprotein receptor 2 (ASGR2), transcript variant 2, mRNA gi|18426874|ref|NM—080913.1|[18426874]

[1872] 1472: NM—080912 Homo sapiens asialoglycoprotein receptor 2 (ASGR2), transcript variant H2′, mRNA gi|18426872|ref|NM—080912.1|[18426872]

[1873] 1473: NM—001181 Homo sapiens asialoglycoprotein receptor 2 (ASGR2), transcript variant 1, mRNA gi|18426871|ref|NM—001181.2|[18426871]

[1874] 1474: NM—001671 Homo sapiens asialoglycoprotein receptor 1 (ASGR1), mRNA gi|18426870|ref|NM—001671.2|[18426870]

[1875] 1475: NM—014978 Homo sapiens VPS10 domain receptor protein SORCS 3 (SORCS3), mRNA gi|18379345|ref|NM—014978.1|[18379345]

[1876] 1476: NM—021625 Homo sapiens transient receptor potential cation channel, subfamily V, member 4 (TRPV4), mRNA gi|13699862|ref|NM—021625.2|[13699862]

[1877] 1477: NM—020960 Homo sapiens G protein-coupled receptor 107 (GPR107), mRNA gi|13470087|ref|NM—020960.1|[13470087]

[1878] 1478: NM—021634 Homo sapiens leucine-rich repeat-containing G protein-coupled receptor 7 (LGR7), mRNA gi|11056007|ref|NM—021634.1|[11056007]

[1879] 1479: NM—016179 Homo sapiens transient receptor potential cation channel, subfamily C, member 4 (TRPC4), mRNA gi|7706746|ref|NM—016179.1|[7706746]

[1880] 1480: NM—004621 Homo sapiens transient receptor potential cation channel, subfamily C, member 6 (TRPC6), mRNA gi|5730101|ref|NM—004621.2|[5730101]

[1881] 1481: NM—003304 Homo sapiens transient receptor potential cation channel, subfamily C, member 1 (TRPC1), mRNA gi|4507684|ref|NM—003304.1|[4507684]

[1882] 1485: NM—016235 Homo sapiens G protein-coupled receptor, family C, group 1, member B (GPRC5B), mRNA gi|7706450|ref|NM—016235.1|[7706450]

[1883] 1487: AF024642 Homo sapiens luteinizing hormone receptor gene, exon 1 and partial cds gi|2655113|gb|AF024642.1|AF024642[2655113]

[1884] 1488: NM—007128 Homo sapiens pre-B lymphocyte gene 1 (VPREB1), mRNA gi|18379350|ref|NM—007128.2|[18379350]

[1885] 1489: NM—020777 Homo sapiens VPS10 domain receptor protein (SORCS2), mRNA gi|18379343|ref|NM—020777.1|[18379343]

[1886] 1490: NM—052918 Homo sapiens VPS10 domain receptor protein SORCS 1 (SORCS1), mRNA gi|18379341|ref|NM—052918.2|[18379341]

[1887] 1491: AF391164 Homo sapiens osteoclast-associated receptor hOSCAR-M3 (OSCAR) mRNA, complete cds gi|18376830|gb|AF391164.1|AF391164[18376830]

[1888] 1492: AF391163 Homo sapiens osteoclast-associated receptor hOSCAR-M2 (OSCAR) mRNA, complete cds gi|18376828|gb|AF391163.1|AF391163[18376828]

[1889] 1493: AF391162 Homo sapiens osteoclast-associated receptor hOSCAR-M1 (OSCAR) mRNA, complete cds gi|18376826|gb|AF391162.1|AF391162[18376826]

[1890] 1494: AJ421783 Homo sapiens mRNA for short transient receptor potential channel 7 (TRP7 gene) gi|18376628|emb|AJ421783.1|HSA421783[18376628]

[1891] 1497: AF410902 Homo sapiens neurotrophin receptor tyrosine kinase type 2 (NTRK2) gene, promoter region and partial cds; alternatively spliced gi|18369868|gb|AF410902.1|AF410902[18369868]

[1892] 1498: AF410901 Homo sapiens neurotrophin receptor tyrosine kinase type 2 truncated isoform (NTRK2) mRNA, complete cds; alternatively spliced gi|18369866|gb|AF410901.1|AF410901[18369866]

[1893] 1499: AF410900 Homo sapiens neurotrophin receptor tyrosine kinase type 2 truncated isoform (NTRK2) mRNA, complete cds; alternatively spliced gi|18369864|gb|AF410900.1|AF410900[18369864]

[1894] 1500: AF410899 Homo sapiens neurotrophin receptor tyrosine kinase type 2 (NTRK2) mRNA, complete cds; alternatively spliced gi|18369862|gb|AF410899.1|AF410899[18369862]

[1895] 1501: AF410898 Homo sapiens clone DKFZp547L014 neurotrophin receptor tyrosine kinase type 2 truncated isoform (NTRK2) mRNA, partial cds; alternatively spliced gi|18369860|gb|AF410898.1|AF410898[18369860]

[1896] 1502: AY071830 Homo sapiens interleukin 9 receptor (IL9R) gene, complete cds gi|18071671|gb|AY071830.1|[18071671]

[1897] 1503: AF421362 Homo sapiens transient receptor potential channel 4 zeta splice variant (TRPC4) mRNA, complete cds; alternatively spliced gi|16517177|gb|AF421362.1|AF421362[16517177]

[1898] 1504: AF421361 Homo sapiens transient receptor potential channel 4 eta splice variant (TRPC4) mRNA, complete cds; alternatively spliced gi|16517175|gb|AF421361.1|AF421361[16517175]

[1899] 1505: AF421360 Homo sapiens transient receptor potential channel 4 epsilon splice variant (TRPC4) mRNA, complete cds; alternatively spliced gi|16517173|gb|AF421360.1|AF421360[16517173]

[1900] 1506: AF421359 Homo sapiens transient receptor potential channel 4 beta splice variant (TRPC4) mRNA, complete cds; alternatively spliced gi|16517171|gb|AF421359.1|AF421359[16517171]

[1901] 1507: AF421358 Homo sapiens transient receptor potential channel 4 alpha splice variant (TRPC4) mRNA, complete cds; alternatively spliced gi|16517169|gb|AF421358.1|AF421358[16517169]

[1902] 1508: AF359246 Homo sapiens fibroblast growth factor receptor 4 variant mRNA, complete cds gi|13991617|gb|AF359246.1|AF359246[13991617]

[1903] 1509: NM—022349 Homo sapiens membrane-spanning 4-domains, subfamily A, member 6A (MS4A6A), mRNA gi|11641258|ref|NM—022349.1|[11641258]

[1904] 1510: NM—006055 Homo sapiens LanC lantibiotic synthetase component C-like 1 (bacterial) (LANCL1), mRNA gi|5174444|ref|NM—006055.1|[5174444]

[1905] 1511: NM—005716 Homo sapiens regulator of G-protein signalling 19 interacting protein 1 (RGS19IP1), mRNA gi|5031714|ref|NM—005716.1|[5031714]

[1906] 1512: NM—003307 Homo sapiens transient receptor potential cation channel, subfamily M, member 2 (TRPM2), mRNA gi|4507688|ref|NM—003307.1|[4507688]

[1907] 1513: NM—003807 Homo sapiens tumor necrosis factor (ligand) superfamily, member 14 (TNFSF14), mRNA gi|4507600|ref|NM—003807.1|[4507600]

[1908] 1514: NM—002984 Homo sapiens small inducible cytokine A4 (SCYA4), mRNA gi|4506844|ref|NM—002984.1|[4506844]

[1909] 1515: NM—021181 Homo sapiens 19A24 protein (CRACC), mRNA gi|12711663|ref|NM—021181.2|[12711663]

[1910] 1516: BC021892 Homo sapiens, CD36 antigen (collagen type I receptor, thrombospondin receptor)-like 2 (lysosomal integral membrane protein II), clone MGC:9392 IMAGE:3872778, mRNA, complete cds gi|18257311|gb|BC021892.1|BC021892[18257311]

[1911] 1517: AF459285 Homo sapiens 5-hydroxytryptamine receptor 3 subunit C (HTR3C) mRNA, complete cds gi|18251965|gb|AF459285.1|AF459285[18251965]

[1912] 1518: BC021553 Homo sapiens, G protein coupled receptor interacting protein, complement-c1q tumor necrosis factor-related, clone MGC:31795 IMAGE:4622952, mRNA, complete cds gi|18204860|gb|BC021553.1|BC021553[18204860]

[1913] 1519: BC021195 Homo sapiens, dopamine receptor D2, clone MGC:10521 IMAGE:3939741, mRNA, complete cds gi|18203702|gb|BC021195.1|BC021195[18203702]

[1914] 1520: BC020752 Homo sapiens, Epstein-Barr virus induced gene 2 (lymphocyte-specific G protein-coupled receptor), clone MGC:22599 IMAGE:4722289, mRNA, complete cds gi|18089130|gb|BC020752.1|BC020752[18089130]

[1915] 1521: BC020614 Homo sapiens, G protein-coupled receptor 84, clone MGC:22224 IMAGE:4279185, mRNA, complete cds gi|18089044|gb|BC020614.1|BC020614[18089044]

[1916] 1522: BC021104 Homo sapiens, apelin; peptide ligand for APJ receptor, clone MGC:31846 IMAGE:4586949, mRNA, complete cds gi|18088893|gb|BC021104.1|BC021104[18088893]

[1917] 1523: BC020805 Homo sapiens, leukocyte receptor cluster (LRC) member 5, clone MGC:23828 IMAGE:4277870, mRNA, complete cds gi|18088780|gb|BC020805.1|BC020805[18088780]

[1918] 1524: BC020742 Homo sapiens, complement component 3a receptor 1, clone MGC:22570 IMAGE:4690283, mRNA, complete cds gi|18088764|gb|BC020742.1|BC020742[18088764]

[1919] 1525: BC020815 Homo sapiens, putative receptor protein, clone MGC:23860 IMAGE:4296149, mRNA, complete cds gi|18088747|gb|BC020815.1|BC020815[18088747]

[1920] 1526: BC020768 Homo sapiens, olfactory receptor, family 51, subfamily E, member 2, clone MGC:22638 IMAGE:4249775, mRNA, complete cds gi|18088468|gb|BC020768.1|BC020768[18088468]

[1921] 1527: BC020739 Homo sapiens, interleukin 13 receptor, alpha 2, clone MGC:22566 IMAGE:4807603, mRNA, complete cds gi|18088440|gb|BC020739.1|BC020739[18088440]

[1922] 1528: BC020678 Homo sapiens, G protein-coupled receptor 34, clone MGC:22389 IMAGE:4770479, mRNA, complete cds gi|18088371|gb|BC020678.1|BC020678[18088371]

[1923] 1529: BC020669 Homo sapiens, advanced glycosylation end product-specific receptor, clone MGC:22357 IMAGE:4718076, mRNA, complete cds gi|18088362|gb|BC020669.1|BC020669[18088362]

[1924] 1530: BC020968 Homo sapiens, chemokine (C-X-C motif), receptor 4 (fusin), clone MGC:9199 IMAGE:3846345, mRNA, complete cds gi|18088082|gb|BC020968.1|BC020968[18088082]

[1925] 1531: BC019610 Homo sapiens, somatostatin receptor 2, clone MGC:24950 IMAGE:3875163, mRNA, complete cds gi|18043108|gb|BC019610.1|BC019610[18043108]

[1926] 1532: BC020079 Homo sapiens, lamin B receptor, clone MGC:9041 IMAGE:3925138, mRNA, complete cds gi|18042833|gb|BC020079.1|BC020079[18042833]

[1927] 1715: NM—001364 Homo sapiens discs, large homolog 2, chapsyn-110 (Drosophila) (DLG2), mRNA gi|4557526|ref|NM—001364.1|[4557526]

[1928] 1716: NM—080744 Homo sapiens scavenger receptor cysteine rich domain containing, group B (4 domains) (SRCRB4D), mRNA gi|18152778|ref|NM—080744.1|[18152778]

[1929] 1717: AB063170 Homo sapiens mRNA for BANK, complete cds gi|17646091|dbj|AB063170.1|AB063170[17646091]

[1930] 1718: NM—022760 Homo sapiens chromosome 20 open reading frame 81 (C20orf81), mRNA gi|16163672|ref|NM—022760.2|[16163672]

[1931] 1719: NM—032554 Homo sapiens G protein-coupled receptor 81 (GPR81), mRNA gi|14211850|ref|NM—032554.1|[14211850]

[1932] 1720: AB054004 Homo sapiens DR5 gene for death receptor 5, promoter and partial cds gi|13429873|dbj|AB054004.1|AB054004[13429873]

[1933] 1721: NM—000668 Homo sapiens alcohol dehydrogenase IB (class I), beta polypeptide (ADH1B), mRNA gi|11496887|ref|NM—000668.2|[11496887]

[1934] 1722: NM—018697 Homo sapiens LanC lantibiotic synthetase component C-like 2 (bacterial) (LANCL2), mRNA gi|8923910|ref|NM—018697.1|[8923910]

[1935] 1723: NM—016610 Homo sapiens toll-like receptor 8 (TLR8), mRNA gi|7706147|ref|NM—016610.1|[7706147]

[1936] 1725: NM—015833 Homo sapiens adenosine deaminase, RNA-specific, B1 (RED1 homolog rat) (ADARB1), transcript variant DRABA2b, mRNA gi|7669476|ref|NM—015833.1|[7669476]

[1937] 1727: NM—007184 Homo sapiens nischarin (NISCH), mRNA gi|6005787|ref|NM—007184.1|[6005787]

[1938] 1728: NM—000139 Homo sapiens membrane-spanning 4-domains, subfamily A, member 1 (MS4A2), mRNA gi|4503676|ref|NM—000139.1|[4503676]

[1939] 1730: NM—080681 Homo sapiens collagen, type XI, alpha 2 (COL11A2), transcript variant 2, mRNA gi|18201918|ref|NM—080681.1|[18201918]

[1940] 1731: NM—080680 Homo sapiens collagen, type XI, alpha 2 (COL11A2), transcript variant 1, mRNA gi|18201916|ref|NM—080680.1|[18201916]

[1941] 1732: NM—080679 Homo sapiens collagen, type XI, alpha 2 (COL11A2), transcript variant 3, mRNA gi|18201914|ref|NM—080679.1|[18201914]

[1942] 1733: NM—006115 Homo sapiens preferentially expressed antigen in melanoma (PRAME), mRNA gi|18201906|ref|NM—006115.2|[18201906]

[1943] 1734: NM—020526 Homo sapiens EphA8 (EPHA8), mRNA gi|18201903|ref|NM—020526.2|[18201903]

[1944] 1735: NM—080818 Homo sapiens G protein-coupled receptor 80 (GPR80), mRNA gi|18201871|ref|NM—080818.1|[18201871]

[1945] 1736: NM—080817 Homo sapiens G protein-coupled receptor 82 (GPR82), mRNA gi|18201869|ref|NM—080817.1|[18201869]

[1946] 1737: AF400075 Homo sapiens coagulation factor II (thrombin) receptor-like 1 (F2RL1) gene, complete cds gi|15021772|gb|AF400075.1|AF400075[15021772]

[1947] 1738: NM—024021 Homo sapiens membrane-spanning 4-domains, subfamily A, member 4 (MS4A4A), mRNA gi|13430865|ref|NM—024021.1|[13430865]

[1948] 1739: AB066218 Homo sapiens RYR1 gene for ryanodine receptor type1, partial cds, clone:4-101 gi|18181961|dbj|AB066218.1|AB066218[18181961]

[1949] 1740: AB066217 Homo sapiens RYR1 gene for ryanodine receptor type1, partial cds, clone:4-96 gi|18181959|dbj|AB066217.1|AB066217[18181959]

[1950] 1741: NM—021950 Homo sapiens membrane-spanning 4-domains, subfamily A, member 2 (Fc fragment of IgE, high affinity I, receptor for; beta polypeptide) (MS4A1), mRNA gi|11386186|ref|NM—021950.1|[11386186]

[1951] 1742: NM—012323 Homo sapiens v-maf musculoaponeurotic fibrosarcoma oncogene homolog F (avian) (MAFF), mRNA gi|6912489|ref|NM—012323.1|[6912489]

[1952] 1743: AJ298292 Homo sapiens mRNA for histamine receptor H4 (HRH4 gene) gi|18152452|emb|AJ298292.1|HSA298292[18152452]

[1953] 1744: AB070621 Homo sapiens HTR4 gene for 5-hydroxytryptamine 4 receptor, promoter and exon gi|18149171|dbj|AB070621.1|AB070621[18149171]

[1954] 1745: AB070620 Homo sapiens HTR4 mRNA for 5-hydroxytryptamine 4 receptor, partial cds gi|18149169|dbj|AB070620.1|AB070620[18149169]

[1955] 1746: AB050774 Homo sapiens N27C7-4 gene, complete cds gi|18147104|dbj|AB050774.1|AB050774[18147104]

[1956] 1747: AB048946 Homo sapiens PrRPR gene for prolactin releasing peptide receptor, complete cds gi|18147078|dbj|AB048946.1|AB048946[18147078]

[1957] 1748: NM—030760 Homo sapiens endothelial differentiation, sphingolipid G-protein-coupled receptor, 8 (EDG8), mRNA gi|18141314|ref|NM—030760.2|[18141314]

[1958] 1749: NM—032556 Homo sapiens interleukin-1 HY2 (IL1HY2), mRNA gi|18141307|ref|NM—032556.2|[18141307]

[1959] 1750: AF459634 Homo sapiens immunoglobulin superfamily receptor translocation associated 5 mRNA, complete cds gi|18140080|gb|AF459634.1|AF459634[18140080]

[1960] 1751: AF459633 Homo sapiens immunoglobulin superfamily receptor translocation associated 4 mRNA, complete cds gi|18140078|gb|AF459633.1|AF459633[18140078]

[1961] 1752: AY046529 Homo sapiens melanocortin 1 receptor mutant V122M (MC1R) gene, complete cds gi|18138241|gb|AY046529.1|[18138241]

[1962] 1753: AY046528 Homo sapiens melanocortin 1 receptor mutant I40T (MC1R) gene, complete cds gi|18138239|gb|AY046528.1|[18138239]

[1963] 1754: AX338549 Sequence 1 from Patent WO0185790 gi|18128949|emb|AX338549.1|AX338549[18128949]

[1964] 1755: NM—001745 Homo sapiens calcium modulating ligand (CAMLG), mRNA gi|18105008|ref|NM—001745.2|[18105008]

[1965] 1756: NM—001128 Homo sapiens adaptor-related protein complex 1, gamma 1 subunit (AP1G1), mRNA gi|18104997|ref|NM—001128.2|[18104997]

[1966] 1757: NM—080545 Homo sapiens adaptor-related protein complex 1, gamma 2 subunit (AP1G2), transcript variant 2, mRNA gi|18104995|ref|NM—080545.1|[18104995]

[1967] 1758: NM—003917 Homo sapiens adaptor-related protein complex 1, gamma 2 subunit (AP1G2), transcript variant 1, mRNA gi|18104994|ref|NM—003917.2|[18104994]

[1968] 1759: AF459027 Homo sapiens immunoglobulin superfamily receptor translocation associated protein 3 mRNA, complete cds gi|18092654|gb|AF459027.1|AF459027[18092654]

[1969] 1760: AY069943 Homo sapiens TCP11b protein mRNA, complete cds gi|18091790|gb|AY069943.1|[18091790]

[1970] 1761: AY063126 Homo sapiens Fc alpha/mu receptor mRNA, partial cds; alternatively spliced gi|18032043|gb|AY063126.1|[18032043]

[1971] 1762: AY063125 Homo sapiens Fc alpha/mu receptor mRNA, complete cds; alternatively spliced gi|18032041|gb|AY063125.1|[18032041]

[1972] 1763: AF395264 Homo sapiens clone EIII48bpVNTR55 dopamine receptor D4 (DRD4) gene, partial cds gi|17063763|gb|AF395264.1|AF395264[17063763]

[1973] 1764: AF395263 Homo sapiens clone EIII48bpVNTR54 dopamine receptor D4 (DRD4) gene, partial cds gi|17063761|gb|AF395263.1|AF395263[17063761]

[1974] 1765: AF395262 Homo sapiens clone EIII48bpVNTR53 dopamine receptor D4 (DRD4) gene, partial cds gi|17063759|gb|AF395262.1|AF395262[17063759]

[1975] 1766: AF395261 Homo sapiens clone EIII48bpVNTR52 dopamine receptor D4 (DRD4) gene, partial cds gi|17063757|gb|AF395261.1|AF395261[17063757]

[1976] 1767: AF395260 Homo sapiens clone EIII48bpVNTR51 dopamine receptor D4 (DRD4) gene, partial cds gi|17063755|gb|AF395260.1|AF395260[17063755]

[1977] 1768: AF395259 Homo sapiens clone EIII48bpVNTR50 dopamine receptor D4 (DRD4) gene, partial cds gi|17063753|gb|AF395259.1|AF395259[17063753]

[1978] 1769: AF395258 Homo sapiens clone EIII48bpVNTR49 dopamine receptor D4 (DRD4) gene, partial cds gi|17063751|gb|AF395258.1|AF395258[17063751]

[1979] 1770: AF395257 Homo sapiens clone EIII48bpVNTR48 dopamine receptor D4 (DRD4) gene, partial cds gi|17063749|gb|AF395257.1|AF395257[17063749]

[1980] 1771: AF395256 Homo sapiens clone EIII48bpVNTR47 dopamine receptor D4 (DRD4) gene, partial cds gi|17063747|gb|AF395256.1|AF395256[17063747]

[1981] 1772: AF395255 Homo sapiens clone EIII48bpVNTR46 dopamine receptor D4 (DRD4) gene, partial cds gi|17063745|gb|AF395255.1|AF395255[17063745]

[1982] 1773: AF395254 Homo sapiens clone EIII48bpVNTR45 dopamine receptor D4 (DRD4) gene, partial cds gi|17063743|gb|AF395254.1|AF395254[17063743]

[1983] 1774: AF395253 Homo sapiens clone EIII48bpVNTR44 dopamine receptor D4 (DRD4) gene, partial cds gi|17063741|gb|AF395253.1|AF395253[17063741]

[1984] 1775: AF395252 Homo sapiens clone EIII48bpVNTR43 dopamine receptor D4 (DRD4) gene, partial cds gi|17063739|gb|AF395252.1|AF395252[17063739]

[1985] 1776: AF395251 Homo sapiens clone EIII48bpVNTR42 dopamine receptor D4 (DRD4) gene, partial cds gi|17063737|gb|AF395251.1|AF395251[17063737]

[1986] 1777: AF395250 Homo sapiens clone EIII48bpVNTR41 dopamine receptor D4 (DRD4) gene, partial cds gi|17063735|gb|AF395250.1|AF395250[17063735]

[1987] 1778: AF395249 Homo sapiens clone EIII48bpVNTR40 dopamine receptor D4 (DRD4) gene, partial cds gi|17063733|gb|AF395249.1|AF395249[17063733]

[1988] 1779: AF395248 Homo sapiens clone EIII48bpVNTR39 dopamine receptor D4 (DRD4) gene, partial cds gi|17063731|gb|AF395248.1|AF395248[17063731]

[1989] 1780: AF395247 Homo sapiens clone EIII48bpVNTR38 dopamine receptor D4 (DRD4) gene, partial cds gi|17063729|gb|AF395247.1|AF395247[17063729]

[1990] 1781: AF395246 Homo sapiens clone EIII48bpVNTR37 dopamine receptor D4 (DRD4) gene, partial cds gi|17063727|gb|AF395246.1|AF395246[17063727]

[1991] 1782: AF395245 Homo sapiens clone EIII48bpVNTR36 dopamine receptor D4 (DRD4) gene, partial cds gi|17063725|gb|AF395245.1|AF395245[17063725]

[1992] 1783: AF395244 Homo sapiens clone EIII48bpVNTR35 dopamine receptor D4 (DRD4) gene, partial cds gi|17063723|gb|AF395244.1|AF395244[17063723]

[1993] 1784: AF395243 Homo sapiens clone EIII48bpVNTR34 dopamine receptor D4 (DRD4) gene, partial cds gi|17063721|gb|AF395243.1|AF395243[17063721]

[1994] 1785: AF395242 Homo sapiens clone EIII48bpVNTR33 dopamine receptor D4 (DRD4) gene, partial cds gi|17063719|gb|AF395242.1|AF395242[17063719]

[1995] 1786: AF395241 Homo sapiens clone EIII48bpVNTR32 dopamine receptor D4 (DRD4) gene, partial cds gi|17063717|gb|AF395241.1|AF395241[17063717]

[1996] 1787: AF395240 Homo sapiens clone EIII48bpVNTR31 dopamine receptor D4 (DRD4) gene, partial cds gi|17063715|gb|AF395240.1|AF395240[17063715]

[1997] 1788: AF395239 Homo sapiens clone EIII48bpVNTR30 dopamine receptor D4 (DRD4) gene, partial cds gi|17063713|gb|AF395239.1|AF395239[17063713]

[1998] 1789: AF395238 Homo sapiens clone EIII48bpVNTR29 dopamine receptor D4 (DRD4) gene, partial cds gi|17063711|gb|AF395238.1|AF395238[17063711]

[1999] 1790: AF395237 Homo sapiens clone EIII48bpVNTR28 dopamine receptor D4 (DRD4) gene, partial cds gi|17063709|gb|AF395237.1|AF395237[17063709]

[2000] 1791: AF395236 Homo sapiens clone EIII48bpVNTR27 dopamine receptor D4 (DRD4) gene, partial cds gi|17063707|gb|AF395236.1|AF395236[17063707]

[2001] 1792: AF395235 Homo sapiens clone EIII48bpVNTR26 dopamine receptor D4 (DRD4) gene, partial cds gi|17063705|gb|AF395235.1|AF395235[17063705]

[2002] 1793: AF395234 Homo sapiens clone EIII48bpVNTR25 dopamine receptor D4 (DRD4) gene, partial cds gi|17063703|gb|AF395234.1|AF395234[17063703]

[2003] 1794: AF395233 Homo sapiens clone EIII48bpVNTR24 dopamine receptor D4 (DRD4) gene, partial cds gi|17063701|gb|AF395233.1|AF395233[17063701]

[2004] 1795: AF395232 Homo sapiens clone EIII48bpVNTR23 dopamine receptor D4 (DRD4) gene, partial cds gi|17063699|gb|AF395232.1|AF395232[17063699]

[2005] 1796: AF395231 Homo sapiens clone EIII48bpVNTR22 dopamine receptor D4 (DRD4) gene, partial cds gi|17063697|gb|AF395231.1|AF395231[17063697]

[2006] 1797: AF395230 Homo sapiens clone EIII48bpVNTR21 dopamine receptor D4 (DRD4) gene, partial cds gi|17063695|gb|AF395230.1|AF395230[17063695]

[2007] 1798: AF395229 Homo sapiens clone EIII48bpVNTR20 dopamine receptor D4 (DRD4) gene, partial cds gi|17063693|gb|AF395229.1|AF395229[17063693]

[2008] 1799: AF395228 Homo sapiens clone EIII48bpVNTR19 dopamine receptor D4 (DRD4) gene, partial cds gi|17063691|gb|AF395228.1|AF395228[17063691]

[2009] 1800: AF395227 Homo sapiens clone EIII48bpVNTR18 dopamine receptor D4 (DRD4) gene, partial cds gi|17063689|gb|AF395227.1|AF395227[17063689]

[2010] 1801: AF395226 Homo sapiens clone EIII48bpVNTR17 dopamine receptor D4 (DRD4) gene, partial cds gi|17063687|gb|AF395226.1|AF395226[17063687]

[2011] 1802: AF395225 Homo sapiens clone EIII48bpVNTR16 dopamine receptor D4 (DRD4) gene, partial cds gi|17063685|gb|AF395225.1|AF395225[17063685]

[2012] 1803: AF395224 Homo sapiens clone EIII48bpVNTR15 dopamine receptor D4 (DRD4) gene, partial cds gi|17063683|gb|AF395224.1|AF395224[17063683]

[2013] 1804: AF395223 Homo sapiens clone EIII48bpVNTR14 dopamine receptor D4 (DRD4) gene, partial cds gi|17063681|gb|AF395223.1|AF395223[17063681]

[2014] 1805: AF395222 Homo sapiens clone EIII48bpVNTR13 dopamine receptor D4 (DRD4) gene, partial cds gi|17063679|gb|AF395222.1|AF395222[17063679]

[2015] 1806: AF395221 Homo sapiens clone EIII48bpVNTR12 dopamine receptor D4 (DRD4) gene, partial cds gi|17063677|gb|AF395221.1|AF395221[17063677]

[2016] 1807: AF395220 Homo sapiens clone EIII48bpVNTR11 dopamine receptor D4 (DRD4) gene, partial cds gi|17063675|gb|AF395220.1|AF395220[17063675]

[2017] 1808: AF395219 Homo sapiens clone EIII48bpVNTR10 dopamine receptor D4 (DRD4) gene, partial cds gi|17063673|gb|AF395219.1|AF395219[17063673]

[2018] 1809: AF395218 Homo sapiens clone EIII48bpVNTR9 dopamine receptor D4 (DRD4) gene, partial cds gi|17063671|gb|AF395218.1|AF395218[17063671]

[2019] 1810: AF395217 Homo sapiens clone EIII48bpVNTR8 dopamine receptor D4 (DRD4) gene, partial cds gi|17063669|gb|AF395217.1|AF395217[17063669]

[2020] 1811: AF395216 Homo sapiens clone EIII48bpVNTR7 dopamine receptor D4 (DRD4) gene, partial cds gi|17063667|gb|AF395216.1|AF395216[17063667]

[2021] 1812: AF395215 Homo sapiens clone EIII48bpVNTR6 dopamine receptor D4 (DRD4) gene, partial cds gi|17063665|gb|AF395215.1|AF395215[17063665]

[2022] 1813: AF395214 Homo sapiens clone EIII48bpVNTR5 dopamine receptor D4 (DRD4) gene, partial cds gi|17063663|gb|AF395214.1|AF395214[17063663]

[2023] 1814: AF395213 Homo sapiens clone EIII48bpVNTR4 dopamine receptor D4 (DRD4) gene, partial cds gi|17063661|gb|AF395213.1|AF395213[17063661]

[2024] 1815: AF395212 Homo sapiens clone EIII48bpVNTR3 dopamine receptor D4 (DRD4) gene, partial cds gi|17063659|gb|AF395212.1|AF395212[17063659]

[2025] 1816: AF395211 Homo sapiens clone EIII48bpVNTR2 dopamine receptor D4 (DRD4) gene, partial cds gi|17063657|gb|AF395211.1|AF395211[17063657]

[2026] 1817: AF395210 Homo sapiens clone EIII48bpVNTR1 dopamine receptor D4 (DRD4) gene, partial cds gi|17063655|gb|AF395210.1|AF395210[17063655]

[2027] 1818: AF258342 Homo sapiens biogenic amine receptor-like protein mRNA, complete cds gi|15428321|gb|AF258342.1|AF258342[15428321]

[2028] 1819: AJ278982 Homo sapiens mRNA for 5-hydroxytryptamine4 receptor (HTR4 gene), splice variant h5-HT4(n) gi|12274905|emb|AJ278982.1|HSA278982[12274905]

[2029] 1820: AJ278981 Homo sapiens mRNA for 5-hydroxytryptamine4 receptor (HTR4 gene), splice variant h5-HT4(g) gi|12274903|emb|AJ278981.1|HSA278981[12274903]

[2030] 1821: AJ278980 Homo sapiens mRNA for 5-hydroxytryptamine4 receptor (HTR4 gene), splice variant h5-HT4(b) gi|12274901|emb|AJ278980.1|HSA278980[12274901]

[2031] 1822: AJ278979 Homo sapiens mRNA for 5-hydroxytryptamine4 receptor (HTR4 gene), splice variant h5-HT4(a) gi|12274899|emb|AJ278979.1|HSA278979[12274899]

[2032] 1823: NM—014555 Homo sapiens transient receptor potential cation channel, subfamily M, member (TRPM5), mRNA gi|11225265|ref|NM—014555.1|[11225265]

[2033] 1824: AF200627 Homo sapiens putative catecholamine receptor gene, complete cds gi|10441576|gb|AF200627.1|AF200627[10441576]

[2034] 1825: AF257789 Homo sapiens urokinase-type plasminogen activator receptor mRNA, partial cds gi|8050814|gb|AF257789.1|AF257789[8050814]

[2035] 1826: NM—002335 Homo sapiens low density lipoprotein receptor-related protein 5 (LRP5), mRNA gi|4505018|ref|NM—002335.1|[4505018]

[2036] 1827: Y00508 H. sapiens M1 gene for muscarinic acetylcholine receptor gi|297405|emb|Y00508.1|HSMIMAR[297405]

[2037] 1828: AF457599 Homo sapiens killer cell immunoglobulin-like receptor (KIR3DL1) gene, KIR3DL1-NKB1-like allele, promoter region and exon 1 gi|18087432|gb|AF457599.1|AF457599[18087432]

[2038] 1829: AF457598 Homo sapiens killer cell immunoglobulin-like receptor (KIR3DL1) gene, KIR3DL1-NKB1-like allele, promoter region and exon 1 gi|18087431|gb|AF457598.1|AF457598[18087431]

[2039] 1830: AF457597 Homo sapiens killer cell immunoglobulin-like receptor (KIR3DL1) gene, KIR3DL1-NKAT3-like allele, promoter region and exon 1 gi|18087430|gb|AF457597.1|AF457597[18087430]

[2040] 1831: AJ312755 Homo sapiens mRNA for scavenger receptor cysteine-rich protein SRCRB-S4D, (SRCRB-S4D gene) gi|18073905|emb|AJ312755.1|HSA312755[18073905]

[2041] 1832: AF331842 Homo sapiens SPPR-2 mRNA, complete cds, alternatively spliced gi|18033260|gb|AF331842.1|AF331842[18033260]

[2042] 1833: AF331841 Homo sapiens SPPR-1 mRNA, complete cds, alternatively spliced gi|18033258|gb|AF331841.1|AF331841[18033258]

[2043] 1834: AF331840 Homo sapiens SPPR mRNA, complete cds, alternatively spliced gi|18033256|gb|AF331840.1|AF331840[18033256]

[2044] 1835: AF284756 Homo sapiens VPS10 domain receptor SorCS mRNA, complete cds gi|18032274|gb|AF284756.1|AF284756[18032274]

[2045] 1836: AF328684 Homo sapiens Fc-epsilon receptor III mRNA, complete cds gi|18028292|gb|AF328684.1|AF328684[18028292]

[2046] 1837: AY029413 Homo sapiens interleukin-1 receptor antagonist-like FIL1 theta (FIL1-theta) mRNA, complete cds gi|18025343|gb|AY029413.1|[18025343]

[2047] 1838: AF126470 Homo sapiens KOR-3D (KOR-3) mRNA, complete cds gi|18000078|gb|AF126470.1|AF126470[18000078]

[2048] 1839: AF435925 Homo sapiens very large G protein-coupled receptor 1b (VLGR1) mRNA, complete cds gi|16904207|gb|AF435925.1|AF435925[16904207]

[2049] 1840: G67431 D7S3125 GRB10 Homo sapiens STS genomic, sequence tagged site gi|12025489|gb|G67431.1|G67431[12025489]

[2050] 1841: AF260136 Homo sapiens NK cell receptor D (NKG2-D) mRNA, NKG2-D*03 allele, complete cds gi|9295444|gb|AF260136.1|AF260136[9295444]

[2051] 1842: AF260135 Homo sapiens NK cell receptor D (NKG2-D) mRNA, NKG2-D*02 allele, complete cds gi|9295442|gb|AF260135.1|AF260135[9295442]

[2052] 1843: AF260134 Homo sapiens NK cell receptor C (NKG2-C) mRNA, NKG2-C*02 allele, complete cds gi|9295440|gb|AF260134.1|AF260134[9295440]

[2053] 1844: NM—015891 Homo sapiens pre-mRNA splicing factor 17 (PRP17), mRNA gi|7706656|ref|NM—015891.1|[7706656]

[2054] 1845: L12397 Homo sapiens Dopamine D4 receptor (DRD4) gene, partial cds gi|291947|gb|L12397.1|HUMD4G[291947]

[2055] 1846: NM—019888 Homo sapiens melanocortin 3 receptor (MC3R), mRNA gi|17986278|ref|NM—019888.2|[17986278]

[2056] 1847: NM—000795 Homo sapiens dopamine receptor D2 (DRD2), transcript variant 1, mRNA gi|17986271|ref|NM—000795.2|[17986271]

[2057] 1848: NM—016574 Homo sapiens dopamine receptor D2 (DRD2), transcript variant 2, mRNA gi|17986269|ref|NM—016574.2|[17986269]

[2058] 1849: AY070269 Homo sapiens hypocretin receptor 1 (HCRTR1) gene, complete cds gi|17979217|gb|AY070269.1|[17979217]

[2059] 1850: NM—052945 Homo sapiens BAFF receptor (BAFFR), mRNA gi|17978517|ref|NM—052945.2|[17978517]

[2060] 1851: NM—054026 Homo sapiens CCR4-NOT transcription complex, subunit 7 (CNOT7), transcript variant 2, mRNA gi|17978499|ref|NM—054026.1|[17978499]

[2061] 1852: NM—013354 Homo sapiens CCR4-NOT transcription complex, subunit 7 (CNOT7), transcript variant 1, mRNA gi|17978498|ref|NM—013354.3|[17978498]

[2062] 1853: NM—004444 Homo sapiens EphB4 (EPHB4), mRNA gi|17975769|ref|NM—004444.2|[17975769]

[2063] 1854: NM—004443 Homo sapiens EphB3 (EPHB3), mRNA gi|17975767|ref|NM—004443.2|[17975767]

[2064] 1855: NM—004442 Homo sapiens EphB2 (EPHB2), transcript variant 1, mRNA gi|17975766|ref|NM—004442.2|[17975766]

[2065] 1856: NM—017449 Homo sapiens EphB2 (EPHB2), transcript variant 2, mRNA gi|17975764|ref|NM—017449.1|[17975764]

[2066] 1857: BC019278 Homo sapiens, cargo selection protein (mannose 6 phosphate receptor binding protein), clone MGC:3816 IMAGE:2905275, mRNA, complete cds gi|17939468|gb|BC019278.1|BC019278[17939468]

[2067] 1858: NM—080387 Homo sapiens C-type lectin-like receptor (CLEC-6), mRNA gi|17933769|ref|NM—080387.1|[17933769]

[2068] 1859: NM—007200 Homo sapiens A kinase (PRKA) anchor protein 13 (AKAP13), mRNA gi|17933491|ref|NM—007200.1|[17933491]

[2069] 1861: AF373878 Homo sapiens herpesvirus entry mediator (TNFRSF14) mRNA, TNFRSF14-V241I allele, complete cds gi|17901872|gb|AF373878.1|AF373878[17901872]

[2070] 1862: AF373877 Homo sapiens herpesvirus entry mediator (TNFRSF14) mRNA, TNFRSF14-R17K allele, complete cds gi|17901869|gb|AF373877.1|AF373877[17901869]

[2071] 1863: AF373876 Homo sapiens nectin-1 (PVRL1) gene, PVRL1-R199W allele, partial cds gi|17901866|gb|AF373876.1|AF373876[17901866]

[2072] 1864: AY065844 Homo sapiens truncated receptor tyrosine kinase TrkC mRNA, partial cds gi|17887448|gb|AY065844.1|[17887448]

[2073] 1865: AY062295 Homo sapiens prolactin receptor (PRLR) mRNA, partial cds; alternatively spliced gi|17887307|gb|AY062295.1|[17887307]

[2074] 1866: NM—078474 Homo sapiens BBP-like protein 2 (BLP2), transcript variant 1, mRNA gi|17865799|ref|NM—078474.1|[17865799]

[2075] 1867: NM—025141 Homo sapiens BBP-like protein 2 (BLP2), transcript variant 2, mRNA gi|17865798|ref|NM—025141.2|[17865798]

[2076] 1868: NM—078473 Homo sapiens BBP-like protein 1 (BLP1), transcript variant 1, mRNA gi|17865796|ref|NM—078473.1|[17865796]

[2077] 1869: NM—020749 Homo sapiens AT2 receptor-interacting protein 1 (ATIP1), mRNA gi|17865631|ref|NM—020749.1|[17865631]

[2078] 1870: NM—002088 Homo sapiens glutamate receptor, ionotropic, kainate 5 (GRIK5), mRNA gi|17864085|ref|NM—002088.2|[17864085]

[2079] 1871: AY064474 Homo sapiens interleukin 21 receptor (IL21R) gene, complete cds gi|17863086|gb|AY064474.1|[17863086]

[2080] 1872: AY036093 Homo sapiens lysyl oxidase-like 4 mRNA, complete cds gi|17861371|gb|AY036093.1|[17861371]

[2081] 1873: AF369653 Homo sapiens corticotropin releasing hormone receptor variant 1g (CRHR1) mRNA, partial cds, alternatively spliced gi|17834100|gb|AF369653.1|AF369653[17834100]

[2082] 1874: AF369652 Homo sapiens corticotropin releasing hormone receptor variant 1f (CRHR1) mRNA, partial cds, alternatively spliced gi|17834097|gb|AF369652.1|AF369652[17834097]

[2083] 1875: AF369651 Homo sapiens corticotropin releasing hormone receptor variant 1e (CRHR1) mRNA, partial cds, alternatively spliced gi|17834094|gb|AF369651.1|AF369651[17834094]

[2084] 1876: NM—001239 Homo sapiens cyclin H (CCNH), mRNA gi|17738313|ref|NM—001239.2|[17738313]

[2085] 1877: NM 014286 Homo sapiens frequenin homolog (Drosophila) (FREQ), mRNA gi|17738307|ref|NM—014286.2|[17738307]

[2086] 1878: NM—006650 Homo sapiens complexin 2 (CPLX2), mRNA gi|17738306|ref|NM—006650.2|[17738306]

[2087] 1879: NM—006651 Homo sapiens complexin 1 (CPLX1), mRNA gi|17738305|ref|NM—006651.2|[17738305]

[2088] 1880: AF416558 Homo sapiens N-methyl-D-aspartate receptor 3A (GRIN3A) mRNA, complete cds gi|17530176|gb|AF416558.1|AF416558[17530176]

[2089] 1882: BC018926 Homo sapiens, vanilloid receptor-like protein, clone MGC:12549 IMAGE:4298484, mRNA, complete cds gi|17511937|gb|BC018926.1|BC018926[17511937]

[2090] 1883: BC018778 Homo sapiens, KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 1, clone MGC:32075 IMAGE:4870476, mRNA, complete cds gi|17511855|gb|BC018778.1|BC018778[17511855]

[2091] 1884: NM 004625 Homo sapiens wingless-type MMTV integration site family, member 7A (WNT7A), mRNA gi|17505190|ref|NM—004625.2|[17505190]

[2092] 1885: L78805 Homo sapiens G protein-coupled receptor gene, partial cds gi|17466993|gb|L78805.1|HUMGPCRE[17466993]

[2093] 1886: NM—003602 Homo sapiens FK506 binding protein 6 (36kD) (FKBP6), mRNA gi|17149848|ref|NM—003602.2|[17149848]

[2094] 1887: NM—000801 Homo sapiens FKS06 binding protein 1A (12kD) (FKBP1A), transcript variant 12B, mRNA gi|17149837|ref|NM—000801.2|[17149837]

[2095] 1888: NM—054014 Homo sapiens FK506 binding protein 1A (12kD) (FKBPlA), transcript variant 12A, mRNA gi|17149835|ref|NM—054014.1|[17149835]

[2096] 1889: AF411044 Homo sapiens DnaJ protein Tid-1 mRNA, complete cds gi|17066574|gb|AF411044.1|AF411044[17066574]

[2097] 1890: NM—003728 Homo sapiens unc-5 homolog B (C. elegans) (UNC5C), mRNA gi|16933524|ref|NM—003728.2|[16933524]

[2098] 1891: NM—005633 Homo sapiens son of sevenless homolog 1 (Drosophila) (SOS1), mRNA gi|15529995|ref|NM—005633.2|[15529995]

[2099] 1892: AJ308539 Homo sapiens partial mRNA for T-cell receptor beta chain V-D-J region (TCRBV7BJ2S4 gene) gi|14787781|emb|AJ308539.1|HSA308539[14787781]

[2100] 1893: AJ308538 Homo sapiens partial mRNA for T-cell receptor beta chain V-D-J region (TCRBV14BJ1S1 gene) gi|14787779|emb|AJ308538.1|HSA308538[14787779]

[2101] 1894: AJ308537 Homo sapiens partial mRNA for T-cell receptor beta chain V-D-J region (TCRBV17BJ2S7 gene) gi|14787777|emb|AJ308537.1|HSA308537[14787777]

[2102] 1895: AJ308536 Homo sapiens partial mRNA for T-cell receptor beta chain V-D-J region (TCRBV23BJ2S2 gene) gi|14787775|emb|AJ308536.1|HSA308536[14787775]

[2103] 1896: AJ308535 Homo sapiens partial mRNA for T-cell receptor beta chain V-D-J region (TCRBV12BJ1S5 gene) gi|14787773|emb|AJ308535.1|HSA308535[14787773]

[2104] 1897: AJ308534 Homo sapiens partial mRNA for T-cell receptor beta chain, V-D-J region (TCRBVlBJ2S1 gene) gi|14787771|emb|AJ308534.1|HSA308534[14787771]

[2105] 1898: AJ308533 Homo sapiens partial mRNA for T-cell receptor beta chain, V-D-J region (TCRBV25BJ2S7 gene) gi|14787769|emb|AJ308533.1|HSA308533[14787769]

[2106] 1899: AJ308532 Homo sapiens partial mRNA for T-cell receptor beta chain, V-D-J region (TCRBV22BJ2S7 gene) gi|14787767|emb|AJ308532.1|HSA308532[14787767]

[2107] 1900: NM—014459 Homo sapiens protocadherin 17 (PCDH17), mRNA gi|14589926|ref|NM—014459.2|[14589926]

[2108] 1901: NM—032961 Homo sapiens protocadherin 10 (PCDH10), transcript variant 1, mRNA gi|14589915|ref|NM—032961.1|[14589915]

[2109] 1902: NM—020815 Homo sapiens protocadherin 10 (PCDH10), transcript variant 2, mRNA gi|14589913|ref|NM—020815.1|[14589913]

[2110] 1903: NM—032966 Homo sapiens Burkitt lymphoma receptor 1, GTP binding protein (BLR1), transcript variant 2, mRNA gi|145

[2111] 2001: AF011513 Homo sapiens isolate MwCCR5-1553 CCR5 receptor (CCR5) mRNA, partial cds gi|2305143|gb|AF011513.1|AF011513[2305143]

[2112] 2002: AF011512 Homo sapiens isolate MwCCR5-107 CCR5 receptor (CCR5) mRNA, partial cds gi|2305141|gb|AF011512.1|AF011512[2305141]

[2113] 2003: AF011511 Homo sapiens isolate KeCCR5-3b CCR5 receptor (CCR5) mRNA, partial cds gi|2305139|gb|AF011511.1|AF011511[2305139]

[2114] 2004: AF011510 Homo sapiens isolate KeCCR5-3a CCR5 receptor (CCR5) mRNA, partial cds gi|2305137|gb|AF011510.1|AF011510[2305137]

[2115] 2005: AF011509 Homo sapiens isolate KeCCR5-116 CCR5 receptor (CCR5) mRNA, partial cds gi|2305135|gb|AF011509.1|AF011509[2305135]

[2116] 2006: AF011508 Homo sapiens isolate KeCCR5-111 CCR5 receptor (CCR5) mRNA, partial cds gi|2305133|gb|AF011508.1|AF011508[2305133]

[2117] 2007: AF011507 Homo sapiens isolate InCCR5-72a CCR5 receptor (CCR5) mRNA, partial cds gi|2305131|gb|AF011507.1|AF011507[2305131]

[2118] 2008: AF011506 Homo sapiens isolate InCCR5-71b CCR5 receptor (CCR5) mRNA, partial cds gi|2305129|gb|AF011506.1|AF011506[2305129]

[2119] 2009: AF011505 Homo sapiens isolate InCCRS-71a CCR5 receptor (CCR5) mRNA, partial cds gi|2305127|gb|AF011505.1|AF011505[2305127]

[2120] 2010: AF011504 Homo sapiens isolate InCCR5-46 CCR5 receptor (CCR5) mRNA, partial cds gi|2305125|gb|AF011504.1|AF011504[2305125]

[2121] 2011: AF011503 Homo sapiens isolate InCCR5-467 CCRS receptor (CCR5) mRNA, partial cds gi|2305123|gb|AF011503.1|AF011503[2305123]

[2122] 2012: AF011502 Homo sapiens isolate InCCR5-463 CCR5 receptor (CCR5) mRNA, partial cds gi|2305121|gb|AF011502.1|AF011502[2305121]

[2123] 2013: AF011501 Homo sapiens isolate InCCR5-45c CCR5 receptor (CCR5) mRNA, partial cds gi|2305119|gb|AF011501.1|AF011501[2305119]

[2124] 2014: AF011500 Homo sapiens isolate HtCCR5-104 CCR5 receptor (CCR5) mRNA, partial cds gi|2305117|gb|AF011500.1|AF011500[2305117]

[2125] 2015: U77732 Homo sapiens glycine receptor alpha 1 subunit gene, partial cds gi|1718390|gb|U77732.1|HSU77732[1718390]

[2126] 2016: NM—033519 Homo sapiens olfactory receptor sdolf (sdolf), mRNA gi|15723373|ref|NM—033519.1|[15723373]

[2127] 2017: NM—032192 Homo sapiens hypothetical protein FLJ20940 (FLJ20940), mRNA gi|14149882|ref|NM—032192.1|[14149882]

[2128] 2018: NM—032152 Homo sapiens PRAM-1 protein (PRAM-1), mRNA gi|14149826|ref|NM—032152.1|[14149826]

[2129] 2019: NM—032142 Homo sapiens hypothetical protein FLJ10352 (FLJ10352), mRNA gi|14149808|ref|NM—032142.1|[14149808]

[2130] 2020: NM—004801 Homo sapiens neurexin 1 (NRXN1), mRNA gi|14149612|ref|NM—004801.1|[14149612]

[2131] 2021: NM—031936 Homo sapiens G protein-coupled receptor 61 (GPR61), mRNA gi|13994319|ref|NM—031936.1|[13994319]

[2132] 2022: NM—030901 Homo sapiens olfactory receptor, family 7, subfamily A, member 17 (OR7A17), mRNA gi|13775161|ref|NM—030901.1|[13775161]

[2133] 2023: NM—024681 Homo sapiens hypothetical protein FLJ12242 (FLJ12242), mRNA gi|13489098|ref|NM—024681.1|[13489098]

[2134] 2024: NM—022571 Homo sapiens putative leukocyte platelet-activating factor receptor (HUMNPIIY20), mRNA gi|12007653|ref|NM—022571.1|[12007653]

[2135] 2025: NM—022065 Homo sapiens hypothetical protein FLJ21877 (FLJ21877), mRNA gi|11545774|ref|NM—022065.1|[11545774]

[2136] 2026: NM—020806 Homo sapiens gephyrin (GPHN), mRNA gi|10880982|ref|NM—020806.1|[10880982]

[2137] 2027: NM—021258 Homo sapiens interleukin 22 receptor (IL22R), mRNA gi|10864066|ref|NM—021258.1|[10864066]

[2138] 2029: NM—020400 Homo sapiens G protein-coupled receptor 92 (GPR92), mRNA gi|9966878|ref|NM—020400.1|[9966878]

[2139] 2030: NM—000888 Homo sapiens integrin, beta 6 (ITGB6), mRNA gi|9966771|ref|NM—000888.3|[9966771]

[2140] 2032: NM—018113 Homo sapiens lipocalin-interacting membrane receptor (LIMR), mRNA gi|8922462|ref|NM—018113.1|[8922462]

[2141] 2033: NM—018423 Homo sapiens hypothetical protein DKFZp761P1010 (DKFZp761P1010), mRNA gi|8922178|ref|NM—018423.1|[8922178]

[2142] 2034: AF257182 Homo sapiens G-protein-coupled receptor 48 (GPR48) mRNA, complete cds gi|7739736|gb|AF257182.1|AF257182[7739736]

[2143] 2035: NM—016442 Homo sapiens type 1 tumor necrosis factor receptor shedding aminopeptidase regulator (ARTS-1), mRNA gi|7706544|ref|NM—016442.1|[7706544]

[2144] 2036: NM—015364 Homo sapiens MD-2 protein (MD-2), mRNA gi|7662503|ref|NM—015364.1|[7662503]

[2145] 2037: NM—014380 Homo sapiens nerve growth factor receptor (TNFRSF16) associated protein 1 (NGFRAP1), mRNA gi|7657043|ref|NM—014380.1|[7657043]

[2146] 2038: NM—013308 Homo sapiens platelet activating receptor homolog (H963), mRNA gi|7019400|ref|NM—013308.1|[7019400]

[2147] 2039: NM—013333 Homo sapiens EH domain-binding mitotic phosphoprotein (EPSIN), mRNA gi|7019368|ref|NM—013333.1|[7019368]

[2148] 2040: NM—007369 Homo sapiens G-protein coupled receptor (RE2), mRNA gi|6677700|ref|NM—007369.1|[6677700]

[2149] 2041: NM—002673 Homo sapiens plexin B1 (PLXNB1), mRNA gi|6631105|ref|NM—002673.1|[6631105]

[2150] 2042: NM—007115 Homo sapiens tumor necrosis factor, alpha-induced protein 6 (TNFAIP6), mRNA gi|6005905|ref|NM—007115.1|[6005905]

[2151] 2044: NM—007223 Homo sapiens putative G protein coupled receptor (GPR), mRNA gi|6005771|ref|NM—007223.1|[6005771]

[2152] 2045: NM—006748 Homo sapiens Src-like-adaptor (SLA), mRNA gi|5803170|ref|NM—006748.1|[5803170]

[2153] 2046: NM—006681 Homo sapiens neuromedin U (NMU), mRNA gi|5729946|ref|NM—006681.1|[5729946]

[2154] 2047: NM—006068 Homo sapiens toll-like receptor 6 (TLR6), mRNA gi|5174720|ref|NM—006068.1|[5174720]

[2155] 2048: NM—006018 Homo sapiens putative chemokine receptor; GTP-binding protein (HM74), mRNA gi|5174460|ref|NM—006018.1|[5174460]

[2156] 2049: NM—006098 Homo sapiens guanine nucleotide binding protein (G protein), beta polypeptide 2-like 1 (GNB2L1), mRNA gi|5174446|ref|NM—006098.1|[5174446]

[2157] 2050: NM—005879 Homo sapiens TRAF interacting protein (TRIP), mRNA gi|5032194|ref|NM—005879.1|[5032194]

[2158] 2051: NM—005843 Homo sapiens signal transducing adaptor molecule (SH3 domain and ITAM motif) 2 (STAM2), mRNA gi|5032126|ref|NM—005843.1|[5032126]

[2159] 2052: NM—005505 Homo sapiens CD36 antigen (collagen type I receptor, thrombospondin receptor)-like 1 (CD36L1), mRNA gi|5031628|ref|NM—005505.1|[5031628]

[2160] 2053: NM—005795 Homo sapiens calcitonin receptor-like (CALCRL), mRNA gi|5031620|ref|NM—005795.1|[5031620]

[2161] 2054: NM—005400 Homo sapiens protein kinase C, epsilon (PRKCE), mRNA gi|4885562|ref|NM—005400.1|[4885562]

[2162] 2057: NM—004488 Homo sapiens glycoprotein V (platelet) (GP5), mRNA gi|4758459|ref|NM—004488.1|[4758459]

[2163] 2058: NM—004122 Homo sapiens growth hormone secretagogue receptor (GHSR), mRNA gi|4758433|ref|NM—004122.1|[4758433]

[2164] 2059: NM—004438 Homo sapiens EphA4 (EPHA4), mRNA gi|4758279|ref|NM—004438.1|[4758279]

[2165] 2060: NM—004198 Homo sapiens cholinergic receptor, nicotinic, alpha polypeptide 6 (CHRNA6), mRNA gi|4757981|ref|NM—004198.1|[4757981]

[2166] 2061: NM—004054 Homo sapiens complement component 3a receptor 1 (C3AR1), mRNA gi|4757887|ref|NM—004054.1|[4757887]

[2167] 2062: NM—003955 Homo sapiens STAT induced STAT inhibitor 3 (SSI-3), mRNA gi|4507234|ref|NM—003955.1|[4507234]

[2168] 2063: NM—003693 Homo sapiens acetyl LDL receptor; SREC=scavenger receptor expressed by endothelial cells (SREC), mRNA gi|4507202|ref|NM—003693.1|[4507202]

[2169] 2064: NM—003625 Homo sapiens protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 2 (PPFIA2), mRNA gi|4505984|ref|NM—003625.1|[4505984]

[2170] 2065: NM—000286 Homo sapiens peroxisomal biogenesis factor 12 (PEX12), mRNA gi|4505720|ref|NM—000286.1|[4505720]

[2171] 2066: NM—002563 Homo sapiens purinergic receptor P2Y, G-protein coupled, 1 (P2RY1), mRNA gi|4505556|ref|NM—002563.1|[4505556]

[2172] 2067: NM—000913 Homo sapiens opiate receptor-like 1 (OPRL1), mRNA gi|4505512|ref|NM—000913.1|[4505512]

[2173] 2068: NM—002333 Homo sapiens low density lipoprotein receptor-related protein 3 (LRP3), mRNA gi|4505014|ref|NM—002333.1|[4505014]

[2174] 2069: NM—001957 Homo sapiens endothelin receptor type A (EDNRA), mRNA gi|4503464|ref|NM—001957.1|[4503464]

[2175] 2070: L34726 Homo sapiens T-cell receptor beta (TCRB) mRNA (HLA-A3, 29; B7, 44; DR 2, 7), partial cds gi|1100206|gb|L34726.1|HUMTCRBZ[1100206]

[2176] 2071: L34725 Homo sapiens T-cell receptor beta (TCRB) mRNA (HLA-A1, 24; B7, 8; DR 1, 3), partial cds gi|1100204|gb|L34725.1|HUMTCRBY[1100204]

[2177] 2072: L34724 Homo sapiens T-cell receptor beta (TCRB) mRNA (HLA-A3, 29; B7, 44; DR 2, 7), partial cds gi|1100202|gb|L34724.1|HUMTCRBU[1100202]

[2178] 2073: L34723 Homo sapiens T-cell receptor beta (TCRB) mRNA (HLA-A3, 29; B7, 44; DR 2, 7), partial cds gi|1100200|gb|L34723.1|HUMTCRBT[1100200]

[2179] 2074: L34722 Homo sapiens T-cell receptor beta (TCRB) mRNA (HLA-A1, 24; B7, 8; DR 1, 3), partial cds gi|1100198|gb|L34722.1|HUMTCRBS[1100198]

[2180] 2075: L34721 Homo sapiens T-cell receptor beta (TCRB) mRNA (HLA-A3, 29; B7, 44; DR 2, 7). partial cds gi|1100196|gb|L34721 1|HUMTCRBQ[1100196]

[2181] 2076: L34719 Homo sapiens T-cell receptor beta (TCRB) mRNA (HLA-A1, 24; B7, 8; DR 1, 3), partial cds gi|1100192|gb|L34719.1|HUMTCRBO[1100192]

[2182] 2077: L34737 Homo sapiens T-cell receptor beta (TCRB) mRNA (HLA-A3, 29; B7, 44; DR2, 7), partial cds gi|1100188|gb|L34737.1|HUMTCRBAO[1100188]

[2183] 2078: L34736 Homo sapiens T-cell receptor beta (TCRB) mRNA (HLA-A3, 29; B7, 44; DR2, 7), partial cds gi|1100186|gb|L34736.1|HUMTCRBAN[1100186]

[2184] 2079: L34735 Homo sapiens T-cell receptor beta (TCRB) mRNA (HLA-A1, 24; B7, 8; DR 1, 3), partial cds gi|1100184|gb|L34735.1|HUMTCRBAM[1100184]

[2185] 2080: L34733 Homo sapiens T-cell receptor beta (TCRB) mRNA (HLA-A3, 29; B7, 44; DR 2, 7), partial cds gi|1100179|gb|L34733.1|HUMTCRBAK[1100179]

[2186] 2081: L34732 Homo sapiens T-cell receptor beta (TCRB) mRNA (HLA-A3, 29; B7, 44; DR 2, 7), partial cds gi|1100177|gb|L34732.1|HUMTCRBAJ[1100177]

[2187] 2082: L34731 Homo sapiens T-cell receptor beta (TCRB) mRNA (HLA-A3, 29; B7, 44; DR 2, 7), partial cds gi|1100175|gb|L34731.1|HUMTCRBAI[1100175]

[2188] 2083: L34730 Homo sapiens T-cell receptor beta (TCRB) mRNA (HLA-A1, 24; B7, 8; DR 1, 3), partial cds gi|1001173|gb|L34730.1|HUMTCRBAH[1100173]

[2189] 2084: L34728 Homo sapiens T-cell receptor beta (TCRB) mRNA (HLA-A3, 29; B7, 44; DR 2, 7), partial cds gi|1100169|gb|L34728.1|HUMTCRBAF[1100169]

[2190] 2085: L34727 Homo sapiens T-cell receptor beta (TCRB) mRNA (HLA-A3, 29; B7, 44; DR 2, 7), partial cds gi|1100167|gb|L34727.1|HUMTCRBAE[1100167]

[2191] 2086: L34703 Homo sapiens T-cell receptor alpha chain (TCRA) mRNA (HLA-A1, 24; B7, 8; DR 1, 3), complete cds gi|1100165|gb|L34703.1|HUMTCRAZ[1100165]

[2192] 2087: L34702 Homo sapiens T-cell receptor alpha (TCRA) mRNA (HLA-A3, 29; B7, 44; DR 2, 7), partial cds gi|1100163|gb|L34702.1|HUMTCRAY[1100163]

[2193] 2088: L34701 Homo sapiens T-cell receptor alpha (TCRA) mRNA (HLA-A3, 29; B7, 44; DR 2, 7), partial cds gi|1100161|gb|L34701.1|HUMTCRAV[1100161]

[2194] 2089: L34700 Homo sapiens T-cell receptor alpha (TCRA) mRNA (HLA-A3, 29; B7, 44; DR 2, 7), partial cds gi|1100159|gb|L34700.1|HUMTCRAU[1100159]

[2195] 2090: L34699 Homo sapiens T-cell receptor alpha (TCRA) mRNA (HLA-A1, 24; B7, 8; C7; DR 1, 3), partial cds gi|1100157|gb|L34699.1|HUMTCRAT[1100157]

[2196] 2091: L34698 Homo sapiens T-cell receptor alpha (TCRA) mRNA (HLA-A3, 29; B7, 44; DR 2, 7), complete cds gi|1100155|gb|L34698.1|HUMTCRAQ[1100155]

[2197] 2092: L34695 Homo sapiens T-cell receptor alpha (TCRA) mRNA (HLA-A3, 29; B7, 44; DR2, 7), partial cds gi|1100153|gb|L34695.1|HUMTCRAP[1100153]

[2198] 2093: L34694 Homo sapiens T-cell receptor alpha (TCRA) mRNA (HLA-A1, 24; B7, 8; C7; DR 1, 3), partial cds gi|1100151|gb|L34694.1|HUMTCRAO[1100151]

[2199] 2094: L34738 Homo sapiens T-cell receptor beta (TCRB) mRNA (HLA-A1, 24; B7, 8; C7; DR 1, 3), partial cds gi|1100149|gb|L34738.1|HUMTCRAAX[1100149]

[2200] 2095: L34718 Homo sapiens T-cell receptor alpha (TCRA) mRNA (HLA-A3, 29; B7, 44; DR 2, 7), partial cds gi|1100147|gb|L34718.1|HUMTCRAAW[1100147]

[2201] 2096: L34717 Homo sapiens T-cell receptor alpha (TCRA) mRNA (HLA-A3, 29; B7, 44; DR 2, 7), partial cds gi|1100145|gb|L34717.1|HUMTCRAAV[1100145]

[2202] 2097: L34716 Homo sapiens T-cell receptor alpha (TCRA) mRNA (HLA-A1, 24; B7, 8; DR 1, 3), partial cds gi|1100143|gb|L34716.1|HUMTCRAAU[1100143]

[2203] 2098: L34715 Homo sapiens T-cell receptor alpha (TCRA) mRNA (HLA-A1, 24; B7, 8; DR 1, 3), partial cds gi|1100141|gb|L34715.1|HUMTCRAAT[1100141]

[2204] 2099: L34714 Homo sapiens T-cell receptor alpha (TCRA) mRNA (HLA-A1, 24; B7, 8; DR 1, 3), partial cds gi|1100139|gb|L34714.1|HUMTCRAAS[1100139]

[2205] 2100: L34713 Homo sapiens T-cell receptor alpha (TCRA) mRNA (HLA-A3, 29; B7, 44; DR 2, 7), partial cds gi|1100137|gb|L34713.1|HUMTCRAAR[1100137]

[2206] 2101: L34712 Homo sapiens T-cell receptor alpha (TCRA) mRNA (HLA-A3, 29; B7, 44; DR 2, 7), partial cds gi|1100135|gb|L34712.1|HUMTCRAAQ[1100135]

[2207] 2102: L34711 Homo sapiens T-cell receptor alpha (TCRA) mRNA (HLA-A3, 29; B7, 44; DR 2, 7), partial cds gi|1100133|gb|L34711.1|HUMTCRAAP[1100133]

[2208] 2103: L34710 Homo sapiens T-cell receptor alpha (TCRA) mRNA (HLA-A3, 29; B7, 44; DR 2, 7), partial cds gi|1100131|gb|L34710.1|HUMTCRAAO[1100131]

[2209] 2104: L34709 Homo sapiens T-cell receptor alpha (TCRA) mRNA (HLA-A3, 29; B7, 44; DR 2, 7), partial cds gi|1100129|gb|L34709.1|HUMTCRAAN[1100129]

[2210] 2105: L34708 Homo sapiens T-cell receptor alpha (TCRA) mRNA (HLA-A1, 24; B7, 8; DR1, 3), partial cds gi|1100127|gb|L34708.1|HUMTCRAAM[1100127]

[2211] 2106: L34707 Homo sapiens T-cell receptor alpha (TCRA) mRNA (HLA-A3, 29; B7, 44; DR 2, 7), partial cds gi|1100125|gb|L34707.1|HUMTCRAAL[1100125]

[2212] 2107: L34706 Homo sapiens T-cell receptor alpha (TCRA) mRNA (HLA-A3, 29; B7, 44; DR 2, 7), partial cds gi|1100123|gb|L34706.1|HUMTCRAAK[1100123]

[2213] 2108: L34705 Homo sapiens T-cell receptor alpha (TCRA) mRNA (HLA-A3, 29; B7, 44; DR 2, 7), partial cds gi|1100121|gb|L34705.1|HUMTCRAAJ[1100121]

[2214] 2109: L34704 Homo sapiens T-cell receptor alpha (TCRA) mRNA (HLA-A3, 29; B7, 44; DR 2, 7), partial cds gi|1100119|gb|L34704.1|HUMTCRAAI[1100119]

[2215] 2110: L29037 Human T-cell antigen receptor mRNA gi|517066|gb|L29037.1|HUMTCRBW[517066]

[2216] 2111: L29038 Human T-cell antigen receptor mRNA gi|456432|gb|L29038.1|HUMTCRBX[456432]

[2217] 2112: L29036 Human T-cell antigen receptor mRNA gi|456431|gb|L29036.1|HUMTCRAX[456431]

[2218] 2113: L29035 Human T-cell antigen receptor mRNA gi|456430|gb|L29035.1|HUMTCRAW[456430]

[2219] 2114: AF106913 Homo sapiens CRL3 protein (CRL3) mRNA, complete cds gi|17221662|gb|AF106913.1|AF106913[17221662]

[2220] 2115: AB055881 Homo sapiens NKp30 mRNA for natural killer cell receptor, complete cds gi|17221621|dbj|AB055881.1|AB055881[17221621]

[2221] 2116: AJ417149 Homo sapiens partial mRNA for T cell receptor beta chain (TCRB gene), clone 26 gi|17154680|emb|AJ417149.1|HSA417149[17154680]

[2222] 2117: AJ417148 Homo sapiens partial mRNA for T cell receptor beta chain (TCRB gene), clone 17 gi|17148484|emb|AJ417148.1|HSA417148[17148484]

[2223] 2118: NM—054021 Homo sapiens G protein-coupled receptor 101 (GPR101), mRNA gi|16876434|ref|NM—054021.1|[16876434]

[2224] 2119: NM—052939 Homo sapiens Fc receptor-like protein 3 (FCRH3), mRNA gi|16418420|ref|NM—052939.1|[16418420]

[2225] 2120: NM—052938 Homo sapiens Fc receptor-like protein 1 (FCRH1), mRNA gi|16418418|ref|NM—052938.1|[16418418]

[2226] 2121: NM—003823 Homo sapiens tumor necrosis factor receptor superfamily, member 6b, decoy (TNFRSF6B), transcript variant M68E, mRNA gi|14790166|ref|NM—003823.2|[14790166]

[2227] 2122: NM—006470 Homo sapiens tripartite motif-containing 16 (TRIM16), mRNA gi|14577927|ref|NM—006470.2|[14577927]

[2228] 2123: NM—031918 Homo sapiens Kruppel-like factor 16 (KLF16), mRNA gi|13994286|ref|NM—031918.1|[13994286]

[2229] 2124: NM—023945 Homo sapiens membrane-spanning 4-domains, subfamily A, member 5 (MS4A5), mRNA gi|12965204|ref|NM—023945.1|[12965204]

[2230] 2125: NM—018485 Homo sapiens G protein-coupled receptor C5L2 (LOC55868), mRNA gi|8923872|ref|NM—018485.1|[8923872]

[2231] 2126: NM—016562 Homo sapiens toll-like receptor 7 (TLR7), mRNA gi|7706092|ref|NM—016562.1|[7706092]

[2232] 2130: NM—006138 Homo sapiens membrane-spanning 4-domains, subfamily A, member 3 (hematopoietic cell-specific) (MS4A3), mRNA gi|5453608|ref|NM—006138.1|[5453608]

[2233] 2131: AF447176 Homo sapiens protein tyrosine kinase-7 (PTK7) gene, exon 20 and complete cds gi|17432420|gb|AF447176.1|F447157S11[17432420]

[2234] 2132: AF447175 Homo sapiens protein tyrosine kinase-7 (PTK7) gene, exon 19 gi|17432419|gb|AF447175.1|F447157S10[17432419]

[2235] 2133: AF447174 Homo sapiens protein tyrosine kinase-7 (PTK7) gene, exon 18 gi|17432418|gb|AF447174.1|F447157S09[17432418]

[2236] 2134: AF447173 Homo sapiens protein tyrosine kinase-7 (PTK7) gene, exon 17 gi|17432417|gb|AF447173.1|F447157S08[17432417]

[2237] 2135: AF447171 Homo sapiens protein tyrosine kinase-7 (PTK7) gene, exons 15 and 16 gi|17432416|gb|AF447171.1|F447157S07[17432416]

[2238] 2136: AF447170 Homo sapiens protein tyrosine kinase-7 (PTK7) gene, exon 14 gi|17432415|gb|AF447170.1|F447157S06[17432415]

[2239] 2137: AF447167 Homo sapiens protein tyrosine kinase-7 (PTK7) gene, exons 11, 12, and 13 gi|17432414|gb|AF447167.1|F447157S05[17432414]

[2240] 2138: AF447164 Homo sapiens protein tyrosine kinase-7 (PTK7) gene, exons 8, 9, and 10 gi|17432413|gb|AF447164.1|F447157S04[17432413]

[2241] 2139: AF447162 Homo sapiens protein tyrosine kinase-7 (PTK7) gene, exons 6 and 7 gi|17432412|gb|AF447162.1|F447157S03[17432412]

[2242] 2140: AF447158 Homo sapiens protein tyrosine kinase-7 (PTK7) gene, exons 2, 3, 4, and 5 gi|17432411|gb|AF447158.1|F447157S02[17432411]

[2243] 2141: AF447157 Homo sapiens protein tyrosine kinase-7 (PTK7) gene, exon 1 gi|17432410|gb|AF447157.1|F447157S01[17432410]

[2244] 2142: AH011239 Homo sapiens protein tyrosine kinase-7 (PTK7) gene, complete cds gi|17432409|gb|AH011239.1|SEG_F447157S[17432409]

[2245] 2143: AF374231 Homo sapiens corticotropin releasing hormone receptor variant 1h mRNA, partial cds, alternatively spliced gi|17432316|gb|AF374231.1|AF374231[17432316]

[2246] 2145: AY013309 Homo sapiens clone FM1-3.3.12A immunoglobulin heavy chain variable region gene, partial cds gi|17220530|gb|AY013309.1|[17220530]

[2247] 2146: AY013308 Homo sapiens clone FL1-2.4.2G immunoglobulin heavy chain variable region gene, partial cds gi|17220528|gb|AY013308.1|[17220528]

[2248] 2147: AY013307 Homo sapiens clone FL1-2.4.12A immunoglobulin heavy chain variable region gene, partial cds gi|17220526|gb|AY013307.1|[17220526]

[2249] 2148: AY013306 Homo sapiens clone FL3-3.4.4G immunoglobulin heavy chain variable region gene, partial cds gi|17220524|gb|AY013306.1|[17220524]

[2250] 2149: AB062787 Homo sapiens mRNA for triggering receptor TREM-2V, complete cds gi|17425161|dbj|AB062787.1|AB062787[17425161]

[2251] 2150: NM—003392 Homo sapiens wingless-type MMTV integration site family, member 5A (WNT5A), mRNA gi|17402917|ref|NM—003392.2|[17402917]

[2252] 2152: AJ421518 Homo sapiens mRNA for tumor necrosis factor-stimulated gene 6 (TSG-6) protein, G431 allele gi|17402491|emb|AJ421518.1|HSA421518[17402491]

[2253] 2153: NM—053049 Homo sapiens stresscopin (SPC), mRNA gi|16596691|ref|NM—053049.1|[16596691]

[2254] 2154: AF430697 Homo sapiens T cell receptor beta variable region, Vbeta 13S3-KRGAYETQYF-Jbeta 2.5 mRNA, partial cds gi|16566919|gb|AF430697.1|AF430697[16566919]

[2255] 2155: AF430696 Homo sapiens T cell receptor beta variable region, Vbeta 13S2A1T-SEVRETQYF-Jbeta 2.5 mRNA, partial cds gi|16566916|gb|AF430696.1|AF430696[16566916]

[2256] 2156: AF430695 Homo sapiens T cell receptor beta variable region, Vbeta 13S3-EKVTGGETQYF-Jbeta 2.5 mRNA, partial cds gi|16566913|gb|AF430695.1|AF430695[16566913]

[2257] 2157: AF430694 Homo sapiens T cell receptor beta variable region, Vbeta 13S2A1T-QGRTSVIETQYF-Jbeta 2.5 mRNA, partial cds gi|16566910|gb|AF430694.1|AF430694[16566910]

[2258] 2158: AF430693 Homo sapiens T cell receptor beta variable region, Vbeta 13S2A1T-RSDRRKTRYF-Jbeta2.5 mRNA, partial cds gi|16566907|gb|AF430693.1|AF430693[16566907]

[2259] 2159: AF430692 Homo sapiens T cell receptor beta variable region, Vbeta 13S3-GRGAQETQYF-Jbeta 2.5 mRNA, partial cds gi|16566904|gb|AF430692.1|AF430692[16566904]

[2260] 2160: AF430691 Homo sapiens T cell receptor beta variable region, Vbeta 13S2A1T-GGQTYF-Jbeta 2.5 mRNA, partial cds gi|16566901|gb|AF430691.1|AF430691[16566901]

[2261] 2161: AF430690 Homo sapiens T cell receptor beta variable region, Vbeta 1S1A1N1-SGLTPNTGELFF-Jbeta 2.2 mRNA, partial cds gi|16566898|gb|AF430690.1|AF430690[16566898]

[2262] 2162: AF430689 Homo sapiens T cell receptor beta variable region, Vbeta 13S6A1N1-TSPVPIGTDTQYF-Jbeta 2.3 mRNA, partial cds gi|16566895|gb|AF430689.1|AF430689[16566895]

[2263] 2163: AF430688 Homo sapiens T cell receptor beta variable region, Vbeta 13S3-MFGGSTGELFF-Jbeta 2.2 mRNA, partial cds gi|16566892|gb|AF430688.1|AF430688[16566892]

[2264] 2164: AF430687 Homo sapiens T cell receptor beta variable region, Vbeta 13S3-AQGKGTQYF-Jbeta 2.5 mRNA, partial cds gi|16566889|gb|AF430687.1|AF430687[16566889]

[2265] 2165: AF430686 Homo sapiens T cell receptor beta variable region, Vbeta 13 S3-EQGLLSTDTQYF-Jbeta 2.3 mRNA, partial cds gi|16566886|gb|AF430686.1|AF430686[16566886]

[2266] 2166: AF430685 Homo sapiens T cell receptor beta variable region, Vbeta 13S5-ETPGQGAGELFF-Jbeta 2.2 mRNA, partial cds gi|16566883|gb|AF430685.1|AF430685[16566883]

[2267] 2167: AF430684 Homo sapiens T cell receptor beta variable region, Vbeta 13S5-RLAGASYNEQYF-Jbeta 2.1 mRNA, partial cds gi|16566880|gb|AF430684.1|AF430684[16566880]

[2268] 2168: AF430683 Homo sapiens T cell receptor beta variable region, Vbeta 13S5-DTAGSTDTQYF-Jbeta 2.3 mRNA, partial cds gi|16566877|gb|AF430683.1|AF430683[16566877]

[2269] 2169: AF430682 Homo sapiens T cell receptor beta variable region, Vbeta 13S5-EVASGTDTQYF-Jbeta 2.3 mRNA, partial cds gi|16566874|gb|AF430682.1|AF430682[16566874]

[2270] 2170: AF430681 Homo sapiens T cell receptor beta variable region, Vbeta S6A3N2T-ASSGGYEQYF-Jbeta 2.7 mRNA, partial cds gi|16566871|gb|AF430681.1|AF430681[16566871]

[2271] 2171: AF430680 Homo sapiens T cell receptor beta variable region, Vbeta 5 S3A1T/S1A1T-RRSDTQYF-Jbeta 2.3 mRNA, partial cds gi|16566868|gb|AF430680.1|AF430680[16566868]

[2272] 2172: AF430679 Homo sapiens T cell receptor beta variable region, Vbeta 5S1A1T-FGGEDTDTQYF-Jbeta 2.3 mRNA, partial cds gi|16566865|gb|AF430679.1|AF430679[16566865]

[2273] 2173: AF430678 Homo sapiens T cell receptor beta variable region, Vbeta 5 S2-FGTRGNEQFF-Jbeta 2.7 mRNA, partial cds gi|16566862|gb|AF430678.1|AF430678[16566862]

[2274] 2174: AF430677 Homo sapiens T cell receptor beta variable region, Vbeta 5-FQGARETQYF-Jbeta 2.5 mRNA, partial cds gi|16566859|gb|AF430677.1|AF430677[16566859]

[2275] 2175: AF430676 Homo sapiens T cell receptor beta variable region, Vbeta 5S6A3N2T-FTGTGIYGYTF-Jbeta 1.2 mRNA, partial cds gi|16566856|gb|AF430676.1|AF430676[16566856]

[2276] 2176: AF430675 Homo sapiens T cell receptor beta variable region, Vbeta 5S1A1T-APLTGDSGNTIYF-Jbeta 1.3 mRNA, partial cds gi|16566853|gb|AF430675.1|AF430675[16566853]

[2277] 2177: AF430674 Homo sapiens T cell receptor beta variable region, Vbeta 5S1A1TSDLSGANVLTF-Jbeta 2.6 mRNA, partial cds gi|16566850|gb|AF430674.1|AF430674[16566850]

[2278] 2178: AF430673 Homo sapiens T cell receptor beta variable region, Vbeta 5S6A3N2T-GQGKGTF-Jbeta 1.2 mRNA, partial cds gi|16566847|gb|AF430673.1|AF430673[16566847]

[2279] 2179: AF430672 Homo sapiens T cell receptor beta variable region, Vbeta 5S6A3N2T-YTGGVWRNQYF-Jbeta 2.5 mRNA, partial cds gi|16566844|gb|AF430672.1|AF430672[16566844]

[2280] 2180: AF430671 Homo sapiens T cell receptor beta variable region, Vbeta 5S2-FSGGAHTQYF-Jbeta 2.3 mRNA, partial ads gi|16566841|gb|AF430671.1|AF430671[16566841]

[2281] 2181: AF430670 Homo sapiens T cell receptor beta variable region, Vbeta 5S2/S6A3N2T-SGQGKTEAFF-Jbeta 1.1 mRNA, partial cds gi|16566838|gb|AF430670.1|AF430670[16566838]

[2282] 2182: AF430669 Homo sapiens T cell receptor beta variable region, Vbeta 5S1A1T-FSKGVTEAFF-Jbeta 1.1 mRNA, partial cds gi|16566835|gb|AF430669.1|AF430669[16566835]

[2283] 2183: AF430668 Homo sapiens T cell receptor beta variable region, Vbeta 5S2-SSPTGRSGNTIYF-Jbeta 1.3 mRNA, partial cds gi|16566832|gb|AF430668.1|AF430668[16566832]

[2284] 2184: AF430667 Homo sapiens T cell receptor beta variable region, Vbeta 5S4A2T-PLLGQGRDEQFF-Jbeta 2.1 mRNA, partial cds gi|16566829|gb|AF430667.1|AF430667[16566829]

[2285] 2185: AF430666 Homo sapiens T cell receptor beta variable region, Vbeta 5S1A1T-FDFPGELFF-Jbeta 2.2 mRNA, partial cds gi|16566827|gb|AF430666.1|AF430666[16566827]

[2286] 2186: AF430665 Homo sapiens T cell receptor beta variable region, Vbeta 5S1A1T-DPSGGYNEQFF-Jbeta 2.1 mRNA, partial cds gi|16566824|gb|AF430665.1|AF430665[16566824]

[2287] 2187: AF430664 Homo sapiens T cell receptor beta variable region, Vbeta 5S1A1T-DATGNLNEQYF-Jbeta 2.7 mRNA, partial cds gi|16566821|gb|AF430664.1|AF430664[16566821]

[2288] 2188: AF430663 Homo sapiens T cell receptor beta variable region, Vbeta 5S1A1T-SGQVTGELFF-Jbeta 2.2 mRNA, partial cds gi|16566818|gb|AF430663.1|AF430663[16566818]

[2289] 2189: AF430662 Homo sapiens T cell receptor beta variable region, Vbeta 5S1A1T-AWWGAGYEGYF-Jbeta 2.7 mRNA, partial cds gi|16566815|gb|AF430662.1|AF430662[16566815]

[2290] 2190: AF430661 Homo sapiens T cell receptor beta variable region, Vbeta 5S1A1T-RRLAGVYNEQFF-Jbeta 2.1 mRNA, partial cds gi|16566812|gb|AF430661.1|AF430661[16566812]

[2291] 2191: AF430660 Homo sapiens T cell receptor beta variable region, Vbeta 5S1A1T-EFQAPYGYTF-Jbeta1.2 mRNA, partial cds gi|16566809|gb|AF430660.1|AF430660[16566809]

[2292] 2192: AF430659 Homo sapiens T cell receptor beta variable region, Vbeta 5S6A3N2T-TGTESPDTQYF-Jbeta 2.3 mRNA, partial cds gi|16566806|gb|AF430659.1|AF430659[16566806]

[2293] 2193: AF430658 Homo sapiens T cell receptor beta variable region, Vbeta 5S6A3N2T-TFGTPTYNEQFF-Jbeta 2.1 mRNA, partial cds gi|16566803|gb|AF430658.1|AF430658[16566803]

[2294] 2194: AF430657 Homo sapiens T cell receptor beta variable region, Vbeta 5-SGPSTDTQYF-Jbeta 2.3 mRNA, partial cds gi|16566800|gb|AF430657.1|AF430657[16566800]

[2295] 2195: AF430656 Homo sapiens T cell receptor beta variable region, Vbeta 5S2-NPGGNYGYTF-Jbeta 1.2 mRNA, partial cds gi|16566797|gb|AF430656.1|AF430656[16566797]

[2296] 2196: AF430655 Homo sapiens T cell receptor beta variable region, Vbeta 5S1A1T-VIGTYEQYF-Jbeta 2.7 mRNA, partial cds gi|16566794|gb|AF430655.1|AF430655[16566794]

[2297] 2197: AF430654 Homo sapiens T cell receptor beta variable region, Vbeta 5S2-AGGETQYF-J beta 2.5 mRNA, partial cds gi|16566791|gb|AF430654.1|AF430654[16566791]

[2298] 2198: AF430653 Homo sapiens T cell receptor beta variable region, Vbeta 5S1A1T-VSGRGSYEQYF-Jbeta 2.7 mRNA, partial cds gi|16566788|gb|AF430653.1|AF430653[16566788]

[2299] 2199: AF430652 Homo sapiens T cell receptor beta variable region, Vbeta 5S2-VRSEAFF-JBeta 1.1 mRNA, partial cds gi|16566785|gb|AF430652.1|AF430652[16566785]

[2300] 2200: AF430651 Homo sapiens T cell receptor beta variable region, Vbeta 5S1A1T-RTRTGETNTGELFF-JBeta2.2 mRNA, partial cds gi|16566782|gb|AF430651.1|AF430651[16566782]

[2301] 2201: AF430650 Homo sapiens T cell receptor beta variable region, Vbeta 5S6A3N2T-GAGPSGELFF-JBeta 2.2 mRNA, partial cds gi|16566779|gb|AF430650.1|AF430650[16566779]

[2302] 2202: AF430649 Homo sapiens T cell receptor beta variable region, Vbeta 5S1A1T-GGGTGELFF-Jbeta2.2 mRNA, partial cds gi|16566776|gb|AF430649.1|AF430649[16566776]

[2303] 2203: AF430648 Homo sapiens T cell receptor beta variable region, Vbeta 5S1AT-PGQGAYEQYF-2.7 mRNA, partial cds gi|16566773|gb|AF430648.1|AF430648[16566773]

[2304] 2204: AF430647 Homo sapiens T cell receptor beta variable region, Vbeta 5S2-RPDSGYTF-Jeta1.2 mRNA, partial cds gi|16566770|gb|AF430647.1|AF430647[16566770]

[2305] 2205: AF411117 Homo sapiens G protein-coupled receptor (GPR103) mRNA, complete cds gi|16566346|gb|AF411117.1|AF411117[16566346]

[2306] 2206: AF411116 Homo sapiens G protein-coupled receptor (GPR102) gene, complete cds gi|16566343|gb|AF411116.1|AF411116[16566343]

[2307] 2207: AF411115 Homo sapiens G protein-coupled receptor (GPR101) gene, complete cds gi|16566340|gb|AF411115.1|AF411115[16566340]

[2308] 2208: AF411114 Homo sapiens G protein-coupled receptor (GPR95) mRNA, complete cds gi|16566337|gb|AF411114.1|AF411114[16566337]

[2309] 2209: AF411113 Homo sapiens G protein-coupled receptor (GPR94) gene, complete cds gi|16566334|gb|AF411113.1|AF411113[16566334]

[2310] 2210: AF411112 Homo sapiens G protein-coupled receptor (GPR93) gene, complete cds gi|16566331|gb|AF411112.1|AF411112[16566331]

[2311] 2211: AF411111 Homo sapiens G protein-coupled receptor (GPR82) gene, complete cds gi|16566328|gb|AF411111.1|AF411111[16566328]

[2312] 2212: AF411110 Homo sapiens G protein-coupled receptor (GPR81) gene, complete cds gi|16566325|gb|AF411110.1|AF411110[16566325]

[2313] 2213: AF411109 Homo sapiens G protein-coupled receptor (GPR80) gene, complete cds gi|16566322|gb|AF411109.1|AF411109[16566322]

[2314] 2215: AF411107 Homo sapiens G protein-coupled receptor (GPR78) mRNA, complete cds gi|16566318|gb|AF411107.1|AF411107[16566318]

[2315] 2216: AF406692 Homo sapiens G protein-coupled receptor GPR86 mRNA, complete cds gi|15487985|gb|AF406692.1|AF406692[15487985]

[2316] 2217: NM—019035 Homo sapiens protocadherin 18 (PCDH18), mRNA gi|14589928|ref|NM—019035.1|[14589928]

[2317] 2218: AF214012 Homo sapiens prolactin receptor gene, exon 11 and partial sequence gi|14328908|gb|AF214012.1|AF214012[14328908]

[2318] 2219: NM—030943 Homo sapiens amnionless protein (AMN), mRNA gi|13569914|ref|NM—030943.1|[13569914]

[2319] 2220: NM—023922 Homo sapiens taste receptor, type 2, member 14 (TAS2R14), mRNA gi|12965181|ref|NM—023922.1|[12965181]

[2320] 2221: NM—023921 Homo sapiens taste receptor, type 2, member 10 (TAS2R10), mRNA gi|12965179|ref|NM—023921.1|[12965179]

[2321] 2222: NM—023920 Homo sapiens taste receptor, type 2, member 13 (TAS2R13), mRNA gi|12965177|ref|NM—023920.1|[12965177]

[2322] 2223: NM—023919 Homo sapiens taste receptor, type 2, member 7 (TAS2R7), mRNA gi|12965175|ref|NM—023919.1|[12965175]

[2323] 2224: NM—023918 Homo sapiens taste receptor, type 2, member 8 (TAS2R8), mRNA gi|12965173|ref|NM—023918.1|[12965173]

[2324] 2225: NM—023917 Homo sapiens taste receptor, type 2, member 9 (TAS2R9), mRNA gi|12965171|ref|NM—023917.1|[12965171]

[2325] 2226: AF206696 Homo sapiens interleukin-1 epsilon (IL1E) mRNA, complete cds gi|11493847|gb|AF206696.1|AF206696[11493847]

[2326] 2227: AF230377 Homo sapiens interleukin-1 delta mRNA, complete cds gi|9651788|gb|AF230377.1|AF230377[9651788]

[2327] 2228: BC018284 Homo sapiens, triggering receptor expressed on myeloid cells 2, clone IMAGE:4151400, mRNA gi|17390669|gb|BC018284.1|BC018284[17390669]

[2328] 2229: BC016130 Homo sapiens, coagulation factor II (thrombin) receptor-like 1, clone MGC:9298 IMAGE:3895653, mRNA, complete cds gi|17390291|gb|BC018130.1|BC018130[17390291]

[2329] 2230: BC017898 Homo sapiens, Purinergic receptor P2Y, G protein-coupled, 12, clone MGC:23802 IMAGE:4251263, mRNA, complete cds gi|17389766|gb|BC017898.1|BC017898[17389766]

[2330] 2231: BC017865 Homo sapiens, Fc fragment of IgG, low affinity IIIa, receptor for (CD16), clone MGC:22630 IMAGE:4690249, mRNA, complete cds gi|17389687|gb|BC017865.1|BC017865[17389687]

[2331] 2232: BC017852 Homo sapiens, tumor necrosis factor receptor superfamily, member 10c, decoy without an intracellular domain, clone IMAGE:4700855, mRNA gi|17389657|gb|BC017852.1|BC017852[17389657]

[2332] 2233: BC017784 Homo sapiens, killer cell lectin-like receptor subfamily C, member 4, clone MGC:22279 IMAGE:4619154, mRNA, complete cds gi|17389488|gb|BC017784.1|BC017784[17389488]

[2333] 2234: BC017773 Homo sapiens, triggering receptor expressed on myeloid cells 1, clone MGC:22242 IMAGE:4692680, mRNA, complete cds gi|17389458|gb|BC017773.1|BC017773[17389458]

[2334] 2235: BC017730 Homo sapiens, tumor necrosis factor receptor superfamily, member 21, clone MGC:21476 IMAGE:3847246, mRNA, complete cds gi|17389378|gb|BC017730.1|BC017730[17389378]

[2335] 2237: AJ252246 Homo sapiens mRNA for kainate receptor subunit (GRIK2 gene) gi|17384623|emb|AJ252246.1|HSA252246[17384623]

[2336] 2238: AJ249210 Homo sapiens mRNA for glutamate/kainate receptor subtype GluR7 (GRIK3 gene) gi|17384612|emb|AJ249210.1|HSA249210[17384612]

[2337] 2239: AJ249209 Homo sapiens mRNA for glutamate/kainate receptor subunit KA2a (GRIK5 gene) gi|17384610|emb|AJ249209.1|HSA249209[17384610]

[2338] 2240: AJ249208 Homo sapiens mRNA for glutamate receptor subunit GluR5 (GRIK1 gene) gi|17384608|emb|AJ249208.1|HSA249208[17384608]

[2339] 2241: AJ415410 Homo sapiens partial IGVK1-014 gene for immunoglobulin kappa chain variable region, donor MF, cel124 gi|17384019|emb|AJ415410.2|HSA415410[17384019]

[2340] 2242: AJ415291 Homo sapiens partial IGVH3-33 gene for immunoglobulin heavy chain variable region, donor TG, cel146 gi|17384018|emb|AJ415291.2|HSA415291[17384018]

[2341] 2243: AJ414840 Homo sapiens partial IGVKA30 gene for immunoglobulin kappa chain variable region, donor MF, cel12 gi|17384017|emb|AJ414840.2|HSA414840[17384017]

[2342] 2244: NM—000623 Homo sapiens bradykinin receptor B2 (BDKRB2), mRNA gi|17352499|ref|NM—000623.2|[17352499]

[2343] 2246: AJ347709 Homo sapiens mRNA for FKBP-associated protein gi|15620770|emb|AJ347709.1|HSA347709[15620770]

[2344] 2247: AF356518 Homo sapiens junctional adhesion molecule 3 precursor, mRNA, complete cds gi|13448824|gb|AF356518.1|AF356518[13448824]

[2345] 2248: NM—021201 Homo sapiens membrane-spanning 4-domains, subfamily A, member 7 (MS4A7), mRNA gi|11139298|ref|NM—021201.1|[11139298]

[2346] 2249: NM—015344 Homo sapiens leptin receptor overlapping transcript-like 1 (LEPROTL1), mRNA gi|7662509|ref|NM—015344.1|[7662509]

[2347] 2250: AF411850 Homo sapiens C-type lectin-like receptor CLEC-6 mRNA, complete cds gi|17226267|gb|AF411850.1|AF411850[17226267]

[2348] 2251: AF325460 Homo sapiens dendritic lectin b isoform (CLECSF11) mRNA, complete cds, alternatively spliced gi|17225338|gb|AF325460.1|AF325460[17225338]

[2349] 2252: AF325459 Homo sapiens dendritic lectin (CLECSF11) mRNA, complete cds, alternatively spliced gi|17225336|gb|AF325459.1|AF325459[17225336]

[2350] 2253: AF293357 Homo sapiens AT2 receptor-interacting protein 1 mRNA, complete cds gi|17224595|gb|AF293357.1|AF293357[17224595]

[2351] 2254: AF283988 Homo sapiens leukocyte immunoglobulin-like receptor-5 (LILRB5) mRNA, LILRB5-v1 allele, complete cds gi|17224473|gb|AF283988.1|AF283988[17224473]

[2352] 2255: AF283987 Homo sapiens leukocyte immunoglobulin-like receptor-2 (LILRB2) mRNA, LILRB2-v2 allele, complete cds gi|17224471|gb|AF283987.1|AF283987[17224471]

[2353] 2256: AF283986 Homo sapiens leukocyte immunoglobulin-like receptor-2 (LILRB2) mRNA, LILRB2-v1 allele, complete cds gi|17224469|gb|AF283986.1|AF283986[17224469]

[2354] 2257: AF283985 Homo sapiens leukocyte immunoglobulin-like receptor-1 (LILRB1) mRNA, LILRB1-v2 allele, complete cds gi|17224467|gb|AF283985.1|AF283985[17224467]

[2355] 2258: AF283984 Homo sapiens leukocyte immunoglobulin-like receptor-1 (LILRB1) mRNA, LILRB1-v1 allele, complete cds gi|17224465|gb|AF283984.1|AF283984[17224465]

[2356] 2259: NM—057170 Homo sapiens G protein-coupled receptor kinase-interactor 2 (GIT2), transcript variant 2, mRNA gi|17149831|ref|NM—057170.1|[17149831]

[2357] 2260: NM—057169 Homo sapiens G protein-coupled receptor kinase-interactor 2 (GIT2), transcript variant 1, mRNA gi|17149829|ref|NM—057169.1|[17149829]

[2358] 2261: AJ417151 Homo sapiens partial mRNA for T cell receptor beta chain (TCRB gene), clone gi|17148488|emb|AJ417151.1|HSA417151[17148488]

[2359] 2262: AJ417150 Homo sapiens partial mRNA for T cell receptor beta chain (TCRB gene), clone gi|17148486|emb|AJ417150.1|HSA417150[17148486]

[2360] 2263: NM—014776 Homo sapiens G protein-coupled receptor kinase-interactor 2 (GIT2), transcript variant 3, mRNA gi|7661943|ref|NM—014776.1|[7661943]

[2361] 2264: AJ239326 Homo sapiens chromosome 21 clone cosmid LLNLc116 32E2 map 21q22.3, *** SEQUENCING IN PROGRESS ***, 4 ordered pieces gi|6982097|emb|AJ239326.3|HSS171M[6982097]

[2362] 2265: NM—000675 Homo sapiens adenosine A2a receptor (ADORA2A), mRNA gi|17136146|ref|NM—000675.3|[17136146]

[2363] 2266: AF035374 Homo sapiens Cys-rich protein (RAMP) mRNA, complete cds gi|2665702|gb|AF035374.1|AF035374[2665702]

[2364] 2267: AF282269 Homo sapiens G protein-coupled receptor kinase 7 mRNA, complete cds gi|17026317|gb|AF282269.1|AF282269[17026317]

[2365] 2268: AF437510 Homo sapiens T-cell receptor beta-chain mRNA, partial cds gi|16974744|gb|AF437510.1|AF437510[16974744]

[2366] 2269: AX286800 Sequence 35 from Patent WO0178796 gi|17048833|emb|AX286800.1|AX286800[17048833]

[2367] 2270: AX286799 Sequence 34 from Patent WO0178796 gi|17048832|emb|AX286799.1|AX286799[17048832]

[2368] 2271: AB005145 Homo sapiens CL-P1 mRNA for collectin placenta 1, complete cds gi|17026100|dbj|AB005145.1|AB005145[17026100]

[2369] 2272: SEG_HUMIL3RA Homo sapiens gene for interleukin 3 receptor alpha subunit gi|1345401|dbj|SEG_HUMIL3RA[1345401]

[2370] 2273: L34720 Homo sapiens T-cell receptor beta (TCRB) mRNA, partial cds gi|1001194|gb|L34720.1|HUMTCRBP[1100194]

[2371] 2274: L34734 Homo sapiens T-cell receptor beta (TCRB) mRNA, complete cds gi|1100181|gb|L34734.1|HUMTCRBAL[1100181]

[2372] 2275: L34729 Homo sapiens T-cell receptor beta (TCRB) mRNA, partial cds gi|1100171|gb|L34729.1|HUMTCRBAG[1100171]

[2373] 2276: D49412 Homo sapiens gene for interleukin 3 receptor alpha subunit, exon 11 gi|684969|dbj|D49412.1|HUMIL3RA11[684969]

[2374] 2277: D49410 Homo sapiens gene for interleukin 3 receptor alpha subunit, exon 12 and partial cds gi|684968|dbj|D49410.1|HUMIL3RA12[684968]

[2375] 2278: D49408 Homo sapiens gene for interleukin 3 receptor alpha subunit, exon 10 gi|684967|dbj|D49408.1|HUMIL3RA10[684967]

[2376] 2279: D49409 Homo sapiens gene for interleukin 3 receptor alpha subunit, exon 6 gi|684966|dbj|D49409.1|HUMIL3RA06[684966]

[2377] 2280: D49407 Homo sapiens gene for interleukin 3 receptor alpha subunit, exon 4 gi|684965|dbj|D49407.1|HUMIL3RA04[684965]

[2378] 2281: D49406 Homo sapiens gene for interleukin 3 receptor alpha subunit, exon 2 gi|684964|dbj|D49406.1|HUMIL3RA02[684964]

[2379] 2282: D49404 Homo sapiens gene for interleukin 3 receptor alpha subunit, exon 7 gi|684963|dbj|D49404.1|HUMIL3RA07[684963]

[2380] 2283: D49403 Homo sapiens gene for interleukin 3 receptor alpha subunit, exon 5 gi|684962|dbj|D49403.1|HUMIL3RA05[684962]

[2381] 2284: D49402 Homo sapiens gene for interleukin 3 receptor alpha subunit, exon 3 gi|684961|dbj|D49402.1|HUMIL3RA03[684961]

[2382] 2285: D49401 Homo sapiens gene for interleukin 3 receptor alpha subunit, exon 1 gi|684960|dbj|D49401.1|HUMIL3RA01[684960]

[2383] 2286: D49411 Homo sapiens gene for interleukin 3 receptor alpha subunit, exon 9 gi|684959|dbj|D49411.1|HUMIL3RA09[684959]

[2384] 2287: D49405 Homo sapiens gene for interleukin 3 receptor alpha subunit, exon 8 gi|684958|dbj|D49405.1|HUMIL3RA08[684958]

[2385] 2288: SEG_HUMGRAS Homo sapiens gene for granulocyte-macrophage colony stimulating factor (GM-CSF) receptor alpha subunit gi|522101|dbj|SEG_HUMGRAS[522101]

[2386] 2289: D26625 Homo sapiens gene for granulocyte-macrophage colony stimulating factor (GM-CSF) receptor alpha subunit, exon 10 gi|467508|dbj|D26625.1|HUMGRAS10[467508]

[2387] 2290: D26624 Homo sapiens gene for granulocyte-macrophage colony stimulating factor (GM-CSF) receptor alpha subunit, exon 9 gi|467507|dbj|D26624.1|HUMGRAS09[467507]

[2388] 2291: D26623 Homo sapiens gene for granulocyte-macrophage colony stimulating factor (GM-CSF) receptor alpha subunit, exon 8 gi|467506|dbj|D26623.1|HUMGRAS08[467506]

[2389] 2292: D26622 Homo sapiens gene for granulocyte-macrophage colony stimulating factor (GM-CSF) receptor alpha subunit, exon 7 gi|467505|dbj|D26622.1|HUMGRAS07[467505]

[2390] 2293: D26621 Homo sapiens gene for granulocyte-macrophage colony stimulating factor (GM-CSF) receptor alpha subunit, exon 6 gi|467504|dbj|D26621.1|HUMGRAS06[467504]

[2391] 2294: D26628 Homo sapiens gene for granulocyte-macrophage colony stimulating factor (GM-CSF) receptor alpha subunit, exon 13 and partial cds gi|456594|dbj|D26628.1|HUMGRAS13[456594]

[2392] 2295: D26627 Homo sapiens gene for granulocyte-macrophage colony stimulating factor (GM-CSF) receptor alpha subunit, exon 12 gi|456593|dbj|D26627.1|HUMGRAS12[456593]

[2393] 2296: D26626 Homo sapiens gene for granulocyte-macrophage colony stimulating factor (GM-CSF) receptor alpha subunit, exon 11 gi|456592|dbj|D26626.1|HUMGRAS11[456592]

[2394] 2297: D26620 Homo sapiens gene for granulocyte-macrophage colony stimulating factor (GM-CSF) receptor alpha subunit, exon 5 gi|456591|dbj|D26620.1|HUMGRAS05[456591]

[2395] 2298: D26619 Homo sapiens gene for granulocyte-macrophage colony stimulating factor (GM-CSF) receptor alpha subunit, exon 4 gi|456590|dbj|D26619.1|HUMGRAS04[456590]

[2396] 2299: D26618 Homo sapiens gene for granulocyte-macrophage colony stimulating factor (GM-CSF) receptor alpha subunit, exon 3 gi|456589|dbj|D26618.1|HUMGRAS03[456589]

[2397] 2300: D26617 Homo sapiens gene for granulocyte-macrophage colony stimulating factor (GM-CSF) receptor alpha subunit, exon 2 gi|456588|dbj|D26617.1|HUMGRAS02[456588]

[2398] 2301: D26616 Homo sapiens gene for granulocyte-macrophage colony stimulating factor (GM-CSF) receptor alpha subunit, exon 1 gi|456587|dbj|D26616.1|HUMGRAS01[456587]

[2399] 2307: AF324499 Homo sapiens olfactory-like receptor mRNA, complete cds gi|17016397|gb|AF324499.1|AF324499[17016397]

[2400] 2308: AF308814 Homo sapiens olfactory receptor-like protein (JCG10) mRNA, partial cds gi|17016395|gb|AF308814.1|AF308814[17016395]

[2401] 2309: AF238488 Homo sapiens olfactory-like receptor JCG8 (JCG8) mRNA, complete cds gi|17016318|gb|AF238488.1|AF238488[17016318]

[2402] 2310: AF238487 Homo sapiens olfactory-like receptor PJCG2 (PJCG2) mRNA, partial cds gi|17016316|gb|AF238487.1|AF238487[17016316]

[2403] 2311: AF220494 Homo sapiens olfactory receptor-like protein JCG4 (JCG4) mRNA, partial cds gi|17016314|gb|AF220494.1|AF220494[17016314]

[2404] 2312: AF220493 Homo sapiens olfactory receptor-like protein PJCG1 (PJCG1) mRNA, partial cds gi|17016312|gb|AF220493.1|AF220493[17016312]

[2405] 2313: AF209507 Homo sapiens olfactory receptor-like protein mRNA, complete sequence gi|17016311|gb|AF209507.1|AF209507[17016311]

[2406] 2314: AF403014 Homo sapiens type II gonadotropin-releasing hormone receptor gene, partial cds gi|16589055|gb|AF403014.1|AF403014[16589055]

[2407] 2316: AF403012 Homo sapiens ribonucleoprotein RBM8 gene, complete cds gi|16589051|gb|AF403012.1|AF403012[16589051]

[2408] 2317: AY011601 Homo sapiens cannabinoid receptor 1 (CNR1) gene, partial cds gi|12699807|gb|AY011601.1|[12699807]

[2409] 2318: AY011231 Homo sapiens adenosine A3 receptor (ADORA3) gene, partial cds gi|12699245|gb|AY011231.1|[12699245]

[2410] 2319: AF400602 Homo sapiens beta-glucan receptor isoform H (BGR) mRNA, complete cds, alternatively spliced gi|15986713|gb|AF400602.1|AF400602[15986713]

[2411] 2320: AF400601 Homo sapiens beta-glucan receptor isoform G (BGR) mRNA, complete cds, alternatively spliced gi|15986711|gb|AF400601.1|AF400601[15986711]

[2412] 2321: AF400600 Homo sapiens beta-glucan receptor isoform F (BGR) mRNA, complete cds, alternatively spliced gi|15986709|gb|AF400600.1|AF400600[15986709]

[2413] 2322: AF400599 Homo sapiens beta-glucan receptor isoform E (BGR) mRNA, complete cds, alternatively spliced gi|15986707|gb|AF400599.1|AF400599[15986707]

[2414] 2323: AF400598 Homo sapiens beta-glucan receptor isoform D (BGR) mRNA, complete cds, alternatively spliced gi|15986705|gb|AF400598.1|AF400598[15986705]

[2415] 2324: AF400597 Homo sapiens beta-glucan receptor isoform C (BGR) mRNA, complete cds, alternatively spliced gi|15986703|gb|AF400597.1|AF400597[15986703]

[2416] 2325: AF400596 Homo sapiens beta-glucan receptor isoform B (BGR) mRNA, complete cds, alternatively spliced gi|15986701|gb|AF400596.1|AF400596[15986701]

[2417] 2326: AF400595 Homo sapiens beta-glucan receptor isoform A (BGR) mRNA, complete cds, alternatively spliced gi|15986699|gb|AF400595.1|AF400595[15986699]

[2418] 2329: AF162669 Homo sapiens olfactory receptor-like protein JCG2 (JCG2) gene, complete cds gi|12002783|gb|AF162669.1|AF162669[12002783]

[2419] 2330: NM—004895 Homo sapiens cold autoinflammatory syndrome 1 (CIAS1), mRNA gi|4757727|ref|NM—004895.1|[4757727]

[2420] 2331: AF409103 Homo sapiens T-cell receptor VB3 CDR3 region mRNA, partial cds gi|15425973|gb|AF409103.1|AF409103[15425973]

[2421] 2332: NM—033181 Homo sapiens cannabinoid receptor 1 (brain) (CNR1), transcript variant 3, mRNA gi|15208647|ref|NM—033181.1|[15208647]

[2422] 2333: AF373846 Homo sapiens BAFF receptor mRNA, complete cds gi|15208474|gb|AF373846.1|AF373846[15208474]

[2423] 2334: AF361108 Homo sapiens CRHF2 receptor beta-isoform mRNA, partial sequence, aberrantly spliced gi|14586959|gb|AF361108.1|AF361108[14586959]

[2424] 2335: NM—005755 Homo sapiens Epstein-Barr virus induced gene 3 (EBI3), mRNA gi|14577916|ref|NM—005755.2|[14577916]

[2425] 2336: AF369794 Homo sapiens B cell crosslinked IgM-activating sequence protein (BXMAS1) mRNA, complete cds gi|14278718|gb|AF369794.2|AF369794[14278718]

[2426] 2337: AF376725 Homo sapiens lung seven transmembrane receptor 1 (LUSTR1) mRNA, complete cds gi|14248996|gb|AF376725.1|AF376725[14248996]

[2427] 2343: AF352324 Homo sapiens killer cell Ig-like receptor KIR3DL7 (KIRC1) mRNA, complete cds gi|13560903|gb|AF352324.1|AF352324[13560903]

[2428] 2344: AJ249131 Homo sapiens partiel mPR gene for progesterone membrane binding protein gi|6688178|emb|AJ249131.1|HSA249131[6688178]

[2429] 2345: S73474 Homo sapiens folate receptor alpha isoform mRNA, partial cds gi|688233|gb|S73474.1|S73490S2[688233]

[2430] 2346: S73490 Homo sapiens folate receptor alpha isoform mRNA, partial cds gi|688232|gb|S73490.1|S73490S1[688232]

[2431] 2347: S69142 Homo sapiens T-cell receptor alpha-chain (TcR V alpha) mRNA, partial cds gi|545977|gb|S69142.1|S69142[545977]

[2432] 2348: S67401 Homo sapiens T-cell receptor beta chain VDJ region (TCR Vbeta 7.1 Jbeta 2.3) mRNA, partial cds gi|455870|gb|S67401.1|S67401[455870]

[2433] 2349: S62797 Homo sapiens T cell receptor beta chain VDJ region (Tcrvbeta 6) mRNA, Tcrvbeta 6.7a allele, partial cds gi|385951|gb|S62797.1|S62797[385951]

[2434] 2350: AF310685 Homo sapiens ADP-glucose receptor gene, complete cds gi|16973448|gb|AF310685.1|AF310685[16973448]

[2435] 2351: NM—057160 Homo sapiens artemin (ARTN), transcript variant 3, mRNA gi|16950644|ref|NM—057160.1|[16950644]

[2436] 2352: NM—057091 Homo sapiens artemin (ARTN), transcript variant 2, mRNA gi|16950642|ref|NM—057091.1|[16950642]

[2437] 2353: NM—057090 Homo sapiens artemin (ARTN), transcript variant 4, mRNA gi|16950640|ref|NM—057090.1|[16950640]

[2438] 2354: NM—003976 Homo sapiens artemin (ARTN), transcript variant 1, mRNA gi|16950639|ref|NM—003976.2|[16950639]

[2439] 2355: NM—053032 Homo sapiens myosin, light polypeptide kinase (MYLK), transcript variant 8, mRNA gi|16950624|ref|NM—053032.1|[16950624]

[2440] 2356: NM—053031 Homo sapiens myosin, light polypeptide kinase (MYLK), transcript variant 7, mRNA gi|16950622|ref|NM—053031.1|[16950622]

[2441] 2357: NM—053030 Homo sapiens myosin, light polypeptide kinase (MYLK), transcript variant 5, mRNA gi|16950620|ref|NM—053030.1|[16950620]

[2442] 2358: NM—053029 Homo sapiens myosin, light polypeptide kinase (MYLK), transcript variant 4, mRNA gi|16950618|ref|NM—053029.1|[16950618]

[2443] 2359: NM—053028 Homo sapiens myosin, light polypeptide kinase (MYLK), transcript variant 3B, mRNA gi|16950616|ref|NM—053028.1|[16950616]

[2444] 2360: NM—053027 Homo sapiens myosin, light polypeptide kinase (MYLK), transcript variant 3A, mRNA gi|16950614|ref|NM—053027.1|[16950614]

[2445] 2361: NM—053026 Homo sapiens myosin, light polypeptide kinase (MYLK), transcript variant 2, mRNA gi|16950612|ref|NM—053026.1|[16950612]

[2446] 2362: NM—053025 Homo sapiens myosin, light polypeptide kinase (MYLK), transcript variant 1, mRNA gi|16950610|ref|NM—053025.1|[16950610]

[2447] 2363: NM—005965 Homo sapiens myosin, light polypeptide kinase (MYLK), transcript variant 6, mRNA gi|16950600|ref|NM—005965.2|[16950600]

[2448] 2364: AF106202 Homo sapiens endothelial cell protein C receptor precursor (EPCR) gene, promoter region and complete cds gi|16950557|gb|AF106202.2|AF106202[16950557]

[2449] 2365: AY033942 Homo sapiens prostate-specific G protein-coupled receptor (PSGR) mRNA, complete cds gi|16943640|gb|AY033942.1|[16943640]

[2450] 2366: AF369708 Homo sapiens prostate-specific G-protein coupled receptor mRNA, complete cds gi|13752563|gb|AF369708.1|AF369708[13752563]

[2451] 2368: AJ276204 Homo sapiens partial mRNA for T-cell receptor beta-chain (TCRB gene) Plasmid-C-8 gi|9968287|emb|AJ276204.1|HSA276204[9968287]

[2452] 2369: AJ276203 Homo sapiens partial mRNA for T-cell receptor beta-chain (TCRB gene) Plasmid-C-7 gi|9968285|emb|AJ276203.1|HSA276203[9968285]

[2453] 2370: AJ276202 Homo sapiens partial mRNA for T-cell receptor beta-chain (TCRB gene) Plasmid-C-6 gi|9968266|emb|AJ276202.1|HSA276202[9968266]

[2454] 2371: AJ276201 Homo sapiens partial mRNA for T-cell receptor beta-chain (TCRB gene) Plasmid-C-5 gi|9968264|emb|AJ276201.1|HSA276201[9968264]

[2455] 2372: AJ276200 Homo sapiens partial mRNA for T-cell receptor beta-chain (TCRB gene) Plasmid-C-4 gi|9968262|emb|AJ276200.1|HSA276200[9968262]

[2456] 2373: AJ276199 Homo sapiens partial mRNA for T-cell receptor beta-chain (TCRB gene) Plasmid-C-3 gi|9968260|emb|AJ276199.1|HSA276199[9968260]

[2457] 2374: AJ276198 Homo sapiens partial mRNA for T-cell receptor beta-chain (TCRB gene) Plasmid-C-2 gi|9968258|emb|AJ276198.1|HSA276198[9968258]

[2458] 2375: AJ276197 Homo sapiens partial mRNA for T-cell receptor beta-chain (TCRB gene) Plasmid-C-1 gi|9968256|emb|AJ276197.1|HSA276197[9968256]

[2459] 2376: AJ276196 Homo sapiens partial mRNA for T-cell receptor beta-chain (TCRB gene) Gel-C gi|9968254|emb|AJ276196.1|HSA276196[9968254]

[2460] 2377: AJ276195 Homo sapiens partial mRNA for T-cell receptor beta-chain (TCRB gene) Plasmid-B-11 gi|9968252|emb|AJ276195.1|HSA276195[9968252]

[2461] 2378: AJ276194 Homo sapiens partial mRNA for T-cell receptor beta-chain (TCRB gene) Plasmid-B-10 gi|9968250|emb|AJ276194.1|HSA276194[9968250]

[2462] 2379: AJ276193 Homo sapiens partial mRNA for T-cell receptor beta-chain (TCRB gene) Plasmid-B-9 gi|9968248|emb|AJ276193.1|HSA276193[9968248]

[2463] 2380: AJ276192 Homo sapiens partial mRNA for T-cell receptor beta-chain (TCRB gene) Plasmid-B-8 gi|9968246|emb|AJ276192.1|HSA276192[9968246]

[2464] 2381: AJ276191 Homo sapiens partial mRNA for T-cell receptor beta-chain (TCRB gene) Plasmid-B-7 gi|9968244|emb|AJ276191.1|HSA276191[9968244]

[2465] 2382: AJ276190 Homo sapiens partial mRNA for T-cell receptor beta-chain (TCRB gene) Plasmid-B-6 gi|9968242|emb|AJ276190.1|HSA276190[9968242]

[2466] 2383: AJ276189 Homo sapiens partial mRNA for T-cell receptor beta-chain (TCRB gene) Plasmid-B-5 gi|9968240|emb|AJ276189.1|HSA276189[9968240]

[2467] 2384: AJ276188 Homo sapiens partial mRNA for T-cell receptor beta-chain (TCRB gene) Plasmid-B-4 gi|9968238|emb|AJ276188.1|HSA276188[9968238]

[2468] 2385: AJ276187 Homo sapiens partial mRNA for T-cell receptor beta-chain (TCRB gene) Plasmid-B-3 gi|9968236|emb|AJ276187.1|HSA276187[9968236]

[2469] 2386: AJ276186 Homo sapiens partial mRNA for T-cell receptor beta-chain (TCRB gene) Plasmid-B-2 gi|9968234|emb|AJ276186.1|HSA276186[9968234]

[2470] 2387: AJ276185 Homo sapiens partial mRNA for T-cell receptor beta-chain (TCRB gene) Plasmid-B-1 gi|9968232|emb|AJ276185.1|HSA276185[9968232]

[2471] 2388: AJ276184 Homo sapiens partial mRNA for T-cell receptor beta-chain (TCRB gene) Gel-A2 gi|9968230|emb|AJ276184.1|HSA276184[9968230]

[2472] 2389: AJ276183 Homo sapiens partial mRNA for T-cell receptor beta-chain (TCRB gene) Gel-A1 gi|9968228|emb|AJ276183.1|HSA276183[9968228]

[2473] 2390: NM—005086 Homo sapiens sarcospan (Kras oncogene-associated gene) (SSPN), mRNA gi|16933560|ref|NM—005086.3|[16933560]

[2474] 2391: NM—018153 Homo sapiens tumor endothelial marker 8 (TEM8), transcript variant 3, mRNA gi|16933552|ref|NM—018153.2|[16933552]

[2475] 2392: NM—053034 Homo sapiens tumor endothelial marker 8 (TEM8), transcript variant 2, mRNA gi|16933550|ref|NM—053034.1|[16933550]

[2476] 2393: NM—005929 Homo sapiens antigen p97 (melanoma associated) identified by monoclonal antibodies 133.2 and 96.5 (MFI2), transcript variant 1, mRNA gi|16933549|ref|NM—005929.3|[16933549]

[2477] 2394: NM—033316 Homo sapiens antigen p97 (melanoma associated) identified by monoclonal antibodies 133.2 and 96.5 (MFI2), transcript variant 2, mRNA gi|16933548|ref|NM—033316.2|[16933548]

[2478] 2395: AF361473 Homo sapiens magic roundabout mRNA, complete cds gi|16930357|gb|AF361473.1|AF361473[16930357]

[2479] 2396: NM—032208 Homo sapiens tumor endothelial marker 8 (TEM8), transcript variant 1, mRNA gi|14149903|ref|NM—032208.1|[14149903]

[2480] 2397: NM—007346 Homo sapiens opioid growth factor receptor (OGFR), mRNA gi|6671492|ref|NM—007346.1|[6671492]

[2481] 2398: BC017412 Homo sapiens, leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 2, clone MGC:27265 IMAGE:4618777, mRNA, complete cds gi|16924270|gb|BC017412.1|BC017412[16924270]

[2482] 2401: AF435588 Homo sapiens melatonin receptor Mella (MTNR1A) mRNA, partial cds gi|16904202|gb|AF435588.1|AF435588[16904202]

[2483] 2402: AF421380 Homo sapiens anthrax toxin receptor mRNA, complete cds gi|16566412|gb|AF421380.1|AF421380[16566412]

[2484] 2403: AF291815 Homo sapiens NK cell receptor (CS1) mRNA, complete cds gi|13021809|gb|AF291815.1|AF291815[13021809]

[2485] 2404: AF117899 Homo sapiens LDLR-FUT fusion protein (LDLR-FUT) mRNA, complete cds gi|6739499|gb|AF117899.1|AF117899[6739499]

[2486] 2405: AF054013 Homo sapiens lipoxin A4 receptor mRNA, complete cds gi|3047268|gb|AF054013.1|AF054013[3047268]

[2487] 2406: AF013250 Homo sapiens leukocyte-associated Ig-like receptor-2 (LAIR-2) mRNA, complete cds gi|2352942|gb|AF013250.1|AF013250[2352942]

[2488] 2407: AF013249 Homo sapiens leukocyte-associated Ig-like receptor-1 (LAIR-1) mRNA, complete cds gi|2352940|gb|AF013249.1|AF013249[2352940]

[2489] 2409: AF326353 Homo sapiens Src-like adapter protein-2 mRNA, complete cds gi|16797891|gb|AF326353.1|AF326353[16797891]

[2490] 2411: BC017065 Homo sapiens, tumor necrosis factor receptor superfamily, member 6b, decoy, clone MGC:9587 IMAGE:3886635, mRNA, complete cds gi|16877637|gb|BC017065.1|BC017065[16877637]

[2491] 2412: BC016938 Homo sapiens, neuromedin U receptor 2, clone MGC:21396 IMAGE:3852151, mRNA, complete cds gi|16877376|gb|BC016938.1|BC016938[16877376]

[2492] 2413: BC016860 Homo sapiens, G protein-coupled receptor, family C, group 5, member C, clone MGC:17384 IMAGE:3904655, mRNA, complete cds gi|16877192|gb|BC016860.1|BC016860[16877192]

[2493] 2414: BC016692 Homo sapiens, progesterone receptor membrane component 2, clone MGC:22407 IMAGE:4067832, mRNA, complete cds gi|16876813|gb|BC016692.1|BC016692[16876813]

[2494] 2415: AY026949 Homo sapiens stresscopin mRNA, complete cds gi|15026913|gb|AY026949.1|[15026913]

[2495] 2416: AF285092 Homo sapiens Bcl-2-like protein 10 mRNA, complete cds gi|9837265|gb|AF285092.1|AF285092[9837265]

[2496] 2417: D78579 Homo sapiens NOR-1 mRNA for neuron derived orphan receptor, complete cds gi|1651190|dbj|D78579.1|D78579[1651190]

[2497] 2418: D38044 Homo sapiens gene for Ah-receptor, partial cds, exons 7-9 gi|532672|dbj|D38044.1|HUMAHRA[532672]

[2498] 2419: NM—053278 Homo sapiens G protein-coupled receptor 102 (GPR102), mRNA gi|16751916|ref|NM—053278.1|[16751916]

[2499] 2420: NM—030916 Homo sapiens Ig superfamily receptor LNIR (LNIR), mRNA gi|16716338|ref|NM—030916.1|[16716338]

[2500] 2421: AF403479 Homo sapiens EWS/FLI1 activated transcript 2 protein mRNA, complete cds gi|16611777|gb|AF403479.1|AF403479[16611777]

[2501] 2422: NM—053036 Homo sapiens G protein-coupled receptor 74 (GPR74), mRNA gi|16604257|ref|NM—053036.1|[16604257]

[2502] 2431: BC016004 Homo sapiens, macrophage receptor with collagenous structure, clone MGC:27263 IMAGE:4618447, mRNA, complete cds gi|16359078|gb|BC016004.1|BC016004[16359078]

[2503] 2432: BC013827 Homo sapiens, laminin receptor 1 (67kD, ribosomal protein SA), clone MGC:17122 IMAGE:3446816, mRNA, complete cds gi|16307601|gb|BC013827.1|BC013827[16307601]

[2504] 2433: BC001590 Homo sapiens, cargo selection protein (mannose 6 phosphate receptor binding protein), clone MGC:2012 IMAGE:2987965, mRNA, complete cds gi|16306788|gb|BC001590.1|BC001590[16306788]

[2505] 2434: BC001492 Homo sapiens, ciliary neurotrophic factor receptor, clone MGC:1774 IMAGE:3510004, mRNA, complete cds gi|16306633|gb|BC001492.1|BC001492[16306633]

[2506] 2435: BC015768 Homo sapiens, interleukin 13 receptor, alpha 1, clone MGC:23204 IMAGE:4868206, mRNA, complete cds gi|16041774|gb|BC015768.1|BC015768[16041774]

[2507] 2436: BC015731 Homo sapiens, leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 1, clone MGC:22968 IMAGE:4878915, mRNA, complete cds gi|16041710|gb|BC015731.1|BC015731[16041710]

[2508] 2437: BC015542 Homo sapiens, poliovirus receptor, clone MGC:9603 IMAGE:3902226, mRNA, complete cds gi|15930222|gb|BC015542.1|BC015542[15930222]

[2509] 2439: BC015195 Homo sapiens, Fc fragment of IgE, high affinity I, receptor for; alpha polypeptide, clone MGC:14717 IMAGE:4251469, mRNA, complete cds gi|15929529|gb|BC015195.1|BC015195[15929529]

[2510] 2440: BC014972 Homo sapiens, interleukin 2 receptor, gamma (severe combined immunodeficiency), clone MGC:23116 IMAGE:4878734, mRNA, complete cds gi|15929027|gb|BC014972.1|BC014972[15929027]

[2511] 2441: BC014962 Homo sapiens, GDNF family receptor alpha 1, clone MGC:23045 IMAGE:4874042, mRNA, complete cds gi|1592900|lgb|BC014962.1|BC014962[15929001]

[2512] 2442: BC014960 Homo sapiens, low density lipoprotein receptor defect C complementing, clone MGC:23019 IMAGE:4876271, mRNA, complete cds gi|15928995|gb|BC014960.1|BC014960[15928995]

[2513] 2443: BC013816 Homo sapiens, platelet-activating factor receptor, clone MGC:17210 IMAGE:4343214, mRNA, complete cds gi|15489458|gb|BC013816.1|BC013816[15489458]

[2514] 2444: BC013780 Homo sapiens, adenosine A2a receptor, clone MGC:21342 IMAGE:4385637, mRNA, complete cds gi|15489369|gb|BC013780.1|BC013780[15489369]

[2515] 2445: NM—032551 Homo sapiens G protein-coupled receptor 54 (GPR54), mRNA gi|14211846|ref|NM—032551.1|[14211846]

[2516] 2446: AF329490 Homo sapiens IFGP2 mRNA, complete cds gi|16506260|gb|AF329490.1|AF329490[16506260]

[2517] 2447: AF329488 Homo sapiens IFGP1 mRNA, complete cds gi|16506256|gb|AF329488.1|AF329488[16506256]

[2518] 2448: NM—000798 Homo sapiens dopamine receptor D5 (DRDS), mRNA gi|16445405|ref|NM—000798.2|[16445405]

[2519] 2449: NM—000794 Homo sapiens dopamine receptor D1 (DRD1), mRNA gi|16445404|ref|NM—000794.2|[16445404]

[2520] 2450: NM—000796 Homo sapiens dopamine receptor D3 (DRD3), transcript variant a, mRNA gi|16445403|ref|NM—000796.2|[16445403]

[2521] 2451: NM—033663 Homo sapiens dopamine receptor D3 (DRD3), transcript variant e, mRNA gi|16445401|ref|NM—033663.1|[16445401]

[2522] 2452: NM—033660 Homo sapiens dopamine receptor D3 (DRD3), transcript variant d, mRNA gi|16445399|ref|NM—033660.1|[16445399]

[2523] 2453: NM—033659 Homo sapiens dopamine receptor D3 (DRD3), transcript variant c, mRNA gi|16445397|ref|NM—033659.1|[16445397]

[2524] 2454: NM—033658 Homo sapiens dopamine receptor D3 (DRD3), transcript variant b, mRNA gi|16445395|ref|NM—033658.1|[16445395]

[2525] 2455: AJ298918 Homo sapiens t(8;22)(p11;q11) translocation breakpoint, BCR/FGFR gene gi|16444915|emb|AJ298918.1|HSA298918[16444915]

[2526] 2456: AJ298917 Homo sapiens partial mRNA for FGFR1/BCR chimaeric fusion peptide gi|16444913|emb|AJ298917.1|HSA298917[16444913]

[2527] 2457: AJ298916 Homo sapiens partial mRNA for BCR/FGFR1 chimaeric fusion protein gi|16444911|emb|AJ298916.1|HSA298916[16444911]

[2528] 2458: AF325925 Homo sapiens tandem motif downstream of INSRR gene, allele 2 gi|13374363|gb|AF325925.1|AF325925[13374363]

[2529] 2459: AF325924 Homo sapiens tandem motif downstream of INSRR gene, allele 1 gi|13374362|gb|AF325924.1|AF325924[13374362]

[2530] 2460: NM—014879 Homo sapiens G protein-coupled receptor 105 (GPR105), mRNA gi|7661847|ref|NM—014879.1|[7661847]

[2531] 2461: NM—000797 Homo sapiens dopamine receptor D4 (DRD4), mRNA gi|4503388|ref|NM—000797.1|[4503388]

[2532] 2462: NM—052962 Homo sapiens class II cytokine receptor (IL22RA2), mRNA gi|16418458|ref|NM—052962.1|[16418458]

[2533] 2463: NM—052932 Homo sapiens pro-oncosis receptor inducing membrane injury gene (PORIMIN), mRNA gi|16418408|ref|NM—052932.1|[16418408]

[2534] 2464: NM—052887 Homo sapiens Toll-interleukin 1 receptor (TIR) domain-containing adapter protein (TIRAP), mRNA gi|16418398|ref|NM—052887.1|[16418398]

[2535] 2465: NM—018835 Homo sapiens olfactory receptor, family 1, subfamily K, member 1 (OR1K1), mRNA gi|9256536|ref|NM—018835.1|[9256536]

[2536] 2466: BC016141 Homo sapiens, interleukin 1 receptor accessory protein, clone IMAGE:3920152, mRNA gi|16359373|gb|BC016141.1|BC016141[16359373]

[2537] 2467: AF177765 Homo sapiens toll-like receptor 4 (TLR4) gene, TLR4A allele, complete cds gi|6175872|gb|AF177765.1|AF177765[6175872]

[2538] 2468: U11813 Homo sapiens hepatocyte growth factor receptor precursor, mRNA, partial cds; alternatively spliced gi|530799|gb|U11813.1|HSU11813[530799]

[2539] 2469: BC009540 Homo sapiens, G protein-coupled receptor 87, clone MGC:10065 IMAGE:3894333, mRNA, complete cds gi|16306940|gb|BC009540.1|BC009540[16306940]

[2540] 2474: AJ313162 Homo sapiens mRNA for soluble cytokine class II receptor, long isoform (CRF2-S1 gene) gi|16304592|emb|AJ313162.1|HSA313162[16304592]

[2541] 2475: AJ313161 Homo sapiens mRNA for soluble cytokine class II receptor, short isoform (CRF2-S1 gene) gi|16304590|emb|AJ313161.1|HSA313161[16304590]

[2542] 2476: AY048757 Homo sapiens ATP-binding cassette transporter G1 (ABCG1) mRNA, complete cds, alternatively spliced gi|16304310|gb|AY048757.1|[16304310]

[2543] 2501: AJ313161 Homo sapiens mRNA for soluble cytokine class II receptor, short isoform (CRF2-S1 gene) gi|16304590|emb|AJ313161.1|HSA313161[16304590]

[2544] 2502: AY048757 Homo sapiens ATP-binding cassette transporter G1 (ABCG1) mRNA, complete cds, alternatively spliced gi|16304310|gb|AY048757.1|[16304310]

[2545] 2626: NM—012068 Homo sapiens activating transcription factor 5 (ATF5), mRNA gi|12597624|ref|NM—012068.2|[12597624]

[2546] 2627: AF055084 Homo sapiens very large G-protein coupled receptor-1 (VLGR1) mRNA, complete cds gi|5902965|gb|AF055084.1|AF055084[5902965]

[2547] 2629: AJ414821 Homo sapiens partial IGVKL12 gene for immunoglobulin kappa chain variable region, donor TG, cel184 gi|16215495|emb|AJ414821.2|HSA414821[16215495]

[2548] 2630: AY056048 Homo sapiens receptor protein tyrosine kinase variant EphB4v1 (EPHB4) mRNA, complete cds, alternatively spliced gi|16209619|gb|AY056048.1|[16209619]

[2549] 2631: AY056047 Homo sapiens receptor protein tyrosine kinase EphB4 (EPHB4) gene, complete cds, alternatively spliced gi|16209617|gb|AY056047.1|[16209617]

[2550] 2632: AY052498 Homo sapiens NK cell receptor (KIR2DL4) mRNA, KIR2DL4-10A allele, partial cds gi|16209550|gb|AY052498.1|[16209550]

[2551] 2633: AY052497 Homo sapiens NK cell receptor (KIR2DL4) mRNA, KIR2DL4-9A allele, partial cds gi|16209510|gb|AY052497.1|[16209510]

[2552] 2634: AY052496 Homo sapiens truncated NK cell receptor (KIR2DL4) mRNA, KIR2DL4-9A allele, partial cds gi|16209507|gb|AY052496.1|[16209507]

[2553] 2635: AF267245 Homo sapiens killer cell lectin-like receptor KLRF1-S3 (KLRF1) mRNA, complete cds., alternatively spliced gi|16151842|gb|AF267245.1|AF267245[16151842]

[2554] 2636: AF267244 Homo sapiens killer cell lectin-like receptor KLRF1-S2 (KLRF1) mRNA, complete cds., alternatively spliced gi|16151840|gb|AF267244.1|AF267244[16151840]

[2555] 2637: NM—033637 Homo sapiens beta-transducin repeat containing (BTRC), transcript variant 1, mRNA gi|16117782|ref|NM—033637.1|[16117782]

[2556] 3563: NM—033050 Homo sapiens G protein-coupled receptor 91 (GPR91), mRNA gi|14780893|ref|NM—033050.1|[14780893]

[2557] 3564: NM—023914 Homo sapiens G protein-coupled receptor 86 (GPR86), mRNA gi|13194202|ref|NM—023914.1|[13194202]

[2558] 3565: NM—020402 Homo sapiens cholinergic receptor, nicotinic, alpha polypeptide 10 (CHRNA10), mRNA gi|11138122|ref|NM—020402.2|[11138122]

[2559] 3566: NM—020370 Homo sapiens G protein-coupled receptor 84 (GPR84), mRNA gi|9966838|ref|NM—020370.1|[9966838]

[2560] 3567: NM—012301 Homo sapiens atrophin-1 interacting protein 1; activin receptor interacting protein 1 (KIAA0705), mRNA gi|6912461|ref|NM—012301.1|[6912461]

[2561] 3568: AF208541 Homo sapiens V1-vascular vasopressin receptor AVPR1A gene, promoter region and partial cds gi|6581121|gb|AF208541.1|AF208541[6581121]

[2562] 3569: NM—005756 Homo sapiens G protein-coupled receptor 64 (GPR64), mRNA gi|5031732|ref|NM—005756.1|[5031732]

[2563] 3570: NM—003939 Homo sapiens beta-transducin repeat containing (BTRC), transcript variant 2, mRNA gi|4502476|ref|NM—003939.1|[4502476]

[2564] 3571: AH003597 Homo sapiens A3 adenosine receptor (ADORA3) gene gi|1387984|gb|AH003597.1|SEG_HUMADOR0[1387984]

[2565] 3572: L77730 Homo sapiens A3 adenosine receptor (ADORA3) gene, exon 2 gi|1387983|gb|L77730.1|HUMADOR02[1387983]

[2566] 3573: L77729 Homo sapiens A3 adenosine receptor (ADORA3) gene, exon 1 gi|1387982|gb|L77729.1|HUMADOR01[1387982]

[2567] 3574: AF000381 Homo sapiens folate binding protein mRNA, partial cds gi|16041647|gb|AF000381.2|AF000381[16041647]

[2568] 3583: AY054974 Homo sapiens RAE-1-like transcript 4 mRNA, complete cds gi|15990603|gb|AY054974.1|[15990603]

[2569] 3584: AF421855 Homo sapiens interleukin 4 receptor (IL4R) gene, complete cds gi|15987825|gb|AF421855.1|AF421855[15987825]

[2570] 3585: AF359241 Homo sapiens soluble truncated fibroblast growth factor receptor 4 (FGFR4) mRNA, complete cds gi|13877134|gb|AF359241.1|AF359241[13877134]

[2571] 3586: NM—022148 Homo sapiens cytokine receptor-like factor 2 (CRLF2), mRNA gi|13375623|ref|NM—022148.1|[13375623]

[2572] 3587: AF179770 Homo sapiens olfactory receptor (HSA8) gene, partial cds gi|7211542|gb|AF179770.1|AF179770[7211542]

[2573] 3590: AF179767 Homo sapiens olfactory receptor (HSA5) gene, partial cds gi|7211538|gb|AF179767.1|AF179767[7211538]

[2574] 3591: AF179766 Homo sapiens olfactory receptor (HSA3) gene, partial cds gi|7211536|gb|AF179766.1|AF179766[7211536]

[2575] 3596: AF179761 Homo sapiens olfactory receptor (HSA12) gene, partial cds gi|7211530|gb|AF179761.1|AF179761[7211530]

[2576] 3597: AF179760 Homo sapiens olfactory receptor (HSA10) gene, partial cds gi|7211528|gb|AF179760.1|AF179760[7211528]

[2577] 3598: AF179759 Homo sapiens olfactory receptor (HSA1) gene, partial cds gi|7211526|gb|AF179759.1|AF179759[7211526]

[2578] 3599: D86962 Human mRNA for KIAA0207 gene, complete cds gi|1503997|dbj|D86962.1|D86962[1503997]

[2579] 3600: D13626 Human mRNA for KIAA0001 gene, complete cds gi|285994|dbj|D13626.1|HUMRSC338[285994]

[2580] 3601: AY026770 Homo sapiens lectin-like receptor 1B (DECTIN1) mRNA, complete cds, alternatively spliced gi|15967098|gb|AY026770.2|[15967098]

[2581] 3602: AY026769 Homo sapiens lectin-like receptor 1 (DECTIN1) mRNA, complete cds gi|15967096|gb|AY026769.2|[15967096]

[2582] 3605: AJ344142 Homo sapiens mRNA for putative MCP-1 chemokine receptor (CCR11 gene) gi|15919090|emb|AJ344142.1|HSA344142[15919090]

[2583] 3606: AY029770 Homo sapiens CCK-B/gastrin receptor variant mRNA, complete cds, alternatively spliced gi|15911832|gb|AY029770.1|[15911832]

[2584] 3607: NM—002821 Homo sapiens PTK7 protein tyrosine kinase 7 (PTK7), mRNA gi|15826839|ref|NM—002821.2|[15826839]

[2585] 3608: AF303576 Homo sapiens G protein-coupled receptor 75 (GPR75) gene, exon 1 gi|15824419|gb|AF303576.1|AF303576[15824419]

[2586] 3609: AB032427 Homo sapiens VRL-2 mRNA for vanilloid receptor like channel-2, complete cds gi|15822824|dbj|AB032427.1|AB032427[15822824]

[2587] 3610: AY008280 Homo sapiens histamine receptor H4 (H4) mRNA, complete cds gi|15822540|gb|AY008280.1|[15822540]

[2588] 3611: U40271 Homo sapiens transmembrane receptor precursor (PTK7) mRNA, complete cds gi|15808058|gb|U40271.2|HSU40271 [15808058]

[2589] 3612: NM—000575 Homo sapiens interleukin 1, alpha (IL1A), mRNA gi|13236493|ref|NM—000575.1|[13236493]

[2590] 3615: NM—014312 Homo sapiens cortical thymocyte receptor (X. laevis CTX) like (CTXL), mRNA gi|7657000|ref|NM—014312.1|[7657000]

[2591] 3616: AB032738 Homo sapiens gene for chemokine receptor CXCR3, partial cds gi|7209698|dbj|AB032738.1|AB032738[7209698]

[2592] 3617: AB032737 Homo sapiens gene for chemokine receptor CXCR3, partial cds gi|7209696|dbj|AB032737.1|AB032737[7209696]

[2593] 3618: AB032736 Homo sapiens gene for chemokine receptor CXCR3, partial cds gi|7209694|dbj|AB032736.1|AB032736[7209694]

[2594] 3619: AB032735 Homo sapiens gene for chemokine receptor CXCR3, partial cds gi|7209692|dbj|AB032735.1|AB032735[7209692]

[2595] 3620: AB032734 Homo sapiens CXCR2 gene for IL-8 receptor type B, partial cds gi|7209690|dbj|AB032734.1|AB032734[7209690]

[2596] 3621: AB032733 Homo sapiens CXCR2 gene for IL-8 receptor type B, partial cds gi|7209688|dbj|AB032733.1|AB032733[7209688]

[2597] 3622: AB032732 Homo sapiens CXCR1 gene for IL-8 receptor type A, partial cds gi|7209686|dbj|AB032732.1|AB032732[7209686]

[2598] 3623: AB032731 Homo sapiens CXCR1 gene for IL-8 receptor type A, partial cds gi|7209684|dbj|AB032731.1|AB032731[7209684]

[2599] 3624: AB032730 Homo sapiens CXCR1 gene for IL-8 receptor type A, partial cds gi|7209682|dbj|AB032730.1|AB032730[7209682]

[2600] 3625: AB032729 Homo sapiens CXCR1 gene for IL-8 receptor type A, partial cds gi|7209680|dbj|AB032729.1|AB032729[7209680]

[2601] 3626: AB032728 Homo sapiens CXCR1 gene for IL-8 receptor type A, partial cds gi|7209678|dbj|AB032728.1|AB032728[7209678]

[2602] 3628: AB030952 Homo sapiens TNFR2 gene for tumor necrosis factor receptor 2, partial cds gi|6683135|dbj|AB030952.1|AB030952[6683135]

[2603] 3629: AB030951 Homo sapiens TNFR2 gene for tumor necrosis factor receptor 2, partial cds gi|6683133|dbj|AB030951.1|AB030951[6683133]

[2604] 3630: AB030950 Homo sapiens TNFR2 gene for tumor necrosis factor receptor 2, partial cds gi|6683131|dbj|AB030950.1|AB030950[6683131]

[2605] 3631: AB030949 Homo sapiens TNFR2 gene for tumor necrosis factor receptor 2, partial cds gi|6683129|dbj|AB030949.1|AB030949[6683129]

[2606] 3632: AB023892 Homo sapiens gene for b-chemokine receptor CCR4, complete cds gi|6467142|dbj|AB023892.1|AB023892[6467142]

[2607] 3633: AB023891 Homo sapiens gene for b-chemokine receptor CCR4, complete cds gi|6467140|dbj|AB023891.1|AB023891[6467140]

[2608] 3634: AB023890 Homo sapiens gene for b-chemokine receptor CCR4, complete cds gi|6467138|dbj|AB023890.1|AB023890[6467138]

[2609] 3635: AB023889 Homo sapiens gene for b-chemokine receptor CCR4, complete cds gi|6467136|dbj|AB023889.1|AB023889[6467136]

[2610] 3636: AB023888 Homo sapiens gene for b-chemokine receptor CCR4, complete cds gi|6467134|dbj|AB023888.1|AB023888[6467134]

[2611] 3637: AB023887 Homo sapiens gene for b-chemokine receptor CCR3, complete cds gi|6467132|dbj|AB023887.1|AB023887[6467132]

[2612] 3638: AH008153 Homo sapiens IL-IRI gene, complete sequence gi|5823144|gb|AH008153.1|SEG_HSAIL1R[5823144]

[2613] 3639: AF146427 Homo sapiens interleukin-1 receptor type I (IL1R1) gene, exon 1c gi|5823143|gb|AF146427.1|HSAIL1R2[5823143]

[2614] 3640: AF146426 Homo sapiens interleukin-1 receptor type I (IL1R1) gene, exon 1b and intron 1b gi|5823142|gb|AF146426.1|HSAIL1R1[5823142]

[2615] 3641: NM—006691 Homo sapiens extracellular link domain-containing 1 (XLKD1), mRNA gi|5729910|ref|NM—006691.1|[5729910]

[2616] 3642: Z99761 Homo sapiens gonadotrophin-releasing hormone receptor gene exon 2 gi|5514748|emb|Z99761.2|HSGRHRX2[5514748]

[2617] 3643: Z99760 Homo sapiens gonadotropin-releasing hormone receptor gene exon 1 variant 1 gi|5514747|emb|Z99760.2|HSGRHRX1[5514747]

[2618] 3644: NM—001250 Homo sapiens tumor necrosis factor receptor superfamily, member 5 (TNFRSF5), mRNA gi|4507580|ref|NM—001250.1|[4507580]

[2619] 3645: NM—000406 Homo sapiens gonadotropin-releasing hormone receptor (GNRHR), mRNA gi|4504058|ref|NM—000406.1|[4504058]

[2620] 3646: Z99995 Homo sapiens partial gonadotropin releasing hormone receptor gene gi|3334762|emb|Z99995.1|HSZ99995[3334762]

[2621] 3647: G16069 928H1R CEPH YAC and mega-YAC libraries (DBThompson) Homo sapiens STS genomic clone 928H1 right arm, sequence tagged site gi|1825444|gb|G16069.1|G16069[1825444]

[2622] 3648: G16077 817D6L CEPH YAC and mega-YAC libraries (DBThompson) Homo sapiens STS genomic clone 817D6 left arm, sequence tagged site gi|1592357|gb|G16077.1|G16077[1592357]

[2623] 3649: G16076 807B6L CEPH YAC and mega-YAC libraries (DBThompson) Homo sapiens STS genomic clone 807B6 left arm, sequence tagged site gi|1592356|gb|G16076.1|G16076[1592356]

[2624] 3650: G16075 940H12L CEPH YAC and mega-YAC libraries (DBThompson) Homo sapiens STS genomic clone 940H12 left arm, sequence tagged site gi|1592355|gb|G16075.1|G16075[1592355]

[2625] 3651: G16074 706A2L CEPH YAC and mega-YAC libraries (DBThompson) Homo sapiens STS genomic clone 706A2 left arm, sequence tagged site gi|1592354|gb|G16074.1|G16074[1592354]

[2626] 3652: G16073 967A10L CEPH YAC and mega-YAC libraries (DBThompson) Homo sapiens STS genomic clone 967A10 left arm, sequence tagged site gi|1592353|gb|G16073.1|G16073[1592353]

[2627] 3653: G16072 816C10L CEPH YAC and mega-YAC libraries (DBThompson) Homo sapiens STS genomic clone 816C10 left arm, sequence tagged site gi|1592352|gb|G16072.1|G16072[1592352]

[2628] 3654: G16071 765B8R CEPH YAC and mega-YAC libraries (DBThompson) Homo sapiens STS genomic clone 765B8 right arm, sequence tagged site gi|1592351|gb|G16071.1|G16071[1592351]

[2629] 3655: G16070 622F2R CEPH YAC and mega-YAC libraries (DBThompson) Homo sapiens STS genomic clone 622F2 right arm, sequence tagged site gi|1592350|gb|G16070.1|G16070[1592350]

[2630] 3656: G16068 868H11L CEPH YAC and mega-YAC libraries (DBThompson) Homo sapiens STS genomic clone 868H11 left arm, sequence tagged site gi|1592349|gb|G16068.1|G16068[1592349]

[2631] 3657: G16067 662F2L CEPH YAC and mega-YAC libraries (DBThompson) Homo sapiens STS genomic clone 662F2 left arm, sequence tagged site gi|1592348|gb|G16067.1|G16067[1592348]

[2632] 3658: G16066 918D7R CEPH YAC and mega-YAC libraries (DBThompson) Homo sapiens STS genomic clone 918D7 right arm, sequence tagged site gi|1592347|gb|G16066.1|G16066[1592347]

[2633] 3659: G16065 758C4R CEPH YAC and mega-YAC libraries (DBThompson) Homo sapiens STS genomic clone 758C4 right arm, sequence tagged site gi|1592346|gb|G16065.1|G16065[1592346]

[2634] 3660: G16064 677D7L CEPH YAC and mega-YAC libraries (DBThompson) Homo sapiens STS genomic clone 677D7 left arm, sequence tagged site gi|1592345|gb|G16064.1|G16064[1592345]

[2635] 3663: L11238 Homo sapiens platelet membrane glycoprotein V mRNA, complete cds gi|388759|gb|L11238.1|HUMGLYCOPR[388759]

[2636] 3665: AF406652 Homo sapiens MyD88 adapter-like protein mRNA, complete cds gi|15528826|gb|AF406652.1|AF406652[15528826]

[2637] 4053: NM—022059 Homo sapiens chemokine (C-X-C motif) ligand 16 (CXCL16), mRNA gi|11545764|ref|NM—022059.1|[11545764]

[2638] 4054: NM—030956 Homo sapiens toll-like receptor 10 (TLR10), mRNA gi|13569929|ref|NM—030956.1|[13569929]

[2639] 4055: NM—033358 Homo sapiens caspase 8, apoptosis-related cysteine protease (CASP8), transcript variant E, mRNA gi|15718711|ref|NM—033358.1|[15718711]

[2640] 4056: NM—033357 Homo sapiens caspase 8, apoptosis-related cysteine protease (CASPB), transcript variant D, mRNA gi|15718709|ref|NM—033357.1|[15718709]

[2641] 4057: NM—033356 Homo sapiens caspase 8, apoptosis-related cysteine protease (CASP8), transcript variant C, mRNA gi|15718707|ref|NM—033356.1|[15718707]

[2642] 4058: NM—033355 Homo sapiens caspase 8, apoptosis-related cysteine protease (CASP8), transcript variant B, mRNA gi|15718705|ref|NM—033355.1|[15718705]

[2643] 4059: NM—001228 Homo sapiens caspase 8, apoptosis-related cysteine protease (CASP8), transcript variant A, mRNA gi|15718703|ref|NM—001228.2|[15718703]

[2644] 4061: NM—000024 Homo sapiens adrenergic, beta-2-, receptor, surface (ADRB2), mRNA gi|15718673|ref|NM—000024.3|[15718673]

[2645] 4062: NM—000683 Homo sapiens adrenergic, alpha-2C-, receptor (ADRA2C), mRNA gi|15718672|ref|NM—000683.2|[15718672]

[2646] 4063: NM—000682 Homo sapiens adrenergic, alpha-2B-, receptor (ADRA2B), mRNA gi|15718671|ref|NM—000682.2|[15718671]

[2647] 4064: NM—000681 Homo sapiens adrenergic, alpha-2A-, receptor (ADRA2A), mRNA gi|15718669|ref|NM—000681.2|[15718669]

[2648] 4065: NM—006179 Homo sapiens neurotrophin 5 (neurotrophin 4/5) (NTF5), mRNA gi|15718666|ref|NM—006179.2|[15718666]

[2649] 4066: L26458 Homo sapiens T-cell receptor mRNA, partial sequence gi|432477|gb|L26458.1|HUMEBSH[432477]

[2650] 4067: L26457 Homo sapiens T-cell receptor mRNA, partial sequence gi|432476|gb|L26457.1|HUMEBSG[432476]

[2651] 4068: L26456 Homo sapiens T-cell receptor mRNA, partial sequence gi|432475|gb|L26456.1|HUMEBSF[432475]

[2652] 4069: L26455 Homo sapiens T-cell receptor mRNA, partial sequence gi|432474|gb|L26455.1|HUMEBSE[432474]

[2653] 4070: L26454 Homo sapiens T-cell receptor mRNA, partial sequence gi|432473|gb|L26454.1|HUMEBSD[432473]

[2654] 4071: L26453 Homo sapiens T-cell receptor mRNA, partial sequence gi|432472|gb|L26453.1|HUMEBSC[432472]

[2655] 4072: L26452 Homo sapiens T-cell receptor mRNA, partial sequence gi|432471|gb|L26452.1|HUMEBSB[432471]

[2656] 4073: L26451 Homo sapiens T-cell receptor mRNA, partial sequence gi|432470|gb|L26451.1|HUMEBSA[432470]

[2657] 4074: AH009839 Homo sapiens HVEC cell-cell adhesion molecule/herpesvirus receptor (HVEC) gene, partial cds, alternatively spliced gi|15706245|gb|AH009839.2|[15706245]

[2658] 4075: AJ301610 Homo sapiens mRNA for GluR6 kainate receptor (GRIK2 gene), isoform-b gi|15485591|emb|AJ301610.1|HSA301610[15485591]

[2659] 4076: AJ301609 Homo sapiens partial mRNA for GluR6 kainate receptor (GRIK2 gene), exons 10, and 13 gi|15485589|emb|AJ301609.1|HSA301609[15485589]

[2660] 4077: AJ301608 Homo sapiens partial mRNA for GluR6 kainate receptor (GRIK2 gene), exons 11, and 14 gi|15485587|emb|AJ301608.1|HSA301608[15485587]

[2661] 4078: AF196774 Homo sapiens HVEC cell-cell adhesion molecule/herpesvirus receptor (HVEC) gene, exon 8 and partial cds, alternatively spliced gi|10312084|gb|AF196774.1|AH009839S8[10312084]

[2662] 4079: AF196773 Homo sapiens HVEC cell-cell adhesion molecule/herpesvirus receptor (HVEC) gene, exon 7 gi|10312083|gb|AF196773.1|AH009839S7[10312083]

[2663] 4080: AF196772 Homo sapiens HVEC cell-cell adhesion molecule/herpesvirus receptor (HVEC) gene, exon 6 gi|10312082|gb|AF196772.1|AH009839S6[10312082]

[2664] 4081: AF252867 Homo sapiens HVEC cell-cell adhesion molecule/herpesvirus receptor (HVEC) gene, exon 6A and partial cds, alternatively spliced gi|10312081|gb|AF252867.1|AH009839S5[10312081]

[2665] 4082: AF196771 Homo sapiens HVEC cell-cell adhesion molecule/herpesvirus receptor (HVEC) gene, exon 5 gi|10312080|gb|AF196771.1|AH009839S4[10312080]

[2666] 4083: AF196770 Homo sapiens HVEC cell-cell adhesion molecule/herpesvirus receptor (HVEC) gene, exon 4 gi|10312079|gb|AF196770.1|AH009839S3[10312079]

[2667] 4084: AF196769 Homo sapiens HVEC cell-cell adhesion molecule/herpesvirus receptor (HVEC) gene, exon 3 gi|10312078|gb|AF196769.1|AH009839S2[10312078]

[2668] 4085: AF196768 Homo sapiens HVEC cell-cell adhesion molecule/herpesvirus receptor (HVEC) gene, exon 2 gi|10312077|gb|AF196768.1|AH009839S1[10312077]

[2669] 4086: AF399937 Homo sapiens melanin-concentrating hormone receptor MCH-R2 mRNA, complete cds gi|15667842|gb|AF399937.1|AF399937[15667842]

[2670] 4087: NM—032405 Homo sapiens transmembrane protease, serine 3 (TMPRSS3), transcript variant D, mRNA gi|14602456|ref|NM—032405.1|[14602456]

[2671] 4088: NM—032404 Homo sapiens transmembrane protease, serine 3 (TMPRSS3), transcript variant C, mRNA gi|14602454|ref|NM—032404.1|[14602454]

[2672] 4089: NM—032401 Homo sapiens transmembrane protease, serine 3 (TMPRSS3), transcript variant B, mRNA gi|14602452|ref|NM—032401.1|[14602452]

[2673] 4090: NM—024022 Homo sapiens transmembrane protease, serine 3 (TMPRSS3), transcript variant A, mRNA gi|13173470|ref|NM—024022.1|[13173470]

[2674] 4091: AY046418 Homo sapiens brain immunoglobulin receptor precursor, mRNA, complete cds gi|15636797|gb|AY046418.1|[15636797]

[2675] 4092: AF069333 Homo sapiens insulin-like growth factor II receptor (IGF2R) gene, partial cds gi|15628184|gb|AF069333.2|AF069333[15628184]

[2676] 4093: AY029541 Homo sapiens putative G protein-coupled receptor mRNA, complete cds gi|15626067|gb|AY029541.1|[15626067]

[2677] 4094: AF117819 Homo sapiens bradykinin B1 receptor mRNA, partial cds and 3′-untranslated region gi|4325046|gb|AF117819.1|AF117819[4325046]

[2678] 4095: NM—004624 Homo sapiens vasoactive intestinal peptide receptor 1 (VIPR1), mRNA gi|15619005|ref|NM—004624.2|[15619005]

[2679] 4096: AY042216 Homo sapiens G protein-coupled receptor (MRGX4) gene, complete cds gi|15546067|gb|AY042216.1|[15546067]

[2680] 4097: AY042215 Homo sapiens G protein-coupled receptor (MRGX3) gene, complete cds gi|15546065|gb|AY042215.1|[15546065]

[2681] 4098: AY042214 Homo sapiens G protein-coupled receptor (MRGX2) gene, complete cds gi|15546063|gb|AY042214.1|[15546063]

[2682] 4099: AY042213 Homo sapiens G protein-coupled receptor (MRGX1) gene, complete cds gi|15546061|gb|AY042213.1|[15546061]

[2683] 4100: Y11395 Homo sapiens mRNA for lanthionine synthetase C-like protein 1 (LANCL1 gene) gi|2894085|emb|Y11395.1|HSRNAP40[2894085]

[2684] 4101: BC014108 Homo sapiens, Fc fragment of IgE, low affinity II, receptor for (CD23A), clone MGC:20696 IMAGE:4309266, mRNA, complete cds gi|15559484|gb|BC014108.1|BC014108[15559484]

[2685] 4102: AF306329 Homo sapiens neuronal nicotinic acetylcholine receptor beta 4 subunit (CHRNB4) gene, exon 6 and complete cds gi|15558964|gb|AF306329.1|AF306325S5[15558964]

[2686] 4103: AF306328 Homo sapiens neuronal nicotinic acetylcholine receptor beta 4 subunit (CHRNB4) gene, exon 5 gi|15558963|gb|AF306328.1|AF306325S4[15558963]

[2687] 4104: AF306327 Homo sapiens neuronal nicotinic acetylcholine receptor beta 4 subunit (CHRNB4) gene, exons 3, 4, and 4a, alternatively spliced gi|15558962|gb|AF306327.1|AF306325S3[15558962]

[2688] 4105: AF306326 Homo sapiens neuronal nicotinic acetylcholine receptor beta 4 subunit (CHRNB4) gene, exon 2 gi|15558961|gb|AF306326.1|AF306325S2[15558961]

[2689] 4106: AF306325 Homo sapiens neuronal nicotinic acetylcholine receptor beta 4 subunit (CHRNB4) gene, exon 1 gi|15558960|gb|AF306325.1|AF306325S1[15558960]

[2690] 4107: AH011061 Homo sapiens neuronal nicotinic acetylcholine receptor beta 4 subunit (CHRNB4) gene, complete cds gi|15558959|gb|AH011061.1|SEG_AF306325S[15558959]

[2691] 4108: AJ316282 Homo sapiens partial TCRB gene for T cell receptor beta chain, allele TCRBV1J2S3, isolate P15SF, clone 9 gi|15558855|emb|AJ316282.1|HSA316282[15558855]

[2692] 4109: AJ316281 Homo sapiens partial TCRB gene for T cell receptor beta chain, allele TCRBV1J2S3, patient P22SF, clone 3 gi|15558853|emb|AJ316281.1|HSA316281[15558853]

[2693] 4110: AJ316280 Homo sapiens partial TCRB gene for T cell receptor beta chain, allele TCRBVlJ2S3, patient P14SF, clone 1 gi|15558851|emb|AJ316280.1|HSA316280[15558851]

[2694] 4111: NM—001954 Homo sapiens discoidin domain receptor family, member 1 (DDR1), transcript variant 2, mRNA gi|7669486|ref|NM—001954.2|[7669486]

[2695] 4112: NM—013994 Homo sapiens discoidin domain receptor family, member 1 (DDR1), transcript variant 3, mRNA gi|7669484|ref|NM—013994.1|[7669484]

[2696] 4113: NM—013993 Homo sapiens discoidin domain receptor family, member 1 (DDR1), transcript variant 1, mRNA gi|7669482|ref|NM—013993.1|[7669482]

[2697] 4114: AF325356 Homo sapiens histamine receptor H4 (AXOR35) mRNA, complete cds gi|15553202|gb|AF325356.1|AF325356[15553202]

[2698] 4115: AF349574 Homo sapiens interleukin 12 receptor beta 2 (IL12RB2) gene, partial sequence gi|15088551|gb|AF349574.1|AF349574[15088551]

[2699] 4116: NM—014395 Homo sapiens dual adaptor of phosphotyrosine and 3-phosphoinositides (DAPP1), mRNA gi|7657006|ref|NM—014395.1|[7657006]

[2700] 4117: AY043466 Homo sapiens Fc receptor-like protein 3 (FCRH3) mRNA, complete cds gi|15528834|gb|AY043466.1|[15528834]

[2701] 4118: AY043465 Homo sapiens Fc receptor-like protein 2 (FCRH2) mRNA, complete cds gi|15528832|gb|AY043465.1|[15528832]

[2702] 4119: AY043464 Homo sapiens Fc receptor-like protein 1 (FCRH1) mRNA, complete cds gi|15528830|gb|AY043464.1|[15528830]

[2703] 4120: AJ344350 Homo sapiens partial IGDH3-9 gene segment, isolate case6-cell520 gi|15528515|emb|AJ344350.1|HSA344350[15528515]

[2704] 4121: AJ344349 Homo sapiens partial IGDH3-9 gene segment, isolate case5-cell49 gi|15528514|emb|AJ344349.1|HSA344349[15528514]

[2705] 4122: AJ344348 Homo sapiens partial IGDH6-25 gene segment, isolate case4-cell89 gi|15528513|emb|AJ344348.1|HSA344348[15528513]

[2706] 4125: NM—033135 Homo sapiens spinal cord-derived growth factor-B (SCDGF-B), transcript variant 2, mRNA gi|15451920|ref|NM—033135.1|[15451920]

[2707] 4126: NM—025208 Homo sapiens spinal cord-derived growth factor-B (SCDGF-B), transcript variant 1, mRNA gi|15451919|ref|NM—025208.2|[15451919]

[2708] 4127: NM—033346 Homo sapiens bone morphogenetic protein receptor, type II (serine/threonine kinase) (BMPR2), transcript variant 2, mRNA gi|15451917|ref|NM—033346.1|[15451917]

[2709] 4128: NM—001204 Homo sapiens bone morphogenetic protein receptor, type II (serine/threonine kinase) (BMPR2), transcript variant 1, mRNA gi|15451915|ref|NM—001204.3|[15451915]

[2710] 4129: NM—003933 Homo sapiens BAI1-associated protein 3 (BAIAP3), mRNA gi|15451913|ref|NM—003933.3|[15451913]

[2711] 4130: NM—002006 Homo sapiens fibroblast growth factor 2 (basic) (FGF2), mRNA gi|15451897|ref|NM—002006.2|[15451897]

[2712] 4131: NM—000647 Homo sapiens chemokine (C-C motif) receptor 2 (CCR2), transcript variant A, mRNA gi|15451896|ref|NM—000647.3|[15451896]

[2713] 4132: NM—004631 Homo sapiens low density lipoprotein receptor-related protein 8, apolipoprotein e receptor (LRP8), transcript variant 1, mRNA gi|15451869|ref|NM—004631.2|[15451869]

[2714] 4133: NM—033300 Homo sapiens low density lipoprotein receptor-related protein 8, apolipoprotein e receptor (LRP8), transcript variant 2, mRNA gi|15451867|ref|NM—033300.1|[15451867]

[2715] 4134: NM—017522 Homo sapiens low density lipoprotein receptor-related protein 8, apolipoprotein e receptor (LRP8), transcript variant 3, mRNA gi|15451865|ref|NM—017522.2|[15451865]

[2716] 4135: NM—033337 Homo sapiens caveolin 3 (CAV3), transcript variant 1, mRNA gi|15451859|ref|NM—033337.1|[15451859]

[2717] 4136: NM—001234 Homo sapiens caveolin 3 (CAV3), transcript variant 2, mRNA gi|15451858|ref|NM—001234.3|[15451858]

[2718] 4137: NM—002609 Homo sapiens platelet-derived growth factor receptor, beta polypeptide (PDGFRB), mRNA gi|15451788|ref|NM—002609.2|[15451788]

[2719] 4138: NM—006206 Homo sapiens platelet-derived growth factor receptor, alpha polypeptide (PDGFRA), mRNA gi|15451787|ref|NM—006206.2|[15451787]

[2720] 4139: NM—000679 Homo sapiens adrenergic, alpha-1B-, receptor (ADRA1B), mRNA gi|15451783|ref|NM—000679.2|[15451783]

[2721] 4140: AY026771 Homo sapiens lectin-like receptor 1C (DECTIN1) mRNA, complete cds, alternatively spliced gi|14278822|gb|AY026771.1|[14278822]

[2722] 4142: NM—000648 Homo sapiens chemokine (C-C motif) receptor 2 (CCR2), transcript variant B, mRNA gi|4757937|ref|NM—000648.1|[4757937]

[2723] 4143: AB041403 Homo sapiens HTR1A gene for serotonin receptor 1A, complete cds gi|7592996|dbj|AB041403.1|AB041403[7592996]

[2724] 4144: NM—015722 Homo sapiens calcyon; D1 dopamine receptor-interacting protein (CALCYON), mRNA gi|9257200|ref|NM—015722.2|[9257200]

[2725] 4145: AY044429 Homo sapiens class II cytokine receptor (IL22RA2) mRNA, complete cds gi|15419022|gb|AY044429.1|[15419022]

[2726] 4148: AJ306388 Homo sapiens mRNA for NTB-A receptor (KALI b gene) gi|15384842|emb|AJ306388.1|HSA306388[15384842]

[2727] 4149: AJ277141 Homo sapiens mRNA for activating NK receptor (KALI gene) gi|15384840|emb|AJ277141.1|HSA277141[15384840]

[2728] 4150: NM—033199 Homo sapiens stresscopin-related peptide (SRP), mRNA gi|15082239|ref|NM—033199.1|[15082239]

[2729] 4151: AB052684 Homo sapiens mRNA for Gi-coupled ADP receptor HORK3, complete cds gi|14422409|dbj|AB052684.1|AB052684[14422409]

[2730] 4152: AF227732 Homo sapiens nicotinic acetylcholine receptor alpha 9 subunit mRNA, partial cds gi|7407124|gb|AF227732.1|AF227732[7407124]

[2731] 4153: NM—005849 Homo sapiens immunoglobulin superfamily, member 6 (IGSF6), mRNA gi|5031672|ref|NM—005849.1|[5031672]

[2732] 4154: AF317654 Homo sapiens G protein-coupled receptor (GPR63) gene, complete cds gi|15321723|gb|AF317654.2|AF317654[15321723]

[2733] 4155: AF399637 Homo sapiens clone OR5B16 olfactory receptor gene, partial cds gi|15293858|gb|AF399637.1|AF399637[15293858]

[2734] 4156: AF399636 Homo sapiens clone OR5B2 olfactory receptor gene, partial cds gi|15293856|gb|AF399636.1|AF399636[15293856]

[2735] 4157: AF399635 Homo sapiens clone OR5AU1 olfactory receptor gene, partial cds gi|15293854|gb|AF399635.1|AF399635[15293854]

[2736] 4158: AF399634 Homo sapiens clone OR10A3 olfactory receptor gene, partial cds gi|15293852|gb|AF399634.1|AF399634[15293852]

[2737] 4159: AF399633 Homo sapiens clone OR13H1 olfactory receptor gene, partial cds gi|15293850|gb|AF399633.1|AF399633[15293850]

[2738] 4160: AF399632 Homo sapiens clone OR2B3 olfactory receptor gene, partial cds gi|15293848|gb|AF399632.1|AF399632[15293848]

[2739] 4161: AF399631 Homo sapiens clone OR2H2 olfactory receptor gene, partial cds gi|15293846|gb|AF399631.1|AF399631[15293846]

[2740] 4162: AF399630 Homo sapiens clone OR2J3 olfactory receptor gene, partial cds gi|15293844|gb|AF399630.1|AF399630[15293844]

[2741] 4163: AF399629 Homo sapiens clone OR2Y1 olfactory receptor gene, partial cds gi|15293842|gb|AF399629.1|AF399629[15293842]

[2742] 4164: AF399628 Homo sapiens clone OR2W1 olfactory receptor gene, partial cds gi|15293840|gb|AF399628.1|AF399628[15293840]

[2743] 4165: AF399627 Homo sapiens clone OR10C2 olfactory receptor gene, partial cds gi|15293838|gb|AF399627.1|AF399627[15293838]

[2744] 4166: AF399626 Homo sapiens clone OR10A7 olfactory receptor gene, partial cds gi|15293836|gb|AF399626.1|AF399626[15293836]

[2745] 4167: AF399625 Homo sapiens clone OR10A4 olfactory receptor gene, partial cds gi|15293834|gb|AF399625.1|AF399625[15293834]

[2746] 4168: AF399624 Homo sapiens clone OR10A1 olfactory receptor gene, partial cds gi|15293832|gb|AF399624.1|AF399624[15293832]

[2747] 4169: AF399623 Homo sapiens clone OR10A5 olfactory receptor gene, partial cds gi|15293830|gb|AF399623.1|AF399623[15293830]

[2748] 4170: AF399622 Homo sapiens clone OR1K1 olfactory receptor gene, partial cds gi|15293828|gb|AF399622.1|AF399622[15293828]

[2749] 4171: AF399621 Homo sapiens clone OR3A4 olfactory receptor gene, partial cds gi|15293826|gb|AF399621.1|AF399621[15293826]

[2750] 4172: AF399620 Homo sapiens clone OR3A3 olfactory receptor gene, partial cds gi|15293824|gb|AF399620.1|AF399620[15293824]

[2751] 4173: AF399619 Homo sapiens clone OR2Z2 olfactory receptor gene, partial cds gi|15293822|gb|AF399619.1|AF399619[15293822]

[2752] 4174: AF399618 Homo sapiens clone OR2AG1 olfactory receptor gene, partial cds gi|15293820|gb|AF399618.1|AF399618[15293820]

[2753] 4175: AF399617 Homo sapiens clone OR2M4 olfactory receptor gene, partial cds gi|15293818|gb|AF399617.1|AF399617[15293818]

[2754] 4176: AF399616 Homo sapiens clone OR2M2 olfactory receptor gene, partial cds gi|15293816|gb|AF399616.1|AF399616[15293816]

[2755] 4177: AF399615 Homo sapiens clone OR2M1 olfactory receptor gene, partial cds gi|15293814|gb|AF399615.1|AF399615[15293814]

[2756] 4178: AF399614 Homo sapiens clone OR2V2 olfactory receptor gene, partial cds gi|15293812|gb|AF399614.1|AF399614[15293812]

[2757] 4179: AF399613 Homo sapiens clone OR2T1 olfactory receptor gene, partial cds gi|15293810|gb|AF399613.1|AF399613[15293810]

[2758] 4180: AF399612 Homo sapiens clone OR2T3 olfactory receptor gene, partial cds gi|15293808|gb|AF399612.1|AF399612[15293808]

[2759] 4181: AF399611 Homo sapiens clone OR11H1 olfactory receptor gene, partial cds gi|15293806|gb|AF399611.1|AF399611[15293806]

[2760] 4182: AF399610 Homo sapiens clone OR11G2 olfactory receptor gene, partial cds gi|15293804|gb|AF399610.1|AF399610[15293804]

[2761] 4183: AF399609 Homo sapiens clone OR6Q1 olfactory receptor gene, partial cds gi|15293802|gb|AF399609.1|AF399609[15293802]

[2762] 4184: AF399608 Homo sapiens clone OR6N1 olfactory receptor gene, partial cds gi|15293800|gb|AF399608.1|AF399608[15293800]

[2763] 4185: AF399607 Homo sapiens clone OR6W1 olfactory receptor gene, partial cds gi|15293798|gb|AF399607.1|AF399607[15293798]

[2764] 4186: AF399606 Homo sapiens clone OR6M1 olfactory receptor gene, partial cds gi|15293796|gb|AF399606.1|AF399606[15293796]

[2765] 4187: AF399605 Homo sapiens clone OR6B1 olfactory receptor gene, partial cds gi|15293794|gb|AF399605.1|AF399605[15293794]

[2766] 4188: AF399604 Homo sapiens clone OR6F1 olfactory receptor gene, partial cds gi|15293792|gb|AF399604.1|AF399604[15293792]

[2767] 4189: AF399603 Homo sapiens clone OR13J1 olfactory receptor gene, partial cds gi|15293790|gb|AF399603.1|AF399603[15293790]

[2768] 4190: AF399602 Homo sapiens clone OR13C4 olfactory receptor gene, partial cds gi|15293788|gb|AF399602.1|AF399602[15293788]

[2769] 4191: AF399601 Homo sapiens clone OR2S2 olfactory receptor gene, partial cds gi|15293786|gb|AF399601.1|AF399601[15293786]

[2770] 4192: AF399600 Homo sapiens clone OR13C7 olfactory receptor gene, partial cds gi|15293784|gb|AF399600.1|AF399600[15293784]

[2771] 4193: AF399599 Homo sapiens clone OR13C8 olfactory receptor gene, partial cds gi|15293782|gb|AF399599.1|AF399599[15293782]

[2772] 4194: AF399598 Homo sapiens clone OR2A7 olfactory receptor gene, partial cds gi|15293780|gb|AF399598.1|AF399598[15293780]

[2773] 4195: AF399597 Homo sapiens clone OR2A1 olfactory receptor gene, partial cds gi|15293778|gb|AF399597.1|AF399597[15293778]

[2774] 4196: AF399596 Homo sapiens clone OR2A6 olfactory receptor gene, partial cds gi|15293776|gb|AF399596.1|AF399596[15293776]

[2775] 4197: AF399595 Homo sapiens clone OR2A5 olfactory receptor gene, partial cds gi|15293774|gb|AF399595.1|AF399595[15293774]

[2776] 4198: AF399594 Homo sapiens clone OR2F1 olfactory receptor gene, partial cds gi|15293772|gb|AF399594.1|AF399594[15293772]

[2777] 4199: AF399593 Homo sapiens clone OR10V1 olfactory receptor gene, partial cds gi|15293770|gb|AF399593.1|AF399593[15293770]

[2778] 4200: AF399592 Homo sapiens clone OR2D3 olfactory receptor gene, partial cds gi|15293768|gb|AF399592.1|AF399592[15293768]

[2779] 4201: AF399591 Homo sapiens clone OR2D2 olfactory receptor gene, partial cds gi|15293766|gb|AF399591.1|AF399591[15293766]

[2780] 4202: AF399590 Homo sapiens clone OR5AY1 olfactory receptor gene, partial cds gi|15293764|gb|AF399590.1|AF399590[15293764]

[2781] 4203: AF399589 Homo sapiens clone OR5AX1 olfactory receptor gene, partial cds gi|15293762|gb|AF399589.1|AF399589[15293762]

[2782] 4204: AF399588 Homo sapiens clone OR10J6 olfactory receptor gene, partial cds gi|15293760|gb|AF399588.1|AF399588[15293760]

[2783] 4205: AF399587 Homo sapiens clone OR10J1 olfactory receptor gene, partial cds gi|15293758|gb|AF399587.1|AF399587[15293758]

[2784] 4206: AF399586 Homo sapiens clone OR10H4 olfactory receptor gene, partial cds gi|15293756|gb|AF399586.1|AF399586[15293756]

[2785] 4207: AF399585 Homo sapiens clone OR10H2 olfactory receptor gene, partial cds gi|15293754|gb|AF399585.1|AF399585[15293754]

[2786] 4208: AF399584 Homo sapiens clone OR10H1 olfactory receptor gene, partial cds gi|15293752|gb|AF399584.1|AF399584[15293752]

[2787] 4209: AF399583 Homo sapiens clone OR10H5 olfactory receptor gene, partial cds gi|15293750|gb|AF399583.1|AF399583[15293750]

[2788] 4210: AF399582 Homo sapiens clone OR10R2 olfactory receptor gene, partial cds gi|15293748|gb|AF399582.1|AF399582[15293748]

[2789] 4211: AF399581 Homo sapiens clone OR4E2 olfactory receptor gene, partial cds gi|15293746|gb|AF399581.1|AF399581[15293746]

[2790] 4212: AF399580 Homo sapiens clone OR4X2 olfactory receptor gene, partial cds gi|15293744|gb|AF399580.1|AF399580[15293744]

[2791] 4213: AF399579 Homo sapiens clone OR4B1 olfactory receptor gene, partial cds gi|15293742|gb|AF399579.1|AF399579[15293742]

[2792] 4214: AF399578 Homo sapiens clone OR4A15 olfactory receptor gene, partial cds gi|15293740|gb|AF399578.1|AF399578[15293740]

[2793] 4215: AF399577 Homo sapiens clone OR4A4 olfactory receptor gene, partial cds gi|15293738|gb|AF399577.1|AF399577[15293738]

[2794] 4216: AF399576 Homo sapiens clone OR4C12 olfactory receptor gene, partial cds gi|15293736|gb|AF399576.1|AF399576[15293736]

[2795] 4217: AF399575 Homo sapiens clone OR4C13 olfactory receptor gene, partial cds gi|15293734|gb|AF399575.1|AF399575[15293734]

[2796] 4218: AF399574 Homo sapiens clone OR4F4 olfactory receptor gene, partial cds gi|15293732|gb|AF399574.1|AF399574[15293732]

[2797] 4219: AF399573 Homo sapiens clone OR4F15 olfactory receptor gene, partial cds gi|15293730|gb|AF399573.1|AF399573[15293730]

[2798] 4220: AF399572 Homo sapiens clone OR4K14 olfactory receptor gene, partial cds gi|15293728|gb|AF399572.1|AF399572[15293728]

[2799] 4221: AF399571 Homo sapiens clone OR4K3 olfactory receptor gene, partial cds gi|15293726|gb|AF399571.1|AF399571[15293726]

[2800] 4222: AF399570 Homo sapiens clone OR4K1 olfactory receptor gene, partial cds gi|15293724|gb|AF399570.1|AF399570[15293724]

[2801] 4223: AF399569 Homo sapiens clone OR4D6 olfactory receptor gene, partial cds gi|15293722|gb|AF399569.1|AF399569[15293722]

[2802] 4224: AF399568 Homo sapiens clone OR4D2 olfactory receptor gene, partial cds gi|15293720|gb|AF399568.1|AF399568[15293720]

[2803] 4225: AF399567 Homo sapiens clone OR4D1 olfactory receptor gene, partial cds gi|15293718|gb|AF399567.1|AF399567[15293718]

[2804] 4226: AF399566 Homo sapiens clone OR10G3 olfactory receptor gene, partial cds gi|15293716|gb|AF399566.1|AF399566[15293716]

[2805] 4227: AF399565 Homo sapiens clone OR10S1 olfactory receptor gene, partial cds gi|15293714|gb|AF399565.1|AF399565[15293714]

[2806] 4228: AF399564 Homo sapiens clone OR1L8 olfactory receptor gene, partial cds gi|15293712|gb|AF399564.1|AF399564[15293712]

[2807] 4229: AF399563 Homo sapiens clone OR1L6 olfactory receptor gene, partial cds gi|15293710|gb|AF399563.1|AF399563[15293710]

[2808] 4230: AF399562 Homo sapiens clone OR1L4 olfactory receptor gene, partial cds gi|15293708|gb|AF399562.1|AF399562[15293708]

[2809] 4231: AF399561 Homo sapiens clone OR1Q1 olfactory receptor gene, partial cds gi|15293706|gb|AF399561.1|AF399561[15293706]

[2810] 4232: AF399560 Homo sapiens clone OR1C1 olfactory receptor gene, partial cds gi|15293704|gb|AF399560.1|AF399560[15293704]

[2811] 4233: AF399559 Homo sapiens clone OR1F1 olfactory receptor gene, partial cds gi|15293702|gb|AF399559.1|AF399559[15293702]

[2812] 4234: AF399558 Homo sapiens clone OR1F2 olfactory receptor gene, partial cds gi|15293700|gb|AF399558.1|AF399558[15293700]

[2813] 4235: AF399557 Homo sapiens clone OR1S2 olfactory receptor gene, partial cds gi|15293698|gb|AF399557.1|AF399557[15293698]

[2814] 4236: AF399556 Homo sapiens clone OR1A2 olfactory receptor gene, partial cds gi|15293696|gb|AF399556.1|AF399556[15293696]

[2815] 4237: AF399555 Homo sapiens clone OR1A1 olfactory receptor gene, partial cds gi|15293694|gb|AF399555.1|AF399555[15293694]

[2816] 4238: AF399554 Homo sapiens clone OR1J1 olfactory receptor gene, partial cds gi|15293692|gb|AF399554.1|AF399554[15293692]

[2817] 4239: AF399553 Homo sapiens clone OR1J4 olfactory receptor gene, partial cds gi|15293690|gb|AF399553.1|AF399553[15293690]

[2818] 4240: AF399552 Homo sapiens clone OR1J2 olfactory receptor gene, partial cds gi|15293688|gb|AF399552.1|AF399552[15293688]

[2819] 4241: AF399551 Homo sapiens clone OR1E2 olfactory receptor gene, partial cds gi|15293686|gb|AF399551.1|AF399551[15293686]

[2820] 4242: AF399550 Homo sapiens clone OR1E1 olfactory receptor gene, partial cds gi|15293684|gb|AF399550.1|AF399550[15293684]

[2821] 4243: AF399549 Homo sapiens clone OR1M1 olfactory receptor gene, partial cds gi|15293682|gb|AF399549.1|AF399549[15293682]

[2822] 4244: AF399548 Homo sapiens clone OR1I1 olfactory receptor gene, partial cds gi|15293680|gb|AF399548.1|AF399548[15293680]

[2823] 4245: AF399547 Homo sapiens clone OR1N3 olfactory receptor gene, partial cds gi|15293678|gb|AF399547.1|AF399547[15293678]

[2824] 4246: AF399546 Homo sapiens clone OR7C1 olfactory receptor gene, partial cds gi|15293676|gb|AF399546.1|AF399546[15293676]

[2825] 4247: AF399545 Homo sapiens clone OR7C2 olfactory receptor gene, partial cds gi|15293674|gb|AF399545.1|AF399545[15293674]

[2826] 4248: AF399544 Homo sapiens clone OR7A2 olfactory receptor gene, partial cds gi|15293672|gb|AF399544.1|AF399544[15293672]

[2827] 4249: AF399543 Homo sapiens clone OR7A5 olfactory receptor gene, partial cds gi|15293670|gb|AF399543.1|AF399543[15293670]

[2828] 4250: AF399542 Homo sapiens clone OR7A10 olfactory receptor gene, partial cds gi|15293668|gb|AF399542.1|AF399542[15293668]

[2829] 4251: AF399541 Homo sapiens clone OR7A17 olfactory receptor gene, partial cds gi|15293666|gb|AF399541.1|AF399541[15293666]

[2830] 4252: AF399540 Homo sapiens clone OR7G3 olfactory receptor gene, partial cds gi|15293664|gb|AF399540.1|AF399540[15293664]

[2831] 4253: AF399539 Homo sapiens clone OR7G2 olfactory receptor gene, partial cds gi|15293662|gb|AF399539.1|AF399539[15293662]

[2832] 4254: AF399538 Homo sapiens clone OR7G1 olfactory receptor gene, partial cds gi|15293660|gb|AF399538.1|AF399538[15293660]

[2833] 4255: AF399537 Homo sapiens clone OR7D2 olfactory receptor gene, partial cds gi|15293658|gb|AF399537.1|AF399537[15293658]

[2834] 4256: AF399536 Homo sapiens clone OR1N2 olfactory receptor gene, partial cds gi|15293656|gb|AF399536.1|AF399536[15293656]

[2835] 4257: AF399535 Homo sapiens clone OR1D2 olfactory receptor gene, partial cds gi|15293654|gb|AF399535.1|AF399535[15293654]

[2836] 4258: AF399534 Homo sapiens clone OR1D4 olfactory receptor gene, partial cds gi|15293652|gb|AF399534.1|AF399534[15293652]

[2837] 4259: AF399533 Homo sapiens clone OR1D5 olfactory receptor gene, partial cds gi|15293650|gb|AF399533.1|AF399533[15293650]

[2838] 4260: AF399532 Homo sapiens clone OR9Q1 olfactory receptor gene, partial cds gi|15293648|gb|AF399532.1|AF399532[15293648]

[2839] 4261: AF399531 Homo sapiens clone OR9I1 olfactory receptor gene, partial cds gi|15293646|gb|AF399531.1|AF399531[15293646]

[2840] 4262: AF399530 Homo sapiens clone OR9G4 olfactory receptor gene, partial cds gi|15293644|gb|AF399530.1|AF399530[15293644]

[2841] 4263: AF399529 Homo sapiens clone OR5A2 olfactory receptor gene, partial cds gi|15293642|gb|AF399529.1|AF399529[15293642]

[2842] 4264: AF399528 Homo sapiens clone OR5A1 olfactory receptor gene, partial cds gi|15293640|gb|AF399528.1|AF399528[15293640]

[2843] 4265: AF399527 Homo sapiens clone OR5F1 olfactory receptor gene, partial cds gi|15293638|gb|AF399527.1|AF399527[15293638]

[2844] 4266: AF399526 Homo sapiens clone OR5L2 olfactory receptor gene, partial cds gi|15293636|gb|AF399526.1|AF399526[15293636]

[2845] 4267: AF399525 Homo sapiens clone OR5D18 olfactory receptor gene, partial cds gi|15293634|gb|AF399525.1|AF399525[15293634]

[2846] 4268: AF399524 Homo sapiens clone OR5D16 olfactory receptor gene, partial cds gi|15293632|gb|AF399524.1|AF399524[15293632]

[2847] 4269: AF399523 Homo sapiens clone OR5D14 olfactory receptor gene, partial cds gi|15293630|gb|AF399523.1|AF399523[15293630]

[2848] 4270: AF399522 Homo sapiens clone OR5M1 olfactory receptor gene, partial cds gi|15293628|gb|AF399522.1|AF399522[15293628]

[2849] 4271: AF399521 Homo sapiens clone OR5M11 olfactory receptor gene, partial cds gi|15293626|gb|AF399521.1|AF399521[15293626]

[2850] 4272: AF399520 Homo sapiens clone OR5M8 olfactory receptor gene, partial cds gi|15293624|gb|AF399520.1|AF399520[15293624]

[2851] 4273: AF399519 Homo sapiens clone OR5M9 olfactory receptor gene, partial cds gi|15293622|gb|AF399519.1|AF399519[15293622]

[2852] 4274: AF399518 Homo sapiens clone OR5M3 olfactory receptor gene, partial cds gi|15293620|gb|AF399518.1|AF399518[15293620]

[2853] 4275: AF399517 Homo sapiens clone OR8K1 olfactory receptor gene, partial cds gi|15293618|gb|AF399517.1|AF399517[15293618]

[2854] 4276: AF399516 Homo sapiens clone OR8J3 olfactory receptor gene, partial cds gi|15293616|gb|AF399516.1|AF399516[15293616]

[2855] 4277: AF399515 Homo sapiens clone OR8J1 olfactory receptor gene, partial cds gi|15293614|gb|AF399515.1|AF399515[15293614]

[2856] 4278: AF399514 Homo sapiens clone OR5C1 olfactory receptor gene, partial cds gi|15293612|gb|AF399514.1|AF399514[15293612]

[2857] 4279: AF399513 Homo sapiens clone OR8I2 olfactory receptor gene, partial cds gi|15293610|gb|AF399513.1|AF399513[15293610]

[2858] 4280: AF399512 Homo sapiens clone OR8A1 olfactory receptor gene, partial cds gi|15293608|gb|AF399512.1|AF399512[15293608]

[2859] 4281: AF399511 Homo sapiens clone OR8B12 olfactory receptor gene, partial cds gi|15293606|gb|AF399511.1|AF399511[15293606]

[2860] 4282: AF399510 Homo sapiens clone OR8B8 olfactory receptor gene, partial cds gi|15293604|gb|AF399510.1|AF399510[15293604]

[2861] 4283: AF399509 Homo sapiens clone OR8B4 olfactory receptor gene, partial cds gi|15293602|gb|AF399509.1|AF399509[15293602]

[2862] 4284: AF399508 Homo sapiens clone OR8B2 olfactory receptor gene, partial cds gi|15293600|gb|AF399508.1|AF399508[15293600]

[2863] 4285: AF399507 Homo sapiens clone OR8G1 olfactory receptor gene, partial cds gi|15293598|gb|AF399507.1|AF399507[15293598]

[2864] 4286: AF399506 Homo sapiens clone OR6C1 olfactory receptor gene, partial cds gi|15293596|gb|AF399506.1|AF399506[15293596]

[2865] 4287: AF399505 Homo sapiens clone OR52B2 olfactory receptor gene, partial cds gi|15293594|gb|AF399505.1|AF399505[15293594]

[2866] 4288: AF399504 Homo sapiens clone OR52E6 olfactory receptor gene, partial cds gi|15293592|gb|AF399504.1|AF399504[15293592]

[2867] 4289: AF399503 Homo sapiens clone OR51B2 olfactory receptor gene, partial cds gi|15293590|gb|AF399503.1|AF399503[15293590]

[2868] 4290: AF244813 Homo sapiens platelet-derived growth factor C mRNA, complete cds gi|8886883|gb|AF244813.1|AF244813[8886883]

[2869] 4291: AF169650 Homo sapiens high mobility group 1 protein (HMG1) gene, exon 5 gi|14522864|gb|AF169650.1|AF169650[14522864]

[2870] 4451: AF330055 Homo sapiens neuropeptide NPVF receptor mRNA, complete cds gi|15281399|gb|AF330055.1|AF330055[15281399]

[2871] 4452: AF330053 Homo sapiens neuropeptide NPFF receptor mRNA, complete cds gi|15281395|gb|AF330053.1|AF330053[15281395]

[2872] 4453: AF402318 Homo sapiens differentiation-related DIF14 long form (DIF14) mRNA, complete cds, alternatively spliced gi|15278166|gb|AF402318.1|AF402318[15278166]

[2873] 4454: AF397453 Homo sapiens Fc receptor-like protein 5 (FCRH5) mRNA, complete cds gi|15277745|gb|AF397453.1|AF397453[15277745]

[2874] 4455: AF397452 Homo sapiens Fc receptor-like protein 4 (FCRH4) mRNA, complete cds gi|15277740|gb|AF397452.1|AF397452[15277740]

[2875] 4456: AF400441 Homo sapiens neurotrophic tyrosine kinase receptor type 2 (NTRK2) mRNA, complete cds gi|15217076|gb|AF400441.1|AF400441[15217076]

[2876] 4462: NM—020535 Homo sapiens killer cell immunoglobulin-like receptor, two domains, long cytoplasmic tail, 5 (KIR2DL5), mRNA gi|11968153|ref|NM—020535.1|[11968153]

[2877] 4463: AP000511 Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region, section 10/20 gi|5926698|dbj|AP000511.1|AP000511[5926698]

[2878] 4465: L20295 Homo sapiens vasoactive intestinal peptide receptor mRNA, partial cds gi|403461|gb|L20295.1|HUMVAIPR[403461]

[2879] 4466: AY040568 Homo sapiens interleukin 22-binding protein CRF2-10S (IL22BP) mRNA, complete cds, alternatively spliced gi|15212829|gb|AY040568.1|[15212829]

[2880] 4467: AY040567 Homo sapiens interleukin 22-binding protein CRF2-10L (IL22BP) mRNA, complete cds, alternatively spliced gi|15212827|gb|AY040567.1|[15212827]

[2881] 4468: AY040566 Homo sapiens interleukin 22-binding protein CRF2-10 (IL22BP) mRNA, complete cds gi|15212825|gb|AY040566.1|[15212825]

[2882] 4471: AX193708 Sequence 30 from Patent WO0136467 gi|15211557|emb|AX193708.1|AX193708[15211557]

[2883] 4472: AX193705 Sequence 27 from Patent WO0136467 gi|15211554|emb|AX193705.1|AX193705[15211554]

[2884] 4473: AX193702 Sequence 24 from Patent WO0136467 gi|15211551|emb|AX193702.1|AX193702[15211551]

[2885] 4474: AX193682 Sequence 4 from Patent WO0136467 gi|15211548|emb|AX193682.1|AX193682[15211548]

[2886] 4475: AX193679 Sequence 1 from Patent WO0136467 gi|15211545|emb|AX193679.1|AX193679[15211545]

[2887] 4476: NM—005675 Homo sapiens DiGeorge syndrome critical region gene 6 (DGCR6), mRNA gi|15208653|ref|NM—005675.2|[15208653]

[2888] 4477: NM—016083 Homo sapiens cannabinoid receptor 1 (brain) (CNR1), transcript variant 2, mRNA gi|15208646|ref|NM—016083.2|[15208646]

[2889] 4478: NM—016205 Homo sapiens platelet derived growth factor C (PDGFC), mRNA gi|9994186|ref|NM—016205.1|[9994186]

[2890] 4479: AF159056 Homo sapiens T-cell gamma receptor locus, complete sequence gi|5566238|gb|AF159056.1|AF159056[5566238]

[2891] 4480: NM—006207 Homo sapiens platelet-derived growth factor receptor-like (PDGFRL), mRNA gi|5453871|ref|NM—006207.1|[5453871]

[2892] 4481: NM—004986 Homo sapiens kinectin 1 (kinesin receptor) (KTN1), mRNA gi|4826813|ref|NM—004986.1|[4826813]

[2893] 4482: NM—001840 Homo sapiens cannabinoid receptor 1 (brain) (CNR1), transcript variant 1, mRNA gi|4502926|ref|NM—001840.1|[4502926]

[2894] 4483: NM—033223 Homo sapiens gamma-aminobutyric acid (GABA) A receptor, gamma 3 (GABRG3), mRNA gi|15193297|ref|NM—033223.1|[15193297]

[2895] 4484: AY008283 Homo sapiens porimin mRNA, complete cds gi|15192138|gb|AY008283.1|[15192138]

[2896] 4485: NM—015906 Homo sapiens tripartite motif-containing 33 (TRIM33), transcript variant alpha, mRNA gi|14971412|ref|NM—015906.2|[14971412]

[2897] 4486: NM—033020 Homo sapiens tripartite motif-containing 33 (TRIM33), transcript variant beta, mRNA gi|1497141051 ref|NM—033020.1|[14971410]

[2898] 4487: AH006431 Homo sapiens glycine receptor alpha 2 subunit, complete cds gi|3598700|gb|AH006431.1|SEG_HSGLRA2G[3598700]

[2899] 4488: AF053495 Homo sapiens glycine receptor alpha 2 subunit (GLRA2) gene, exon 9 and complete cds gi|3598699|gb|AF053495.1|HSGLRA2G9[3598699]

[2900] 4489: AF053494 Homo sapiens glycine receptor alpha 2 subunit (GLRA2) gene, exon 8 gi|3598698|gb|AF053494.1|HSGLRA2G8[3598698]

[2901] 4490: AF053493 Homo sapiens glycine receptor alpha 2 subunit (GLRA2) gene, exon 7 gi|3598697|gb|AF053493.1|HSGLRA2G7[3598697]

[2902] 4491: AF053492 Homo sapiens glycine receptor alpha 2 subunit (GLRA2) gene, exon 6 gi|3598696|gb|AF053492.1|HSGLRA2G6[3598696]

[2903] 4492: AF053491 Homo sapiens glycine receptor alpha 2 subunit (GLRA2) gene, exon 5 gi|3598695|gb|AF053491.1|HSGLRA2G5[3598695]

[2904] 4493: AF053490 Homo sapiens glycine receptor alpha 2 subunit (GLRA2) gene, exon 4 gi|3598694|gb|AF053490.1|HSGLRA2G4[3598694]

[2905] 4494: AF053489 Homo sapiens glycine receptor alpha 2 subunit (GLRA2) gene, exons 3a and 3b gi|3598693|gb|AF053489.1|HSGLRA2G3[3598693]

[2906] 4495: AF053488 Homo sapiens glycine receptor alpha 2 subunit (GLRA2) gene, exon 2 gi|3598692|gb|AF053488.1|HSGLRA2G2[3598692]

[2907] 4496: AF053487 Homo sapiens glycine receptor alpha 2 subunit (GLRA2) gene, exon 1 gi|3598691|gb|AF053487.1|HSGLRA2G1[3598691]

[2908] 4499: AF344654 Homo sapiens growth hormone receptor variant gene, partial cds gi|15186845|gb|AF344654.1|[15186845]

[2909] 4501: AF179680 Homo sapiens apelin gene, complete cds gi|6708145|gb|AF179680.1|AF179680[6708145]

[2910] 4502: AJ296652 Homo sapiens HRH3 gene for histamine h3 receptor, exons 1-3 gi|15149878|emb|AJ296652.1|HSA296652[15149878]

[2911] 4503: NM—006707 Homo sapiens butyrophilin-like 3 (BTNL3), mRNA gi|5729747|ref|NM—006707.1|[5729747]

[2912] 4504: NM—002009 Homo sapiens fibroblast growth factor 7 (keratinocyte growth factor) (FGF7), mRNA gi|15147344|ref|NM—002009.2|[15147344]

[2913] 4505: AF190501 Homo sapiens leucine-rich repeat-containing G protein-coupled receptor 6 (LGR6) mRNA, partial cds gi|10441731|gb|AF190501.1|AF190501[10441731]

[2914] 4506: AF190500 Homo sapiens leucine-rich repeat-containing G protein-coupled receptor 7 (LGR7) mRNA, complete cds gi|10441729|gb|AF190500.1|AF190500[10441729]

[2915] 4507: NM—016543 Homo sapiens sialic acid binding Ig-like lectin 7 (SIGLEC7), mRNA gi|7706570|ref|NM—016543.1|[7706570]

[2916] 4508: NM—014385 Homo sapiens sialic acid binding Ig-like lectin 7 (SIGLEC7), mRNA gi|7657569|ref|NM—014385.1|[7657569]

[2917] 4509: AC005153 Homo sapiens PAC clone RP4-537P9 from 7p11.2-p12, complete sequence gi|3242766|gb|AC005153.1|AC005153[3242766]

[2918] 4528: AJ309020 Homo sapiens mRNA for G protein-coupled receptor (AXOR12 gene) gi|14330412|emb|AJ309020.1|HSA309020[14330412]

[2919] 4529: AJ243297 Homo sapiens partial RET gene, exons 2 to 20 gi|5419752|emb|AJ243297.1|HSA243297[5419752]

[2920] 4530: X57019 H.sapiens mRNA for tyrosine kinase receptor gi|37592|emb|X57019.1|HSUF025[37592]

[2921] 4585: AF166361 Homo sapiens GABA receptor subunit alpha 3 (GABRA3) gene, exon 9 and complete cds gi|10086249|gb|AF166361.1|AF165901S9[10086249]

[2922] 4586: AF166360 Homo sapiens GABA receptor subunit alpha 3 (GABRA3) gene, exon 8 gi|10086248|gb|AF166360.1|AF165901S8[10086248]

[2923] 4587: AF166359 Homo sapiens GABA receptor subunit alpha 3 (GABRA3) gene, exon 7 gi|10086247|gb|AF166359.1|AF165901S7[10086247]

[2924] 4588: AF165906 Homo sapiens GABA receptor subunit alpha 3 (GABRA3) gene, exon 6 gi|10086246|gb|AF165906.1|AF165901S6[10086246]

[2925] 4589: AF165905 Homo sapiens GABA receptor subunit alpha 3 (GABRA3) gene, exon 5 gi|10086245|gb|AF165905.1|AF165901S5[10086245]

[2926] 4590: AF165904 Homo sapiens GABA receptor subunit alpha 3 (GABRA3) gene, exon 4 gi|10086244|gb|AF165904.1|AF165901S4[10086244]

[2927] 4591: AF165903 Homo sapiens GABA receptor subunit alpha 3 (GABRA3) gene, exon 3 gi|10086243|gb|AF165903.1|AF165901S3[10086243]

[2928] 4592: AF165902 Homo sapiens GABA receptor subunit alpha 3 (GABRA3) gene, exon 2 q gi|10086242|gb|AF165902.1|AF165901S2[10086242]

[2929] 4593: AF165901 Homo sapiens GABA receptor subunit alpha 3 (GABRA3) gene, exon 1 gi|10086241|gb|AF165901.1|AF1659011[10086241]

[2930] 4594: AH009803 Homo sapiens GABA receptor subunit alpha 3 (GABRA3) gene, complete cds gi|10086240|gb|AH009803.1|SEG_AF165901S[10086240]

[2931] 4595: AF167332 Homo sapiens glutamate receptor subunit 3 flip and flop isoforms (GRIA3) gene, exon 16 and partial cds, alternatively spliced gi|9738978|gb|AF167332.1|F166362S15[9738978]

[2932] 4596: AF166375 Homo sapiens glutamate receptor subunit 3 (GRIA3) gene, exon 15 gi|9738977|gb|AF166375.1|F166362S14[9738977]

[2933] 4597: AF166374 Homo sapiens glutamate receptor subunit 3 (GRIA3) gene, exon 14 gi|9738976|gb|AF166374.1|F166362S13[9738976]

[2934] 4598: AF166373 Homo sapiens glutamate receptor subunit 3 (GRIA3) gene, exon 13 gi|9738975|gb|AF166373.1|F166362S12[9738975]

[2935] 4599: AF166372 Homo sapiens glutamate receptor subunit 3 (GRIA3) gene, exon 12 gi|9738974|gb|AF166372.1|F166362S11[9738974]

[2936] 4600: AF166371 Homo sapiens glutamate receptor subunit 3 (GRIA3) gene, exon 11 gi|9738973|gb|AF166371.1|F166362S10[9738973]

[2937] 4601: AF166370 Homo sapiens glutamate receptor subunit 3 (GRIA3) gene, exon 10 gi|9738972|gb|AF166370.1|F166362S09[9738972]

[2938] 4602: AF166369 Homo sapiens glutamate receptor subunit 3 (GRIA3) gene, exon 9 gi|973897|gb|AF166369.1|F166362S08[9738971]

[2939] 4603: AF166368 Homo sapiens glutamate receptor subunit 3 (GRIA3) gene, exon 8 gi|9738970|gb|AF166368.1|F166362S07[9738970]

[2940] 4604: AF166367 Homo sapiens glutamate receptor subunit 3 (GRIA3) gene, exon 7 gi|9738969|gb|AF166367.1|F166362S06[9738969]

[2941] 4605: AF166366 Homo sapiens glutamate receptor subunit 3 (GRIA3) gene, exon 6 gi|9738968|gb|AF166366.1|F166362S05[9738968]

[2942] 4606: AF166365 Homo sapiens glutamate receptor subunit 3 flip and flop isoforms (GRIA3) gene, exon 4 and partial cds gi|9738967|gb|AF166365.1|F166362S04[9738967]

[2943] 4607: AF166364 Homo sapiens glutamate receptor subunit 3 (GRIA3) gene, exon 3 gi|9738966|gb|AF166364.1|F166362S03[9738966]

[2944] 4608: AF166363 Homo sapiens glutamate receptor subunit 3 (GRIA3) gene, exon 2 gi|9738965|gb|AF166363.1|F166362S02[9738965]

[2945] 4609: AF166362 Homo sapiens glutamate receptor subunit 3 (GRIA3) gene, exon 1 gi|9738964|gb|AF166362.1|F166362S01[9738964]

[2946] 4610: AH009704 Homo sapiens glutamate receptor subunit 3 (GRIA3) gene, partial cds; and glutamate receptor subunit 3 (GRIA3) gene, partial cds, alternatively spliced gi|9738963|gb|AH009704.1|SEG_F166362S[9738963]

[2947] 4611: AF272389 Homo sapiens natural killer cell immunoglobulin-like receptor (KIR2DS5) mRNA, partial cds gi|15080894|gb|AF272389.1|AF272389[15080894]

[2948] 4612: BC011847 Homo sapiens, fibroblast growth factor receptor 4, clone MGC:20292 IMAGE:4121396, mRNA, complete cds gi|15080147|gb|BC011847.1|BC011847[15080147]

[2949] 4613: BC011787 Homo sapiens, nogo receptor, clone MGC:19831 IMAGE:4040540, mRNA, complete cds gi|15080004|gb|BC011787.1|BC011787[15080004]

[2950] 4614: AF353942 Homo sapiens lantibiotic synthetase C-like protein 2 (LANCL2) mRNA, complete cds gi|15077638|gb|AF353942.1|AF353942[15077638]

[2951] 4615: AF343725 Homo sapiens G-protein-coupled receptor GPR54 (GPR54) mRNA, complete cds gi|15077535|gb|AF343725.1|AF343725[15077535]

[2952] 4617: AJ272063 Homo sapiens mRNA for vanilloid receptor 1 (VR1 gene) gi|5028818|emb|AJ272063.2|HSA272063[15028818]

[2953] 4618: AF133266 Homo sapiens cysteinyl leukotriene receptor mRNA, complete cds gi|5359717|gb|AF133266.1|AF133266[5359717]

[2954] 4619: NM—033130 Homo sapiens sialic acid binding Ig-like lectin 10 (SIGLEC10), mRNA gi|15055512|ref|NM—033130.1|[15055512]

[2955] 4620: NM—033180 Homo sapiens olfactory receptor, family 51, subfamily B, member 2 (OR51B2), mRNA gi|15042966|ref|NM—033180.1|[15042966]

[2956] 4621: NM—033179 Homo sapiens olfactory receptor, family 51, subfamily B, member 4 (OR51B4), mRNA gi|15042964|ref|NM—033179.1|[15042964]

[2957] 4622: AF380193 Homo sapiens trace amine receptor 5 (TA5) gene, complete cds gi|14600089|gb|AF380193.1|AF380193[14600089]

[2958] 4623: AF380192 Homo sapiens trace amine receptor 4 (TA4) gene, complete cds gi|14600087|gb|AF380192.1|AF380192[14600087]

[2959] 4624: AF380189 Homo sapiens trace amine receptor 3 (TA3) gene, complete cds gi|14600081|gb|AF380189.1|AF380189[14600081]

[2960] 4625: AF380185 Homo sapiens trace amine receptor 1 (TA1) gene, complete cds gi|14600073|gb|AF380185.1|AF380185[14600073]

[2961] 4626: AF313468 Homo sapiens dendritic cell-associated C-type lectin-1 mRNA, complete cds gi|13649707|gb|AF313468.1|AF313468[13649707]

[2962] 4627: NM—007096 Homo sapiens clathrin, light polypeptide (Lca) (CLTA), transcript variant brain-specific, mRNA gi|6005992|ref|NM—007096.1|[6005992]

[2963] 4628: NM—001833 Homo sapiens clathrin, light polypeptide (Lca) (CLTA), transcript variant nonbrain, mRNA gi|4502898|ref|NM—001833.1|[4502898]

[2964] 4629: NM—005292 Homo sapiens G protein-coupled receptor 18 (GPR18), mRNA gi|15029527|ref|NM—005292.1|[15029527]

[2965] 4630: NM—012276 Homo sapiens leukocyte immunoglobulin-like receptor, subfamily A (without TM domain), member 4 (ILT7), mRNA gi|15029521|ref|NM—012276.1|[15029521]

[2966] 4631: AJ299451 Homo sapiens mRNA for glutamate receptor 7 (GRIK3 gene) gi|15028906|emb|AJ299451.1|HSA299451[15028906]

[2967] 4632: AY033606 Homo sapiens fused in glioblastoma mRNA, complete cds gi|14289128|gb|AY033606.1|[14289128]

[2968] 4633: AF190696 Homo sapiens bile salt export pump (ABCB11) gene, promoter region and partial sequence gi|14280234|gb|AF190696.1|AF190696[14280234]

[2969] 4634: NM—018558 Homo sapiens gamma-aminobutyric acid (GABA) receptor, theta (GABRQ), mRNA gi|8924257|ref|NM—018558.1|[8924257]

[2970] 4635: NM—014452 Homo sapiens tumor necrosis factor receptor superfamily, member 21 (TNFRSF21), mRNA gi|7657038|ref|NM—014452.1|[7657038]

[2971] 4637: AF320560 Homo sapiens stresscopin-related protein mRNA, complete cds gi|14029393|gb|AF320560.1|AF320560[14029393]

[2972] 4638: NM—007368 Homo sapiens RAS p21 protein activator (GTPase activating protein) 3 (Ins(1,3,4,5)P4-binding protein) (GAP1IP4BP), mRNA gi|12545409|ref|NM—007368.1|[12545409]

[2973] 4639: NM—016109 Homo sapiens angiopoietin-like 4 (ANGPTL4), mRNA gi|7705828|ref|NM—016109.1|[7705828]

[2974] 4640: NM—006667 Homo sapiens progesterone receptor membrane component 1 (PGRMC1), mRNA gi|6857798|ref|NM—006667.2|[6857798]

[2975] 4641: NM—006320 Homo sapiens progesterone receptor membrane component 2 (PGRMC2), mRNA gi|5453915|ref|NM—006320.1|[5453915]

[2976] 4662: AF319553 Homo sapiens TNFRSF19L mRNA, complete cds gi|15011026|gb|AF319553.1|AF319553[15011026]

[2977] 4663: AF395806 Homo sapiens adrenergic receptor alpha-1a (ADRA1A) mRNA, complete cds gi|15004693|gb|AF395806.1|AF395806[15004693]

[2978] 4664: AF388194 Homo sapiens PML/RARA fusion mRNA, partial sequence gi|15004544|gb|AF388194.1|AF388194[15004544]

[2979] 4665: AF388193 Homo sapiens PML/RARA fusion mRNA, partial sequence gi|15004543|gb|AF388193.1|AF388193[15004543]

[2980] 4666: AF334818 Homo sapiens sodium-dependent neutral amino acid transporter type 2 truncated isoform (ASCT2) mRNA, partial cds gi|15004316|gb|AF334818.1|AF334818[15004316]

[2981] 4667: NM—022788 Homo sapiens Purinergic receptor P2Y, G protein-coupled, 12 (P2RY12), mRNA gi|12232482|ref|NM—022788.1|[12232482]

[2982] 4668: NM—016523 Homo sapiens killer cell lectin-like receptor subfamily F, member 1 (KLRF1), mRNA gi|7705573|ref|NM—016523.1|[7705573]

[2983] 4669: NM—002558 Homo sapiens purinergic receptor P2X, ligand-gated ion channel, 1 (P2RX1), mRNA gi|4505544|ref|NM—002558.1|[4505544]

[2984] 4670: AF391809 Homo sapiens coagulation factor II (thrombin) receptor (F2R) gene, complete cds gi|4971463|gb|AF391809.2|AF391809[14971463]

[2985] 4671: NM—016930 Homo sapiens syntaxin 18 (STX18), mRNA gi|8394375|ref|NM—016930.1|[8394375]

[2986] 4672: NM—032957 Homo sapiens tumor necrosis factor receptor superfamily, member 6b, decoy (TNFRSF6B), transcript variant 1, mRNA gi|14790173|ref|NM—032957.1|[14790173]

[2987] 4673: NM—032945 Homo sapiens tumor necrosis factor receptor superfamily, member 6b, decoy (TNFRSF6B), transcript variant M68C, mRNA gi|14790169|ref|NM—032945.1|[14790169]

[2988] 4674: NM—015647 Homo sapiens tumor necrosis factor receptor superfamily, member 6b, decoy (TNFRSF6B), transcript variant 3, mRNA gi|14790156|ref|NM—015647.2|[14790156]

[2989] 4675: NM—005409 Homo sapiens small inducible cytokine subfamily B (Cys-X-Cys), member 11 (SCYB11), mRNA gi|14790145|ref|NM—005409.3|[14790145]

[2990] 4676: NM—001305 Homo sapiens claudin 4 (CLDN4), mRNA gi|14790131|ref|NM—001305.2|[14790131]

[2991] 4677: NM—004346 Homo sapiens caspase 3, apoptosis-related cysteine protease (CASP3), transcript variant alpha, mRNA gi|14790118|ref|NM—004346.2|[14790118]

[2992] 4678: NM—032991 Homo sapiens caspase 3, apoptosis-related cysteine protease (CASP3), transcript variant beta, mRNA gi|14790114|ref|NM—032991.1|[14790114]

[2993] 4679: NM—033057 Homo sapiens olfactory receptor, family 2, subfamily B, member 2 (OR2B2), mRNA gi|14780899|ref|NM—033057.1|[14780899]

[2994] 4680: NM—020137 Homo sapiens GRIP-associated protein 1 (GRASP1), mRNA gi|14719405|ref|NM—020137.1|[14719405]

[2995] 4681: NM—032503 Homo sapiens G protein-coupled receptor slt (SLT), mRNA gi|14210483|ref|NM—032503.1|[14210483]

[2996] 4682: AF260738 Homo sapiens platelet-derived growth factor C (PDGFC) mRNA, complete cds gi|14009503|gb|AF260738.1|AF260738[14009503]

[2997] 4683: AF326275 Homo sapiens melanocortin 1 receptor (MC1R) gene, complete cds gi|12658397|gb|AF326275.1|AF326275[12658397]

[2998] 4684: NM—016434 Homo sapiens tumor necrosis factor receptor superfamily, member 6b, decoy (TNFRSF6B), transcript variant 2, mRNA gi|7706540|ref|NM—016434.1|[7706540]

[2999] 4685: NM—013314 Homo sapiens B-cell linker (BLNK), mRNA gi|7019534|ref|NM—013314.1|[7019534]

[3000] 4686: NM—005817 Homo sapiens cargo selection protein (mannose 6 phosphate receptor binding protein) (TIP47), mRNA gi|5032182|ref|NM—005817.1|[5032182]

[3001] 4687: NM—003110 Homo sapiens Sp2 transcription factor (SP2), mRNA gi|4507166|ref|NM—003110.1|[4507166]

[3002] 4688: NM—002704 Homo sapiens pro-platelet basic protein (includes platelet basic protein, beta-thromboglobulin, connective tissue-activating peptide III, neutrophil-activating peptide-2) (PPBP), mRNA gi|4505980|ref|NM—002704.1|[4505980]

[3003] 4689: AF064083 Homo sapiens T-cell receptor beta chain variable region (TCRBV28) mRNA, TCRBV28*S2 allele, partial cds gi|3859856|gb|AF064083.1|AF064083[3859856]

[3004] 4690: BC010641 Homo sapiens, gamma-aminobutyric acid (GABA) A receptor, beta 3, clone MGC:9051 IMAGE:3871111, mRNA, complete cds gi|14714964|gb|BC010641.1|BC010641[14714964]

[3005] 4691: BC010574 Homo sapiens, glutamate receptor, ionotropic, AMPA2 (alpha 2), clone MGC:17079 IMAGE:4215347, mRNA, complete cds gi|14714845|gb|BC010574.1|BC010574[14714845]

[3006] 4692: BC010536 Homo sapiens, coxsackie virus and adenovirus receptor, clone MGC:17118 IMAGE:3456544, mRNA, complete cds gi|14714774|gb|BC010536.1|BC010536[14714774]

[3007] 4693: BC010423 Homo sapiens, Ig superfamily receptor LNIR, clone MGC:15117 IMAGE:3610849, mRNA, complete cds gi|14714573|gb|BC010423.1|BC010423[14714573]

[3008] 4694: BC010418 Homo sapiens, laminin receptor 1 (67 kD, ribosomal protein SA), clone MGC:16557 IMAGE:4079845, mRNA, complete cds gi|14714563|gb|BC010418.1|BC010418[14714563]

[3009] 4695: NM—020168 Homo sapiens p21 (CDKN1A)-activated kinase 6 (PAK6), mRNA gi|14670348|ref|NM—020168.2|[14670348]

[3010] 4696: BC010140 Homo sapiens, tumor necrosis factor receptor superfamily, member 1A, clone MGC:19588 IMAGE:4131360, mRNA, complete cds gi|14603367|gb|BC010140.1|BC010140[14603367]

[3011] 4697: BC010054 Homo sapiens, laminin receptor 1 (67 kD, ribosomal protein SA), clone MGC:19795 IMAGE:3845335, mRNA, complete cds gi|14603183|gb|BC010054.1|BC010054[14603183]

[3012] 4698: BC009974 Homo sapiens, laminin receptor 1 (67 kD, ribosomal protein SA), clone MGC:16607 IMAGE:4110990, mRNA, complete cds gi|14602973|gb|BC009974.1|BC009974[14602973]

[3013] 4699: BC009960 Homo sapiens, interleukin 13 receptor, alpha 1, clone MGC:15228 IMAGE:4300487, mRNA, complete cds gi|14602931|gb|BC009960.1|BC009960[14602931]

[3014] 4701: BC009877 Homo sapiens, purinergic receptor P2Y, G-protein coupled, 11, clone MGC:16468 IMAGE:3953307, mRNA, complete cds gi|14602717|gb|BC009877.1|BC009877[14602717]

[3015] 4702: BC009861 Homo sapiens, super conserved receptor expressed in brain 3, clone MGC:16375 IMAGE:3936037, mRNA, complete cds gi|14602675|gb|BC009861.1|BC009861[14602675]

[3016] 4703: BC009748 Homo sapiens, dopamine receptor D5, clone MGC:10601 IMAGE:3928370, mRNA, complete cds gi|14602484|gb|BC009748.1|BC009748[14602484]

[3017] 4705: BC009391 Homo sapiens, pyrimidinergic receptor P2Y, G-protein coupled, 6, clone MGC:15335 IMAGE:4128941, mRNA, complete cds gi|14424757|gb|BC009391.1|BC009391[14424757]

[3018] 4707: BC009237 Homo sapiens, thyroid stimulating hormone receptor, clone MGC:2216 IMAGE:2989823, mRNA, complete cds gi|14328043|gb|BC009237.1|BC009237[14328043]

[3019] 4708: BC008982 Homo sapiens, complement component 5 receptor 1 (C5a ligand), clone MGC:17119 IMAGE:4177114, mRNA, complete cds gi|14290435|gb|BC008982.1|BC008982[14290435]

[3020] 4709: BC008867 Homo sapiens, laminin receptor 1 (67 kD, ribosomal protein SA), clone MGC:16750 IMAGE:4130936, mRNA, complete cds gi|14250793|gb|BC008867.1|BC008867[14250793]

[3021] 4710: BC008786 Homo sapiens, integrin, alpha 5 (fibronectin receptor, alpha polypeptide), clone MGC:3697 IMAGE:3629647, mRNA, complete cds gi|14250643|gb|BC008786.1|BC008786[14250643]

[3022] 4711: BC008770 Homo sapiens, G protein-coupled receptor 56, clone MGC:1409 IMAGE:3139174, mRNA, complete cds gi|14250619|gb|BC008770.1|BC008770[14250619]

[3023] 4712: BC008734 Homo sapiens, Fc fragment of IgG, receptor, transporter, alpha, clone MGC:1506 IMAGE:3163446, mRNA, complete cds gi|14250560|gb|BC008734.1|BC008734[14250560]

[3024] 4714: BC008716 Homo sapiens, discoidin domain receptor family, member 1, clone MGC:8681 IMAGE:2964574, mRNA, complete cds gi|14250529|gb|BC008716.1|BC008716[14250529]

[3025] 4715: BC008406 Homo sapiens, CD36 antigen (collagen type I receptor, thrombospondin receptor), clone MGC:14530 IMAGE:4244251, mRNA, complete cds gi|14250019|gb|BC008406.1|BC008406[14250019]

[3026] 4716: NM—032571 Homo sapiens EGF-like module-containing mucin-like receptor EMR3 (EMR3), mRNA gi|14211882|ref|NM—032571.1|[14211882]

[3027] 4717: AF345568 Homo sapiens putative chemokine receptor (FKSG80) mRNA, complete cds gi|13517963|gb|AF345568.1|AF345568[13517963]

[3028] 4718: AF345567 Homo sapiens putative purinergic receptor (FKSG79) mRNA, complete cds gi|13517961|gb|AF345567.1|AF345567[13517961]

[3029] 4719: AF345566 Homo sapiens putative G-protein-coupled receptor FKSG78 (FKSG78) mRNA, complete cds gi|13517959|gb|AF345566.1|AF345566[13517959]

[3030] 4720: AF345565 Homo sapiens putative G-protein-coupled receptor FKSG77 (FKSG77) mRNA, complete cds gi|13517957|gb|AF345565.1|AF345565[13517957]

[3031] 4722: NM—013447 Homo sapiens egf-like module containing, mucin-like, hormone receptor-like sequence 2 (EMR2), mRNA gi|7305024|ref|NM—013447.1|[7305024]

[3032] 4724: BC007720 Homo sapiens, 5-hydroxytryptamine (serotonin) receptor 1D, clone MGC:12645 IMAGE:4299633, mRNA, complete cds gi|14043458|gb|BC007720.1|BC007720[14043458]

[3033] 4725: BC007713 Homo sapiens, protein tyrosine phosphatase, receptor type, N, clone MGC:12646 IMAGE:4130827, mRNA, complete cds gi|14043446|gb|BC007713.1|BC007713[14043446]

[3034] 4727: BC007566 Homo sapiens, cargo selection protein (mannose 6 phosphate receptor binding protein), clone MGC:15516 IMAGE:3028104, mRNA, complete cds gi|14043156|gb|BC007566.1|BC007566[14043156]

[3035] 4728: BC007408 Homo sapiens, low density lipoprotein receptor-related protein 3, clone MGC:2428 IMAGE:3009711, mRNA, complete cds gi|13938518|gb|BC007408.1|BC007408[13938518]

[3036] 4729: BC006196 Homo sapiens, tumor necrosis factor receptor superfamily, member 9, clone MGC:2172 IMAGE:2924109, mRNA, complete cds gi|13623200|gb|BC006196.1|BC006196[13623200]

[3037] 4730: BC005912 Homo sapiens, Fc fragment of IgE, high affinity I, receptor for; alpha polypeptide, clone MGC:14507 IMAGE:4294467, mRNA, complete cds gi|13543505|gb|BC005912.1|BC005912[13543505]

[3038] 4731: BC005818 Homo sapiens, cargo selection protein (mannose 6 phosphate receptor binding protein), clone MGC:11117 IMAGE:3833411, mRNA, complete cds gi|13543306|gb|BC005818.1|BC005818[13543306]

[3039] 4732: BC005391 Homo sapiens, laminin receptor 1 (67 kD, ribosomal protein SA), clone MGC:12521 IMAGE:3997019, mRNA, complete cds gi|13529268|gb|BC005391.1|BC005391[13529268]

[3040] 4733: BC005333 Homo sapiens, interferon gamma receptor 1, clone MGC:12420 IMAGE:3950528, mRNA, complete cds gi|13529118|gb|BC005333.1|BC005333[13529118]

[3041] 4734: BC005315 Homo sapiens, formyl peptide receptor 1, clone MGC:12392 IMAGE:3829614, mRNA, complete cds gi|13529064|gb|BC005315.1|BC005315[13529064]

[3042] 4735: BC005268 Homo sapiens, putative receptor protein, clone MGC:12310 IMAGE:4051155, mRNA, complete cds gi|13528953|gb|BC005268.1|BC005268[13528953]

[3043] 4737: BC004555 Homo sapiens, G protein-coupled receptor, clone MGC:10314 IMAGE:4054377, mRNA, complete cds gi|13528716|gb|BC004555.1|BC004555[13528716]

[3044] 4738: BC004553 Homo sapiens, receptor-interacting serine-threonine kinase 2, clone MGC:10684 IMAGE:4026156, mRNA, complete cds gi|13528713|gb|BC004553.1|BC004553[13528713]

[3045] 4739: BC004545 Homo sapiens, leukotriene b4 receptor (chemokine receptor-like 1), clone MGC:10388 IMAGE:3946189, mRNA, complete cds gi|13528695|gb|BC004545.1|BC004545[13528695]

[3046] 4740: BC004899 Homo sapiens, sigma receptor (SR31747 binding protein 1), clone MGC:3851 IMAGE:3529352, mRNA, complete cds gi|13436169|gb|BC004899.1|BC004899[13436169]

[3047] 4741: BC004348 Homo sapiens, interleukin 21 receptor, clone MGC:10967 IMAGE:3634520, mRNA, complete cds gi|13279298|gb|BC004348.1|BC004348[13279298]

[3048] 4742: BC003684 Homo sapiens, coxsackie virus and adenovirus receptor, clone MGC:5086 IMAGE:3463613, mRNA, complete cds gi|13277551|gb|BC003684.1|BC003684[13277551]

[3049] 4743: BC003624 Homo sapiens, interferon gamma receptor 2 (interferon gamma transducer 1), clone MGC:2193 IMAGE:2967074, mRNA, complete cds gi|13177681|gb|BC003624.1|BC003624[13177681]

[3050] 4744: BC003187 Homo sapiens, putative G-protein coupled receptor, clone MGC:688 IMAGE:3537949, mRNA, complete cds gi|13112026|gb|BC003187.1|BC003187[13112026]

[3051] 4745: BC003142 Homo sapiens, vesicle-associated soluble NSF attachment protein receptor (v-SNARE; homolog of S. cerevisiae VTI1), clone MGC:3767 IMAGE:2958320, mRNA, complete cds gi|13111940|gb|BC003142.1|BC003142[13111940]

[3052] 4746: BC003110 Homo sapiens, interleukin 11 receptor, alpha, clone MGC:2146 IMAGE:3502059, mRNA, complete cds gi|13111884|gb|BC003110.1|BC003110[13111884]

[3053] 4747: BC003091 Homo sapiens, poliovirus receptor-related 2 (herpesvirus entry mediator B), clone MGC:1349 IMAGE:3503222, mRNA, complete cds gi|13111848|gb|BC003091.1|BC003091[13111848]

[3054] 4748: BC000181 Homo sapiens, putative G protein-coupled receptor, clone MGC:5003 IMAGE:3048193, mRNA, complete cds gi|13111815|gb|BC000181.2|BC000181[13111815]

[3055] 4751: BC003005 Homo sapiens, unactive progesterone receptor, 23 kD, clone MGC:4004 IMAGE:2821965, mRNA, complete cds gi|12804292|gb|BC003005.1|BC003005[12804292]

[3056] 4752: BC002996 Homo sapiens, cholinergic receptor, nicotinic, alpha polypeptide 3, clone MGC:3862 IMAGE:2822768, mRNA, complete cds gi|12804274|gb|BC002996.1|BC002996[12804274]

[3057] 4753: BC002947 Homo sapiens, folate receptor 1 (adult), clone MGC:10473 IMAGE:3956659, mRNA, complete cds gi|12804178|gb|BC002947.1|BC002947[12804178]

[3058] 4754: BC002819 Homo sapiens, putative receptor protein, clone MGC:3676 IMAGE:3636199, mRNA, complete cds gi|12803944|gb|BC002819.1|BC002819[12803944]

[3059] 4755: BC002794 Homo sapiens, tumor necrosis factor receptor superfamily, member 14 (herpesvirus entry mediator), clone MGC:3753 IMAGE:3614650, mRNA, complete cds gi|12803894|gb|BC002794.1|BC002794[12803894]

[3060] 4756: BC002793 Homo sapiens, interferon (alpha, beta and omega) receptor 2, clone MGC:3873 IMAGE:3626374, mRNA, complete cds gi|12803892|gb|BC002793.1|BC002793[12803892]

[3061] 4757: BC002788 Homo sapiens, plasminogen activator, urokinase receptor, clone MGC:3905 IMAGE:3617894, mRNA, complete cds gi|12803884|gb|BC002788.1|BC002788[12803884]

[3062] 4758: BC002635 Homo sapiens, colony stimulating factor 2 receptor, alpha, low-affinity (granulocyte-macrophage), clone MGC:3848 IMAGE:3606186, mRNA, complete cds gi|12803600|gb|BC002635.1|BC002635[12803600]

[3063] 4759: BC002537 Homo sapiens, fibroblast growth factor receptor-like 1, clone IMAGE:3140874, mRNA gi|12803426|gb|BC002537.1|BC002537[12803426]

[3064] 4760: BC002464 Homo sapiens, coagulation factor II (thrombin) receptor, clone MGC:1197 IMAGE:3343051, mRNA, complete cds gi|12803296|gb|BC002464.1|BC002464[12803296]

[3065] 4761: BC002443 Homo sapiens, putative T1/ST2 receptor binding protein, clone MGC:1270 IMAGE:3346273, mRNA, complete cds gi|12803256|gb|BC002443.1|BC002443[12803256]

[3066] 4762: BC002354 Homo sapiens, 5-hydroxytryptamine (serotonin) receptor 3A, clone MGC:8469 IMAGE:2821710, mRNA, complete cds gi|12803100|gb|BC002354.1|BC002354[12803100]

[3067] 4763: BC001379 Homo sapiens, G protein-coupled receptor kinase-interactor 2, clone MGC:760 IMAGE:3051069, mRNA, complete cds gi|12655058|gb|BC001379.1|BC001379[12655058]

[3068] 4764: BC001281 Homo sapiens, tumor necrosis factor receptor superfamily, member 10b, clone MGC:5144 IMAGE:3458466, mRNA, complete cds gi|12654874|gb|BC001281.1|BC001281[12654874]

[3069] 4766: BC001188 Homo sapiens, transferrin receptor (p90, CD71), clone MGC:3151 IMAGE:3354176, mRNA, complete cds gi|12654696|gb|BC001188.1|BC001188[12654696]

[3070] 4769: BC001110 Homo sapiens, benzodiazapine receptor (peripheral), clone MGC:1184 IMAGE:2989070, mRNA, complete cds gi|12654552|gb|BC001110.1|BC001110[12654552]

[3071] 4770: BC000740 Homo sapiens, cholecystokinin B receptor, clone MGC:2199 IMAGE:3504160, mRNA, complete cds gi|12653894|gb|BC000740.1|BC000740[12653894]

[3072] 4772: BC000571 Homo sapiens, pyrimidinergic receptor P2Y, G-protein coupled, 6, clone MGC:2067 IMAGE:3162734, mRNA, complete cds gi|12653590|gb|BC000571.1|BC000571[12653590]

[3073] 4773: BC000548 Homo sapiens, receptor (calcitonin) activity modifying protein 1, clone MGC:1996 IMAGE:3163522, mRNA, complete cds gi|12653550|gb|BC000548.1|BC000548[12653550]

[3074] 4774: BC000513 Homo sapiens, cholinergic receptor, nicotinic, alpha polypeptide 3, clone MGC:8545 IMAGE:2822768, mRNA, complete cds gi|12653482|gb|BC000513.1|BC000513[12653482]

[3075] 4776: BC000254 Homo sapiens, activin A receptor, type IB, clone MGC:2177 IMAGE:3352720, mRNA, complete cds gi|12652986|gb|BC000254.1|BC000254[12652986]

[3076] 4780: AF037351 Homo sapiens macrophage scavenger receptor type III (SR-A) mRNA, complete cds gi|3004959|gb|AF037351.1|AF037351[3004959]

[3077] 4781: BC009277 Homo sapiens, G protein-coupled receptor kinase 6, clone IMAGE:4053197, mRNA gi|14627273|gb|BC009277.1|BC009277[14627273]

[3078] 4782: AF369786 Homo sapiens growth hormone secretagogue receptor gene, complete cds, alternatively spliced gi|14625865|gb|AF369786.1|AF369786[14625865]

[3079] 4784: U35877 Homo sapiens (−) genotype B2 bradykinin receptor gene, exon 1 gi|1353393|gb|U35877.1|HSU35877[1353393]

[3080] 4785: U35876 Homo sapiens (+) genotype B2 bradykinin receptor gene, exon 1 gi|1353392|gb|U35876.1|HSU35876[1353392]

[3081] 4786: NM—005656 Homo sapiens transmembrane protease, serine 2 (TMPRSS2), mRNA gi|14602458|ref|NM—005656.2|[14602458]

[3082] 4787: NM—004167 Homo sapiens small inducible cytokine subfamily A (Cys-Cys), member 15 (SCYA15), transcript variant 2, mRNA gi|14602450|ref|NM—004167.2|[14602450]

[3083] 4788: NM—032965 Homo sapiens small inducible cytokine subfamily A (Cys-Cys), member 15 (SCYA15), transcript variant 3, mRNA gi|14602448|ref|NM—032965.1|[14602448]

[3084] 4789: NM—032964 Homo sapiens small inducible cytokine subfamily A (Cys-Cys), member 15 (SCYA15), transcript variant 1, mRNA gi|14602446|ref|NM—032964.1|[14602446]

[3085] 4790: AJ312373 Homo sapiens mRNA for DECTIN-1 receptor, splice variant 2 gi|14599395|emb|AJ312373.1|HSA312373[14599395]

[3086] 4791: AJ312372 Homo sapiens mRNA for DECTIN-1 receptor, splice variant 1 gi|14599393|emb|AJ312372.1|HSA312372[14599393]

[3087] 4792: AJ307885 Homo sapiens mRNA for T-cell receptor beta chain, clone 83 gi|14595016|emb|AJ307885.1|HSA307885[14595016]

[3088] 4793: NM—001987 Homo sapiens ets variant gene 6 (TEL oncogene) (ETV6), mRNA gi|14589947|ref|NM—001987.2|[14589947]

[3089] 4794: NM—020403 Homo sapiens protocadherin 9 (PCDH9), mRNA gi|14589940|ref|NM—020403.2|[14589940]

[3090] 4795: NM—022843 Homo sapiens protocadherin 20 (PCDH20), mRNA gi|14589938|ref|NM—022843.1|[14589938]

[3091] 4797: NM—020164 Homo sapiens aspartate beta-hydroxylase (ASPH), transcript variant 5, mRNA gi|14589858|ref|NM—020164.2|[14589858]

[3092] 4798: AF361107 Homo sapiens CRHF2 receptor beta-isoform mRNA, partial sequence, aberrantly spliced gi|14586958|gb|AF361107.1|AF361107[14586958]

[3093] 4799: AF361106 Homo sapiens CRHF2 receptor beta-isoform mRNA, partial sequence, aberrantly spliced gi|14586957|gb|AF361106.1|AF361106[14586957]

[3094] 4800: AF284768 Homo sapiens laminin receptor-like protein LAMRL5 mRNA, complete cds gi|14583013|gb|AF284768.1|AF284768[14583013]

[3095] 4801: AF343090 Homo sapiens HSF-27 protein mRNA, complete cds gi|14582809|gb|AF343090.1|AF343090[14582809]

[3096] 4802: AF286696 Homo sapiens olfactory receptor sdolf mRNA, complete cds gi|14582606|gb|AF286696.1|AF286696[14582606]

[3097] 4803: AF279673 Homo sapiens vanilloid receptor-like protein 2 (VRL2) mRNA, complete cds gi|14582397|gb|AF279673.1|AF279673[14582397]

[3098] 4804: AF279611 Homo sapiens cysteinyl leukotriene receptor type 2 (CYSLT2) gene, complete cds gi|14582393|gb|AF279611.1|AF279611[14582393]

[3099] 4806: NM—005111 Homo sapiens crystallin, zeta (quinone reductase)-like 1 (CRYZL1), mRNA gi|14577924|ref|NM—005111.2|[14577924]

[3100] 4807: NM—000592 Homo sapiens complement component 4B (C4B), mRNA gi|14577920|ref|NM—000592.3|[14577920]

[3101] 4809: NM—016557 Homo sapiens orphan seven-transmembrane receptor, chemokine related (VSHK1), mRNA gi|7706768|ref|NM—016557.1|[7706768]

[3102] 4810: NM—006850 Homo sapiens interleukin 24 (IL24), mRNA gi|5803085|ref|NM—006850.1|[5803085]

[3103] 4811: NM—000029 Homo sapiens angiotensinogen (serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 8) (AGT), mRNA gi|4557286|ref|NM—000029.1|[4557286]

[3104] 4812: AF385591 Homo sapiens m5 muscarinic cholinergic receptor (CHRM5) mRNA, complete cds gi|14573544|gb|AF385591.1|AF385591[14573544]

[3105] 4813: AF385590 Homo sapiens m4 muscarinic cholinergic receptor (CHRM4) mRNA, complete cds gi|14573542|gb|AF385590.1|AF385590[14573542]

[3106] 4814: AF385589 Homo sapiens m3 muscarinic cholinergic receptor (CHRM3) mRNA, partial cds gi|14573540|gb|AF385589.1|AF385589[14573540]

[3107] 4815: AF385588 Homo sapiens m2 muscarinic cholinergic receptor (CHRM2) mRNA, complete cds gi|14573538|gb|AF385588.1|AF385588[14573538]

[3108] 4816: AF385587 Homo sapiens m1 muscarinic cholinergic receptor (CHRM1) mRNA, complete cds gi|14573536|gb|AF385587.1|AF385587[14573536]4817: AF385585 Homo sapiens nicotinic cholinergic receptor alpha 7 (CHRNA7) mRNA, complete cds gi|14573533|gb|AF385585.1|AF385585[14573533]

[3109] 4818: AF385584 Homo sapiens nicotinic cholinergic receptor alpha 3 (CHRNA3) mRNA, partial cds gi|14573531|gb|AF385584.1|AF385584[14573531]

[3110] 4819: AF361943 Homo sapiens urocortin III (UCNIII) gene, complete cds gi|14571921|gb|AF361943.1|AF361943[14571921]

[3111] 4825: NM—031282 Homo sapiens immunoglobulin superfamily receptor translocation associated 1 (IRTA1), mRNA gi|14550415|ref|NM—031282.1|[14550415]

[3112] 4826: NM—031281 Homo sapiens immunoglobulin superfamily receptor translocation associated 2 (IRTA2), mRNA gi|14550413|ref|NM—031281.1|[14550413]

[3113] 4827: NM—020404 Homo sapiens tumor endothelial marker 1 precursor (TEM1), mRNA gi|9966884|ref|NM—020404.1|[9966884]

[3114] 4830: AF338733 Homo sapiens thymic stromal lymphopoietin protein receptor TSLPR mRNA, complete cds gi|14335439|gb|AF338733.1|AF338733[14335439]

[3115] 4831: AF338732 Homo sapiens thymic stromal lymphopoietin protein TSLP mRNA, complete cds gi|14335437|gb|AF338732.1|AF338732[14335437]

[3116] 4832: AJ272324 Homo sapiens mRNA for PRAM-1 protein gi|11558108|emb|AJ272324.1|HSA272324[11558108]

[3117] 4833: AF281043 Homo sapiens high mobility group 1 protein (HMG1) gene, promoter and partial cds gi|14522873|gb|AF281043.1|AF281043[14522873]

[3118] 4834: NM—024298 Homo sapiens malignant cell expression-enhanced gene/tumor progression-enhanc (LENG4), mRNA gi|13236521|ref|NM—024298.1|[13236521]

[3119] 4835: AB051580 Homo sapiens gene for IgG receptor IIIB, complete cds gi|11344590|dbj|AB051580.1|AB051580[11344590]

[3120] 4836: NM—006134 Homo sapiens chromosome 21 open reading frame 4 (C21orf4), mRNA gi|8659558|ref|NM—006134.2|[8659558]

[3121] 4837: NM—015927 Homo sapiens transforming growth factor beta 1 induced transcript 1 (TGFB1I1), mRNA gi|7706249|ref|NM—015927.1|[7706249]

[3122] 4838: NM—000956 Homo sapiens prostaglandin E receptor 2 (subtype EP2), 53 kD (PTGER2), mRNA gi|4506254|ref|NM—000956.1|[4506254]

[3123] 4839: AF019381 Homo sapiens corticotropin releasing hormone receptor type 2 gamma isoform (CRH2R) mRNA, complete cds gi|2738888|gb|AF019381.1|AF019381[2738888]

[3124] 4840: AB043702 Homo sapiens FZD5 mRNA for seven-transmembrane receptor Frizzled-5, complete cds gi|14495150|dbj|AB043702.1|AB043702[14495150]

[3125] 4841: AF384819 Homo sapiens coagulation factor II receptor-like 3 (F2RL3) gene, complete cds gi|14488403|gb|AF384819.2|AF384819[14488403]

[3126] 4842: AF343666 Homo sapiens translocation associated fusion protein IRTA1/IGA1 (IRTA1/IGHA1) mRNA, complete cds gi|13591717|gb|AF343666.1|AF343666[13591717]

[3127] 4843: AF343665 Homo sapiens immunoglobulin superfamily receptor translocation associated protein 2d (IRTA2) mRNA, partial cds, alternatively spliced gi|13591715|gb|AF343665.1|AF343665[13591715]

[3128] 4844: AF343664 Homo sapiens immunoglobulin superfamily receptor translocation associated protein 2c (IRTA2) mRNA, complete cds, alternatively spliced gi|13591713|gb|AF343664.1|AF343664[13591713]

[3129] 4845: AF343663 Homo sapiens immunoglobulin superfamily receptor translocation associated protein 2b (IRTA2) mRNA, complete cds, alternatively spliced gi|13591711|gb|AF343663.1|AF343663[13591711]

[3130] 4846: AF343662 Homo sapiens immunoglobulin superfamily receptor translocation associated protein 2a (IRTA2) mRNA, complete cds, alternatively spliced gi|13591709|gb|AF343662.1|AF343662[13591709]

[3131] 4847: AF343661 Homo sapiens immunoglobulin superfamily receptor translocation associated protein 1a (IRTAL) mRNA, complete cds, alternatively spliced gi|13591707|gb|AF343661.1|AF343661[13591707]

[3132] 4848: AF343660 Homo sapiens immunoglobulin superfamily receptor translocation associated protein 1b (IRTA1) mRNA, complete cds, alternatively spliced gi|13591705|gb|AF343660.1|AF343660[13591705]

[3133] 4849: AF343659 Homo sapiens immunoglobulin superfamily receptor translocation associated protein 1c (IRTA1) mRNA, complete cds, alternatively spliced gi|13591703|gb|AF343659.1|AF343659[13591703]

[3134] 4850: AF321237 Homo sapiens chromosome 11p15.4 clone RPC11-610i20 P2-containing olfactory receptor gene cluster, complete sequence gi|12007433|gb|AF321237.1|AF321237[12007433]

[3135] 4851: NM—005567 Homo sapiens lectin, galactoside-binding, soluble, 3 binding protein (LGALS3BP), mRNA gi|6006016|ref|NM—005567.2|[6006016]

[3136] 4852: AF351620 Homo sapiens lipocalin-1 interacting membrane receptor (LIMR) gene, complete cds gi|14485746|gb|AF351620.1|AF351620[14485746]

[3137] 4853: AF366519

[3138] 4890: AB063174 Homo sapiens SLC-1 mRNA for somatostatin receptor-like protein, complete cds gi|14475646|dbj|AB063174.1|AB063174[14475646]

[3139] 4891: AF238470 Homo sapiens natural killer cell receptor NKG2F gene, partial cds gi|11023178|gb|AF238470.1|AF238470[11023178]

[3140] 4892: AF238469 Homo sapiens natural killer cell receptor NKG2E gene, partial cds gi|11023176|gb|AF238469.1|AF238469[11023176]

[3141] 4893: AF238468 Homo sapiens natural killer cell receptor NKG2C gene, partial cds gi|11023174|gb|AF238468.1|AF238468[11023174]

[3142] 4894: AE000662 Homo sapiens T-cell receptor alpha delta locus from bases 1000498 to 1071650 (section 5 of 5) of the Complete Nucleotide Sequence gi|2358068|gb|AE000662.1|HUAE000662[2358068]

[3143] 4895: AE000661 Homo sapiens T-cell receptor alpha delta locus from bases 752679 to 1000555 (section 4 of 5) of the Complete Nucleotide Sequence gi|2358060|gb|AE000661.1|HUAE000661[2358060]

[3144] 4896: AE000660 Homo sapiens T-cell receptor alpha delta locus from bases 501613 to 752736 (section 3 of 5) of the Complete Nucleotide Sequence gi|2358042|gb|AE000660.1|HUAE000660[2358042]

[3145] 4897: AE000659 Homo sapiens T-cell receptor alpha delta locus from bases 250472 to 501670 (section 2 of 5) of the Complete Nucleotide Sequence gi|2358025|gb|AE000659.1|HUAE000659[2358025|

[3146] 4898: AE000658 Homo sapiens T-cell receptor alpha delta locus from bases 1 to 250529 (section 1 of 5) of the Complete Nucleotide Sequence gi|2358019|gb|AE000658.1|HUAE000658[2358019]

[3147] 4899: AF364129 Homo sapiens tandem repeat region 76.3 kb upstream of BMPR1A exon 1 gi|14423333|gb|AF364129.1|AF364129[14423333]

[3148] 4900: AF364128 Homo sapiens tandem repeat region 49.4 kb upsteam of BMPR1A exon 1 gi|14423332|gb|AF364128.1|AF364128[14423332]

[3149] 4901: AF261083 Homo sapiens polymeric immunoglobulin receptor (PIGR) gene, partial cds gi|8099662|gb|AF261083.1|AF261083[8099662]

[3150] 4902: AF243129 Homo sapiens intrinsic factor-vitamin B12 receptor (CUBN) gene, exon 67 and partial cds gi|1438867|gb|AF243129.1|F243081S49[14388671]

[3151] 4903: AF243128 Homo sapiens intrinsic factor-vitamin B12 receptor (CUBN) gene, exon 66 gi|14388670|gb|AF243128.1|F243081S48[14388670]

[3152] 4904: AF243127 Homo sapiens intrinsic factor-vitamin B12 receptor (CUBN) gene, exon 65 gi|14388669|gb|AF243127.1|F243081S47[14388669]

[3153] 4905: AF243126 Homo sapiens intrinsic factor-vitamin B12 receptor (CUBN) gene, exons 63 and gi|14388668|gb|AF243126.1|F243081S46[14388668]

[3154] 4906: AF243125 Homo sapiens intrinsic factor-vitamin B12 receptor (CUBN) gene, exons 61 and gi|14388667|gb|AF243125.1|F243081S45[14388667]

[3155] 4907: AF243124 Homo sapiens intrinsic factor-vitamin B12 receptor (CUBN) gene, exon 60 gi|14388666|gb|AF243124.1|F243081S44[14388666]

[3156] 4908: AF243123 Homo sapiens intrinsic factor-vitamin B12 receptor (CUBN) gene, exon 59 gi|14388665|gb|AF243123.1|F243081S43[14388665]

[3157] 4909: AF243122 Homo sapiens intrinsic factor-vitamin B12 receptor (CUBN) gene, exon 58 gi|14388664|gb|AF243122.1|F243081S42[14388664]

[3158] 4910: AF243121 Homo sapiens intrinsic factor-vitamin B12 receptor (CUBN) gene, exon 57 gi|14388663|gb|AF243121.1|F243081S41[14388663]

[3159] 4911: AF243120 Homo sapiens intrinsic factor-vitamin B12 receptor (CUBN) gene, exon 56 gi|14388662|gb|AF243120.1|F243081S40[14388662]

[3160] 4912: AF243119 Homo sapiens intrinsic factor-vitamin B12 receptor (CUBN) gene, exon 55 gi|14388661|gb|AF243119.1|F243081S39[14388661]

[3161] 4913: AF243118 Homo sapiens intrinsic factor-vitamin B12 receptor (CUBN) gene, exon 54 gi|14388660|gb|AF243118.1|F243081S38[14388660]

[3162] 4914: AF243117 Homo sapiens intrinsic factor-vitamin B12 receptor (CUBN) gene, exons 52 and gi|14388659|gb|AF243117.1|F243081S37[14388659]

[3163] 4915: AF243116 Homo sapiens intrinsic factor-vitamin B12 receptor (CUBN) gene, exon 51 gi|14388658|gb|AF243116.1|F243081S36[14388658]

[3164] 4916: AF243115 Homo sapiens intrinsic factor-vitamin B12 receptor (CUBN) gene, exons 49 and gi|14388657|gb|AF243115.1|F243081S35[14388657]

[3165] 4917: AF243114 Homo sapiens intrinsic factor-vitamin B12 receptor (CUBN) gene, exon 48 gi|14388656|gb|AF243114.1|F243081S34[14388656]

[3166] 4918: AF243113 Homo sapiens intrinsic factor-vitamin B12 receptor (CUBN) gene, exon 47 gi|14388655|gb|AF243113.1|F243081S33[14388655]

[3167] 4919: AF243112 Homo sapiens intrinsic factor-vitamin B12 receptor (CUBN) gene, exon 46 gi|14388654|gb|AF243112.1|F243081S32[14388654]

[3168] 4920: AF243111 Homo sapiens intrinsic factor-vitamin B12 receptor (CUBN) gene, exon 45 gi|14388653|gb|AF243111.1|F243081S31[14388653]

[3169] 4921: AF243110 Homo sapiens intrinsic factor-vitamin B12 receptor (CUBN) gene, exon 44 gi|14388652|gb|AF243110.1|F243081S30[14388652]

[3170] 4922: AF243109 Homo sapiens intrinsic factor-vitamin B12 receptor (CUBN) gene, exons 42 and gi|14388651|gb|AF243109.1|F243081S29[14388651]

[3171] 4923: AF243108 Homo sapiens intrinsic factor-vitamin B12 receptor (CUBN) gene, exon 41 gi|14388650|gb|AF243108.1|F243081S28[14388650]

[3172] 4924: AF243107 Homo sapiens intrinsic factor-vitamin B12 receptor (CUBN) gene, exon 40 gi|14388649|gb|AF243107.1|F243081S27[14388649]

[3173] 4925: AF243106 Homo sapiens intrinsic factor-vitamin B12 receptor (CUBN) gene, exon 39 gi|14388648|gb|AF243106.1|F243081S26[14388648]

[3174] 4926: AF243105 Homo sapiens intrinsic factor-vitamin B12 receptor (CUBN) gene, exons 37 and gi|14388647|gb|AF243105.1|F243081S25[14388647]

[3175] 4927: AF243104 Homo sapiens intrinsic factor-vitamin B12 receptor (CUBN) gene, exons 35 and gi|14388646|gb|AF243104.1|F243081S24[14388646]

[3176] 4928: AF243103 Homo sapiens intrinsic factor-vitamin B12 receptor (CUBN) gene, exon 34 gi|14388645|gb|AF243103.1|F243081S23[14388645]

[3177] 4929: AF243102 Homo sapiens intrinsic factor-vitamin B12 receptor (CUBN) gene, exon 33 gi|14388644|gb|AF243102.1|F243081S22[14388644]

[3178] 4930: AF243101 Homo sapiens intrinsic factor-vitamin B12 receptor (CUBN) gene, exon 32 gi|14388643|gb|AF243101.1|F243081S21[14388643]

[3179] 4931: AF243100 Homo sapiens intrinsic factor-vitamin B12 receptor (CUBN) gene, exon 31 gi|14388642|gb|AF243100.1|F243081S20[14388642]

[3180] 4932: AF243099 Homo sapiens intrinsic factor-vitamin B12 receptor (CUBN) gene, exon 30 gi|14388641|gb|AF243099.1|F243081S19[14388641]

[3181] 4933: AF243098 Homo sapiens intrinsic factor-vitamin B12 receptor (CUBN) gene, exon 29 gi|14388640|gb|AF243098.1|F243081S18[14388640]

[3182] 4934: AF243097 Homo sapiens intrinsic factor-vitamin B12 receptor (CUBN) gene, exon 28 gi|14388639|gb|AF243097.1|F243081S17[14388639]

[3183] 4935: AF243096 Homo sapiens intrinsic factor-vitamin B12 receptor (CUBN) gene, exon 27 gi|14388638|gb|AF243096.1|F243081S16[14388638]

[3184] 4936: AF24309S Homo sapiens intrinsic factor-vitamin B12 receptor (CUBN) gene, exon 26 gi|14388637|gb|AF243095.1|F243081S15[14388637]

[3185] 4937: AF243094 Homo sapiens intrinsic factor-vitamin B12 receptor (CUBN) gene, exons 23, 24, and 25 gi|14388636|gb|AF243094.1|F243081S14[14388636]

[3186] 4938: AF243093 Homo sapiens intrinsic factor-vitamin B12 receptor (CUBN) gene, exon 22 gi|14388635|gb|AF243093.1|F243081S13[14388635]

[3187] 4939: AF243092 Homo sapiens intrinsic factor-vitamin B12 receptor (CUBN) gene, exons 20 and gi|14388634|gb|AF243092.1|F243081S12[14388634]

[3188] 4940: AF243091 Homo sapiens intrinsic factor-vitamin B12 receptor (CUBN) gene, exons 18 and gi|14388633|gb|AF243091.1|F243081S11[14388633]

[3189] 4941: AF243090 Homo sapiens intrinsic factor-vitamin B12 receptor (CUBN) gene, exons 16 and gi|14388632|gb|AF243090.1|F243081S10[14388632]

[3190] 4942: AF243089 Homo sapiens intrinsic factor-vitamin B12 receptor (CUBN) gene, exon 15 gi|14388631|gb|AF243089.1|F243081S09[14388631]

[3191] 4943: AF243088 Homo sapiens intrinsic factor-vitamin B12 receptor (CUBN) gene, exon 14 gi|14388630|gb|AF243088.1|F243081S08[14388630]

[3192] 4944: AF243087 Homo sapiens intrinsic factor-vitamin B12 receptor (CUBN) gene, exons 11, 12, and 13 gi|14388629|gb|AF243087.1|F243081S07[14388629]

[3193] 4945: AF243086 Homo sapiens intrinsic factor-vitamin B12 receptor (CUBN) gene, exons 9 and gi|14388628|gb|AF243086.1|F243081S06[14388628]

[3194] 4946: AF243085 Homo sapiens intrinsic factor-vitamin B12 receptor (CUBN) gene, exon 8 gi|14388627|gb|AF243085.1|F243081S05[14388627]

[3195] 4947: AF243084 Homo sapiens intrinsic factor-vitamin B12 receptor (CUBN) gene, exon 7 gi|14388626|gb|AF243084.1|F243081S04[14388626]

[3196] 4948: AF243083 Homo sapiens intrinsic factor-vitamin B12 receptor (CUBN) gene, exons 5 and 6 gi|14388625|gb|AF243083.1|F243081S03[14388625]

[3197] 4949: AF243082 Homo sapiens intrinsic factor-vitamin B12 receptor (CUBN) gene, exon 3 and partial cds gi|14388624|gb|AF243082.1|F243081S02[14388624]

[3198] 4950: AF243081 Homo sapiens intrinsic factor-vitamin B12 receptor (CUBN) gene, exons 1 and 2 gi|14388623|gb|AF243081.1|F243081S01[14388623]

[3199] 4951: AH010855 Homo sapiens intrinsic factor-vitamin B12 receptor (CUBN) and intrinsic factor-vitamin B12 receptor (CUBN) genes, partial cds gi|14388622|gb|AH010855.1|SEG_F243081S[14388622]

[3200] 4952: AY029596 Homo sapiens melanin-concentrating hormone 2 receptor mRNA, complete cds gi|14388165|gb|AY029596.1|[14388165]

[3201] 4953: AF233349 Homo sapiens neuronal phosphoprotein DARPP-32 mRNA, partial cds gi|7243754|gb|AF233349.1|AF233349[7243754]

[3202] 4954: AF208690 Homo sapiens clone 24 p70 killer cell inhibitory receptor mRNA, partial cds gi|6851353|gb|AF208690.1|AF208690[6851353]

[3203] 4955: AF208689 Homo sapiens clone 22 p70 killer cell inhibitory receptor mRNA, partial cds gi|6851351|gb|AF208689.1|AF208689[6851351]

[3204] 4956: AF208688 Homo sapiens clone 3 p70 killer cell inhibitory receptor mRNA, partial cds gi|6851349|gb|AF208688.1|AF208688[6851349]

[3205] 4957: AF208687 Homo sapiens clone 25 p70 killer cell inhibitory receptor mRNA, partial cds gi|6851347|gb|AF208687.1|AF208687[6851347]

[3206] 4958: AF208686 Homo sapiens clone 23 p70 killer cell inhibitory receptor mRNA, partial cds gi|6851345|gb|AF208686.1|AF208686[6851345]

[3207] 4959: AF208685 Homo sapiens clone 21 p70 killer cell inhibitory receptor mRNA, partial cds gi|6851343|gb|AF208685.1|AF208685[6851343]

[3208] 4960: AF208684 Homo sapiens clone 6 p70 killer cell inhibitory receptor mRNA, partial cds gi|6851341|gb|AF208684.1|AF208684[6851341]

[3209] 4961: AF208683 Homo sapiens clone 1 p70 killer cell inhibitory receptor mRNA, partial cds gi|6851339|gb|AF208683.1|AF208683[6851339]

[3210] 4962: AB052639 Homo sapiens mRNA for IL-XR, complete cds gi|14349288|dbj|AB052639.1|AB052639[14349288]

[3211] 4963: AF366364 Homo sapiens interleukin-1 receptor type 1 (IL1R1) gene, exon 1A, partial sequence gi|14348871|gb|AF366364.1|AF366364[14348871]

[3212] 4967: AF260728 Homo sapiens lipocalin-interacting protein mRNA, complete cds gi|14335227|gb|AF260728.1|AF260728[14335227]

[3213] 4968: AJ308526 Homo sapiens partial GRIK3 gene for glutamate receptor 7, exon 18 gi|14329723|emb|AJ308526.1|HSA308526[14329723]

[3214] 4969: AJ308525 Homo sapiens partial GRIK3 gene for glutamate receptor 7, exon 16 gi|14329720|emb|AJ308525.1|HSA308525[14329720]

[3215] 4970: AF165124 Homo sapiens chromosome 5q31.1-q33.1 clone BAC djn082c10 containing GABRG2 gene, complete sequence gi|5738137|gb|AF165124.1|AF165124[5738137]

[3216] 4971: AF353733 Homo sapiens leukocyte immunoglobulin-like receptor A3 (LILRA3) gene, exon 3 and partial cds gi|14280086|gb|AF353733.1|AF353733[14280086]

[3217] 4972: AF236083 Homo sapiens G-protein-coupled receptor 74 (GPR74) mRNA, complete cds gi|14279164|gb|AF236083.1|AF236083[14279164]

[3218] 4973: AF375468 Homo sapiens endothelial protein C receptor (PROCR) gene, complete cds gi|14278711|gb|AF375468.2|AF375468[14278711]

[3219] 4974: AF374726 Homo sapiens coagulation factor II receptor-like 2 (F2RL2) gene, complete cds gi|14278710|gb|AF374726.2|AF374726[14278710]

[3220] 4975: AF378542 Homo sapiens bradykinin receptor B2 (BDKRB2) gene, complete cds gi|14278705|gb|AF378542.2|AF378542[14278705]

[3221] 4976: AB051065 Homo sapiens hot7t175 mRNA for G protein-coupled receptor, complete cds gi|14041797|dbj|AB051065.1|AB051065[14041797]

[3222] 4977: AF347063 Homo sapiens G protein-coupled receptor MCH2 mRNA, complete cds gi|13604341|gb|AF347063.1|AF347063[13604341]

[3223] 4978: AJ278250 Homo sapiens HRH3 gene for histamine H3 receptor, exons 1-3 gi|14270360|emb|AJ278250.1|HSA278250[14270360]

[3224] 4979: AF297616 Homo sapiens natural killer cell receptor 2B4 gene, partial cds gi|14268841|gb|AF297616.1|AF297616[14268841]

[3225] 4980: AJ271068 Homo sapiens mRNA for transient receptor potential channel 6, variant delta377-431 (TRP6 gene) gi|9716912|emb|AJ271068.1|HSA271068[9716912]

[3226] 4981: AJ271067 Homo sapiens mRNA for transient receptor potential channel 6, variant delta316-431 (TRP6 gene) gi|9716910|emb|AJ271067.1|HSA271067[9716910]

[3227] 4982: AJ271066 Homo sapiens mRNA for transient receptor potential channel 6 (TRP6 gene) gi|9716908|emb|AJ271066.1|HSA271066[9716908]

[3228] 4983: X91852 H.sapiens P2Y4 gene gi|1124904|emb|X91852.1|HSP2Y4[1124904]

[3229] 4984: NM—032565 Homo sapiens emopamil binding related protein, delta8-delta7 sterol isomerase related protein (EBRP), mRNA gi|4211872|ref|NM—032565.1|[14211872]

[3230] 4986: AY029539 Homo sapiens soluble nectini gamma mRNA, complete cds gi|14196221|gb|AY029539.1|[14196221]

[3231] 4987: NM—006986 Homo sapiens melanoma antigen, family D, 1 (MAGED1), mRNA gi|14195633|ref|NM—006986.2|[14195633]

[3232] 4988: AF351784 Homo sapiens dopamine receptor interacting protein mRNA, partial cds gi|14194056|gb|AF351784.1|AF351784[14194056]

[3233] 4989: AF336376 Homo sapiens platelet-derived growth factor D (PDGFD) mRNA, complete cds gi|14193795|gb|AF336376.1|AF336376[14193795]

[3234] 4992: AH010778 Homo sapiens CHRNA3 gene, partial sequence gi|14190789|gb|AH010778.1|SEG_AY027913S[14190789]

[3235] 4995: AH010779 Homo sapiens CHRNB4 gene, partial sequence gi|14190786|gb|AH010779.1|SEG_AY027915S[14190786]

[3236] 4996: AF310234 Homo sapiens sialic acid binding immunoglobulin-like lectin 8 (SIGLEC8) mRNA, complete cds, alternatively spliced gi|4164614|gb|AF310234.1|AF310234[14164614]

[3237] 4997: AF310233 Homo sapiens sialic acid binding immunoglobulin-like lectin 10 (SIGLEC10) mRNA, complete cds gi|14164612|gb|AF310233.1|AF310233[14164612]

[3238] 4998: AB060151 Homo sapiens slt mRNA for G protein-coupled receptor, complete cds gi|14164382|dbj|AB060151.1|AB060151[14164382]

[3239] 4999: AF239764 Homo sapiens EGF-like module-containing mucin-like receptor EMR3 mRNA, complete cds gi|13183148|gb|AF239764.1|AF239764[13183148]

[3240] 5000: AF199235 Homo sapiens nicotinic acetylcholine receptor subunit alpha 10 mRNA, complete cds gi|11128455|gb|AF199235.2|AF199235[11128455]

[3241] 5001: AF054176 Homo sapiens angiotensin/vasopressin receptor AII/AVP mRNA, complete cds gi|3341995|gb|AF054176.1|AF054176[3341995]

[3242] 5002: AF369213 Homo sapiens fibroblast growth factor receptor 3 IIIc isoform (FGFR3) mRNA, partial cds gi|14161391|gb|AF369213.1|AF369213[14161391]

[3243] 5003: AF369212 Homo sapiens fibroblast growth factor receptor 3 IIIc isoform (FGFR3) mRNA, partial cds gi|14161389|gb|AF369212.1|AF369212[14161389]

[3244] 5004: AF369211 Homo sapiens fibroblast growth factor receptor 3 IIIc isoform (FGFR3) mRNA, partial cds gi|14161387|gb|AF369211.1|AF369211[14161387]

[3245] 5005: AF274714 Homo sapiens oxysterol-binding protein-related protein (ORP1) mRNA, complete cds gi|13183326|gb|AF274714.1|AF274714[13183326]

[3246] 5034: NM—005959 Homo sapiens melatonin receptor 1B (MTNR1B), mRNA gi|14141172|ref|NM—005959.2|[14141172]

[3247] 5035: NM—005958 Homo sapiens melatonin receptor 1A (MTNR1A), mRNA gi|14141171|ref|NM005958.2|[14141171]

[3248] 5036: AF366903 Homo sapiens MER receptor tyrosine kinase gene, exon 1 and partial cds gi|14133725|gb|AF366903.1|AF366903[14133725]

[3249] 5037: NM—002226 Homo sapiens jagged 2 (JAG2), mRNA gi|4504800|ref|NM—002226.1|[4504800]

[3250] 5039: NM—009585 Homo sapiens angiotensin receptor 1 (AGTR1), transcript variant 2, mRNA gi|14043067|ref|NM—009585.2|[14043067]

[3251] 5040: NM—032049 Homo sapiens angiotensin receptor 1 (AGTR1), transcript variant 5, mRNA gi|14043065|ref|NM—032049.1|[14043065]

[3252] 5041: NM—031850 Homo sapiens angiotensin receptor 1 (AGTR1), transcript variant 4, mRNA gi|14043063|ref|NM—031850.1|[14043063]

[3253] 5042: NM—004835 Homo sapiens angiotensin receptor 1 (AGTR1), transcript variant 3, mRNA gi|14043061|ref|NM—004835.2|[14043061]

[3254] 5043: NM—000685 Homo sapiens angiotensin receptor 1 (AGTR1), transcript variant 1, mRNA gi|14043060|ref|NM000685.3|[14043060]

[3255] 5044: NM—003965 Homo sapiens chemokine (C-C motif) receptor-like 2 (CCRL2), mRNA gi|14043058|ref|NM—003965.2|[14043058]

[3256] 5045: AJ298334 Homo sapiens mRNA for P2Y11 receptor (P2Y11 gene) gi|12964589|emb|AJ298334.1|HSA298334[12964589]

[3257] 5046: NM—000323 Homo sapiens ret proto-oncogene (multiple endocrine neoplasia and medullary thyroid carcinoma 1, Hirschsprung disease) (RET), transcript variant 1, mRNA gi|10862704|ref|NM—000323.1|[10862704]

[3258] 5047: NM—020975 Homo sapiens ret proto-oncogene (multiple endocrine neoplasia and medullary thyroid carcinoma 1, Hirschsprung disease) (RET), transcript variant 2, mRNA gi|10862702|ref|NM—020975.1|[10862702]

[3259] 5048: NM—020630 Homo sapiens ret proto-oncogene (multiple endocrine neoplasia and medullary thyroid carcinoma 1, Hirschsprung disease) (RET), transcript variant 4, mRNA gi|10862700|ref|NM—020630.1|[10862700]

[3260] 5049: NM—020629 Homo sapiens ret proto-oncogene (multiple endocrine neoplasia and medullary thyroid carcinoma 1, Hirschsprung disease) (RET), transcript variant 3, mRNA gi|10862698|ref|NM—020629.1|[10862698]

[3261] 5050: NM—002342 Homo sapiens lymphotoxin beta receptor (TNFR superfamily, member 3) (LTBR), mRNA gi|4505038|ref|NM—002342.1|[4505038]

[3262] 5051: AY032736 Homo sapiens alpha-2A adrenergic receptor (ADR2AR) gene, complete cds gi|14029162|gb|AY032736.1|[14029162]

[3263] 5052: AF322014 Homo sapiens growth hormone receptor gene, partial sequence gi|14028657|gb|AF322014.1|AF322014S1[14028657]

[3264] 5053: AF283321 Homo sapiens low density lipoprotein receptor-related protein 5 (LRP5) gene, exons 10 through 23 and complete cds gi|14028617|gb|AF283321.1|AF283320S2[14028617]

[3265] 5054: AF283320 Homo sapiens low density lipoprotein receptor-related protein 5 (LRP5) gene, exons 1 through 9 gi|14028616|gb|AF283320.1|AF283320S1[14028616]

[3266] 5055: AH010745 Homo sapiens low density lipoprotein receptor-related protein 5 (LRP5) gene, complete cds gi|14028615|gb|AH010745.1|SEG_AF283320S[14028615]

[3267] 5056: NM—017934 Homo sapiens pleckstrin homology domain interacting protein (PHIP), mRNA gi|8923633|ref|NM—017934.1|[8923633]

[3268] 5057: AF203386 Homo sapiens beta-2 adrenergic receptor (ADRB2) gene, complete cds gi|6636495|gb|AF203386.1|AF203386[6636495]

[3269] 5058: AF202305 Homo sapiens beta-2 andrenergic receptor gene, complete cds gi|6573152|gb|AF202305.1|AF202305[6573152]

[3270] 5059: AF169225 Homo sapiens beta-2-adrenergic receptor gene, complete cds gi|5714687|gb|AF169225.1|AF169225[5714687]

[3271] 5060: AF063657 Homo sapiens vascular endothelial growth factor receptor (FLT1) mRNA, complete cds gi|3132830|gb|AF063657.1|AF063657[3132830]

[3272] 5061: AF022049 Homo sapiens natural killer cell inhibitory receptor KIR3DL1 variant mRNA, complete cds gi|2760898|gb|AF022049.1|AF022049[2760898]

[3273] 5062: AF022048 Homo sapiens natural killer cell inhibitory receptor KIR2DL3 variant mRNA, complete cds gi|2760896|gb|AF022048.1|AF022048[2760896]

[3274] 5066: AF361880 Homo sapiens neurokinin-2 receptor gene, partial cds gi|14010294|gb|AF361880.1|AF361880[14010294]

[3275] 5068: AF209923 Homo sapiens orphan G-protein coupled receptor (GPRC5D) mRNA, complete cds gi|8118039|gb|AF209923.1|AF209923[8118039]

[3276] 5069: AF207989 Homo sapiens orphan G-protein coupled receptor (GPRC5C) mRNA, complete cds gi|811803|gb|AF207989.1|AF207989[8118031]

[3277] 5070: AB018076 Homo sapiens hedgehog gene, exon 3 and complete cds gi|13990993|dbj|AB018076.2|AB010092S3[13990993]

[3278] 5071: SEG_AB010092S Homo sapiens hedgehog gene gi|13990992|dbj||SEG_AB010092S[13990992]

[3279] 5072: NM—018980 Homo sapiens taste receptor, type 2, member 5 (TAS2R5), mRNA gi|9507172|ref|NM—018980.1|[9507172]

[3280] 5073: NM—016945 Homo sapiens taste receptor, type 2, member 16 (TAS2R16), mRNA gi|8394394|ref|NM—016945.1|[8394394]

[3281] 5074: AB018075 Homo sapiens hedgehog gene, exon 2 gi|3702725|dbj|AB018075.1|AB010092S2[3702725]

[3282] 5075: AB010092 Homo sapiens hedgehog gene, exon 1 gi|2810977|dbj|AB010092.1|AB010092S1[2810977]

[3283] 5076: AF130867 Homo sapiens smoothened mRNA, partial cds gi|4732138|gb|AF130867.1|AF130867[4732138]

[3284] 5077: AF363791 Homo sapiens histamine receptor H3S (HRH3) mRNA, complete cds gi|13937081|gb|AF363791.1|AF363791[13937081]

[3285] 5078: AF363452 Homo sapiens NK cell type I receptor protein 2B4 (CD244) mRNA, partial cds, alternatively spliced gi|13937022|gb|AF363452.1|AF363452[13937022]

[3286] 5079: AY029486 Homo sapiens G protein gamma subunit 13 mRNA, complete cds gi|13936268|gb|AY029486.1|[13936268]

[3287] 5080: AF224497 Homo sapiens CC chemokine receptor 3 (CCR3) gene, exon 2 and partial cds gi|3924486|gb|AF224497.1|AF224496S2[13924486]

[3288] 5081: AF224496 Homo sapiens CC chemokine receptor 3 (CCR3) gene, exon 1 gi|3924485|gb|AF224496.1|AF224496S1[13924485]

[3289] 5082: AH010691 Homo sapiens CC chemokine receptor 3 (CCR3) gene, partial cds gi|13924484|gb|AH010691.1|SEG_AF224496S[13924484]

[3290] 5083: AF224495 Homo sapiens CC chemokine receptor 3 (CCR3) mRNA, partial cds gi|3924481|gb|AF224495.1|AF224495[13924481]

[3291] 5084: AF251120 Homo sapiens interleukin-1-related protein short isoform mRNA, complete cds; alternatively spliced gi|10185739|gb|AF251120.1|AF251120[10185739]

[3292] 5085: AF251119 Homo sapiens interleukin-1-related protein long isoform mRNA, complete cds; alternatively spliced gi|10185737|gb|AF251119.1|AF251119[10185737]

[3293] 5086: AF251118 Homo sapiens interleukin-1-related protein long isoform a mRNA, complete cds; alternatively spliced gi|10185735|gb|AF251118.1|AF251118[10185735]

[3294] 5087: AF103013 Homo sapiens JME clone 4 KIR3DL1-like natural killer cell receptor mRNA, complete cds gi|3983423|gb|AF103013.1|AF103013[3983423]

[3295] 5088: AF103012 Homo sapiens JME clone 3 KIR3DL1-like natural killer cell receptor mRNA, complete cds gi|3983421|gb|AF103012.1|AF103012[3983421]

[3296] 5089: AF103011 Homo sapiens JME clone 2 KIR3DL1-like natural killer cell receptor mRNA, complete cds gi|3983419|gb|AF103011.1|AF103011[3983419]

[3297] 5090: AF103010 Homo sapiens JME clone 1 KIR3DL1-like natural killer cell receptor mRNA, complete cds gi|3983417|gb|AF103010.1|AF103010[3983417]

[3298] 5091: AF353183 Homo sapiens discoidin domain receptor DDR1e (DDR1) mRNA, partial cds, alternatively spliced gi|13898644|gb|AF353183.1|AF353183[13898644]

[3299] 5092: AF353182 Homo sapiens discoidin domain receptor DDR1d (DDR1) mRNA, partial cds, alternatively spliced gi|13898642|gb|AF353182.1|AF353182[13898642]

[3300] 5096: AF014112 Homo sapiens phenol UDP-glucuronosyltransferase (UGT1A6) gene, partial cds gi|2645490|gb|AF014112.1|AF014112[2645490]

[3301] 5097: AJ293654 Homo sapiens partial IL4RA gene for interleukin-4 receptor alfa chain, exon 11, ARSPRV allele gi|12054061|emb|AJ293654.1|HSA293654[12054061]

[3302] 5098: AJ293653 Homo sapiens partial IL4RA gene for interleukin-4 receptor alfa chain, exon 11, ACSPRV allele gi|12054059|emb|AJ293653.1|HSA293653[12054059]

[3303] 5099: AJ293652 Homo sapiens partial IL4RA gene for interleukin-4 receptor alfa chain, exon 11, ACSSRI allele gi|12054057|emb|AJ293652.1|HSA293652[12054057]

[3304] 5100: AJ293651 Homo sapiens partial IL4RA gene for interleukin-4 receptor alfa chain, exon 11, ECLPRV allele gi|12054055|emb|AJ293651.1|HSA293651[12054055]

[3305] 5101: AJ293650 Homo sapiens partial IL4RA gene for interleukin-4 receptor alfa chain, exon 11, ECSPRV allele gi|12054053|emb|AJ293650.1|HSA293650[12054053]

[3306] 5102: AJ293649 Homo sapiens partial IL4RA gene for interleukin-4 receptor alfa chain, exon 11, ECSSRV allele gi|12054051|emb|AJ293649.1|HSA293649[12054051]

[3307] 5103: AJ293648 Homo sapiens partial IL4RA gene for interleukin-4 receptor alfa chain, exon 11, ECSPQV allele gi|12054049|emb|AJ293648.1|HSA293648[12054049]

[3308] 5104: AJ293647 Homo sapiens partial IL4RA gene for interleukin-4 receptor alfa chain, exon 11, ECSSQV allele gi|12054047|emb|AJ293647.1|HSA293647[12054047]

[3309] 5105: AF329449 Homo sapiens histamine receptor H4 mRNA, complete cds gi|13876643|gb|AF329449.1|AF329449[13876643]

[3310] 5106: AF276893 Homo sapiens p21-activated protein kinase 6 (PAK6) mRNA, complete cds gi|9082305|gb|AF276893.1|AF276893[9082305]

[3311] 5107: AY029324 Homo sapiens mRNA sequence gi|13752242|gb|AY029324.1|[13752242]

[3312] 5108: AF307337 Homo sapiens ALPP, ALPPL2, ALPI, XCE, CHRND, and CHRNG genes, complete sequence gi|10732831|gb|AF307337.1|AF307337[10732831]

[3313] 5109: Z75190 H.sapiens mRNA for apolipoprotein E receptor 2 gi|1834533|emb|Z75190.1|HSZ75190[1834533]

[3314] 5110: NM—004523 Homo sapiens kinesin-like 1 (KNSL1), mRNA gi|113699823|ref|NM—004523.2|[13699823]

[3315] 5111: NM—006646 Homo sapiens WAS protein family, member 3 (WASF3), mRNA gi|13699802|ref|NM—006646.2|[13699802]

[3316] 5112: NM—030667 Homo sapiens protein tyrosine phosphatase, receptor type, O (PTPRO), transcript variant 1, mRNA gi|13677213|ref|NM—030667.1|[13677213]

[3317] 5113: NM—002848 Homo sapiens protein tyrosine phosphatase, receptor type, O (PTPRO), transcript variant 2, mRNA gi|13677212|ref|NM—002848.2|[13677212]

[3318] 5114: NM—006990 Homo sapiens WAS protein family, member 2 (WASF2), mRNA gi|11386182|ref|NM—006990.1|[11386182]

[3319] 5115: AF250309 Homo sapiens putative cytokine receptor CRL4 precusor mRNA, complete cds gi|13649476|gb|AF250309.1|AF250309[13649476]

[3320] 5116: AY029180 Homo sapiens soluble urokinase plasminogen activator receptor precursor (SUPAR) mRNA, complete cds gi|13641308|gb|AY029180.1|[13641308]

[3321] 5117: AF346711 Homo sapiens G-protein couple receptor (GPR48) gene, exons 3 through 18, and complete cds gi|13569576|gb|AF346711.1|AF346709S3[13569576]

[3322] 5118: AF346710 Homo sapiens G-protein couple receptor (GPR48) gene, exon 2 gi|13569575|gb|AF346710.1|AF346709S2[13569575]

[3323] 5119: AF346709 Homo sapiens G-protein couple receptor (GPR48) gene, exon 1 gi|13569574|gb|AF346709.1|AF346709S1[13569574]

[3324] 5120: AH010608 Homo sapiens G-protein couple receptor (GPR48) gene, complete cds gi|13569573|gb|AH010608.1|SEG_AF346709S[13569573]

[3325] 5121: AF251059 Homo sapiens FGF receptor 4b mRNA, complete cds gi|13625179|gb|AF251059.1|AF251059[13625179]

[3326] 5122: AF251055 Homo sapiens 5-HT receptor mRNA, complete cds gi|13625171|gb|AF251055.1|AF251055[13625171]

[3327] 5123: NM—030905 Homo sapiens olfactory receptor, family 2, subfamily J, member 2 (OR2J2), mRNA gi|13624330|ref|NM—030905.1|[13624330]

[3328] 5124: NM—012377 Homo sapiens olfactory receptor, family 7, subfamily C, member 2 (OR7C2), mRNA gi|13624324|ref|NM—012377.1|[13624324]

[3329] 5125: AB043703 Homo sapiens FZD8 mRNA for seven-transmembrane receptor Frizzled-8, complete cds gi|13623798|dbj|AB043703.1|AB043703[13623798]

[3330] 5126: AB051851 Homo sapiens DR3 gene for death receptor 3, complete cds, mutant DR3 sequnce gi|13537362|dbj|A]3051851.1|AB051851[13537362]

[3331] 5127: AB051850 Homo sapiens DR3 gene for death receptor 3, complete cds gi|13537360|dbj|AB051850.1|AB051850[13537360]

[3332] 5128: AF349939 Homo sapiens prolactin receptor isoform delta S1 precursor, mRNA, complete cds gi|3605397|gb|AF349939.1|AF349939[13605397]

[3333] 5130: AF346629 Homo sapiens channel-kinase 1 (CHAK1) mRNA, complete cds gi|13562152|gb|AF346629.2|AF346629[13562152]

[3334] 5131: NM—012373 Homo sapiens olfactory receptor, family 3, subfamily A, member 3 (OR3A3), mRNA gi|13562103|ref|NM—012373.1|[13562103]

[3335] 5132: AF056979 Homo sapiens clone YAN1 interferon-gamma receptor mRNA, complete cds gi|13562048|gb|AF056979.1|AF056979[13562048]

[3336] 5133: NM—017506 Homo sapiens olfactory receptor, family 7, subfamily C, member 1 (OR7C1), mRNA gi|9506798|ref|NM—017506.1|[9506798]

[3337] 5134: AF222689 Homo sapiens protein arginine N-methyltransferase 1 (HRMT1L2) gene, complete cds, alternatively spliced gi|7453574|gb|AF222689.1|AF222689[7453574]

[3338] 5135: NM—005137 Homo sapiens DiGeorge syndrome critical region gene 2 (DGCR2), mRNA gi|4826693|ref|NM—005137.1|[4826693]

[3339] 5136: AC002533 Homo sapiens clone SCb-24C13 from 7q31.3, complete sequence gi|2388587|gb|AC002533.1|AC002533[2388587]

[3340] 5139: AF263617 Homo sapiens killer cell immunoglobulin-like receptor 3DL2 (KIR3DL2) mRNA, KIR3DL2*00901 allele, complete cds gi|13560454|gb|AF263617.1|AF263617[13560454]

[3341] 5140: AF262974 Homo sapiens killer cell immunoglobulin-like receptor 3DL1 (KIR3DL1) mRNA, KIR3DL1*00801 allele, complete cds gi|13560452|gb|AF262974.1|AF262974[13560452]

[3342] 5141: AF262973 Homo sapiens killer cell immunoglobulin-like receptor 3DL1 (KIR3DL1) mRNA, KIR3DL1*00701 allele, complete cds gi|13560450|gb|AF262973.1|AF262973[13560450]

[3343] 5142: AF262972 Homo sapiens killer cell immunoglobulin-like receptor 3DL1 (KIR3DL1) mRNA, KIR3DL1*00601 allele, partial cds gi|13560448|gb|AF262972.1|AF262972[13560448]

[3344] 5143: AF262971 Homo sapiens killer cell immunoglobulin-like receptor 3DL1 (KIR3DL1) mRNA, KIR3DL1*00501 allele, partial cds gi|13560446|gb|AF262971.1|AF262971[13560446]

[3345] 5144: AF262970 Homo sapiens killer cell immunoglobulin-like receptor 3DL1 (KIR3DL1) mRNA, KIR3DL1*00402 allele, partial cds gi|3560444|gb|AF262970.1|AF262970[13560444]

[3346] 5145: AF262969 Homo sapiens killer cell immunoglobulin-like receptor 3DL1 (KIR3DL1) mRNA, KIR3DL1*00401 allele, partial cds gi|13560442|gb|AF262969.1|AF262969[13560442]

[3347] 5146: AF262968 Homo sapiens killer cell immunoglobulin-like receptor 3DL1 (KIR3DL1) mRNA, KIR3DL1*00102 allele, partial cds gi|3560440|gb|AF262968.1|AF262968[13560440]

[3348] 5147: AF262967 Homo sapiens killer cell immunoglobulin-like receptor 3DL2 (KIR3DL2) mRNA, KIR3DL2*00801 allele, complete cds gi|13560438|gb|AF262967.1|AF262967[13560438]

[3349] 5148: AF262966 Homo sapiens killer cell immunoglobulin-like receptor 3DL2 (KIR3DL2) mRNA, KIR3DL2*00601 allele, partial cds gi|13560436|gb|AF262966.1|AF262966[13560436]

[3350] 5149: AF262965 Homo sapiens killer cell immunoglobulin-like receptor 3DL2 (KIR3DL2) mRNA, KIR3DL2*00701 allele, partial cds gi|3560434|gb|AF262965.1|AF262965[13560434]

[3351] 5150: AF348491 Homo sapiens chemokine receptor CXCR4 mRNA, complete cds gi|13549089|gb|AF348491.1|AF348491[13549089]

[3352] 5151: AF295368 Homo sapiens G-protein coupled receptor GPR86 (GPR86) mRNA, complete cds gi|12711484|gb|AF295368.1|AF295368[12711484]

[3353] 5152: AF237763 Homo sapiens orphan G protein-coupled receptor 87 (GPR87) mRNA, complete cds gi|12711472|gb|AF237763.1|AF237763[12711472]

[3354] 5153: AF237762 Homo sapiens orphan G protein-coupled receptor 84 (GPR84) mRNA, complete cds gi|12711470|gb|AF237762.1|AF237762[12711470]

[3355] 5154: NM—004248 Homo sapiens G protein-coupled receptor 10 (GPR10), mRNA gi|4758473|ref|NM—004248.1|[4758473]

[3356] 5155: AC000099 Homo sapiens chromosome 7 map 7q31.3 cosmid g0771a003, complete sequence gi|1764159|gb|AC000099.1|HSAC000099[1764159]

[3357] 5156: NM030784 Homo sapiens brain expressed G-protein-coupled receptor PSP24 beta (PSP24B), mRNA gi|13540556|ref|NM—030784.1|[13540556]

[3358] 5157: NM—030774 Homo sapiens prostate specific G-protein coupled receptor (PSGR), mRNA gi|13540538|ref|NM—030774.1|[13540538]

[3359] 5158: NM—030764 Homo sapiens SH2 domain-containing phosphatase anchor protein 1 (SPAP1), mRNA gi|13540524|ref|NM—030764.1|[13540524]

[3360] 5160: AJ249921 Homo sapiens intergenic region between apoE and apoCI genes gi|6006507|emb|AJ249921.1|HSA249921[6006507]

[3361] 5161: AF050737 Homo sapiens dopamine D2 receptor (DRD2) gene, complete cds gi|3820491|gb|AF050737.1|AF050737[3820491]

[3362] 5162: NM—004987 Homo sapiens LIM and senescent cell antigen-like domains 1 (LIMS1), mRNA gi|13518025|ref|NM—004987.2|[13518025]

[3363] 5163: AF348078 Homo sapiens G-protein coupled receptor 91 (GPR91) mRNA, complete cds gi|13517982|gb|AF348078.1|AF348078[13517982]

[3364] 5164: AJ276125 Homo sapiens mRNA for inhibitory NK receptor (kir3d gene) gi|13516222|emb|AJ276125.1|HSA276125[13516222]

[3365] 5165: AF246999 Homo sapiens TRADEbeta mRNA, complete cds gi|13506909|gb|AF246999.1|AF246999[13506909]

[3366] 5166: AF246998 Homo sapiens TRADEalpha mRNA, complete cds gi|13506907|gb|AF246998.1|AF246998[13506907]

[3367] 5167: AF263450 Homo sapiens dopamine D3 receptor (DRD3) gene, exon 2 and partial cds gi|13506728|gb|AF263450.1|AF148807S2[13506728]

[3368] 5168: AF148807 Homo sapiens dopamine D3 receptor (DRD3) gene, exon 1 gi|13506727|gb|AF148807.1|AF148807S1[13506727]

[3369] 5169: AH010591 Homo sapiens dopamine D3 receptor (DRD3) gene, partial cds gi|13506726|gb|AH010591.1|SEG_AF148807S[13506726]

[3370] 5170: Y18388 Homo sapiens CD163 gene, exon 1 and joined CDS gi|5107944|emb|Y18388.1|HSA118388[5107944]

[3371] 5171: NM—002183 Homo sapiens interleukin 3 receptor, alpha (low affinity) (IL3RA), mRNA gi|13324709|ref|NM—002183.1|[13324709]

[3372] 5172: AF142570 Homo sapiens cytokine receptor CRL2 precusor (CRL2) mRNA, complete cds gi|11055018|gb|AF142570.1|AF142570[11055018]

[3373] 5173: NM—006140 Homo sapiens colony stimulating factor 2 receptor, alpha, low-affinity (granulocyte-macrophage) (CSF2RA), mRNA gi|5453626|ref|NM—006140.1|[5453626]

[3374] 5174: NM—002186 Homo sapiens interleukin 9 receptor (IL9R), mRNA gi|4504684|ref|NM—002186.1|[4504684]

[3375] 5175: AF296673 Homo sapiens toll-like receptor 10 mRNA, complete cds gi|13447752|gb|AF296673.1|AF296673[13447752]

[3376] 5176: AF284095 Homo sapiens alpha-2A adrenergic receptor mRNA, complete cds gi|13447750|gb|AF284095.1|AF284095[13447750]

[3377] 5177: AF279689 Homo sapiens fibroblast growth factor receptor 5 (FGFR5) mRNA, complete cds gi|13447748|gb|AF279689.1|AF279689[13447748]

[3378] 5178: NM—000861 Homo sapiens histamine receptor H1 (HRH1), mRNA gi|13435403|ref|NM—000861.2|[13435403]

[3379] 5179: NM—001514 Homo sapiens general transcription factor IIB (GTF2B), mRNA gi|13435384|ref|NM—001514.2|[13435384]

[3380] 5180: NM—022845 Homo sapiens core-binding factor, beta subunit (CBFB), transcript variant 1, mRNA gi|13124880|ref|NM—022845.1|[13124880]

[3381] 5181: AF213460 Homo sapiens ephrin receptor EPHA3 secreted form (EPHA3) mRNA, complete cds gi|12003436|gb|AF213460.1|AF213460[12003436]

[3382] 5182: AF213459 Homo sapiens ephrin receptor EPHA3 complete form (EPHA3) mRNA, complete cds gi|12003434|gb|AF213459.1|AF213459[12003434]

[3383] 5183: NM—019599 Homo sapiens taste receptor, type 2, member 1 (TAS2R1), mRNA gi|9625042|ref|NM—019599.1|[9625042]

[3384] 5184: NM—017579 Homo sapiens deleted in malignant brain tumors 1 (DMBT1), transcript variant 3, mRNA gi|8923739|ref|NM—017579.1|[8923739]

[3385] 5185: AJ306481 Homo sapiens partial CHRNA5 gene for neuronal nicotinic acetylcholine receptor alpha-5 subunit, exon 1 and joined CDS gi|13400975|emb|AJ306481.1|HSA306481[13400975]

[3386] 5186: AJ306454 Homo sapiens partial CHRNB4 gene for neuronal nicotinic acetylcholine receptor beta-4 subunit, exon 1 and joined CDS gi|13400963|emb|AJ306454.1|HSA3064S4[13400963]

[3387] 5187: NM—024317 Homo sapiens immunoglobulin-like transcript 10 (ILT10), mRNA gi|13399319|ref|NM—024317.1|[13399319]

[3388] 5188: NM—020070 Homo sapiens immunoglobulin lambda-like polypeptide 1 (IGLL1), mRNA gi|13399297|ref|NM020070.1|[13399297]

[3389] 5189: NM—002383 Homo sapiens MYC-associated zinc finger protein (purine-binding transcription factor) (MAZ), mRNA gi|13399295|ref|NM—002383.1|[13399295]

[3390] 5190: AJ306486 Homo sapiens partial CHRNA5 gene for neuronal nicotinic acetylcholine receptor alpha-5 subunit, exon 6 gi|13399189|emb|AJ306486.1|HSA306486[13399189]

[3391] 5191: AJ306485 Homo sapiens partial CHRNA5 gene for neuronal nicotinic acetylcholine receptor alpha-5 subunit, exon 5 gi|13399188|emb|AJ306485.1|HSA306485[13399188]

[3392] 5192: AJ306484 Homo sapiens partial CHRNA5 gene for neuronal nicotinic acetylcholine receptor alpha-5 subunit, exon 4 gi|13399187|emb|AJ306484.1|HSA306484[13399187]

[3393] 5193: AJ306483 Homo sapiens partial CHRNA5 gene for neuronal nicotinic acetylcholine receptor alpha-5 subunit, exon 3 gi|13399186|emb|AJ306483.1|HSA306483[13399186]

[3394] 5194: AJ306482 Homo sapiens partial CHRNA5 gene for neuronal nicotinic acetylcholine receptor alpha-5 subunit, exon 2 gi|13399185|emb|AJ306482.1|HSA306482[13399185]

[3395] 5195: AJ306459 Homo sapiens partial CHRNB4 gene for neuronal nicotinic acetylcholine receptor beta-4 subunit, exon 6 gi|13399184|emb|AJ306459.1|HSA306459[13399184]

[3396] 5196: AJ306458 Homo sapiens partial CHRNB4 gene for neuronal nicotinic acetylcholine receptor beta-4 subunit, exon 5 gi|13399183|emb|AJ306458.1|HSA306458[13399183]

[3397] 5197: AJ306457 Homo sapiens partial CHRNB4 gene for neuronal nicotinic acetylcholine receptor beta-4 subunit, exon 4 gi|13399182|emb|AJ306457.1|HSA306457[13399182]

[3398] 5198: AJ306456 Homo sapiens partial CHRNB4 gene for neuronal nicotinic acetylcholine receptor beta-4 subunit, exon 3 gi|13399181|emb|AJ306456.1|HSA306456[13399181]

[3399] 5199: AJ306455 Homo sapiens partial CHRNB4 gene for neuronal nicotinic acetylcholine receptor beta-4 subunit, exon 2 gi|13399180|emb|AJ306455.1|HSA306455[13399180]

[3400] 5200: AJ291675 Homo sapiens mRNA for putative GDNF family receptor alpha 4, secreted isoform c (GFRA4 gene) gi|12038960|emb|AJ291675.1|HSA291675[12038960]

[3401] 5201: AJ291674 Homo sapiens mRNA for putative GDNF family receptor alpha 4, GPI anchored isoform b (GFRA4 gene) gi|12038958|emb|AJ291674.1|HSA291674[12038958]

[3402] 5202: AJ291673 Homo sapiens mRNA for GDNF family receptor alpha 4, GPI anchored isoform (GFRA4 gene) gi|12038956|emb|AJ291673.1|HSA291673[12038956]

[3403] 5203: AF245704 Homo sapiens toll-like receptor 9 (TLR9) mRNA, complete cds gi|8575528|gb|AF245704.1|AF245704[8575528]

[3404] 5204: AF245703 Homo sapiens toll-like receptor 8 (TLR8) mRNA, complete cds gi|8575526|gb|AF245703.1|AF245703[8575526]

[3405] 5205: AF245702 Homo sapiens toll-like receptor 7 (TLR7) mRNA, complete cds gi|8575524|gb|AF245702.1|AF245702[8575524]

[3406] 5206: NM—016944 Homo sapiens taste receptor, type 2, member 4 (TAS2R4), mRNA gi|8394401|ref|NM—016944.1|[8394401]

[3407] 5207: NM—016943 Homo sapiens taste receptor, type 2, member 3 (TAS2R3), mRNA gi|8394397|ref|NM—016943.1|[8394397]

[3408] 5209: AF307776 Homo sapiens beta-1 adrenergic receptor gene, 5′ UTR and partial cds gi|11837864|gb|AF307776.1|AF307776[11837864]

[3409] 5210: AB026043 Homo sapiens mRNA for MS4A7, complete cds gi|11559249|dbj|AB026043.1|AB026043[11559249]

[3410] 5211: AB013104 Homo sapiens mRNA for MS4A6, complete cds gi|1559215|dbj|AB013104.1|AB013104[11559215]

[3411] 5212: AB013103 Homo sapiens mRNA for MS4A5, complete cds gi|11559213|dbj|AB013103.1|AB013103[11559213]

[3412] 5213: AB013102 Homo sapiens mRNA for MS4A4, complete cds gi|1155921|dbj|AB013102.1|AB013102[11559211]

[3413] 5215: NM—003789 Homo sapiens TNFRSF1A-associated via death domain (TRADD), mRNA gi|13378136|ref|NM—003789.1|[13378136]

[3414] 5216: NM—025218 Homo sapiens UL16-binding protein 1 (ULBP1), mRNA gi|13376825|ref|NM—025218.1|[13376825]

[3415] 5217: NM—025217 Homo sapiens UL16-binding protein 2 (ULBP2), mRNA gi|13376823|ref|NM—025217.1|[13376823]

[3416] 5218: NM—024518 Homo sapiens UL16-binding protein 3 (ULBP3), mRNA gi|13375655|ref|NM—024518.1|[13375655]

[3417] 5220: AB052103 Homo sapiens SRCL mRNA for scavenger receptor with C-type lectin type II, complete cds gi|113365552|dbj|AB052103.1|AB052103[13365552]

[3418] 5221: AB038518 Homo sapiens SRCL mRNA for scavenger receptor with C-type lectin type I, complete cds gi|13365514|dbj|AB038518.1|AB038518[13365514]

[3419] 5222: NM—021708 Homo sapiens leukocyte-associated Ig-like receptor 1 (LARIR1), transcript variant d, mRNA gi|11231178|ref|NM—021708.1|[11231178]

[3420] 5223: NM—021706 Homo sapiens leukocyte-associated Ig-like receptor 1 (LAIR1), transcript variant b, mRNA gi|11231176|ref|NM—021706.1|[11231176]

[3421] 5224: NM—002287 Homo sapiens leukocyte-associated Ig-like receptor 1 (LAIR1), transcript variant a, mRNA gi|11231175|ref|NM002287.2|[11231175]

[3422] 5225: AB038237 Homo sapiens mRNA for G protein-coupled receptor C5L2, complete cds gi|7707800|dbj|AB038237.1|AB038237[7707800]

[3423] 5226: S82756 Homo sapiens T cell receptor (Vbeta8.2-N1DbetaN2-Jbeta1.6) mRNA, partial cds gi|1835847|gb|S82756.1|S82756[1835847]

[3424] 5227: S82754 Homo sapiens T cell receptor mRNA, partial cds gi|1835843|gb|S82754.1|S82754[1835843]

[3425] 5233: NM—024318 Homo sapiens immunoglobulin-like transcript 8 (ILT8), mRNA gi|13324689|ref|NM—024318.1|[13324689]

[3426] 5234: AF178982 Homo sapiens putative G protein-coupled receptor GPCR1 precursor, mRNA, complete cds gi|13324450|gb|AF178982.1|AF178982[13324450]

[3427] 5236: NM—021956 Homo sapiens glutamate receptor, ionotropic, kainate 2 (GRIK2), mRNA gi|11386136|ref|NM—021956.1|[11386136]

[3428] 5237: NM—018724 Homo sapiens interleukin 20 (IL20), mRNA gi|11036633|ref|NM—018724.1|[11036633]

[3429] 5238: AJ295846 Homo sapiens mRNA for endosialin protein gi|3277300|emb|AJ295846.1|HSA295846[13277300]

[3430] 5242: AF310249 Homo sapiens peroxisome proliferator activated receptor gamma 2 gene, upstream sequence gi|13274397|gb|AF310249.1|AF310249[13274397]

[3431] 5243: AF321815 Homo sapiens G-protein coupled receptor SP1999 mRNA, complete cds gi|12656597|gb|AF321815.1|AF321815[12656597]

[3432] 5244: AL136818 Homo sapiens mRNA; cDNA DKFZp434F1726 (from clone DKFZp434F1726) gi|12053146|emb|AL136818.1|HSM801786[12053146]

[3433] 5245: AF285440 Homo sapiens clone KIR2DS4v1 killer-cell Ig-like receptor mRNA, complete cds gi|11385699|gb|AF285440.1|AF285440[11385699]

[3434] 5246: AF285439 Homo sapiens clone KIR2DS2v2 killer-cell Ig-like receptor mRNA, complete cds gi|11385697|gb|AF285439.1|AF285439[11385697]

[3435] 5247: AF285438 Homo sapiens clone KIR2DS2v1 killer-cell Ig-like receptor mRNA, partial cds gi|11385695|gb|AF285438.1|AF285438[11385695]

[3436] 5248: AF285437 Homo sapiens clone KIR2DS1v2 killer-cell Ig-like receptor mRNA, partial cds gi|11385693|gb|AF285437.1|AF285437[11385693]

[3437] 5249: AF285436 Homo sapiens clone KIR2DL4v4 killer-cell Ig-like receptor mRNA, complete cds gi|1385691|gb|AF285436.1|AF285436[11385691]

[3438] 5250: AF285435 Homo sapiens clone KIR2DL3v2 killer-cell Ig-like receptor mRNA, partial cds gi|11385689|gb|AF285435.1|AF285435[11385689]

[3439] 5251: AF285434 Homo sapiens clone KIR2DL2v2 killer-cell Ig-like receptor mRNA, partial cds gi|11385687|gb|AF285434.1|AF285434[11385687]

[3440] 5252: AF285433 Homo sapiens clone KIR2DL2v1 killer-cell Ig-like receptor mRNA, partial cds gi|11385685|gb|AF285433.1|AF285433[11385685]

[3441] 5253: AF285432 Homo sapiens clone KIR2DL1v3 killer-cell Ig-like receptor mRNA, partial cds gi|11385683|gb|AF285432.1|AF285432[11385683]

[3442] 5254: AF285431 Homo sapiens clone KIR2DL1v2 killer-cell Ig-like receptor mRNA, complete cds gi|11385681|gb|AF285431.1|AF285431[11385681]

[3443] 5255: AJ245872 Homo sapiens mRNA for putative truncated metabotropic glutamatereceptor 6 form b, partial (tr-mGluR6 b) gi|6688173|emb|AJ245872.1|HSA245872[6688173]

[3444] 5256: AJ245871 Homo sapiens mRNA for putative truncated metabotropic glutamatereceptor 6 form a, partial (tr-mGluR6 a) gi|6688171|emb|AJ245871.1|HSA245871[6688171]

[3445] 5258: AL050262 Homo sapiens mRNA; cDNA DKFZp564I0682 (from clone DKFZp564I0682); complete cds gi|4886482|emb|AL050262.1|HSM800268[4886482]

[3446] 5259: AF308820 Homo sapiens adrenocorticotropin receptor gene, upstream sequence gi|13272368|gb|AF308820.1|AF308820[13272368]

[3447] 5260: NM—014432 Homo sapiens interleukin 20 receptor, alpha (IL20RA), mRNA gi|7657690|ref|NM—014432.1|[7657690]

[3448] 5261: NM—004967 Homo sapiens integrin-binding sialoprotein (bone sialoprotein, bone sialoprotein II) (IBSP), mRNA gi|13259536|ref|NM—004967.2|[13259536]

[3449] 5270: AF348323 Homo sapiens nociceptin receptor (ORL1) mRNA, complete cds gi|13022242|gb|AF348323.1|AF348323[13022242]

[3450] 5272: S79217 Homo sapiens Ca(2+)-sensing receptor mRNA, partial cds gi|1050985|gb|S79217.1|S79217[1050985]

[3451] 5273: S78723 Homo sapiens serotonin 5-HT2A receptor (5-HT2A R) gene, partial cds gi|1042173|gb|S78723.1|S78723[1042173]

[3452] 5274: S78505 Homo sapiens prolactin receptor mRNA, partial cds gi|999114|gb|S78505.1|S78505[999114]

[3453] 5277: S77555 Homo sapiens corticotropin receptor/ACTH receptor gene, partial cds gi|957294|gb|S77555.1|S77555[957294]

[3454] 5278: NM—024012 Homo sapiens 5-hydroxytryptamine (serotonin) receptor 5A (HTR5A), mRNA gi|13236496|ref|NM—024012.1|[13236496]

[3455] 5279: NM—021904 Homo sapiens gamma-aminobutyric acid (GABA) B receptor, 1 (GABBR1), transcript variant 3, mRNA gi|11497613|ref|NM—021904.1|[11497613]

[3456] 5280: NM—021903 Homo sapiens gamma-aminobutyric acid (GABA) B receptor, 1 (GABBR1), transcript variant 2, mRNA gi|11497611|ref|NM—021903.1|[11497611]

[3457] 5281: NM—001470 Homo sapiens gamma-aminobutyric acid (GABA) B receptor, 1 (GABBR1), transcript variant 1, mRNA gi|10835014|ref|NM—001470.1|[10835014]

[3458] 5282: NM—007329 Homo sapiens deleted in malignant brain tumors 1 (DMBT1), transcript variant 2, mRNA gi|6633800|ref|NM—007329.1|[6633800]

[3459] 5283: S71404 Homo sapiens interleukin-9 receptor mRNA, partial cds gi|551356|gb|S71404.1|S71404[551356]

[3460] 5356: NM—023031 Homo sapiens fibroblast growth factor receptor 2 (bacteria-expressed kinase, keratinocyte growth factor receptor, craniofacial dysostosis 1, Crouzon syndrome, Pfeiffer syndrome, Jackson-Weiss syndrome) (FGFR2), transcript variant 13, mRNA gi|13186272|ref|NM—023031.1|[13186272]

[3461] 5357: NM—023030 Homo sapiens fibroblast growth factor receptor 2 (bacteria-expressed kinase, keratinocyte growth factor receptor, craniofacial dysostosis 1, Crouzon syndrome, Pfeiffer syndrome, Jackson-Weiss syndrome) (FGFR2), transcript variant 12, mRNA gi|13186270|ref|NM—023030.1|[13186270]

[3462] 5358: NM—023028 Homo sapiens fibroblast growth factor receptor 2 (bacteria-expressed kinase, keratinocyte growth factor receptor, craniofacial dysostosis 1, Crouzon syndrome, Pfeiffer syndrome, Jackson-Weiss syndrome) (FGFR2), transcript variant 10, mRNA gi|13186268|ref|NM—023028.1|[13186268]

[3463] 5359: NM—022976 Homo sapiens fibroblast growth factor receptor 2 (bacteria-expressed kinase, keratinocyte growth factor receptor, craniofacial dysostosis 1, Crouzon syndrome, Pfeiffer syndrome, Jackson-Weiss syndrome) (FGFR2), transcript variant 9, mRNA gi|13186266|ref|NM—022976.1|[13186266]

[3464] 5360: NM—022975 Homo sapiens fibroblast growth factor receptor 2 (bacteria-expressed kinase, keratinocyte growth factor receptor, craniofacial dysostosis 1, Crouzon syndrome, Pfeiffer syndrome, Jackson-Weiss syndrome) (FGFR2), transcript variant 8, mRNA gi|13186264|ref|NM—022975.1|[13186264]

[3465] 5361: NM—022974 Homo sapiens fibroblast growth factor receptor 2 (bacteria-expressed kinase, keratinocyte growth factor receptor, craniofacial dysostosis 1, Crouzon syndrome, Pfeiffer syndrome, Jackson-Weiss syndrome) (FGFR2), transcript variant 7, mRNA gi|13186262|ref|NM—022974.1|[13186262]

[3466] 5362: NM—022973 Homo sapiens fibroblast growth factor receptor 2 (bacteria-expressed kinase, keratinocyte growth factor receptor, craniofacial dysostosis 1, Crouzon syndrome, Pfeiffer syndrome, Jackson-Weiss syndrome) (FGFR2), transcript variant 6, mRNA gi|13186260|ref|NM—022973.1|[13186260]

[3467] 5363: NM—022972 Homo sapiens fibroblast growth factor receptor 2 (bacteria-expressed kinase, keratinocyte growth factor receptor, craniofacial dysostosis 1, Crouzon syndrome, Pfeiffer syndrome, Jackson-Weiss syndrome) (FGFR2), transcript variant 5, mRNA gi|13186258|ref|NM—022972.1|[13186258]

[3468] 5364: NM—022971 Homo sapiens fibroblast growth factor receptor 2 (bacteria-expressed kinase, keratinocyte growth factor receptor, craniofacial dysostosis 1, Crouzon syndrome, Pfeiffer syndrome, Jackson-Weiss syndrome) (FGFR2), transcript variant 4, mRNA gi|13186256|ref|NM—022971.1|[13186256]

[3469] 5365: NM—022970 Homo sapiens fibroblast growth factor receptor 2 (bacteria-expressed kinase, keratinocyte growth factor receptor, craniofacial dysostosis 1, Crouzon syndrome, Pfeiffer syndrome, Jackson-Weiss syndrome) (FGFR2), transcript variant 3, mRNA gi|13186254|ref|NM—022970.1|[13186254]

[3470] 5366: NM—022969 Homo sapiens fibroblast growth factor receptor 2 (bacteria-expressed kinase, keratinocyte growth factor receptor, craniofacial dysostosis 1, Crouzon syndrome, Pfeiffer syndrome, Jackson-Weiss syndrome) (FGFR2), transcript variant 2, mRNA gi|13186252|ref|NM—022969.1|[13186252]

[3471] 5367: NM—023029 Homo sapiens fibroblast growth factor receptor 2 (bacteria-expressed kinase, keratinocyte growth factor receptor, craniofacial dysostosis 1, Crouzon syndrome, Pfeiffer syndrome, Jackson-Weiss syndrome) (FGFR2), transcript variant 11, mRNA gi|13186242|ref|NM023029.1|[13186242]

[3472] 5368: NM—000141 Homo sapiens fibroblast growth factor receptor 2 (bacteria-expressed kinase, keratinocyte growth factor receptor, craniofacial dysostosis 1, Crouzon syndrome, Pfeiffer syndrome, Jackson-Weiss syndrome) (FGFR2), transcript variant 1, mRNA gi|13186239|ref|NM—000141.2|[13186239]

[3473] 5369: AF312678 Homo sapiens FGF homologous factor receptor (FHFR) mRNA, complete cds gi|13183617|gb|AF312678.1|AF312678[13183617]

[3474] 5370: AF243385 Homo sapiens beta-2 syntrophin mRNA, complete cds, alternatively spliced gi|13183299|gb|AF243385.1|AF243385[13183299]

[3475] 5371: M97191 Homo sapiens Sp3 protein mRNA, partial cds gi|13162672|gb|M97191.2|HUMSP3A[13162672]

[3476] 5474: NM—024075 Homo sapiens LENG5 protein (LENG5), mRNA gi|13129061|ref|NM—024075.1|[13129061]

[3477] 5475: AF304379 Homo sapiens ULBP3 protein mRNA, complete cds gi|13128926|gb|AF304379.1|AF304379[13128926]

[3478] 5476: AF304378 Homo sapiens ULBP2 protein mRNA, complete cds gi|13128924|gb|AF304378.1|AF304378[13128924]

[3479] 5477: AF304377 Homo sapiens ULBP1 protein mRNA, complete cds gi|13128922|gb|AF304377.1|AF304377[13128922]

[3480] 5481: AF000549 AF000549 Human Homo sapiens genomic clone P1 clone DMPC-HFF#1-1075-D9, genomic survey sequence gi|2232072|gb|AF000549.1|AF000549[2232072]

[3481] 5482: NM—001755 Homo sapiens core-binding factor, beta subunit (CBFB), transcript variant 2, mRNA gi|13124872|ref|NM—001755.1|[13124872]

[3482] 5483: AF172398 Homo sapiens junctional adhesion molecule-1 mRNA, complete cds gi|13124448|gb|AF172398.2|AF172398[13124448]

[3483] 5484: AF317655 Homo sapiens G protein-coupled receptor (GPR77) gene, complete cds gi|13122466|gb|AF317655.1|AF317655[13122466]

[3484] 5485: AF317653 Homo sapiens G protein-coupled receptor (GPR62) gene, complete cds gi|13122462|gb|AF317653.1|AF317653[13122462]

[3485] 5486: AF317652 Homo sapiens G protein-coupled receptor (GPR61) mRNA, complete cds gi|13122460|gb|AF317652.1|AF317652[13122460]

[3486] 5487: NM—022036 Homo sapiens G protein-coupled receptor, family C, group 5, member C (GPRC5C), transcript variant 1, mRNA gi|13112058|ref|NM—022036.1|[13112058]

[3487] 5488: NM—018653 Homo sapiens G protein-coupled receptor, family C, group 5, member C (GPRC5C), transcript variant 2, mRNA gi|13112056|ref|NM—018653.2|[13112056]

[3488] 5489: NM—000707 Homo sapiens arginine vasopressin receptor 1B (AVPR1B), mRNA gi|13112055|ref|NM—000707.2|[13112055]

[3489] 5490: NM—000706 Homo sapiens arginine vasopressin receptor 1A (AVPR1A), mRNA gi|13112054|ref|NM—000706.2|[13112054]

[3490] 5491: NM—021923 Homo sapiens fibroblast growth factor receptor-like 1 (FGFRL1), mRNA gi|13112053|ref|NM—021923.2|[13112053]

[3491] 5492: NM—002011 Homo sapiens fibroblast growth factor receptor 4 (FGFR4), transcript variant 1, mRNA gi|13112051|ref|NM—002011.2|[13112051]

[3492] 5493: NM—022963 Homo sapiens fibroblast growth factor receptor 4 (FGFR4), transcript variant 2, mRNA gi|13112049|ref|NM—022963.1|[13112049]

[3493] 5494: NM—022965 Homo sapiens fibroblast growth factor receptor 3 (achondroplasia, thanatophoric dwarfism) (FGFR3), transcript variant 2, mRNA gi|13112047|ref|NM—022965.1|[13112047]

[3494] 5495: NM—000142 Homo sapiens fibroblast growth factor receptor 3 (achondroplasia, thanatophoric dwarfism) (FGFR3), transcript variant 1, mRNA gi|13112046|ref|NM—000142.2|[13112046]

[3495] 5496: NM—022336 Homo sapiens ectodysplasin 1, anhidrotic receptor (EDAR), mRNA gi|11641230|ref|NM—022336.1|[11641230]

[3496] 5497: NM—018654 Homo sapiens G protein-coupled receptor, family C, group 5, member D (GPRC5D), mRNA gi|8923704|ref|NM018654.1|[8923704]

[3497] 5498: AF312230 Homo sapiens histamine receptor H4 subtype mRNA, complete cds gi|13094918|gb|AF312230.1|AF312230[13094918]

[3498] 5504: AY016370 Homo sapiens hnRNPA1 pseudogene, complete sequence; and CC chemokine receptor (CCR8) and CX3C chemokine receptor 1 (CX3CR1) genes, complete cds gi|13027668|gb|AY016370.1|[13027668]

[3499] 5505: E32517 Scavenger receptor-like protein gi|13026764|dbj|E32517.1|E32517[13026764]

[3500] 5506: E32511 Scavenger receptor-like protein gi|13026758|dbj|E32511.1|E32511[13026758]

[3501] 5507: E32510 Scavenger receptor-like protein gi|13026757|dbj|E32510.1|E32510[13026757]

[3502] 5508: E32509 Scavenger receptor-like protein gi|13026756|dbj|E32509.1|E32509[13026756]

[3503] 5509: E32504 Scavenger receptor-like protein gi|13026751|dbj|E32504.1|E32504[13026751]

[3504] 5510: E32503 Scavenger receptor-like protein gi|13026750|dbj|E32503.1|E32503[13026750]

[3505] 5511: E60222 Melatonin receptor expressing cell and utilization thereof gi|13025812|dbj|E60222.1|E60222[13025812]

[3506] 5512: E36078 cDNA clone HNEAA81 encoding human seven-pass transmembrane receptor gi|13022480|dbj|E36078.1|E36078[13022480]

[3507] 5522: AJ309545 Homo sapiens mRNA for T-cell receptor alpha chain, clone 57LSK10 (Va2, Ja45) gi|13016702|emb|AJ309545.1|HSA309545[13016702]

[3508] 5523: AF323176 Homo sapiens death receptor-interacting protein mRNA, complete cds gi|12964787|gb|AF323176.1|AF323176[12964787]

[3509] 5524: AF329496 Homo sapiens immunoglobulin kappa light chain gene, partial cds gi|12963392|gb|AF329496.1|AF329496[12963392]

[3510] 5529: NM—015717 Homo sapiens Langerhans cell specific c-type lectin (LANGERIN), mRNA gi|7657290|ref|NM—015717.1|[7657290]

[3511] 5530: NM—012329 Homo sapiens monocyte to macrophage differentiation-associated (MMD), mRNA gi|6912507|ref|NM—012329.1|[6912507]

[3512] 5571: AH009956 Homo sapiens chromosome 12 clone pacHRARg map 12q13 gi|12746591|gb|AH009956.2|SEG_AF311283S[12746591]

[3513] 5573: AF230330 Homo sapiens angiopoietin-related protein 5 (ARP5) mRNA, complete cds gi|12743935|gb|AF230330.1|AF230330[12743935]

[3514] 5574: AF316895 Homo sapiens alpha 2B adrenergic receptor (ADRA2B) gene, complete cds gi|12698669|gb|AF316895.1|AF316895[12698669]

[3515] 5575: NM—021905 Homo sapiens gamma-aminobutyric acid (GABA) B receptor, 1 (GABBR1), transcript variant 4, mRNA gi|11497615|ref|NM—021905.1|[11497615]

[3516] 5578: NM—016730 Homo sapiens folate receptor 1 (adult) (FOLR1), transcript variant 3, mRNA gi|9257214|ref|NM—016730.1|[9257214]

[3517] 5579: NM—016729 Homo sapiens folate receptor 1 (adult) (FOLR1), transcript variant 4, mRNA gi|9257212|ref|NM—016729.1|[9257212]

[3518] 5580: NM—016725 Homo sapiens folate receptor 1 (adult) (FOLR1), transcript variant 1, mRNA gi|9257206|ref|NM—016725.1|[9257206]

[3519] 5581: NM—016724 Homo sapiens folate receptor 1 (adult) (FOLR1), transcript variant 7, mRNA gi|9257204|ref|NM—016724.1|[9257204]

[3520] 5582: NM—004406 Homo sapiens deleted in malignant brain tumors 1 (DMBT1), transcript variant 1, mRNA gi|4758169|ref|NM—004406.1|[4758169]

[3521] 5583: L27609 Homo sapiens T-cell receptor beta gene, partial cds gi|457265|gb|L27609.1|HUMTCRBD[457265]

[3522] 5584: U65905 U65905 Human Homo sapiens genomic, genomic survey sequence gi|743863|gb|U65905.1|U65905[1743863]

[3523] 5585: U65904 U65904 Human Homo sapiens genomic, genomic survey sequence gi|743862|gb|U65904.1|U65904[1743862]

[3524] 5586: U65903 U65903 Human Homo sapiens genomic, genomic survey sequence gi|1743861|gb|U65903.1|U65903[1743861]

[3525] 5587: NM—016731 Homo sapiens folate receptor 1 (adult) (FOLR1), transcript variant 8, mRNA gi|12719454|ref|NM—016731.2|[12719454]

[3526] 5588: AF316870 Homo sapiens T cell receptor beta chain variable region mRNA, partial cds gi|2711595|gb|AF316870.1|AF316870[12711595]

[3527] 5589: AX074315 Sequence 29 from Patent WO00104310 gi|12710501|emb|AX074315.1|AX074315[12710501]

[3528] 5590: AX074314 Sequence 28 from Patent WO00104310 gi|12710500|emb|AX074314.1|AX074314[12710500]

[3529] 5591: NM—022113 Homo sapiens kinesin family member 13A (KIF13A), mRNA gi|1545828|ref|NM—022113.1|[11545828]

[3530] 5592: AF283296 Homo sapiens interleukin-15 receptor alpha gene, 5′ regulatory region and exon 1, partial sequence gi|9965299|gb|AF283296.1|AF283296[9965299]

[3531] 5593: NM—014688 Homo sapiens related to the N terminus of tre (RNTRE), mRNA gi|7661863|ref|NM—014688.1|[7661863]

[3532] 5594: NM—000916 Homo sapiens oxytocin receptor (OXTR), mRNA gi|12707575|ref|NM—000916.2|[12707575]

[3533] 5595: NM—000915 Homo sapiens oxytocin, prepro-(neurophysin I) (OXT), mRNA gi|12707574|ref|NM—000915.2|[12707574]

[3534] 5596: NM—004961 Homo sapiens gamma-aminobutyric acid (GABA) A receptor, epsilon (GABRE), transcript variant 1, mRNA gi|12707559|ref|NM—004961.2|[12707559]

[3535] 5597: NM—021990 Homo sapiens gamma-aminobutyric acid (GABA) A receptor, epsilon (GABRE), transcript variant 4, mRNA gi|12707557|ref|NM—021990.1|[12707557]

[3536] 5598: NM—021987 Homo sapiens gamma-aminobutyric acid (GABA) A receptor, epsilon (GABRE), transcript variant 3, mRNA gi|12707555|ref|NM—021987.1|[12707555]

[3537] 5599: NM—021984 Homo sapiens gamma-aminobutyric acid (GABA) A receptor, epsilon (GABRE), transcript variant 2, mRNA gi|12707553|ref|NM—021984.1|[12707553]

[3538] 5600: AY011291 Homo sapiens beta-2 adrenergic receptor (ADRB2) gene, partial cds gi|12699005|gb|AY011291.1|[12699005]

[3539] 5601: AF316894 Homo sapiens alpha 2A adrenergic receptor (ADRA2A) gene, complete cds gi|12698667|gb|AF316894.1|AF316894[12698667]

[3540] 5602: AJ300340 Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 1 and joined complete CDS gi|11878410|emb|AJ300340.1|HSA300340[11878410]

[3541] 5603: AF063605 Homo sapiens brain my047 protein mRNA, complete cds gi|4071360|gb|AF063605.1|AF063605[4071360]

[3542] 5604: AF319440 Homo sapiens SH2 domain-containing phosphatase anchor protein 1c (SPAP1) mRNA, complete cds, alternatively spliced gi|12667355|gb|AF319440.1|AF319440[12667355]

[3543] 5605: AF319439 Homo sapiens SH2 domain-containing phosphatase anchor protein 1b (SPAP1) mRNA, complete cds, alternatively spliced gi|2667353|gb|AF319439.1|AF319439[12667353]

[3544] 5606: AF319438 Homo sapiens SH2 domain-containing phosphatase anchor protein 1a (SPAP1) mRNA, complete cds, alternatively spliced gi|12667351|gb|AF319438.1|AF319438[12667351]

[3545] 5607: NM—021912 Homo sapiens gamma-aminobutyric acid (GABA) A receptor, beta 3 (GABRB3), transcript variant 2, mRNA gi|12548787|ref|NM—021912.1|[12548787]

[3546] 5608: NM—021911 Homo sapiens gamma-aminobutyric acid (GABA) A receptor, beta 2 (GABRB2), transcript variant 1, mRNA gi|12548784|ref|NM—021911.1|[12548784]

[3547] 5609: NM—000814 Homo sapiens gamma-aminobutyric acid (GABA) A receptor, beta 3 (GABRB3), transcript variant 1, mRNA gi|12548782|ref|NM—000814.2|[12548782]

[3548] 5610: NM—000812 Homo sapiens gamma-aminobutyric acid (GABA) A receptor, beta 1 (GABRB1), mRNA gi|12548775|ref|NM—000812.2|[12548775]

[3549] 5611: NM—006786 Homo sapiens urotensin 2 (UTS2), transcript variant 2, mRNA gi|12056480|ref|NM—006786.2|[12056480]

[3550] 5612: NM—021995 Homo sapiens urotensin 2 (UTS2), transcript variant 1, mRNA gi|12056478|ref|NM—021995.1|[12056478]

[3551] 5613: AJ300444 Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 105 gi|11863669|emb|AJ300444.1|HSA300444[11863669]

[3552] 5614: AJ300443 Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 104 gi|11863668|emb|AJ300443.1|HSA300443[11863668]

[3553] 5615: AJ300442 Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 103 gi|11863667|emb|AJ300442.1|HSA300442[11863667]

[3554] 5616: AJ300441 Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 102 gi|11863666|emb|AJ300441.1|HSA300441[11863666]

[3555] 5617: AJ300440 Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 101 gi|11863665|emb|AJ300440.1|HSA300440[11863665]

[3556] 5618: AJ300439 Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 100 gi|11863664|emb|AJ300439.1|HSA300439[11863664]

[3557] 5619: AJ300438 Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 99 gi|11863663|emb|AJ300438.1|HSA300438[11863663]

[3558] 5620: AJ300437 Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 98 gi|11863662|emb|AJ300437.1|HSA300437[11863662]

[3559] 5621: AJ300436 Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 97 gi|11863661|emb|AJ300436.1|HSA300436[11863661]

[3560] 5622: AJ300435 Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 96 gi|11863660|emb|AJ300435.1|HSA300435[11863660]

[3561] 5623: AJ300434 Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 95 gi|11863659|emb|AJ300434.1|HSA300434[11863659]

[3562] 5624: AJ300433 Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 94 gi|1863658|emb|AJ300433.1|HSA300433[11863658]

[3563] 5625: AJ300432 Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 93 gi|11863657|emb|AJ300432.1|HSA300432[11863657]

[3564] 5626: AJ300431 Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 92 gi|11863656|emb|AJ300431.1|HSA300431[11863656]

[3565] 5627: AJ300430 Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 91 gi|11863655|emb|AJ300430.1|HSA300430[11863655]

[3566] 5628: AJ300429 Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 90 gi|11863654|emb|AJ300429.1|HSA300429[11863654]

[3567] 5629: AJ300428 Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 89 gi|11863653|emb|AJ300428.1|HSA300428[11863653]

[3568] 5630: AJ300427 Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 88 gi|11863652|emb|AJ300427.1|HSA300427[11863652]

[3569] 5631: AJ300426 Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 87 gi|11863651|emb|AJ300426.1|HSA300426[11863651]

[3570] 5632: AJ300425 Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 86 gi|11863650|emb|AJ300425.1|HSA300425[11863650]

[3571] 5633: AJ300424 Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 85 gi|11863649|emb|AJ300424.1|HSA300424[11863649]

[3572] 5634: AJ300423 Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 84 gi|11863648|emb|AJ300423.1|HSA300423[11863648]

[3573] 5635: AJ300422 Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 83 gi|11863647|emb|AJ300422.1|HSA300422[11863647]

[3574] 5636: AJ300421 Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 82 gi|1863646|emb|AJ300421.1|HSA300421[11863646]

[3575] 5637: AJ300420 Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 81 gi|1863645|emb|AJ300420.1|HSA300420[11863645]

[3576] 5638: AJ300419 Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 80 gi|11863644|emb|AJ300419.1|HSA300419[11863644]

[3577] 5639: AJ300418 Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 79 gi|11863643|emb|AJ300418.1|HSA300418[11863643]

[3578] 5640: AJ300417 Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 78 gi|11863642|emb|AJ300417.1|HSA300417[11863642]

[3579] 5641: AJ300416 Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 77 gi|11863641|emb|AJ300416.1|HSA300416[11863641]

[3580] 5642: AJ300415 Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 76 gi|11863640|emb|AJ300415.1|HSA300415[11863640]

[3581] 5643: AJ300414 Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 75 gi|11863639|emb|AJ300414.1|HSA300414[11863639]

[3582] 5644: AJ300413 Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 74 gi|11863638|emb|AJ300413.1|HSA300413[11863638]

[3583] 5645: AJ300412 Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 73 gi|11863637|emb|AJ300412.1|HSA300412[11863637]

[3584] 5646: AJ300411 Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 72 gi|1863636|emb|AJ300411.1|HSA300411[11863636]

[3585] 5647: AJ300410 Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 71 gi|1863635|emb|AJ300410.1|HSA300410[11863635]

[3586] 5648: AJ300409 Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 70 gi|11863634|emb|AJ300409.1|HSA300409[11863634]

[3587] 5649: AJ300408 Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 69 gi|11863633|emb|AJ300408.1|HSA300408[11863633]

[3588] 5650: AJ300407 Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 68 gi|11863632|emb|AJ300407.1|HSA300407[11863632]

[3589] 5651: AJ300406 Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 67 gi|11863631|emb|AJ300406.1|HSA300406[11863631]

[3590] 5652: AJ300405 Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 66 gi|11863630|emb|AJ300405.1|HSA300405[11863630]

[3591] 5653: AJ300404 Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 65 gi|11863629|emb|AJ300404.1|HSA300404[11863629]

[3592] 5654: AJ300403 Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 64 gi|11863628|emb|AJ300403.1|HSA300403[11863628]

[3593] 5655: AJ300402 Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 63 gi|11863627|emb|AJ300402.1|HSA300402[11863627]

[3594] 5656: AJ300401 Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 62 gi|11863626|emb|AJ300401.1|HSA300401[11863626]

[3595] 5657: AJ300400 Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 61 gi|11863625|emb|AJ300400.1|HSA300400[11863625]

[3596] 5658: AJ300399 Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 60 gi|11863624|emb|AJ300399.1|HSA300399[11863624]

[3597] 5659: AJ300398 Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 59 gi|11863623|emb|AJ300398.1|HSA300398[11863623]

[3598] 5660: AJ300397 Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 58 gi|11863622|emb|AJ300397.1|HSA300397[11863622]

[3599] 5661: AJ300396 Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 57 gi|11863621|emb|AJ300396.1|HSA300396[11863621]

[3600] 5662: AJ300395 Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 56 gi|11863620|emb|AJ300395.1|HSA300395[11863620]

[3601] 5663: AJ300394 Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 55 gi|11863619|emb|AJ300394.1|HSA300394[11863619]

[3602] 5664: AJ300393 Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 54 gi|11863618|emb|AJ300393.1|HSA300393[11863618]

[3603] 5665: AJ300392 Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 53 gi|11863617|emb|AJ300392.1|HSA300392[11863617]

[3604] 5666: AJ300391 Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 52 gi|11863616|emb|AJ300391.1|HSA300391[11863616]

[3605] 5667: AJ300390 Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 51 gi|11863615|emb|AJ300390.1|HSA300390[11863615]

[3606] 5668: AJ300389 Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 50 gi|1863614|emb|AJ300389.1|HSA300389[11863614]

[3607] 5669: AJ300388 Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 49 gi|11863613|emb|AJ300388.1|HSA300388[11863613]

[3608] 5670: AJ300387 Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 48 gi|11863612|emb|AJ300387.1|HSA300387[11863612]

[3609] 5671: AJ300386 Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 47 gi|11863611|emb|AJ300386.1|HSA300386[11863611]

[3610] 5672: AJ300385 Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 46 gi|11863610|emb|AJ300385.1|HSA300385[11863610]

[3611] 5673: AJ300384 Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 45 gi|11863609|emb|AJ300384.1|HSA300384[11863609]

[3612] 5674: AJ300383 Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 44 gi|11863608|emb|AJ300383.1|HSA300383[11863608]

[3613] 5675: AJ300382 Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 43 gi|11863607|emb|AJ300382.1|HSA300382[11863607]

[3614] 5676: AJ300381 Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 42 gi|11863606|emb|AJ300381.1|HSA300381[11863606]

[3615] 5677: AJ300380 Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 41 gi|11863605|emb|AJ300380.1|HSA300380[11863605]

[3616] 5678: AJ300379 Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 40 gi|11863604|emb|AJ300379.1|HSA300379[11863604]

[3617] 5679: AJ300378 Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 39 gi|11863603|emb|AJ300378.1|HSA300378[11863603]

[3618] 5680: AJ300377 Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 38 gi|11863602|emb|AJ300377.1|HSA300377[11863602]

[3619] 5681: AJ300376 Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 37 gi|11863601|emb|AJ300376.1|HSA300376[11863601]

[3620] 5682: AJ300375 Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 36 gi|11863600|emb|AJ300375.1|HSA300375[11863600]

[3621] 5683: AJ300374 Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 35 gi|11863599|emb|AJ300374.1|HSA300374[11863599]

[3622] 5684: AJ300373 Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 34 gi|1863598|emb|AJ300373.1|HSA300373[11863598]

[3623] 5685: AJ300372 Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 33 gi|11863597|emb|AJ300372.1|HSA300372[11863597]

[3624] 5686: AJ300371 Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 32 gi|11863596|emb|AJ300371.1|HSA300371[11863596]

[3625] 5687: AJ300370 Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 31 gi|11863595|emb|AJ300370.1|HSA300370[11863595]

[3626] 5688: AJ300369 Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 30 gi|11863594|emb|AJ300369.1|HSA300369[11863594]

[3627] 5689: AJ300368 Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 29 gi|11863593|emb|AJ300368.1|HSA300368[11863593]

[3628] 5690: AJ300367 Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 28 gi|11863592|emb|AJ300367.1|HSA300367[11863592]

[3629] 5691: AJ300366 Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 27 gi|11863591|emb|AJ300366.1|HSA300366[11863591]

[3630] 5692: AJ300365 Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 26 gi|1863590|emb|AJ300365.1|HSA300365[11863590]

[3631] 5693: AJ300364 Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 25 gi|11863589|emb|AJ300364.1|HSA300364[11863589]

[3632] 5694: AJ300363 Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 24 gi|11863588|emb|AJ300363.1|HSA300363[11863588]

[3633] 5695: AJ300362 Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 23 gi|11863587|emb|AJ300362.1|HSA300362[11863587]

[3634] 5696: AJ300361 Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 22 gi|11863586|emb|AJ300361.1|HSA300361[11863586]

[3635] 5697: AJ300360 Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 21 gi|11863585|emb|AJ300360.1|HSA300360[11863585]

[3636] 5698: AJ300359 Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 20 gi|11863584|emb|AJ300359.1|HSA300359[11863584]

[3637] 5699: AJ300358 Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 19 gi|11863583|emb|AJ300358.1|HSA300358[11863583]

[3638] 5700: AJ300357 Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 18 gi|11863582|emb|AJ300357.1|HSA300357[11863582]

[3639] 5701: AJ300356 Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 17 gi|11863581|emb|AJ300356.1|HSA300356[11863581]

[3640] 5702: AJ300355 Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 16 gi|111863580|emb|AJ300355.1|HSA300355[11863580]

[3641] 5703: AJ300354 Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 15 gi|11863579|emb|AJ300354.1|HSA300354[11863579]

[3642] 5704: AJ300353 Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 14 gi|11863578|emb|AJ300353.1|HSA300353[11863578]

[3643] 5705: AJ300352 Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 13 gi|11863577|emb|AJ300352.1|HSA300352[11863577]

[3644] 5706: AJ300351 Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 12 gi|11863576|emb|AJ300351.1|HSA300351[11863576]

[3645] 5707: AJ300350 Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 11 gi|11863575|emb|AJ300350.1|HSA300350[11863575]

[3646] 5708: AJ300349 Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 10 gi|11863574|emb|AJ300349.1|HSA300349[11863574]

[3647] 5709: AJ300348 Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 9 |gi|11863573|emb|AJ300348.1|HSA300348[11863573]

[3648] 5710: AJ300347 Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 8 gi|1863572|emb|AJ300347.1|HSA300347[11863572]

[3649] 5711: AJ300346 Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 7 gi|11863571|emb|AJ300346.1|HSA300346[11863571]

[3650] 5712: AJ300345 Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 6 gi|11863570|emb|AJ300345.1|HSA300345[11863570]

[3651] 5713: AJ300344 Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 5 gi|11863569|emb|AJ300344.1|HSA300344[11863569]

[3652] 5714: AJ300343 Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 4 gi|11863568|emb|AJ300343.1|HSA300343[11863568]

[3653] 5715: AJ300342 Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 3 gi|11863567|emb|AJ300342.1|HSA300342[11863567]

[3654] 5716: AJ300341 Homo sapiens partial RYR2 gene for ryanodine receptor 2, exon 2 gi|11863566|emb|AJ300341.1|HSA300341[11863566]

[3655] 5717: NM—000832 Homo sapiens glutamate receptor, ionotropic, N-methyl D-aspartate 1 (GRIN1), transcript variant NR1-1, mRNA gi|11496970|ref|NM—000832.4|[11496970]

[3656] 5718: NM—021709 Homo sapiens CD27-binding (Siva) protein (SIVA), transcript variant 2, mRNA gi|11277469|ref|NM—021709.1|[11277469]

[3657] 5719: NM—006427 Homo sapiens CD27-binding (Siva) protein (SIVA), transcript variant 1, mRNA gi|11277467|ref|NM—006427.2|[11277467]

[3658] 5720: NM—016232 Homo sapiens interleukin 1 receptor-like 1 (IL1RL1), mRNA gi|1136631|ref|NM—016232.2|[11136631]

[3659] 5721: AF202091 Homo sapiens hypocretin receptor-2 (HCRTR2) gene, exon 7 and complete cds gi|11055242|gb|AF202091.1|F202078S14[11055242]

[3660] 5722: AF202090 Homo sapiens hypocretin receptor-2 (HCRTR2) gene, exon 6 gi|1105524|gb|AF202090.1|F202078S13[11055241]

[3661] 5723: AF202089 Homo sapiens hypocretin receptor-2 (HCRTR2) gene, exon 5 gi|11055240|gb|AF202089.1|F202078S12[11055240]

[3662] 5724: AF202088 Homo sapiens hypocretin receptor-2 (HCRTR2) gene, exon 4 gi|11055239|gb|AF202088.1|F202078S11[11055239]

[3663] 5725: AF202087 Homo sapiens hypocretin receptor-2 (HCRTR2) gene, exon 3 gi|11055238|gb|AF202087.1|F202078S10[11055238]

[3664] 5726: AF202086 Homo sapiens hypocretin receptor-2 (HCRTR2) gene, exon 2 gi|11055237|gb|AF202086.1|F202078S09[11055237]

[3665] 5727: AF202085 Homo sapiens hypocretin receptor-2 (HCRTR2) gene, exon 1 gi|11055236|gb|AF202085.1|F202078S08[11055236]

[3666] 5728: AF202084 Homo sapiens hypocretin receptor-1 (HCRTR1) gene, exon 7 and complete cds gi|11055235|gb|AF202084.1 (F202078S07[11055235]

[3667] 5729: AF202083 Homo sapiens hypocretin receptor-1 (HCRTR1) gene, exon 6 gi|11055234|gb|AF202083.1|F202078S06[11055234]

[3668] 5730: AF202082 Homo sapiens hypocretin receptor-1 (HCRTR1) gene, exon 5 gi|11055233|gb|AF202082.1|F202078S05[11055233]

[3669] 5731: AF202081 Homo sapiens hypocretin receptor-1 (HCRTR1) gene, exon 4 gi|11055232|gb|AF202081.1|F202078S04[11055232]

[3670] 5732: AF202080 Homo sapiens hypocretin receptor-1 (HCRTR1) gene, exon 3 gi|11055231|gb|AF202080.1|F202078S03[11055231]

[3671] 5733: AF202079 Homo sapiens hypocretin receptor-1 (HCRTR1) gene, exon 2 gi|11055230|gb|AF202079.1|F202078S02[11055230]

[3672] 5734: AF202078 Homo sapiens hypocretin receptor-1 (HCRTR1) gene, exon 1 gi|11055229|gb|AF202078.1|F202078S01[11055229]

[3673] 5735: AH009943 Homo sapiens hypocretin receptor-1 (HCRTR1) and hypocretin receptor-2 (HCRTR2) genes, complete cds gi|11055228|gb|AH009943.1|SEG_F202078S[11055228]

[3674] 5736: NM—021602 Homo sapiens CD79B antigen (immunoglobulin-associated beta) (CD79B), transcript variant 2, mRNA gi|11038675|ref|NM—021602.1|[11038675]

[3675] 5737: NM—000626 Homo sapiens CD79B antigen (immunoglobulin-associated beta) (CD79B), transcript variant 1, mRNA gi|11038673|ref|NM—000626.1|[11038673]

[3676] 5738: NM—021601 Homo sapiens CD79A antigen (immunoglobulin-associated alpha) (CD79A), transcript variant 2, mRNA gi|11038671|ref|NM—021601.1|[11038671]

[3677] 5739: NM—007327 Homo sapiens glutamate receptor, ionotropic, N-methyl D-aspartate 1 (GRIN1), transcript variant NR1-3, mRNA gi|11038636|ref|NM—007327.1|[11038636]

[3678] 5740: NM—021569 Homo sapiens glutamate receptor, ionotropic, N-methyl D-aspartate 1 (GRIN1), transcript variant NR1-2, mRNA gi|11038634|ref|NM—021569.1|[11038634]

[3679] 5743: NM—021270 Homo sapiens leukocyte-associated Ig-like receptor 2 (LAIR2), transcript variant 2, mRNA gi|10947102|ref|NM—021270.1|[10947102]

[3680] 5744: NM—002288 Homo sapiens leukocyte-associated Ig-like receptor 2 (LAIR2), transcript variant 1, mRNA gi|10947100|ref|NM—002288.2|[10947100]

[3681] 5745: NM—004041 Homo sapiens arrestin, beta 1 (ARRB1), transcript variant 1, mRNA gi|10880135|ref|NM—004041.2|[10880135]

[3682] 5746: NM—020251 Homo sapiens arrestin, beta 1 (ARRB1), transcript variant 2, mRNA gi|10880133|ref|NM—020251.1|[10880133]

[3683] 5747: NM—000872 Homo sapiens 5-hydroxytryptamine (serotonin) receptor 7 (adenylate cyclase-coupled) (HTR7), transcript variant a, mRNA gi|10880132|ref|NM—000872.2|[10880132]

[3684] 5748: NM—019860 Homo sapiens 5-hydroxytryptamine (serotonin) receptor 7 (adenylate cyclase-coupled) (HTR7), transcript variant b, mRNA gi|10880130|ref|NM—019860.1|[10880130]

[3685] 5749: NM—019859 Homo sapiens 5-hydroxytryptamine (serotonin) receptor 7 (adenylate cyclase-coupled) (HTR7), transcript variant d, mRNA gi|10880128|ref|NM—019859.1|[10880128]

[3686] 5750: NM—004302 Homo sapiens activin A receptor, type IB (ACVR1B), transcript variant 1, mRNA gi|10862695|ref|NM—004302.2|[10862695]

[3687] 5751: NM—020328 Homo sapiens activin A receptor, type IB (ACVR1B), transcript variant 3, mRNA gi|10862693|ref|NM—020328.1|[10862693]

[3688] 5752: NM—020327 Homo sapiens activin A receptor, type IB (ACVR1B), transcript variant 2, mRNA gi|10862691|ref|NM—020327.1|[10862691]

[3689] 5753: NM—020525 Homo sapiens interleukin 22 (IL22), mRNA gi|10092624|ref|NM—020525.1|[10092624]

[3690] 5754: NM—000407 Homo sapiens glycoprotein Ib (platelet), beta polypeptide (GP1BB), mRNA gi|9945387|ref|NM—000407.3|[9945387]

[3691] 5755: NM—018971 Homo sapiens G protein-coupled receptor 27 (GPR27), mRNA gi|9506746|ref|NM—018971.1|[9506746]

[3692] 5756: NM—017455 Homo sapiens stromal cell derived factor receptor 1 (SDFR1), transcript variant alpha, mRNA gi|9257239|ref|NM—017455.1|[9257239]

[3693] 5757: NM—002197 Homo sapiens aconitase 1, soluble (AC01), mRNA gi|8659554|ref|NM—002197.1|[8659554]

[3694] 5758: NM—005242 Homo sapiens coagulation factor II (thrombin) receptor-like 1 (F2RL1), mRNA gi|8051581|ref|NM—005242.2|[8051581]

[3695] 5759: NM—016388 Homo sapiens T-cell receptor interacting molecule (TRIM), mRNA gi|7706744|ref|NM—016388.1|[7706744]

[3696] 5760: NM—016334 Homo sapiens putative G-protein coupled receptor (SH120), mRNA gi|7706703|ref|NM—016334.1|[7706703]

[3697] 5761: NM—016318 Homo sapiens purinergic receptor P2X, ligand-gated ion channel, 2 (P2RX2), mRNA gi|7706628|ref|NM—016318.1|[7706628]

[3698] 5762: NM—016602 Homo sapiens G protein-coupled receptor 2 (GPR2), mRNA gi|7705315|ref|NM—016602.1|[7705315]

[3699] 5763: NM—013964 Homo sapiens neuregulin 1 (NRG1), transcript variant HRG-alpha, mRNA gi|7669525|ref|NM—013964.1|[7669525]

[3700] 5764: NM—013962 Homo sapiens neuregulin 1 (NRG1), transcript variant GGF2, mRNA gi|7669523|ref|NM—013962.1|[7669523]

[3701] 5765: NM—013961 Homo sapiens neuregulin 1 (NRG1), transcript variant GGF, mRNA gi|7669521|ref|NM—013961.1|[7669521]

[3702] 5766: NM—013960 Homo sapiens neuregulin 1 (NRG1), transcript variant ndf43, mRNA gi|7669519|ref|NM—013960.1|[7669519]

[3703] 5767: NM—013959 Homo sapiens neuregulin 1 (NRG1), transcript variant SMDF, mRNA gi|7669517|ref|NM—013959.1|[7669517]

[3704] 5768: NM—013958 Homo sapiens neuregulin 1 (NRG1), transcript variant HRG-beta3, mRNA gi|7669515|ref|NM—013958.1|[7669515]

[3705] 5769: NM—013957 Homo sapiens neuregulin 1 (NRG1), transcript variant HRG-beta2, mRNA gi|7669513|ref|NM—013957.1|[7669513]

[3706] 5770: NM—013956 Homo sapiens neuregulin 1 (NRG1), transcript variant HRG-beta1, mRNA gi|7669511|ref|NM—013956.1|[7669511]

[3707] 5771: NM—007334 Homo sapiens killer cell lectin-like receptor subfamily D, member 1 (KLRD1), transcript variant 2, mRNA gi|7669498|ref|NM—007334.1|[7669498]

[3708] 5772: NM—002262 Homo sapiens killer cell lectin-like receptor subfamily D, member 1 (KLRD1), transcript variant 1, mRNA gi|7669497|ref|NM—002262.2|[7669497]

[3709] 5773: NM—007319 Homo sapiens presenilin 1 (Alzheimer disease 3) (PSEN1), transcript variant I-374., mRNA gi|7549814|ref|NM—007319.1|[7549814]

[3710] 5774: NM—007318 Homo sapiens presenilin 1 (Alzheimer disease 3) (PSEN1), transcript variant I-463, mRNA gi|7549812|ref|NM—007318.1|[7549812]

[3711] 5775: NM—007333 Homo sapiens killer cell lectin-like receptor subfamily C, member 3 (KLRC3), transcript variant NKG2-H, mRNA gi|7262385|ref|NM—007333.1|[7262385]

[3712] 5776: NM—007328 Homo sapiens killer cell lectin-like receptor subfamily C, member 1 (KLRC1), transcript variant NKG2-B, mRNA gi|7262383|ref|NM—007328.1|[7262383]

[3713] 5777: NM—002259 Homo sapiens killer cell lectin-like receptor subfamily C, member 1 (KLRC1), transcript variant NKG2-A, mRNA gi|7262382|ref|NM—002259.2|[7262382]

[3714] 5778: NM—006350 Homo sapiens follistatin (FST), transcript variant FST317, mRNA gi|7242223|ref|NM—006350.2|[7242223]

[3715] 5779: NM—013409 Homo sapiens follistatin (FST), transcript variant FST344, mRNA gi|7242221|ref|NM—013409.1|[7242221]

[3716] 5780: NM—012486 Homo sapiens presenilin 2 (Alzheimer disease 4) (PSEN2), transcript variant 2, mRNA gi|7108359|ref|NM—012486.1|[7108359]

[3717] 5781: NM—012485 Homo sapiens hyaluronan-mediated motility receptor (RHAMM) (HMMR), transcript variant 2, mRNA gi|7108350|ref|NM—012485.1|[7108350]

[3718] 5782: NM012484 Homo sapiens hyaluronan-mediated motility receptor (RHAMM) (HMMR), transcript variant 1, mRNA gi|7108348|ref|NM—012484.1|[7108348]

[3719] 5783: NM—012428 Homo sapiens stromal cell derived factor receptor 1 (SDFR1), transcript variant beta, mRNA gi|6912645|ref|NM—012428.1|[6912645]

[3720] 5784: NM—012226 Homo sapiens purinergic receptor P2X, ligand-gated ion channel, 2 (P2RX2), mRNA gi|6912565|ref|NM—012226.1|[6912565]

[3721] 5785: NM—012369 Homo sapiens olfactory receptor, family 2, subfamily F, member 1 (OR2F1), mRNA gi|6912557|ref|NM—012369.1|[6912557]

[3722] 5786: NM—007325 Homo sapiens glutamate receptor, ionotrophic, AMPA 3 (GRIA3), transcript variant flip, mRNA gi|6598324|ref|NM—007325.1|[6598324]

[3723] 5787: NM—000632 Homo sapiens integrin, alpha M (complement component receptor 3, alpha; also known as CD11b (p170), macrophage antigen alpha polypeptide) (ITGAM), mRNA gi|6006013|ref|NM—000632.2|[6006013]

[3724] 5788: NM—007097 Homo sapiens clathrin, light polypeptide (Lcb) (CLTB), mRNA gi|6005994|ref|NM—007097.1|[6005994]

[3725] 5789: NM—000655 Homo sapiens selectin L (lymphocyte adhesion molecule 1) (SELL), mRNA gi|5713320|ref|NM—000655.2|[5713320]

[3726] 5790: NM—005751 Homo sapiens A kinase (PRKA) anchor protein (yotiao) 9 (AKAP9), mRNA gi|5032230|ref|NM—005751.1|[5032230]

[3727] 5791: NM—005691 Homo sapiens ATP-binding cassette, sub-family C (CFTR/MRP), member 9 (ABCC9), transcript variant SUR2A, mRNA gi|5032134|ref|NM—005691.1|[5032134]

[3728] 5792: NM—005534 Homo sapiens interferon gamma receptor 2 (interferon gamma transducer 1) (IFNGR2), mRNA gi|5031782|ref|NM—005534.1|[5031782]

[3729] 5793: NM—005682 Homo sapiens G protein-coupled receptor 56 (GPR56), mRNA gi|5031724|ref|NM—005682.1|[5031724]

[3730] 5794: NM—005446 Homo sapiens purinergic receptor P2X-like 1, orphan receptor (P2RXL1), mRNA gi|4885534|ref|NM—005446.1|[4885534]

[3731] 5795: NM—004958 Homo sapiens FK506 binding protein 12-rapamycin associated protein 1 (FRAP1), mRNA gi|4826729|ref|NM—004958.1|[4826729]

[3732] 5796: NM—004495 Homo sapiens neuregulin 1 (NRG1), transcript variant HRG-gamma, mRNA gi|4758525|ref|NM—004495.1|[4758525]

[3733] 5797: NM—003995 Homo sapiens natriuretic peptide receptor B/guanylate cyclase B (atrionatriuretic peptide receptor B) (NPR2), mRNA gi|4580421|ref|NM—003995.2|[4580421]

[3734] 5798: NM—003994 Homo sapiens KIT ligand (KITLG), mRNA gi|4580419|ref|NM—003994.2|[4580419]

[3735] 5799: NM—000115 Homo sapiens endothelin receptor type B (EDNRB), transcript variant 1, mRNA gi|4557546|ref|NM—000115.1|[4557546]

[3736] 5800: NM—000734 Homo sapiens CD3Z antigen, zeta polypeptide (TiT3 complex) (CD3Z), mRNA gi|4557430|ref|NM—000734.1|[4557430]

[3737] 5801: NM—003856 Homo sapiens interleukin 1 receptor-like 1 (IL1RL1), mRNA gi|4507244|ref|NM—003856.1|[4507244]

[3738] 5802: NM—002980 Homo sapiens secretin receptor (SCTR), mRNA gi|4506824|ref|NM—002980.1|[4506824]

[3739] 5803: NM—000447 Homo sapiens presenilin 2 (Alzheimer disease 4) (PSEN2), transcript variant 1, mRNA gi|4506164|ref|NM—000447.1|[4506164]

[3740] 5804: NM—000021 Homo sapiens presenilin 1 (Alzheimer disease 3) (PSEN1), transcript variant I-467, mRNA gi|4506162|ref|NM—000021.1|[4506162]

[3741] 5805: NM—000907 Homo sapiens natriuretic peptide receptor B/guanylate cyclase B (atrionatriuretic peptide receptor B) (NPR2), mRNA gi|4505436|ref|NM—000907.1|[4505436]

[3742] 5806: NM—000899 Homo sapiens KIT ligand (KITLG), mRNA gi|4505174|ref|NM—000899.1|[4505174]

[3743] 5807: NM—002353 Homo sapiens tumor-associated calcium signal transducer 2 (TACSTD2), mRNA gi|4505056|ref|NM—002353.1|[4505056]

[3744] 5808: NM—002261 Homo sapiens killer cell lectin-like receptor subfamily C, member 3 (KLRC3), transcript variant NKG2-E, mRNA gi|4504884|ref|NM—002261.1|[4504884]

[3745] 5809: NM—000836 Homo sapiens glutamate receptor, ionotropic, N-methyl D-aspartate 2D (GRIN2D), mRNA gi|4504130|ref|NM—000836.1|[4504130]

[3746] 5810: NM—000828 Homo sapiens glutamate receptor, ionotrophic, AMPA 3 (GRIA3), transcript variant flop, mRNA gi|4504114|ref|NM—000828.1|[4504114]

[3747] 5811: NM—000813 Homo sapiens gamma-aminobutyric acid (GABA) A receptor, beta 2 (GABRB2), transcript variant 2, mRNA gi|4503864|ref|NM—000813.1|[4503864]

[3748] 5812: NM—003991 Homo sapiens endothelin receptor type B (EDNRB), transcript variant 2, mRNA gi|4503466|ref|NM—003991.1|[4503466]

[3749] 5813: NM—001337 Homo sapiens chemokine (C-X3-C) receptor 1 (CX3CR1), mRNA gi|4503170|ref|NM—001337.1|[4503170]

[3750] 5814: NM—001834 Homo sapiens clathrin, light polypeptide (Lcb) (CLTB), transcript variant nonbrain, mRNA gi|4502900|ref|NM—001834.1|[4502900]

[3751] 5815: NM—001783 Homo sapiens CD79A antigen (immunoglobulin-associated alpha) (CD79A), transcript variant 1, mRNA gi|4502684|ref|NM001783.1|[4502684]

[3752] 5816: AF277897 Homo sapiens truncated epidermal growth factor receptor (EGFR) mRNA, partial cds; alternatively spliced gi|12658300|gb|AF277897.1|AF277897[12658300]

[3753] 5817: AF192403 Homo sapiens ETL protein (ETL) mRNA, complete cds gi|11225482|gb|AF192403.1|AF192403[11225482]

[3754] 5818: AF259263 Homo sapiens toll-like receptor 9 form B (TLR9) mRNA, complete cds; alternatively spliced gi|8099653|gb|AF259263.1|AF259263[8099653]

[3755] 5819: AF259262 Homo sapiens toll-like receptor 9 form A (TLR9) mRNA, complete cds; alternatively spliced gi|8099651|gb|AF259262.1|AF259262[8099651]

[3756] 5820: AF246971 Homo sapiens Toll-like receptor 8 (TLR8) mRNA, complete cds gi|7576932|gb|AF246971.1|AF246971[7576932]

[3757] 5821: AF240467 Homo sapiens toll-like receptor 7 (TLR7) mRNA, complete cds gi|7330280|gb|AF240467.1|AF240467[7330280]

[3758] 5822: AF230073 Homo sapiens sialoadhesin mRNA, complete cds gi|2656129|gb|AF230073.1|AF230073[12656129]

[3759] 5823: BC000783 Homo sapiens, calcitonin gene-related peptide-receptor component protein, clone MGC:804, mRNA, complete cds gi|12653974|gb|BC000783.1|BC000783[12653974]

[3760] 5824: NM—016184 Homo sapiens C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 6 (CLECSF6), mRNA gi|7705337|ref|NM—016184.1|[7705337]

[3761] 5825: AF242540 Homo sapiens NK cell type I receptor protein 2B4 (2B4) mRNA, complete cds, alternatively spliced gi|12642415|gb|AF242540.1|AF242540[12642415]

[3762] 5826: NM—020979 Homo sapiens adaptor protein with pleckstrin homology and src homology 2 domains (APS), mRNA gi|10280625|ref|NM020979.1|[10280625]

[3763] 5827: NM—018557 Homo sapiens low density lipoprotein-related protein 1B (deleted in tumors) (LRP1B), mRNA gi|9055269|ref|NM—018557.1|[9055269]

[3764] 5828: NM—012452 Homo sapiens transmembrane activator and CAML interactor (TACI), mRNA gi|6912693|ref|NM—012452.1|[6912693]

[3765] 5829: NM—005338 Homo sapiens huntingtin interacting protein 1 (HIP1), mRNA gi|12545385|ref|NM—005338.3|[12545385]

[3766] 5830: AF321238 Homo sapiens T-cell receptor variable beta-chain 15 mRNA, partial cds gi|12484115|gb|AF321238.1|AF321238[12484115]

[3767] 5831: AF125253 Homo sapiens truncated epidermal growth factor receptor precursor (EGFR) mRNA, complete cds gi|12002211|gb|AF125253.1|AF125253[12002211]

[3768] 5832: NM—014211 Homo sapiens gamma-aminobutyric acid (GABA) A receptor, pi (GABRP), mRNA gi|7657105|ref|NM—014211.1|[7657105]

[3769] 5833: AF283463 Homo sapiens Nogo receptor mRNA, complete cds gi|2407652|gb|AF283463.1|AF283463[12407652]

[3770] 5834: AF224266 Homo sapiens four alpha helix cytokine (ZCYTO10) mRNA, ZCYTO10-1 allele, complete cds gi|7109206|gb|AF224266.1|AF224266[7109206]

[3771] 5837: AB045370 Homo sapiens mRNA for histamine H4 receptor HH4R, complete cds gi|12248411|dbj|AB045370.1|AB045370[12248411]

[3772] 5838: AB045369 Homo sapiens mRNA for histamine H3 receptor HH3R, complete cds gi|112248409|dbj|AB045369.1|AB045369[12248409]

[3773] 5840: NM—016363 Homo sapiens glycoprotein VI (platelet) (GP6), mRNA gi|7705956|ref|NM—016363.1|[7705956]

[3774] 5841: NM—022139 Homo sapiens GDNF family receptor alpha 4 (GFRA4), mRNA gi|11545874|ref|NM—022139.1|[11545874]

[3775] 5842: NM—004403 Homo sapiens deafness, autosomal dominant 5 (DFNA5), mRNA gi|4758153|ref|NM—004403.1|[4758153]

[3776] 5847: AF308156 Homo sapiens HERV-E LTR/leader long terminal repeat, complete sequence; and endothelin B receptor mRNA, partial cds gi|12239519|gb|AF308156.1|AF308156[12239519]

[3777] 5850: NM—022789 Homo sapiens interleukin 17E (IL17E), mRNA gi|12232484|ref|NM—022789.1|[12232484]

[3778] 5851: AX054991 Sequence 3 from Patent WO0073451 gi|12228357|emb|AX054991.1|AX054991[12228357]

[3779] 5852: AX054989 Sequence 1 from Patent WO00073451 gi|12228355|emb|AX054989.1|AX054989[12228355]

[3780] 5853: AJ278581 Homo sapiens DREV gene and IGSF6 gene for immunoglobulin superfamily 6 protein gi|12053852|emb|AJ278581.1|HSA278581[12053852]

[3781] 5854: AJ302556 Homo sapiens 6M1-3*02 gene for olfactory receptor, cell line OLGA olfactory receptor gi|12140483|emb|AJ302556.1|HSA302556[12140483]

[3782] 5855: AJ302555 Homo sapiens 6M1-3*02 gene for olfactory receptor, cell line SA olfactory receptor gi|12140479|emb|AJ302555.1|HSA302555[12140479]

[3783] 5856: AJ302554 Homo sapiens 6M1-3*02 gene for olfactory receptor, cell line KR3598 olfactory receptor gi|12140476|emb|AJ302554.1|HSA302554[12140476]

[3784] 5857: AJ302553 Homo sapiens 6M1-3*02 gene for olfactory receptor, cell line BM19.7 olfactory receptor gi|12140472|emb|AJ302553.1|HSA302553[12140472]

[3785] 5858: AJ302552 Homo sapiens 6M1-3*02 gene for olfactory receptor, cell line BM28.7 olfactory receptor gi|12140468|emb|AJ302552.1|HSA302552[12140468]

[3786] 5859: AF209481 Homo sapiens probable mannose binding C-type lectin DC-SIGNR gene, exons 3-8, and complete cds gi|12084794|gb|AF209481.2|AF209480S2[12084794]

[3787] 5860: AH009824 Homo sapiens chromosome 19 probable mannose binding C-type lectin DC-SIGNR (abc) gene, complete cds gi|12084793|gb|AH009824.2|SEG_AF209480S[12084793]

[3788] 5861: AF313449 Homo sapiens P2Y12 platelet ADP receptor mRNA, complete cds gi|12083901|gb|AF313449.1|AF313449[12083901]

[3789] 5884: AH009659 Homo sapiens RON gene, partial sequence gi|9621821|gb|AH009659.1|SEG_HSRONPO[9621821]

[3790] 5885: NM—002351 Homo sapiens SH2 domain protein 1A, Duncan's disease (lymphoproliferative syndrome) (SH2D1A), mRNA gi|4506922|ref|NM—002351.1|[4506922]

[3791] 5886: NM—000171 Homo sapiens glycine receptor, alpha 1 (startle disease/hyperekplexia, stiff man syndrome) (GLRA1), mRNA gi|4504018|ref|NM—000171.1|[4504018]

[3792] 5887: NM—000569 Homo sapiens Fc fragment of IgG, low affinity IIIa, receptor for (CD16) (FCGR3A), mRNA gi|12056966|ref|NM—000569.2|[12056966]

[3793] 5888: NM—000802 Homo sapiens folate receptor 1 (adult) (FOLR1), transcript variant 2, mRNA gi|12056965|ref|NM—000802.2|[12056965]

[3794] 5889: NM—003979 Homo sapiens retinoic acid induced 3 (RAI3), mRNA gi|12056470|ref|NM—003979.2|[12056470]

[3795] 5900: AJ302633 Homo sapiens 6M1-02P*02 gene for olfactory receptor, cell line BM28.7 gi|12054481|emb|AJ302633.1|HSA302633[12054481]

[3796] 5910: AJ302623 Homo sapiens 6M1-18*02 gene for olfactory receptor, cell line KR3598 gi|12054470|emb|AJ302623.1|HSA302623[12054470]

[3797] 5911: AJ302622 Homo sapiens 6M1-18*01 gene for olfactory receptor, cell line AMAI gi|12054468|emb|AJ302622.1|HSA302622[12054468]

[3798] 5912: AJ302621 Homo sapiens 6M1-18*01 gene for olfactory receptor, cell line OLGA gi|12054466|emb|AJ302621.1|HSA302621[12054466]

[3799] 5913: AJ302620 Homo sapiens 6M1-18*01 gene for olfactory receptor, cell line YAR gi|12054464|emb|AJ302620.1|HSA302620[12054464]

[3800] 5914: AJ302619 Homo sapiens 6M1-18*01 gene for olfactory receptor, cell line SA gi|12054462|emb|AJ302619.1|HSA302619[12054462]

[3801] 5915: AJ302618 Homo sapiens 6M1-18*01 gene for olfactory receptor, cell line WT51 gi|12054460|emb|AJ302618.1|HSA302618[12054460]

[3802] 5916: AJ302617 Homo sapiens 6M1-18*01 gene for olfactory receptor, cell line H2LCL gi|12054458|emb|AJ302617.1|HSA302617[12054458]

[3803] 5917: AJ302616 Homo sapiens 6M1-18*01 gene for olfactory receptor, cell line LG2 gi|12054456|emb|AJ302616.1|HSA302616[12054456]

[3804] 5918: AJ302615 Homo sapiens 6M1-18*01 gene for olfactory receptor, cell line BM19.7 gi|12054454|emb|AJ302615.1|HSA302615[12054454]

[3805] 5919: AJ302614 Homo sapiens 6M1-18*01 gene for olfactory receptor, cell line BM28.7 gi|112054452|emb|AJ302614.1|HSA302614[12054452]

[3806] 5920: AJ302613 Homo sapiens 6M1-16*03 gene for olfactory receptor, cell line AMAI gi|12054450|emb|AJ302613.1|HSA302613[12054450]

[3807] 5921: AJ302612 Homo sapiens 6M1-16*03 gene for olfactory receptor, cell line BM19.7 gi|12054448|emb|AJ302612.1|HSA302612[12054448]

[3808] 5922: AJ302611 Homo sapiens 6M1-16*02 gene for olfactory receptor, cell line BM28.7 gi|12054446|emb|AJ302611.1|HSA302611[12054446]

[3809] 5923: AJ302610 Homo sapiens 6M1-16*01 gene for olfactory receptor, cell line OLGA gi|12054444|emb|AJ302610.1|HSA302610[12054444]

[3810] 5924: AJ302609 Homo sapiens 6M1-16*01 gene for olfactory receptor, cell line YAR gi|12054442|emb|AJ302609.1|HSA302609[12054442]

[3811] 5925: AJ302608 Homo sapiens 6M1-16*01 gene for olfactory receptor, cell line SA gi|12054440|emb|AJ302608.1|HSA302608[12054440]

[3812] 5926: AJ302607 Homo sapiens 6M1-16*01 gene for olfactory receptor, cell line WT51 gi|12054438|emb|AJ302607.1|HSA302607[12054438]

[3813] 5927: AJ302606 Homo sapiens 6M1-16*01 gene for olfactory receptor, cell line H2LCL gi|12054436|emb|AJ302606.1|HSA302606[12054436]

[3814] 5928: AJ302605 Homo sapiens 6M1-16*01 gene for olfactory receptor, cell line KR3598 gi|12054434|emb|AJ302605.1|HSA302605[12054434]

[3815] 5929: AJ302604 Homo sapiens 6M1-16*01 gene for olfactory receptor, cell line LG2 gi|12054432|emb|AJ302604.1|HSA302604[12054432]

[3816] 5930: AJ302603 Homo sapiens 6M1-15*03 gene for olfactory receptor, cell line AMAI gi|12054430|emb|AJ302603.1|HSA302603[12054430]

[3817] 5931: AJ302602 Homo sapiens 6M1-15*02 gene for olfactory receptor, cell line WT51 gi|12054428|emb|AJ302602.1|HSA302602[12054428]

[3818] 5932: AJ302601 Homo sapiens 6M1-15*01 gene for olfactory receptor, cell line OLGA gi|12054426|emb|AJ302601.1|HSA302601[12054426]

[3819] 5933: AJ302600 Homo sapiens 6M1-15*01 gene for olfactory receptor, cell line YAR gi|12054424|emb|AJ302600.1|HSA302600[12054424]

[3820] 5934: AJ302599 Homo sapiens 6M115*01 gene for olfactory receptor, cell line SA gi|12054422|emb|AJ302599.1|HSA302599[12054422]

[3821] 5935: AJ302598 Homo sapiens 6M1-15*01 gene for olfactory receptor, cell line H2LCL gi|12054420|emb|AJ302598.1|HSA302598[12054420]

[3822] 5936: AJ302597 Homo sapiens 6M1-15*01 gene for olfactory receptor, cell line KR3598 gi|12054418|emb|AJ302597.1|HSA302597[12054418]

[3823] 5937: AJ302596 Homo sapiens 6M1-15*01 gene for olfactory receptor, cell line LG2 gi|12054416|emb|AJ302596.1|HSA302596[12054416]

[3824] 5938: AJ302595 Homo sapiens 6M1-15*01 gene for olfactory receptor, cell line BM19.7 gi|12054414|emb|AJ302595.1|HSA302595[12054414]

[3825] 5939: AJ302594 Homo sapiens 6M1-15*01 gene for olfactory receptor, cell line BM28.7 gi|12054412|emb|AJ302594.1|HSA302594[12054412]

[3826] 5940: AJ302593 Homo sapiens 6M1-10*02 gene for olfactory receptor, cell line KR3598 gi|12054410|emb|AJ302593.1|HSA302593[12054410]

[3827] 5941: AJ302592 Homo sapiens 6M1-10*01 gene for olfactory receptor, cell line AMAI gi|12054408|emb|AJ302592.1|HSA302592[12054408]

[3828] 5942: AJ302591 Homo sapiens 6M1-10*01 gene for olfactory receptor, cell line OLGA gi|12054406|emb|AJ302591.1|HSA302591[12054406]

[3829] 5943: AJ302590 Homo sapiens 6M1-10*01 gene for olfactory receptor, cell line YAR gi|12054404|emb|AJ302590.1|HSA302590[12054404]

[3830] 5944: AJ302589 Homo sapiens 6M1-10*01 gene for olfactory receptor, cell line SA gi|12054402|emb|AJ302589.1|HSA302589[12054402]

[3831] 5945: AJ302588 Homo sapiens 6M1-10*01 gene for olfactory receptor, cell line WT51 gi|12054400|emb|AJ302588.1|HSA302588[12054400]

[3832] 5946: AJ302587 Homo sapiens 6M1-10*01 gene for olfactory receptor, cell line H2LCL gi|12054398|emb|AJ302587.1|HSA302587[12054398]

[3833] 5947: AJ302586 Homo sapiens 6M1-10*01 gene for olfactory receptor, cell line LG2 gi|12054396|emb|AJ302586.1|HSA302586[12054396]

[3834] 5948: AJ302585 Homo sapiens 6M1-10*01 gene for olfactory receptor, cell line BM19.7 gi|12054394|emb|AJ302585.1|HSA302585[12054394]

[3835] 5949: AJ302584 Homo sapiens 6M1-10*01 gene for olfactory receptor, cell line BM28.7 gi|12054392|emb|AJ302584.1|HSA302584[12054392]

[3836] 5950: AJ302583 Homo sapiens 6M1-6*03 gene for olfactory receptor, cell line WT51 gi|12054390|emb|AJ302583.1|HSA302583[12054390]

[3837] 5951: AJ302582 Homo sapiens 6M1-6*02 gene for olfactory receptor, cell line OLGA gi|112054388|emb|AJ302582.1|HSA302582[12054388]

[3838] 5952: AJ302581 Homo sapiens 6M1-6*02 gene for olfactory receptor, cell line KR3598 gi|12054386|emb|AJ302581.1|HSA302581[12054386]

[3839] 5953: AJ302580 Homo sapiens 6M1-6*02 gene for olfactory receptor, cell line SA gi|12054384|emb|AJ302580.1|HSA302580[12054384]

[3840] 5954: AJ302579 Homo sapiens 6M1-6*02 gene for olfactory receptor, cell line AMAI gi|12054382|emb|AJ302579.1|HSA302579[12054382]

[3841] 5955: AJ302578 Homo sapiens 6M1-6*02 gene for olfactory receptor, cell line BM28.7 gi|12054380|emb|AJ302578.1|HSA302578[12054380]

[3842] 5956: AJ302577 Homo sapiens 6M1-6*02 gene for olfactory receptor, cell line BM19.7 gi|12054378|emb|AJ302577.1|HSA302577[12054378]

[3843] 5957: AJ302576 Homo sapiens 6M1-6*01 gene for olfactory receptor, cell line OLGA gi|12054376|emb|AJ302576.1|HSA302576[12054376]

[3844] 5958: AJ302575 Homo sapiens 6M1-6*01 gene for olfactory receptor, cell line YAR gi|12054374|emb|AJ302575.1|HSA302575[12054374]

[3845] 5959: AJ302574 Homo sapiens 6M1-6*01 gene for olfactory receptor, cell line SA gi|12054372|emb|AJ302574.1|HSA302574[12054372]

[3846] 5960: AJ302573 Homo sapiens 6M1-6*01 gene for olfactory receptor, cell line H2LCL gi|12054370|emb|AJ302573.1|HSA302573[12054370]

[3847] 5961: AJ302572 Homo sapiens 6M1-6*01 gene for olfactory receptor, cell line KR3598 gi|12054368|emb|AJ302572.1|HSA302572[12054368]

[3848] 5962: AJ302571 Homo sapiens 6M1-6*01 gene for olfactory receptor, cell line LG2 gi|12054366|emb|AJ302571.1|HSA302571[12054366]

[3849] 5963: AJ302570 Homo sapiens 6M1-4P*05 gene for olfactory receptor, cell line BM19.7 gi|12054364|emb|AJ302570.1|HSA302570[12054364]

[3850] 5964: AJ302569 Homo sapiens 6M1-4P*05 gene for olfactory receptor, cell line BM28.7 gi|12054362|emb|AJ302569.1|HSA302569[12054362]

[3851] 5965: AJ302568 Homo sapiens 6M1-4P*04 gene for olfactory receptor, cell line AMAI gi|12054360|emb|AJ302568.1|HSA302568[12054360]

[3852] 5966: AJ302567 Homo sapiens 6M1-4P*03 gene for olfactory receptor, cell line WT51 gi|12054358|emb|AJ302567.1|HSA302567[12054358]

[3853] 5967: AJ302566 Homo sapiens 6M1-4P*02 gene for olfactory receptor, cell line OLGA gi|12054356|emb|AJ302566.1|HSA302566[12054356]

[3854] 5968: AJ302565 Homo sapiens 6M1-4P*02 gene for olfactory receptor, cell line KR3598 gi|12054354|emb|AJ302565.1|HSA302565[12054354]

[3855] 5975: AJ302558 Homo sapiens 6M1-3*04 gene for olfactory receptor, cell line AMAI gi|12054346|emb|AJ302558.1|HSA302558[12054346]

[3856] 5976: AJ302557 Homo sapiens 6M1-3*03 gene for olfactory receptor, cell line WT51 gi|12054344|emb|AJ302557.1|HSA302557[12054344]

[3857] 5977: AJ302551 Homo sapiens 6M1-3*01 gene for olfactory receptor, cell line OLGA gi|12054342|emb|AJ302551.1|HSA302551[12054342]

[3858] 5978: AJ302550 Homo sapiens 6M1-3*01 gene for olfactory receptor, cell line YAR gi|12054340|emb|AJ302550.1|HSA302550[12054340]

[3859] 5979: AJ302549 Homo sapiens 6M1-3*01 gene for olfactory receptor, cell line SA gi|12054338|emb|AJ302549.1|HSA302549[12054338]

[3860] 5980: AJ302548 Homo sapiens 6M1-3*01 gene for olfactory receptor, cell line H2LCL gi|12054336|emb|AJ302548.1|HSA302548[12054336]

[3861] 5981: AJ302547 Homo sapiens 6M1-3*01 gene for olfactory receptor, cell line LG2 gi|12054334|emb|AJ302547.1|HSA302547[12054334]

[3862] 5982: AJ302546 Homo sapiens 6M1-1*02 gene for olfactory receptor, cell line BM19.7 gi|12054332|emb|AJ302546.1|HSA302546[12054332]

[3863] 5983: AJ302545 Homo sapiens 6M1-1*01 gene for olfactory receptor, cell line KR3598 gi|12054330|emb|AJ302545.1|HSA302545[12054330]

[3864] 5984: AJ302544 Homo sapiens 6M1-1*01 gene for olfactory receptor, cell line YAR gi|12054328|emb|AJ302544.1|HSA302544[12054328]

[3865] 5985: AJ302543 Homo sapiens 6M1-1*01 gene for olfactory receptor, cell line OLGA gi|12054326|emb|AJ302543.1|HSA302543[12054326]

[3866] 5986: AJ302542 Homo sapiens 6M1-1*01 gene for olfactory receptor, cell line SA gi|2054324|emb|AJ302542.1|HSA302542[12054324]

[3867] 5987: AJ302541 Homo sapiens 6M1-1*01 gene for olfactory receptor, cell line AMAI gi|12054322|emb|AJ302541.1|HSA302541[12054322]

[3868] 5988: AJ302540 Homo sapiens 6M1-1*01 gene for olfactory receptor, cell line WT51 gi|12054320|emb|AJ302540.1|HSA302540[12054320]

[3869] 5989: AJ302539 Homo sapiens 6M1-1*01 gene for olfactory receptor, cell line H2LCL gi|112054318|emb|AJ302539.1|HSA302539[12054318]

[3870] 5990: AJ302538 Homo sapiens 6M1-1*01 gene for olfactory receptor, cell line BM28.7 gi|12054316|emb|AJ302538.1|HSA302538[12054316]

[3871] 5991: AJ302537 Homo sapiens 6M1-1*01 gene for olfactory receptor, cell line LG2 gi|12054314|emb|AJ302537.1|HSA302537[12054314]

[3872] 5993: AJ131724 Homo sapiens mRNA for serotonin receptor 5-HT4 (splice variant h5-HT4 (b)) gi|12053629|emb|AJ131724.1|HSA131724[12053629]

[3873] 5994: AF305200 Homo sapiens interleukin 17E (IL17E) mRNA, complete cds gi|11878209|gb|AF305200.1|AF305200[11878209]

[3874] 5995: AH003378 Homo sapiens ciliary neurotrophic factor alpha receptor gene gi|608655|gb|AH003378.1|SEG_HUMCNFAR0[608655]

[3875] 5996: L38025 Homo sapiens ciliary neurotrophic factor alpha receptor gene, exons 8-10, complete cds gi|608654|gb|L38025.1|HUMCNFAR06[608654]

[3876] 5997: L38024 Homo sapiens ciliary neurotrophic factor alpha receptor gene, exons 5-7 gi|608653|gb|L38024.1|HMCNFAR05[608653]

[3877] 5998: L38023 Homo sapiens ciliary neurotrophic factor alpha receptor gene, exon 4 gi|608652|gb|L38023.1|HUMCNFAR04[608652]

[3878] 5999: L38022 Homo sapiens ciliary neurotrophic factor alpha receptor gene, exon 3 gi|608651|gb|L38022.1|HUMCNFAR03[608651]

[3879] 6000: L38021 Homo Sapiens ciliary neurutrophic factor alpha receptor gene, exon 2 gi|608650|gb|L38021.1|HUMCNFAR02[608650]

[3880] 6001: L38020 Homo sapiens ciliary neurotrophic factor alpha receptor gene, exon 1 gi|608649|gb|L38020.1|HUMCNFAR01[608649]

[3881] 6050: NM—012152 Homo sapiens endothelial differentiation, lysophosphatidic acid G-protein-coupled receptor, 7 (EDG7), mRNA gi|6912347|ref|NM012152.1|[6912347]

[3882] 6051: NM—007360 Homo sapiens DNA segment on chromosome 12 (unique) 2489 expressed sequence (D12S2489E), mRNA gi|6679051|ref|NM—007360.1|[6679051]

[3883] 6054: AF263029 Homo sapiens protein tyrosine phosphatase receptor type R (PTPRR) gene, exon and complete cds gi|12043771|gb|AF263029.1|F263016S14[12043771]

[3884] 6055: AF263028 Homo sapiens protein tyrosine phosphatase receptor type R (PTPRR) gene, exon 13 gi|2043770|gb|AF263028.1|F263016S13[12043770]

[3885] 6056: AF263027 Homo sapiens protein tyrosine phosphatase receptor type R (PTPRR) gene, exon 12 gi|2043769|gb|AF263027.1|F263016S12[12043769]

[3886] 6057: AF263026 Homo sapiens protein tyrosine phosphatase receptor type R (PTPRR) gene, exon 11 gi|12043768|gb|AF263026.1|F263016S11[12043768]

[3887] 6058: AF263025 Homo sapiens protein tyrosine phosphatase receptor type R (PTPRR) gene, exon 10 gi|2043767|gb|AF263025.1|F263016S10[12043767]

[3888] 6059: AF263024 Homo sapiens protein tyrosine phosphatase receptor type R (PTPRR) gene, exon 9 gi|12043766|gb|AF263024.1|F263016S09[12043766]

[3889] 6060: AF263023 Homo sapiens protein tyrosine phosphatase receptor type R (PTPRR) gene, exon 8 gi|12043765|gb|AF263023.1|F263016S08[12043765]

[3890] 6061: AF263022 Homo sapiens protein tyrosine phosphatase receptor type R (PTPRR) gene, exon 7 gi|12043764|gb|AF263022.1|F263016S07[12043764]

[3891] 6062: AF263021 Homo sapiens protein tyrosine phosphatase receptor type R (PTPRR) gene, exon 6 gi|12043763|gb|AF263021.1|F263016S06[12043763]

[3892] 6063: AF263020 Homo sapiens protein tyrosine phosphatase receptor type R (PTPRR) gene, exon 5 gi|12043762|gb|AF263020.1|F263016S05[12043762]

[3893] 6064: AF263019 Homo sapiens protein tyrosine phosphatase receptor type R (PTPRR) gene, exon 4 gi|1204376|gb|AF263019.1|F263016S04[12043761]

[3894] 6065: AF263018 Homo sapiens protein tyrosine phosphatase receptor type R (PTPRR) gene, exon gi|12043760|gb|AF263018.1|F263016S03[12043760]

[3895] 6066: AF263017 Homo sapiens protein tyrosine phosphatase receptor type R (PTPRR) gene, exon gi|12043759|gb|AF263017.1|F263016S02[12043759]

[3896] 6067: AF263016 Homo sapiens protein tyrosine phosphatase receptor type R (PTPRR) gene, exon gi|12043758|gb|AF263016.1|F263016S01[12043758]

[3897] 6068: AH010208 Homo sapiens chromosome 12 map 12q15 gi|12043757|gb|AH010208.1|SEG_F263016S[12043757]

[3898] 6069: AF310676 Homo sapiens E3 ubiquitin ligase SMURF2 mRNA, complete cds gi|12018150|gb|AF310676.1|AF310676[12018150]

[3899] 6070: AF310250 Homo sapiens IRS-1 PH domain binding protein PHIP mRNA, complete cds gi|12007333|gb|AF310250.1|AF310250[12007333]

[3900] 6071: AF276292 Homo sapiens killer cell immunoglobulin-like receptor KIR2DL4 mRNA, complete cds gi|12006296|gb|AF276292.1|AF276292[12006296]

[3901] 6072: AF272157 Homo sapiens killer cell immunoglobulin-like receptor precursor (KIR2DLX) gene, complete cds gi|12006228|gb|AF272157.1|AF272157[12006228]

[3902] 6073: AF271608 Homo sapiens clone 3 killer cell immunoglobulin-like receptor KIR2DLX (KIR2DLX) mRNA, complete cds gi|2006190|gb|AF271608.1|AF271608[12006190]

[3903] 6074: AF271607 Homo sapiens clone 13 killer cell immunoglobulin-like receptor KIR2DLX (KIR2DLX) mRNA, complete cds gi|12006188|gb|AF271607.1|AF271607[12006188]

[3904] 6075: AF223941 Homo sapiens complement receptor 2 (CR2) gene, promoter region and partial sequence gi|12004993|gb|AF223941.1|AF223941[12004993]

[3905] 6076: AF196176 Homo sapiens capsaicin receptor variant mRNA, complete cds gi|12003147|gb|AF196176.1|AF196176[12003147]

[3906] 6077: AF196175 Homo sapiens capsaicin receptor mRNA, complete cds gi|12003145|gb|AF196175.1|AF196175[12003145]

[3907] 6078: AF125539 Homo sapiens epidermal growth factor receptor (EGFR) gene, alternative exons, exons 16 and 17 and partial cds, alternatively spliced gi|2002219|gb|AF125539.1|AF125538S2[12002219]

[3908] 6079: AF125538 Homo sapiens epidermal growth factor receptor (EGFR) gene, exon 15 gi|2002218|gb|AF125538.1|AF125538S1[12002218]

[3909] 6080: AH010139 Homo sapiens epidermal growth factor receptor (EGFR) gene, partial cds, alternatively spliced gi|12002217|gb|AH010139.1|SEG_AF125538S[12002217]

[3910] 6081: AF308571 Homo sapiens hepatointestinal leukotriene B4 receptor mRNA, complete cds gi|11878227|gb|AF308571.1|AF308571[11878227]

[3911] 6082: AF275260 Homo sapiens SRPSOX (SRPSOX) mRNA, complete cds gi|11139543|gb|AF275260.1|AF275260[11139543]

[3912] 6083: NM—007161 Homo sapiens DNA segment on chromosome 6 (unique) 49 expressed sequence, NK cell triggering receptor, p30 (D6S49E), mRNA gi|6005740|ref|NM—007161.1|[6005740]

[3913] 6090: AF289204 Homo sapiens odorant receptor HOR3′beta4 and odorant receptor HOR3′beta5 genes, complete cds gi|11991862|gb|AF289204.1|AF289203S2[11991862]

[3914] 6091: AF289203 Homo sapiens odorant receptor HOR3′beta1, odorant receptor HOR3′beta2, and odorant receptor HOR3′beta3 genes, complete cds gi|11991861|gb|AF289203.1|AF289203S[11991861]

[3915] 6092: AH010109 Homo sapiens odorant receptor HOR3′beta1, odorant receptor HOR3′beta4, odorant receptor HOR3′beta2, odorant receptor HOR3′beta5, and odorant receptor HOR3′beta3 genes, complete cds gi|11991860|gb|AH010109.1|SEG_AF289203S[11991860]

[3916] 6093: AF217689 Homo sapiens nociceptin receptor ORL1 (ORL1) gene, exons 1b and 2, and partial cds, alternatively spliced gi|11991833|gb|AF217689.1|AF217688S2[11991833]

[3917] 6094: AF217688 Homo sapiens G alpha interacting protein (GAIP) gene, partial cds, alternatively spliced; and nociceptin receptor ORL1 (ORL1) gene, exon 1a gi|11991832|gb|AF217688.1|AF217688S1[11991832]

[3918] 6095: AH010108 Homo sapiens G alpha interacting protein (GAIP) and nociceptin receptor ORL1 (ORL1) genes, partial cds gi|1199183|gb|AH010108.1|SEG_AF217688S[11991831]

[3919] 6096: AB045011 Homo sapiens hmGluR2 gene for metabotropic glutamate receptor type 2, complete cds gi|11990938|dbj|AB045011.1|AB045011[11990938]

[3920] 6097: AF281074 Homo sapiens neuropilin 2 (NRP2) gene, complete cds, alternatively spliced gi|11934947|gb|AF281074.1|AF281074[11934947]

[3921] 6098: AJ400846 Homo sapiens mRNA for immunoglobulin-like cell surface receptor FDFACT1, activating counterpart allele 1 gi|11932154|emb|AJ400846.1|HSA400846[11932154]

[3922] 6099: AJ400845 Homo sapiens mRNA for immunoglobulin-like cell surface receptor FDFACT2, activating counterpart allele 2 gi|11932151|emb|AJ400845.1|HSA400845[11932151]

[3923] 6100: AB024327 Homo sapiens pt-wd mRNA for WD-40 repeat protein, complete cds gi|4519416|dbj|AB024327.1|AB024327[4519416]

[3924] 6102: AF280547 Homo sapiens neuropilin-1 soluble isoform 11 (NRP1) mRNA, complete cds, alternatively spliced gi|11907931|gb|AF280547.1|AF280547[11907931]

[3925] 6103: AF280546 Homo sapiens neuropilin-2 soluble isoform 9 (NRP2) mRNA, complete cds, alternatively spliced gi|11907929|gb|AF280546.1|AF280546[11907929]

[3926] 6104: AF280545 Homo sapiens neuropilin-2b(5) (NRP2) mRNA, complete cds, alternatively spliced gi|11907927|gb|AF280545.1|AF280545[11907927]

[3927] 6105: AF280544 Homo sapiens neuropilin-2b(O) (NRP2) mRNA, complete cds, alternatively spliced gi|11907925|gb|AF280544.1|AF280544[11907925]

[3928] 6106: AF268899 Homo sapiens neuropeptide FF receptor 2 (NPFF2) mRNA, complete cds gi|1907914|gb|AF268899.1|AF268899[11907914]

[3929] 6107: AF268898 Homo sapiens neuropeptide FF receptor 1 (NPFF1) mRNA, complete cds gi|11907912|gb|AF268898.1|AF268898[11907912]

[3930] 6111: Y19228 Homo sapiens partial GIR gene for glucocorticoid induced receptor, exons and joined CDS gi|11878425|emb|Y19228.1|HSY19228[11878425]

[3931] 6118: Y19231 Homo sapiens partial GIR gene for glucocorticoid induced receptor, exon 4 gi|11877264|emb|Y19231.1|HSY19231[11877264]

[3932] 6119: Y19230 Homo sapiens partial GIR gene for glucocorticoid induced receptor, exon 3 gi|11877263|emb|Y19230.1|HSY19230[11877263]

[3933] 6120: Y19229 Homo sapiens partial GIR gene for glucocorticoid induced receptor, exon 2 gi|1877262|emb|Y19229.1|HSY19229[11877262]

[3934] 6121: AX047952 Sequence 19 from Patent WO0070045 gi|11876875|emb|AX047952.1|AX047952[11876875]

[3935] 6122: AX047940 Sequence 7 from Patent WO0070045 gi|11876863|emb|AX047940.1|AX047940[11876863]

[3936] 6123: AX047936 Sequence 3 from Patent WO0070045 gi|11876859|emb|AX047936.1|AX047936[11876859]

[3937] 6124: AJ272207 Homo sapiens mRNA for putative G protein-coupled receptor 92 (GPR92 gene) gi|9843745|emb|AJ272207.1|HSA272207[9843745]

[3938] 6125: AF311306 Homo sapiens prostate specific G-protein coupled receptor gene, complete cds gi|11875777|gb|AF311306.1|AF311306[11875777]

[3939] 6126: NM—022146 Homo sapiens neuropeptide FF 1; RFamide-related peptide receptor (OT7T022), mRNA gi|1545886|ref|NM—022146.1|[11545886]

[3940] 6127: NM—004885 Homo sapiens neuropeptide G protein-coupled receptor; neuropeptide FF 2 (NPGPR), mRNA gi|4758819|ref|NM—004885.1|[4758819]

[3941] 6128: NM—002958 Homo sapiens RYK receptor-like tyrosine kinase (RYK), mRNA gi|11863158|ref|NM—002958.1|[11863158]

[3942] 6129: AF217485 Homo sapiens KIR3DS1 gene, partial sequence; and killer cell Ig-like receptor KIR2DL5.1 (KIR2DL5.1) gene, complete cds gi|11761705|gb|AF217485.1|AF217485[11761705]

[3943] 6130: NM—005856 Homo sapiens receptor (calcitonin) activity modifying protein 3 (RAMP3), mRNA gi|5032022|ref|NM—005856.1|[5032022]

[3944] 6131: NM—005854 Homo sapiens receptor (calcitonin) activity modifying protein 2 (RAMP2), mRNA gi|5032020|ref|NM—005854.1|[5032020]

[3945] 6132: NM—005855 Homo sapiens receptor (calcitonin) activity modifying protein 1 (RAMP1), mRNA gi|5032018|ref|NM—005855.1|[5032018]

[3946] 6133: NM—000025 Homo sapiens adrenergic, beta-3-, receptor (ADRB3), mRNA gi|4557266|ref|NM—000025.1|[4557266]

[3947] 6134: AF245390 Homo sapiens GREB1c (GREB1) mRNA, complete cds, alternatively spliced gi|11611737|gb|AF245390.1|AF245390[11611737]

[3948] 6135: AF245389 Homo sapiens GREB1b (GREB1) mRNA, complete cds, alternatively spliced gi|11611735|gb|AF245389.1|AF245389[11611735]

[3949] 6136: AF245388 Homo sapiens GREB1a (GREB1) mRNA, partial cds, alternatively spliced gi|11611733|gb|AF245388.1|AF245388[11611733]

[3950] 6137: AF292402 Homo sapiens neuromedin U receptor-type 2 mRNA, complete cds gi|9944989|gb|AF292402.1|AF292402[9944989]

[3951] 6138: NM—002855 Homo sapiens poliovirus receptor-related 1 (herpesvirus entry mediator C; nectin) (PVRL1), mRNA gi|11602905|ref|NM—002855.2|[11602905]

[3952] 6143: AH010043 Homo sapiens gi|11559571|gb|AH010043.1|SEG_AF260138S[11559571]

[3953] 6144: AF260137 Homo sapiens killer-cell immunoglobulin-like receptor KIR2DL5.3 (KIR2DL5) gene, exon 1 and partial cds gi|11559569|gb|AF260137.1|AF260137[11559569]

[3954] 6145: X76400 Homo sapiens mRNA for nectin 1 (PRR1 gene) gi|11558774|emb|X76400.2|HSPRR[11558774]

[3955] 6147: NM—022159 Homo sapiens ETL protein (ETL), mRNA gi|11545907|ref|NM—022159.1|[11545907]

[3956] 6148: NM—022150 Homo sapiens RFamide-related peptide precursor (RFRP), mRNA gi|11545893|ref|NM—022150.1|[11545893]

[3957] 6149: NM—022049 Homo sapiens G-protein coupled receptor 88 (GPR88), mRNA gi|11545752|ref|NM—022049.1|[11545752]

[3958] 6219: AF281308 Homo sapiens alpha 2A adrenergic receptor (ADRA2A) gene, complete cds gi|9652209|gb|AF281308.1|AF281308[9652209]

[3959] 6241: AF217487 Homo sapiens killer cell Ig-like receptor KIR2DL5.3 (KIR2DL5.3) mRNA, complete cds gi|11528059|gb|AF217487.1|AF217487[11528059]

[3960] 6242: NM—003553 Homo sapiens olfactory receptor, family 1, subfamily E, member 1 (OR1E1), mRNA gi|11496274|ref|NM—003553.1|[11496274]

[3961] 6243: AF208054 Homo sapiens non-inhibitory killer-cell Ig-like receptor KIR (KIR2DS5) mRNA, complete cds gi|11493968|gb|AF208054.1|AF208054[11493968]

[3962] 6244: NM—018690 Homo sapiens apolipoprotein B48 receptor (APOB48R), mRNA gi|8922078|ref|NM—018690.1|[8922078]

[3963] 6245: AB044934 Homo sapiens H4R mRNA for histamine H4 receptor, complete cds gi|10241846|dbj|AB044934.1|AB044934[10241846]

[3964] 6246: NM—003555 Homo sapiens olfactory receptor, family 1, subfamily G, member 1 (OR1G1), mRNA gi|11415033|ref|NM—003555.1|[11415033]

[3965] 6247: NM—003552 Homo sapiens olfactory receptor, family 1, subfamily D, member 4 (OR1D4), mRNA gi|11415031|ref|NM—003552.1|[11415031]

[3966] 6248: NM—003554 Homo sapiens olfactory receptor, family 1, subfamily E, member 2 (OR1E2), mRNA gi|11386152|ref|NM—003554.1|[11386152]

[3967] 6390: AF264014 Homo sapiens scavenger receptor cysteine-rich type I protein M160 precursor, mRNA, complete cds, alternatively spliced gi|9652086|gb|AF264014.1|AF264014[9652086]

[3968] 6391: AF169007 Homo sapiens beta-1-adrenergic receptor (ADRB1) gene, complete cds gi|5833816|gb|AF169007.1|AF169007[5833816]

[3969] 6392: AF169006 Homo sapiens beta-1-adrenergic receptor (ADRB1) gene, complete cds gi|5833814|gb|AF169006.1|AF169006[5833814]

[3970] 6393: AF159854 Homo sapiens cytokine signaling suppressor (SOCS3) mRNA, complete cds gi|5353755|gb|AF159854.1|AF159854[5353755]

[3971] 6394: AF032124 Homo sapiens RET proto-oncogene (RET) gene, 5′ flanking region and partial cds gi|2795879|gb|AF032124.1|AF032124[2795879]

[3972] 6395: NM—002644 Homo sapiens polymeric immunoglobulin receptor (PIGR), mRNA gi|11342673|ref|NM—002644.1|[11342673]

[3973] 6396: AJ249248 Homo sapiens mRNA for putative G protein-coupled Receptor gi|5834594|emb|AJ249248.1|HSA249248[5834594]

[3974] 6397: AJ277028 Homo sapiens mRNA for vanilloid receptor 1 (VR1 gene) gi|8977865|emb|AJ277028.1|HSA277028[8977865]

[3975] 6398: AF072872 Homo sapiens frizzled 1 mRNA, complete cds gi|5305406|gb|AF072872.1|AF072872[5305406]

[3976] 6399: AF073727 Homo sapiens EH domain-binding mitotic phosphoprotein (EPSIN) mRNA, complete cds gi|5051635|gb|AF073727.1|AF073727[5051635]

[3977] 6400: NM—002551 Homo sapiens olfactory receptor, family 3, subfamily A, member 2 (OR3A2), mRNA gi|11321568|ref|NM—002551.1|[11321568]

[3978] 6401: NM—000870 Homo sapiens 5-hydroxytryptamine (serotonin) receptor 4 (HTR4), mRNA gi|11321562|ref|NM—000870.1|[11321562]

[3979] 6419: AB042411 Homo sapiens strg gene for striatum-specific G potein-coupled receptor, complete cds gi|111275369|dbj|AB042411.1|AB042411[11275369]

[3980] 6420: AB042410 Homo sapiens strg mRNA for striatum-specific G protein-coupled receptor, complete cds gi|11275367|dbj|AB042410.1|AB042410[11275367]

[3981] 6434: AJ289159 Homo sapiens CD30 gene for cytokine receptor CD30, exons 1-8 gi|1230634|emb|AJ289159.1|HSA289159[11230634]

[3982] 6435: AF279762 Homo sapiens ROR2 (ROR2) gene, exon 9 and partial cds gi|11228720|gb|AF279762.1|AF279755S8[11228720]

[3983] 6436: AF279761 Homo sapiens ROR2 (ROR2) gene, exon 8 gi|11228719|gb|AF279761.1|AF279755S7[11228719]

[3984] 6437: AF279760 Homo sapiens ROR2 (ROR2) gene, exon 7 gi|11228718|gb|AF279760.1|AF279755S6[11228718]

[3985] 6438: AF279759 Homo sapiens ROR2 (ROR2) gene, exon 6 gi|11228717|gb|AF279759.1|AF279755S5[11228717]

[3986] 6439: AF279758 Homo sapiens ROR2 (ROR2) gene, exon 5 gi|11228716|gb|AF279758.1|AF279755S4[11228716]

[3987] 6440: AF279757 Homo sapiens ROR2 (ROR2) gene, exon 4 gi|11228715|gb|AF279757.1|AF279755S3[11228715]

[3988] 6441: AF279756 Homo sapiens ROR2 (ROR2) gene, exon 3 gi|11228714|gb|AF279756.1|AF279755S2[11228714]

[3989] 6442: AF279755 Homo sapiens ROR2 (ROR2) gene, exon 2 gi|11228713|gb|AF279755.1|AF279755S1[11228713]

[3990] 6443: AH010002 Homo sapiens ROR2 (ROR2) gene, partial cds gi|11228712|gb|AH010002.1|SEG_AF279755S[11228712]

[3991] 6444: AF260529 Homo sapiens MER receptor tyrosine kinase (MERTK) gene, exon 19 and partial cds gi|11228705|gb|AF260529.1|F260514S16[11228705]

[3992] 6445: AF260528 Homo sapiens MER receptor tyrosine kinase (MERTK) gene, exons 17 and 18 gi|11228704|gb|AF260528.1|F260514S15[11228704]

[3993] 6446: AF260527 Homo sapiens MER receptor tyrosine kinase (MERTK) gene, exon 16 gi|11228703|gb|AF260527.1|F260514S14[11228703]

[3994] 6447: AF260526 Homo sapiens MER receptor tyrosine kinase (MERTK) gene, exon 15 gi|11228702|gb|AF260526.1|F260514S13[11228702]

[3995] 6448: AF260525 Homo sapiens MER receptor tyrosine kinase (MERTK) gene, exon 14 gi|11228701|gb|AF260525.1|F260514S12[11228701]

[3996] 6449: AF260524 Homo sapiens MER receptor tyrosine kinase (MERTK) gene, exons 12 and 13 gi|11228700|gb|AF260524.1|F260514S11[11228700]

[3997] 6450: AF260523 Homo sapiens MER receptor tyrosine kinase (MERTK) gene, exon 11 gi|11228699|gb|AF260523.1|F260514S10[11228699]

[3998] 6451: AF260522 Homo sapiens MER receptor tyrosine kinase (MERTK) gene, exon 10 gi|11228698|gb|AF260522.1|F260514S09[11228698]

[3999] 6452: AF260521 Homo sapiens MER receptor tyrosine kinase (MERTK) gene, exon 9 gi|11228697|gb|AF260521.1|F260514S08[11228697]

[4000] 6453: AF260520 Homo sapiens MER receptor tyrosine kinase (MERTK) gene, exon 8 gi|11228696|gb|AF260520.1|F260514S07[11228696]

[4001] 6454: AF260519 Homo sapiens MER receptor tyrosine kinase (MERTK) gene, exon 7 gi|11228695|gb|AF260519.1|F260514S06[11228695]

[4002] 6455: AF260518 Homo sapiens MER receptor tyrosine kinase (MERTK) gene, exon 6 gi|11228694|gb|AF260518.1|F260514S05[11228694]

[4003] 6456: AF260517 Homo sapiens MER receptor tyrosine kinase (MERTK) gene, exon 5 gi|11228693|gb|AF260517.1|F260514S04[11228693]

[4004] 6457: AF260516 Homo sapiens MER receptor tyrosine kinase (MERTK) gene, exon 4 gi|11228692|gb|AF260516.1|F260514S03[11228692]

[4005] 6458: AF260515 Homo sapiens MER receptor tyrosine kinase (MERTK) gene, exon 3 gi|11228691|gb|AF260515.1|F260514S02[11228691]

[4006] 6459: AF260514 Homo sapiens MER receptor tyrosine kinase (MERTK) gene, exon 2 gi|11228690|gb|AF260514.1|F260514S01[11228690]

[4007] 6460: AH010001 Homo sapiens MER receptor tyrosine kinase (MERTK) gene, partial cds gi|1228689|gb|AH010001.1|SEG_F260514S[11228689]

[4008] 6461: AF175406 Homo sapiens transient receptor potential 4 (TRP4) mRNA, complete cds gi|5802614|gb|AF175406.1|AF175406[5802614]

[4009] 6462: NM—017416 Homo sapiens interleukin 1 receptor accessory protein-like 2 (IL1RAPL2), mRNA gi|11225606|ref|NM—017416.1|[11225606]

[4010] 6463: AJ295237 Homo sapiens mRNA for neuronal nicotinic acetylcholine receptor subunit alpha (NACHR alpha 10 gene) gi|11182127|emb|AJ295237.1|HSA295237[11182127]

[4011] 6464: NM—004720 Homo sapiens endothelial differentiation, lysophosphatidic acid G-protein-coupled receptor, 4 (EDG4), mRNA gi|11038657|ref|NM—004720.3|[11038657]

[4012] 6465: AF298770 Homo sapiens Smac/DIABLO-S protein mRNA, complete cds gi|10719653|gb|AF298770.1|AF298770[10719653]

[4013] 6562: NM—005226 Homo sapiens endothelial differentiation, sphingolipid G-protein-coupled receptor, 3 (EDG3), mRNA gi|4885194|ref|NM—005226.1|[4885194]

[4014] 6563: NM—021803 Homo sapiens interleukin 21 (IL21), mRNA gi|11141874|ref|NM—021803.1|[11141874]

[4015] 6564: NM—021798 Homo sapiens interleukin 21 receptor (IL21R), mRNA gi|11141868|ref|NM—021798.1|[11141868]

[4016] 6565: AF307973 Homo sapiens histamine H4 receptor mRNA, complete cds gi|11141732|gb|AF307973.1|AF307973[11141732]

[4017] 6566: X06026 Homo sapiens partial CD3G gene, exon 1 (and joined CDS) gi|36809|emb|X06026.1|HSTCR3G1[36809]

[4018] 6567: AF200220 Homo sapiens FcRn alpha chain (FCGRT) gene, exons 5, 6, 7, and complete cds gi|11138512|gb|AF200220.1|AF200219S2[11138512]

[4019] 6568: AF200219 Homo sapiens FcRn alpha chain (FCGRT) gene, exons 1 through 4 gi|11138511|gb|AF200219.1|AF200219S1[11138511]

[4020] 6569: AH009974 Homo sapiens FcRn alpha chain (FCGRT) gene, exons 1 through 4 gi|11138510|gb|AH009974.1|SEG_AF200219S[11138510]

[4021] 6570: NM—017581 Homo sapiens cholinergic receptor, nicotinic, alpha polypeptide 9 (CHRNA9), mRNA gi|8923741|ref|NM—017581.1|[8923741]

[4022] 6571: AB040290 Homo sapiens RFRP mRNA for RFamide-related peptide precursor, complete cds gi|11125707|dbj|AB040290.1|AB040290[11125707]

[4023] 6572: AB040104 Homo sapiens OT7T022 mRNA for RFamide-related peptide receptor, complete cds gi|11125701|dbj|AB040104.1|AB040104[11125701]

[4024] 6598: AF308542 Homo sapiens clone ST1L_G11 immunoglobulin heavy chain mRNA, partial cds gi|11119124|gb|AF308542.1|AF308542[11119124]

[4025] 6599: AJ271338 Homo sapiens IL1L1 gene for interleukin-1 like protein 1, exons 1-6 gi|6729586|emb|AJ271338.1|HSA271338[6729586]

[4026] 6600: AJ242738 Homo sapiens mRNA for interleukin-1-like protein 1 (IL1L1 gene) transcript 2 gi|6165335|emb|AJ242738.1|HSA242738[6165335]

[4027] 6601: AJ242737 Homo sapiens mRNA for interleukin-1-like protein-1 (IL1L gene), transcript 1 gi|6165333|emb|AJ242737.1|HSA242737[6165333]

[4028] 6602: NM—005508 Homo sapiens chemokine (C-C motif) receptor 4 (CCR4), mRNA gi|5031626|ref|NM—005508.1|[5031626]

[4029] 6603: NM—005283 Homo sapiens chemokine (C motif) XC receptor 1 (CCXCR1), mRNA gi|4885338|ref|NM—005283.1|[4885338]

[4030] 6604: AJ238419 Homo sapiens mRNA for HIV-specific T-cell receptor beta chain, clone RI, partial gi|4691321|emb|AJ238419.1|HSA238419[4691321]

[4031] 6605: AJ238418 Homo sapiens mRNA for HIV-specific T-cell receptor beta chain, clone MA, partial gi|4691319|emb|AJ238418.1|HSA238418[4691319]

[4032] 6606: AJ238417 Homo sapiens mRNA for HIV-specific T-cell receptor beta chain, clone HA, partial gi|4691317|emb|AJ238417.1|HSA238417[4691317]

[4033] 6607: AJ238416 Homo sapiens mRNA for HIV-specific T-cell receptor alpha chain, clone RI, partial gi|4691315|emb|AJ238416.1|HSA238416[4691315]

[4034] 6608: AJ238415 Homo sapiens mRNA for HIV-specific T-cell receptor alpha chain, clone MA, partial gi|4691313|emb|AJ238415.1|HSA238415[4691313]

[4035] 6609: AJ238414 Homo sapiens mRNA for HIV-specific T-cell receptor alpha chain, clone HA, partial gi|4691311|emb|AJ238414.1|HSA238414[4691311]

[4036] 6610: AF074042 AF074042 Human Homo sapiens genomic clone pTWB15.69 T7, genomic survey sequence gi|3342086|gb|AF074042.1|AF074042[3342086]

[4037] 6611: AF074041 AF074041 Human Homo sapiens genomic clone pTWB15.69 SP6, genomic survey sequence gi|3342085|gb|AF074041.1|AF074041[3342085]

[4038] 6612: AF074040 AF074040 Human Homo sapiens genomic clone pTWB15.53 T7, genomic survey sequence gi|3342084|gb|AF074040.1|AF074040[3342084]

[4039] 6613: AF074039 AF074039 Human Homo sapiens genomic clone pTWB15.53 SP6, genomic survey sequence gi|3342083|gb|AF074039.1|AF074039[3342083]

[4040] 6614: AF074038 AF074038 Human Homo sapiens genomic clone pTWB15.43 T7, genomic survey sequence gi|3342082|gb|AF074038.1|AF074038[3342082]

[4041] 6615: AF074037 AF074037 Human Homo sapiens genomic clone pTWB15.43 SP6, genomic survey sequence gi|3342081|gb|AF074037.1|AF074037[3342081]

[4042] 6616: AF074036 AF074036 Human Homo sapiens genomic clone pTWB15.42, genomic survey sequence gi|3342080|gb|AF074036.1|AF074036[3342080]

[4043] 6617: AF074034 AF074034 Human Homo sapiens genomic clone pTWB15.32 T7, genomic survey sequence gi|3342079|gb|AF074034.1|AF074034[3342079]

[4044] 6618: AF074033 AF074033 Human Homo sapiens genomic clone pTWB15.32 SP6, genomic survey sequence gi|3342078|gb|AF074033.1|AF074033[3342078]

[4045] 6619: AF074032 AF074032 Human Homo sapiens genomic clone pTWB15.31 T7, genomic survey sequence gi|3342077|gb|AF074032.1|AF074032[3342077]

[4046] 6620: AF074031 AF074031 Human Homo sapiens genomic clone pTWB15.31 SP6, genomic survey sequence gi|3342076|gb|AF074031.1|AF074031[3342076]

[4047] 6621: AF074030 AF074030 Human Homo sapiens genomic clone pTWB15.28 T7, genomic survey sequence gi|3342075|gb|AF074030.1|AF074030[3342075]

[4048] 6622: AF074028 AF074028 Human Homo sapiens genomic clone pTWB15.21, genomic survey sequence gi|3342074|gb|AF074028.1|AF074028[3342074]

[4049] 6623: AF074027 AF074027 Human Homo sapiens genomic clone pTWB15.12, genomic survey sequence gi|3342073|gb|AF074027.1|AF074027[3342073]

[4050] 6624: AF074026 AF074026 Human Homo sapiens genomic clone pTWB15.09, genomic survey sequence gi|3342072|gb|AF074026.1|AF074026[3342072]

[4051] 6625: AF074025 AF074025 Human Homo sapiens genomic clone pTWB15.08, genomic survey sequence gi|334207|gb|AF074025.1|AF074025[3342071]

[4052] 6626: AF074024 AF074024 Human Homo sapiens genomic clone pTWB15.07, genomic survey sequence gi|3342070|gb|AF074024.1|AF074024[3342070]

[4053] 6627: AF074023 AF074023 Human Homo sapiens genomic clone pTWB15.04, genomic survey sequence gi|3342069|gb|AF074023.1|AF074023[3342069]

[4054] 6628: AF074022 AF074022 Human Homo sapiens genomic clone pTWB15.04 SP6, genomic survey sequence gi|3342068|gb|AF074022.1|AF074022[3342068]

[4055] 6629: NM—000450 Homo sapiens selectin E (endothelial adhesion molecule 1) (SELE), mRNA gi|4506870|ref|NM—000450.1|[4506870]

[4056] 6630: AF254069 Homo sapiens interleukin 21 (IL21) mRNA, complete cds gi|11093535|gb|AF254069.1|AF254069[11093535]

[4057] 6631: AF254067 Homo sapiens interleukin 21 receptor (IL21R) mRNA, complete cds gi|1109353|gb|AF254067.1|AF254067[11093531]

[4058] 6632: AF251510 Homo sapiens leukocyte-associated Ig-like receptor 1D isoform mRNA, complete cds gi|11090865|gb|AF251510.2|AF251510[11090865]

[4059] 6633: AF251509 Homo sapiens leukocyte-associated Ig-like receptor 1C isoform mRNA, complete cds gi|11090859|gb|AF251509.2|AF251509[11090859]

[4060] 6634: AB043943 Homo sapiens GPVI gene for platelet glycoprotein VI, partial cds gi|9955915|dbj|AB043943.1|AB043943[9955915]

[4061] 6635: AB043821 Homo sapiens GPVI mRNA for platelet glycoprotein VI-3, complete cds gi|9955913|dbj|AB043821.1|AB043821[9955913]

[4062] 6636: AB043820 Homo sapiens GPVI mRNA for platelet glycoprotein VI-2, complete cds gi|9955911|dbj|A;3043820.1|AB043820[9955911]

[4063] 6637: AB043819 Homo sapiens GPVI mRNA for platelet glycoprotein VI-1, complete cds gi|9955909|dbj|AB043819.1|AB043819[9955909]

[4064] 6638: NM—000527 Homo sapiens low density lipoprotein receptor (familial hypercholesterolemia) (LDLR), mRNA gi|8051613|ref|NM—000527.2|[8051613]

[4065] 6639: NM—012407 Homo sapiens protein kinase C, alpha binding protein (PRKCABP), mRNA gi|7110696|ref|NM—012407.1|[7110696]

[4066] 6640: NM—005232 Homo sapiens EphA1 (EPHA1), mRNA gi|4885208|ref|NM—005232.1|[4885208]

[4067] 6641: NM—000214 Homo sapiens jagged 1 (Alagille syndrome) (JAG1), mRNA gi|4557678|ref|NM—000214.1|[4557678]

[4068] 6642: NM—000875 Homo sapiens insulin-like growth factor 1 receptor (IGF1R), mRNA gi|11068002|ref|NM—000875.2|[11068002]

[4069] 6643: AF298812 Homo sapiens X-linked ectodysplasin-A2 receptor (XEDAR) mRNA, complete cds gi|11066914|gb|AF298812.1|AF298812[11066914]

[4070] 6644: AF197929 Homo sapiens short form lysophosphatidic acid receptor EDG4 (EDG4) mRNA, complete cds gi|11066253|gb|AF197929.1|AF197929[11066253]

[4071] 6645: NM—021642 Homo sapiens Fc fragment of IgG, low affinity IIa, receptor for (CD32) (FCGR2A), mRNA gi|11056051|ref|NM—021642.1|[11056051]

[4072] 6646: AF280400 Homo sapiens alpha 2C adrenergic receptor variant (ADRA2C) gene, complete cds gi|11055420|gb|AF280400.1|AF280400[11055420]

[4073] 6647: AF280399 Homo sapiens alpha 2C adrenergic receptor (ADRA2C) gene, complete cds gi|11055418|gb|AF280399.1|AF280399[11055418]

[4074] 6648: AF263523 Homo sapiens vanilloid receptor-related osmotically activated channel (VROAC) mRNA, complete cds gi|11055321|gb|AF263523.1|AF263523[11055321]

[4075] 6649: NM—001117 Homo sapiens adenylate cyclase activating polypeptide 1 (pituitary) (ADCYAP1), mRNA gi|10947062|ref|NM—001117.2|[10947062]

[4076] 6650: NM—002355 Homo sapiens mannose-6-phosphate receptor (cation dependent) (M6PR), mRNA gi|10947032|ref|NM—002355.2|[10947032]

[4077] 6651: NM—000541 Homo sapiens S-antigen; retina and pineal gland (arrestin) (SAG), mRNA gi|10880124|ref|NM—000541.2|[10880124]

[4078] 6652: NM—021130 Homo sapiens peptidylprolyl isomerase A (cyclophilin A) (PPIA), mRNA gi|10863926|ref|NM—021130.1|[10863926]

[4079] 6653: NM—001106 Homo sapiens activin A receptor, type IIB (ACVR2B), mRNA gi|10862697|ref|NM—001106.2|[10862697]

[4080] 6654: NM—001616 Homo sapiens activin A receptor, type II (ACVR2), mRNA gi|10862696|ref|NM—001616.2|[10862696]

[4081] 6655: NM—001105 Homo sapiens activin A receptor, type I (ACVR1), mRNA gi|10862690|ref|NM—001105.2|[10862690]

[4082] 6656: NM—001136 Homo sapiens advanced glycosylation end product-specific receptor (AGER), mRNA gi|10835202|ref|NM—001136.1|[10835202]

[4083] 6657: NM—000866 Homo sapiens 5-hydroxytryptamine (serotonin) receptor IF (HTR1F), mRNA gi|10835196|ref|NM—000866.1|[10835196]

[4084] 6658: NM—000629 Homo sapiens interferon (alpha, beta and omega) receptor 1 (IFNAR1), mRNA gi|10835182|ref|NM—000629.1|[10835182]

[4085] 6659: NM—000621 Homo sapiens 5-hydroxytryptamine (serotonin) receptor 2A (HTR2A), mRNA gi|10835174|ref|NM—000621.1|[10835174]

[4086] 6660: NM—000610 Homo sapiens CD44 antigen (homing function and Indian blood group system) (CD44), mRNA gi|10835162|ref|NM—000610.1|[10835162]

[4087] 6661: NM—000585 Homo sapiens interleukin 15 (IL15), mRNA gi|10835152|ref|NM—000585.1|[10835152]

[4088] 6662: NM—000586 Homo sapiens interleukin 2 (IL2), mRNA gi|10835148|ref|NM—000586.1|[10835148]

[4089] 6663: NM—000577 Homo sapiens interleukin 1 receptor antagonist (IL1RN), mRNA gi|10835146|ref|NM—000577.1|[10835146]

[4090] 6664: NM—000576 Homo sapiens interleukin 1, beta (IL1B), mRNA gi|10835144|ref|NM—000576.1|[10835144]

[4091] 6665: NM—000570 Homo sapiens Fc fragment of IgG, low affinity IIIb, receptor for (CD16) (FCGR3B), mRNA gi|10835138|ref|NM—000570.1|[10835138]

[4092] 6666: NM—000566 Homo sapiens Fc fragment of IgG, high affinity Ia, receptor for (CD64) (FCGR|A), mRNA gi|10835132|ref|NM—000566.1|[10835132]

[4093] 6667: NM—000564 Homo sapiens interleukin 5 receptor, alpha (IL5RA), mRNA gi|10835130|ref|NM—000564.1|[10835130]

[4094] 6668: NM—000525 Homo sapiens potassium inwardly-rectifying channel, subfamily J, member 11 (KCNJ11), mRNA gi|10835116|ref|NM—000525.1|[10835116]

[4095] 6669: NM—003841 Homo sapiens tumor necrosis factor receptor superfamily, member 10c, decoy without an intracellular domain (TNFRSF10C), mRNA gi|10835042|ref|NM003841.1|[10835042]

[4096] 6672: NM—001307 Homo sapiens claudin 7 (CLDN7), mRNA gi|10835007|ref|NM001307.1|[10835007]

[4097] 6673: NM—000640 Homo sapiens interleukin 13 receptor, alpha 2 (IL13RA2), mRNA gi|10834991|ref|NM—000640.1|[10834991]

[4098] 6674: NM—001993 Homo sapiens coagulation factor III (thromboplastin, tissue factor) (F3), mRNA gi|10518499|ref|NM—001993.2|[10518499]

[4099] 6675: NM—013252 Homo sapiens C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 5 (CLECSF5), mRNA gi|10281668|ref|NM—013252.1|[10281668]

[4100] 6676: NM—020547 Homo sapiens anti-Mullerian hormone receptor, type II (AMHR2), mRNA gi|10198655|ref|NM—020547.1|[10198655]

[4101] 6677: NM—018970 Homo sapiens G protein-coupled receptor 85 (GPR85), mRNA gi|10190654|ref|NM018970.2|[10190654]

[4102] 6678: NM—014292 Homo sapiens chromobox homolog 6 (CBX6), mRNA gi|10140848|ref|NM—014292.1|[10140848]

[4103] 6679: NM—019897 Homo sapiens olfactory receptor, family 2, subfamily S, member 2 (OR2S2), mRNA gi|10092668|ref|NM—019897.1|[10092668]

[4104] 6680: NM—014499 Homo sapiens putative purinergic receptor (P2Y10), mRNA gi|10092632|ref|NM—014499.1|[10092632]

[4105] 6681: NM—017572 Homo sapiens G protein-coupled receptor kinase 7 (GPRK7), mRNA gi|9994196|ref|NM—017572.1|[9994196]

[4106] 6682: NM—020406 Homo sapiens polycythemia rubra vera 1; cell surface receptor (PRV1), mRNA gi|9966888|ref|NM020406.1|[9966888]

[4107] 6683: NM—020377 Homo sapiens cysteinyl leukotriene CysLT2 receptor; cDNA: PSEC0146 from clone PLACE1006979 (LOC57105), mRNA gi|9966850|ref|NM—020377.1|[9966850]

[4108] 6686: NM—002295 Homo sapiens laminin receptor 1 (67 kD, ribosomal protein SA) (LAMR1), mRNA gi|9845501|ref|NM—002295.2|[9845501]

[4109] 6687: NM—019839 Homo sapiens seven transmembrane receptor BLTR2; leukotriene B4 receptor BLT2 (BLTR2), mRNA gi|9789896|ref|NM—019839.1|[9789896]

[4110] 6688: NM—018969 Homo sapiens super conserved receptor expressed in brain 3 (SREB3), mRNA gi|9507142|ref|NM—018969.1|[9507142]

[4111] 6689: NM—018949 Homo sapiens G protein-coupled receptor 14 (GPR14), mRNA gi|9506744|ref|NM—018949.1|[9506744]

[4112] 6690: NM—000804 Homo sapiens folate receptor 3 (gamma) (FOLR3), mRNA gi|9257219|ref|NM—000804.2|[9257219]

[4113] 6691: NM—000803 Homo sapiens folate receptor 2 (fetal) (FOLR2), mRNA gi|9257218|ref|NM—000803.2|[9257218]

[4114] 6692: NM017526 Homo sapiens leptin receptor gene-related protein (HSOBRGRP), mRNA gi|8923784|ref|NM—017526.1|[8923784]

[4115] 6693: NM—017532 Homo sapiens p65 protein (HSAJ2425), mRNA gi|8923776|ref|NM—017532.1|[8923776]

[4116] 6694: NM—017442 Homo sapiens toll-like receptor 9 (TLR9), mRNA gi|8394455|ref|NM—017442.1|[8394455]

[4117] 6695: NM—016946 Homo sapiens junctional adhesion molecule (JAM), mRNA gi|8393637|ref|NM—016946.1|[8393637]

[4118] 6697: NM—013280 Homo sapiens fibronectin leucine rich transmembrane protein 1 (FLRT1), mRNA gi|8051591|ref|NM—013280.2|[8051591]

[4119] 6698: NM—013431 Homo sapiens killer cell lectin-like receptor subfamily C, member 4 (KLRC4), mRNA gi|7710123|ref|NM—013431.1|[7710123]

[4120] 6699: NM—016568 Homo sapiens G-protein coupled receptor SALPR; somatostatin and angiotensin-like peptide receptor (LOC51289), mRNA gi|7706102|ref|NM—016568.1|[7706102]

[4121] 6700: NM—015863 Homo sapiens surfactant protein B (LOC51041), mRNA gi|7705659|ref|NM—015863.1|[7705659]

[4122] 6702: NM—015868 Homo sapiens NK-receptor (KIR-023GB), mRNA gi|7705567|ref|NM—015868.1|[7705567]

[4123] 6703: NM—016540 Homo sapiens G protein-coupled receptor 72 (GPR72), mRNA gi|7705384|ref|NM016540.1|[7705384]

[4124] 6704: NM—001059 Homo sapiens tachykinin receptor 3 (TACR3), mRNA gi|7669547|ref|NM—001059.1|[7669547]

[4125] 6705: NM—014030 Homo sapiens G protein-coupled receptor kinase-interactor 1 (GIT1), mRNA gi|7661711|ref|NM—014030.1|[7661711]

[4126] 6706: NM—014521 Homo sapiens SH3-domain binding protein 4 (SH3BP4), mRNA gi|7657561|ref|NM—014521.1|[7657561]

[4127] 6707: NM—014285 Homo sapiens homolog of Yeast RRP4 (ribosomal RNA processing 4),

[4128] 3′-5′-exoribonuclease (RRP4), mRNA gi|7657527|ref|NM—014285.1|[7657527]

[4129] 6708: NM—014566 Homo sapiens olfactory receptor, family 1, subfamily D, member 5 (OR1D5), mRNA gi|7657422|ref|NM—014566.1|[7657422]

[4130] 6709: NM—014565 Homo sapiens olfactory receptor, family 1, subfamily A, member 1 (OR1A1), mRNA gi|7657420|ref|NM—014565.1|[7657420]

[4131] 6710: NM—014221 Homo sapiens mature T-cell proliferation 1 (MTCP1), mRNA gi|7657348|ref|NM—014221.1|[7657348]

[4132] 6711: NM—014387 Homo sapiens linker for activation of T cells (LAT), mRNA gi|7657292|ref|NM—014387.1|[7657292]

[4133] 6712: NM—014514 Homo sapiens killer cell immunoglobulin-like receptor, three domains, short cytoplasmic tail, 1 (KIR3DS1), mRNA gi|7657280|ref|NM—014514.1|[7657280]

[4134] 6713: NM—014513 Homo sapiens killer cell immunoglobulin-like receptor, two domains, short cytoplasmic tail, 5 (KIR2DS5), mRNA gi|7657278|ref|NM—014513.1|[7657278]

[4135] 6714: NM—014512 Homo sapiens killer cell immunoglobulin-like receptor, two domains, short cytoplasmic tail, 1 (KIR2DS1), mRNA gi|7657276|ref|NM014512.1|[7657276]

[4136] 6715: NM—014511 Homo sapiens killer cell immunoglobulin-like receptor, two domains, long cytoplasmic tail, 3 (KIR2DL3), mRNA gi|7657274|ref|NM—014511.1|[7657274]

[4137] 6716: NM—014219 Homo sapiens killer cell immunoglobulin-like receptor, two domains, long cytoplasmic tail, 2 (KIR2DL2), mRNA gi|7657272|ref|NM—014219.1|[7657272]

[4138] 6717: NM—014218 Homo sapiens killer cell immunoglobulin-like receptor, two domains, long cytoplasmic tail, 1 (KIR2DL1), mRNA gi|7657270|ref|NM—014218.1|[7657270]

[4139] 6718: NM—014271 Homo sapiens interleukin 1 receptor accessory protein-like 1 (IL1RAPL1), mRNA gi|7657231|ref|NM—014271.1|[7657231]

[4140] 6719: NM—014339 Homo sapiens interleukin 17 receptor (IL17R), mRNA gi|7657229|ref|NM—014339.1|[7657229]

[4141] 6720: NM—014619 Homo sapiens glutamate receptor, ionotropic, kainate 4 (GRIK4), mRNA gi|7657143|ref|NM—014619.1|[7657143]

[4142] 6721: NM—014626 Homo sapiens G protein-coupled receptor 58 (GPR58), mRNA gi|7657141|ref|NM—014626.1|[7657141]

[4143] 6722: NM—014627 Homo sapiens G protein-coupled receptor 57 (GPR57), mRNA gi|7657139|ref|NM—014627.1|[7657139]

[4144] 6723: NM014373 Homo sapiens putative G protein-coupled receptor (GPCR150), mRNA gi|7657135|ref|NM—014373.1|[7657135]

[4145] 6724: NM—005529 Homo sapiens heparan sulfate proteoglycan 2 (perlecan) (HSPG2), mRNA gi|7427516|ref|NM—005529.2|[7427516]

[4146] 6727: NM—005415 Homo sapiens solute carrier family 20 (phosphate transporter), member 1 (SLC20A1), mRNA gi|7382462|ref|NM—005415.2|[7382462]

[4147] 6728: NM—005199 Homo sapiens cholinergic receptor, nicotinic, gamma polypeptide (CHRNG), mRNA gi|7382453|ref|NM—005199.3|[7382453]

[4148] 6729: NM—013940 Homo sapiens olfactory receptor, family 10, subfamily H, member 1 (OR1OH1), mRNA gi|7363438|ref|NM—013940.1|[7363438]

[4149] 6730: NM—013440 Homo sapiens paired immunoglobulin-like receptor beta (PILR(BETA)), mRNA gi|7305386|ref|NM—013440.1|[7305386]

[4150] 6731: NM—013439 Homo sapiens paired immunoglobulin-like receptor alpha (PILR(ALPHA)), mRNA gi|7305384|ref|NM—013439.1|[7305384]

[4151] 6732: NM—002260 Homo sapiens killer cell lectin-like receptor subfamily C, member 2 (KLRC2), mRNA gi|7108353|ref|NM—002260.2|[7108353]

[4152] 6733: NM—012125 Homo sapiens cholinergic receptor, muscarinic 5 (CHRM5), mRNA gi|7108335|ref|NM—012125.1|[7108335]

[4153] 6734: NM—013378 Homo sapiens pre-B lymphocyte gene 3 (VPREB3), mRNA gi|7019566|ref|NM—013378.1|[7019566]

[4154] 6735: NM—013261 Homo sapiens peroxisome proliferative activated receptor, gamma, coactivator (PPARGC1), mRNA gi|7019498|ref|NM—013261.1|[7019498]

[4155] 6736: NM—013269 Homo sapiens lectin-like NK cell receptor (LLT1), mRNA gi|7019446|ref|NM—013269.1|[7019446]

[4156] 6737: NM—013289 Homo sapiens killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 1 (KIR3DL1), mRNA gi|7019440|ref|NM—013289.1|[7019440]

[4157] 6738: NM—013281 Homo sapiens fibronectin leucine rich transmembrane protein 3 (FLRT3), mRNA gi|7019382|ref|NM013281.1|[7019382]

[4158] 6739: NM—013231 Homo sapiens fibronectin leucine rich transmembrane protein 2 (FLRT2), mRNA gi|7019380|ref|NM—013231.1|[7019380]

[4159] 6740: NM—012410 Homo sapiens type I transmembrane receptor (seizure-related protein) (PSK-1), mRNA gi|6912611|ref|NM—012410.1|[6912611]

[4160] 6741: NM—012391 Homo sapiens prostate epithelium-specific Ets transcription factor (PDEF), mRNA gi|6912579|ref|NM—012391.1|[6912579]

[4161] 6742: NM—012375 Homo sapiens olfactory receptor, family 52, subfamily A, member 1 (OR52A1), mRNA gi|6912559|ref|NM—012375.1|[6912559]

[4162] 6743: NM—012368 Homo sapiens olfactory receptor, family 2, subfamily C, member 1 (OR2C1), mRNA gi|6912555|ref|NM—012368.1|[6912555]

[4163] 6744: NM—012360 Homo sapiens olfactory receptor, family 1, subfamily F, member 8 (OR1F8), mRNA gi|6912553|ref|NM—012360.1|[6912553]

[4164] 6745: NM—012352 Homo sapiens olfactory receptor, family 1, subfamily A, member 2 (OR1A2), mRNA gi|6912551|ref|NM—012352.1|[6912551]

[4165] 6746: NM—012351 Homo sapiens olfactory receptor, family 10, subfamily J, member 1 (OR10J1), mRNA gi|6912549|ref|NM—012351.1|[6912549]

[4166] 6747: NM—012344 Homo sapiens neurotensin receptor 2 (NTSR2), mRNA gi|6912537|ref|NM—012344.1|[6912537]

[4167] 6748: NM—012314 Homo sapiens killer cell immunoglobulin-like receptor, two domains, short cytoplasmic tail, 4 (KIR2DS4), mRNA gi|6912475|ref|NM—012314.1|[6912475]

[4168] 6749: NM—012313 Homo sapiens killer cell immunoglobulin-like receptor, two domains, short cytoplasmic tail, 3 (KIR2DS3), mRNA gi|6912473|ref|NM—012313.1|[6912473]

[4169] 6750: NM—012312 Homo sapiens killer cell immunoglobulin-like receptor, two domains, short cytoplasmic tail, 2 (KIR2DS2), mRNA gi|6912471|ref|NM—012312.1|[6912471]

[4170] 6751: NM—012211 Homo sapiens integrin, alpha 11 (ITGA11), mRNA gi|6912435|ref|NM—012211.1|[6912435]

[4171] 6752: NM—012275 Homo sapiens interleukin-1 receptor antagonist homolog 1 (IL1HY1), mRNA gi|6912431|ref|NM—012275.1|[6912431]

[4172] 6753: NM—004525 Homo sapiens low density lipoprotein-related protein 2 (LRP2), mRNA gi|6806918|ref|NM—004525.1|[6806918]

[4173] 6754: NM—004304 Homo sapiens anaplastic lymphoma kinase (Ki-1) (ALK), mRNA gi|6715586|ref|NM—004304.2|[6715586]

[4174] 6755: NM—000686 Homo sapiens angiotensin receptor 2 (AGTR2), mRNA gi|6715584|ref|NM—000686.2|[6715584]

[4175] 6756: NM—007366 Homo sapiens phospholipase A2 receptor 1, 180 kD (PLA2R1), mRNA gi|6679370|ref|NM—007366.1|[6679370]

[4176] 6757: NM—005385 Homo sapiens natural killer-tumor recognition sequence (NKTR), mRNA gi|6631099|ref|NM—005385.2|[6631099]

[4177] 6758: NM—005266 Homo sapiens gap junction protein, alpha 5, 40 kD (connexin 40) (GJA5), mRNA gi|6631082|ref|NM—005266.2|[6631082]

[4178] 6759: NM—000827 Homo sapiens glutamate receptor, ionotropic, AMPA 1 (GRIA1), mRNA gi|6552333|ref|NM000827.2|[6552333]

[4179] 6760: NM—001619 Homo sapiens adrenergic, beta, receptor kinase 1 (ADRBK1), mRNA gi|6138971|ref|NM—001619.2|[6138971]

[4180] 6761: NM—000810 Homo sapiens gamma-aminobutyric acid (GABA) A receptor, alpha 5 (GABRA5), mRNA gi|6031207|ref|NM—000810.2|[6031207]

[4181] 6762: NM—003006 Homo sapiens selectin P ligand (SELPLG), mRNA gi|6031197|ref|NM—003006.2|[6031197]

[4182] 6763: NM—001480 Homo sapiens galanin receptor 1 (GALR1), mRNA gi|6031165|ref|NM—001480.2|[6031165]

[4183] 6764: NM—001992 Homo sapiens coagulation factor II (thrombin) receptor (F2R), mRNA gi|6031164|ref|NM—001992.2|[6031164]

[4184] 6765: NM—000677 Homo sapiens adenosine A3 receptor (ADORA3), mRNA gi|6031156|ref|NM—000677.2|[6031156]

[4185] 6766: NM—001526 Homo sapiens hypocretin (orexin) receptor 2 (HCRTR2), mRNA gi|6006037|ref|NM—001526.2|[6006037]

[4186] 6767: NM—000885 Homo sapiens integrin, alpha 4 (antigen CD49D, alpha 4 subunit of VLA-4 receptor) (ITGA4), mRNA gi|6006032|ref|NM—000885.2|[6006032]

[4187] 6768: NM—002377 Homo sapiens MAS1 oncogene (MAS1), mRNA gi|6006022|ref|NM—002377.2|[6006022]

[4188] 6769: NM—000887 Homo sapiens integrin, alpha X (antigen CD11C (p150), alpha polypeptide) (ITGAX), mRNA gi|60060l4|ref|NM—000887.2|[6006014]

[4189] 6770: NM—000419 Homo sapiens integrin, alpha 2b (platelet glycoprotein IIb of IIb/IIIa complex, antigen CD41B) (ITGA2B), mRNA gi|606009|ref|NM—000419.2|[6006009]

[4190] 6771: NM—002203 Homo sapiens integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor) (ITGA2), mRNA gi|6006008|ref|NM—002203.2|[6006008]

[4191] 6772: NM—000843 Homo sapiens glutamate receptor, metabotropic 6 (GRM6), mRNA gi|6006006|ref|NM—000843.2|[6006006]

[4192] 6773: NM—000838 Homo sapiens glutamate receptor, metabotropic 1 (GRM1), mRNA gi|6006005|ref|NM—000838.2|[6006005]

[4193] 6774: NM—000835 Homo sapiens glutamate receptor, ionotropic, N-methyl D-aspartate 2C (GRIN2C), mRNA gi|6006004|ref|NM—000835.2|[6006004]

[4194] 6775: NM—000834 Homo sapiens glutamate receptor, ionotropic, N-methyl D-aspartate 2B (GRIN2B), mRNA gi|6006003|ref|NM—000834.2|[6006003]

[4195] 6776: NM—000833 Homo sapiens glutamate receptor, ionotropic, N-methyl D-aspartate 2A (GRIN2A), mRNA gi|6006002|ref|NM—000833.2|[6006002]

[4196] 6777: NM—007155 Homo sapiens zona pellucida glycoprotein 3A (sperm receptor) (ZP3A), mRNA gi|6005983|ref|NM—007155.1|[6005983]

[4197] 6778: NM—007124 Homo sapiens utrophin (homologous to dystrophin) (UTRN), mRNA gi|6005937|ref|NM—007124.1|[6005937]

[4198] 6779: NM—007114 Homo sapiens TATA element modulatory factor 1 (TMF1), mRNA gi|6005903|ref|NM—007114.1|[6005903]

[4199] 6780: NM—007273 Homo sapiens B-cell associated protein (REA), mRNA gi|6005853|ref|NM—007273.1|[6005853]

[4200] 6781: NM—007160 Homo sapiens olfactory receptor, family 2, subfamily H, member 3 (OR2H3), mRNA gi|600582|ref|NM—007160.1|[6005821]

[4201] 6782: NM—007227 Homo sapiens G protein-coupled receptor 45 (GPR45), mRNA gi|6005769|ref|NM—007227.1|[6005769]

[4202] 6783: NM—006934 Homo sapiens solute carrier family 6 (neurotransmitter transporter, glycine), member 9 (SLC6A9), mRNA gi|5902093|ref|NM—006934.1|[5902093]

[4203] 6785: NM—007011 Homo sapiens putative transmembrane protein (HS1-2), mRNA gi|5901977|ref|NM—007011.1|[5901977]

[4204] 6786: NM—007045 Homo sapiens FGFR1 oncogene partner (FOP), mRNA gi|5901953|ref|NM—007045.1|[5901953]

[4205] 6787: NM—006889 Homo sapiens CD86 antigen (CD28 antigen ligand 2, B7-2 antigen) (CD86), mRNA gi|5901919|ref|NM—006889.1|[5901919]

[4206] 6788: NM—006749 Homo sapiens solute carrier family 20 (phosphate transporter), member 2 (SLC20A2), mRNA gi|5803172|ref|NM—006749.1|[5803172]

[4207] 6789: NM—006770 Homo sapiens macrophage receptor with collagenous structure (MARCO), mRNA gi|5803079|ref|NM—006770.1|[5803079]

[4208] 6790: NM—006840 Homo sapiens leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 5 (LILRB5), mRNA gi|5803069|ref|NM—006840.1|[5803069]

[4209] 6791: NM—006866 Homo sapiens leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 2 (LILRA2), mRNA gi|5803067|ref|NM—006866.1|[5803067]

[4210] 6792: NM—006863 Homo sapiens leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 1 (LILRA1), mRNA gi|5803065|ref|NM—006863.1|[5803065]

[4211] 6793: NM—006847 Homo sapiens leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 4 (LILRB4), mRNA gi|5803063|ref|NM—006847.1|[5803063]

[4212] 6794: NM—006865 Homo sapiens leukocyte immunoglobulin-like receptor, subfamily A (without TM domain), member 3 (LILRA3), mRNA gi|5803061|ref|NM—006865.1|[5803061]

[4213] 6795: NM—006864 Homo sapiens leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 3 (LILRB3), mRNA gi|5803059|ref|NM—006864.1|[5803059]

[4214] 6796: NM—006738 Homo sapiens lymphoid blast crisis oncogene (LBC), mRNA gi|5803057|ref|NM—006738.1|[5803057]

[4215] 6797: NM—006737 Homo sapiens killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 2 (KIR3DL2), mRNA gi|5803051|ref|NM—006737.1|[5803051]

[4216] 6799: NM—006564 Homo sapiens G protein-coupled receptor (TYMSTR), mRNA gi|5730105|ref|NM—006564.1|[5730105]

[4217] 6800: NM—001561 Homo sapiens tumor necrosis factor receptor superfamily, member 9 (TNFRSF9), mRNA gi|5730094|ref|NM—001561.2|[5730094]

[4218] 6801: NM—006664 Homo sapiens small inducible cytokine subfamily A (Cys-Cys), member 27 (SCYA27), mRNA gi|5730034|ref|NM—006664.1|[5730034]

[4219] 6802: NM—006583 Homo sapiens retinal pigment epithelium-derived rhodopsin homolog (RRH), mRNA gi|5730018|ref|NM—006583.1|[5730018]

[4220] 6803: NM—006505 Homo sapiens poliovirus receptor (PVR), mRNA gi|5729994|ref|NM—006505.1|[5729994]

[4221] 6804: NM—006637 Homo sapiens olfactory receptor, family 5, subfamily I, member 1 (OR5I1), mRNA gi|5729959|ref|NM—006637.1|[5729959]

[4222] 6805: NM—006669 Homo sapiens leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 1 (LILRB1), mRNA gi|5729926|ref|NM—006669.1|[5729926]

[4223] 6806: NM—006611 Homo sapiens killer cell lectin-like receptor subfamily A, member 1 (KLRA1), mRNA gi|5729898|ref|NM—006611.1|[5729898]

[4224] 6807: NM—006496 Homo sapiens guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 3 (GNAI3), mRNA gi|5729849|ref|NM—006496.1|[5729849]

[4225] 6808: NM—006529 Homo sapiens glycine receptor, alpha 3 (GLRA3), mRNA gi|5729843|ref|NM—006529.1|[5729843]

[4226] 6809: NM—006639 Homo sapiens cysteinyl leukotriene receptor 1 (CYSLT1), mRNA gi|5729797|ref|NM—006639.1|[5729797]

[4227] 6810: NM—006293 Homo sapiens TYRO3 protein tyrosine kinase (TYRO3), mRNA gi|5454141|ref|NM—006293.1|[5454141]

[4228] 6813: NM—006238 Homo sapiens peroxisome proliferative activated receptor, delta (PPARD), mRNA gi|5453939|ref|NM—006238.1|[5453939]

[4229] 6814: NM—006189 Homo sapiens olfactory marker protein (OMP), mRNA gi|5453827|ref|NM—006189.1|[5453827]

[4230] 6815: NM—006182 Homo sapiens discoidin domain receptor family, member 2 (DDR2), mRNA gi|5453813|ref|NM—006182.1|[5453813]

[4231] 6816: NM—006180 Homo sapiens neurotrophic tyrosine kinase, receptor, type 2 (NTRK2), mRNA gi|5453811|ref|NM—006180.1|[5453811]

[4232] 6817: NM—006403 Homo sapiens enhancer of filamentation 1 (cas-like docking; Crk-associated substrate related) (HEF1), mRNA gi|5453679|ref|NM—006403.1|[5453679]

[4233] 6818: NM—006143 Homo sapiens G protein-coupled receptor 19 (GPR19), mRNA gi|5453665|ref|NM006143.1|[5453665]

[4234] 6819: NM—006404 Homo sapiens protein C receptor, endothelial (EPCR) (PROCR), mRNA gi|5453645|ref|NM—006404.1|[5453645]

[4235] 6820: NM—006419 Homo sapiens small inducible cytokine B subfamily (Cys-X-Cys motif), member (B-cell chemoattractant) (SCYB13), mRNA gi|5453576|ref|NM—006419.1|[5453576]

[4236] 6821: NM—005954 Homo sapiens metallothionein 3 (growth inhibitory factor (neurotrophic)) (MT3), mRNA gi|5174761|ref|NM—005954.1|[5174761]

[4237] 6822: NM—006006 Homo sapiens zinc finger protein 145 (Kruppel-like, expressed in promyelocytic leukemia) (ZNF145), mRNA gi|5174752|ref|NM—006006.1|[5174752]

[4238] 6823: NM—006072 Homo sapiens small inducible cytokine subfamily A (Cys-Cys), member 26 (SCYA26), mRNA gi|5174670|ref|NM—006072.1|[5174670]

[4239] 6824: NM—005972 Homo sapiens pancreatic polypeptide receptor 1 (PPYR1), mRNA gi|5174638|ref|NM—005972.1|[5174638]

[4240] 6825: NM—005913 Homo sapiens melanocortin 5 receptor (MC5R), mRNA gi|5174534|ref|NM—005913.1|[5174534]

[4241] 6826: NM—005912 Homo sapiens melanocortin 4 receptor (MC4R), mRNA gi|5174532|ref|NM—005912.1|[5174532]

[4242] 6827: NM—006028 Homo sapiens 5-hydroxytryptamine (serotonin) receptor 3B (HTR3B), mRNA gi|5174468|ref|NM—006028.1|[5174468]

[4243] 6828: NM—005628 Homo sapiens solute carrier family 1 (neutral amino acid transporter), member (SLC1A5), mRNA gi|5032092|ref|NM—005628.1|[5032092]

[4244] 6829: NM—005767 Homo sapiens purinergic receptor (family A group 5) (P2Y5), mRNA gi|5031968|ref|NM—005767.1|[5031968]

[4245] 6830: NM—005592 Homo sapiens muscle, skeletal, receptor tyrosine kinase (MUSK), mRNA gi|5031926|ref|NM—005592.1|[5031926]

[4246] 6831: NM—005874 Homo sapiens leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 2 (LILRB2), mRNA gi|5031910|ref|NM—005874.1|[5031910]

[4247] 6832: NM—005810 Homo sapiens killer cell lectin-like receptor subfamily G, member 1 (KLRG1), mRNA gi|5031900|ref|NM—005810.1|[5031900]

[4248] 6833: NM—005544 Homo sapiens insulin receptor substrate 1 (IRS1), mRNA gi|5031804|ref|NM—005544.1|[5031804]

[4249] 6834: NM—005535 Homo sapiens interleukin 12 receptor, beta 1 (IL12RB1), mRNA gi|5031784|ref|NM—005535.1|[5031784]

[4250] 6835: NM—005683 Homo sapiens G protein-coupled receptor 55 (GPR55), mRNA gi|5031722|ref|NM—005683.1|[5031722]

[4251] 6836: NM—005684 Homo sapiens G protein-coupled receptor 52 (GPR52), mRNA gi|5031720|ref|NM005684.1|[5031720]

[4252] 6837: NM—001621 Homo sapiens aryl hydrocarbon receptor (AHR), mRNA gi|5016091|ref|NM—001621.2|[5016091]

[4253] 6838: NM—005429 Homo sapiens vascular endothelial growth factor C (VEGFC), mRNA gi|4885652|ref|NM—005429.1|[4885652]

[4254] 6839: NM—005424 Homo sapiens tyrosine kinase with immunoglobulin and epidermal growth factor homology domains (TIE), mRNA gi|4885630|ref|NM—005424.1|[4885630]

[4255] 6840: NM—005408 Homo sapiens small inducible cytokine subfamily A (Cys-Cys), member 13 (SCYA13), mRNA gi|4885586|ref|NM—005408.1|[4885586]

[4256] 6841: NM—005328 Homo sapiens hyaluronan synthase 2 (HAS2), mRNA gi|4885390|ref|NM—005328.1|[4885390]

[4257] 6842: NM—005314 Homo sapiens gastrin-releasing peptide receptor (GRPR), mRNA gi|4885360|ref|NM—005314.1|[4885360]

[4258] 6843: NM—005311 Homo sapiens growth factor receptor-bound protein 10 (GRB10), mRNA gi|4885352|ref|NM—005311.1|[4885352]

[4259] 6844: NM—005308 Homo sapiens G protein-coupled receptor kinase 5 (GPRK5), mRNA gi|4885348|ref|NM—005308.1|[4885348]

[4260] 6845: NM—005286 Homo sapiens G protein-coupled receptor 8 (GPR8), mRNA gi|4885344|ref|NM—005286.1|[4885344]

[4261] 6846: NM—005285 Homo sapiens G protein-coupled receptor 7 (GPR7), mRNA gi|4885342|ref|NM—005285.1|[4885342]

[4262] 6847: NM—005284 Homo sapiens G protein-coupled receptor 6 (GPR6), mRNA gi|4885340|ref|NM—005284.1|[4885340]

[4263] 6848: NM—005458 Homo sapiens G protein-coupled receptor 51 (GPR51), mRNA gi|4885336|ref|NM—005458.1|[4885336]

[4264] 6849: NM—005282 Homo sapiens G protein-coupled receptor 4 (GPR4), mRNA gi|4885334|ref|NM—005282.1|[4885334]

[4265] 6850: NM—005306 Homo sapiens G protein-coupled receptor 43 (GPR43), mRNA gi|4885332|ref|NM—005306.1|[4885332]

[4266] 6851: NM—005305 Homo sapiens G protein-coupled receptor 42 (GPR42), mRNA gi|4885330|ref|NM—005305.1|[4885330]

[4267] 6852: NM—005304 Homo sapiens G protein-coupled receptor 41 (GPR41), mRNA gi|4885328|ref|NM—005304.1|[4885328]

[4268] 6853: NM—005303 Homo sapiens G protein-coupled receptor 40 (GPR40), mRNA gi|4885326|ref|NM—005303.1|[4885326]

[4269] 6854: NM—005281 Homo sapiens G protein-coupled receptor 3 (GPR3), mRNA gi|4885324|ref|NM—005281.1|[4885324]

[4270] 6855: NM—005302 Homo sapiens G protein-coupled receptor 37 (endothelin receptor type B-like) (GPR37), mRNA gi|4885322|ref|NM—005302.1|[4885322]

[4271] 6856: NM—005301 Homo sapiens G protein-coupled receptor 35 (GPR35), mRNA gi|4885320|ref|NM—005301.1|[4885320]

[4272] 6857: NM—005300 Homo sapiens G protein-coupled receptor 34 (GPR34), mRNA gi|4885318|ref|NM—005300.1|[4885318]

[4273] 6858: NM—005299 Homo sapiens G protein-coupled receptor 31 (GPR31), mRNA gi|4885316|ref|NM—005299.1|[4885316]

[4274] 6859: NM—005298 Homo sapiens G protein-coupled receptor 25 (GPR25), mRNA gi|4885314|ref|NM—005298.1|[4885314)

[4275] 6860: NM—005297 Homo sapiens G protein-coupled receptor 24 (GPR24), mRNA gi|4885312|ref|NM—005297.1|[4885312]

[4276] 6861: NM—005296 Homo sapiens G protein-coupled receptor 23 (GPR23), mRNA gi|4885310|ref|NM—005296.1|[4885310]

[4277] 6862: NM—005295 Homo sapiens G protein-coupled receptor 22 (GPR22), mRNA gi|4885308|ref|NM—005295.1|[4885308]

[4278] 6863: NM—005294 Homo sapiens G protein-coupled receptor 21 (GPR21), mRNA gi|4885306|ref|NM—005294.1|[4885306]

[4279] 6864: NM—005293 Homo sapiens G protein-coupled receptor 20 (GPR20), mRNA gi|4885304|ref|NM—005293.1|[4885304]

[4280] 6865: NM—005279 Homo sapiens G protein-coupled receptor 1 (GPR1), mRNA gi|4885302|ref|NM—005279.1|[4885302]

[4281] 6866: NM—005291 Homo sapiens G protein-coupled receptor 17 (GPR17), mRNA gi|4885300|ref|NM—005291.1|[4885300]

[4282] 6867: NM—005290 Homo sapiens G protein-coupled receptor 15 (GPR15), mRNA gi|4885298|ref|NM—005290.1|[4885298]

[4283] 6868: NM—005288 Homo sapiens G protein-coupled receptor 12 (GPR12), mRNA gi|4885294|ref|NM—005288.1|[4885294]

[4284] 6869: NM—005264 Homo sapiens GDNF family receptor alpha 1 (GFRA1), mRNA gi|4885268|ref|NM—005264.1|[4885268]

[4285] 6870: NM—005246 Homo sapiens fer (fps/fes related) tyrosine kinase (phosphoprotein NCP94) (FER), mRNA gi|4885230|ref|NM—005246.1|[4885230]

[4286] 6871: NM—005233 Homo sapiens EphA3 (EPHA3), mRNA gi|4885210|ref|NM—005233.1|[4885210]

[4287] 6872: NM—005227 Homo sapiens ephrin-A4 (EFNA4), mRNA gi|4885196|ref|NM—005227.1|[4885196]

[4288] 6873: NM—005211 Homo sapiens colony stimulating factor 1 receptor, formerly McDonough feline sarcoma viral (v-fms) oncogene homolog (CSF1R), mRNA gi|4885158|ref|NM—005211.1|[4885158]

[4289] 6875: NM—005161 Homo sapiens angiotensin receptor-like 1 (AGTRL1), mRNA gi|4885056|ref|NM—005161.1|[4885056]

[4290] 6876: NM—005092 Homo sapiens tumor necrosis factor (ligand) superfamily, member 18 (TNFSF18), mRNA gi|4827033|ref|NM—005092.1|[4827033]

[4291] 6877: NM—005118 Homo sapiens tumor necrosis factor (ligand) superfamily, member 15 (TNFSF15), mRNA gi|4827031|ref|NM—005118.1|[4827031]

[4292] 6878: NM—005048 Homo sapiens parathyroid hormone receptor 2 (PTHR2), mRNA gi|4826953|ref|NM—005048.1|[4826953]

[4293] 6879: NM—004963 Homo sapiens guanylate cyclase 2C (heat stable enterotoxin receptor) (GUCY2C), mRNA gi|4826751|ref|NM—004963.1|[4826751]

[4294] 6880: NM—005145 Homo sapiens guanine nucleotide binding protein (G protein), gamma 7 (GNG7), mRNA gi|4826745|ref|NM—005145.1|[4826745]

[4295] 6881: NM004952 Homo sapiens ephrin-A3 (EFNA3), mRNA gi|4826707|ref|NM—004952.1|[4826707]

[4296] 6882: NM—004736 Homo sapiens xenotropic and polytropic retrovirus receptor (XPR1), mRNA gi|4759333|ref|NM—004736.1|[4759333]

[4297] 6883: NM—004664 Homo sapiens Vertebrate LIN7 homolog 1, Tax interaction protein 33 (VELI1), mRNA gi|4759305|ref|NM—004664.1|[4759305]

[4298] 6884: NM—004195 Homo sapiens tumor necrosis factor receptor superfamily, member 18 (TNFRSF18), mRNA gi|4759245|ref|NM—004195.1|[4759245]

[4299] 6885: NM—004612 Homo sapiens transforming growth factor, beta receptor I (activin A receptor type II-like kinase, 53 kD) (TGFBR1), mRNA gi|4759225|ref|NM—004612.1|[4759225]

[4300] 6887: NM—004154 Homo sapiens pyrimidinergic receptor P2Y, G-protein coupled, 6 (P2RY6), mRNA gi|4758863|ref|NM—004154.1|[4758863]

[4301] 6888: NM—004244 Homo sapiens CD163 antigen (CD163), mRNA gi|4758721|ref|NM—004244.1|[4758721]

[4302] 6889: NM—002332 Homo sapiens low density lipoprotein-related protein 1 (alpha-2-macroglobulin receptor) (LRP1), mRNA gi|4758685|ref|NM—002332.1|[4758685]

[4303] 6890: NM—004514 Homo sapiens interleukin enhancer binding factor 1 (ILF1), mRNA gi|4758599|ref|NM—004514.1|[4758599]

[4304] 6891: NM—004633 Homo sapiens interleukin 1 receptor, type II (IL1R2), mRNA gi|4758597|ref|NM—004633.1|[4758597]

[4305] 6892: NM—004512 Homo sapiens interleukin 11 receptor, alpha (IL11RA), mRNA gi|4758593|ref|NM—004512.1|[4758593]

[4306] 6894: NM—000826 Homo sapiens glutamate receptor, ionotropic, AMPA 2 (GRIA2), mRNA gi|4758479|ref|NM—000826.1|[4758479]

[4307] 6896: NM—004224 Homo sapiens G protein-coupled receptor 50 (GPR50), mRNA gi|4758467|ref|NM—004224.1|[4758467]

[4308] 6898: NM—004246 Homo sapiens glucagon-like peptide 2 receptor (GLP2R), mRNA gi|4758437|ref|NM—004246.1|[4758437]

[4309] 6899: NM—004293 Homo sapiens guanine deaminase (GDA), mRNA gi|4758425|ref|NM—004293.1|[4758425]

[4310] 6900: NM—002030 Homo sapiens formyl peptide receptor-like 2 (FPRL2), mRNA gi|4758401|ref|NM—002030.2|[4758401]

[4311] 6901: NM—004469 Homo sapiens c-fos induced growth factor (vascular endothelial growth factor D) (FIGF), mRNA gi|4758377|ref|NM—004469.1|[4758377]

[4312] 6902: NM—004107 Homo sapiens Fc fragment of IgG, receptor, transporter, alpha (FCGRT), mRNA gi|4758345|ref|NM—004107.1|[4758345]

[4313] 6903: NM—004101 Homo sapiens coagulation factor II (thrombin) receptor-like 2 (F2RL2), mRNA gi|4758325|ref|NM—004101.1|[4758325]

[4314] 6904: NM—004447 Homo sapiens epidermal growth factor receptor pathway substrate 8 (EPS8), mRNA gi|4758295|ref|NM—004447.1|[4758295]

[4315] 6905: NM—004431 Homo sapiens EphA2 (EPHA2), mRNA gi|4758277|ref|NM—004431.1|[4758277]

[4316] 6906: NM—004093 Homo sapiens ephrin-B2 (EFNB2), mRNA gi|4758249|ref|NM—004093.1|[4758249]

[4317] 6907: NM—004429 Homo sapiens ephrin-B1 (EFNB1), mRNA gi|4758247|ref|NM—004429.1|[4758247]

[4318] 6908: NM—004428 Homo sapiens ephrin-A1 (EFNA1), mRNA gi|4758245|ref|NM—004428.1|[4758245]

[4319] 6909: NM—004393 Homo sapiens dystroglycan 1 (dystrophin-associated glycoprotein 1) (DAG1), mRNA gi|4758115|ref|NM—004393.1|[4758115]

[4320] 6910: NM—004383 Homo sapiens c-src tyrosine kinase (CSK), mRNA gi|4758077|ref|NM—004383.1|[4758077]

[4321] 6911: NM—004778 Homo sapiens G protein-coupled receptor 44 (GPR44), mRNA gi|4758069|ref|NM—004778.1|[4758069]

[4322] 6912: NM—004382 Homo sapiens corticotropin releasing hormone receptor 1 (CRHR1), mRNA gi|4758059|ref|NM—004382.1|[4758059]

[4323] 6913: NM—004072 Homo sapiens chemokine-like receptor 1 (CMKLR1), mRNA gi|4758013|ref|NM—004072.1|[4758013]

[4324] 6914: NM—004329 Homo sapiens bone morphogenetic protein receptor, type IA (BMPR1A), mRNA gi|4757853|ref|NM—004329.1|[4757853]

[4325] 6915: NM—004313 Homo sapiens arrestin, beta 2 (ARRB2), mRNA gi|4757779|ref|NM—004313.1|[4757779]

[4326] 6916: NM—004039 Homo sapiens annexin A2 (ANXA2), mRNA gi|4757755|ref|NM—004039.1|[4757755]

[4327] 6917: NM—000806 Homo sapiens gamma-aminobutyric acid (GABA) A receptor, alpha 1 (GABRA1), mRNA gi|4585862|ref|NM—000806.2|[4585862]

[4328] 6918: NM—002529 Homo sapiens neurotrophic tyrosine kinase, receptor, type 1 (NTRK1), mRNA gi|4585711|ref|NM—002529.2|[4585711]

[4329] 6919: NM—000395 Homo sapiens colony stimulating factor 2 receptor, beta, low-affinity (granulocyte-macrophage) (CSF2RB), mRNA gi|4559407|ref|NM—000395.1|[4559407]

[4330] 6920: NM—000211 Homo sapiens integrin, beta 2 (antigen CD18 (p95), lymphocyte function-associated antigen 1; macrophage antigen 1 (mac-1) beta subunit) (ITGB2), mRNA gi|4557885|ref|NM—000211.1|[4557885]

[4331] 6921: NM—000208 Homo sapiens insulin receptor (INSR), mRNA gi|4557883|ref|NM—000208.1|[4557883]

[4332] 6922: NM—000206 Homo sapiens interleukin 2 receptor, gamma (severe combined immunodeficiency) (IL2RG), mRNA gi|4557881|ref|NM—000206.1|[4557881]

[4333] 6923: NM—000416 Homo sapiens interferon gamma receptor 1 (IFNGR1), mRNA gi|4557879|ref|NM—000416.1|[4557879]

[4334] 6924: NM—000201 Homo sapiens intercellular adhesion molecule 1 (CD54), human rhinovirus receptor (ICAM1), mRNA gi|4557877|ref|NM—000201.1|[4557877]

[4335] 6925: NM—000459 Homo sapiens TEK tyrosine kinase, endothelial (venous malformations, multiple cutaneous and mucosal) (TEK), mRNA gi|4557868|ref|NM—000459.1|[4557868]

[4336] 6926: NM—001053 Homo sapiens somatostatin receptor 5 (SSTR5), mRNA gi|4557864|ref|NM—001053.1|[4557864]

[4337] 6927: NM—001052 Homo sapiens somatostatin receptor 4 (SSTR4), mRNA gi|4557862|ref|NM—001052.1|[4557862]

[4338] 6928: NM—001051 Homo sapiens somatostatin receptor 3 (SSTR3), mRNA gi|4557860|ref|NM—001051.1|[4557860]

[4339] 6929: NM—001050 Homo sapiens somatostatin receptor 2 (SSTR2), mRNA gi|4557858|ref|NM—001050.1|[4557858]

[4340] 6930: NM—001049 Homo sapiens somatostatin receptor 1 (SSTR1), mRNA gi|4557856|ref|NM—001049.1|[4557856]

[4341] 6931: NM—000245 Homo sapiens met proto-oncogene (hepatocyte growth factor receptor) (MET), mRNA gi|4557746|ref|NM—000245.1|[4557746]

[4342] 6932: NM—000242 Homo sapiens mannose-binding lectin (protein C) 2, soluble (opsonic defect) (MBL2), mRNA gi|4557738|ref|NM—000242.1|[4557738]

[4343] 6933: NM—000237 Homo sapiens lipoprotein lipase (LPL), mRNA gi|4557726|ref|NM—000237.1|[4557726]

[4344] 6934: NM—000236 Homo sapiens lipase, hepatic (LIPC), mRNA gi|4557722|ref|NM—000236.1|[4557722]

[4345] 6935: NM—000233 Homo sapiens luteinizing hormone/choriogonadotropin receptor (LHCGR), mRNA gi|4557716|ref|NM—000233.1|[4557716]

[4346] 6936: NM—000222 Homo sapiens v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog (KIT), mRNA gi|4557694|ref|NM—000222.1|[4557694]

[4347] 6937: NM—000212 Homo sapiens integrin, beta 3 (platelet glycoprotein IIIa, antigen CD61) (ITGB3), mRNA gi|4557676|ref|NM—000212.1|[4557676]

[4348] 6939: NM—000418 Homo sapiens interleukin 4 receptor (IL4R), mRNA gi|4557668|ref|NM—000418.1|[4557668]

[4349] 6940: NM—000417 Homo sapiens interleukin 2 receptor, alpha (IL2RA), mRNA gi|4557666|ref|NM—000417.1|[4557666]

[4350] 6941: NM—001551 Homo sapiens immunoglobulin (CD79A) binding protein 1 (IGBP1), mRNA gi|4557662|ref|NM—001551.1|[4557662]

[4351] 6942: NM—000859 Homo sapiens 3-hydroxy-3-methylglutaryl-Coenzyme A reductase (HMGCR), mRNA gi|4557642|ref|NM—000859.1|[4557642]

[4352] 6943: NM—001525 Homo sapiens hypocretin (orexin) receptor 1 (HCRTR1), mRNA gi|4557636|ref|NM—001525.1|[4557636]

[4353] 6944: NM—001510 Homo sapiens glutamate receptor, ionotropic, delta 2 (GRID2), mRNA gi|4557632|ref|NM—001510.1|[4557632]

[4354] 6945: NM—000829 Homo sapiens glutamate receptor, ionotrophic, AMPA 4 (GRIA4), mRNA gi|4557630|ref|NM—000829.1|[4557630]

[4355] 6946: NM—001496 Homo sapiens GDNF family receptor alpha 3 (GFRA3), mRNA gi|4557622|ref|NM—001496.1|[4557622]

[4356] 6947: NM—000820 Homo sapiens growth arrest-specific 6 (GAS6), mRNA gi|4557616|ref|NM—000820.1|[4557616]

[4357] 6948: NM—000155 Homo sapiens galactose-1-phosphate uridylyltransferase (GALT), mRNA gi|4557614|ref|NM—000155.1|[4557614]

[4358] 6949: NM—000816 Homo sapiens gamma-aminobutyric acid (GABA) A receptor, gamma 2 (GABRG2), mRNA gi|4557610|ref|NM—000816.1|[4557610]

[4359] 6950: NM—000815 Homo sapiens gamma-aminobutyric acid (GABA) A receptor, delta (GABRD), mRNA gi|4557608|ref|NM—000815.1|[4557608]

[4360] 6951: NM—000811 Homo sapiens gamma-aminobutyric acid (GABA) A receptor, alpha 6 (GABRA6), mRNA gi|4557606|ref|NM—000811.1|[4557606]

[4361] 6952: NM—000809 Homo sapiens gamma-aminobutyric acid (GABA) A receptor, alpha 4 (GABRA4), mRNA gi|4557604|ref|NM—000809.1|[4557604]

[4362] 6953: NM—000808 Homo sapiens gamma-aminobutyric acid (GABA) A receptor, alpha 3 (GABRA3), mRNA gi|4557602|ref|NM—000808.1|[4557602]

[4363] 6954: NM—000807 Homo sapiens gamma-aminobutyric acid (GABA) A receptor, alpha 2 (GABRA2), mRNA gi|4557600|ref|NM—000807.1|[4557600]

[4364] 6955: NM—000121 Homo sapiens erythropoietin receptor (EPOR), mRNA gi|4557561|ref|NM—000121.2|[4557561]

[4365] 6956: NM—000118 Homo sapiens endoglin (Osler-Rendu-Weber syndrome 1) (ENG), mRNA gi|4557554|ref|NM—000118.1|[4557554]

[4366] 6957: NM—000114 Homo sapiens endothelin 3 (EDN3), mRNA gi|4557544|ref|NM—000114.1|[4557544]

[4367] 6958: NM—001365 Homo sapiens discs, large (Drosophila) homolog 4 (DLG4), mRNA gi|4557528|ref|NM—001365.1|[4557528]

[4368] 6959: NM—000080 Homo sapiens cholinergic receptor, nicotinic, epsilon polypeptide (CHRNE), mRNA gi|4557462|ref|NM—000080.1|[4557462]

[4369] 6960: NM—000751 Homo sapiens cholinergic receptor, nicotinic, delta polypeptide (CHRND), mRNA gi|4557460|ref|NM—000751.1|[4557460]

[4370] 6961: NM—000747 Homo sapiens cholinergic receptor, nicotinic, beta polypeptide 1 (muscle) (CHRNB1), mRNA gi|4557458|ref|NM—000747.1|[4557458]

[4371] 6962: NM—000079 Homo sapiens cholinergic receptor, nicotinic, alpha polypeptide 1 (muscle) (CHRNA1), mRNA gi|4557456|ref|NM—000079.1|[4557456]

[4372] 6963: NM—000074 Homo sapiens tumor necrosis factor (ligand) superfamily, member 5 (hyper-IgM syndrome) (TNFSF5), mRNA gi|4557432|ref|NM—000074.1|[4557432]

[4373] 6964: NM—000073 Homo sapiens CD3G antigen, gamma polypeptide (TiT3 complex) (CD3G), mRNA gi|4557428|ref|NM—000073.1|[4557428]

[4374] 6965: NM—000072 Homo sapiens CD36 antigen (collagen type I receptor, thrombospondin receptor) (CD36), mRNA gi|4557418|ref|NM—000072.1|[4557418]

[4375] 6966: NM—000388 Homo sapiens calcium-sensing receptor (hypocalciuric hypercalcemia 1, severe neonatal hyperparathyroidism) (CASR), mRNA gi|4557410|ref|NM—000388.1|[4557410]

[4376] 6967: NM—000069 Homo sapiens calcium channel, voltage-dependent, L type, alpha 1S subunit (CACNA1S), mRNA gi|4557400|ref|NM—000069.1|[4557400]

[4377] 6968: NM—000041 Homo sapiens apolipoprotein E (APOE), mRNA gi|4557324|ref|NM—000041.1|[4557324]

[4378] 6969: NM—000684 Homo sapiens adrenergic, beta-1-, receptor (ADRB1), mRNA gi|4557264|ref|NM—000684.1|[4557264]

[4379] 6970: NM—001116 Homo sapiens adenylate cyclase 9 (ADCY9), mRNA gi|4557258|ref|NM—001116.1|[4557258]

[4380] 6971: NM—001115 Homo sapiens adenylate cyclase 8 (brain) (ADCY8), mRNA gi|4557256|ref|NM—001115.1|[4557256]

[4381] 6972: NM—004001 Homo sapiens Fc fragment of IgG, low affinity IIb, receptor for (CD32) (FCGR2B), mRNA gi|4557021|ref|NM—004001.1|[4557021]

[4382] 6975: NM—003931 Homo sapiens WAS protein family, member 1 (WASF1), mRNA gi|4507912|ref|NM—003931.1|[4507912]

[4383] 6976: NM—003383 Homo sapiens very low density lipoprotein receptor (VLDLR), mRNA gi|4507900|ref|NM—003383.1|[4507900]

[4384] 6977: NM—003382 Homo sapiens vasoactive intestinal peptide receptor 2 (VIPR2), mRNA gi|4507898|ref|NM—003382.1|[4507898]

[4385] 6978: NM—000376 Homo sapiens vitamin D (1,25-dihydroxyvitamin D3) receptor (VDR), mRNA gi|4507882|ref|NM—000376.1|[4507882]

[4386] 6979: NM—003329 Homo sapiens thioredoxin (TXN), mRNA gi|4507744|ref|NM—003329.1|[4507744]

[4387] 6980: NM—000369 Homo sapiens thyroid stimulating hormone receptor (TSHR), mRNA gi|4507700|ref|NM—000369.1|[4507700]

[4388] 6981: NM—003301 Homo sapiens thyrotropin-releasing hormone receptor (TRHR), mRNA gi|4507680|ref|NM—003301.1|[4507680]

[4389] 6982: NM—001244 Homo sapiens tumor necrosis factor (ligand) superfamily, member 8 (TNFSF8), mRNA gi|4507606|ref|NM—001244.1|[4507606]

[4390] 6983: NM—003809 Homo sapiens tumor necrosis factor (ligand) superfamily, member 12 (TNFSF12), mRNA gi|4507596|ref|NM—003809.1|[4507596]

[4391] 6984: NM—001243 Homo sapiens tumor necrosis factor receptor superfamily, member 8 (TNFRSF8), mRNA gi|4507588|ref|NM—001243.1|[4507588]

[4392] 6985: NM—001242 Homo sapiens tumor necrosis factor receptor superfamily, member 7 (TNFRSF7), mRNA gi|4507586|ref|NM—001242.1|[4507586]

[4393] 6986: NM—000043 Homo sapiens tumor necrosis factor receptor superfamily, member 6 (TNFRSF6), mRNA gi|4507582|ref|NM—000043.1|[4507582]

[4394] 6987: NM—003327 Homo sapiens tumor necrosis factor receptor superfamily, member 4 (TNFRSF4), mRNA gi|4507578|ref|NM—003327.1|[4507578]

[4395] 6988: NM—001065 Homo sapiens tumor necrosis factor receptor superfamily, member 1A (TNFRSF1A), mRNA gi|4507574|ref|NM—001065.1|[4507574]

[4396] 6989: NM—001192 Homo sapiens tumor necrosis factor receptor superfamily, member 17 (TNFRSF17), mRNA gi|4507572|ref|NM—001192.1|[4507572]

[4397] 6990: NM—003820 Homo sapiens tumor necrosis factor receptor superfamily, member 14 (herpesvirus entry mediator) (TNFRSF14), mRNA gi|4507570|ref|NM—003820.1|[4507570]

[4398] 6991: NM—003790 Homo sapiens tumor necrosis factor receptor superfamily, member 12 (translocating chain-association membrane protein) (TNFRSF12), mRNA gi|4507568|ref|NM—003790.1|[4507568]

[4399] 6992: NM—002546 Homo sapiens tumor necrosis factor receptor superfamily, member 11b (osteoprotegerin) (TNFRSF11B), mRNA gi|4507566|ref|NM—002546.1|[4507566]

[4400] 6993: NM—003839 Homo sapiens tumor necrosis factor receptor superfamily, member 11a, activator of NFKB (TNFRSF11A), mRNA gi|4507564|ref|NM—003839.1|[4507564]

[4401] 6994: NM—003840 Homo sapiens tumor necrosis factor receptor superfamily, member 10d, decoy with truncated death domain (TNFRSF10D), mRNA gi|4507562|ref|NM—003840.1|[4507562]

[4402] 6995: NM—003842 Homo sapiens tumor necrosis factor receptor superfamily, member 10b (TNFRSF10B), mRNA gi|4507560|ref|NM—003842.1|[4507560]

[4403] 6996: NM—003844 Homo sapiens tumor necrosis factor receptor superfamily, member 10a (TNFRSF10A), mRNA gi|4507558|ref|NM—003844.1|[4507558]

[4404] 6997: NM—003692 Homo sapiens transmembrane protein with EGF-like and two follistatin-like domains 1 (TMEFF1), mRNA gi|4507548|ref|NM—003692.1|[4507548]

[4405] 6998: NM—003273 Homo sapiens transmembrane 7 superfamily member 2 (TM7SF2), mRNA gi|4507546|ref|NM—003273.1|[4507546]

[4406] 6999: NM—003272 Homo sapiens transmembrane 7 superfamily member 1 (upregulated in kidney) (TM7SF1), mRNA gi|4507544|ref|NM—003272.1|[4507544]

[4407] 7000: NM—000460 Homo sapiens thrombopoietin (myeloproliferative leukemia virus oncogene ligand, megakaryocyte growth and development factor) (THPO), mRNA gi|4507492|ref|NM—000460.1|[4507492]

[4408] 7001: NM—003844 Homo sapiens tumor necrosis factor receptor superfamily, member 10a (TNFRSF10A), mRNA gi|4507558|ref|NM—003844.1|[4507558]

[4409] 7002: NM—003692 Homo sapiens transmembrane protein with EGF-like and two follistatin-like domains 1 (TMEFF1), mRNA gi|4507548|ref|NM—003692.1|[4507548]

[4410] 7003: NM—003273 Homo sapiens transmembrane 7 superfamily member 2 (TM7SF2), mRNA gi|4507546|ref|NM—003273.1|[4507546]

[4411] 7004: NM—003272 Homo sapiens transmembrane 7 superfamily member 1 (upregulated in kidney) (TM7SF1), mRNA gi|4507544|ref|NM—003272.1|[4507544]

[4412] 7005: NM—000460 Homo sapiens thrombopoietin (myeloproliferative leukemia virus oncogene ligand, megakaryocyte growth and development factor) (THPO), mRNA gi|4507492|ref|NM—000460.1|[4507492]

[4413] 7006: NM—000361 Homo sapiens thrombomodulin (THBD), mRNA gi|4507482|ref|NM—000361.1|[4507482]

[4414] 7007: NM—003243 Homo sapiens transforming growth factor, beta receptor III (betaglycan, 300 kD) (TGFBR3), mRNA gi|4507470|ref|NM—003243.1|[4507470]

[4415] 7008: NM—003234 Homo sapiens transferrin receptor (p90, CD71) (TFRC), mRNA gi|4507456|ref|NM—003234.1|[4507456]

[4416] 7009: NM—003608 Homo sapiens G protein-coupled receptor 65 (GPR65), mRNA gi|4507420|ref|NM—003608.1|[4507420]

[4417] 7010: NM—001060 Homo sapiens thromboxane A2 receptor (TBXA2R), mRNA gi|4507380|ref|NM—001060.1|[4507380]

[4418] 7012: NM—001057 Homo sapiens tachykinin receptor 2 (TACR2), mRNA gi|4507344|ref|NM—001057.1|[4507344]

[4419] 7013: NM—003177 Homo sapiens spleen tyrosine kinase (SYK), mRNA gi|4507328|ref|NM—003177.1|[4507328]

[4420] 7015: NM—003070 Homo sapiens SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2 (SMARCA2), mRNA gi|4507068|ref|NM—003070.1|[4507068]

[4421] 7016: NM—003045 Homo sapiens solute carrier family 7 (cationic amino acid transporter, y+system), member 1 (SLC7A1), mRNA gi|4507046|ref|NM—003045.1|[4507046]

[4422] 7017: NM—003037 Homo sapiens signaling lymphocytic activation molecule (SLAM), mRNA gi|4506968|ref|NM—003037.1|[4506968]

[4423] 7019: NM—001036 Homo sapiens ryanodine receptor 3 (RYR3), mRNA gi|4506758|ref|NM—001036.1|[4506758]

[4424] 7020: NM—001035 Homo sapiens ryanodine receptor 2 (cardiac) (RYR2), mRNA gi|4506756|ref|NM—001035.1|[4506756]

[4425] 7023: NM—002921 Homo sapiens retinal G protein coupled receptor (RGR), mRNA gi|4506502|ref|NM—002921.1|[4506502]

[4426] 7026: NM—002852 Homo sapiens pentaxin-related gene, rapidly induced by IL-1 beta (PTX3), mRNA gi|4506332|ref|NM—002852.1|[4506332]

[4427] 7027: NM—002851 Homo sapiens protein tyrosine phosphatase, receptor-type, z polypeptide 1 (PTPRZ1), mRNA gi|4506328|ref|NM—002851.1|[4506328]

[4428] 7028: NM—000316 Homo sapiens parathyroid hormone receptor 1 (PTHR1), mRNA gi|4506270|ref|NM—000316.1|[4506270]

[4429] 7029: NM—000960 Homo sapiens prostaglandin I2 (prostacyclin) receptor (IP) (PTGIR), mRNA gi|4506262|ref|NM—000960.1|[4506262]

[4430] 7030: NM—000959 Homo sapiens prostaglandin F receptor (FP) (PTGFR), mRNA gi|4506260|ref|NM—000959.1|[4506260]

[4431] 7031: NM—000958 Homo sapiens prostaglandin E receptor 4 (subtype EP4) (PTGER4), mRNA gi|4506258|ref|NM—000958.1|[4506258]

[4432] 7032: NM—000957 Homo sapiens prostaglandin E receptor 3 (subtype EP3) (PTGER3), mRNA gi|4506256|ref|NM—000957.1|[4506256]

[4433] 7033: NM—000955 Homo sapiens prostaglandin E receptor 1 (subtype EP1), 42 kD (PTGER1), mRNA gi|4506252|ref|NM—000955.1|[4506252]

[4434] 7034: NM—000952 Homo sapiens platelet-activating factor receptor (PTAFR), mRNA gi|4506240|ref|NM—000952.1|[4506240]

[4435] 7035: NM—002769 Homo sapiens protease, serine, 1 (trypsin 1) (PRSS1), mRNA gi|4506144|ref|NM—002769.1|[4506144]

[4436] 7036: NM—000949 Homo sapiens prolactin receptor (PRLR), mRNA gi|4506106|ref|NM—000949.1|[4506106]

[4437] 7037: NM—002745 Homo sapiens mitogen-activated protein kinase 1 (MAPK1), mRNA gi|4506086|ref|NM—002745.1|[4506086]

[4438] 7038: NM—002702 Homo sapiens POU domain, class 6, transcription factor 1 (POU6F1), mRNA gi|4505968|ref|NM—002702.1|[4505968]

[4439] 7039: NM—003967 Homo sapiens putative neurotransmitter receptor (PNR), mRNA gi|4505924|ref|NM—003967.1|[4505924]

[4440] 7040: NM—002659 Homo sapiens plasminogen activator, urokinase receptor (PLAUR), mRNA gi|4505864|ref|NM—002659.1|[4505864]

[4441] 7041: NM—000926 Homo sapiens progesterone receptor (PGR), mRNA gi|4505766|ref|NM—000926.1|[4505766]

[4442] 7042: NM—000288 Homo sapiens peroxisomal biogenesis factor 7 (PEX7), mRNA gi|4505730|ref|NM—000288.1|[4505730]

[4443] 7043: NM—000287 Homo sapiens peroxisomal biogenesis factor 6 (PEX6), mRNA gi|4505728|ref|NM—000287.1|[4505728]

[4444] 7044: NM—002618 Homo sapiens peroxisome biogenesis factor 13 (PEX13), mRNA gi|4505722|ref|NM—002618.1|[4505722]

[4445] 7045: NM—002591 Homo sapiens phosphoenolpyruvate carboxykinase 1 (soluble) (PCK1), mRNA gi|4505638|ref|NM—002591.1|[4505638]

[4446] 7046: NM—002586 Homo sapiens pre-B-cell leukemia transcription factor 2 (PBX2), mRNA gi|4505624|ref|NM—002586.1|[4505624]

[4447] 7047: NM—002569 Homo sapiens paired basic amino acid cleaving enzyme (furin, membrane associated receptor protein) (PACE), mRNA gi|4505578|ref|NM—002569.1|[4505578]

[4448] 7048: NM—002565 Homo sapiens pyrimidinergic receptor P2Y, G-protein coupled, 4 (P2RY4), mRNA gi|4505560|ref|NM—002565.1|[4505560]

[4449] 7049: NM—002566 Homo sapiens purinergic receptor P2Y, G-protein coupled, 11 (P2RY11), mRNA gi|4505554|ref|NM—002566.1|[4505554]

[4450] 7050: NM—002562 Homo sapiens purinergic receptor P2X, ligand-gated ion channel, 7 (P2RX7), mRNA gi|4505552|ref|NM—002562.1|[4505552]

[4451] 7051: NM—002561 Homo sapiens purinergic receptor P2X, ligand-gated ion channel, 5 (P2RX5), mRNA gi|4505550|ref|NM—002561.1|[4505550]

[4452] 7052: NM—002560 Homo sapiens purinergic receptor P2X, ligand-gated ion channel, 4 (P2RX4), mRNA gi|4505548|ref|NM—002560.1|[4505548]

[4453] 7053: NM—002559 Homo sapiens purinergic receptor P2X, ligand-gated ion channel, 3 (P2RX3), mRNA gi|4505546|ref|NM—002559.1|[4505546]

[4454] 7054: NM—002556 Homo sapiens oxysterol binding protein (OSBP), mRNA gi|4505530|ref|NM—002556.1|[4505530]

[4455] 7055: NM—003696 Homo sapiens olfactory receptor, family 6, subfamily A, member 1 (OR6A1), mRNA gi|4505520|ref|NM—003696.1|[4505520]

[4456] 7056: NM—002550 Homo sapiens olfactory receptor, family 3, subfamily A, member 1 (OR3A1), mRNA gi|4505518|ref|NM—002550.1|[4505518]

[4457] 7057: NM—002548 Homo sapiens olfactory receptor, family 1, subfamily D, member 2 (OR1D2), mRNA gi|4505516|ref|NM—002548.1|[4505516]

[4458] 7058: NM—000914 Homo sapiens opioid receptor, mu 1 (OPRM1), mRNA gi|4505514|ref|NM—000914.1|[4505514]

[4459] 7059: NM—000912 Homo sapiens opioid receptor, kappa 1 (OPRK1), mRNA gi|4505510|ref|NM—000912.1|[4505510]

[4460] 7060: NM—000911 Homo sapiens opioid receptor, delta 1 (OPRD1), mRNA gi|4505508|ref|NM—000911.1|[4505508]

[4461] 7061: NM—002543 Homo sapiens oxidised low density lipoprotein (lectin-like) receptor 1 (OLR1), mRNA gi|4505500|ref|NM—002543.1|[4505500]

[4462] 7062: NM—003485 Homo sapiens G protein-coupled receptor 68 (GPR68), mRNA gi|4505496|ref|NM—003485.1|[4505496]

[4463] 7063: NM—002531 Homo sapiens neurotensin receptor 1 (high affinity) (NTSR1), mRNA gi|4505476|ref|NM—002531.1|[4505476]

[4464] 7064: NM—002530 Homo sapiens neurotrophic tyrosine kinase, receptor, type 3 (NTRK3), mRNA gi|4505474|ref|NM—002530.1|[4505474]

[4465] 7065: NM—003580 Homo sapiens neutral sphingomyelinase (N-SMase) activation associated factor (NSMAF), mRNA gi|4505464|ref|NM—003580.1|[4505464]

[4466] 7066: NM—003872 Homo sapiens neuropilin 2 (NRP2), mRNA gi|4505458|ref|NM—003872.1|[4505458]

[4467] 7067: NM—003873 Homo sapiens neuropilin 1 (NRP1), mRNA gi|4505456|ref|NM—003873.1|[4505456]

[4468] 7068: NM—000910 Homo sapiens neuropeptide Y receptor Y2 (NPY2R), mRNA gi|4505446|ref|NM—000910.1|[4505446]

[4469] 7069: NM—000909 Homo sapiens neuropeptide Y receptor Y1 (NPY1R), mRNA gi|4505444|ref|NM—000909.1|[4505444]

[4470] 7070: NM—000908 Homo sapiens natriuretic peptide receptor C/guanylate cyclase C (atrionatriuretic peptide receptor C) (NPR3), mRNA gi|4505440|ref|NM—000908.1|[4505440]

[4471] 7071: NM—000906 Homo sapiens natriuretic peptide receptor A/guanylate cyclase A (atrionatriuretic peptide receptor A) (NPR1), mRNA gi|4505434|ref|NM—000906.1|[4505434]

[4472] 7072: NM—002511 Homo sapiens neuromedin B receptor (NMBR), mRNA gi|4505406|ref|NM—002511.1|[4505406]

[4473] 7073: NM—003954 Homo sapiens mitogen-activated protein kinase kinase kinase 14 (MAP3K14), mRNA gi|4505396|ref|NM—003954.1|[4505396]

[4474] 7074: NM—002507 Homo sapiens nerve growth factor receptor (TNFR superfamily, member 16) (NGFR), mRNA gi|4505392|ref|NM—002507.1|[4505392]

[4475] 7075: NM—002447 Homo sapiens macrophage stimulating 1 receptor (c-met-related tyrosine kinase) (MST1R), mRNA gi|4505264|ref|NM—002447.1|[4505264]

[4476] 7076: NM—002445 Homo sapiens macrophage scavenger receptor 1 (MSR1), mRNA gi|4505258|ref|NM—002445.1|[4505258]

[4477] 7077: NM—000529 Homo sapiens melanocortin 2 receptor (adrenocorticotropic hormone) (MC2R), mRNA gi|4505126|ref|NM—000529.1|[4505126]

[4478] 7078: NM—002386 Homo sapiens melanocortin 1 receptor (alpha melanocyte stimulating hormone receptor) (MC1R), mRNA gi|4505124|ref|NM—002386.1|[4505124]

[4479] 7079: NM—002349 Homo sapiens lymphocyte antigen 75 (LY75), mRNA gi|4505052|ref|NM—002349.1|[4505052]

[4480] 7080: NM—002344 Homo sapiens leukocyte tyrosine kinase (LTK), mRNA gi|4505044|ref|NM—002344.1|[4505044]

[4481] 7081: NM—000752 Homo sapiens leukotriene b4 receptor (chemokine receptor-like 1) (LTB4R), mRNA gi|4505032|ref|NM—000752.1|[4505032]

[4482] 7082: NM—002336 Homo sapiens low density lipoprotein receptor-related protein 6 (LRP6), mRNA gi|4505016|ref|NM—002336.1|[4505016]

[4483] 7083: NM—002319 Homo sapiens leucine-rich neuronal protein (LRN), mRNA gi|4505012|ref|NM—002319.1|[4505012]

[4484] 7084: NM—002303 Homo sapiens leptin receptor (LEPR), mRNA gi|4504978|ref|NM—002303.1|[4504978]

[4485] 7085: NM—002291 Homo sapiens laminin, beta 1 (LAMB1), mRNA gi|4504950|ref|NM—002291.1|[4504950]

[4486] 7086: NM—002258 Homo sapiens killer cell lectin-like receptor subfamily B, member 1 (KLRB1), mRNA gi|4504878|ref|NM—002258.1|[4504878]

[4487] 7087: NM—002255 Homo sapiens killer cell immunoglobulin-like receptor, two domains, long cytoplasmic tail, 4 (KIR2DL4), mRNA gi|4504870|ref|NM—002255.1|[4504870]

[4488] 7088: NM—002227 Homo sapiens Janus kinase 1 (a protein tyrosine kinase) (JAK1), mRNA gi|4504802|ref|NM—002227.1|[4504802]

[4489] 7091: NM—002210 Homo sapiens integrin, alpha V (vitronectin receptor, alpha polypeptide, antigen CD51) (ITGAV), mRNA gi|4504762|ref|NM—002210.1|[4504762]

[4490] 7092: NM—002205 Homo sapiens integrin, alpha 5 (fibronectin receptor, alpha polypeptide) (ITGA5), mRNA gi|4504750|ref|NM—002205.1|[4504750]

[4491] 7094: NM—001565 Homo sapiens small inducible cytokine subfamily B (Cys-X-Cys), member 10 (SCYB10), mRNA gi|4504700|ref|NM—001565.1|[4504700]

[4492] 7095: NM—001557 Homo sapiens interleukin 8 receptor, beta (IL8RB), mRNA gi|4504682|ref|NM—001557.1|[4504682]

[4493] 7096: NM—000634 Homo sapiens interleukin 8 receptor, alpha (IL8RA), mRNA gi|4504680|ref|NM—000634.1|[4504680]

[4494] 7097: NM—002185 Homo sapiens interleukin 7 receptor (IL7R), mRNA gi|4504678|ref|NM—002185.1|[4504678]

[4495] 7098: NM—002184 Homo sapiens interleukin 6 signal transducer (gp130, oncostatin M receptor) (IL6ST), mRNA gi|4504674|ref|NM—002184.1|[4504674]

[4496] 7099: NM—000565 Homo sapiens interleukin 6 receptor (IL6R), mRNA gi|4504672|ref|NM—000565.1|[4504672]

[4497] 7100: NM—000878 Homo sapiens interleukin 2 receptor, beta (IL2RB), mRNA gi|4504664|ref|NM—000878.1|[4504664]

[4498] 7101: NM—003854 Homo sapiens interleukin 1 receptor-like 2 (IL1RL2), mRNA gi|4504662|ref|NM—003854.1|[4504662]

[4499] 7102: NM—000877 Homo sapiens interleukin 1 receptor, type I (IL1R1), mRNA gi|4504658|ref|NM—000877.1|[4504658]

[4500] 7103: NM—003853 Homo sapiens interleukin 18 receptor accessory protein (IL18RAP), mRNA gi|4504656|ref|NM—003853.1|[4504656]

[4501] 7104: NM—002189 Homo sapiens interleukin 15 receptor, alpha (IL15RA), mRNA gi|4504648|ref|NM—002189.1|[4504648]

[4502] 7105: NM—001559 Homo sapiens interleukin 12 receptor, beta 2 (IL12RB2), mRNA gi|4504642|ref|NM—001559.1|[4504642]

[4503] 7106: NM—001558 Homo sapiens interleukin 10 receptor, alpha (IL10RA), mRNA gi|4504632|ref|NM—001558.1|[4504632]

[4504] 7107: NM—000876 Homo sapiens insulin-like growth factor 2 receptor (IGF2R), mRNA gi|4504610|ref|NM—000876.1|[4504610]

[4505] 7108: NM—000871 Homo sapiens 5-hydroxytryptamine (serotonin) receptor 6 (HTR6), mRNA gi|4504544|ref|NM—000871.1|[4504544]

[4506] 7109: NM—000869 Homo sapiens 5-hydroxytryptamine (serotonin) receptor 3A (HTR3A), mRNA gi|4504542|ref|NM—000869.1|[4504542]

[4507] 7110: NM—000868 Homo sapiens 5-hydroxytryptamine (serotonin) receptor 2C (HTR2C), mRNA gi|4504540|ref|NM—000868.1|[4504540]

[4508] 7111: NM—000867 Homo sapiens 5-hydroxytryptamine (serotonin) receptor 2B (HTR2B), mRNA gi|4504538|ref|NM—000867.1|[4504538]

[4509] 7112: NM—000865 Homo sapiens 5-hydroxytryptamine (serotonin) receptor 1E (HTR1E), mRNA gi|4504536|ref|NM—000865.1|[4504536]

[4510] 7113: NM—000863 Homo sapiens 5-hydroxytryptamine (serotonin) receptor 1B (HTR1B), mRNA gi|4504532|ref|NM—000863.1|[4504532]

[4511] 7114: NM—000524 Homo sapiens 5-hydroxytryptamine (serotonin) receptor |A (HTR1A), mRNA gi|4504530|ref|NM—000524.1|[4504530]

[4512] 7115: NM—000186 Homo sapiens H factor 1 (complement) (HF1), mRNA gi|4504374|ref|NM—000186.1|[4504374]

[4513] 7116: NM—001523 Homo sapiens hyaluronan synthase 1 (HAS1), mRNA gi|4504338|ref|NM—001523.1|[4504338]

[4514] 7117: NM—000845 Homo sapiens glutamate receptor, metabotropic 8 (GRM8), mRNA gi|4504148|ref|NM—000845.1|[4504148]

[4515] 7118: NM—000844 Homo sapiens glutamate receptor, metabotropic 7 (GRM7), mRNA gi|4504146|ref|NM—000844.1|[4504146]

[4516] 7119: NM—000841 Homo sapiens glutamate receptor, metabotropic 4 (GRM4), mRNA gi|4504140|ref|NM—000841.1|[4504140]

[4517] 7120: NM—000840 Homo sapiens glutamate receptor, metabotropic 3 (GRM3), mRNA gi|4504138|ref|NM—000840.1|[4504138]

[4518] 7121: NM—000831 Homo sapiens glutamate receptor, ionotropic, kainate 3 (GRIK3), mRNA gi|4504118|ref|NM—000831.1|[4504118]

[4519] 7122: NM—000830 Homo sapiens glutamate receptor, ionotropic, kainate 1 (GRIK1), mRNA gi|4504116|ref|NM—000830.1|[4504116]

[4520] 7123: NM—002086 Homo sapiens growth factor receptor-bound protein 2 (GRB2), mRNA gi|4504110|ref|NM—002086.1|[4504110]

[4521] 7124: NM—002082 Homo sapiens G protein-coupled receptor kinase 6 (GPRK6), mRNA gi|4504100|ref|NM—002082.1|[4504100]

[4522] 7125: NM—001504 Homo sapiens G protein-coupled receptor 9 (GPR9), mRNA gi|4504098|ref|NM—001504.1|[4504098]

[4523] 7126: NM—001508 Homo sapiens G protein-coupled receptor 39 (GPR39), mRNA gi|4504096|ref|NM—001508.1|[4504096]

[4524] 7127: NM—001507 Homo sapiens G protein-coupled receptor 38 (GPR38), mRNA gi|4504094|ref|NM—001507.1|[4504094]

[4525] 7128: NM—001506 Homo sapiens G protein-coupled receptor 32 (GPR32), mRNA gi|4504092|ref|NM—001506.1|[4504092]

[4526] 7129: NM—001505 Homo sapiens G protein-coupled receptor 30 (GPR30), mRNA gi|4504090|ref|NM—001505.1|[4504090]

[4527] 7130: NM—000173 Homo sapiens glycoprotein Ib (platelet), alpha polypeptide (GP1BA), mRNA gi|4504070|ref|NM—000173.1|[4504070]

[4528] 7131: NM—000824 Homo sapiens glycine receptor, beta (GLRB), mRNA gi|4504022|ref|NM—000824.1|[4504022]

[4529] 7132: NM—002063 Homo sapiens glycine receptor, alpha 2 (GLRA2), mRNA gi|4504020|ref|NM—002063.1|[4504020]

[4530] 7133: NM—000164 Homo sapiens gastric inhibitory polypeptide receptor (GIPR), mRNA gi|4503998|ref|NM—000164.1|[4503998]

[4531] 7134: NM—000823 Homo sapiens growth hormone releasing hormone receptor (GHRHR), mRNA gi|4503996|ref|NM—000823.1|[4503996]

[4532] 7135: NM—000163 Homo sapiens growth hormone receptor (GHR), mRNA gi|4503992|ref|NM—000163.1|[4503992]

[4533] 7136: NM—000160 Homo sapiens glucagon receptor (GCGR), mRNA gi|4503946|ref|NM—000160.1|[4503946]

[4534] 7137: NM—003614 Homo sapiens galanin receptor 3 (GALR3), mRNA gi|4503906|ref|NM—003614.1|[4503906]

[4535] 7138: NM—002043 Homo sapiens gamma-aminobutyric acid (GABA) receptor, rho 2 (GABRR2), mRNA gi|4503870|ref|NM—002043.1|[4503870]

[4536] 7139: NM—002042 Homo sapiens gamma-aminobutyric acid (GABA) receptor, rho 1 (GABRR1), mRNA gi|4503868|ref|NM—002042.1|[4503868]

[4537] 7140: NM—002036 Homo sapiens Duffy blood group (FY), mRNA gi|4503818|ref|NM—002036.1|[4503818]

[4538] 7141: NM—001462 Homo sapiens formyl peptide receptor-like 1 (FPRL1), mRNA gi|4503780|ref|NM—001462.1|[4503780]

[4539] 7142: NM—002029 Homo sapiens formyl peptide receptor 1 (FPR1), mRNA gi|4503778|ref|NM—002029.1|[4503778]

[4540] 7143: NM—001461 Homo sapiens flavin containing monooxygenase 5 (FMO5), mRNA gi|4503760|ref|NM—001461.1|[4503760]

[4541] 7144: NM—002020 Homo sapiens fms-related tyrosine kinase 4 (FLT4), mRNA gi|4503752|ref|NM—002020.1|[4503752]

[4542] 7145: NM—001459 Homo sapiens fms-related tyrosine kinase 3 ligand (FLT3LG), mRNA gi|4503750|ref|NM—001459.1|[4503750]

[4543] 7146: NM—002019 Homo sapiens fms-related tyrosine kinase 1 (vascular endothelial growth factor/vascular permeability factor receptor) (FLT1), mRNA gi|4503748|ref|NM—002019.1|[4503748]

[4544] 7147: NM—002002 Homo sapiens Fc fragment of IgE, low affinity II, receptor for (CD23A) (FCER2), mRNA gi|4503678|ref|NM—002002.1|[4503678]

[4545] 7148: NM—002001 Homo sapiens Fc fragment of IgE, high affinity I, receptor for; alpha polypeptide (FCER1A), mRNA gi|4503674|ref|NM—002001.1|[4503674]

[4546] 7149: NM—003950 Homo sapiens coagulation factor II (thrombin) receptor-like 3 (F2RL3), mRNA gi|4503638|ref|NM—003950.1|[4503638]

[4547] 7150: NM—001981 Homo sapiens epidermal growth factor receptor pathway substrate 15 (EPS15), mRNA gi|4503592|ref|NM—001981.1|[4503592]

[4548] 7151: NM—001974 Homo sapiens egf-like module containing, mucin-like, hormone receptor-like sequence 1 (EMR1), mRNA gi|4503564|ref|NM—001974.1|[4503564]

[4549] 7152: NM—001423 Homo sapiens epithelial membrane protein 1 (EMP1), mRNA gi|4503558|ref|NM—001423.1|[4503558]

[4550] 7153: NM—003757 Homo sapiens eukaryotic translation initiation factor 3, subunit 2 (beta,

[4551] 36 kD) (EIF3S2), mRNA gi|4503512|ref|NM—003757.1|[4503512]

[4552] 7154: NM—001406 Homo sapiens ephrin-B3 (EFNB3), mRNA gi|4503488|ref|NM—001406.1|[4503488]

[4553] 7155: NM—001962 Homo sapiens ephrin-A5 (EFNA5), mRNA gi|4503486|ref|NM—001962.1|[4503486]

[4554] 7156: NM—001405 Homo sapiens ephrin-A2 (EFNA2), mRNA gi|4503484|ref|NM—001405.1|[4503484]

[4555] 7157: NM—003775 Homo sapiens endothelial differentiation, G-protein-coupled receptor 6 (EDG6), mRNA gi|4503458|ref|NM—003775.1|[4503458]

[4556] 7158: NM—001945 Homo sapiens diphtheria toxin receptor (heparin-binding epidermal growth factor-like growth factor) (DTR), mRNA gi|4503412|ref|NM—001945.1|[4503412]

[4557] 7159: NM—001360 Homo sapiens 7-dehydrocholesterol reductase (DHCR7), mRNA gi|4503320|ref|NM—001360.1|[4503320]

[4558] 7160: NM—003467 Homo sapiens chemokine (C-X-C motif), receptor 4 (fusin) (CXCR4), mRNA gi|4503174|ref|NM—003467.1|[4503174]

[4559] 7161: NM—001338 Homo sapiens coxsackie virus and adenovirus receptor (CXADR), mRNA gi|4503172|ref|NM—001338.1|[4503172]

[4560] 7162: NM—003478 Homo sapiens cullin 5 (CUL5), mRNA gi|4503166|ref|NM—003478.1|[4503166]

[4561] 7163: NM—001330 Homo sapiens cardiotrophin 1 (CTF1), mRNA gi|4503120|ref|NM—001330.1|[4503120]

[4562] 7164: NM—000760 Homo sapiens colony stimulating factor 3 receptor (granulocyte) (CSF3R), mRNA gi|4503080|ref|NM—000760.1|[4503080]

[4563] 7165: NM—003805 Homo sapiens CASP2 and RIPK1 domain containing adaptor with death domain (CRADD), mRNA gi|4503030|ref|NM—003805.1|[4503030]

[4564] 7166: NM—001877 Homo sapiens complement component (3d/Epstein Barr virus) receptor 2 (CR2), mRNA gi|4503026|ref|NM—001877.1|[4503026]

[4565] 7167: NM—001842 Homo sapiens ciliary neurotrophic factor receptor (CNTFR), mRNA gi|4502930|ref|NM—001842.1|[4502930]

[4566] 7168: NM—001281 Homo sapiens cytoskeleton-associated protein 1 (CKAP1), mRNA gi|4502848|ref|NM—001281.1|[4502848]

[4567] 7169: NM—000750 Homo sapiens cholinergic receptor, nicotinic, beta polypeptide 4 (CHRNB4), mRNA gi|4502836|ref|NM—000750.1|[4502836]

[4568] 7170: NM—000749 Homo sapiens cholinergic receptor, nicotinic, beta polypeptide 3 (CHRNB3), mRNA gi|4502834|ref|NM—000749.1|[4502834]

[4569] 7171: NM—000748 Homo sapiens cholinergic receptor, nicotinic, beta polypeptide 2 (neuronal) (CHRNB2), mRNA gi|4502832|ref|NM—000748.1|[4502832]

[4570] 7172: NM—000746 Homo sapiens cholinergic receptor, nicotinic, alpha polypeptide 7 (CHRNA7), mRNA gi|4502830|ref|NM—000746.1|[4502830]

[4571] 7173: NM—000745 Homo sapiens cholinergic receptor, nicotinic, alpha polypeptide 5 (CHRNA5), mRNA gi|4502828|ref|NM—000745.1|[4502828]

[4572] 7174: NM—000744 Homo sapiens cholinergic receptor, nicotinic, alpha polypeptide 4 (CHRNA4), mRNA gi|4502826|ref|NM—000744.1|[4502826]

[4573] 7175: NM—000742 Homo sapiens cholinergic receptor, nicotinic, alpha polypeptide 2 (neuronal) (CHRNA2), mRNA gi|4502822|ref|NM—000742.1|[4502822]

[4574] 7176: NM—000741 Homo sapiens cholinergic receptor, muscarinic 4 (CHRM4), mRNA gi|4502820|ref|NM—000741.1|[4502820]

[4575] 7177: NM—000740 Homo sapiens cholinergic receptor, muscarinic 3 (CHRM3), mRNA gi|4502818|ref|NM—000740.1|[4502818]

[4576] 7178: NM—000739 Homo sapiens cholinergic receptor, muscarinic 2 (CHRM2), mRNA gi|4502816|ref|NM—000739.1|[4502816]

[4577] 7179: NM—000738 Homo sapiens cholinergic receptor, muscarinic 1 (CHRM1), mRNA gi|4502814|ref|NM—000738.1|[4502814]

[4578] 7181: NM—001768 Homo sapiens CD8 antigen, alpha polypeptide (p32) (CD8A), mRNA gi|4502688|ref|NM—001768.1|[4502688]

[4579] 7182: NM—001781 Homo sapiens CD69 antigen (p60, early T-cell activation antigen) (CD69), mRNA gi|4502680|ref|NM—001781.1|[4502680]

[4580] 7183: NM—001779 Homo sapiens CD58 antigen, (lymphocyte function-associated antigen 3) (CD58), mRNA gi|4502676|ref|NM—001779.1|[4502676]

[4581] 7184: NM—000733 Homo sapiens CD3E antigen, epsilon polypeptide (TiT3 complex) (CD3E), mRNA gi|4502670|ref|NM—000733.1|[4502670]

[4582] 7185: NM—000732 Homo sapiens CD3D antigen, delta polypeptide (TiT3 complex) (CD3D), mRNA gi|4502668|ref|NM—000732.1|[4502668]

[4583] 7186: NM—001775 Homo sapiens CD38 antigen (p45) (CD38), mRNA gi|4502664|ref|NM—001775.1|[4502664]

[4584] 7187: NM—001767 Homo sapiens CD2 antigen (p50), sheep red blood cell receptor (CD2), mRNA gi|4502652|ref|NM—001767.1|[4502652]

[4585] 7188: NM—001837 Homo sapiens chemokine (C-C motif) receptor 3 (CCR3), mRNA gi|4502636|ref|NM—001837.1|[4502636]

[4586] 7189: NM—000731 Homo sapiens cholecystokinin B receptor (CCKBR), mRNA gi|4502608|ref|NM—000731.1|[4502608]

[4587] 7190: NM—000730 Homo sapiens cholecystokinin A receptor (CCKAR), mRNA gi|4502606|ref|NM—000730.1|[4502606]

[4588] 7191: NM—001742 Homo sapiens calcitonin receptor (CALCR), mRNA gi|4502546|ref|NM—001742.1|[4502546]

[4589] 7192: NM—001737 Homo sapiens complement component 9 (C9), mRNA gi|4502510|ref|NM—001737.1|[4502510]

[4590] 7193: NM—001736 Homo sapiens complement component 5 receptor 1 (C5a ligand) (C5R1), mRNA gi|4502508|ref|NM—001736.1|[4502508]

[4591] 7194: NM—001732 Homo sapiens butyrophilin, subfamily 1, member A1 (BTN|A1), mRNA gi|4502474|ref|NM—001732.1|[4502474]

[4592] 7195: NM—001729 Homo sapiens betacellulin (BTC), mRNA gi|4502460|ref|NM—001729.1|[4502460]

[4593] 7196: NM—001727 Homo sapiens bombesin-like receptor 3 (BRS3), mRNA gi|4502454|ref|NM—001727.1|[4502454]

[4594] 7197: NM—001203 Homo sapiens bone morphogenetic protein receptor, type IB (BMPR1B), mRNA gi|4502430|ref|NM—001203.1|[4502430]

[4595] 7198: NM—000710 Homo sapiens bradykinin receptor B1 (BDKRB1), mRNA gi|4502390|ref|NM—000710.1|[4502390]

[4596] 7199: NM—003921 Homo sapiens B-cell CLL/lymphoma 10 (BCL10), mRNA gi|4502378|ref|NM—003921.1|[4502378]

[4597] 7200: NM—001168 Homo sapiens baculoviral IAP repeat-containing 5 (survivin) (BIRC5), mRNA gi|4502144|ref|NM—001168.1|[4502144]

[4598] 7201: NM—001150 Homo sapiens alanyl (membrane) aminopeptidase (aminopeptidase N, aminopeptidase M, microsomal aminopeptidase, CD13, p150) (ANPEP), mRNA gi|4502094|ref|NM—001150.1|[4502094]

[4599] 7202: NM—001146 Homo sapiens angiopoietin 1 (ANGPT1), mRNA gi|4502086|ref|NM—001146.1|[4502086]

[4600] 7203: NM—000676 Homo sapiens adenosine A2b receptor (ADORA2B), mRNA gi|4501950|ref|NM—000676.1|[4501950]

[4601] 7204: NM—000674 Homo sapiens adenosine Al receptor (ADORA1), mRNA gi|4501946|ref|NM—000674.1|[4501946]

[4602] 7205: NM—001118 Homo sapiens adenylate cyclase activating polypeptide 1 (pituitary) receptor type I (ADCYAP1R1), mRNA gi|4501922|ref|NM—001118.1|[4501922]

[4603] 7206: AF287270 Homo sapiens mucolipin (MCOLN1) gene, complete cds gi|9844925|gb|AF287270.1|AF287270[9844925]

[4604] 7207: AF287269 Homo sapiens mucolipin (MCOLN1) mRNA, complete cds gi|9844923|gb|AF287269.1|AF287269[9844923]

[4605] 7208: AF307080 Homo sapiens lectomedin-3 (LEC3) mRNA, complete cds gi|11037015|gb|AF307080.1|AF307080[11037015]

[4606] 7209: AF307079 Homo sapiens lectomedin-2 (LEC2) mRNA, complete cds gi|11037013|gb|AF307079.1|AF307079[11037013]

[4607] 7216: AF265242 Homo sapiens type-I T cell cytokine receptor mRNA, complete cds gi|11036791|gb|AF265242.1|AF265242[11036791]

[4608] 7217: AF018284 Homo sapiens P2Y1 receptor (P2YR1) mRNA, partial cds gi|2738815|gb|AF018284.1|AF018284[2738815]

[4609] 7218: AF017307 Homo sapiens Ets-related transcription factor (ERT) mRNA, complete cds gi|2338755|gb|AF017307.1|AF017307[2338755]

[4610] 7219: AF106912 Homo sapiens CRL1 protein (CRL1) mRNA, complete cds gi|11022746|gb|AF106912.1|AF106912[11022746]

[4611] 7220: AB042033 Homo sapiens FCER1B gene for high affinity IgE receptor beta subunit, 5′ flanking sequence and partial cds gi|11022658|dbj|AB042033.1|AB042033[11022658]

[4612] 7221: AB019000 Homo sapiens mRNA for G-protein coupled receptor, complete cds gi|11022652|dbj|AB019000.1|AB019000[11022652]

[4613] 7222: AH007076 Homo sapiens chromosome 13 map 13q34 gi|3955190|gb|AH007076.1|SEG_HSGRKIN[3955190]

[4614] 7223: AF019765 Homo sapiens G protein-coupled receptor kinase 1 and G protein-coupled receptor kinase 1b (GRK1) gene, alternatively spliced, alternative exon 6, exon 7, and partial cds gi|3955189|gb|AF019765.1|HSGRKIN2[3955189]

[4615] 7224: AF019764 Homo sapiens G protein-coupled receptor kinase 1 and G protein-coupled receptor kinase 1b (GRK1) gene, alternatively spliced, exon 6, alternative exon 6, and partial cds gi|3955188|gb|AF019764.1|HSGRKIN1[3955188]

[4616] 7225: AF035819 Homo sapiens macrophage receptor MARCO mRNA, complete cds gi|3002790|gb|AF035819.1|AF035819[3002790]

[4617] 7227: AF253318 Homo sapiens GFR receptor alpha 4 protein (GFRA4) mRNA, complete cds gi|10998399|gb|AF253318.1|AF253318[10998399]

[4618] 7228: AF077186 Homo sapiens neuronal nicotinic acetylcholine receptor beta 2 (CHRNB2) gene, complete cds gi|10947140|gb|AF077186.2|[10947140]

[4619] 7229: AF272363 Homo sapiens neuromedin U receptor 2 (NMUR2) mRNA, complete cds gi|10946202|gb|AF272363.1|AF272363[10946202]

[4620] 7230: AF272362 Homo sapiens neuromedin U receptor 1 (NMUR1) mRNA, complete cds gi|10946200|gb|AF272362.1|AF272362[10946200]

[4621] 7231: AJ277437 Homo sapiens mRNA for fibroblast growth factor receptor-like protein 1, (FGFRL1 gene) gi|10944886|emb|AJ277437.1|HSA277437[10944886]

[4622] 7232: G64264 Alk4/3′ Human Chromosome 12 Homo sapiens STS genomic, sequence tagged site gi|9802476|gb|G64264.1|G64264[9802476]

[4623] 7233: G64261 AMHR2/ex1-2 Human Chromosome 12 Homo sapiens STS genomic, sequence tagged site gi|9802473|gb|G64261.1|G64261[9802473]

[4624] 7234: G64251 Alk4/ex1 Human Chromosome 12 Homo sapiens STS genomic, sequence tagged site gi|9802463|gb|G64251.1|G64251[9802463]

[4625] 7235: G64250 Alk1/ex10 Human Chromosome 12 Homo sapiens STS genomic, sequence tagged site gi|9802462|gb|G64250.1|G64250[9802462]

[4626] 7236: G64249 Alk1/ex2 Human Chromosome 12 Homo sapiens STS genomic, sequence tagged site gi|9802461|gb|G64249.1|G64249[9802461]

[4627] 7237: AF301005 Homo sapiens gamma-aminobutyric acid receptor GABA-B1e mRNA, complete cds gi|10863757|gb|AF301005.1|AF301005[10863757]

[4628] 7238: AF269133 Homo sapiens novel interleukin receptor (NILR) mRNA, complete cds gi|10801190|gb|AF269133.1|AF269133[10801190]

[4629] 7239: AF127670 Homo sapiens hyaluronic acid receptor (HAR) mRNA, complete cds gi|1080012|gb|AF127670.2|AF127670[10800121]

[4630] 7241: AF284436 Homo sapiens TIGIRR-1 mRNA, complete cds gi|10644689|gb|AF284436.1|AF284436[10644689]

[4631] 7242: AF284435 Homo sapiens TIGIRR-2 mRNA, complete cds gi|10644687|gb|AF284435.1|AF284435[10644687]

[4632] 7243: AF284434 Homo sapiens IL-1Rrp2 mRNA, complete cds gi|10644685|gb|AF284434.1|AF284434[10644685]

[4633] 7244: M35198 Homo sapiens integrin beta-subunit mRNA, complete cds gi|9961228|gb|M35198.3|HUMINTB6A[9961228]

[4634] 7245: AF302903 Homo sapiens vomeronasal receptor 1 (VNR19I1) mRNA, complete cds gi|1073280|gb|AF302903.1|AF302903[10732801]

[4635] 7246: AF286095 Homo sapiens IL-22 receptor (IL22R) mRNA, complete cds gi|10719607|gb|AF286095.1|AF286095[10719607]

[4636] 7248: AF239668 Homo sapiens CCK-B/gastrin receptor mRNA, complete cds; alternatively spliced gi|7677459|gb|AF239668.1|AF239668[7677459]

[4637] 7249: AF029759 Homo sapiens mutant G protein-coupled receptor STRL33 (STRL33) gene, STRL33-3K allele, complete cds gi|10716827|gb|AF029759.1|AF029759[10716827]

[4638] 7250: AB041644 Homo sapiens gene for cysteinyl leukotriene receptor like receptor, complete cds gi|10716135|dbj|AB041644.1|AB041644[10716135]

[4639] 7251: AF237381 Homo sapiens CCR3 gene and exon 3 gi|10643653|gb|AF237381.1|AF237380S2[10643653]

[4640] 7252: AF237380 Homo sapiens CCR3 gene, promotor and exon 1 gi|10643652|gb|AF237380.1|AF237380S1[10643652]

[4641] 7253: AH009867 Homo sapiens gi|10643651|gb|AH009867.1|SEG_AF237380S[10643651]

[4642] 7254: AF233516 Homo sapiens PD-1-ligand precursor, mRNA, complete cds gi|10567621|gb|AF233516.1|AF233516[10567621]

[4643] 7255: AJ297688 Homo sapiens partial IL-12RB1 gene for IL-12 receptor beta1 chain, exon 1 and joined CDS gi|10445329|emb|AJ297688.1|HSA297688[10445329]

[4644] 7256: AJ297701 Homo sapiens partial IL-12RB1 gene for IL-12 receptor beta1 chain, exons 16-17 gi|10443220|emb|AJ297701.1|HSA297701[10443220]

[4645] 7257: AJ297700 Homo sapiens partial IL-12RB1 gene for IL-12 receptor beta1 chain, exon 15 gi|10443219|emb|AJ297700.1|HSA297700[10443219]

[4646] 7258: AJ297699 Homo sapiens partial IL-12RB1 gene for IL-12 receptor beta1 chain, exon 14 gi|10443218|emb|AJ297699.1|HSA297699[10443218]

[4647] 7259: AJ297698 Homo sapiens partial IL-12RB1 gene for IL-12 receptor beta1 chain, exon 13 gi|10443217|emb|AJ297698.1|HSA297698[10443217]

[4648] 7260: AJ297697 Homo sapiens partial IL-12RB1 gene for IL-12 receptor beta1 chain, exon 12 gi|10443216|emb|AJ297697.1|HSA297697[10443216]

[4649] 7261: AJ297696 Homo sapiens partial IL-12RB1 gene for IL-12 receptor beta1 chain, exon 11 gi|10443215|emb|AJ297696.1|HSA297696[10443215]

[4650] 7262: AJ297695 Homo sapiens partial IL-12RB1 gene for IL-12 receptor beta1 chain, exon 10 gi|10443214|emb|AJ297695.1|HSA297695[10443214]

[4651] 7263: AJ297694 Homo sapiens partial IL-12RB1 gene for IL-12 receptor beta1 chain, exon 9 gi|10443213|emb|AJ297694.1|HSA297694[10443213]

[4652] 7264: AJ297693 Homo sapiens partial IL-12RB1 gene for IL-12 receptor beta1 chain, exon 8 gi|110443212|emb|AJ297693.1|HSA297693[10443212]

[4653] 7265: AJ297692 Homo sapiens partial IL-12RB1 gene for IL-12 receptor beta1 chain, exons 6-7 gi|10443211|emb|AJ297692.1|HSA297692[10443211]

[4654] 7266: AJ297691 Homo sapiens partial IL-12RB1 gene for IL-12 receptor beta1 chain, exon 5 gi|10443210|emb|AJ297691.1|HSA297691[10443210]

[4655] 7267: AJ297690 Homo sapiens partial IL-12RB1 gene for IL-12 receptor beta1 chain, exon 4 gi|10443209|emb|AJ297690.1|HSA297690[10443209]

[4656] 7268: AJ297689 Homo sapiens partial IL-12RB1 gene for IL-12 receptor beta1 chain, exons 2-3 gi|10443208|emb|AJ297689.1|HSA297689[10443208]

[4657] 7269: AJ276452 Homo sapiens partial pIgR gene for polymeric immunoglobulin receptor, partial intron 1 and partial exon 2 gi|10303247|emb|AJ276452.1|HSA276452[10303247]

[4658] 7271: AF254664 Homo sapiens cysteinyl leukotriene receptor CYSLT2 gene, complete cds gi|10442007|gb|AF254664.1|AF254664[10442007]

[4659] 7273: AC005330 Homo sapiens chromosome 19, cosmid R34047 and overlapping PCR product, complete sequence gi|10305189|gb|AC005330.2|AC005330[10305189]

[4660] 7517: AF176039 Homo sapiens high mobility group protein-R mRNA, complete cds gi|5834272|gb|AF176039.1|AF176039[5834272]

[4661] 7518: AB041228 Homo sapiens mRNA for G protein-coupled receptor TGR-1, complete cds gi|10257380|dbj|AB041228.1|AB041228[10257380]

[4662] 7519: AF282262 Homo sapiens GHRH receptor splice variant 4 mRNA, complete cds gi|10242297|gb|AF282262.1|AF282262[10242297]

[4663] 7520: AF282261 Homo sapiens GHRH receptor splice variant 3 mRNA, complete cds gi|10242295|gb|AF282261.1|AF282261[10242295]

[4664] 7521: AF282260 Homo sapiens GHRH receptor splice variant 2 mRNA, complete cds gi|10242293|gb|AF282260.1|AF282260[10242293]

[4665] 7522: AF282259 Homo sapiens GHRH receptor splice variant 1 mRNA, complete cds gi|10242291|gb|AF282259.1|AF282259[10242291]

[4666] 7523: X80389 H.sapiens platelet-derived growth factor alpha receptor DNA gi|10241726|emb|X80389.2|HSPDGFAD[10241726]

[4667] 7524: AF177761 Homo sapiens herstatin (HER-2) mRNA, alternatively spliced, complete cds gi|10181232|gb|AF177761.2|AF177761[10181232]

[4668] 7525: AF005058 Homo sapiens chemokine receptor (CXCR-4) gene, complete cds gi|2735718|gb|AF005058.1|AF005058[2735718]

[4669] 7526: AF264716 Homo sapiens complement receptor type 1 (CR1) gene, CR1*SCR25-HUM1 allele, partial cds gi|10185787|gb|AF264716.1|AF264716[10185787]

[4670] 7527: AF264715 Homo sapiens complement receptor type 1 (CR1) gene, CR1*SCR25-HUM2 allele, partial cds gi|10185785|gb|AF264715.1|AF264715[10185785]

[4671] 7528: AF250237 Homo sapiens orphan G protein-coupled receptor 85 (GPR85) mRNA, complete cds gi|10181092|gb|AF250237.2|AF250237[10181092]

[4672] 7533: AF189277 Homo sapiens leukocyte immunoglobulin-like receptor 1 (LIR1) gene, complete cds gi|9954209|gb|AF189277.1|AF189277[9954209]

[4673] 7534: AB010994 Homo sapiens hedgehog gene, exon 3 and complete cds gi|10047225|dbj|AB010994.2|A]3010581S3[10047225]

[4674] 7535: AB010993 Homo sapiens hedgehog gene, exon 2 gi|10047224|dbj|AB010993.2|AB010581S2[10047224]

[4675] 7536: AB3010581 Homo sapiens hedgehog gene, exon 1 gi|10047223|dbj |AB010581.2|AB010581S1[10047223]

[4676] 7537: SEG_A13010581S Homo sapiens hedgehog gene gi|10047222|dbj||SEG_AB010581S[10047222]

[4677] 7538: AX015117 Sequence 8 from Patent WO9952943 gi|10041220|emb|AX015117.1|AX015117[10041220]

[4678] 7539: AX015116 Sequence 7 from Patent WO9952943 gi|10041219|emb|AX015116.1|AX015116[10041219]

[4679] 7540: AX015115 Sequence 6 from Patent WO9952943 gi|10041218|emb|AX015115.1|AX015115[10041218]

[4680] 7541: AX015114 Sequence 5 from Patent WO9952943 gi|10041217|emb|AX015114.1|AX015114[10041217]

[4681] 7542: AX015113 Sequence 4 from Patent WO9952943 gi|10041216|emb|AX015113.1|AX015113[10041216]

[4682] 7543: AX015112 Sequence 3 from Patent WO9952943 gi|10041215|emb|AX015112.1|AX015112[10041215]

[4683] 7544: AX015111 Sequence 2 from Patent WO9952943 gi|10041214|emb|AX015111.1|AX015111[10041214]

[4684] 7545: AX015110 Sequence 1 from Patent WO9952943 gi|10041213|emb|AX015110.1|AX015110[10041213]

[4685] 7546: AF042080 Homo sapiens glial cell line-derived neurotrophic factor receptor alpha (GFRA1) mRNA, complete cds gi|2801556|gb|AF042080.1|AF042080[2801556]

[4686] 7547: AF255342 Homo sapiens putative pheromone receptor V1RL1 long form (V1RL1) mRNA, complete cds gi|9988584|gb|AF255342.1|AF255342[9988584]

[4687] 7548: AF254747 Homo sapiens ROR2 protein (ROR2) gene, exon 2 gi|9664303|gb|AF254747.1|AF254747S1[9664303]

[4688] 7550: AJ295613 Homo sapiens partial GHR gene for growth hormone receptor, exon 2 gi|9968301|emb|AJ295613.1|HSA295613[9968301]

[4689] 7551: AJ278681 Homo sapiens partial GHR gene for growth hormone receptor, exons 8-10 gi|9968297|emb|AJ278681.1|HSA278681[9968297]

[4690] 7553: AF217963 Homo sapiens NRAGE mRNA, complete cds gi|9963809|gb|AF217963.1|AF217963[9963809]

[4691] 7554: AF169970 Homo sapiens complement receptor 1 (CR1) gene, CR1*SCR25-HUM5 allele, exon 29 and partial cds gi|9956947|gb|AF169970.1|AF169970[9956947]

[4692] 7555: AF169969 Homo sapiens complement receptor 1 (CR1) gene, CR1*SCR25-HUM4 allele, exon 29 and partial cds gi|9956945|gb|AF169969.1L|AF169969[9956945]

[4693] 7556: AB044402 Homo sapiens mRNA for LTB4 receptor JULF2, complete cds gi|9081802|dbj|AB044402.1|AB044402[9081802]

[4694] 7557: U96190 Homo sapiens p58 NK cell inhibitory receptor NKR-K7 mRNA, partial cds gi|2088618|gb|U96190.1|HSU96190[2088618]

[4695] 7558: U96189 Homo sapiens p58 NK cell inhibitory receptor NKR-K6 mRNA, partial cds gi|2088616|gb|U96189.1|HSU96189[2088616]

[4696] 7559: U96188 Homo sapiens p50 cell activatory receptor NKR-K1 mRNA, partial cds gi|2088614|gb|U96188.1|HSU96188[2088614]

[4697] 7560: AF251841 Homo sapiens vitronectin receptor alpha polypeptide (ITGAV) gene, exons 29, 30, and complete cds gi|9944844|gb|AF251841.1|F251818S24[9944844]

[4698] 7561: AF251840 Homo sapiens vitronectin receptor alpha polypeptide (ITGAV) gene, exons 27 and gi|9944843|gb|AF251840.1|F251818S23[9944843]

[4699] 7562: AF251839 Homo sapiens vitronectin receptor alpha polypeptide (ITGAV) gene, exon 26 gi|9944842|gb|AF251839.1|F251818S22[9944842]

[4700] 7563: AF251838 Homo sapiens vitronectin receptor alpha polypeptide (ITGAV) gene, exon 25 gi|994484|gb|AF251838.1|F251818S21[9944841]

[4701] 7564: AF251837 Homo sapiens vitronectin receptor alpha polypeptide (ITGAV) gene, exons 23 and gi|9944840|gb|AF251837.1|F251818S20[9944840]

[4702] 7565: AF251836 Homo sapiens vitronectin receptor alpha polypeptide (ITGAV) gene, exon 22 gi|9944839|gb|AF251836.1|F251818S19[9944839]

[4703] 7566: AF251835 Homo sapiens vitronectin receptor alpha polypeptide (ITGAV) gene, exons 20 and gi|9944838|gb|AF251835.1|F251818S18[9944838]

[4704] 7567: AF251834 Homo sapiens vitronectin receptor alpha polypeptide (ITGAV) gene, exon 19 gi|9944837|gb|AF251834.1|F2511818S17[9944837]

[4705] 7568: AF251833 Homo sapiens vitronectin receptor alpha polypeptide (ITGAV) gene, exon 18 gi|9944836|gb|AF251833.1|F251818S16[9944836]

[4706] 7569: AF251832 Homo sapiens vitronectin receptor alpha polypeptide (ITGAV) gene, exon 17 gi|9944835|gb|AF251832.1|F251818S15[9944835]

[4707] 7570: AF251831 Homo sapiens vitronectin receptor alpha polypeptide (ITGAV) gene, exon 16 gi|9944834|gb|AF251831.1|F251818S14[9944834]

[4708] 7571: AF251830 Homo sapiens vitronectin receptor alpha polypeptide (ITGAV) gene, exon 15 gi|9944833|gb|AF251830.1|F251818S13[9944833]

[4709] 7572: AF251829 Homo sapiens vitronectin receptor alpha polypeptide (ITGAV) gene, exon 14 gi|9944832|gb|AF251829.1|F251818S12[9944832]

[4710] 7573: AF251828 Homo sapiens vitronectin receptor alpha polypeptide (ITGAV) gene, exon 13 gi|9944831|gb|AF251828.1|F251818S11[9944831]

[4711] 7574: AF251827 Homo sapiens vitronectin receptor alpha polypeptide (ITGAV) gene, exons 11 and gi|9944830|gb|AF251827.1|F251818S10[9944830]

[4712] 7575: AF251826 Homo sapiens vitronectin receptor alpha polypeptide (ITGAV) gene, exons 9 and gi|9944829|gb|AF251826.1|F251818S09[9944829]

[4713] 7576: AF251825 Homo sapiens vitronectin receptor alpha polypeptide (ITGAV) gene, exon 8 gi|9944828|gb|AF251B25.1|F251818S08[9944828]

[4714] 7577: AF251824 Homo sapiens vitronectin receptor alpha polypeptide (ITGAV) gene, exon 7 gi|9944827|gb|AF251824.1|F251818S07[9944827]

[4715] 7578: AF251823 Homo sapiens vitronectin receptor alpha polypeptide (ITGAV) gene, exon 6 gi|9944826|gb|AF251823.1|F251818S06[9944826]

[4716] 7579: AF251822 Homo sapiens vitronectin receptor alpha polypeptide (ITGAV) gene, exon 5 gi|9944825|gb|AF251822.1|F251818S05[9944825]

[4717] 7580: AF251821 Homo sapiens vitronectin receptor alpha polypeptide (ITGAV) gene, exon 4 gi|9944824|gb|AF251821.1|F251818S04[9944824]

[4718] 7581: AF251820 Homo sapiens vitronectin receptor alpha polypeptide (ITGAV) gene, exon 3 gi|9944823|gb|AF251820.1|F251818S03[9944823]

[4719] 7582: AF251819 Homo sapiens vitronectin receptor alpha polypeptide (ITGAV) gene, exon 2 gi|9944822|gb|AF251819.1|F251818S02[9944822]

[4720] 7583: AF251818 Homo sapiens vitronectin receptor alpha polypeptide (ITGAV) gene, promoter region and exon 1 gi|9944821|gb|AF251818.1|F251818S01[9944821]

[4721] 7584: AH009773 Homo sapiens vitronectin receptor alpha polypeptide (ITGAV) gene, complete cds gi|9944820|gb|AH009773.1|SEG_F251818S[9944820]

[4722] 7585: AF189768 Homo sapiens leukocyte immunoglobulin-like receptor 5 (LIR5) gene, complete cds gi|9930102|gb|AF189768.1|AF189768[9930102]

[4723] 7600: AJ245377 Homo sapiens mRNA for 2B4 NK receptor homologue (h2B4 gene) gi|9621661|emb|AJ245377.1|HSA245377[9621661]

[4724] 7601: X07206 H.sapiens TRGV10 gene, allele V10*A1 gi|1848182|emb|X07206.1|HSTRGV10[1848182]

[4725] 7603: AF246974 Homo sapiens toll-like receptor 9 (TLR9) mRNA, partial cds, alternatively spliced gi|9887086|gb|AF246974.1|AF246974[9887086]

[4726] 7604: AF246973 Homo sapiens toll-like receptor 9 (TLR9) mRNA, partial cds, alternatively spliced gi|9887084|gb|AF246973.1|AF246973[9887084]

[4727] 7605: AF246972 Homo sapiens toll-like receptor 9 (TLR9) mRNA, partial cds gi|9887082|gb|AF246972.1|AF246972[9887082]

[4728] 7606: AF215826 Homo sapiens killer-cell Ig-like receptor KIR2DL4v1 (KIR2DL4) gene, KIR2DL4v1 allele, exon 3 and partial cds gi|9886965|gb|AF215826.1|AF215826[9886965]

[4729] 7607: AF215825 Homo sapiens killer-cell Ig-like receptor KIR3DL1v (KIR3DL1) gene, KIR3DL1v allele, exon 3 and partial cds gi|9886963|gb|AF215825.1|AF215825[9886963]

[4730] 7608: AB008193 Homo sapiens genes for leukotriene B4 receptor BLT2, leukotriene B4 receptor BLT1, complete cds gi|9229835|dbj|AB008193.1|AB008193[9229835]

[4731] 7609: AB029892 Homo sapiens hBLT2 mRNA for Leukotriene B4 receptor BLT2, complete cds gi|9186899|dbj|AB029892.1|AB029892[9186899]

[4732] 7610: AF211978 Homo sapiens LENG11 mRNA, partial sequence gi|9885308|gb|AF211978.1|AF211978[9885308]

[4733] 7611: AF211977 Homo sapiens LENG10 mRNA, partial sequence gi|9885307|gb|AF211977.1|AF211977[9885307]

[4734] 7612: AF211976 Homo sapiens LENG9 mRNA, partial sequence gi|9885306|gb|AF211976.1|AF211976[9885306]

[4735] 7613: AF211975 Homo sapiens LENG8 mRNA, variant C, partial sequence gi|9885305|gb|AF211975.1|AF211975[9885305]

[4736] 7614: AF211974 Homo sapiens LENG8 mRNA, variant B, partial sequence gi|9885304|gb|AF211974.1|AF211974 [9885304]

[4737] 7615: AF211973 Homo sapiens LENG8 mRNA, variant A, partial sequence gi|9885303|gb|AF211973.1|AF211973[9885303]

[4738] 7616: AF211972 Homo sapiens LENG7 mRNA, partial sequence gi|9885302|gb|AF211972.1|AF211972[9885302]

[4739] 7617: AF211971 Homo sapiens LENG6 mRNA, partial sequence gi|9885301|gb|AF211971.1|AF211971[9885301]

[4740] 7618: AF211970 Homo sapiens LENG5 mRNA, partial sequence gi|9885300|gb|AF211970.1|AF211970[9885300]

[4741] 7619: AF211969 Homo sapiens LENG4 mRNA, partial sequence gi|9885299|gb|AF211969.1|AF211969[9885299]

[4742] 7620: AF211968 Homo sapiens LENG3 mRNA, partial sequence gi|9885298|gb|AF211968.1|AF211968[9885298]

[4743] 7621: AF211967 Homo sapiens LENG2 mRNA, partial sequence gi|9885297|gb|AF211967.1|AF211967[9885297]

[4744] 7622: AF211966 Homo sapiens LENG1 protein (LENG1) mRNA, partial cds gi|9885295|gb|AF211966.1|AF211966[9885295]

[4745] 7624: AF262016 Homo sapiens adrenergic receptor alpha-2A gene, complete cds gi|9864781|gb|AF262016.2|AF262016[9864781]

[4746] 7626: AF242865 Homo sapiens coxsackie virus and adenovirus receptor (CXADR) gene, exon 7 and complete cds gi|9858570|gb|AF242865.1|AF242862S4[9858570]

[4747] 7627: AF242864 Homo sapiens coxsackie virus and adenovirus receptor (CXADR) gene, exons 2 through 6 gi|9858569|gb|AF242864.1|AF242862S3[9858569]

[4748] 7629: AF242862 Homo sapiens coxsackie virus and adenovirus receptor (CXADR) gene, exon 1 gi|9858567|gb|AF242862.1|AF242862S1[9858567]

[4749] 7630: AH009718 Homo sapiens coxsackie virus and adenovirus receptor (CXADR) gene, complete cds gi|9858566|gb|AH009718.1|SEG_AF242862S[9858566]

[4750] 7631: AF257210 Homo sapiens G-protein coupled receptor HLWAR77 mRNA, complete cds gi|9309468|gb|AF257210.1|AF257210[9309468]

[4751] 7632: AF292403 Homo sapiens type B natriuretic peptide receptor gene, promoter region and partial cds gi|9858187|gb|AF292403.1|AF292403[9858187]

[4752] 7633: AF288571 Homo sapiens lymphoid enhancer factor-1 (LEF1) mRNA, complete cds gi|9858157|gb|AF288571.1|AF288571[9858157]

[4753] 7634: AF146747 Homo sapiens cell surface receptor (PRV1) mRNA, complete cds gi|9857660|gb|AF146747.1|AF146747[9857660]

[4754] 7862: AF233092 Homo sapiens lysophosphatidic acid G protein-coupled receptor 4 (EDG4) mRNA, complete cds gi|7243675|gb|AF233092.1|AF233092[7243675]

[4755] 7863: AF269144 Homo sapiens GABAA receptor gamma 3 subunit (GABRG3) gene, exon 10 and complete cds gi|9802369|gb|AF269144.1|F269135S10[9802369]

[4756] 7864: AF269143 Homo sapiens GABAA receptor gamma 3 subunit (GABRG3) gene, exon 9 gi|9802368|gb|AF269143.1|F269135S09[9802368]

[4757] 7865: AF269142 Homo sapiens GABAA receptor gamma 3 subunit (GABRG3) gene, exon 8 gi|9802367|gb|AF269142.1|F269135S08[9802367]

[4758] 7866: AF269141 Homo sapiens GABAA receptor gamma 3 subunit (GABRG3) gene, exon 7 gi|9802366|gb|AF269141.1.1|F269135S07[9802366]

[4759] 7867: AF269140 Homo sapiens GABAA receptor gamma 3 subunit (GABRG3) gene, exon 6 gi|9802365|gb|AF269140.1|F269135S06[9802365]

[4760] 7868: AF269139 Homo sapiens GABAA receptor gamma 3 subunit (GABRG3) gene, exon 5 gi|9802364|gb|AF269139.1|F269135S05[9802364]

[4761] 7869: AF269138 Homo sapiens GABAA receptor gamma 3 subunit (GABRG3) gene, exon 4 gi|9802363|gb|AF269138.1|F269135S04[9802363]

[4762] 7870: AF269137 Homo sapiens GABAA receptor gamma 3 subunit (GABRG3) gene, exon 3 gi|9802362|gb|AF269137.1|F269135S03[9802362]

[4763] 7871: AF269136 Homo sapiens GABAA receptor gamma 3 subunit (GABRG3) gene, exon 2 gi|980236|gb|AF269136.1|F269135S02[9802361]

[4764] 7872: AF269135 Homo sapiens GABAA receptor gamma 3 subunit (GABRG3) gene, exon 1 gi|9802360|gb|AF269135.1|F269135S01[9802360]

[4765] 7873: AH009710 Homo sapiens GABAA receptor gamma 3 subunit (GABRG3) gene, complete cds gi|9802359|gb|AH009710.1|SEG_F269135S[9802359]

[4766] 7874: AF211942 Homo sapiens haplotype 1089 olfactory receptor (OR2H3) gene, partial cds gi|9798923|gb|AF211942.1|AF211942[9798923]

[4767] 7875: AF211941 Homo sapiens haplotype 1037 olfactory receptor (OR2H3) gene, partial cds gi|9798921|gb|AF211941.1|AF211941[9798921]

[4768] 7876: AF211940 Homo sapiens haplotype 1012 olfactory receptor (OR2H3) gene, partial cds gi|9798919|gb|AF211940.1|AF211940[9798919]

[4769] 7877: AF211939 Homo sapiens haplotype 1013 olfactory receptor (OR2H3) gene, partial cds gi|9798917|gb|AF211939.1|AF211939[9798917]

[4770] 7878: AJ272029 Homo sapiens partial CD30 gene for cytokine receptor CD30 and promoter region gi|9798449|emb|AJ272029.1|HSA272029[9798449]

[4771] 7880: AF101726 Homo sapiens vasopressin receptor subtype 1b mRNA, complete cds gi|4336681|gb|AF101726.1|AF101726[4336681]

[4772] 7881: AF101725 Homo sapiens vasopressin receptor subtype 1a mRNA, complete cds gi|4336679|gb|AF101725.1|AF101725[4336679]

[4773] 7882: AF101728 Homo sapiens truncated vasopressin receptor type 2 mRNA, complete cds gi|4323606|gb|AF101728.1|AF101728[4323606]

[4774] 7883: AF101727 Homo sapiens vasopressin receptor type 2 mRNA, complete cds gi|4323604|gb|AF101727.1|AF101727[4323604]

[4775] 7884: AF064078 Homo sapiens insulin receptor-related receptor (INSRR) mRNA, partial cds gi|3152883|gb|AF064078.1|AF064078[3152883]

[4776] 7885: S82307 Homo sapiens p65 mRNA, partial cds gi|1839613|gb|S82307.1|S82307[1839613]

[4777] 7886: S83176 Homo sapiens calcium-sensing receptor long isoform (CASR) mRNA, partial cds gi|1836093|gb|S83176.1|S83176[1836093]

[4778] 7887: S82755 Homo sapiens T cell receptor mRNA, partial cds gi|1835845|gb|S82755.1S82755[1835845]

[4779] 7888: S82612 Homo sapiens 5-hydroxytryptamine type 3AS receptor subunit mRNA, complete cds gi|1699437|gb|S82612.1|S82612[1699437]

[4780] 7891: AF238374 Homo sapiens mutant fibroblast growth factor receptor 3 (FGFR3) mRNA, partial cds gi|9719331|gb|AF238374.1|AF238374[9719331]

[4781] 7894: AJ400843 Homo sapiens partial mRNA for immunoglobulin-like cell surface receptor FDF03-M14, soluble alternative form gi|9715838|emb|AJ400843.1|HSA400843[9715838]

[4782] 7895: AJ400842 Homo sapiens partial mRNA for immunoglobulin-like cell surface receptor FDF03-dtm, soluble form gi|9715835|emb|AJ400842.1|HSA400842[9715835]

[4783] 7896: AJ400841 Homo sapiens mRNA for immunoglobulin-like cell surface receptor FDF03 gi|9715833|emb|AJ400841.1|HSA400841[9715833]

[4784] 8061: AJ005205 Homo sapiens 5HT3 gene for serotonin 3 receptor gi|7019744|emb|AJ005205.2|HSA005205[7019744]

[4785] 8062: AB038269 Homo sapiens mRNA for cysteinyl leukotriene CysLT2 receptor, complete cds; cDNA: PSEC0146 from clone PLACE1006979 gi|9663957|dbj|AB038269.1|AB038269[9663957]

[4786] 8063: AJ278476 Homo sapiens partial mRNA for transport-secretion protein 2.2, (TTS-2.2 gene) gi|9663152|emb|AJ278476.1|HSA278476[9663152]

[4787] 8064: AJ278475 Homo sapiens partial mRNA for transport-secretion protein 2.1 (TTS-2.1 gene) gi|9663150|emb|AJ278475.1|HSA278475[9663150]

[4788] 8065: AF282693 Homo sapiens inflammation-related G protein-coupled receptor EX33 (EX33) mRNA, complete cds gi|9652260|gb|AF282693.1|AF282693[9652260]

[4789] 8066: AF254409 Homo sapiens scavenger receptor class B type III SR-BIII mRNA, partial cds gi|9651987|gb|AF254409.1|AF254409[9651987]

[4790] 8067: AF236117 Homo sapiens G-protein coupled receptor EDG-7 mRNA, complete cds gi|9651838|gb|AF236117.1|AF236117[9651838]

[4791] 8068: AF287008 Homo sapiens triggering receptor expressed on monocytes 1 (TREML) mRNA, complete cds gi|9624485|gb|AF287008.1|AF287008[9624485]

[4792] 8069: AF172171 Homo sapiens toll-like receptor 4 (TLR4) gene, exon 4 and complete cds gi|9622356|gb|AF172171.1|HSTLR3[9622356]

[4793] 8070: AF172170 Homo sapiens toll-like receptor 4 (TLR4) gene, exons 2 and 3 gi|9622355|gb|AF172170.1|HSTLR2[9622355]

[4794] 8071: AF172169 Homo sapiens toll-like receptor 4 (TLR4) gene, exon 1 gi|9622354|gb|AF172169.1|HSTLR1[9622354]

[4795] 8072: AH009665 Homo sapiens toll-like receptor 4 (TLR4) gene, complete cds gi|9622353|gb|AH009665.1|SEG_HSTLR[9622353]

[4796] 8073: AF165312 Homo sapiens pre-T-cell receptor alpha chain (PTA) mRNA, alternatively spliced, complete cds gi|9621867|gb|AF165312.1|AF165312[9621867]

[4797] 8074: AJ245375 Homo sapiens mRNA for PP35 act (h2B4 gene) gi|9621657|emb|AJ245375.1|HSA245375[9621657]

[4798] 8075: AF277230 Homo sapiens seven transmembrane receptor BLTR2 (BLTR2) mRNA, complete cds gi|8896158|gb|AF277230.1|AF277230[8896158]

[4799] 8076: AF114491 Homo sapiens EGF-like module EMR2 (EMR2) mRNA, complete cds gi|6650688|gb|AF114491.1|AF114491[6650688]

[4800] 8077: AF107259 Homo sapiens chromosome 21q22.1 cosmid clone ICRFcA0552D2, complete sequence, containing part of the glutamate receptor gene GLUR5 gi|4154320|gb|AF107259.1|AF107259[4154320]

[4801] 8078: AF107257 Homo sapiens chromosome 21q22.1 PAC L12209, complete sequence gi|4106881|gb|AF107257.1|AF107257[4106881]

[4802] 8079: AZ081535 p133B6#4 RPCI-6 Homo sapiens genomic, genomic survey sequence gi|9587541|gb|AZ081535.1|AZ081535[9587541]

[4803] 8081: AF285168 Homo sapiens GABA-A receptor beta 1 subunit (GABRB1) gene, promoter and partial cds gi|9502261|gb|AF285168.1|AF285168[9502261]

[4804] 8126: AC018755 Homo sapiens chromosome 19, BAC BC330783 (CIT-HSPC—470E3), complete sequence gi|9454515|gb|AC018755.3|AC018755[9454515]

[4805] 8159: AF246303 Homo sapiens peroxisome proliferative activated receptor delta (PPARD) gene, exon 9 and complete cds gi|7417394|gb|AF246303.1|AF246296S8[7417394]

[4806] 8160: AF246302 Homo sapiens peroxisome proliferative activated receptor delta (PPARD) gene, exons 7 and 8 gi|7417393|gb|AF246302.1|AF246296S7[7417393]

[4807] 8161: AF246301 Homo sapiens peroxisome proliferative activated receptor delta (PPARD) gene, exon 6 gi|7417392|gb|AF246301.1|AF246296S6[7417392]

[4808] 8162: AF246300 Homo sapiens peroxisome proliferative activated receptor delta (PPARD) gene, exon 5 gi|7417391|gb|AF246300.1|AF246296S5[7417391]

[4809] 8163: AF246299 Homo sapiens peroxisome proliferative activated receptor delta (PPARD) gene, exon 4 gi|7417390|gb|AF246299.1|AF246296S4[7417390]

[4810] 8164: AF246298 Homo sapiens peroxisome proliferative activated receptor delta (PPARD) gene, exon 3 gi|7417389|gb|AF246298.1|AF246296S3[7417389]

[4811] 8165: AF246297 Homo sapiens peroxisome proliferative activated receptor delta (PPARD) gene, exon 2 gi|7417388|gb|AF246297.1|AF246296S2[7417388]

[4812] 8166: AF246296 Homo sapiens peroxisome proliferative activated receptor delta (PPARD) gene, promoter and exon 1 gi|7417387|gb|AF246296.1|AF246296S1[7417387]

[4813] 8167: AH009223 Homo sapiens peroxisome proliferative activated receptor delta (PPARD) gene, complete cds gi|7417386|gb|AH009223.1|SEG_AF246296S[7417386]

[4814] 8168: U94888 Homo sapiens CC-chemokine-binding receptor JAB61 mRNA, complete cds gi|2213808|gb|U94888.1|HSU94888[2213808]

[4815] 8169: AB040434 Homo sapiens mRNA for hTROY, complete cds gi|9392329|dbj|AB040434.1|AB040434[9392329]

[4816] 8170: AJ272427 Homo sapiens mRNA for frizzled homolog 3 (FZD3 gene) gi|7649448|emb|AJ272427.1|HSA272427[7649448]

[4817] 8173: U88356 Homo sapiens receptor tyrosine kinase ErbB-3 (c-erbB-3) gene, exons 12, 13, 14, and partial cds gi|9294704|gb|U88356.1|HSCERBR3[9294704]

[4818] 8174: U88355 Homo sapiens receptor tyrosine kinase ErbB-3 (c-erbB-3) gene, exon 10 and partial cds gi|9294703|gb|U88355.1|HSCERBR2[9294703]

[4819] 8175: U88354 Homo sapiens receptor tyrosine kinase ErbB-3 (c-erbB-3) gene, exons 8 and 9 gi|9294702|gb|U88354.1|HSCERBR1[9294702]

[4820] 8176: AB037533 Homo sapiens HTR1F gene for 5-hydroxytryptamine (serotonin) receptor 1F, partial cds gi|6815236|dbj|AB037533.1|AB037533[6815236]

[4821] 8177: AB037513 Homo sapiens HTR2A gene for 5-hydroxytryptamine (serotonin) receptor 2A, partial cds gi|6815196|dbj |AB037513.1|AB037513[6815196]

[4822] 8178: AF180301 Homo sapiens corticotropin-releasing factor receptor variant 1d (CRHR1) mRNA, alternative splice product, complete cds gi|5815472|gb|AF180301.1|AF180301[5815472]

[4823] 8181: AF208111 Homo sapiens truncated IL-17 receptor homolog precursor (EVI27) mRNA, complete cds gi|9246434|gb|AF208111.1|AF208111[9246434]

[4824] 8182: AF208110 Homo sapiens IL-17 receptor homolog precursor (EVI27) mRNA, complete cds gi|9246432|gb|AF208110.1|AF208110[9246432]

[4825] 8183: M15222 Homo sapiens T-cell receptor (TCRB) mRNA, partial cds gi|338893|gb|M15222.1|HUMTCBVO[338893]

[4826] 8189: AF263279 Homo sapiens CD164 mRNA, complete cds gi|9230740|gb|AF263279.1|AF263279[9230740]

[4827] 8192: AF242874 Homo sapiens neuromedin U receptor 2 (NMU2R) mRNA, complete cds gi|9082155|gb|AF242874.1|AF242874[9082155]

[4828] 8193: AF160477 Homo sapiens Ig superfamily receptor LNIR precursor, mRNA, complete cds gi|9049507|gb|AF160477.1|AF160477[9049507]

[4829] 8194: AF058290 Homo sapiens imidazoline receptor antisera-selected protein mRNA, partial cds gi|3493224|gb|AF058290.1|AF058290[3493224]

[4830] 8195: AF082516 Homo sapiens I-1 receptor candidate protein mRNA, complete cds gi|3462806|gb|AF082516.1|AF082516[3462806]

[4831] 8211: X06031 Homo sapiens partial T-cell receptor CD3-gamma gene, exon 6 gi|36818|emb|X06031.1|HSTCR3G6[36818]

[4832] 8212: X06030 Homo sapiens partial T-cell receptor CD3-gamma gene, exon 5 gi|36816|emb|X06030.1|HSTCR3G5[36816]

[4833] 8213: X06029 Homo sapiens partial T-cell receptor CD3-gamma gene exon 4 gi|36814|emb|X06029.1|HSTCR3G4[36814]

[4834] 8214: X06027 Homo sapiens partial CD3G gene, exon 2 (and joined mature peptide) gi|36811|emb|X06027.1|HSTCR3G2[36811]

[4835] 8216: Z30426 H.sapiens gene for early lymphocyte activation antigen CD69, exon 1 gi|525242|emb|Z30426.1|HSLACD691[525242]

[4836] 8302: AJ278605 Homo sapiens BLT-2R gene for leukotriene B4 receptor 2 gi|8919627|emb|AJ278605.1|HSA278605[8919627]

[4837] 8444: AF246925 Homo sapiens haplotype 28 CC chemokine receptor 5 (CCR5) gene, partial sequence gi|8809841|gb|AF246925.1|AF246925[8809841]

[4838] 8445: AF246924 Homo sapiens haplotype 27 CC chemokine receptor 5 (CCR5) gene, partial sequence gi|8809840|gb|AF246924.1|AF246924[8809840]

[4839] 8446: AF246923 Homo sapiens haplotype 26 CC chemokine receptor 5 (CCR5) gene, partial sequence gi|8809839|gb|AF246923.1|AF246923[8809839]

[4840] 8447: AF246922 Homo sapiens haplotype 24 CC chemokine receptor 5 (CCR5) gene, partial sequence gi|8809838|gb|AF246922.1|AF246922[8809838]

[4841] 8448: AF246921 Homo sapiens haplotype 23 CC chemokine receptor 5 (CCR5) gene, partial sequence gi|8809837|gb|AF246921.1|AF246921[8809837]

[4842] 8449: AF246920 Homo sapiens haplotype 22 CC chemokine receptor 5 (CCR5) gene, partial sequence gi|8809836|gb|AF246920.1|AF246920[8809836]

[4843] 8450: AF246919 Homo sapiens haplotype 21 CC chemokine receptor 5 (CCR5) gene, partial sequence gi|8809835|gb|AF246919.1|AF246919[8809835]

[4844] 8451: AF246918 Homo sapiens haplotype 20 CC chemokine receptor 5 (CCR5) gene, partial sequence gi|8809834|gb|AF246918.1|AF246918[8809834]

[4845] 8452: AF246917 Homo sapiens haplotype 19 CC chemokine receptor 5 (CCR5) gene, partial sequence gi|8809833|gb|AF246917.1|AF246917[8809833]

[4846] 8453: AF246916 Homo sapiens haplotype 18 CC chemokine receptor 5 (CCR5) gene, partial sequence gi|8809832|gb|AF246916.1|AF246916[8809832]

[4847] 8454: AF246915 Homo sapiens haplotype 17 CC chemokine receptor 5 (CCR5) gene, partial sequence gi|880983|gb|AF246915.1|AF246915[8809831]

[4848] 8455: AF246914 Homo sapiens haplotype 16 CC chemokine receptor 5 (CCR5) gene, partial sequence gi|8809830|gb|AF246914.1|AF246914[8809830]

[4849] 8456: AF246913 Homo sapiens haplotype 15 CC chemokine receptor 5 (CCR5) gene, partial sequence gi|8809829|gb|AF246913.1|AF246913[8809829]

[4850] 8457: AF246912 Homo sapiens haplotype 14 CC chemokine receptor 5 (CCR5) gene, partial sequence gi|8809828|gb|AF24692.12|AF246912[8809828]

[4851] 8458: AF246911 Homo sapiens haplotype 13 CC chemokine receptor 5 (CCR5) gene, partial sequence gi|8809827|gb|AF246911.1|AF246911[8809827]

[4852] 8459: AF246910 Homo sapiens haplotype 12 CC chemokine receptor 5 (CCR5) gene, partial sequence gi|8809826|gb|AF246910.1|AF246910[8809826]

[4853] 8460: AF246909 Homo sapiens haplotype 11 CC chemokine receptor 5 (CCRS) gene, partial sequence gi|8809825|gb|AF246909.1|AF246909[8809825]

[4854] 8461: AF246908 Homo sapiens haplotype 10 CC chemokine receptor 5 (CCR5) gene, partial sequence gi|8809824|gb|AF246908.1|AF246908[8809824]

[4855] 8462: AF246907 Homo sapiens haplotype 9 CC chemokine receptor 5 (CCR5) gene, partial sequence gi|8809823|gb|AF246907.1|AF246907[8809823]

[4856] 8463: AF246906 Homo sapiens haplotype 8 CC chemokine receptor 5 (CCR5) gene, partial sequence gi|8809822|gb|AF246906.1|AF246906[8809822]

[4857] 8464: AF246905 Homo sapiens haplotype 7 CC chemokine receptor 5 (CCR5) gene, partial sequence gi|8809821|gb|AF246905.1|AF246905[8809821]

[4858] 8465: AF246904 Homo sapiens haplotype 6 CC chemokine receptor 5 (CCR5) gene, partial sequence gi|8809820|gb|AF246904.1|AF246904[8809820]

[4859] 8466: AF246903 Homo sapiens haplotype 5 CC chemokine receptor 5 (CCR5) gene, partial sequence gi|8809819|gb|AF246903.1|AF246903[8809819]

[4860] 8467: AF246902 Homo sapiens haplotype 4 CC chemokine receptor 5 (CCR5) gene, partial sequence gi|8809818|gb|AF246902.1|AF246902[8809818]

[4861] 8468: AF246901 Homo sapiens haplotype 1 CC chemokine receptor 5 (CCR5) gene, partial sequence gi|8809817|gb|AF246901.1|AF246901[8809817]

[4862] 8469: AF246900 Homo sapiens haplotype 2 CC chemokine receptor 5 (CCR5) gene, partial sequence gi|8809816|gb|AF246900.1|AF246900[8809816]

[4863] 8470: AF246899 Homo sapiens haplotype 3 CC chemokine receptor 5 (CCR5) gene, partial sequence gi|8809815|gb|AF246899.1|AF246899[8809815]

[4864] 8471: AF210633 Homo sapiens growth hormone receptor (GHR) gene, GHR-d3 allele, partial sequence gi|8809760|gb|AF210633.1|AF210633[8809760]

[4865] 8472: M22057 Homo sapiens T-cell receptor epsilon (CD3E) gene, exon 5 and partial cds gi|339220|gb|M22057.1|HUMTCR3E[339220]

[4866] 8476: AF212311 Homo sapiens interleukin 20 (IL20) mRNA, complete cds gi|8705219|gb|AF212311.1|AF212311[8705219]

[4867] 8477: AF141334 Homo sapiens placenta apolipoprotein B48 receptor type 2 (APOB48R) mRNA, complete cds gi|8699629|gb|AF141334.1|AF141334[8699629]

[4868] 8478: AF277379 Homo sapiens vitamin D receptor-interacting protein complex component DRIP100 (DRIP100) mRNA, complete cds gi|8699627|gb|AF277379.1|AF277379[8699627]

[4869] 8480: AJ251962 Homo sapiens partial TGF-beta III receptor gene gi|6634455|emb|AJ251962.1|HSA251962[6634455]

[4870] 8481: AJ251961 Homo sapiens partial mRNA for betaglycan (TBR III gene) gi|6634453|emb|AJ251961.1|HSA251961[6634453]

[4871] 8483: AF062039 Homo sapiens integrin alpha-2 subunit (ITGA2) gene, ITGA2-1 allele, partial cds gi|8574452|gb|AF062039.1|AF062039[8574452]

[4872] 8485: AF141333 Homo sapiens apolipoprotein B48 receptor (APOB48R) gene, complete cds gi|8547065|gb|AF141333.1|AF141333[8547065]

[4873] 8486: AF141332 Homo sapiens apolipoprotein B48 receptor (APOB48R) mRNA, complete cds gi|8547063|gb|AF141332.1|AF141332[8547063]

[4874] 8488: X56253 Homo sapiens partial MPR46 gene for 46 kd mannose 6-phosphate receptor, exon 1 and join mRNA gi|34727|emb|X56253.1|HSMPR461[34727]

[4875] 8489: AF155912 Homo sapiens growth hormone receptor (GHR) gene, exon 3 and partial cds gi|8037572|gb|AF155912.1|AF155912[8037572]

[4876] 8490: AF263744 Homo sapiens erbb2-interacting protein ERBIN mRNA, complete cds gi|8572220|gb|AF263744.1|AF263744[8572220]

[4877] 8501: X56254 Homo sapiens partial MPR46 gene for 46 kd mannose 6-phosphate receptor, exon 2 join CDS gi|34729|emb|X56254.1|HSMPR462[34729]

[4878] 8503: AB040801 Homo sapiens mRNA for SREB3, complete cds gi|8467969|dbj|AB040801.1|AB040801[8467969]

[4879] 8504: AB040800 Homo sapiens mRNA for SREB2, complete cds gi|8467967|dbj|AB040800.1|AB040800[8467967]

[4880] 8505: AB040799 Homo sapiens mRNA for SREB1, complete cds gi|8467965|dbj|AB040799.1|AB040799[8467965]

[4881] 8506: AF187064 Homo sapiens p75NTR-associated cell death executor (NADE) mRNA, complete cds gi|8452893|gb|AF187064.1|AF187064[8452893]

[4882] 8507: AF045606 Homo sapiens C21 orf4 mRNA, complete cds gi|8277249|gb|AF045606.2|AF045606[8277249]

[4883] 8508: AF204920 Homo sapiens killer cell Ig-like receptor (KIR48) gene, KIR48b variant, exon gi|8248132|gb|AF204920.1|AF204918S3[8248132]

[4884] 8509: AF204919 Homo sapiens killer cell Ig-like receptor (KIR48) gene, KIR48b variant, exon gi|824813|gb|AF204919.1|AF204918S2[8248131]

[4885] 8510: AF204918 Homo sapiens killer cell Ig-like receptor (KIR48) gene, KIR48b variant, exons and 3 gi|8248130|gb|AF204918.1|AF204918S1[8248130]

[4886] 8511: AH009422 Homo sapiens gi|8248129|gb|AH009422.1|SEG_AF204918S[8248129]

[4887] 8512: AF204917 Homo sapiens killer cell Ig-like receptor (KIR48) gene, KIR48a variant, exon gi|8248128|gb|AF204917.1|AF204915S3[8248128]

[4888] 8513: AF204916 Homo sapiens killer cell Ig-like receptor (KIR48) gene, KIR48a variant, exon gi|8248127|gb|AF204916.1|AF204915S2[8248127]

[4889] 8514: AF204915 Homo sapiens killer cell Ig-like receptor (KIR48) gene, KIR48a variant, exons and 3 gi|8248126|gb|AF204915.1|AF204915S1[8248126]

[4890] 8515: AH009421 Homo sapiens gi|8248125|gb|AH009421.1|SEG_AF204915S[8248125]

[4891] 8516: AF204914 Homo sapiens killer cell Ig-like receptor (KIR44) gene, KIR44b variant, exon gi|8248124|gb|AF204914.1|AF204912S3[8248124]

[4892] 8517: AF204913 Homo sapiens killer cell Ig-like receptor (KIR44) gene, KIR44b variant, exon gi|8248123|gb|AF204913.1|AF204912S2[8248123]

[4893] 8518: AF204912 Homo sapiens killer cell Ig-like receptor (KIR44) gene, KIR44b variant, exons and 3 gi|8248122|gb|AF204912.1|AF204912S1[8248122]

[4894] 8519: AH009420 Homo sapiens gi|8248121|gb|AH009420.1|SEG_AF204912S[8248121]

[4895] 8520: AF204911 Homo sapiens killer cell Ig-like receptor (KIR44) gene, KIR44a variant, exon gi|8248120|gb|AF204911.1|AF204909S3[8248120]

[4896] 8521: AF204910 Homo sapiens killer cell Ig-like receptor (KIR44) gene, KIR44a variant, exon gi|8248119|gb|AF204910.1|AF204909S2[8248119]

[4897] 8522: AF204909 Homo sapiens killer cell Ig-like receptor (KIR44) gene, KIR44a variant, exons and 3 gi|8248118|gb|AF204909.1|AF204909S1[8248118]

[4898] 8523: AH009419 Homo sapiens gi|8248117|gb|AH009419.1|SEG_AF204909S[8248117]

[4899] 8524: AF204905 Homo sapiens killer cell Ig-like receptor (KIR2DL5) gene, KIR2DL5.2 variant, partial sequence gi|8248112|gb|AF204905.1|AF204905[8248112]

[4900] 8525: AF204904 Homo sapiens killer cell Ig-like receptor (KIR2DL5) gene, KIR2DL5.1 variant, partial cds gi|8248110|gb|AF204904.1|AF204904[8248110]

[4901] 8607: AF212842 Homo sapiens immunoglobulin-like transcript 11 protein (ILT11) mRNA, partial cds gi|8163785|gb|AF212842.1|AF212842[8163785]

[4902] 8608: AF208237 Homo sapiens 7-transmembrane G-protein coupled receptor 2 (GPR2) mRNA, complete cds gi|8118034|gb|AF208237.1|AF208237[8118034]

[4903] 8609: AF204903 Homo sapiens killer-cell immunoglobulin-like receptor KIR2DL5.1 (KIR2DL5) mRNA, complete cds gi|8117976|gb|AF204903.1|AF204903[8117976]

[4904] 8610: AP001716 Homo sapiens genomic DNA, chromosome 21q, section 60/105 gi|7768717|dbj|AP001716.1|AP001716[7768717]

[4905] 8611: AP001705 Homo sapiens genomic DNA, chromosome 21q, section 49/105 gi|7768711|dbj|AP001705.1|AP001705[7768711]

[4906] 8612: AP001670 Homo sapiens genomic DNA, chromosome 21q, section 14/105 gi|7768690|dbj|AP001670.1|AP001670[7768690]

[4907] 8613: AP001717 Homo sapiens genomic DNA, chromosome 21q, section 61/105 gi|7768678|dbj|AP001717.1|AP001717[7768678]

[4908] 8616: AJ012074 Homo sapiens VPAC1 receptor gene, 5′ end and promoter region gi|3758828|emb|AJ012074.1|HSA012074[3758828]

[4909] 8617: AF039906 Homo sapiens cosmid D16B8, chromosome 21 3′ of IFNGR2 gi|2914756|gb|AF039906.1|AF039906[2914756]

[4910] 8619: S77335 Homo sapiens growth hormone receptor gene, partial cds gi|999143|gb|S77335.1|S77335[999143]

[4911] 8621: S75765 Homo sapiens delta CCK-B gene, partial cds gi|913754|gb|S75765.1|S75765[913754]

[4912] 8624: S78717 Homo sapiens ryanodine receptor (RYR1) gene, partial cds gi|244183|gb|S78717.1|S78717[244183]

[4913] 8625: X15266 Homo sapiens gene for muscarinic acetylcholine receptor HM3 gi|32323|emb|X15266.1|HSACM3[32323]

[4914] 8626: X15265 Homo sapiens gene for muscarinic acetylcholine receptor M4 gi|32321|emb|X15265.1|HSACM4[32321]

[4915] 8627: AF220542 Homo sapiens FcRN protein gene, complete cds gi|8101614|gb|AF220542.1|AF220542[8101614]

[4916] 8629: AF073924 Homo sapiens putative taste receptor HTR2 mRNA, partial cds gi|8100088|gb|AF073924.1|AF073924[8100088]

[4917] 8630: D88437 Homo sapiens mRNA for G-protein coupled receptor SALPR, complete cds gi|7340885|dbj|D88437.1|D88437[7340885]

[4918] 8631: AB032369 Homo sapiens MIST mRNA, partial cds gi|8099156|dbj|AB032369.1|AB032369[8099156]

[4919] 8632: AF167555 Homo sapiens TAJ-alpha mRNA, complete cds gi|8071643|gb|AF167555.1|AF167555[8071643]

[4920] 8633: AF002982 Homo sapiens killer cell receptor (KIR103) mRNA, allele ASD2, complete cds gi|2443483|gb|AF002982.1|AF002982[2443483]

[4921] 8634: AF002981 Homo sapiens killer cell receptor (KIR103) mRNA, allele ASD1, complete cds gi|2443481|gb|AF002981.1|AF002981[2443481]

[4922] 8635: AF002980 Homo sapiens killer cell receptor (KIR103) mRNA, allele AS, complete cds gi|2443479|gb|AF002980.1|AF002980[2443479]

[4923] 8636: AF002979 Homo sapiens killer cell receptor (KIR103) mRNA, allele LP, complete cds gi|2443477|gb|AF002979.1|AF002979[2443477]

[4924] 8637: AH005453 Homo sapiens chromosome 19 clone 4 map 19q13.4 gi|2228790|gb|AH005453.1|SEG_HSKIR[2228790]

[4925] 8638: AF003123 Homo sapiens killer cell inhibitory receptor (KIR-103AS) gene, exon 8 and complete cds gi|2228789|gb|AF003123.1|HSKIR8[2228789]

[4926] 8639: AF003122 Homo sapiens killer cell inhibitory receptor (KIR-103AS) gene, exon 7 gi|2228788|gb|AF003122.1|HSKIR7[2228788]

[4927] 8640: AF003121 Homo sapiens killer cell inhibitory receptor (KIR-103AS) gene, exon 6 gi|2228787|gb|AF003121.1|HSKIR6[2228787]

[4928] 8641: AF003120 Homo sapiens killer cell inhibitory receptor (KIR-103AS) gene, exon 5 gi|2228786|gb|AF003120.1|HSKIR5[2228786]

[4929] 8642: AF003119 Homo sapiens killer cell inhibitory receptor (KIR-103AS) gene, exon 4 gi|2228785|gb|AF003119.1|HSKIR4[2228785]

[4930] 8643: AF003118 Homo sapiens killer cell inhibitory receptor (KIR-103AS) gene, exon 3 gi|2228784|gb|AF003118.1|HSKIR3[2228784]

[4931] 8644: AF003117 Homo sapiens killer cell inhibitory receptor (KIR-103AS) gene, exon 2 gi|2228783|gb|AF003117.1|HSKIR2[2228783]

[4932] 8645: AF003116 Homo sapiens killer cell inhibitory receptor (KIR-103AS) gene, exon 1 gi|2228782|gb|AF003116.1|HSKIR1[2228782]

[4933] 8646: AF196329 Homo sapiens triggering receptor expressed on monocytes 1 mRNA, complete cds gi|8050526|gb|AF196329.1|AF196329[8050526]

[4934] 8647: AF167342 Homo sapiens membrane interleukin 1 receptor accessory protein (IL1RAP) gene, exon 12 and complete cds, alternatively spliced gi|8050498|gb|AF167342.1F167333S10[8050498]

[4935] 8648: AF167341 Homo sapiens membrane interleukin 1 receptor accessory protein (IL1RAP) gene, exons 10 and 11 gi|8050497|gb|AF167341.1|F167333S09[8050497]

[4936] 8649: AF167340 Homo sapiens soluble interleukin 1 receptor accessory protein (IL1RAP) gene, exon 8, alternative exons 9 and complete cds, alternatively spliced gi|8050496|gb|AF167340.1|F167333S08[8050496]

[4937] 8650: AF167339 Homo sapiens interleukin 1 receptor accessory protein (IL1RAP) gene, exon 7 gi|8050495|gb|AF167339.1|F167333S07[8050495]

[4938] 8651: AF167338 Homo sapiens interleukin 1 receptor accessory protein (IL1RAP) gene, exon 6 gi|8050494|gb|AF167338.1|F167333S06[8050494]

[4939] 8652: AF167337 Homo sapiens interleukin 1 receptor accessory protein (IL1RAP) gene, exon 5 gi|8050493|gb|AF167337.1|F167333S05[8050493]

[4940] 8653: AF167336 Homo sapiens interleukin 1 receptor accessory protein (IL1RAP) gene, exon 4 gi|8050492|gb|AF167336.1|F167333S04[8050492]

[4941] 8654: AF167335 Homo sapiens interleukin 1 receptor accessory protein (IL1RAP) gene, exon 3 gi|8050491|gb|AF167335.1|F167333S03[8050491]

[4942] 8655: AF167334 Homo sapiens interleukin 1 receptor accessory protein (IL1RAP) gene, exon 2 gi|8050490|gb|AF167334.1|F167333S02[8050490]

[4943] 8656: AF167333 Homo sapiens interleukin 1 receptor accessory protein (IL1RAP) gene, exon 1 gi|8050489|gb|AF167333.1|F167333S01[8050489]

[4944] 8657: AH009309 Homo sapiens interleukin 1 receptor accessory protein (IL1RAP) gene, complete cds, alternatively spliced gi|8050488|gb|AH009309.1|SEG_F167333S[8050488]

[4945] 8658: AF167343 Homo sapiens soluble interleukin-1 receptor accessory protein (IL1RAP) mRNA, complete cds gi|8050486|gb|AF167343.1|AF167343[8050486]

[4946] 8659: AF213457 Homo sapiens triggering receptor expressed on myeloid cells 2 mRNA, complete cds gi|7800156|gb|AF213457.1|AF213457[7800156]

[4947] 8661: AF233281 Homo sapiens CC chemokine receptor (CCBP2) gene, complete cds gi|7274391|gb|AF233281.1|AF233281[7274391]

[4948] 8662: AF189259 Homo sapiens GABA-A receptor theta subunit (THETA) mRNA, complete cds gi|7861735|gb|AF189259.1|AF189259[7861735]

[4949] 8663: AF176832 Homo sapiens low density lipoprotein receptor related protein-deleted in tumor (LRPDIT) mRNA, complete cds gi|7861732|gb|AF176832.1|AF176832[7861732]

[4950] 8664: AH001455 Homo sapiens protooncogene protein (c-erb-2) gene, partial cds gi|182164|gb|AH001455.1|SEG_HUMERB2[182164]

[4951] 8665: M11767 Homo sapiens protooncogene protein (c-erb-2) gene, exon 7 and partial cds gi|182163|gb|M11767.1|HUMERB27[182163]

[4952] 8666: M11766 Homo sapiens protooncogene protein (c-erb-2) gene, exon 6 gi|182162|gb|M11766.1|HUMERB26[182162]

[4953] 8667: M11765 Homo sapiens protooncogene protein (c-erb-2) gene, exon 5 gi|182161|gb|M11765.1|HUMERB25[182161]

[4954] 8668: M11764 Homo sapiens protooncogene protein (c-erb-2) gene, exon 4 gi|182160|gb|M11764.1|HUMERB24[182160]

[4955] 8669: M11763 Homo sapiens protooncogene protein (c-erb-2) gene, exon 3 gi|182159|gb|M11763.1|HUMERB23[182159]

[4956] 8670: M11762 Homo sapiens protooncogene protein (c-erb-2) gene, exon 2 gi|182158|gb|M11762.1|HUMERB22[182158]

[4957] 8671: M11761 Homo sapiens protooncogene protein (c-erb-2) gene, exon 1 gi|182157|gb|M11761.1|HUMERB21[182157]

[4958] 8674: AC068948 Homo sapiens chromosome 19, cosmid R28371 (LLNL-R—244D7), complete sequence gi|7798735|gb|AC068948.1|AC068948[7798735]

[4959] 8675: AF060231 Homo sapiens herpesvirus entry protein C (HVEC) mRNA, complete cds gi|3242792|gb|AF060231.1|AF060231[3242792]

[4960] 8676: Z24459 H. sapiens MTCP1 gene, exons 2A to 7 (and joined mRNA) gi|2252491|emb|Z24459.1|HSMTCP12A[2252491]

[4961] 8677: AB006200 Homo sapiens gene for parathyroid hormone/parathyroid hormone-related protein receptor, exon1, partial sequence gi|7770088|dbj|AB006200.1|AB006200[7770088]

[4962] 8693: AB023493 Homo sapiens mRNA for preproapelin, complete cds gi|6009585|dbj|AB023493.1|AB023493[6009585]

[4963] 8697: M55336 Homo sapiens oncogene tyrosine protein kinase receptor (trk2) mRNA, partial cds gi|339913|gb|M55336.1|HUMTRK2[339913]

[4964] 8701: AB028741 Homo sapiens mRNA for syntaxin 18, complete cds gi|7707423|dbj|AB028741.1|AB028741[7707423]

[4965] 8702: U27478 Homo sapiens angiotensin II type 2 receptor (AT2) gene, partial cds gi|1143833|gb|U27478.1HSU27478[1143833]

[4966] 8707: M81774 Homo sapiens T-cell receptor alpha (TCRB) mRNA, partial cds gi|186224|gb|M81774.1|HUMIGTCACA[186224]

[4967] 8708: S70782 Homo sapiens alpha adrenergic receptor subtype alpha 1a mRNA, complete cds gi|547219|gb|S70782.1|S70782[547219]

[4968] 8709: S70057 Homo sapiens cholecystokinin B receptor mRNA, complete cds gi|546748|gb|S70057.1|S70057[546748]

[4969] 8711: S70123 Homo sapiens low density lipoprotein receptor mRNA, partial cds gi|546107|gb|S70123.1S70123[546107]

[4970] 8712: S56143 Homo sapiens A1 adenosine receptor mRNA, complete cds gi|298327|gb|S56143.1|S56143[298327]

[4971] 8715: S57793 Homo sapiens luteinizing hormone receptor mRNA, complete cds gi|236050|gb|S57793.1|S57793[236050]

[4972] 8722: AF202640 Homo sapiens orphan G-protein coupled receptor (GPRC5B) mRNA, complete cds gi|7682556|gb|AF202640.1|AF202640[7682556]

[4973] 8723: AF211154 AF211154 Clontech HL1008b Homo sapiens cDNA, mRNA sequence gi|7677996|gb|AF211154.1|AF211154[7677996]

[4974] 8724: AF211153 AF211153 Clontech HL1008b Homo sapiens cDNA, mRNA sequence gi|7677995|gb|AF211153.1|AF211153[7677995]

[4975] 8729: AF145440 Homo sapiens CC chemokine receptor 9B (CCR9) mRNA, alternatively spliced, complete cds gi|7673010|gb|AF145440.1|AF145440[7673010]

[4976] 8730: AF145439 Homo sapiens CC chemokine receptor 9A (CCR9) mRNA, alternatively spliced, complete cds gi|7673008|gb|AF145439.1|AF145439[7673008]

[4977] 8731: AF129170 Homo sapiens apolipoprotein E receptor 2 gene, exon 6b and partial cds, alternatively spliced gi|7672339|gb|AF129170.1|AF129169S2[7672339]

[4978] 8732: AF129169 Homo sapiens apolipoprotein E receptor 2 gene, exon 6a and partial cds, alternatively spliced gi|7672338|gb|AF129169.1|AF129169S1[7672338]

[4979] 8733: AH009264 Homo sapiens apolipoprotein E receptor 2 and apolipoprotein E receptor 2 genes, partial cds gi|7672337|gb|AH009264.1|SEG_AF129169S[7672337]

[4980] 8812: AB039723 Homo sapiens FZD3 mRNA for WNT receptor frizzled-3, complete cds gi|7670051|dbj|AB039723.1|AB039723[7670051]

[4981] 8813: AL353940 Homo sapiens mRNA; cDNA DKFZp761P1010 (from clone DKFZp761P1010) gi|7669978emb|AL353940.1|HSM802647[7669978]

[4982] 8814: AC067969 Homo sapiens chromosome 19, cosmid R26839 (LLNL-R—228D1), complete sequence gi|7656699|gb|AC067969.1|AC067969[7656699]

[4983] 8815: AF236081 Homo sapiens orphan G-protein coupled receptor GPR72 (GPR72) mRNA, complete cds gi|7248881|gb|AF236081.1|AF236081[7248881]

[4984] 8819: AC004416 Homo sapiens BAC clone CTB-13N12 from 7q31.2, complete sequence gi|2979585|gb|AC004416.1|AC004416[2979585]

[4985] 8820: AF056020 Homo sapiens chemokine receptor CCR5 (CCR5) gene, CCR5-delta32 allele, partial cds gi|7648496|gb|AF056020.1|AF056020[7648496]

[4986] 8821: AF056019 Homo sapiens mutant chemokine receptor CCR5 (CCR5) gene, CCR5-delta32 allele, partial cds gi|7648494|gb|AF056019.1|AF056019[7648494]

[4987] 8822: AF052244 Homo sapiens mutant chemokine receptor CCR5 (CCR5) gene, CCR5-delta32 allele, partial cds gi|7648492|gb|AF052244.1|AF052244[7648492]

[4988] 8824: AF068288 Homo sapiens HDCME31P mRNA, complete cds gi|7643783|gb|AF068288.1|AF068288[7643783]

[4989] 8825: AF186022 Homo sapiens B lymphocyte adapter protein BAM32 (BAM32) mRNA, complete cds gi|6503077|gb|AF186022.1|AF186022[6503077]

[4990] 8826: AB002168 Homo sapiens gene for vitamin D receptor, exon 9 and complete cds gi|5736651|dbj|AB002168.1|AB00215S12[5736651]

[4991] 8827: AB002167 Homo sapiens gene for vitamin D receptor, exon 8 gi|5736591|dbj|AB002167.1|AB00215S11[5736591]

[4992] 8828: AB002166 Homo sapiens gene for vitamin D receptor, exon 7 gi|5736588|dbj|AB002166.1|AB00215S10[5736588]

[4993] 8829: AB002165 Homo sapiens gene for vitamin D receptor, exon 6 gi|5736585|dbj|AB002165.1|AB00215S09[5736585]

[4994] 8830: AB002164 Homo sapiens gene for vitamin D receptor, exon 5 gi|5736582|dbj|AB002164.1|AB00215S08[5736582]

[4995] 8831: AB002163 Homo sapiens gene for vitamin D receptor, exon 4 gi|5736579|dbj|AB002163.1|AB00215S07[5736579]

[4996] 8832: AB002162 Homo sapiens gene for vitamin D receptor, exon 3 gi|5736575|dbj|AB002162.1|AB00215S06[5736575]

[4997] 8833: AB002161 Homo sapiens gene for vitamin D receptor, exon 2 gi|5736571|dbj|AB002161.1|AB00215S05[5736571]

[4998] 8834: AB002160 Homo sapiens gene for vitamin D receptor, exon 1c, 5′ non-coding region gi|5736566|dbj|AB002160.1|AB00215S04[5736566]

[4999] 8835: AB002159 Homo sapiens gene for vitamin D receptor, exon 1b, 5′ non-coding region gi|5736562|dbj|AB002159.1|AB00215S03[5736562]

[5000] 8839: AB005647 Homo sapiens gene for atrial natriuretic peptide Btype receptor, exon 22 and complete cds gi|5139788|dbj|AB005647.1|AB00562S23[5139788]

[5001] 8840: AB005646 Homo sapiens gene for atrial natriuretic peptide Btype receptor, exon 21 gi|5139787|dbj|AB005646.1|AB00562S22[5139787]

[5002] 8841: AB005645 Homo sapiens gene for atrial natriuretic peptide Btype receptor, exon 20 gi|5139786|dbj|AB005645.1|AB00562S21[5139786]

[5003] 8842: AB005644 Homo sapiens gene for atrial natriuretic peptide Btype receptor, exon 19 gi|5139785|dbj|AB005644.1|AB00562S20[5139785]

[5004] 8843: AB005643 Homo sapiens gene for atrial natriuretic peptide Btype receptor, exon 18 gi|5139784|dbj|AB005643.1|AB00562S19[5139784]

[5005] 8844: AB005642 Homo sapiens gene for atrial natriuretic peptide Btype receptor, exon 17 gi|5139783|dbj|AB005642.1|AB00562S18[5139783]

[5006] 8845: AB005641 Homo sapiens gene for atrial natriuretic peptide Btype receptor, exon 16 gi|5139782|dbj|AB005641.1|AB00562S17[5139782]

[5007] 8846: AB005640 Homo sapiens gene for atrial natriuretic peptide Btype receptor, exon 15 gi|5139781|dbj|AB005640.1|AB00562S16[5139781]

[5008] 8847: AB005639 Homo sapiens gene for atrial natriuretic peptide Btype receptor, exon 14 gi|5139780|dbj|AB005639.1|AB00562S15[5139780]

[5009] 8848: AB005638 Homo sapiens gene for atrial natriuretic peptide Btype receptor, exon 13 gi|5139779|dbj|AB005638.1|AB00562S14[5139779]

[5010] 8849: AB005637 Homo sapiens gene for atrial natriuretic peptide Btype receptor, exon 12 gi|5139778|dbj|AB005637.1|AB00562S13[5139778]

[5011] 8850: AB005636 Homo sapiens gene for atrial natriuretic peptide Btype receptor, exon 11 gi|5139777|dbj|AB005636.1|AB00562S12[5139777]

[5012] 8851: AB005635 Homo sapiens gene for atrial natriuretic peptide Btype receptor, exon 10 gi|5139776|dbj|AB005635.1|AB00562S11[5139776]

[5013] 8852: AB005634 Homo sapiens gene for atrial natriuretic peptide Btype receptor, exon 9 gi|5139775|dbj|AB005634.1|AB00562S10[5139775]

[5014] 8853: AB005633 Homo sapiens gene for atrial natriuretic peptide Btype receptor, exon 8 gi|5139774|dbj|AB005633.1|AB00562S09[5139774]

[5015] 8854: AB005632 Homo sapiens gene for atrial natriuretic peptide Btype receptor, exon 7 gi|5139773|dbj|AB005632.1|AB00562S08[5139773]

[5016] 8855: AB005631 Homo sapiens gene for atrial natriuretic peptide Btype receptor, exon 6 gi|5139772|dbj|AB005631.1|AB00562S07[5139772]

[5017] 8856: AB005630 Homo sapiens gene for atrial natriuretic peptide Btype receptor, exon 5 gi|5139771|dbj|AB005630.1|AB00562S06[5139771]

[5018] 8857: AB005629 Homo sapiens gene for atrial natriuretic peptide Btype receptor, exon 4 gi|5139770|dbj|AB005629.1|AB00562S05[5139770]

[5019] 8858: AB005628 Homo sapiens gene for atrial natriuretic peptide Btype receptor, exon 3 gi|5139769|dbj|AB005628.1AB00562S04[5139769]

[5020] 8859: AB005627 Homo sapiens gene for atrial natriuretic peptide Btype receptor, exon 2 gi|5139768|dbj|AB005627.1|AB00562S03[5139768]

[5021] 8860: AB005626 Homo sapiens gene for atrial natriuretic peptide Btype receptor, exon 1 gi|5139767|dbj|AB005626.1|AB00562S02[5139767]

[5022] 8862: AF030335 Homo sapiens purinergic P2Y11 receptor (P2Y11) mRNA, complete cds gi|2674119|gb|AF030335.1|AF030335[2674119]

[5023] 8863: AF003522 Homo sapiens Delta mRNA, complete cds gi|2197068|gb|AF003522.1|AF003522[2197068]

[5024] 8864: AF003521 Homo sapiens Jagged 2 mRNA, complete cds gi|2197066|gb|AF003521.1|AF003521[2197066]

[5025] 8865: AF068292 Homo sapiens HDCMA39P mRNA, partial cds gi|7634778|gb|AF068292.1|AF068292[7634778]

[5026] 8868: AH007819 Homo sapiens 5-hydroxytryptamine 2B receptor (HTR2B) gene, complete cds gi|5442455|gb|AH007819.2|SEG_HSHTR2B[5442455]

[5027] 8869: AF156158 Homo sapiens 5-hydroxytryptamine 2B receptor (HTR2B) gene, exon 1 gi|5442454|gb|AF156158.2|HSHTR2B1[5442454]

[5028] 8870: AF156160 Homo sapiens 5-hydroxytryptamine 2B receptor (HTR2B) gene, exon 3 and complete cds gi|5070703|gb|AF156160.1|HSHTR2B3[5070703]

[5029] 8871: AF156159 Homo sapiens 5-hydroxytryptamine 2B receptor (HTR2B) gene, exon 2 gi|5070702|gb|AF156159.1|HSHTR2B2[5070702]

[5030] 8872: AB041713 Homo sapiens fp gene for prostaglandin F2alpha receptor, exon 1 and 2, partial cds gi|7619988|dbj|AB041713.1|AB041713[7619988]

[5031] 8873: AF041811 Homo sapiens ETS related protein-growth factor receptor tyrosine kinase fusion proteins (ETV6-NTRK3 fusion) mRNA, partial cds gi|6274523|gb|AF041811.2|AF041811[6274523]

[5032] 8874: AF172453 Homo sapiens opioid growth factor receptor mRNA, complete cds gi|7595306|gb|AF172453.1|AF172453[7595306]

[5033] 8875: AF172452 Homo sapiens opioid growth factor receptor mRNA, complete cds gi|7595304|gb|AF172452.1|AF172452[7595304]

[5034] 8876: AF172451 Homo sapiens opioid growth factor receptor mRNA, complete cds gi|7595302|gb|AF172451.1|AF172451[7595302]

[5035] 8877: AF172450 Homo sapiens opioid growth factor receptor mRNA, complete cds gi|7595300|gb|AF172450.1|AF172450[7595300]

[5036] 8878: AF172449 Homo sapiens clone 127 opioid growth factor receptor mRNA, complete cds gi|7595298|gb|AF172449.1|AF172449[7595298]

[5037] 8879: D49394 Homo sapiens mRNA for serotonin 5-HT3 receptor, complete cds gi|681913|dbj|D49394.1|HUMS5HT3RA[681913]

[5038] 8880: AB041395 Homo sapiens CHRM3 gene for muscarinic acetylcholine receptor m3, complete cds gi|7592980|dbj|AB041395.1|AB041395[7592980]

[5039] 8881: AB041391 Homo sapiens CHRM2 gene for muscarinic acetylcholine receptor m2, partial cds gi|7592971|dbj|AB041391.1|AB041391[7592971]

[5040] 8882: AB041384 Homo sapiens gene for histamine H2 receptor, complete cds gi|7592957|dbj|AB041384.1|AB041384[7592957]

[5041] 8883: AB041380 Homo sapiens gene for histamine H1 receptor, complete cds gi|7592949|dbj|AB041380.1|AB041380[7592949]

[5042] 8884: AB041373 Homo sapiens HTR1E gene for 5-hydroxytryptamine (serotonin) receptor 1E, partial cds gi|7592934|dbj|AB041373.1|AB041373[7592934]

[5043] 8885: AB041370 Homo sapiens HTR1B gene for 5-hydroxytryptamine (serotonin) receptor 1B, complete cds gi|7592928|dbj|AB041370.1|AB041370[7592928]

[5044] 8887: AB033598 Homo sapiens gene for melatonin 1b receptor, exon 2 and complete cds gi|7209599|dbj|AB033598.1|AB033597S2[7209599]

[5045] 8888: AB033597 Homo sapiens gene for melatonin 1b receptor, exon 1 gi|7209598|dbj|AB033597.1|AB033597S1[7209598]

[5046] 8889: SEG_AB033597S Homo sapiens gene for melatonin 1b receptor gi|7209597|dbj ||SEG_AAB033597S[7209597]

[5047] 8890: D85606 Homo sapiens gene for cholecystokinin type-A receptor, complete cds gi|7008026|dbj|D85606.1|D85606[7008026]

[5048] 8891: SEG_AB019480S Homo sapiens NTRK1 gene for TRKA gi|6492387|dbj ||SEG_AB019480S[6492387]

[5049] 8892: AB019485 Homo sapiens NTRK1 gene for TRKA, exon 8-14 gi|6492386|dbj|AB019485.2|AB019480S6[6492386]

[5050] 8893: SEG_AB029932S Homo sapiens hMella gene for melatonin 1a receptor gi|6045084|dbj|SEG_AB029932S[6045084]

[5051] 8894: AB029933 Homo sapiens hMella gene for melatonin 1a receptor, exon 2 and complete cds gi|6045083|dbj|AB029933.1|AB029932S2[6045083]

[5052] 8895: AB029932 Homo sapiens hMella gene for melatonin 1a receptor, exon 1 gi|6045082|dbj |AB029932.1|AB029932S1[6045082]

[5053] 8896: AB026584 Homo sapiens gene for endothelial protein C receptor, complete cds gi|5837963|dbj|AB026584.2|AB026584[5837963]

[5054] 8897: AB017444 Homo sapiens gene for lectin-like oxidized LDL receptor, exon 6 gi|5821166|dbj AB017444.1|AB017444[5821166]

[5055] 8898: AB017443 Homo sapiens gene for lectin-like oxidized LDL receptor, exon 5 gi|5821165|dbj|AB017443.1|AB017443[5821165]

[5056] 8899: AB017442 Homo sapiens gene for lectin-like oxidized LDL receptor, exon 4 gi|5821164|dbj|AB017442.1|AB017442[5821164]

[5057] 8900: AB017441 Homo sapiens gene for lectin-like oxidized LDL receptor, exon 3 gi|5821163|dbj|AB017441.1|AB017441[5821163]

[5058] 8901: AB017440 Homo sapiens gene for lectin-like oxidized LDL receptor, exon 2 gi|5821162|dbj|AB017440.1|AB017440[5821162]

[5059] 8902: AB017439 Homo sapiens gene for lectin-like oxidized LDL receptor, exon 1 gi|5821161|dbj|AB017439.1|AB017439[5821161]

[5060] 8903: AB019488 Homo sapiens NTRK1 gene for TRKA, exon 17 and complete cds gi|3869111|dbj|AB019488.1|AB019480S9[3869111]

[5061] 8904: AB019487 Homo sapiens NTRK1 gene for TRKA, exon 16 gi|3869110|dbj|AB019487.1|AB019480S8[3869110]

[5062] 8905: AB019486 Homo sapiens NTRK1 gene for TRKA, exon 15 gi|3869109|dbj|AB019486.1|AB019480S7[3869109]

[5063] 8906: AB019484 Homo sapiens NTRK1 gene for TRKA, exon 7 gi|3869107|dbj|AB019484.1|AB019480S5[3869107]

[5064] 8907: AB019483 Homo sapiens NTRK1 gene for TRKA, exon 5 and 6 gi|3869106|dbj|AB019483.1|AB019480S4[3869106]

[5065] 8908: AB019482 Homo sapiens NTRK1 gene for TRKA, exon 4 gi|3869105|dbj|AB019482.1|AB019480S3[3869105]

[5066] 8909: AB019481 Homo sapiens NTRK1 gene for TRKA, exon 2,3 gi|3869104|dbj|AB019481.1|AB019480S2[3869104]

[5067] 8910: AB019480 Homo sapiens NTRK1 gene for TRKA, exon 1 gi|3869103 |dbj|AB019480.1|AB019480S1[3869103]

[5068] 8911: SEG_AB01471S Homo sapiens DR5 gene gi|3721877|dbj |SEG_A301471S[3721877]

[5069] 8912: AB014718 Homo sapiens DR5 gene, exon 9 and complete cds gi|3721876|dbj|AB014718.1|AB01471S9[3721876]

[5070] 8913: AB014717 Homo sapiens DR5 gene, exon 8 gi|3721875|dbj|AB014717.1|AB01471S8[3721875]

[5071] 8914: AB014716 Homo sapiens DRS gene, exon 7 gi|3721874|dbj|AB014716.1|AB01471S7[3721874]

[5072] 8915: AB014715 Homo sapiens DR5 gene, exon 6 gi|3721873|dbj|AB014715.1|AB01471S6[3721873]

[5073] 8916: AB014714 Homo sapiens DR5 gene, exon 5 gi|3721872|dbj|AB014714.1|AB01471S5[3721872]

[5074] 8917: AB014713 Homo sapiens DR5 gene, exon 4 gi|3721871|dbj|AB014713.1|AB01471S4[3721871]

[5075] 8918: AB014712 Homo sapiens DR5 gene, exon 3 gi|3721870|dbj|AB014712.1|AB01471S3[3721870]

[5076] 8919: AB014711 Homo sapiens DRS gene, exon 2 gi|3721869|dbj|AB014711.1|AB01471S2[3721869]

[5077] 8920: AB014710 Homo sapiens DR5 gene, exon 1, partial sequence gi|3721868|dbj|AB014710.1|AB01471S1[3721868]

[5078] 8921: SEG_AB01047S Homo sapiens gene for natriuretic peptide A type receptor gi|3297985|dbj||SEG_AB01047S[3297985]

[5079] 8922: AB010491 Homo sapiens gene for natriuretic peptide A type receptor,exon 22 and complete cds gi|3297984|dbj|AB010491.1|AB01047S22[3297984]

[5080] 8923: AB010490 Homo sapiens gene for natriuretic peptide A type receptor, exon 21 gi|3297983|dbj|AB010490.1|AB01047S21[3297983]

[5081] 8924: AB010489 Homo sapiens gene for natriuretic peptide A type receptor, exon 20 gi|3297982|dbj|AB010489.1|AB01047S20[3297982]

[5082] 8925: AB010488 Homo sapiens gene for natriuretic peptide A type receptor, exon 19 gi|3297981|dbj|AB010488.1|AB01047S19[3297981]

[5083] 8926: AB010487 Homo sapiens gene for natriuretic peptide A type receptor, exon 18 gi|3297980|dbj|AB010487.1|AB01047S18[3297980]

[5084] 8927: AB010486 Homo sapiens gene for natriuretic peptide A type receptor, exon 17 gi|3297979|dbj|AB010486.1|AB01047S17[3297979]

[5085] 8928: AB010485 Homo sapiens gene for natriuretic peptide A type receptor, exon 16 gi|3297978|dbj|AB010485.1|AB01047S16[3297978]

[5086] 8929: AB010484 Homo sapiens gene for natriuretic peptide A type receptor, exon 15 gi|3297977|dbj 1AB010484.1|AB01047S15[3297977]

[5087] 8930: AB010483 Homo sapiens gene for natriuretic peptide A type receptor, exon 14 gi|3297976|dbj|AB010483.1|AB01047S14[3297976]

[5088] 8931: AB010482 Homo sapiens gene for natriuretic peptide A type receptor, exon 13 gi|3297975|dbj|AB010482.1|AB01047S13[3297975]

[5089] 8932: AB010481 Homo sapiens gene for natriuretic peptide A type receptor, exon 12 gi|3297974|dbj|AB010481.1|AB01047S12[3297974]

[5090] 8933: AB010480 Homo sapiens gene for natriuretic peptide A type receptor, exon 11 gi|3297973|dbj|AB010480.1|AB01047S11[3297973]

[5091] 8934: AB010479 Homo sapiens gene for natriuretic peptide A type receptor, exon 10 gi|3297972|dbj|AB010479.1|AB01047S10[3297972]

[5092] 8935: AB010478 Homo sapiens gene for natriuretic peptide A type receptor, exon 9 gi|3297971|dbj|AB010478.1|AB01047S09[3297971]

[5093] 8936: AB010477 Homo sapiens gene for natriuretic peptide A type receptor, exon 8 gi|3297970|dbj|AB010477.1|AB01047S08[3297970]

[5094] 8937: AB010476 Homo sapiens gene for natriuretic peptide A type receptor, exon 7 gi|3297969|dbj|AB010476.1|AB01047S07[3297969]

[5095] 8938: AB010475 Homo sapiens gene for natriuretic peptide A type receptor, exon 6 gi|3297968|dbj|AB010475.1|AB01047S06[3297968]

[5096] 8939: AB010474 Homo sapiens gene for natriuretic peptide A type receptor, exon 5 gi|3297967|dbj|AB010474.1|AB01047S05[3297967]

[5097] 8940: AB010473 Homo sapiens gene for natriuretic peptide A type receptor, exon 4 gi|3297966|dbj|AB010473.1|AB01047S04[3297966]

[5098] 8941: AB010472 Homo sapiens gene for natriuretic peptide A type receptor, exon 3 gi|3297965|dbj|AB010472.1|AB01047S03[3297965]

[5099] 8942: AB010471 Homo sapiens gene for natriuretic peptide A type receptor, exon 2 gi|3297964|dbj|AB010471.1|AB01047S02[3297964]

[5100] 8943: AB010470 Homo sapiens gene for natriuretic peptide A type receptor, exon 1, partial sequence gi|13297963|dbj |AB010470.1|AB01047S01[3297963]

[5101] 8944: AB008681 Homo sapiens gene for activin receptor type IIB, complete cds gi|2760152|dbj |AB008681.1|AB008681[2760152]

[5102] 8945: SEG_AB005521S Homo sapiens ppar gamma gene for peroxisome proliferator activated-receptor gamma gi|2605496|dbj |SEG_AB005521S[2605496]

[5103] 8946: AB005526 Homo sapiens ppar gamma gene for peroxisome proliferator activated-receptor gamma, eoxn 6 and complete cds gi|2605495|dbj|AB005526.1AB005521S6[2605495]

[5104] 8947: AB005525 Homo sapiens ppar gamma gene for peroxisome proliferator activated-receptor gamma, exon 5 gi|2605494|dbj |AB005525.1|AB005521S5[2605494]

[5105] 8948: AB005524 Homo sapiens ppar gamma gene for peroxisome proliferator activated-receptor gamma, exon 4 gi|2605493|dbj |AB005524.1|AB005521S4[2605493]

[5106] 8949: AB005523 Homo sapiens ppar gamma gene for peroxisome proliferator activated-receptor gamma, exon 3 gi|2605492|dbj|AB005523.1|AB005521S3[2605492]

[5107] 8950: AB005522 Homo sapiens ppar gamma gene for peroxisome proliferator activated-receptor gamma, exon 2 gi|2605491|dbj|AB005522.1|AB005521S2[2605491]

[5108] 8951: AB005521 Homo sapiens ppar gamma gene for peroxisome proliferator activated-receptor gamma, exon 1 gi|2605490|dbj|AB005521.1|AB005521S1[2605490]

[5109] 8954: AB002059 Homo sapiens DNA for Human P2XM, complete cds gi|2350848|dbj|AB002059.1|AB002059[2350848]

[5110] 8955: SEG_D86389S Homo sapiens DNA for apoER2 gi|2344801|dbj||SEG_D86389S[2344801]

[5111] 8956: D86407 Homo sapiens DNA for apoER2, complete cds, and exon 19 gi|2344800|dbj|D86407.1|D86389S19[2344800]

[5112] 8957: D86406 Homo sapiens DNA for apoER2, exon 18 gi|2344799|dbj|D86406.1|D86389S18[2344799]

[5113] 8958: D86405 Homo sapiens DNA for apoER2, exon 17 gi|2344798|dbj|D86405.1|D86389S17[2344798]

[5114] 8959: D86404 Homo sapiens DNA for apoER2, exon 16 gi|2344797|dbj|D86404.1|D86389S16[2344797]

[5115] 8960: D86403 Homo sapiens DNA for apoER2, exon 15 gi|2344796|dbj|D86403.1|D86389S15[2344796]

[5116] 8961: D86402 Homo sapiens DNA for apoER2, exon 14 gi|2344795|dbj|D86402.1|D86389S14[2344795]

[5117] 8962: D86401 Homo sapiens DNA for apoER2, exon 13 gi|2344794|dbj|D86401.1|D86389S13[2344794]

[5118] 8963: D86400 Homo sapiens DNA apoER2, exon 12 gi|2344793|dbj|D86400.1|D86389S12[2344793]

[5119] 8964: D86399 Homo sapiens DNA for apoER2, exon 11 gi|2344792|dbj|D86399.1|D86389S11[2344792]

[5120] 8965: D86398 Homo sapiens DNA for apoER2, exon 10 gi|2344791|dbj|D86398.1|D86389S10[2344791]

[5121] 8966: D86397 Homo sapiens DNA for apoER2, exon 9 gi|2344790|dbj|D86397.1|D86389S09[2344790]

[5122] 8967: D86396 Homo sapiens DNA for apoER2, exon 8 gi|2344789|dbj|D86396.1|D86389S08[2344789]

[5123] 8968: D86395 Homo sapiens DNA for apoER2, exon 7 gi|2344788|dbj|D86395.1|D86389S07[2344788]

[5124] 8969: D86394 Homo sapiens DNA for apoER2, exon 6 gi|2344787|dbj|D86394.1|D86389S06[2344787]

[5125] 8970: D86393 Homo sapiens DNA for apoER2, exon 5 gi|2344786|dbj|D86393.1|D86389S05[2344786]

[5126] 8971: D86392 Homo sapiens DNA for apoER2, exon 4 gi|2344785|dbj|D86392.1|D86389S04[2344785]

[5127] 8972: D86391 Homo sapiens DNA for apoER2, exon 3 gi|2344784|dbj|D86391.1|D86389S03[2344784]

[5128] 8973: D86390 Homo sapiens DNA for apoER2, exon 2 gi|2344783|dbj|D86390.1|D86389S02[2344783]

[5129] 8974: D86389 Homo sapiens DNA for apoER2, exon 1 gi|2344782|dbj|D86389.1ID86389S01[2344782]

[5130] 8975: D86096 Human DNA for prostaglandin EP3 receptor subtype, complete cds gi|2114186|dbj|D86096.1|D86087S10[2114186]

[5131] 8976: D86095 Human DNA for prostaglandin E receptor EP3 subtype, exon 9 gi|211485|dbj|D86095.1|D86087S09[2114185]

[5132] 8977: D86094 Human DNA for prostaglandin E receptor EP3 subtype, exon 8 gi|2114184|dbj|D86094.1|D86087S08[2114184]

[5133] 8978: D86093 Human DNA for prostaglandin E receptor EP3 subtype, exon 7 gi|211483|dbj|D86093.1|D86087S07[2114183]

[5134] 8979: D86092 Human DNA for prostaglandin E receptor EP3 subtype, exon 6 gi|2114182|dbj|D86092.1|D86087S06[2114182]

[5135] 8980: D86091 Human DNA for prostaglandin E receptor EP3 subtype, exon 5 gi|2114181|dbj|D86091.1|D86087S05[2114181]

[5136] 8981: D86090 Human DNA for prostaglandin E receptor EP3 subtype, exon 4 gi|2114180|dbj|D86090.1|D86087S04[2114180]

[5137] 8982: D86089 Human DNA for prostaglandin E receptor EP3 subtype, exon 3 gi|2114179|dbj|D86089.1|D86087S03[2114179]

[5138] 8983: D86088 Human DNA for prostaglandin E receptor EP3 subtype, exon 2 gi|2114178|dbj|D86088.1|D86087S02[2114178]

[5139] 8984: D86087 Human DNA for prostaglandin E receptor EP3 subtype, exon 1 gi|2114177|dbj|D86087.1|D86087S01[2114177]

[5140] 8985: SEG_D49555S Homo sapiens DNA for gastric inhibitory polypeptide receptor gi|1805368|dbj||SEG_D49555S[1805368]

[5141] 8986: D85376 Human DNA for thyrotropin-releasing hormone receptor, exon 3 and copmplete cds gi|1616933|dbj|D85376.1|D85375S2[1616933]

[5142] 8987: D85375 Human DNA for thyrotropin-releasing hormon receptor, exon 1, 2 gi|1616932|dbj|D85375.1D85375S1[1616932]

[5143] 8988: D49559 Human DNA for gastric inhibitory polypeptide receptor, exon 13 and 14, complete cds gi|1088442|dbj|D49559.1|D49555S5[1088442]

[5144] 8989: D49558 Human DNA for gastric inhibitory polypeptide receptor, exon 5, 6, 7, 8, 9, 10, 11 and 12 gi|1088441|dbj|D49558.1|D49555S4[1088441]

[5145] 8990: D49557 Human DNA for gastric inhibitory polypeptide receptor, exon 3 and 4 gi|1088440|dbj|D49557.1|D49555S3[1088440]

[5146] 8991: D49556 Homo sapiens DNA for gastric inhibitory polypeptide receptor, exon 2 gi|1088439|dbj|D49556.1|D49555S2[1088439]

[5147] 8992: D49555 Homo sapiens DNA for gastric inhibitory polypeptide receptor, exon 1 gi|1088438|dbj|D49555.1D49555S1[1088438]

[5148] 8993: D64016 Human gene for vascular endothelial growth factor receptor, promoter and exon 1 gi|1088437|dbj|D64016.1|HUMES[1088437]

[5149] 8994: D38128 Homo sapiens IP gene for prostacyclin receptor, exon 3 gi|1019364|dbj|D38128.1|HUMIP2[1019364]

[5150] 8995: D38127 Human IP gene for prostacyclin receptor, exon 1 and exon 2 gi|1019362|dbj|D38127.1|HUMIP1[1019362]

[5151] 8996: D37965 Human mRNA for PDGF receptor beta-like tumor suppressor (PRLTS), complete cds gi|807818|dbj|D37965.1|HUMPRLTS[807818]

[5152] 8997: D50017 Human DNA for alpha-platelet-derived growth factor receptor, exon 23 gi|767797|dbj|D50017.1|D50001S17[767797]

[5153] 8998: D50016 Human DNA for alpha-platelet-derived growth factor receptor, exon 22 gi|767796|dbj|D50016.1|D50001S16[767796]

[5154] 8999: D50015 Human DNA for alpha-platelet-derived growth factor receptor, exon 20 and 21 gi|767795|dbj|D50015.1|D50001S15[767795]

[5155] 9000: D50014 Human DNA for alpha-platelet-derived growth factor receptor, exon 19 gi|767794|dbj|D50014.1|D5000|S14[767794]

[5156] 9001: D50013 Human DNA for alpha-platelet-derived growth factor receptor, exon 18 gi|767793|dbj|D50013.1|D50001s13[767793]

[5157] 9002: D50012 Human DNA for alpha-platelet-derived growth factor receptor, exon 17 gi|767792|dbj|D50012.1|D50001S12[767792]

[5158] 9003: D50011 Human DNA for alpha-platelet-derived growth factor receptor, exon 16 gi|767791|dbj|D50011.1|D50001S11[767791]

[5159] 9004: D50010 Human DNA for alpha-platelet-derived growth factor receptor, exon 15 gi|767790|dbj|D50010.1|D50001S10[767790]

[5160] 9005: D50009 Human DNA for alpha-platelet-derived growth factor receptor, exon 14 gi|767789|dbj|D50009.1|D50001S09[767789]

[5161] 9006: D50008 Human DNA for alpha-platelet-derived growth factor receptor, exon 13 gi|767788|dbj|D50008.1|D50001S08[767788]

[5162] 9007: D50007 Human DNA for alpha-platelet-derived growth factor receptor, exon 11 and 12 gi|767787|dbj|D50007.1|D50001S07[767787]

[5163] 9008: D50006 Human DNA for alpha-platelet-derived growth factor receptor, exon 6-10 gi|767786|dbj|D50006.1|D50001S06[767786]

[5164] 9009: D50005 Human DNA for alpha-platelet-derived growth factor receptor, exon 5 gi|767785|dbj|D50005.1|D50001S05[767785]

[5165] 9010: D50004 Human DNA for alpha-platelet-derived growth factor receptor, exon 4 gi|767784|dbj|D50004.1|D50001S04[767784]

[5166] 9011: D50003 Human DNA for alpha-platelet-derived growth factor receptor, exon 3 gi|767783|dbj|D50003.1|D50001S03[767783]

[5167] 9012: D50002 Human DNA for alpha-platelet-derived growth factor receptor, exon 2 gi|767781|dbj|D50002.1|D50001S02[767781]

[5168] 9013: D50001 Human DNA for alpha-platelet-derived growth factor receptor, exon 1 gi|767780|dbj|D50001.1|D50001S01[767780]

[5169] 9014: D31793 Human CD40 ligand (CD40L) gene, 5′ flanking region and exon 1 gi|662386|dbj|D31793.1|HUMCD40L1[662386]

[5170] 9015: D28768 Homo sapiens leukocyte DNA for Ah receptor, exon 1 gi|567941|dbj|D28768.1|HUMAHRP[567941]

[5171] 9016: D28769 Human HOX12 and RAGE genes, complete cds gi|561657|dbj|D28769.1|HUMHOXRAGE[561657]

[5172] 9017: D31708 Human DNA for Ah-receptor, exon 1 gi|538228|dbj|D31708.1|HUMAHR[538228]

[5173] 9019: D26535 Human gene for dihydrolipoamide succinyltransferase, complete cds (exon 1-15) gi|537349|dbj|D26535.1|HUMDS[537349]

[5174] 9020: SEG_HUMTA2R Homo sapiens gene for thromboxane A2 receptor gi|488600|dbj||SEG_HUMTA2R[488600]

[5175] 9021: D15056 Homo sapiens gene for thromboxane A2 receptor, exon 3 gi|441173|dbj|D15056.1|HUMTA2R4[441173]

[5176] 9022: D15055 Homo sapiens gene for thromboxane A2 receptor, exon 2 gi|441172|dbj|D15055.1|HUMTA2R3[441172]

[5177] 9023: D15054 Homo sapiens gene for thromboxane A2 receptor, exon 1b (promoter region II) gi|441171|dbj|D15054.1|HUMTA2R2[441171]

[5178] 9024: D15053 Homo sapiens gene for thromboxane A2 receptor, exon 1 (promoter region I) gi|441170|dbj|D15053.1|HUMTA2R1[441170]

[5179] 9025: D21219 Human CCKBR gene for cholecystokinin-B receptor/gastrin receptor, exon 2-5, partial cds gi|416225|dbj|D21219.1|HUMCCKBR2[416225]

[5180] 9026: D21218 Human CCKBR gene for cholecystokinin-B receptor/gastrin receptor, exon 1 gi|416224|dbj|D21218.1|HUMCCKBR1[416224]

[5181] 9027: D16532 Human gene for very low density lipoprotein receptor, exon 19 gi|407219|dbj|D16532.1|HUMVLDLR19[407219]

[5182] 9028: D16531 Human gene for very low density lipoprotein receptor, exon 18 gi|407218|dbj|D16531.1|HUMVLDLR18[407218]

[5183] 9029: D16530 Huma gene for very low density lipoprotein receptor, exon 17 gi|407217|dbj|D16530.1|HUMVLDLR17[407217]

[5184] 9030: D16529 Human gene for very low density lipoprotein receptor, exon 16 gi|407216|dbj|D16529.1|HUMVLDLR16[407216]

[5185] 9031: D16528 Human gene for very low density lipoprotein receptor, exon 15 gi|407215|dbj|D16528.1|HUMVLDLR15[407215]

[5186] 9032: D16527 Human gene for very low density lipoprotein receptor, exon 14 gi|407214|dbj|D16527.1|HUMVLDLR14[407214]

[5187] 9033: D16526 Human gene for very low density lipoprotein receptor, exon 13 gi|407213|dbj|D16526.1|HUMVLDLR13[407213]

[5188] 9034: D16525 Human gene for very low density lipoprotein receptor, exon 12 gi|407212|dbj|D16525.1|HUMVLDLR12[407212]

[5189] 9035: D16524 Human gene for very low density lipoprotein receptor, exon 11 gi|407211|dbj|D16524.1|HUMVLDLR11[407211]

[5190] 9036: D16523 Human gene for very low density lipoprotein receptor, exon 10 gi|407210|dbj|D16523.1|HUMVLDLR10[407210]

[5191] 9037: D16522 Human gene for very low density lipoprotein receptor, exon 9 gi|407209|dbj|D16522.1|HUMVLDLR09[407209]

[5192] 9038: D16520 Human gene for very low density lipoprotein receptor, exon 8 gi|407208|dbj|D16520.1|HUMVLDLR08[407208]

[5193] 9039: D16518 Human gene for very low density lipoprotein receptor, exon 7 gi|407207|dbj|D16518.1|HUMVLDLR07[407207]

[5194] 9040: D16516 Human gene for very low density lipoprotein receptor, exon 6 gi|407206|dbj|D16516.1|HUMVLDLR06[407206]

[5195] 9041: D16514 Human gene for very low density lipoprotein receptor, exon 5 gi|407205|dbj|D16514.1|HUMVLDLR05[407205]

[5196] 9042: D16512 Human gene for very low density lipoprotein receptor, exon 4 gi|407204|dbj|D16512.1|HUMVLDLR04[407204]

[5197] 9043: D16510 Human gene for very low density lipoprotein receptor, exon 3 gi|407203|dbj|D16510.1|HUMVLDLR03[407203]

[5198] 9044: D16508 Human gene for very low density lipoprotein receptor, exon 2 gi|407202|dbj|D16508.1|HUMVLDLR02[407202]

[5199] 9045: D16495 Human gene for very low density lipoprotein receptor, 5′ flanking and exon 1 gi|407201|dbj|D16495.1|HUMVLDLR01[407201]

[5200] 9046: D13168 Human gene for endothelin-B receptor (hET-BR), exon 7 gi|285924|dbj|D13168.1|HUMHETBR7[285924]

[5201] 9047: D13167 Human gene for endothelin-B receptor (hET-BR), exon 6 gi|285923|dbj|D13167.1|HUMHETBR6[285923]

[5202] 9048: D13166 Human gene for endothelin-B receptor (hET-BR), exon 5 gi|285922|dbj|D13166.1|HUMHETBR5[285922]

[5203] 9049: D13165 Human gene for endothelin-B receptor (hET-BR), exon 4 gi|285921|dbj|D13165.1|HUMHETBR4[285921]

[5204] 9050: D13164 Human gene for endothelin-B receptor (hET-BR), exon 3 gi|285920|dbj|D13164.1|HUMHETBR3[285920]

[5205] 9051: D13163 Human gene for endothelin-B receptor (hET-BR), exon 2 gi|285919|dbj|D13163.1|HUMHETBR2[285919]

[5206] 9052: D13162 Human gene for endothelin-B receptor (hET-BR), exon 1 gi|285918|dbj|D13162.1|HUMHETBR1[285918]

[5207] 9053: D10604 Human midkine gene, complete cds gi|219928|dbj|D10604.1|HUMMK[219928]

[5208] 9054: D11151 Human DNA for endothelin-A receptor, exon 8 and 3′ flanking region gi|219628|dbj|D11151.1|HUMETAR8[219628]

[5209] 9055: D11150 Human DNA for endothelin-A receptor, exon 7 gi|2l9627|dbj|D11150.1|HUMETAR7[219627]

[5210] 9056: D11149 Human DNA for endothelin-A receptor, exon 6 gi|219626|dbj|D11149.1|HUMETAR6[219626]

[5211] 9057: D11148 Human DNA for endothelin-A receptor, exon 5 gi|219625|dbj|D11148.1|HUMETAR5[219625]

[5212] 9058: D11147 Human DNA for endothelin-A receptor, exon 4 gi|219624|dbj|D11147.1|HUMETAR4[219624]

[5213] 9059: D11146 Human DNA for endothelin-A receptor, exon 3 gi|2l9623|dbj|D11146.1|HUMETAR3[219623]

[5214] 9060: D11145 Human DNA for endothelin-A receptor, exon 2 gi|2l9622|dbj|D11145.1|HUMETAR2[219622]

[5215] 9061: D11144 Human DNA for endothelin-A receptor, 5′ flanking region and exon 1 gi|219621|dbj|D11144.1|HUMETAR1[219621]

[5216] 9063: AF215981 Homo sapiens CC chemokine receptor 10 (CCR10) mRNA, complete cds gi|7546844|gb|AF215981.1|AF215981[7546844]

[5217] 9066: AF065440 Homo sapiens low density lipoprotein receptor-related protein II (LRP2) gene, exon 1 and partial cds gi|7534311|gb|AF065440.2|AF065440[7534311]

[5218] 9068: AF228458 Homo sapiens GABAA receptor gamma 3 subunit (GABRG3) gene, exon 10 and partial cds gi|7530451|gb|AF228458.1|AF228450S9[7530451]

[5219] 9069: AF228457 Homo sapiens GABAA receptor gamma 3 subunit (GABRG3) gene, exon 9 gi|7530450|gb|AF228457.1|AF228450S8[7530450]

[5220] 9070: AF228456 Homo sapiens GABAA receptor gamma 3 subunit (GABRG3) gene, exon 8 gi|7530449|gb|AF228456.1|AF228450S7[7530449]

[5221] 9071: AF228455 Homo sapiens GABAA receptor gamma 3 subunit (GABRG3) gene, exon 7 gi|7530448 |gb|AF228455.1|AF228450S6[7530448]

[5222] 9072: AF228454 Homo sapiens GABAA receptor gamma 3 subunit (GABRG3) gene, exon 6 gi|7530447|gb|AF228454.1|AF228450S5[7530447]

[5223] 9073: AF228453 Homo sapiens GABAA receptor gamma 3 subunit (GABRG3) gene, exon 5 gi|7530446|gb|AF228453.1|AF228450S4[7530446]

[5224] 9074: AF228452 Homo sapiens GABAA receptor gamma 3 subunit (GABRG3) gene, exon 4 gi|7530445|gb|AF228452.1|AF228450S3[7530445]

[5225] 9075: AF228451 Homo sapiens GABAA receptor gamma 3 subunit (GABRG3) gene, exon 3 gi|7530444|gb|AF228451.1|AF228450S2[7530444]

[5226] 9076: AF228450 Homo sapiens GABAA receptor gamma 3 subunit (GABRG3) gene, exon 2 gi|7530443|gb|AF228450.1|AF228450S1[7530443]

[5227] 9077: AH009226 Homo sapiens GABAA receptor gamma 3 subunit (GABRG3) gene, partial cds gi|7530442|gb|AH009226.1|SEG_AF228450S[7530442]

[5228] 9078: AJ272208 Homo sapiens mRNA for IL-1 receptor accessory protein-like 2 (IL1RAPL-2 gene) gi|7530096|emb|AJ272208.1|HSA272208[7530096]

[5229] 9081: AF056085 Homo sapiens GABA-B receptor mRNA, complete cds gi|3719225|gb|AF056085.1|AF056085[3719225]

[5230] 9083: AF161081 Homo sapiens activating receptor PILRbeta mRNA, complete cds gi|5817856|gb|AF161081.1|AF161081[5817856]

[5231] 9084: AF161080 Homo sapiens inhibitory receptor PILRalpha mRNA, complete cds gi|5817854|gb|AF161080.1|AF161080[5817854]

[5232] 9085: AF228449 Homo sapiens gamma-aminobutyric acid receptor alpha 5 subunit (GABRA5) gene, exon 10 and partial cds gi|7417243|gb|AF228449.1|AF228447S3[7417243]

[5233] 9086: AF228448 Homo sapiens gamma-aminobutyric acid receptor alpha 5 subunit (GABRA5) gene, exon 8 and partial cds gi|7417242|gb|AF228448.1|AF228447S2[7417242]

[5234] 9087: AF228447 Homo sapiens gamma-aminobutyric acid receptor alpha 5 subunit (GABRA5) gene, exons 5, 6, and partial cds gi|7417241 |gb|AF228447.1|AF228447S1[7417241]

[5235] 9088: AH009221 Homo sapiens gamma-aminobutyric acid receptor alpha 5 subunit (GABRA5), gamma-aminobutyric acid receptor alpha 5 subunit (GABRA5), and gamma-aminobutyric acid receptor alpha 5 subunit (GABRA5) genes, partial cds gi|7417240|gb|AH009221.1|SEG_AF228447S[7417240]

[5236] 9089: AF198052 Homo sapiens EVH1 domain binding protein mRNA, complete cds gi|7416992|gb|AF198052.1|AF198052[7416992]

[5237] 9091: AF159278 Homo sapiens glutamate receptor subunit 3 (GRIA3) gene, exon 17 gi|7406946|gb|AF159278.1|F159262S17[7406946]

[5238] 9092: AF159277 Homo sapiens glutamate receptor subunit 3 (GRIA3) gene, exon 16 and complete cds, alternatively spliced gi|7406945|gb|AF159277.1|F159262S16[7406945]

[5239] 9093: AF159276 Homo sapiens glutamate receptor subunit 3 (GRIA3) gene, exon 15 gi|7406944|gb|AF159276.1|F159262S15[7406944]

[5240] 9094: AF159275 Homo sapiens glutamate receptor subunit 3 (GRIA3) gene, exon 14 gi|7406943|gb|AF159275.1|F159262S14[7406943]

[5241] 9095: AF159274 Homo sapiens glutamate receptor subunit 3 (GRIA3) gene, exon 13 gi|7406942|gb|AF159274.1|F159262S13[7406942]

[5242] 9096: AF159273 Homo sapiens glutamate receptor subunit 3 (GRIA3) gene, exon 12 gi|74069411|gb|AF159273.1F159262S12[7406941]

[5243] 9097: AF159272 Homo sapiens glutamate receptor subunit 3 (GRIA3) gene, exon 11 gi|7406940 |gb|AF159272.1F159262S11[7406940]

[5244] 9098: AF159271 Homo sapiens glutamate receptor subunit 3 (GRIA3) gene, exon 10 gi|7406939|gb|AF159271.1|F159262S10[7406939]

[5245] 9099: AF159270 Homo sapiens glutamate receptor subunit 3 (GRIA3) gene, exon 9 gi|7406938|gb|AF159270.1|F159262S09[7406938]

[5246] 9100: AF159269 Homo sapiens glutamate receptor subunit 3 (GRIA3) gene, exon 8 gi|7406937|gb|AF159269.1|F159262S08[7406937]

[5247] 9101: AF159268 Homo sapiens glutamate receptor subunit 3 (GRIA3) gene, exon 7 gi|7406936|gb|AF159268.1|F159262S07[7406936]

[5248] 9102: AF159267 Homo sapiens glutamate receptor subunit 3 (GRIA3) gene, exon 6 gi|7406935|gb|AF159267.1|F159262S06[7406935]

[5249] 9103: AF159266 Homo sapiens glutamate receptor subunit 3 (GRIA3) gene, exon 5 gi|7406934|gb|AF159266.1|F159262S05[7406934]

[5250] 9104: AF159265 Homo sapiens glutamate receptor subunit 3 (GRIA3) gene, exon 4 gi|7406933|gb|AF159265.1|F159262S04[7406933]

[5251] 9105: AF159264 Homo sapiens glutamate receptor subunit 3 (GRIA3) gene, exon 3 gi|7406932|gb|AF159264.1|F159262S03[7406932]

[5252] 9106: AF159263 Homo sapiens glutamate receptor subunit 3 (GRIA3) gene, exon 2 gi|7406931|gb|AF159263.1|F159262S02[7406931]

[5253] 9107: AF159262 Homo sapiens glutamate receptor subunit 3 (GRIA3) gene, exon 1 gi|7406930|gb|AF159262.1|F159262S01[7406930]

[5254] 9108: AH009217 Homo sapiens glutamate receptor subunit 3 (GRIA3) gene, complete cds, alternatively spliced gi|7406929|gb|AH009217.1|SEG_F159262S[7406929]

[5255] 9109: AF176812 Homo sapiens dopamine receptor D2longer mRNA, complete cds gi|7381415|gb|AF176812.1|AF176812[7381415]

[5256] 9112: AF193507 Homo sapiens chemokine receptor (CCR11) gene, complete cds gi|7363341|gb|AF193507.1|AF193507[7363341]

[5257] 9113: AF105239 Homo sapiens killer cell immunoglobulin receptor variant (KIR3DL) gene, exon and complete cds gi|7363319|gb|AF105239.1|KIR3DL9[7363319]

[5258] 9114: AF105238 Homo sapiens killer cell immunoglobulin receptor variant (KIR3DL) gene, exon gi|7363318|gb|AF105238.1|KIR3DL8[7363318]

[5259] 9115: AF105237 Homo sapiens killer cell immunoglobulin receptor variant (KIR3DL) gene, exon gi|7363317|gb|AF105237.1|KIR3DL7[7363317]

[5260] 9116: AF105236 Homo sapiens killer cell immunoglobulin receptor variant (KIR3DL) gene, exon gi|7363316|gb|AF105236.1|KIR3DL6[7363316]

[5261] 9117: AF105235 Homo sapiens killer cell immunoglobulin receptor variant (KIR3DL) gene, exon gi|7363315|gb|AF105235.1|KIR3DL5[7363315]

[5262] 9118: AF105234 Homo sapiens killer cell immunoglobulin receptor variant (KIR3DL) gene, exon gi|7363314|gb|AF105234.1|KIR3DL4[7363314]

[5263] 9119: AF105233 Homo sapiens killer cell immunoglobulin receptor variant (KIR3DL) gene, exon gi|7363313|gb|AF105233.1|KIR3DL3[7363313]

[5264] 9120: AF105232 Homo sapiens killer cell immunoglobulin receptor variant (KIR3DL) gene, exon gi|7363312|gb|AF105232.1|KIR3DL2[7363312]

[5265] 9121: AF105231 Homo sapiens killer cell immunoglobulin receptor variant (KIR3DL) gene, exon gi|7363311|gb|AF105231.1|KIR3DL1[7363311]

[5266] 9122: AH009212 Homo sapiens killer cell immunoglobulin receptor variant (KIR3DL) gene, complete cds gi|7363310|gb[AH009212.1|SEG_KIR3DL[7363310]

[5267] 9123: AF104856 Homo sapiens killer cell immunoglobulin receptor variant (KIR3DL1) gene, exon and complete cds gi|7363308|gb|AF104856.1|HSKCIRV9[7363308]

[5268] 9124: AF104855 Homo sapiens killer cell immunoglobulin receptor variant (KIR3DL1) gene, exon gi|7363307|gb|AF104855.1|HSKCIRV8[7363307]

[5269] 9125: AF104854 Homo sapiens killer cell immunoglobulin receptor variant (KIR3DL1) gene, exon gi|7363306|gb|AF104854.1|HSKCIRV7[7363306]

[5270] 9126: AF104853 Homo sapiens killer cell immunoglobulin receptor variant (KIR3DL1) gene, exon gi|7363305|gb|AF104853.1|HSKCIRV6[7363305]

[5271] 9127: AF104852 Homo sapiens killer cell immunoglobulin receptor variant (KIR3DL1) gene, exon gi|7363304|gb|AF104852.1|HSKCIRV5[7363304]

[5272] 9128: AF104851 Homo sapiens killer cell immunoglobulin receptor variant (KIR3DL1) gene, exon gi|7363303|gb|AF104851.1|HSKCIRV4[7363303]

[5273] 9129: AF104850 Homo sapiens killer cell immunoglobulin receptor variant (KIR3DL1) gene, exon gi|7363302|gb|AF104850.1|HSKCIRV3[7363302]

[5274] 9130: AF104849 Homo sapiens killer cell immunoglobulin receptor variant (KIR3DL1) gene, exon gi|7363301|gb|AF104849.1|HSKCIRV2[7363301]

[5275] 9131: AF104848 Homo sapiens killer cell immunoglobulin receptor variant (KIR3DL1) gene, exon gi|7363300|gb|AF104848.1|HSKCIRV1[7363300]

[5276] 9132: AH009211 Homo sapiens killer cell immunoglobulin receptor variant (KIR3DL1) gene, complete cds gi|7363299|gb|AH009211.1|SEG_HSKCIRV[7363299]

[5277] 9136: AF130742 AF130742 Homo sapiens LNCaP prostate cancer Homo sapiens cDNA, mRNA sequence gi|7330628|gb|AF130742.1|AF130742[7330628]

[5278] 9137: AF130741 AF130741 Homo sapiens LNCaP prostate cancer Homo sapiens cDNA, mRNA sequence gi|7330627|gb|AF130741.1|AF130741[7330627]

[5279] 9138: AF130740 AF130740 Homo sapiens LNCaP prostate cancer Homo sapiens cDNA, mRNA sequence gi|7330626|gb|AF130740.1|AF130740[7330626]

[5280] 9139: AF130739 AF130739 Homo sapiens LNCaP prostate cancer Homo sapiens cDNA, mRNA sequence gi|7330625|gb|AF130739.1|AF130739[7330625]

[5281] 9140: AF130738 AF130738 Homo sapiens LNCaP prostate cancer Homo sapiens cDNA, mRNA sequence gi|7330624|gb|AF130738.1|AF130738[7330624]

[5282] 9141: AF130737 AF130737 Homo sapiens LNCaP prostate cancer Homo sapiens cDNA, mRNA sequence gi|7330623|gb|AF130737.1|AF130737[7330623]

[5283] 9142: AF130743 AF130743 Homo sapiens LNCaP prostate cancer Homo sapiens cDNA, mRNA sequence gi|7330622|gb|AF130743.1|AF130743[7330622]

[5284] 9143: AB032593 Homo sapiens mRNA for PXR2b, complete cds gi|7328930|dbj |AB032593.1|AB032593[7328930]

[5285] 9144: AB032592 Homo sapiens mRNA for PXR2a, complete cds gi|7328928|dbj|AB032592.1|AB032592[7328928]

[5286] 9145: AF110640 Homo sapiens orphan seven-transmembrane receptor (VSHK1) mRNA, complete cds gi|732855|gb|AF110640.1|AF110640[7328551]

[5287] 9147: AF181286 Homo sapiens mutant dystrophin mRNA, partial cds gi|7321332|gb|AF181286.1|AF181286[7321332]

[5288] 9148: AF181285 Homo sapiens X-linked interleukin-1 receptor accessory protein-like 2 (IL1RAPL2) mRNA, partial cds gi|7321330|gb|AF181285.1|AF181285[7321330]

[5289] 9149: AF181284 Homo sapiens X-linked interleukin-1 receptor accessory protein-like 1 (IL1RAPL1) mRNA, complete cds gi|7321328|gb|AF181284.1|AF181284[7321328]

[5290] 9150: G64286 34 Human Homo sapiens STS cDNA, sequence tagged site gi|7274484|gb|G64286.1|G64286[7274484]

[5291] 9151: AF145712 Homo sapiens soluble neuropilin-1 mRNA, complete cds gi|7271464|gb|AF145712.1|AF145712[7271464]

[5292] 9180: AB031325 Homo sapiens gene for calcium-sensing receptor, exons, promoter region gi|7023984|dbj|AB031325.1|AB031325[7023984]

[5293] 9183: AF112461 Homo sapiens G protein-coupled receptor 57 (GPR57) gene, complete cds gi|6739495|gb|AF112461.1|AF112461[6739495]

[5294] 9184: AF112460 Homo sapiens G protein-coupled receptor 58 (GPR58) gene, complete cds gi|6739493|gb|AF112460.1|AF112460[6739493]

[5295] 9185: AF184174 Homo sapiens somatostatin receptor 2 (SSTR2) gene, complete cds, alternatively spliced gi|7229402|gb|AF184174.1|AF184174[7229402]

[5296] 9227: AF175207 Homo sapiens lectin-like receptor F1, splice variant 1 KLRF1-s1 (KLRF1) mRNA, complete cds gi|7188568|gb|AF175207.1|AF175207[7188568]

[5297] 9228: AF175206 Homo sapiens lectin-like receptor F1 (KLRF1) mRNA, complete cds gi|7188566|gb|AF175206.1|AF175206[7188566]

[5298] 9229: AJ271348 Homo sapiens partial DRD3 gene for dopamine D3 receptor, exon 1 gi|7159738|emb|AJ271348.2|HSA271348[7159738]

[5299] 9236: AF180814 Homo sapiens peroxisomal PTS2 receptor (PEX7) gene, exon 10 and complete cds gi|7157949|gb|AF180814.1|HSPEX7NB9[7157949]

[5300] 9237: AF180813 Homo sapiens peroxisomal PTS2 receptor (PEX7) gene, exon 9 gi|7157948|gb|AF180813.1|HSPEX7NB8[7157948]

[5301] 9238: AF180812 Homo sapiens peroxisomal PTS2 receptor (PEX7) gene, exon 8 gi|7157947|gb|AF180812.1|HSPEX7NB7[7157947]

[5302] 9239: AF180811 Homo sapiens peroxisomal PTS2 receptor (PEX7) gene, exon 7 gi|7157946|gb|AF180811.1|HSPEX7NB6[7157946]

[5303] 9240: AF180810 Homo sapiens peroxisomal PTS2 receptor (PEX7) gene, exon 6 gi|7157945|gb|AF180810.1|HSPEX7NB5[7157945]

[5304] 9241: AF180809 Homo sapiens peroxisomal PTS2 receptor (PEX7) gene, exons 4 and 5 gi|7157944|gb|AF180809.1|HSPEX7NB4[7157944]

[5305] 9242: AF180808 Homo sapiens peroxisomal PTS2 receptor (PEX7) gene, exon 3 gi|7157943|gb|AF180808.1|HSPEX7NB3[7157943]

[5306] 9243: AF180807 Homo sapiens peroxisomal PTS2 receptor (PEX7) gene, exon 2 gi|7157942|gb|AF180807.1|HSPEX7NB2[7157942]

[5307] 9244: AF180806 Homo sapiens peroxisomal PTS2 receptor (PEX7) gene, 5′ region and exon 1 gi|7157941|gb|AF180806.1|HSPEX7NB1[7157941]

[5308] 9245: AH009157 Homo sapiens peroxisomal PTS2 receptor (PEX7) gene, complete cds gi|7157940|gb|AH009157.1|SEG_HSPEX7NB[7157940]

[5309] 9246: AF087930 Homo sapiens olfactory receptor 17-228 (OR3A2) gene, complete cds gi|7144641|gb|AF087930.1|AF087930[7144641]

[5310] 9248: AF087928 Homo sapiens olfactory receptor 17-209 (OR1G1) gene, complete cds gi|7144638|gb|AF087928.1|AF087928[7144638]

[5311] 9250: AF087926 Homo sapiens olfactory receptor 17-201 (OR3A3) gene, complete cds gi|7144635|gb|AF087926.1|AF087926[7144635]

[5312] 9251: AF087925 Homo sapiens olfactory receptor 17-93 (OR1E2) gene, complete cds gi|7144633|gb|AF087925.1|AF087925[7144633]

[5313] 9252: AF087924 Homo sapiens olfactory receptor 17-40 (OR3A1) gene, complete cds gi|7144631|gb|AF087924.1|AF087924[7144631]

[5314] 9253: AF087923 Homo sapiens olfactory receptor 17-31 (ORID5) gene, complete cds gi|71446291|gb|AF087923.1|AF087923[7144629]

[5315] 9254: AF087922 Homo sapiens olfactory receptor 17-30 (OR1D4) gene, complete cds gi|7144627|gb|AF087922.1|AF087922[7144627]

[5316] 9258: AF087918 Homo sapiens olfactory receptor 17-7 (OR1A1) gene, complete cds gi|7144622|gb|AF087918.1|AF087918[7144622]

[5317] 9259: AF087917 Homo sapiens olfactory receptor 17-4 (OR1|D2) gene, complete cds gi|7144620|gb|AF087917.1|AF087917[7144620]

[5318] 9260: AF087916 Homo sapiens olfactory receptor 17-2 (OR1E1) gene, complete cds gi|7144618|gb|AF087916.1|AF087916[7144618]

[5319] 9262: AC010582 Homo sapiens chromosome 14 clone CTD-2547F10, complete sequence gi|6721135|gb|AC010582.6|AC010582[6721135]

[5320] 9263: AC010072 Homo sapiens chromosome 14q31 clone CTD-2173I4 containing TSHR gene, partial cds; and unknown gene, complete sequence gi|6453843|gb|AC010072.5|AC010072[6453843]

[5321] 9264: AF155225 Homo sapiens olfactory receptor 17-6 (OR1A2) gene, complete cds gi|5081803|gb|AF155225.1|AF155225[5081803]

[5322] 9265: AC007262 Homo sapiens chromosome 14 clone containing gene for thyroid stimulating hormone receptor, partial CDS, complete sequence gi|4883585|gb|AC007262.1|AC007262[4883585]

[5323] 9266: AC002085 Homo sapiens Chromosome 17p13 Cosmid Clone cos26, complete sequence gi|4835805|gb|AC002085.2|AC002085[4835805]

[5324] 9267: AC006531 Homo sapiens chromosome 16 clone 113K5, complete sequence gi|4235137|gb|AC006531.1|AC006531[4235137]

[5325] 9268: AC004164 Homo sapiens chromosome 19, cosmid R26450, complete sequence gi|2905827|gb|AC004164.1|AC004164[2905827]

[5326] 9269: AF200949 Homo sapiens C-type lectin-like receptor-1 mRNA, complete cds gi|7110215|gb|AF200949.1|AF200949[7110215]

[5327] 9277: AF124841 Homo sapiens C-type lectin-like receptor-2 mRNA, complete cds gi|7109730|gb|AF124841.1|AF124841[7109730]

[5328] 9278: AF210818 Homo sapiens SWAP-70 mRNA, complete cds gi|6691098|gb|AF210818.1|AF210818[6691098]

[5329] 9281: AF134838 Homo sapiens endocytic receptor Endol180 (ENDO180) mRNA, complete cds gi|4835877|gb1AF134838.1|AF134838[4835877]

[5330] 9282: U89326 Homo sapiens bone morphogenetic protein receptor type I ALK-6 mRNA, complete cds gi|3377788|gb|U89326.1|HSU89326[3377788]

[5331] 9283: AJ003080 Homo sapiens mRNA for serotonin receptor (short isoform) gi|3115225|emb1AJ003080.1|HSAJ3080[3115225]

[5332] 9284: AJ003079 Homo sapiens mRNA for 5-hydroxytryptamine3 receptor gi|3115223|emb|AJ003079.1|HSAJ3079[3115223]

[5333] 9285: AJ003078 Homo sapiens mRNA for 5-HT3 serotonin receptor (long isoform) gi|31152211emb|AJ003078.1|HSAJ3078[3115221]

[5334] 9286: AC024126 Homo sapiens chromosome 11 clone cosmid f-o-8180 map 11q13, *** SEQUENCING IN PROGRESS ***, 2 ordered pieces gi|7025812|gb|AC024126.1|AC024126[7025812]

[5335] 9287: AC024124 Homo sapiens chromosome 11 clone cosmid b-o-7185 map 11q13, *** SEQUENCING IN PROGRESS ***, 4 ordered pieces gi|7025810|gb|AC024124.1|AC024124[7025810]

[5336] 9288: AC024123 Homo sapiens chromosome 11 clone bac67-m-5 map 11q13, *** SEQUENCING IN PROGRESS ***, 3 ordered pieces gi|7025809|gb|AC024123.1|AC024123[7025809]

[5337] 9289: AF226728 Homo sapiens somatostatin receptor-interacting protein splice variant b (SSTRIP) mRNA, complete cds gi|7025450|gb|AF226728.1|AF226728[7025450]

[5338] 9290: AL157442 Homo sapiens mRNA; cDNA DKFZp586P1424 (from clone DKFZp586P1424); partial cds gi|7018558|emb|AL157442.1|HSM802508[7018558]

[5339] 9291: AF217796 Homo sapiens SCG10 like-protein, helicase-like protein NHL, M68, and ADP-ribosylation factor related protein 1 (ARFRP1) genes, complete cds gi|7012928|gb|AF217796.1|AF217796[7012928]

[5340] 9293: AL137719 Homo sapiens mRNA; cDNA DKFZp434K1831 (from clone DKFZp434K1831); partial cds gi|6808155|emb|AL137719.1|HSM802224[6808155]

[5341] 9294: AL137432 Homo sapiens mRNA; cDNA DKFZp761E1824 (from clone DKFZp761E1824); partial cds gi|6807990|emb|AL137432.1|HSM802135[6807990]

[5342] 9295: AL137375 Homo sapiens mRNA; cDNA DKFZp434I1926 (from clone DKFZp434I1926); partial cds gi|6807903|emb|AL137375.1|HSM802063[6807903]

[5343] 9296: AL137288 Homo sapiens mRNA; cDNA DKFZp434F1516 (from clone DKFZp434F1516); partial cds gi|6807745|emb|AL137288.1|HSM801953[6807745]

[5344] 9297: AL137651 Homo sapiens mRNA; cDNA DKFZp434O0213 (from clone DKFZp434O0213); partial cds gi|6807717|emb|AL137651.1|HSM801924[6807717]

[5345] 9298: AL133666 Homo sapiens mRNA; cDNA DKFZp434C1418 (from clone DKFZp434C1418); partial cds gi|6599298|emb|AL133666.1|HSM801500[6599298]

[5346] 9299: AL133097 Homo sapiens mRNA; cDNA DKFZp434N1928 (from clone DKFZp434N1928) gi|6453551|emb|AL133097.1|HSM801374[6453551]

[5347] 9300: AL133058 Homo sapiens mRNA; cDNA DKFZp434KO615 (from clone DKFZp434K0615); partial cds gi|6453479|emb|AL133058.1|HSM801329(6453479]

[5348] 9301: AL133030 Homo sapiens mRNA; cDNA DKFZp434H177 (from clone DKFZp434H177); partial cds gi|6453431|emb|AL133030.1|HSM801297[6453431]

[5349] 9304: AL117432 Homo sapiens mRNA; cDNA DKFZp434E066 (from clone DKFZp434E066); partial cds gi|5911868|emb|AL117432.1|HSM800941[5911868]

[5350] 9305: AL096753 Homo sapiens mRNA; cDNA DKFZp434C192 (from clone DKFZp434C192); partial cds gi|5419889|emb|AL096753.1|HSM800719[5419889]

[5351] 9306: AL080164 Homo sapiens mRNA; cDNA DKFZp564C1940 (from clone DKFZp564C1940); partial cds gi|5262628|emb|AL080164.1|HSM800683[5262628]

[5352] 9307: AL050071 Homo sapiens mRNA; cDNA DKFZp566B0846 (from clone DKFZp566B0846); partial cds gi|4884302|emb|AL050071.1|HSM800396[4884302]

[5353] 9308: AL049924 Homo sapiens mRNA; cDNA DKFZp564G1182 (from clone DKFZp564G1182); partial cds gi|4884170|emb|AL049924.1|HSM800265[4884170]

[5354] 9309: X68559 Homo sapiens partial FGFR-4 gene for acidic fibroblast growth factor gi|556841|emb|X68559.1|HSFGRF[556841]

[5355] 9310: AF228312 Homo sapiens T-cell receptor zeta chain precursor, mRNA, partial cds gi|6984206|gb|AF228312.1|AF228312[6984206]

[5356] 9311: AF199028 Homo sapiens B7-like protein (GL50) mRNA, complete cds gi|6983943|gb|AF199028.1|AF199028[6983943]

[5357] 9315: AF225903 Homo sapiens |D1 dopamine receptor interacting protein calcyon mRNA, complete cds gi|6980075|gb|AF225903.1|AF225903[6980075]

[5358] 9316: AF222340 Homo sapiens type 1 tumor necrosis factor receptor shedding aminopeptidase regulator mRNA, complete cds gi|6979942|gb|AF222340.1|AF222340[6979942]

[5359] 9317: AF201349 Homo sapiens glutamate receptor C gene, partial cds gi|6690029|gb|AF201349.1|AF201349[6690029]

[5360] 9318: AF201343 Homo sapiens glutamate receptor B flop isoform and glutamate receptor B flip isoform genes, partial cds gi|6690023|gb|AF201343.1|AF201343[6690023]

[5361] 9319: AJ271729 Homo sapiens mRNA for glucose-regulated protein (HSPA5 gene) gi|6900103|emb|AJ271729.1|HSA271729[6900103]

[5362] 9320: AF217794 Homo sapiens M68E mRNA, alternatively spliced, complete cds gi|6969262|gb|AF217794.1|AF217794[6969262]

[5363] 9321: AF217793 Homo sapiens M68C mRNA, alternatively spliced, complete cds gi|69692601|gb|AF217793.1|AF217793[6969260]

[5364] 9322: AF152238 Homo sapiens V1b vasopressin receptor (VPR3) gene, complete cds gi|6969252|gb|AF152238.1|AF152238[6969252]

[5365] 9325: X89271 H. sapiens mRNA for HG11 orphan receptor gi|6911643|emb|X89271.1|HSHG11ORP[6911643]

[5366] 9328: AJ240085 Homo sapiens mRNA for T-cell receptor interacting molecule protein, splice variant (TRIM gene) gi|6911580|emb|AJ240085.1|HSA240085[6911580]

[5367] 9330: AJ271684 Homo sapiens mRNA for myeloid DAP12-associating lectin (MDL-1 gene) gi|6900101|emb|AJ271684.1|HSA271684[6900101]

[5368] 9331: AJ243213 Homo sapiens partial 5-HT4 receptor gene, exons 2 to 5 gi|6900061|emb|AJ243213.1|HSA243213[6900061]

[5369] 9332: AC003075 Human PAC clone RP4-658N5 from 7p21, complete sequence gi|2588637|gb|AC003075.1|AC003075[2588637]

[5370] 9333: AC003078 Human BAC clone GS1-117010 from 7q21-q22, complete sequence gi|258863|gb|AC003078.1|AC003078[2588631]

[5371] 9334: AC002381 Human BAC clone CTB-20D2 from 7q22, complete sequence gi|2275186|gb|AC002381.1|AC002381[2275186]

[5372] 9335: AC005155 Homo sapiens PAC clone RP5-877J2 from 7p14-p15, complete sequence gi|3242760|gb|AC005155.1|AC005155[3242760]

[5373] 9338: D50678 Human mRNA for apolipoprotein E receptor 2, complete cds gi|1321643|dbj|D50678.1|D50678[1321643]

[5374] 9339: D31770 Human osteosarcoma mRNA for activin typeII A receptor, complete cds gi|1321631|dbj|D31770.1|HUMACTRIIA[1321631]

[5375] 9340: D50516 Human mRNA for type II receptor for bone morphogenetic protein-4, complete cds gi|807712|dbj|D50516.1|HUMBMP4A[807712]

[5376] 9341: D31661 Human mRNA for tyrosine kinase, complete cds gi|495677|dbj|D31661.1|HUMERKA[495677]

[5377] 9342: D17516 Homo sapiens mRNA for PACAP receptor, complete cds gi|457562|dbj|D17516.1|HUMPACAPR[457562]

[5378] 9343: D16105 Human mRNA for leukocyte tyrosine kinase, complete cds gi|440854|dbj|D16105.1|HUMLTKLP2[440854]

[5379] 9344: D16494 Human mRNA for very low density lipoprotein receptor, complete cds gi|391735|dbj|D16494.1|HUMVLDLRB[391735]

[5380] 9345: D16493 Human mRNA for very low density lipoprotein receptor, complete cds gi|391733|dbj|D16493.1|HUMVLDLRA[391733]

[5381] 9346: G63891 GRM7 Human Homo sapiens STS genomic 3′, sequence tagged site gi|6842052|gb|G63891.1|G63891[6842052]

[5382] 9347: G63890 GRM4 Human Homo sapiens STS genomic 5′, sequence tagged site gi|6842051|gb|G63890.1|G63890[6842051]

[5383] 9471: AF148806 Homo sapiens dopamine receptor D2 (DRD2) gene, 51-flanking region and exon 1 gi|6759904|gb|AF148806.1|AF148806[6759904]

[5384] 9473: AF189251 Homo sapiens cytomegalovirus partial fusion receptor mRNA, partial cds gi|6760349|gb|AF189251.1|AF189251[6760349]

[5385] 9474: AF202063 Homo sapiens fibroblast growth factor receptor 4, soluble-form splice variant (FGFR4) mRNA, complete cds gi|6739817|gb|AF202063.1|AF202063[6739817]

[5386] 9475: AF201951 Homo sapiens high affinity immunoglobulin epsilon receptor beta subunit mRNA, complete cds gi|6563299|gb|AF201951.1|AF201951[6563299]

[5387] 9476: AB037108 Homo sapiens mRNA for seven transmembrane domain orphan receptor, complete cds gi|6729335|dbj|AB037108.1|AB037108[6729335]

[5388] 9478: AF209721 Homo sapiens IgG Fc receptor locus, partial sequence gi|6715394|gb|AF209721.1|AF209721[6715394]

[5389] 9480: AJ238323 Homo sapiens mRNA for NK inhibitory receptor (IRC2) gi|6707798|emb|AJ238323.1|HSA238323[6707798]

[5390] 9481: AB036432 Homo sapiens RAGE mRNA for advanced glycation endproducts receptor, complete cds gi|6691625|dbj|AB036432.1|AB036432[6691625]

[5391] 9482: AF192548 Homo sapiens tumor necrosis factor receptor-like protein ZTNFR9 (ZTNFR9) mRNA, complete cds gi|6319129|gb|AF192548.1|AF192548[6319129]

[5392] 9483: AF184971 Homo sapiens class II cytokine receptor ZCYTOR7 (ZCYTOR7) mRNA, complete cds gi|6013324|gb|AF184971.1|AF184971[6013324]

[5393] 9484: AJ012288 Homo sapiens mRNA for GABA-BR1 gi|4186035|emb|AJ012288.1|HSA012288[4186035]

[5394] 9485: AB035073 Homo sapiens mRNA for platelet glycoprotein VI, complete cds gi|6691622|dbj|AB035073.1|AB035073[6691622]

[5395] 9486: AF217403 Homo sapiens low density lipoprotein receptor (LDLR) gene, partial cds gi|6691160|gb|AF217403.1|AF217403[6691160]

[5396] 9487: AF200465 Homo sapiens coxsackievirus and adenovirus receptor (CXADR) gene, complete cds; and ANA gene, partial cds gi|6690789|gb|AF200465.1|AF200465[6690789]

[5397] 9509: AJ243342 Homo sapiens mRNA for nicotinic acetylcholine receptor alpha 9 subunit (NACHRA9 gene) gi|6688135|emb|AJ243342.1|HSA243342[6688135]

[5398] 9510: AJ223183 Homo sapiens mRNA for DORA protein gi|3925598|emb|AJ223183.1|HSAJ3183[3925598]

[5399] 9512: AF006265 Homo sapiens cancer associated surface antigen (RCAS1) mRNA, complete cds gi|2213933|gb|AF006265.1|AF006265[2213933]

[5400] 9513: AF159570 Homo sapiens regulator of G-protein signalling 5 (RGS5) mRNA, complete cds gi|5230675|gb|AF159570.1|AF159570[5230675]

[5401] 9515: D29952 Human DNA for alphalA/D adrenergic receptor, complete cds gi|914933|dbj|D29952.1|HUMA1ADAR[914933]

[5402] 9516: NM—004441 Homo sapiens EphB1 (EPHB1) mRNA gi|4758283|ref|NM—004441.1|[4758283]

[5403] 9532: AF133299 Homo sapiens lectin-like NK cell receptor LLT1 (LLT1) mRNA, complete cds gi|6651064|gb|AF133299.1|AF133299[6651064]

[5404] 9533: AF110265 Homo sapiens epidermal growth factor receptor substrate EPS15R mRNA, complete cds gi|6650598|gb|AF110265.1|AF110265[6650598]

[5405] 9535: AF061779 Homo sapiens cosmid 25, complete sequence gi|6650204|gb|AF061779.1|AF061779[6650204]

[5406] 9537: AF118224 Homo sapiens matriptase mRNA, complete cds gi|6647301|gb|AF118224.2|AF118224[6647301]

[5407] 9538: AF125809 Homo sapiens neurotrophic receptor tyrosine kinase-ETS related protein fusion protein (NTRK3-ETV6 fusion) mRNA, partial cds gi|6635288|gb|AF125809.1|AF125809[6635288]

[5408] 9539: AF125808 Homo sapiens ETS related protein-neurotrophic receptor tyrosine kinase fusion protein (ETV6-NTRK3 fusion) mRNA, partial cds gi|6635286|gb|AF125808.1|AF125808[6635286]

[5409] 9540: AJ000542 Homo sapiens partial p58 gene for NK receptor gi|6624934|emb|AJ000542.2|HSP58NKRC[6624934]

[5410] 9541: AF190826 Homo sapiens P2X2A receptor (P2X2) gene, complete cds gi|6606329|gb|AF190826.1|AF190826[6606329]

[5411] 9542: AF190825 Homo sapiens P2X2D receptor (P2X2) mRNA, complete cds gi|6606327|gb|AF190825.1|AF190825[6606327]

[5412] 9543: AF190824 Homo sapiens P2X2C receptor (P2X2) mRNA, complete cds gi|6606325|gb|AF190824.1|AF190824[6606325]

[5413] 9544: AF190823 Homo sapiens P2X2B receptor (P2X2) mRNA, complete cds gi|6606323|gb|AF190823.1|AF190823[6606323]

[5414] 9545: AF190822 Homo sapiens P2X2A receptor (P2X2) mRNA, complete cds gi|6606321|gb|AF190822.1|AF190822[6606321]

[5415] 9546: AH008809 Homo sapiens FGF receptor activating protein 1 (FRAG1) gene, complete cds gi|6606289|gb|AH008809.1|SEG_AF159616S[6606289]

[5416] 9547: AF159621 Homo sapiens FGF receptor activating protein 1 (FRAG1) gene, exon 6 and complete cds gi|6606288|gb|AF159621.1|AF159616S6[6606288]

[5417] 9548: AF159620 Homo sapiens FGF receptor activating protein 1 (FRAG1) gene, exon 5 gi|6606287|gb|AF159620.1|AF159616S5[6606287]

[5418] 9549: AF159619 Homo sapiens FGF receptor activating protein 1 (FRAG1) gene, exon 4 gi|6606286|gb|AF159619.1|AF159616S4[6606286]

[5419] 9550: AF159618 Homo sapiens FGF receptor activating protein 1 (FRAG1) gene, exon 3 gi|6606285|gb|AF159618.1|AF159616S3[6606285]

[5420] 9551: AF159617 Homo sapiens FGF receptor activating protein 1 (FRAG1) gene, exon 2 gi|6606284|gb|AF159617.1|AF159616S2[6606284]

[5421] 9552: AF159616 Homo sapiens FGF receptor activating protein 1 (FRAG1) gene, exon 1 gi|6606283|gb|AF159616.1|AF159616S1[6606283]

[5422] 9553: AH008808 Homo sapiens PPAR gamma coactivator (PPAR gamma coactivator) gene, complete cds gi|6606153|gb|AH008808.1|SEG_F108193S[6606153]

[5423] 9554: AF108205 Homo sapiens PPAR gamma coactivator-1 (PPARGC1) gene, exon 13 and complete cds gi|6606152|gb|AF108205.1|F108193S13[6606152]

[5424] 9555: AF108204 Homo sapiens PPAR gamma coactivator-1 (PPARGC1) gene, exon 12 gi|6606151|gb|AF108204.1|F108193S12[6606151]

[5425] 9556: AF108203 Homo sapiens PPAR gamma coactivator-1 (PPARGC1) gene, exon 11 gi|6606150|gb|AF108203.1|F108193S11[6606150]

[5426] 9557: AF108202 Homo sapiens PPAR gamma coactivator-1 (PPARGC1) gene, exon 10 gi|6606149|gb|AF108202.1|F108193S10[6606149]

[5427] 9558: AF108201 Homo sapiens PPAR gamma coactivator-1 (PPARGC1) gene, exon 9 gi|6606148|gb|AF108201.1|F108193S09[6606148]

[5428] 9559: AF108200 Homo sapiens PPAR gamma coactivator-1 (PPARGC1) gene, exon 8 gi|6606147|gb|AF108200.1F108193S08[6606147]

[5429] 9560: AF108199 Homo sapiens PPAR gamma coactivator-1 (PPARGC1) gene, exon 7 gi|6606146|gb|AF108199.1|F108193S07[6606146]

[5430] 9561: AF108198 Homo sapiens PPAR gamma coactivator-1 (PPARGC1) gene, exon 6 gi|6606145|gb|AF108198.1|F108193S06[6606145]

[5431] 9562: AF108197 Homo sapiens PPAR gamma coactivator-1 (PPARGC1) gene, exon 5 gi|6606144|gb|AF108197.1F108193S05[6606144]

[5432] 9563: AF108196 Homo sapiens PPAR gamma coactivator-1 (PPARGC1) gene, exon 4 gi|6606143|gb|AF108196.1|F108193S04[6606143]

[5433] 9564: AF108195 Homo sapiens PPAR gamma coactivator-1 (PPARGC1) gene, exon 3 gi|6606142|gb|AF108195.1F108193S03[6606142]

[5434] 9565: AF108194 Homo sapiens PPAR gamma coactivator-1 (PPARGC1) gene, exon 2 gi|6606141|gb|AF108194.1|F108193S02[6606141]

[5435] 9566: AF108193 Homo sapiens PPAR gamma coactivator-1 (PPARGC1) gene, exon 1 gi|6606140|gb|AF108193.1|F108193S01[6606140]

[5436] 9567: AC005009 Homo sapiens BAC clone GS1-67A24 from 7q21.q21.2, complete sequence gi|4156150|gb|AC005009.1|AC005009[4156150]

[5437] 9568: AF047487 Homo sapiens Nck-2 (NCK2) mRNA, complete cds gi|3930216|gb|AF047487.1|AF047487[3930216]

[5438] 9569: AC004822 Homo sapiens PAC clone RP1-170D19 from Xq23, complete sequence gi|3845420|gb|AC004822.1|AC004822[3845420]

[5439] 9570: AC002543 Homo sapiens BAC clone CTA-300C3 from 7q31.2, complete sequence gi|3645947|gb|AC002543.1|AC002543[3645947]

[5440] 9571: AC002081 Homo sapiens BAC clone CTA-331C24 from 7q21, complete sequence gi|2078453|gb|AC002081.1|AC002081[2078453]

[5441] 9572: AF106698 Homo sapiens PPAR gamma coactivator-1 (PPARGC1) mRNA, complete cds gi|6594644|gb|AF106698.1|AF106698[6594644]

[5442] 9574: AH002552 Homo sapiens CHRNG gene, complete sequence; and acetylcholine receptor gamma-subunit (ACHR) gene, partial cds gi|6579185|gb|AH002552.2|SEG_HUMACHRG[6579185]

[5443] 9575: L29197 Homo sapiens acetylcholine receptor gamma-subunit (ACHR) gene, exons 10 and gi|457433|gb|L29197.1|HUMACHRG7[457433]

[5444] 9576: M11811 Homo sapiens acetylcholine receptor gamma-subunit (ACHR) gene, exon 12 and partial cds gi|177984|gb|M11811.1|HUMACHRG8[177984]

[5445] 9580: AF119666 Homo sapiens insulin receptor tyrosine kinase substrate mRNA, complete cds gi|6563257|gb|AF119666.1|AF119666[6563257]

[5446] 9581: AF109683 Homo sapiens leukocyte-associated Ig-like receptor 1b mRNA, complete cds gi|6563041|gb|AF109683.1|AF109683[6563041]

[5447] 9582: AH008758 Homo sapiens insulin-like growth factor 2 receptor (IGF2R) gene, complete cds gi|6561205|gb|AH008758.1|SEG_HSILGFR[6561205]

[5448] 9583: AF109291 Homo sapiens insulin-like growth factor 2 receptor (IGF2R) gene, exon 48 and complete cds gi|6561204|gb|AF109291.1|HSILGFR48[6561204]

[5449] 9584: AF109290 Homo sapiens insulin-like growth factor 2 receptor (IGF2R) gene, exon 47 gi|6561203|gb|AF109290.1|HSILGFR47[6561203]

[5450] 9585: AF109289 Homo sapiens insulin-like growth factor 2 receptor (IGF2R) gene, exon 46 gi|6561202|gb|AF109289.1|HSILGFR46[6561202]

[5451] 9586: AF109288 Homo sapiens insulin-like growth factor 2 receptor (IGF2R) gene, exon 45 gi|6561201|gb|AF109288.1|HSILGFR45[6561201]

[5452] 9587: AF109287 Homo sapiens insulin-like growth factor 2 receptor (IGF2R) gene, exon 44 gi|6561200|gb|AF109287.1|HSILGFR44[6561200]

[5453] 9588: AF109286 Homo sapiens insulin-like growth factor 2 receptor (IGF2R) gene, exon 43 gi|6561199|gb|AF109286.1|HSILGFR43[6561199]

[5454] 9589: AF109285 Homo sapiens insulin-like growth factor 2 receptor (IGF2R) gene, exon 42 gi|6561198|gb|AF109285.1|HSILGFR42[6561198]

[5455] 9590: AF109284 Homo sapiens insulin-like growth factor 2 receptor (IGF2R) gene, exon 41 gi|6561197|gb|AF109284.1|HSILGFR41[6561197]

[5456] 9591: AF109283 Homo sapiens insulin-like growth factor 2 receptor (IGF2R) gene, exon 40 gi|6561196|gb|AF109283.1|HSILGFR40[6561196]

[5457] 9592: AF109282 Homo sapiens insulin-like growth factor 2 receptor (IGF2R) gene, exon 39 gi|6561195|gb|AF109282.1|HSILGFR39[6561195]

[5458] 9593: AF109281 Homo sapiens insulin-like growth factor 2 receptor (IGF2R) gene, exon 38 gi|6561194|gb|AF109281.1|HSILGFR38[6561194]

[5459] 9594: AF109280 Homo sapiens insulin-like growth factor 2 receptor (IGF2R) gene, exon 37 gi|6561193|gb|AF109280.1|HSILGFR37[6561193]

[5460] 9595: AF109279 Homo sapiens insulin-like growth factor 2 receptor (IGF2R) gene, exon 36 gi|6561192|gb|AF109279.1|HSILGFR36[6561192]

[5461] 9596: AF109278 Homo sapiens insulin-like growth factor 2 receptor (IGF2R) gene, exon 35 gi|656119|gb|AF109278.1|HSILGFR35[6561191]

[5462] 9597: AF109277 Homo sapiens insulin-like growth factor 2 receptor (IGF2R) gene, exon 34 gi|6561190|gb|AF109277.1|HSILGFR34[6561190]

[5463] 9598: AF109276 Homo sapiens insulin-like growth factor 2 receptor (IGF2R) gene, exon 33 gi|6561189|gb|AF109276.1|HSILGFR33[6561189]

[5464] 9599: AF109275 Homo sapiens insulin-like growth factor 2 receptor (IGF2R) gene, exon 32 gi|6561188|gb|AF109275.1|HSILGFR32[6561188]

[5465] 9600: AF109274 Homo sapiens insulin-like growth factor 2 receptor (IGF2R) gene, exon 31 gi|6561187|gb|AF109274.1 HSILGFR31[6561187]

[5466] 9601: AF109273 Homo sapiens insulin-like growth factor 2 receptor (IGF2R) gene, exon 30 gi|6561186|gb|AF109273.1|HSILGFR30[6561186]

[5467] 9602: AF109272 Homo sapiens insulin-like growth factor 2 receptor (IGF2R) gene, exon 29 gi|6561185|gb|AF109272.1|HSILGFR29[6561185]

[5468] 9603: AF109271 Homo sapiens insulin-like growth factor 2 receptor (IGF2R) gene, exon 28 gi|6561184|gb|AF109271.1|HSILGFR28[6561184]

[5469] 9604: AF109270 Homo sapiens insulin-like growth factor 2 receptor (IGF2R) gene, exon 27 gi|6561183|gb|AF109270.1|HSILGFR27[6561183]

[5470] 9605: AF109269 Homo sapiens insulin-like growth factor 2 receptor (IGF2R) gene, exon 26 gi|6561182|gb|AF109269.1|HSILGFR26[6561182]

[5471] 9606: AF109268 Homo sapiens insulin-like growth factor 2 receptor (IGF2R) gene, exon 25 gi|6561181|gb|AF109268.1|HSILGFR25[6561181]

[5472] 9607: AF109267 Homo sapiens insulin-like growth factor 2 receptor (IGF2R) gene, exon 24 gi|6561180 |gb|AF109267.1|HSILGFR24[6561180]

[5473] 9608: AF109266 Homo sapiens insulin-like growth factor 2 receptor (IGF2R) gene, exon 23 gi|6561179|gb|AF109266.1|HSILGFR23[6561179]

[5474] 9609: AF109265 Homo sapiens insulin-like growth factor 2 receptor (IGF2R) gene, exon 22 gi|6561178|gb|AF109265.1|HSILGFR22[6561178]

[5475] 9610: AF109264 Homo sapiens insulin-like growth factor 2 receptor (IGF2R) gene, exon 21 gi|6561177|gb|AF109264.1|HSILGFR21[6561177]

[5476] 9611: AF109263 Homo sapiens insulin-like growth factor 2 receptor (IGF2R) gene, exon 20 gi|6561176|gb|AF109263.1|HSILGFR20[6561176]

[5477] 9612: AF109262 Homo sapiens insulin-like growth factor 2 receptor (IGF2R) gene, exon 19 gi|6561175|gb|AF109262.1|HSILGFR19[6561175]

[5478] 9613: AF109261 Homo sapiens insulin-like growth factor 2 receptor (IGF2R) gene, exon 18 gi|6561174|gb|AF109261.1|HSILGFR18[6561174]

[5479] 9614: AF109260 Homo sapiens insulin-like growth factor 2 receptor (IGF2R) gene, exon 17 gi|6561173|gb|AF109260.1|HSILGFR17[6561173]

[5480] 9615: AF109259 Homo sapiens insulin-like growth factor 2 receptor (IGF2R) gene, exon 16 gi|6561172|gb|AF109259.1|HSILGFR16[6561172]

[5481] 9616: AF109258 Homo sapiens insulin-like growth factor 2 receptor (IGF2R) gene, exon 15 gi|6561171|gb|AF109258.1|HSILGFR15[6561171]

[5482] 9617: AF109257 Homo sapiens insulin-like growth factor 2 receptor (IGF2R) gene, exon 14 gi|6561170|gb|AF109257.1|HSILGFR14[6561170]

[5483] 9618: AF109256 Homo sapiens insulin-like growth factor 2 receptor (IGF2R) gene, exon 13 gi|6561169|gb|AF109256.1|HSILGFR13[6561169]

[5484] 9619: AF109255 Homo sapiens insulin-like growth factor 2 receptor (IGF2R) gene, exon 12 gi|6561168|gb|AF109255.1|HSILGFR12[6561168]

[5485] 9620: AF109254 Homo sapiens insulin-like growth factor 2 receptor (IGF2R) gene, exon 11 gi|6561167|gb|AF109254.1|HSILGFR11[6561167]

[5486] 9621: AF109253 Homo sapiens insulin-like growth factor 2 receptor (IGF2R) gene, exon 10 gi|6561166|gb|AF109253.1|HSILGFR10[6561166]

[5487] 9622: AF109252 Homo sapiens insulin-like growth factor 2 receptor (IGF2R) gene, exon 9 gi|6561165|gb|AF109252.1|HSILGFR09[6561165]

[5488] 9623: AF109251 Homo sapiens insulin-like growth factor 2 receptor (IGF2R) gene, exon 8 gi|6561164|gb|AF109251.1|HSILGFR08[6561164]

[5489] 9624: AF109250 Homo sapiens insulin-like growth factor 2 receptor (IGF2R) gene, exon 7 gi|6561163|gb|AF109250.1|HSILGFR07[6561163]

[5490] 9625: AF109249 Homo sapiens insulin-like growth factor 2 receptor (IGF2R) gene, exon 6 gi|6561162|gb|AF109249.1|HSILGFR06[6561162]

[5491] 9626: AF109248 Homo sapiens insulin-like growth factor 2 receptor (IGF2R) gene, exon 5 gi|6561161|gb|AF109248.1|HSILGFR05[6561161]

[5492] 9627: AF109247 Homo sapiens insulin-like growth factor 2 receptor (IGF2R) gene, exon 4 gi|6561160|gb|AF109247.1|HSILGFR04[6561160]

[5493] 9628: AF109246 Homo sapiens insulin-like growth factor 2 receptor (IGF2R) gene, exon 3 gi|6561159|gb|AF109246.1|HSILGFR03[6561159]

[5494] 9629: AF109245 Homo sapiens insulin-like growth factor 2 receptor (IGF2R) gene, exon 2 gi|65611581|gb|AF109245.1|HSILGFR02[6561158]

[5495] 9630: AF109244 Homo sapiens insulin-like growth factor 2 receptor (IGF2R) gene, exon 1 gi|6561157|gb|AF109244.1|HSILGFR01[6561157]

[5496] 9631: AF178684 Homo sapiens class I cytokine receptor (zcytor5) mRNA, complete cds gi|5853247|gb|AF178684.1|AF178684[5853247]

[5497] 9632: AQ917583 hxa18 Bac Human I Homo sapiens genomic, genomic survey sequence gi|6552294|gb|AQ917583.1|AQ917583[6552294]

[5498] 9633: AQ917582 hxa17 Bac Human I Homo sapiens genomic, genomic survey sequence gi|6552293|gb|AQ917582.1|AQ917582[6552293]

[5499] 9634: AQ917581 hxa16 Bac Human I Homo sapiens genomic, genomic survey sequence gi|6552292|gb|AQ917581.1|AQ917581[6552292]

[5500] 9635: AQ917580 hxa15 Bac Human I Homo sapiens genomic, genomic survey sequence gi|6552291|gb|AQ917580.1|AQ917580[6552291]

[5501] 9636: AQ917579 hxa14 Bac Human I Homo sapiens genomic, genomic survey sequence gi|6552290|gb|AQ917579.1|AQ917579[6552290]

[5502] 9637: AQ917578 hxa13 Bac Human I Homo sapiens genomic, genomic survey sequence gi|6552289|gb|AQ917578.1|AQ917578[6552289]

[5503] 9638: AQ917577 hxa12 Bac Human I Homo sapiens genomic, genomic survey sequence gi|6552288|gb|AQ917577.1|AQ917577[6552288]

[5504] 9639: AQ917576 Hxa11 Bac Human I Homo sapiens genomic, genomic survey sequence gi|6552287|gb|AQ917576.1|AQ917576[6552287]

[5505] 9640: AQ917575 hxa10 Bac Human I Homo sapiens genomic, genomic survey sequence gi|6552286|gb|AQ917575.1|AQ917575[6552286]

[5506] 9641: AQ917574 hxa9 Bac Human I Homo sapiens genomic, genomic survey sequence gi|6552285|gb|AQ917574.1|AQ917574[6552285]

[5507] 9642: AQ917573 hxa8 Bac Human I Homo sapiens genomic, genomic survey sequence gi|6552284|gb|AQ917573.1|AQ917573[6552284]

[5508] 9643: AQ917572 hxa7 Bac Human I Homo sapiens genomic, genomic survey sequence gi|6552283|gb|AQ917572.1|AQ917572[6552283]

[5509] 9644: AQ917571 hxa6 Bac Human I Homo sapiens genomic, genomic survey sequence gi|6552282|gb|AQ917571.1|AQ917571[6552282]

[5510] 9645: AQ917570 hxa5 Bac Human I Homo sapiens genomic, genomic survey sequence gi|6552281|gb|AQ917570.1|AQ917570[6552281]

[5511] 9646: AQ917569 hxa4 Bac Human I Homo sapiens genomic, genomic survey sequence gi|6552280|gb|AQ917569.1|AQ917569[6552280]

[5512] 9647: AQ917568 hxa3 Bac Human I Homo sapiens genomic, genomic survey sequence gi|6552279|gb|AQ917568.1|AQ917568[6552279]

[5513] 9648: AQ917567 hxa2 Bac Human I Homo sapiens genomic, genomic survey sequence gi|6552278|gb|AQ917567.1|AQ917567[6552278]

[5514] 9649: AQ917566 hxa1 Bac Human I Homo sapiens genomic, genomic survey sequence gi|6552277|gb|AQ917566.1|AQ917566[6552277]

[5515] 9650: AH008470 Homo sapiens somatostatin receptor subtype 2 gene, partial cds gi|6531649|gb|AH008470.1|SEG_AF182397S[6531649]

[5516] 9652: AF182397 Homo sapiens somatostatin receptor subtype 2 gene, promoter region and partial cds gi|6531647|gb|AF182397.1|AF182397S1[6531647]

[5517] 9654: AF068757 Homo sapiens somatostatin receptor subtype 3 (SSTR3) gene, 5′ flanking region and partial cds gi|6523784|gb|AF068757.1|AF068757[6523784]

[5518] 9656: AF166329 Homo sapiens intermediate prolactin receptor isoform mRNA, complete cds gi|5734139|gb|AF166329.1|AF166329[5734139]

[5519] 9658: AJ251595 Homo sapiens mRNA for transmembrane glycoprotein (CD44 gene) gi|6491738|emb|AJ251595.1|HSA251595[6491738]

[5520] 9659: AF100772 Homo sapiens tenascin-M1 (TNM1) mRNA, complete cds gi|6165844|gb|AF100772.1|AF100772[6165844]

[5521] 9660: AF100634 Homo sapiens Duffy antigen/Receptor for chemokines (DARC) gene, DARC-Fya allele, partial cds gi|604895|gb|AF100634.1|AF100634[6048958]

[5522] 9661: AH008438 Homo sapiens outer membrane receptor Tom20 (TOM20) gene, complete cds gi|6469611|gb|AH008438.1|SEG_HS20TOM[6469611]

[5523] 9662: AF019638 Homo sapiens nedasin s-form mRNA, complete cds gi|6469319|gb|AF019638.1|AF019638[6469319]

[5524] 9663: AB010445 Homo sapiens mRNA for CC chemokine ILC, complete cds gi|6469037|dbj |AB010445.1|AB010445[6469037]

[5525] 9664: AF119330 Synthetic construct from Homo sapiens dopamine receptor D4-7 mRNA, partial cds gi|4325159|gb|AF119330.1|AF119330[4325159]

[5526] 9665: AF119329 Synthetic construct from Homo sapiens dopamine receptor D4-4 mRNA, partial cds gi|4325157|gb|AF119329.1|AF119329[4325157]

[5527] 9666: AF119328 Synthetic construct from Homo sapiens dopamine receptor D4-2 mRNA, partial cds gi|4325155|gb|AF119328.1|AF119328[4325155]

[5528] 9667: AL021940 Homo sapiens |DNA sequence from PAC 117P20 on chromosome 1q24. Contains the LNHR (SELL) gene coding for Lymph Node Homing Receptor (L-Selectin precursor, LAM-1 Leukocyte Adhesion Molecule, Leukocyte surface antigen Leu-8, TQ1, GP90-MEL, LECAM1 Leukocyte-Endothelial Cell Adhesion Molecule 1, CD62L). Contains the SELE gene coding for E-Selectin precursor (CD62E, ELAM-1 Endothelial Leukocyte Adhesion Molecule 1, LECAM-2 Leukocyte-Endothelial Cell Adhesion Molecule 2). Contains an unknown gene with homology to predicted yeast. plant and worm proteins. Contains ESTs and STSs, complete sequence gi|3115962|emb|AL021940.1|HS117P20[3115962]

[5529] 9668: AF152113 Homo sapiens perforin gene, IL-2 responsive enhancer sequence gi|6467393|gb|AF15213.131AF152113[6467393]

[5530] 9669: AB022178 Homo sapiens mRNA for calcitonin receptor, complete cds, isolate from bone marrow osteoclast gi|6456431|dbj|AB022178.1|AB022178[6456431]

[5531] 9670: AB022177 Homo sapiens mRNA for calcitonin receptor, complete cds, isolate from breast carcinoma gi|6456429|dbj|AB022177.1|AB022177[6456429]

[5532] 9671: AJ251004 Homo sapiens ITGB4 gene for integrin beta 4, exons 1-2 and joined CDS gi|6453379|emb|AJ251004.1|HSA251004[6453379]

[5533] 9672: AJ133822 Homo sapiens mRNA for receptor for Advanced Glycation End Product, secreted isoform (RAGEsec gene) gi|4877290|emb|AJ133822.1|HSA133822[4877290]

[5534] 9673: Y18994 Homo sapiens GABRR3 gene, partial gi|6434194|emb|Y18994.1|HSP18994[6434194]

[5535] 9676: AF177766 Homo sapiens human toll-like receptor 4 (TLR4) gene, TLR4B allele, partial cds gi|6403466|gb|AF177766.1|AF177766[6403466]

[5536] 9677: AH008297 Homo sapiens dihydropyridine receptor alpha 2 subunit (CACNA2D1) gene, complete cds gi|6090614|gb|AH008297.1|SEG_HSDRA2S[6090614]

[5537] 9678: AF083854 Homo sapiens dihydropyridine receptor alpha 2 subunit (CACNA2D1) gene, exon and complete cds gi|6090613|gb|AF083854.1|HSDRA2S38[6090613]

[5538] 9679: AF083853 Homo sapiens dihydropyridine receptor alpha 2 subunit (CACNA2D1) gene, exon gi|6090612|gb|AF083853.1|HSDRA2S37[6090612]

[5539] 9680: AF083852 Homo sapiens dihydropyridine receptor alpha 2 subunit (CACNA2D1) gene, exon gi|6090611|gb|AF083852.1|HSDRA2S36[6090611]

[5540] 9681: AF083851 Homo sapiens dihydropyridine receptor alpha 2 subunit (CACNA2D1) gene, exon gi|6090610|gb|AF083851.1|HSDRA2S35[6090610]

[5541] 9682: AF083850 Homo sapiens dihydropyridine receptor alpha 2 subunit (CACNA2D1) gene, exon gi|6090609|gb|AF083850.1|HSDRA2S34[6090609]

[5542] 9683: AF083849 Homo sapiens dihydropyridine receptor alpha 2 subunit (CACNA2D1) gene, exons 34 and 35 gi|6090608|gb|AF083849.1|HSDRA2S33[6090608]

[5543] 9684: AF083848 Homo sapiens dihydropyridine receptor alpha 2 subunit (CACNA2D1) gene, exon gi|6090607|gb|AF083848.1|HSDRA2S32[6090607]

[5544] 9685: AF083847 Homo sapiens dihydropyridine receptor alpha 2 subunit (CACNA2D1) gene, exon gi|6090606|gb|AF083847.1|HSDRA2S31[6090606]

[5545] 9686: AF083846 Homo sapiens dihydropyridine receptor alpha 2 subunit (CACNA2D1) gene, exon gi|6090605|gb|AF083846.1|HSDRA2S30[6090605]

[5546] 9687: AF083845 Homo sapiens dihydropyridine receptor alpha 2 subunit (CACNA2D1) gene, exon gi|6090604|gb|AF083845.1|HSDRA2S29[6090604]

[5547] 9688: AF083844 Homo sapiens dihydropyridine receptor alpha 2 subunit (CACNA2D1) gene, exon gi|6090603|gb|AF083844.1|HSDRA2S28[6090603]

[5548] 9689: AF083843 Homo sapiens dihydropyridine receptor alpha 2 subunit (CACNA2D1) gene, exon gi|6090602|gb|AF083843.1|HSDRA2S27[6090602]

[5549] 9690: AF083842 Homo sapiens dihydropyridine receptor alpha 2 subunit (CACNA2D1) gene, exon gi|6090601|gb|AF083842.1|HSDRA2S26[6090601]

[5550] 9691: AF083841 Homo sapiens dihydropyridine receptor alpha 2 subunit (CACNA2D1) gene, exon gi|6090600|gb|AF083841.1|HSDRA2S25[6090600]

[5551] 9692: AF083840 Homo sapiens dihydropyridine receptor alpha 2 subunit (CACNA2D1) gene, exon gi|6090599|gb|AF083840.1|HSDRA2s24[6090599]

[5552] 9693: AF083839 Homo sapiens dihydropyridine receptor alpha 2 subunit (CACNA2D1) gene, exon gi|6090598|gb|AF083839.1|HSDRA2S23[6090598]

[5553] 9694: AF083838 Homo sapiens dihydropyridine receptor alpha 2 subunit (CACNA2D1) gene, exon gi|6090597|gb|AF083838.1|HSDRA2S22[6090597]

[5554] 9695: AF083837 Homo sapiens dihydropyridine receptor alpha 2 subunit (CACNA2D1) gene, exon gi|6090596|gb|AF083837.1|HSDRA2S21[6090596]

[5555] 9696: AF083836 Homo sapiens dihydropyridine receptor alpha 2 subunit (CACNA2D1) gene, exon gi|6090595|gb|AF083836.1|HSDRA2S20[6090595]

[5556] 9697: AF083835 Homo sapiens dihydropyridine receptor alpha 2 subunit (CACNA2D1) gene, exon gi|6090594|gb|AF083835.1|HSDRA2S19[6090594]

[5557] 9698: AF083834 Homo sapiens dihydropyridine receptor alpha 2 subunit (CACNA2D1) gene, exon gi|6090593|gb|AF083834.1|HSDRA2S18[6090593]

[5558] 9699: AF083833 Homo sapiens dihydropyridine receptor alpha 2 subunit (CACNA2D1) gene, exons 17 and 18 gi|6090592|gb|AF083833.1|HSDRA2S17[6090592]

[5559] 9700: AF083832 Homo sapiens dihydropyridine receptor alpha 2 subunit (CACNA2D1) gene, exon gi|6090591|gb|AF083832.1|HSDRA2S16[6090591]

[5560] 9701: AF083831 Homo sapiens dihydropyridine receptor alpha 2 subunit (CACNA2D1) gene, exon gi|6090590|gb[AF083831.1|HSDRA2S15(6090590]

[5561] 9702: AF083830 Homo sapiens dihydropyridine receptor alpha 2 subunit (CACNA2D1) gene, exon gi|6090589|gb|AF083830.1|HSDRA2SI4[6090589]

[5562] 9703: AF083829 Homo sapiens dihydropyridine receptor alpha 2 subunit (CACNA2D1) gene, exon gi|6090588|gb|AF083829.1|HSDRA2S13[6090588]

[5563] 9704: AF083828 Homo sapiens dihydropyridine receptor alpha 2 subunit (CACNA2D1) gene, exon gi|6090587|gb|AF083828.1|HSDRA2S12[6090587]

[5564] 9705: AF083827 Homo sapiens dihydropyridine receptor alpha 2 subunit (CACNA2D1) gene, exon gi|6090586|gb|AF083827.1|HSDRA2S11[6090586]

[5565] 9706: AF083826 Homo sapiens dihydropyridine receptor alpha 2 subunit (CACNA2D1) gene, exon gi|6090585|gb|AF083826.1|HSDRA2S10[6090585]

[5566] 9707: AF083825 Homo sapiens dihydropyridine receptor alpha 2 subunit (CACNA2D1) gene, exon 9 gi|6090584|gb|AF083825.1|HSDRA2S09[6090584]

[5567] 9708: AF083824 Homo sapiens dihydropyridine receptor alpha 2 subunit (CACNA2D1) gene, exon 8 gi|6090583|gb|AF083824.1|HSDRA2S08[6090583]

[5568] 9709: AF083823 Homo sapiens dihydropyridine receptor alpha 2 subunit (CACNA2|D1) gene, exon 7 gi|6090582|gb|AF083823.1|HSDRA2SO7[6090582]

[5569] 9710: AF083822 Homo sapiens dihydropyridine receptor alpha 2 subunit (CACNA2|D1) gene, exon 6 gi|6090581|gb|AF083822.1|HSDRA2S06[6090581]

[5570] 9711: AF083821 Homo sapiens dihydropyridine receptor alpha 2 subunit (CACNA2|D1) gene, exon 5 gi|6090580|gb|AF083821.1|HSDRA2S05[6090580]

[5571] 9712: AF083820 Homo sapiens dihydropyridine receptor alpha 2 subunit (CACNA2D1) gene, exon 4 gi|6090579|gb|AF083820.1|HSDRA2S04[6090579]

[5572] 9713: AF083819 Homo sapiens dihydropyridine receptor alpha 2 subunit (CACNA2D1) gene, exon 3 gi|6090578|gb|AF083819.1|HSDRA2S03[6090578]

[5573] 9714: AF083818 Homo sapiens dihydropyridine receptor alpha 2 subunit (CACNA2D1) gene, exon 2 gi|6090577|gb|AF083818.1|HSDRA2S02[6090577]

[5574] 9715: AF083817 Homo sapiens dihydropyridine receptor alpha 2 subunit (CACNA2D1) gene, exon 1 gi|6090576|gb|AF083817.1|HSDRA2S01[6090576]

[5575] 9716: U68492 Homo sapiens 5-hydroxytryptamine 7 receptor isoform B gene, alternatively spliced, partial cds gi|1857150|gb|U68492.1|HS5HTSEV01[1857150]

[5576] 9717: AB032417 Homo sapiens FZD4 mRNA for WNT receptor Frizzled-4, complete cds gi|6277265|dbj|AB032417.1|AB032417[6277265]

[5577] 9718: AF191093 Homo sapiens P2X4 purinoceptor gene, complete cds gi|6274470|gb|AF191093.1|AF191093[6274470]

[5578] 9719: AJ130713 Homo sapiens mRNA for QA79 membrane protein, splice product airm-1 gi|5541875|emb|AJ130713.1|HSA130713[5541875]

[5579] 9720: AJ130712 Homo sapiens mRNA for QA79 membrane protein, splice product airm-3 gi|5541873|emb|AJ130712.1|HSA130712[5541873]

[5580] 9721: AJ130711 Homo sapiens mRNA for QA79 membrane protein, splice product airm-2 gi|5541871|emb|AJ130711.1|HSA130711[5541871]

[5581] 9722: AJ130710 Homo sapiens mRNA for QA79 membrane protein, allelic variant airm-1b gi|5541869|emb|AJ130710.1|HSA130710[5541869]

[5582] 9723: AJ007395 Homo sapiens mRNA for QA79 membrane protein gi|5295849|emb|AJ007395.1|HSA7395[5295849]

[5583] 9724: X95097 Homo sapiens mRNA for VIP receptor 2 gi|4837717|emb|X95097.2|HSVIP2R[4837717]

[5584] 9725: Y18423 Homo sapiens VIP2R gene, exons 1-2 (and joined CDS) gi|4753150|emb|Y18423.1|HA18423[4753150]

[5585] 9726: Y18431 Homo sapiens VIP2R gene, exon 13 gi|4741409|emb|Y18431.1|HA18431[4741409]

[5586] 9727: Y18430 Homo sapiens VIP2R gene, exons 9-12 gi|4741408|emb|Y18430.1|HA18430[4741408]

[5587] 9728: Y18429 Homo sapiens VIP2R gene, exon 8 gi|4741407|emb|Y18429.1|HA18429[4741407]

[5588] 9729: Y18428 Homo sapiens VIP2R gene, exon 7 gi|4741406|emb|Y18428.1|HA18428[4741406]

[5589] 9730: Y18427 Homo sapiens VIP2R gene, exon 6 gi|4741405|emb|Y18427.1|HA18427[4741405]

[5590] 9731: Y18426 Homo sapiens VIPR2 gene exon 5 gi|4741404|emb|Y18426.1|HA18426[4741404]

[5591] 9732: Y18425 Homo sapiens VIPR2 gene exon 4 gi|4741403|emb|Y18425.1|HA18425[4741403]

[5592] 9733: Y18424 Homo sapiens VIPR2 gene exon 3 gi|4741402|emb|Y18424.1|HA18424[4741402]

[5593] 9734: X57250 H. sapiens C5aR mRNA for C5 anaphylatoxin receptor gi|29569|emb|X57250.1|HSC5AR[29569]

[5594] 9735: AF200348 Homo sapiens melanoma-associated antigen MG50 mRNA, partial cds gi|6273398|gb|AF200348.1|AF200348[6273398]

[5595] 9736: AH008357 Homo sapiens coxsackievirus B-adenovirus receptor (CAR) gene, exon 1 gi|6224699|gb|AH008357.1|SEG_HSCXADR[6224699]

[5596] 9737: AF169366 Homo sapiens coxsackievirus B-adenovirus receptor (CAR) gene, exon 7 and complete cds gi|6224698|gb|AF169366.1|HSCXADR7[6224698]

[5597] 9738: AF169365 Homo sapiens coxsackievirus B-adenovirus receptor (CAR) gene, exon 6 gi|6224697|gb|AF169365.1|HSCXADR6[6224697]

[5598] 9739: AF169364 Homo sapiens coxsackievirus B-adenovirus receptor (CAR) gene, exon 5 gi|6224696|gb|AF169364.1|HSCXADR5[6224696]

[5599] 9740: AF169363 Homo sapiens coxsackievirus B-adenovirus receptor (CAR) gene, exon 4 gi|6224695|gb|AF169363.1|HSCXADR4[6224695]

[5600] 9741: AF169362 Homo sapiens coxsackievirus B-adenovirus receptor (CAR) gene, exon 3 gi|6224694|gb|AF169362.1|HSCXADR3[6224694]

[5601] 9742: AF169361 Homo sapiens coxsackievirus B-adenovirus receptor (CAR) gene, exon 2 gi|6224693|gb|AF169361.1|HSCXADR2[6224693]

[5602] 9743: AF169360 Homo sapiens coxsackievirus B-adenovirus receptor (CAR) gene, exon 1 gi|6224692|gb|AF169360.1|HSCXADR1[6224692]

[5603] 9744: AF181862 Homo sapiens G protein-coupled receptor mRNA, complete cds gi|6175912|gb|AF181862.1|AF181862[6175912]

[5604] 9745: AF178632 Homo sapiens FEM-1-like death receptor binding protein mRNA, complete cds gi|6175868|gb|AF178632.1|AF178632[6175868]

[5605] 9755: X80763 Homo sapiens gene for 5-hydroxytrptamine 2C receptor, exons 1 to 4 gi|602872|emb|X80763.1|HS5HT2C[602872]

[5606] 9756: X68149 Homo sapiens BLR1 gene for Burkitt's lymphoma receptor 1 gi|29459|emb|X68149.1|HSBLR1A[29459]

[5607] 9757: AF187320 Homo sapiens transferrin receptor (TFRC) gene, complete cds gi|6164847|gb|AF187320.1|AF187320[6164847]

[5608] 9758: AF154673 Homo sapiens olfactory receptor HPFH10 R (HPFH10R) gene, complete cds gi|5764388|gb|AF154673.1|AF154673[5764388]

[5609] 9760: AF169255 Homo sapiens 5-hydroxytryptamine 3 receptor B subunit (5-HTR3B) mRNA, complete cds gi|6103620|gb|AF169255.1|AF169255[6103620]

[5610] 9762: AJ133107 Homo sapiens CD163 gene, exon 17 gi|5102659|emb|AJ133107.1|HSA133107[5102659]

[5611] 9763: Y18403 Homo sapiens CD163 gene, exon 16 gi|5102656|emb|Y18403.1|HSA118403[5102656]

[5612] 9764: Y18402 Homo sapiens CD163 gene, exon 15 gi|5102655|emb|Y18402.1|HSA118402[5102655]

[5613] 9765: Y18401 Homo sapiens CD163 gene, exon 14 gi|5102654|emb|Y18401.1|HSA118401[5102654]

[5614] 9766: Y18400 Homo sapiens CD163 gene, exon 13 gi|5102653|emb|Y18400.1|HSA118400[5102653]

[5615] 9767: Y18399 Homo sapiens CD163 gene, exon 12 gi|5102652|emb|Y18399.1|HSA118399[5102652]

[5616] 9768: Y18398 Homo sapiens CD163 gene, exon 11 gi|5102651|emb|Y18398.1|HSA118398[5102651]

[5617] 9769: Y18397 Homo sapiens CD163 gene, exon 10 gi|5102650|emb|Y18397.1|HSA118397[5102650]

[5618] 9770: Y18396 Homo sapiens CD163 gene, exon 9 gi|5102649|emb|Y18396.1|HSA118396[5102649]

[5619] 9771: Y18395 Homo sapiens CD163 gene, exon 8 gi|5102648|emb|Y18395.1|HSA118395[5102648]

[5620] 9772: Y18394 Homo sapiens CD163 gene, exon 7 gi|5102647|emb|Y18394.1|HSA118394[5102647]

[5621] 9773: Y18393 Homo sapiens CD163 gene, exon 6 gi|5102646|emb|Y18393.1|HSA118393[5102646]

[5622] 9774: Y18392 Homo sapiens CD163 gene, exon 5 gi|5102645|emb|Y18392.1|HSA118392[5102645]

[5623] 9775: Y18391 Homo sapiens CD163 gene, exon 4 gi|5102644|emb|Y18391.1|HSA118391[5102644]

[5624] 9776: Y18390 Homo sapiens CD163 gene, exon 3 gi|5102643|emb|Y18390.1|HSA118390[5102643]

[5625] 9777: Y18389 Homo sapiens CD163 gene, exon 2 gi|5102642|emb|Y18389.1|HSA118389[5102642]

[5626] 9791: AF095725 Homo sapiens PAC LLNLP704E02527Q3 olfactory receptor 17-1 (OR17-1), olfactory receptor 17-2 (OR17-2), olfactory receptor 17-201 (OR17-201), and olfactory receptor 17-93 (OR17-93) genes, complete cds gi|6090622|gb|AF095725.1|AF095725[6090622]

[5627] 9792: AH007997 Homo sapiens prostaglandin E2 receptor EP2 subtype (PTGER2) gene, complete cds gi|5524234|gb|AH007997.1|SEG_HSPTGER2G[5524234]

[5628] 9793: AF134202 Homo sapiens prostaglandin E2 receptor EP2 subtype (PTGER2) gene, alternatively spliced exons and complete cds gi|5524233|gb|AF134202.1|HSPTGER2G2[5524233]

[5629] 9794: AF134201 Homo sapiens prostaglandin E2 receptor EP2 subtype (PTGER2) gene, exon 1 gi|5524232|gb|AF134201.1HSPTGER2G1[5524232]

[5630] 9797: AF139768 Homo sapiens type II transmembrane protein MDL-1 (MDL1) mRNA, complete cds gi|6049175|gb|AF139768.1|AF139768[6049175]

[5631] 9799: X75318 H. sapiens ITIH1 gene (exon 22 and ITIH3 gene (exon 1 and joining features) gi|575256|emb|X75318.1|HSITIH[575256]

[5632] 9800: AJ245822 Homo sapiens mRNA for type I transmembrane receptor (psk-3 gene) gi|6018463|emb|AJ245822.1|HSA245822[6018463]

[5633] 9801: AJ245820 Homo sapiens mRNA for type I transmembrane receptor (psk-1 gene) gi|6018459|emb|AJ245820.1|HSA245820[6018459]

[5634] 9802: L46722 Homo sapiens BTG1 binding factor 1 (CAF1) mRNA, complete cds gi|6016011|gb|L46722.1IL46722[6016011]

[5635] 9803: X87831 Homo sapiens mRNA for partial OCT/plexin-A2 protein gi|6010214|emb|X87831.2|HSOCTPROT[6010214]

[5636] 9804: AJ000994 Homo sapiens |DNA for p58 NK receptor gene gi|2764562|emb|AJ000994.1|HSP58NK[2764562]

[5637] 9805: X84761 H. sapiens LHCGR gene, exon 9 gi|1225992|emb|X84761.1|HSLHCGRX9[1225992]

[5638] 9806: X84760 H. sapiens LHCGR gene, exon 8 gi|1225991|emb|X84760.1|HSLHCGRX8[1225991]

[5639] 9807: X84759 H. sapiens LHCGR gene, exon 7 gi|1225990|emb|X84759.1|HSLHCGRX7[1225990]

[5640] 9808: X84758 H. sapiens LHCGR gene, exon 6 gi|1225989|emb|X84758.1|HSLHCGRX6[1225989]

[5641] 9809: X84757 H. sapiens LHCGR gene, exon 5 gi|1225988|emb|X84757.1|HSLHCGRX5[1225988]

[5642] 9810: X84756 H. sapiens LHCGR gene, exon 4 gi|1225987|emb|X84756.1|HSLHCGRX4[1225987]

[5643] 9811: X84754 H. sapiens LHCGR gene, exon 2 gi|1225985|emb|X84754.1|HSLHCGRX2[1225985]

[5644] 9812: X84753 H. sapiens LHCGR gene, exon 1 gi|1225983|emb|X84753.1|HSLHCGRX1[1225983]

[5645] 9813: X84763 H. sapiens LHCGR gene, exon 11 gi|1225982|emb|X84763.1|HSLHCGR11[1225982]

[5646] 9814: X84762 H. sapiens LHCGR gene, exon 10 gi|1225981|emb|X84762.1|HSLHCGR10[1225981]

[5647] 9815: AF140631 Homo sapiens G-protein coupled receptor 14 (GPR14) gene, complete cds gi|5902615|gb|AF140631.1|AF140631[5902615]

[5648] 9816: AF140630 Homo sapiens urotensin-II mRNA, complete cds gi|5902613|gb|AF140630.1|AF140630[5902613]

[5649] 9817: AF040752 Homo sapiens G protein-coupled receptor kinase 6, splice variant C (GRK6) mRNA, complete cds gi|3005017|gb|AF040752.1|AF040752[3005017]

[5650] 9818: AF040751 Homo sapiens G protein-coupled receptor kinase 6, splice variant B (GRK6) mRNA, complete cds gi|3005015|gb|AF040751.1|AF040751[3005015]

[5651] 9819: AF040753 Homo sapiens G protein-coupled receptor kinase 6 (GRK6) gene, partial cds gi|3004990|gb|AF040753.1|AF040753[3004990]

[5652] 9820: X87832 Homo sapiens mRNA for partial NOV/plexin-A1 protein gi|6010216|emb|X87832.2|HSNOVPROT[6010216]

[5653] 9821: X87904 Homo sapiens mRNA for semaphorin receptor (plexin-B1/SEP gene) gi|6010210|emb|X87904.2|HSRNASEP[6010210]

[5654] 9822: AJ011415 Homo sapiens mRNA for plexin-B1 plasma membrane receptor, splice variant R (plexin-B1/SEP gene) gi|5918166|emb|AJ011415.1|HSA011415[5918166]

[5655] 9823: AJ011414 Homo sapiens mRNA for plexin-B1 plasma membrane receptor, truncated splice variant (plexin-B1/SEP gene) gi|5918164|emb|AJ011414.1|HSA011414[5918164]

[5656] 9824: X07019 Homo sapiens partial TRDC gene for T-cell receptor delta chain, exon 1 gi|29766|emb|X07019.1|HSCD1G[29766]

[5657] 9825: X54559 Homo sapiens mRNA for met proto-oncogene gi|34557|emb|X54559.1|HSMETPRO[34557]

[5658] 9826: AF186380 Homo sapiens calcium-mobilizing lysophosphatidic acid receptor LP-A3/Edg-7 mRNA, complete cds gi|6003655|gb|AF186380.1|AF186380[6003655]

[5659] 9827: AF147204 Homo sapiens chemokine receptor CXCR4-Lo (CXCR4) mRNA, alternatively spliced, complete cds gi|6002763|gb|AF147204.1|AF147204[6002763]

[5660] 9828: AF029213 Homo sapiens IL-1 receptor accessory protein mRNA, complete cds gi|2599126|gb|AF029213.1|AF029213[2599126]

[5661] 9829: Z24462 H. sapiens MTCP-1 gene gi|406858|emb|Z24462.1|HSMTCP1B[406858]

[5662] 9830: Z24455 H. sapiens MTCP-1 gene gi|406857|emb|Z24455.1|HSMTCP1A[406857]

[5663] 9832: AF124598 Homo sapiens coxsackie and adenovirus receptor protein (HCAR2) mRNA, partial cds gi|4884701|gb|AF124598.1|AF124598[4884701]

[5664] 9833: AF124145 Homo sapiens autocrine motility factor receptor (AMFR) mRNA, complete cds gi|5931954|gb|AF124145.1|AF124145[5931954]

[5665] 9835: AF118637 Homo sapiens feline leukemia virus sugbroup C receptor FLVCR (C10) mRNA, complete cds gi|556587|gb|AF118637.1|AF118637[5565871]

[5666] 9836: AF127138 Homo sapiens lysophosphatidic acid G protein-coupled receptor (EDG7) mRNA, complete cds gi|5922724|gb|AF127138.1|AF127138[5922724]

[5667] 9837: AF104939 Homo sapiens lectomedin-1 gamma (LEC1) mRNA, complete cds gi|5880493|gb|AF104939.1|AF104939[5880493]

[5668] 9838: AF104266 Homo sapiens lectomedin-1 alpha (LEC1) mRNA, complete cds gi|5880489|gb|AF104266.1|AF104266[5880489]

[5669] 9839: X51646 Homo sapiens DRD2 gene for dopamine receptor D2 gi|30868|emb|X51646.1|HSDOPD2GE[30868]

[5670] 9840: X51645 Homo sapiens mRNA for dopamine receptor D2 (DRD2 gene) gi|30867|emb|X51645.1|HSDOPD2[30867]

[5671] 9841: AB010447 Homo sapiens mRNA for CC chemokine eotaxin3, complete cds gi|5921130|dbj|AB010447.1|AB010447[5921130]

[5672] 9844: AF137378 Homo sapiens integrin alpha 11 subunit precursor (ITGA11) mRNA, complete cds gi|5915661|gb|AF137378.2|AF137378[5915661]

[5673] 9845: AJ243212 Homo sapiens mRNA for DMBT1 protein 8kb transcript variant 2 (DMBT1/8kb.2) gi|5912463|emb|AJ243212.1|HSA243212[5912463]

[5674] 9846: AJ243874 Homo sapiens mRNA for oligophrenin-4 (OPHN4 gene) gi|5911829|emb|AJ243874.1|HSA243874[5911829]

[5675] 9847: AF091352 Homo sapiens vascular permeability factor 148 mRNA, complete cds gi|5901560|gb|AF091352.1|AF091352[5901560]

[5676] 9848: AF159456 Homo sapiens gp-340 variant protein (DMBT1) mRNA, complete cds gi|5733597|gb|AF159456.1|AF159456[5733597]

[5677] 9948: AB023486 Homo sapiens gene for histamine H2 receptor, promoter region and complete cds gi|5881575|dbj|AB023486.1|AB023486[5881575]

[5678] 9949: AF104938 Homo sapiens lectomedin-1 beta (LEC1) mRNA, complete cds gi|588049|gb|AF104938.1|AF104938[5880491]

[5679] 9950: U81379 Homo sapiens interleukin-13 receptor mRNA, complete cds gi|5870850|gb|U81379.3|HSU81379[5870850]

[5680] 9951: AH008056 Homo sapiens galanin receptor (GALR3) gene, complete cds gi|5870844|gb|AH008056.2|SEG_HSGALR3S[5870844]

[5681] 9952: AF129514 Homo sapiens galanin receptor (GALR3) gene, exon 2 and complete cds gi|5870843|gb|AF129514.2|HSGALR3S2[5870843]

[5682] 9953: AF129513 Homo sapiens galanin receptor (GALR3) gene, exon 1 gi|5870842|gb|AF129513.2|HSGALR3S1[5870842]

[5683] 9954: AF101472 Homo sapiens G protein-coupled receptor 75 (GPR75) gene, complete cds gi|4558866|gb|AF101472.1|AF101472[4558866]

[5684] 9955: AF072693 Homo sapiens G protein-coupled receptor 75 (GPR75) mRNA, complete cds gi|4406084|gb|AF072693.1|AF072693[4406084]

[5685] 9957: AJ246000 Homo sapiens mRNA for leucocyte adhesion receptor, L-selectin gi|5852071|emb|AJ246000.1|HSA246000[5852071]

[5686] 9959: AJ224864 Homo sapiens mRNA for IRC1 protein gi|5834585|emb|AJ224864.1|HSA224864[5834585]

[5687] 9960: AJ132948 Homo sapiens mRNA for rfg7 protein, partial gi|5834581|emb|AJ132948.1|HSA132948[5834581]

[5688] 9961: AB027464 Homo sapiens FZD10 mRNA for Frizzled-10, complete cds gi|5834487|dbj |AB027464.1|AB027464[5834487]

[5689] 9963: AJ133532 Homo sapiens mRNA for dendritic cell immunoreceptor gi|5823973|emb|AJ133532.1|HSA133532[5823973]

[5690] 9964: AJ223153 Homo sapiens mRNA for activating NK-A1 receptor gi|5823969|emb|AJ223153.1|HSAJ3153[5823969]

[5691] 9965: AB025257 Homo sapiens FCER1B gene for high affinity IgE receptor beta chain, promoter region, partial sequence gi|5821396|dbj|AB025257.1|AB025257[5821396]

[5692] 9970: Y16434 Homo sapiens mRNA for T-cell receptor beta, clone PPN82 gi|2879843|emb|Y16434.1|HSTCRB82[2879843]

[5693] 9971: Y16433 Homo sapiens mRNA for T-cell receptor alpha, clone PPN82 gi|2879842|emb|Y16433.1|HSTCRA82[2879842]

[5694] 9972: AF144648 Homo sapiens GABA-A receptor theta (theta) mRNA, complete cds gi|5764186|gb|AF144648.1|AF144648[5764186]

[5695] 9973: AF151104 Homo sapiens T-cell receptor gamma gene sequence gi|5758137|gb|AF151104.1|AF151104[5758137]

[5696] 9974: AF039686 Homo sapiens G-protein coupled receptor GPR34 (GPR34) mRNA, complete cds gi|5757633|gb|AF039686.1|AF039686[5757633]

[5697] 9975: AF000548 Homo sapiens P1 clone DMPC-HFF#1-1075-D9, repeat region gi|2232071|gb|AF000548.1|HSAF000548[2232071]

[5698] 9976: X83701 Homo sapiens IGF2R gene (subclone pE3UP) gi|929648|emb|X83701.1|HSIGF2RX3[929648]

[5699] 9977: X83700 Home sapiens IGF2R gene (subclone pEX2) gi|929646|emb|X83700.1|HSIGF2RX2[929646]

[5700] 9978: X83702 Homo sapiens IGF2R gene (subclone pEX3) gi|929644|emb|X83702.1|HSIGF2RI3[929644]

[5701] 9979: G16210 967A10R CEPH YAC and mega-YAC libraries (DBThompson) Homo sapiens STS genomic clone 967A10, sequence tagged site gi|1592382|gb|G16210.1|G16210[1592382]

[5702] 9980: AH008077 Homo sapiens ectodysplasin-A receptor protein (EDAR) gene, complete cds gi|5737745|gb|AH008077.1|SEG_HSEDAR[5737745]

[5703] 9981: AF130996 Homo sapiens ectodysplasin-A receptor protein (EDAR) gene, exon 12 and complete cds gi|5737744|gb|AF130996.1|HSEDAR8[5737744]

[5704] 9982: AF130995 Homo sapiens ectodysplasin-A receptor protein (EDAR) gene, exon 11 gi|5737743|gb|AF130995.1|HSEDAR7[5737743]

[5705] 9983: AF130994 Homo sapiens ectodysplasin-A receptor protein (EDAR) gene, exon 10 gi|5737742|gb|AF130994.1|HSEDAR6[5737742]

[5706] 9984: AF130993 Homo sapiens ectodysplasin-A receptor protein (EDAR) gene, exons 7, 8, and 9 gi|5737741|gb|AF130993.1|HSEDAR5[5737741]

[5707] 9985: AF130992 Homo sapiens ectodysplasin-A receptor protein (EDAR) gene, exon 6 gi|5737740|gb|AF130992.1|HSEDAR4[5737740]

[5708] 9986: AF130991 Homo sapiens ectodysplasin-A receptor protein (EDAR) gene, exon 5 gi|5737739|gb|AF13099.1|HSEDAR3[5737739]

[5709] 9987: AF130990 Homo sapiens ectodysplasin-A receptor protein (EDAR) gene, exons 2, 3, and 4 gi|5737738|gb|AF130990.1|HSEDAR2[5737738]

[5710] 9988: AF130989 Homo sapiens ectodysplasin-A receptor protein (EDAR) gene, exon 1 gi|5737737|gb|AF130989.1|HSEDAR1[5737737]

[5711] 9989: AF130988 Homo sapiens ectodysplasin-A receptor protein (EDAR) mRNA, complete cds gi|5737735|gb|AF130988.1|AF130988[5737735]

[5712] 9990: AF033111 Homo sapiens Siva-2 mRNA, complete cds gi|5737690|gb|AF033111.1|AF033111[5737690]

[5713] 9992: AJ238044 Homo sapiens mRNA for bradykinin B1 receptor (B1BKR gene) gi|5139485|emb|AJ238044.1|HSA238044[5139485]

[5714] 9993: X95425 H. sapiens mRNA for EHK-1 receptor tyrosine kinase gi|1177465|emb|X95425.1|HSEHK1[1177465]

[5715] 9995: AF135562 Homo sapiens p58 killer cell inhibitory receptor KIR-K78 (KIR-K78) mRNA, partial cds gi|5730925|gb|AF135562.1|AF135562[5730925]

[5716] 9996: AF135561 Homo sapiens p58 killer cell inhibitory receptor KIR-K65 (KIR-K65) mRNA, partial cds gi|5730923|gb|AF135561.1|AF135561[5730923]

[5717] 9997: AF135560 Homo sapiens p58 killer cell inhibitory receptor KIR-K64 (KIR-K64) mRNA, partial cds gi|5730921|gb|AF135560.1|AF135560[5730921]

[5718] 9998: AF135559 Homo sapiens p58 killer cell inhibitory receptor KIR-K61 (KIR-K61) mRNA, partial cds gi|5730919|gb|AF135559.1|AF135559[5730919]

[5719] 9999: AF135558 Homo sapiens p58 killer cell inhibitory receptor KIR-K39 (KIR-K39) mRNA, partial cds gi|5730917|gb|AF135558.1|AF135558[5730917]

[5720] 10000: AF135557 Homo sapiens p58 killer cell inhibitory receptor KIR-K36 (KIR-K36) mRNA, partial cds gi|5730915|gb|AF135557.1|AF135557[5730915]

[5721] 10001: AF135556 Homo sapiens p58 killer cell inhibitory receptor KIR-K15 (KIR-K15) mRNA, partial cds gi|5730913|gb|AF135556.1|AF135556[5730913]

[5722] 10002: AF135555 Homo sapiens p58 killer cell inhibitory receptor KIR-K9 (KIR-K9) mRNA, partial cds gi|5730911|gb|AF135555.1|AF135555[5730911]

[5723] 10003: AF135554 Homo sapiens p58 killer cell inhibitory receptor KIR-K3 (KIR-K3) mRNA, partial cds gi|5730909|gb|AF135554.1|AF135554[5730909]

[5724] 10004: AF135567 Homo sapiens p58 killer cell inhibitory receptor KIR-K7c mRNA, alternatively spliced, partial cds gi|5730907|gb|AF135567.1|AF135567[5730907]

[5725] 10005: AF135566 Homo sapiens p58 killer cell inhibitory receptor KIR-K7b mRNA, alternatively spliced, partial cds gi|5730905|gb|AF135566.1|AF135566[5730905]

[5726] 10006: AF135565 Homo sapiens p58 killer cell inhibitory receptor KIR-K7a mRNA, alternatively spliced, partial cds gi|5730903|gb|AF135565.1|AF135565[5730903]

[5727] 10007: AF135564 Homo sapiens p50 killer cell activating receptor KAR-K1d mRNA, alternatively spliced, partial cds gi|5730901|gb|AF135564.1|AF135564[5730901]

[5728] 10008: AF135563 Homo sapiens p50 killer cell activating receptor KAR-K1a mRNA, alternatively spliced, partial cds gi|5730899|gb|AF135563.1|AF135563[5730899]

[5729] 10009: AF172932 Homo sapiens MIS type II receptor (MISRII) mRNA, complete cds gi|5726642|gb|AF172932.1|AF172932[5726642]

[5730] 10010: AF162790 Homo sapiens Fc gamma receptor III-A gene, partial cds gi|5726469|gb|AF162790.1|AF162790[5726469]

[5731] 10012: AF161921 Homo sapiens clone G7 C-C chemokine receptor 5 (CCR5) mRNA, partial cds gi|5712813|gb|AF161921.1|[5712813]

[5732] 10013: AF161920 Homo sapiens clone G6 C-C chemokine receptor 5 (CCR5) mRNA, partial cds gi|5712812|gb|AF161920.1|[5712812]

[5733] 10014: AF161919 Homo sapiens clone F4 C-C chemokine receptor 5 (CCR5) mRNA, partial cds gi|5712811|gb|AF161919.1|[5712811]

[5734] 10015: AF161918 Homo sapiens clone F3 C-C chemokine receptor 5 (CCR5) mRNA, partial cds gi|5712810|gb|AF161918.1|[5712810]

[5735] 10016: AF161917 Homo sapiens clone F1.1 C-C chemokine receptor 5 (CCR5) mRNA, partial cds gi|5712809|gb|AF161917.1|[5712809]

[5736] 10017: AF161916 Homo sapiens clone H-JM-2 C-C chemokine receptor 5 (CCR5) mRNA, partial cds gi|5712808|gb|AF161916.1|[5712808]

[5737] 10018: AF161915 Homo sapiens clone JM-1 C-C chemokine receptor 5 (CCR5) mRNA, partial cds gi|5712807|gb|AF161915.1|[5712807]

[5738] 10019: AF161914 Homo sapiens clone 9/8.2 C-C chemokine receptor 5 (CCR5) mRNA, partial cds gi|5712806|gb|AF161914.1|[5712806]

[5739] 10020: AF161913 Homo sapiens clone 6-53 C-C chemokine receptor 5 (CCR5) mRNA, partial cds gi|5712805|gb|AF161913.1|[5712805]

[5740] 10021: AF161912 Homo sapiens clone 5-53 C-C chemokine receptor 5 (CCR5) mRNA, partial cds gi|5712804|gb|AF161912.1|[5712804]

[5741] 10022: AF161911 Homo sapiens clone 4-55 C-C chemokine receptor 5 (CCR5) mRNA, partial cds gi|5712803|gb|AF161911.1|[5712803]

[5742] 10023: AF161910 Homo sapiens clone 4-53 C-C chemokine receptor 5 (CCR5) mRNA, partial cds gi|5712802|gb|AF161910.1|[5712802]

[5743] 10024: AF161909 Homo sapiens clone 3-55 C-C chemokine receptor 5 (CCR5) mRNA, partial cds gi|5712801|gb|AF161909.1|[5712801]

[5744] 10025: E17202 Human cDNA for JEG18 complete cds gi|5711885|dbj|E17202.1|E17202[5711885]

[5745] 10026: E17201 Human mRNA for JEG18 complete cds gi|5711884|dbj|E17201.1|E17201[5711884]

[5746] 10027: E16188 cDNA encoding G protein-coupled receptor gi|5710871|dbj|E16188.1|E16188[5710871]

[5747] 10028: E16187 Partial sequence of cDNA encoding G protein-coupled receptor gi|5710870|dbj|E16187.1|E16187[5710870]

[5748] 10029: E16186 Partial sequence of cDNA encoding G protein-coupled receptor gi|5710869|dbj|E16186.1|E16186[5710869]

[5749] 10030: E16000 EST sequence containing human G protein-coupling receptor gene gi|5710683|dbj|E16000.1|E16000[5710683]

[5750] 10031: E15999 EST sequence containing human G protein-coupling receptor gene gi|5710682|dbj|E15999.1|E15999[5710682]

[5751] 10032: E15998 cDNA encoding G protein-coupling receptor protein gi|5710681|dbj|E15998.1|E15998[5710681]

[5752] 10033: E15997 cDNA encoding human G protein-coupling receptor protein gi|5710680|dbj|E15997.1|E15997[5710680]

[5753] 10034: E15919 cDNA encoding prostaglandin EP3-6 receptor gi|5710602|dbj|E15919.1|E15919[5710602]

[5754] 10035: E15918 cDNA encoding prostaglandin EP3-5 receptor gi|5710601|dbj|E15918.1|E15918[5710601]

[5755] 10037: E15242 Human mRNA for endothelin B receptor, complete cds gi|5709925|dbj|E15242.1|E15242[5709925]

[5756] 10038: E14946 Human mRNA for adrenaline beta 3 receptor gi|5709629|dbj|E14946.1|E14946[5709629]

[5757] 10039: E14587 Human mRNA isoform fragment for Vitamin D receptor gi|5709270|dbj|E14587.1|E14587[5709270]

[5758] 10040: E14586 Human mRNA isoform fragment for Vitamin D receptor gi|5709269|dbj|E14586.1|E14586[5709269]

[5759] 10041: E14585 Human mRNA isoform for Vitamin D receptor gi|5709268|dbj|E14585.1|E14585[5709268]

[5760] 10042: E14219 Partial sequence of human cDNA encoding a G protein-coupled receptor, 63A2full gi|5708902|dbj|E14219.1|E14219[5708902]

[5761] 10043: E14218 Partial sequence of human cDNA encoding a G protein-coupled receptor, 63A2full gi|5708901|dbj|E14218.1|E14218[5708901]

[5762] 10044: E14217 Human mRNA for a G protein-coupled receptor, 63A2full, complete cds gi|5708900|dbj|E14217.1|E14217[5708900]

[5763] 10046: X83699 Homo sapiens IGF2R gene (subclone pEX1-P) gi|1006660|emb|X83699.1|HSIGF2RX1[1006660]

[5764] 10048: AF007790 Homo sapiens ICERE-1 mRNA, complete cds gi|5670325|gb|AF007790.2|AF007790[5670325]

[5765] 10054: AF036718 Homo sapiens FGFR signalling adaptor SNT-2 mRNA, complete cds gi|2708629|gb|AF036718.1|AF036718[2708629]

[5766] 10056: AF099033 Homo sapiens gamma-aminobutyric acid type B receptor 2 (GABABR2) mRNA, complete cds gi|5639666|gb|AF099033.1|AF099033[5639666]

[5767] 10057: AF009221 Homo sapiens leucocyte immunoglobulin-like receptor-1 mRNA, complete cds gi|2267169|gb|AF009221.1|AF009221[2267169]

[5768] 10058: AF009220 Homo sapiens |eucocyte immunoglobulin-like receptor-1 mRNA, complete cds gi|2267167|gb|AF009220.1|AF009220[2267167]

[5769] 10059: AF067864 Homo sapiens transferrin receptor 2 alpha (TFR2) mRNA, complete cds gi|5596369|gb|AF067864.1|AF067864[5596369]

[5770] 10061: AF040257 Homo sapiens TNF receptor homolog mRNA, partial cds gi|3170220|gb|AF040257.1|AF040257[3170220]

[5771] 10062: AF026245 Homo sapiens yotiao mRNA, complete cds gi|2623067|gb|AF026245.1|AF026245[2623067]

[5772] 10064: AF163302 Homo sapiens somatostatin receptor interacting protein splice variant a (SSTRIP) mRNA, complete cds gi|5533304|gb|AF163302.1|AF163302[5533304]

[5773] 10065: AF153500 Homo sapiens mu opioid receptor (MOR1) gene, partial cds gi|5524612|gb|AF153500.1|AF153500[5524612]

[5774] 10066: AH007996 Homo sapiens NK receptor Ly-49L gene, complete cds gi|5524171|gb|AH007996.1|SEG_HSLY49L[5524171]

[5775] 10067: AF126038 Homo sapiens NK receptor Ly-49L gene, pseudoexon 7 gi|5524170|gb|AF126038.1|HSLY49L3[5524170]

[5776] 10068: AF126037 Homo sapiens NK receptor Ly-49L gene, exon 5, pseudoexon 6, and complete cds gi|5524169|gb|AF126037.1|HSLY49L2[5524169]

[5777] 10069: AF126036 Homo sapiens NK receptor Ly-49L gene, exons 1 through 4 gi|5524168|gb|AF126036.1|HSLY49L1[5524168]

[5778] 10070: AF081675 Homo sapiens ITIM-containing receptor MAFA-L mRNA, complete cds gi|3421400|gb|AF081675.1|AF081675[3421400]

[5779] 10071: AF145782 Homo sapiens 2B4 type I transmembrane protein mRNA, complete cds gi|5059179|gb|AF145782.1|AF145782[5059179]

[5780] 10072: AH007960 Homo sapiens receptor tyrosine kinase (EPHA1) gene, complete cds gi|545312|gb|AH007960.1|SEG_HSEPHAI[5453121]

[5781] 10073: AF101171 Homo sapiens receptor tyrosine kinase (EPHA1) gene, exon 18 and complete cds gi|5453120|gb|AF101171.1|HSEPHAI7[5453120]

[5782] 10074: AF101170 Homo sapiens receptor tyrosine kinase (EPHAL) gene, exon 17 gi|5453119|gb|AF101170.1|HSEPHAI6[5453119]

[5783] 10075: AF101169 Homo sapiens receptor tyrosine kinase (EPHAL) gene, exons 12 through 16 gi|5453118|gb|AF101169.1|HSEPHAI5[5453118]

[5784] 10076: AF101168 Homo sapiens receptor tyrosine kinase (EPHAL) gene, exons 4 through 11 gi|5453117|gb|AF101168.1|HSEPHAI4[5453117]

[5785] 10077: AF101167 Homo sapiens receptor tyrosine kinase (EPHAL) gene, exon 3 gi|5453116|gb|AF101167.1|HSEPHAI3[5453116]

[5786] 10078: AF101166 Homo sapiens receptor tyrosine kinase (EPHA1) gene, exon 2 gi|5453115|gb|AF101166.1|HSEPHAI2[5453115]

[5787] 10079: AF101165 Homo sapiens receptor tyrosine kinase (EPHAL) gene, exon 1 gi|5453114|gb|AF101165.1|HSEPHAI1[5453114]

[5788] 10080: AF107761 Homo sapiens NK cell receptor (2B4) mRNA, complete cds gi|5442467|gb|AF107761.2|AF107761[5442467]

[5789] 10081: AF109127 Homo sapiens stromal cell-derived receptor-1 alpha mRNA, complete cds gi|5442037|gb|AF109127.1|AF109127[5442037]

[5790] 10082: AF109126 Homo sapiens stromal cell-derived receptor-1 beta mRNA, complete cds gi|5442035|gb|AF109126.1|AF109126[5442035]

[5791] 10084: Y17131 Homo sapiens FGFR2 gene, exon 7 and exon 8 (partial) gi|3077606|emb|Y17131.1|HSY17131[3077606]

[5792] 10085: X57829 H. sapiens serotonin 5-HT1a receptor gene gi|36428|emb|X57829.1|HSSERR51[36428]

[5793] 10086: AF100762 Homo sapiens thyroid receptor interactor trip15 mRNA, complete cds gi|5410309|gb|AF100762.1|TRIP15[5410309]

[5794] 10087: AF109388 Homo sapiens P2X2B receptor mRNA, complete cds gi|5381338|gb|AF109388.1|AF109388[5381338]

[5795] 10088: AF109387 Homo sapiens P2X2A receptor mRNA, complete cds gi|5381336|gb|AF109387.1|AF109387[5381336]

[5796] 10089: AF118108 Homo sapiens lymphatic endothelium-specific hyaluronan receptor LYVE-1 mRNA, complete cds gi|5359672|gb|AF118108.1|AF118108[5359672]

[5797] 10090: AF119711 Homo sapiens cysLT1 LTD4 receptor (CYSLT1) mRNA, complete cds gi|5353886|gb|AF119711.1|AF119711[5353886]

[5798] 10091: X72861 H. sapiens gene for beta-3-adrenergic receptor gi|298094|emb|X72861.1|HSB3A[298094]

[5799] 10092: AF103906 Homo sapiens vanilloid receptor-like protein (VRL) mRNA, complete cds gi|5305597|gb|AF103906.1|AF103906[5305597]

[5800] 10093: AF072873 Homo sapiens frizzled 6 mRNA, complete cds gi|5305408|gb|AF072873.1|AF072873[5305408]

[5801] 10095: AF153437 Homo sapiens haplotype val92met/A942G melanocortin 1 receptor (MC1R) gene, complete cds gi|5257473|gb|AF153437.1|AF153437[5257473]

[5802] 10096: AF153436 Homo sapiens haplotype A942G melanocortin 1 receptor (MC1R) gene, complete cds gi|5257472|gb|AF153436.1|AF153436[5257472]

[5803] 10097: AF153435 Homo sapiens haplotype arg67gln/arg163gln melanocortin 1 receptor (MC1R) gene, complete cds gi|5257471|gb|AF153435.1|AF153435[5257471]

[5804] 10098: AF153434 Homo sapiens haplotype arg163gln melanocortin 1 receptor (MC1R) gene, complete cds gi|5257470|gb|AF153434.1|AF153434[5257470]

[5805] 10099: AF153433 Homo sapiens haplotype arg151cys melanocortin 1 receptor (MC1R) gene, complete cds gi|5257469|gb|AF153433.1|AF153433[5257469]

[5806] 10100: AF153432 Homo sapiens haplotype asp84glu melanocortin 1 receptor (MC1R) gene, complete cds gi|5257468|gb|AF153432.1|AF153432[5257468]

[5807] 10101: AF153431 Homo sapiens melanocortin 1 receptor (MC1R) gene, complete cds gi|5257467|gb|AF153431.1|AF153431[5257467]

[5808] 10103: AH007879 Homo sapiens macrophage receptor (MARCO) gene, complete cds gi|5231091|gb|AH007879.1|SEG_HSMARCO[5231091]

[5809] 10104: AF128186 Homo sapiens macrophage receptor (MARCO) gene, exon 17 and complete cds gi|5231090|gb|AF128186.1|HSMARCO15[5231090]

[5810] 10105: AF128185 Homo sapiens macrophage receptor (MARCO) gene, exon 16 gi|5231089|gb|AF128185.1|HSMARCO14[5231089]

[5811] 10106: AF128184 Homo sapiens macrophage receptor (MARCO) gene, exon 15 gi|5231088|gb|AF128184.1|HSMARCO13[5231088]

[5812] 10107: AF128183 Homo sapiens macrophage receptor (MARCO) gene, exon 14 gi|5231087|gb|AF128183.1|HSMARCO12[5231087]

[5813] 10108: AF128182 Homo sapiens macrophage receptor (MARCO) gene, exon 13 gi|5231086|gb|AF128182.1|HSMARCO11[5231086]

[5814] 10109: AF128181 Homo sapiens macrophage receptor (MARCO) gene, exons 11 and 12 gi|5231085|gb|AF128181.1|HSMARCO10[5231085]

[5815] 10110: AF128180 Homo sapiens macrophage receptor (MARCO) gene, exons 9 and 10 gi|5231084|gb|AF128180.1|HSMARCO09[5231084]

[5816] 10111: AF128179 Homo sapiens macrophage receptor (MARCO) gene, exon 8 gi|5231083|gb|AF128179.1|HSMARCO08[5231083]

[5817] 10112: AF128178 Homo sapiens macrophage receptor (MARCO) gene, exon 7 gi|5231082|gb|AF128178.1|HSMARCO07[5231082]

[5818] 10113: AF128177 Homo sapiens macrophage receptor (MARCO) gene, exon 6 gi|5231081|gb|AF128177.1|HSMARCO06[5231081]

[5819] 10114: AF128176 Homo sapiens macrophage receptor (MARCO) gene, exon 5 gi|5231080|gb|AF128176.1|HSMARCO05[5231080]

[5820] 10115: AF128175 Homo sapiens macrophage receptor (MARCO) gene, exon 4 gi|5231079|gb|AF128175.1|HSMARCO04[5231079]

[5821] 10116: AF128174 Homo sapiens macrophage receptor (MARCO) gene, exon 3 gi|5231078|gb|AF128174.1|HSMARCO03[5231078]

[5822] 10117: AF128173 Homo sapiens macrophage receptor (MARCO) gene, exon 2 gi|5231077|gb|AF128173.1|HSMARCO02[5231077]

[5823] 10118: AF128172 Homo sapiens macrophage receptor (MARCO) gene, exon 1 gi|5231076|gb|AF128172.1|HSMARCO01[5231076]

[5824] 10140: D50855 Human mRNA for Ca-sensing receptor, complete cds gi|904209|dbj|D50855.1|HUMCASR[904209]

[5825] 10141: D49783 Human gene for histamine H2 receptor, complete cds gi|728495|dbj|D49783.1|HUMHH2R[728495]

[5826] 10142: D16826 Human gene for fourth somatostatin receptor subtype gi|693907|dbj|D16826.1|HUMSSTR4[693907]

[5827] 10143: D29984 Human mRNA for monocyte chemoattractant protein 1 receptor (MCP-1 receptor), complete cds gi|531246|dbj|D29984.1|HUMMCP1R[531246]

[5828] 10144: D14436 Human gene for histamine H1-receptor, complete cds gi|506335|dbj|D14436.1|HUMHH1RE[506335]

[5829] 10145: D16827 Human gene for fifth somatostatin receptor subtype gi|487683|dbj|D16827.1|HUMSSTR5[487683]

[5830] 10146: D14717 Human mRNA for large erk kinase gi|285916|dbj|D14717.1|HUMERK[285916]

[5831] 10147: AF073515 Homo sapiens cytokine type 1 receptor CRLP-1 precursor, mRNA, complete cds gi|5106394|gb|AF073515.1|AF073515[5106394]

[5832] 10148: AH007696 Homo sapiens fibroblast growth factor receptor 2 (FGFR2) gene, partial cds; fibroblast growth factor receptor 2 Ksam IV secreted isoform (FGFR2) gene, complete cds; fibroblast growth factor receptor (FGFR2) gene, alternative splice products, partial cds; and fibroblast growth factor receptor 2 (FGFR2) gene, partial cds gi|4808621|gb|AH007696.1|SEG_HSFGFR2A[4808621]

[5833] 10149: AF097354 Homo sapiens fibroblast growth factor receptor 2 (FGFR2) gene, exon 20, alternative splice products and partial cds gi|4808620|gb|AF097354.1|HSFGFR2A19[4808620]

[5834] 10150: AF097353 Homo sapiens fibroblast growth factor receptor 2 (FGFR2) gene, exon 19, alternative splice products and partial cds gi|4808619|gb|AF097353.1|HSFGFR2A18[4808619]

[5835] 10151: AF097352 Homo sapiens fibroblast growth factor receptor 2 (FGFR2) gene, exon 18 gi|4808618|gb|AF097352.1|HSFGFR2Al7[4808618]

[5836] 10152: AF097351 Homo sapiens fibroblast growth factor receptor 2 (FGFR2) gene, exon 17 gi|4808617|gb|AF097351.1|HSFGFR2A16[4808617]

[5837] 10153: AF097350 Homo sapiens fibroblast growth factor receptor 2 (FGFR2) gene, exon 16 gi|4808616|gb|AF097350.1|HSFGFR2Al5[4808616]

[5838] 10154: AF097349 Homo sapiens fibroblast growth factor receptor 2 (FGFR2) gene, exon 15 gi|4808615|gb|AF097349.1|HSFGFR2A14[4808615]

[5839] 10155: AF097348 Homo sapiens fibroblast growth factor receptor 2 (FGFR2) gene, exon 14 gi|4808614|gb|AF097348.1|HSFGFR2A13[4808614]

[5840] 10156: AF097347 Homo sapiens fibroblast growth factor receptor 2 (FGFR2) gene, exon 13 gi|4808613|gb|AF097347.1|HSFGFR2A12[4808613]

[5841] 10157: AF097346 Homo sapiens fibroblast growth factor receptor 2 (FGFR2) gene, exon 12 gi|4808612|gb|AF097346.1|HSFGFR2A11[4808612]

[5842] 10158: AF097345 Homo sapiens fibroblast growth factor receptor 2 (FGFR2) gene, exons 11 and 11′ gi|4808611|gb|AF097345.1|HSFGFR2A10[4808611]

[5843] 10159: AF097344 Homo sapiens fibroblast growth factor receptor 2 (FGFR2) gene, exon 10 gi|4808610 |gb|AF097344.1|HSFGFR2A09[4808610]

[5844] 10160: AF097343 Homo sapiens fibroblast growth factor receptor 2 (FGFR2) gene, exon 9 gi|4808609|gb|AF097343.1|HSFGFR2A08[4808609]

[5845] 10161: AF097342 Homo sapiens fibroblast growth factor receptor 2 (FGFR2) gene, exon 8 gi|4808608|gb|AF097342.1|HSFGFR2A07[4808608]

[5846] 10162: AF097341 Homo sapiens fibroblast growth factor receptor 2 (FGFR2) gene, exons 6 and 7, alternative splice products and partial cds gi|4808607|gb|AF097341.1|HSFGFR2A06[4808607]

[5847] 10163: AF097340 Homo sapiens fibroblast growth factor receptor 2 (FGFR2) gene, exon 5, alternative splice products and partial cds gi|4808606|gb|AF097340.1|HSFGFR2A05[4808606]

[5848] 10164: AF097339 Homo sapiens fibroblast growth factor receptor 2 (FGFR2) gene, exon 4 gi|4808605|gb|AF097339.1|HSFGFR2A04[4808605]

[5849] 10165: AF097338 Homo sapiens fibroblast growth factor receptor 2 (FGFR2) gene, exon 3 gi|4808604|gb|AF097338.1|HSFGFR2A03[4808604]

[5850] 10166: AF097337 Homo sapiens fibroblast growth factor receptor 2 (FGFR2) gene, exon 2 gi|4808603|gb|AF097337.1|HSFGFR2A02[4808603]

[5851] 10167: AF097336 Homo sapiens fibroblast growth factor receptor 2 (FGFR2) gene, exon 1 gi|4808602|gb|AF097336.1|HSFGFR2A01[4808602]

[5852] 10168: U58146 Homo sapiens alternatively spliced interleukin-6 receptor beta chain mRNA, partial cds gi|2253597|gb|U58146.1|HSU58146[2253597]

[5853] 10169: AF134395 Homo sapiens CARD-like apoptotic protein (CLAP) mRNA, complete cds gi|507037|gb|AF134395.1|AF134395[5070371]

[5854] 10170: AF015044 Homo sapiens EH-binding protein mRNA, partial cds gi|4102712|gb|AF015044.1|AF015044[4102712]

[5855] 10171: AF015043 Homo sapiens EH-binding protein mRNA, partial cds gi|4102710|gb|AF015043.1|AF015043[4102710]

[5856] 10172: AF145207 Homo sapiens CCR9 chemokine receptor (CCR9) mRNA, partial cds gi|5052417|gb|AF145207.1|AF145207[5052417]

[5857] 10173: AB018549 Homo sapiens MD-2 mRNA, complete cds gi|5051739|dbj|AB018549.1|AB018549[5051739]

[5858] 10174: AH007443 Homo sapiens chromosome 19 clone cosmid R31931 map 19q13.4 gi|4322573|gb|AH007443.1|SEG_HSCD89S[4322573]

[5859] 10175: AF091544 Homo sapiens myeloid FcalphaRI (CD89) gene, 31 sequence gi|4322572|gb|AF091544.1|HSCD89S2[4322572]

[5860] 10177: AF152962 Homo sapiens somatostatin receptor type 5 (SSTR5) gene, promoter region and partial cds gi|5031446|gb|AF152962.1|AF152962[5031446]

[5861] 10178: AF140538 Homo sapiens histamine H3 receptor mRNA, complete cds gi|5031290|gb|AF140538.1|AF140538[5031290]

[5862] 10179: AJ238896 Homo sapiens partial RAGE gene, exons 9 to 11 gi|4867820|emb|AJ238896.1|HSA238896[4867820]

[5863] 10180: AF039904 Homo sapiens cosmid D66B10, chromosome 21 5′ of IFNAR1 gi|2853622|gb|AF039904.1|AF039904[2853622]

[5864] 10181: AF039905 Homo sapiens cosmid Q95D4, chromosome 21 5′ of IFNAR2 gi|2766549|gb|AF039905.1|AF039905[2766549]

[5865] 10182: AF039907 Homo sapiens cosmid Q50G2, chromosome 21 3′ of IFNAR1 gi|2754858|gb|AF039907.1|AF039907[2754858]

[5866] 10183: AB020807 Homo sapiens mRNA for TLR6, complete cds gi|5006247|dbj|AB020807.1|AB020807[5006247]

[5867] 10184: AF144308 Homo sapiens putative G protein-coupled receptor (DL1R) mRNA, complete cds gi|4959876|gb|AF144308.1|AF144308[4959876]

[5868] 10185: AF107262 Homo sapiens central cannabinoid receptor (CB1K5) mRNA, complete cds gi|4959366|gb|AF107262.1|AF107262[4959366]

[5869] 10263: AH007742 Homo sapiens neuronal acetylcholine receptor beta-3 subunit precursor (CHRNB3) gene, complete cds gi|4927249|gb|AH007742.1|SEG_HSCHRNB[4927249]

[5870] 10264: AF140765 Homo sapiens neuronal acetylcholine receptor beta-3 subunit precursor (CHRNB3) gene, exon 6 and complete cds gi|49272481|gb|AF140765.1|HSCHRNB6[4927248]

[5871] 10265: AF140764 Homo sapiens neuronal acetylcholine receptor beta-3 subunit precursor (CHRNB3) gene, exon 5 gi|4927247|gb|AF140764.1|HSCHRNB5[4927247]

[5872] 10266: AF140763 Homo sapiens neuronal acetylcholine receptor beta-3 subunit precursor (CHRNB3) gene, exon 4 gi|4927246|gb|AF140763.1|HSCHRNB4[4927246]

[5873] 10267: AF140762 Homo sapiens neuronal acetylcholine receptor beta-3 subunit precursor (CHRNB3) gene, exon 3 gi|4927245|gb|AF140762.1|HSCHRNB3[4927245]

[5874] 10268: AF140761 Homo sapiens neuronal acetylcholine receptor beta-3 subunit precursor (CHRNB3) gene, exon 2 gi|4927244|gb|AF14076.1|HSCHRNB2[4927244]

[5875] 10269: AF140760 Homo sapiens neuronal acetylcholine receptor beta-3 subunit precursor (CHRNB3) gene, exon 1 gi|4927243|gb|AF140760.1|HSCHRNB1[4927243]

[5876] 10270: U19261 Homo sapiens Epstein-Barr virus-induced protein mRNA, complete cds gi|675461|gb|U19261.1|HSU19261[675461]

[5877] 10272: AF105261 Homo sapiens natural killer cell receptor 2B4 mRNA, complete cds gi|4894519|gb|AF105261.1|AF105261[4894519]

[5878] 10273: AH007727 Homo sapiens prolactin receptor gene, complete cds gi|4886767|gb|AH007727.1|SEG_HSPLR[4886767]

[5879] 10274: AF091870 Homo sapiens prolactin receptor gene, alternatively spliced, exon 10 and complete cds gi|4886766|gb|AF091870.1|HSPLR12[4886766]

[5880] 10275: AF091869 Homo sapiens prolactin receptor gene, exon 9 gi|4886765|gb|AF091869.1|HSPLR11[4886765]

[5881] 10276: AF091868 Homo sapiens prolactin receptor gene, exon 8 gi|4886764|gb|AF091868.1|HSPLR10[4886764]

[5882] 10277: AF091867 Homo sapiens prolactin receptor gene, exon 7 gi|4886763|gb|AF091867.1|HSPLR09[4886763]

[5883] 10278: AF091866 Homo sapiens prolactin receptor gene, exon 6 gi|4886762|gb|AF091866.1|HSPLR08[4886762]

[5884] 10279: AF091865 Homo sapiens prolactin receptor gene, exon 5 gi|488676|gb|AF091865.1|HSPLR07[4886761]

[5885] 10280: AF091864 Homo sapiens prolactin receptor gene, exon 4 gi|4886760|gb|AF091864.1|HSPLR06[4886760]

[5886] 10281: AF091863 Homo sapiens prolactin receptor gene, exon 3 gi|4886759|gb|AF091863.1|HSPLR05[4886759]

[5887] 10282: AF091862 Homo sapiens prolactin receptor gene, exon 2 gi|4886758|gb|AF091862.1|HSPLR04[4886758]

[5888] 10283: AF091859 Homo sapiens prolactin receptor gene, promoter region and alternative exons 1 gi|4886757|gb|AF091859.1|HSPLR01[4886757]

[5889] 10284: AJ132337 Homo sapiens mRNA for chemokine receptor CCR9 gi|4886431|emb|AJ132337.1|HSA132337[4886431]

[5890] 10285: AF120152 Mus musculus cytokine receptor-like molecule 9 (Creme9) mRNA, complete cds gi|4884628|gb|AF120152.1|AF120152[4884628]

[5891] 10286: AF120151 Homo sapiens cytokine receptor-like molecule 9 (CREME9) mRNA, complete cds gi|4884626|gb|AF120151.1|AF120151[4884626]

[5892] 10287: D13814 Homo sapiens mRNA for angiotensin II type 1b receptor, complete cds gi|471120|dbj|D13814.1|HUMAGRT1B[471120]

[5893] 10288: AJ236922 Homo sapiens mRNA for metabotropic glutamate receptor 8c gi|4456479|emb|AJ236922.1|HSA236922[4456479]

[5894] 10289: AJ236921 Homo sapiens mRNA for metabotropic glutamate receptor 8b gi|4456477|emb|AJ236921.1|HSA236921[4456477]

[5895] 10478: AF106858 Homo sapiens G-protein-coupled receptor (GPR56) mRNA, complete cds gi|4836764|gb|AF106858.1|AF106858[4836764]

[5896] 10479: AF095784 Homo sapiens GABA-B receptor R2 (GABBR2) mRNA, complete cds gi|4836217|gb|AF095784.1|AF095784[4836217]

[5897] 10500: AJ006520 Homo sapiens mRNA for ml muscarinic acetylcholine receptor protein, partial gi|3292964|emb|AJ006520.1|HSA6520[3292964]

[5898] 10693: AF110907 Homo sapiens TNF-receptor associated factor-3 (TRAF-3) gene, exons 1a and 1b, complete sequence gi|4761208|gb|AF110907.1|AF110907[4761208]

[5899] 10694: AJ002425 Homo sapiens mRNA for p65 protein gi|4753767|emb|AJ002425.2|HSAJ2425[4753767]

[5900] 10697: Y15220 Homo sapiens mRNA for chemokine IP-9 gi|4225953|emb|Y15220.1|HSCHIP9RN[4225953]

[5901] 10698: AJ005282 Homo sapiens mRNA for NPR-Bi gi|3059110|emb|AJ005282.1|HSAJ5282[3059110]

[5902] 10699: AJ012188 Homo sapiens mRNA for GABAB receptor, subunit 2 gi|3776097|emb|AJ012188.1|HSA012188[3776097]

[5903] 10700: AJ012187 Homo sapiens mRNA for GABAB receptor, subunit 1c, gi|3776095|emb|AJ012187.1|HSA012187[3776095]

[5904] 10701: AJ012186 Homo sapiens mRNA for GABAB receptor, subunit 1b gi|3776093|emb|AJ012186.1|HSA012186[3776093]

[5905] 10702: AJ012185 Homo sapiens mRNA for GABAB-receptor, subunit 1a gi|3776072|emb|AJ012185.1|HSA012185[3776072]

[5906] 10704: AF129112 Homo sapiens vanilloid receptor-like protein 1 (VRL-1) mRNA, complete cds gi|4589140|gb|AF129112.1|AF129112[4589140]

[5907] 10705: AF068265 Homo sapiens monocyte chemoattractant protein 1 receptor (CCR2) gene promoter and mRNA, partial sequence gi|4587865|gb|AF068265.1|AF068265[4587865]

[5908] 10706: AB020625 Homo sapiens mRNA for butyrophilin like receptor, complete cds gi|4587208|dbj|AB020625.1|AB020625[4587208]

[5909] 10709: AH007576 Homo sapiens killer cell inhibitory receptor G9P gene, complete cds gi|4581764|gb|AH007576.1|SEG_HSKIRG9P[4581764]

[5910] 10710: AF110035 Homo sapiens killer cell inhibitory receptor G9P gene, complete cds gi|4581763|gb|AF110035.1|HSKIRG9P4[4581763]

[5911] 10711: AF110034 Homo sapiens killer cell inhibitory receptor G9P gene, partial sequence gi|4581762|gb|AF110034.1|HSKIRG9P3[4581762]

[5912] 10712: AF110033 Homo sapiens killer cell inhibitory receptor G9P gene, partial sequence gi|4581761|gb|AF110033.1|HSKIRG9P2[4581761]

[5913] 10713: AF110032 Homo sapiens killer cell inhibitory receptor G9P gene, partial sequence gi|4581760|gb|AF110032.1|HSKIRG9P1[4581760]

[5914] 10714: AF114165 Homo sapiens endothelin receptor B delta 3 mRNA, complete cds gi|4580923|gb|AF114165.1|AF114165[4580923]

[5915] 10717: AF105999 Homo sapiens acetylcholine receptor epsilon subunit (CHRNE) gene, complete cds gi|4580858|gb|AF105999.1|AF105999[4580858]

[5916] 10718: AH007573 Homo sapiens killer inhibitory receptor 1 (KIR1) gene, complete cds; and kill inhibitory receptor 2 (KIR2) gene, partial cds gi|4580703|gb|AH007573.1|SEG_HS2KIR[4580703]

[5917] 10720: AF134316 Homo sapiens killer inhibitory receptor 4-1-2 (KIR412) gene, exon 5 and partial cds gi|4580701|gb|AF134316.1|SEG_HS2KIR7[4580701]

[5918] 10721: AF134315 Homo sapiens killer inhibitory receptor 4-1-2 (KIR412) gene, exon 4 gi|4580700|gb|AF134315.1|SEG_HS2KIR6[4580700]

[5919] 10723: AF134313 Homo sapiens killer inhibitory receptor 4-1-2 (KIR412) gene, exon 2 and pseudoexon 3 gi|4580698|gb|AF134313.1|SEG_HS2KIR4[4580698]

[5920] 10724: AF134312 Homo sapiens killer inhibitory receptor 4-1-1 (KIR411) gene, exons 7, 8 and 9 and partial cds; killer inhibitory receptor 4-1-2 (KIR412) gene, exon 1 gi|4580697|gb|AF134312.1|SEG_HS2KIR3[4580697]

[5921] 10725: AF134311 Homo sapiens killer inhibitory receptor 4-1-1 (KIR411) gene, exon 6 gi|4580696|gb|AF134311.1|SEG_HS2KIR2[4580696]

[5922] 10727: AH007572 Homo sapiens killer inhibitory receptor (KIR) gene, partial cds gi|4580693|gb|AH007572.1|SEG_HSKIRP[4580693]

[5923] 10728: AF133900 Homo sapiens killer inhibitory receptor cl 2-3 (KIRCL23) gene, exons 7, 8, and 9 and partial cds gi|4580692|gb|AF133900.1|HSKIRP5[4580692]

[5924] 10729: AF133899 Homo sapiens killer inhibitory receptor cl 2-3 (KIRCL23) gene, exon 6 gi|458069|gb|AF133899.1HSKIRP4[4580691]

[5925] 10730: AF133898 Homo sapiens killer inhibitory receptor cl 2-3 (KIRCL23) gene, exon 5 gi|4580690|gb|AF133898.1|HSKIRP3[4580690]

[5926] 10731: AF133897 Homo sapiens killer inhibitory receptor cl 2-3 (KIRCL23) gene, exon 4 gi|4580689|gb|AF133897.1|HSKIRP2[4580689]

[5927] 10732: AF133896 Homo sapiens killer inhibitory receptor cl 2-3 (KIRCL23) gene, pseudoexon 3 gi|4580688|gb|AF133896.1|HSKIRP1[4580688]

[5928] 10733: AF133901 Homo sapiens killer inhibitory receptor 2-2-1 (KIR221 and killer inhibitory receptor 2-2-2 (KIR222) genes, partial cds gi|4580682|gb|AF133901.1|AF133901[4580682]

[5929] 10736: AF069755 Homo sapiens orphan G protein-coupled receptor HG20 (HG20) mRNA, complete cds gi|4091932|gb|AF069755.1|AF069755[4091932]

[5930] 10738: AC007229 Homo sapiens chromosome 19, cosmid R34187, complete sequence gi|4567173|gb|AC007229.1|AC007229[4567173]

[5931] 10740: AF125303 Homo sapiens glucocorticoid-induced TNFR-related protein ligand (TNFSF18) mRNA, complete cds gi|4558500|gb|AF125303.1|AF125303[4558500]

[5932] 10742: AF058762 Homo sapiens galanin receptor subtype 2 (GALNR2) gene, complete cds gi|3170598|gb|AF058762.1|AF058762[3170598]

[5933] 10743: AF096786 Homo sapiens chromosome 2 G protein-coupled receptor (GPR55) gene, complete cds gi|4545136|gb|AF096786.1|AF096786[4545136]

[5934] 10745: AF096784 Homo sapiens chromosome 1 G protein-coupled receptor (GPR52) gene, complete cds gi|4545133|gb|AF096784.1|AF096784[4545133]

[5935] 10746: AF119815 Homo sapiens G-protein coupled receptor (NPGPR) mRNA, complete cds gi|4530468|gb|AF119815.1|AF119815[4530468]

[5936] 10749: AF098664 Homo sapiens olfactory receptor-like protein (OR2C1) gene, complete cds gi|3982606|gb|AF098664.1|AF098664[3982606]

[5937] 10752: AF090131 Homo sapiens clone b312C2EN9 LDL receptor-related protein 6 gene, partial cds, and CpG island sequence gi|4494988|gb|AF090131.1|AF090131[4494988]

[5938] 10778: X95583 H. sapiens mRNA for monocyte chemotactic protein-1 (MCP-1) receptor gi|4468944|emb|X95583.1|HSMCP1REC[4468944]

[5939] 10791: AJ131757 Homo sapiens olr1 gene gi|4468343|emb|AJ131757.1|HSA131757[4468343]

[5940] 10792: X58674 H. sapiens RNA for receptor for C5a anaphylatoxin gi|29568|emb|X58674.1|HSCSANAPL[29568]

[5941] 10793: U51134 Homo sapiens calcitonin gene-related peptide receptor component protein mRNA, complete cds gi|4097252|gb|U51134.1|HSU51134[4097252]

[5942] 10794: Y13464 Homo sapiens mRNA for cholecystokinin B receptor gi|3287189|emb|Y13464.1|HSY13464[3287189]

[5943] 10795: Z66558 H. sapiens FAS/Apol gene (Del B1 mutation; partial) gi|1150414|emb|Z66558.1|HSFASAPOC[1150414]

[5944] 10796: Z66557 H. sapiens of FAS/Apo1 gene (partial) gi|1150413|emb|Z66557.1|HSFASAPOB[1150413]

[5945] 10797: Z66556 H. sapiens FASExo8Del mRNA gi|1150412|emb|Z66556.1|HSFASAPOA[1150412]

[5946] 10825: AF118266 Homo sapiens orphan G protein-coupled receptor GPR45 (GPR45) gene, complete cds gi|4455062|gb|AF118266.1|AF118266[4455062]

[5947] 10826: AF118265 Homo sapiens orphan G protein-coupled receptor GPR44 (GPR44) gene, complete cds gi|4455060|gb|AF118265.1|AF118265[4455060]

[5948] 10827: Y18046 Homo sapiens mRNA for FOP (FGFR1 oncogene partner) gi|4454262|emb|Y18046.1|HSAY18046[4454262]

[5949] 10828: AJ006276 Homo sapiens mRNA for transient receptor potential protein TRP6 gi|4454260|emb|AJ006276.1|HSAJ6276[4454260]

[5950] 10829: M13918 Homo sapiens fibronectin receptor alpha-subunit precursor (ITGA5) mRNA, partial cds gi|4464190|gb|M13918.2|HUMFNRAS[4464190]

[5951] 10831: D13515 Homo sapiens mRNA for key subunit of N-methyl-D-aspartate receptor, complete cds gi|219919|dbj|D13515.1|HUMMARR[219919]

[5952] 10832: D10583 Homo sapiens mRNA for IgE receptor beta subunit, complete cds gi|219881|dbj|D10583.1|HUMIGERB[219881]

[5953] 10834: AH007490 Homo sapiens gibbon ape leukemia virus receptor 1 (SLC20A1) gene, partial cds gi|4416260|gb|AH007490.1|SEG_HSGLVR1G[4416260]

[5954] 10835: AF102063 Homo sapiens gibbon ape leukemia virus receptor 1 (SLC20A1) gene, exon 11 and complete cds gi|4416259|gb|AF102063.1|HSGLVR1G5[4416259]

[5955] 10836: AF102062 Homo sapiens gibbon ape leukemia virus receptor 1 (SLC2OA1) gene, exons 7 through 10 gi|4416258|gb|AF102062.1|HSGLVR1G4[4416258]

[5956] 10837: AF102061 Homo sapiens gibbon ape leukemia virus receptor 1 (SLC20A1) gene, exon 6 gi|4416257|gb|AF102061.1|HSGLVR1G3[4416257]

[5957] 10838: AF102060 Homo sapiens gibbon ape leukemia virus receptor 1 (SLC20A1) gene, exon 5 gi|4416256|gb|AF102060.1|HSGLVR1G2[4416256]

[5958] 10839: AF102059 Homo sapiens gibbon ape leukemia virus receptor 1 (SLC20A1) gene, exons 1 through 4 gi|4416255|gb|AF102059.1|HSGLVR1G1[4416255]

[5959] 10840: AF098798 Homo sapiens unknown mRNA gi|4416073|gb|AF098798.1|AF098798[4416073]

[5960] 10841: AF118670 Homo sapiens orphan G protein-coupled receptor (GPR34) gene, complete cds gi|4325085|gb|AF118670.1|AF118670[4325085]

[5961] 10842: AF053072 Homo sapiens GABA subunit A receptor alpha 6 precursor, gene, partial cds gi|4405812|gb|AF053072.1|AF053072[4405812]

[5962] 10843: AF052539 Homo sapiens chemokine receptor 5 (CCR5) gene, CCR5-CYS allele, complete cds gi|4337455|gb|AF052539.1|AF052539[4337455]

[5963] 10844: AF117713 Homo sapiens AITR ligand (TL6) mRNA, complete cds gi|4378801|gb|AF117713.1|AF117713[4378801]

[5964] 10845: AF117297 Homo sapiens TNF receptor superfamily activation-inducible protein mRNA, complete cds gi|4378799|gb|AF117297.1|AF117297[4378799]

[5965] 10974: Z29585 H. sapiens gene for high affinity IgE receptor alpha chain gi|452350|emb|Z29585.1|HSHAIGER[452350]

[5966] 10975: AF050154 Homo sapiens clone F19374 APO E-C2 gene cluster, complete sequence gi|4105701|gb|AF050154.1|AF050154[4105701]

[5967] 10981: X97881 H. sapiens mRNA for G protein coupled receptor kinase, GRK4D gi|1770427|emb|X97881.1|HSGRK4D[1770427]

[5968] 10982: X97880 H. sapiens mRNA for G protein coupled receptor kinase, GRK4C gi|1770425|emb|X97880.1|HSGRK4C[1770425]

[5969] 10983: X97879 H. sapiens mRNA for G protein coupled receptor kinase, GRK4B gi|1770423|emb|X97879.1|HSGRK4B[1770423]

[5970] 10984: AJ007787 Homo sapiens CHRNA3 gene, exon 6, partial gi|4164387|emb|AJ007787.1|HSA7787[4164387]

[5971] 10985: AJ007786 Homo sapiens CHRNA3 gene, exon 5 gi|4164386|emb|AJ007786.1|HSA7786[4164386]

[5972] 10986: AJ007785 Homo sapiens CHRNA3 gene, exon 4 gi|4164383|emb|AJ007785.1|HSA7785[4164383]

[5973] 10987: AJ007784 Homo sapiens CHRNA3 gene, exons 2 to 3 gi|4164382|emb|AJ007784.1|HSA7784[4164382]

[5974] 10988: AJ007783 Homo sapiens CHRNA3 gene, exon 1 and joined CDS gi|4164380|emb|AJ007783.1|HSA7783[4164380]

[5975] 10989: AJ001939 Homo sapiens CHRNB2 gene, exon 6 gi|3766463|emb|AJ001939.1|HSAJ1939[3766463]

[5976] 10990: AJ001938 Homo sapiens CHRNB2 gene, exon 5 gi|3766454|emb|AJ001938.1|HSAJ1938[3766454]

[5977] 10991: AJ001937 Homo sapiens CHRNB2 gene, exon 4 gi|3766453|emb|AJ001937.1|HSAJ1937[3766453]

[5978] 10992: AJ001936 Homo sapiens CHRNB2 gene, exon 2 and exon 3 gi|3766452|emb|AJ001936.1|HSAJ1936[3766452]

[5979] 10993: AJ001935 Homo sapiens CHRNB2 gene, exon 1 (and joined CDS) gi|3766450|emb|AJ001935.1|HSAJ1935[3766450]

[5980] 10998: AJ003147 Homo sapiens complete genomic sequence between D16S3070 and D16S3275, containing Familial Mediterranean Fever gene disease gi|2808656|emb|AJ003147.1|HSAJ03147[2808656]

[5981] 11000: AJ225029 Homo sapiens mRNA for GABA-B R1b receptor gi|3892873|emb|AJ225029.1|HSA225029[3892873]

[5982] 11004: AJ003147 Homo sapiens complete genomic sequence between D16S3070 and D16S3275, containing Familial Mediterranean Fever gene disease gi|2808656|emb|AJ003147.1|HSAJ03147[2808656]

[5983] 11006: AJ225029 Homo sapiens mRNA for GABA-B R1b receptor gi|3892873|emb|AJ225029.1|HSA225029[3892873]

[5984] 11007: AJ225028 Homo sapiens mRNA for GABA-B R1a receptor gi|3892593|emb|AJ225028.1|HSA225028[3892593]

[5985] 11092: AJ132194 Homo sapiens olfr89 gene gi|4160227|emb|AJ132194.1|HSA132194[4160227]

[5986] 11093: AJ012753 Homo sapiens RAGE gene (partial), exon 2 gi|4034482|emb|AJ012753.1|HSA012753[4034482]

[5987] 11094: AJ012332 Homo sapiens IL-1R gene cluster PAC contig, centromeric STS, sequence tagged site gi|412803|emb|AJ012332.1|HSA012332[4128031]

[5988] 11095: AJ012331 Homo sapiens IL-1R gene cluster PAC contig, telomeric STS, sequence tagged site gi|4128030|emb|AJ012331.1|HSA012331[4128030]

[5989] 11097: AJ011701 Homo sapiens TRHR gene promoter and exons 1-2, partial gi|4128016|emb|AJ011701.1|HSA011701[4128016]

[5990] 11098: AJ010191 Homo sapiens gababr1 receptor gene, exon 18 gi|3980509|emb|AJ010191.1|HSA010191[3980509]

[5991] 11099: AJ010190 Homo sapiens gababr1 receptor gene, exon 17 gi|3980507|emb|AJ010190.1|HSA010190[3980507]

[5992] 11100: AJ010189 Homo sapiens gababr1 receptor gene, exon 16 gi|3980504|emb|AJ010189.1|HSA010189[3980504]

[5993] 11101: AJ010188 Homo sapiens gababr1 receptor gene, exon 15 gi|3980502|emb|AJ010188.1|HSA010188[3980502]

[5994] 11102: AJ010187 Homo sapiens gababr1 receptor gene, exon 14 gi|3980500|emb|AJ010187.1|HSA010187[3980500]

[5995] 11103: AJ010186 Homo sapiens gababr1 receptor gene, exon 13 gi|3980498|emb|AJ010186.1|HSA010186[3980498]

[5996] 11104: AJ010185 Homo sapiens gababr1 receptor gene, exon 12 gi|3980496|emb|AJ010185.1|HSA010185[3980496]

[5997] 11105: AJ010184 Homo sapiens gababr1 receptor gene, exon 11 gi|3980494|emb|AJ010184.1|HSA010184[3980494]

[5998] 11106: AJ010183 Homo sapiens gababr1 receptor gene, exon 10 gi|3980492|emb|AJ010183.1|HSA010183[3980492]

[5999] 11107: AJ010182 Homo sapiens gababr1 receptor gene, exon 9 gi|3980490|emb|AJ010182.1|HSA010182[3980490]

[6000] 11108: AJ010181 Homo sapiens gababr1 receptor gene, exon 8 gi|3980488|emb|AJ010181.1|HSA010181[3980488]

[6001] 11109: AJ010180 Homo sapiens gababr1 receptor gene, exon 7 gi|3980486|emb|AJ010180.1|HSA010180[3980486]

[6002] 11110: AJ010179 Homo sapiens gababr1 receptor gene, exon 6 gi|3980484|emb|AJ010179.1|HSA010179[3980484]

[6003] 11111: AJ010178 Homo sapiens gababr1 receptor gene, exon 5 gi|3980482|emb|AJ010178.1|HSA010178[3980482]

[6004] 11112: AJ010177 Homo sapiens gababr1 receptor gene, exon 4 gi|3980481|emb|AJ010177.1|HSA010177[3980481]

[6005] 11113: AJ010176 Homo sapiens gababr1 receptor gene, exon 3 gi|3980480|emb|AJ010176.1|HSA010176[3980480]

[6006] 11114: AJ010175 Homo sapiens gababr1 receptor gene, exon 2 gi|3980479|emb|AJ010175.1|HSA010175[3980479]

[6007] 11115: AJ010174 Homo sapiens gababr1 receptor gene, exon 1 gi|3980477|emb|AJ010174.1|HSA010174[3980477]

[6008] 11116: AJ010173 Homo sapiens gababr1 receptor gene, exon 1a4 gi|3980475|emb|AJ010173.1|HSA010173[3980475]

[6009] 11117: AJ010172 Homo sapiens gababr1 receptor gene, exon 1a3 gi|3980472|emb|AJ010172.1|HSA010172[3980472]

[6010] 11118: AJ010171 Homo sapiens gababr1 receptor gene, exon 1a2 gi|3980469|emb|AJ010171.1|HSA010171[3980469]

[6011] 11119: AJ010170 Homo sapiens gababr1 receptor gene, exon 1a1 gi|3980465|emb|AJ010170.1|HSA010170[3980465]

[6012] 11121: AF061022 Homo sapiens CTH gene, complete cds gi|4335930|gb|AF061022.1|AF061022[4335930]

[6013] 11122: AF052041 Homo sapiens olfactory receptor gene cluster, complete sequence gi|4335873|gb|AF052041.1|AF052041[4335873]

[6014] 11124: AC006953 Homo sapiens chromosome 19, cosmid R28316, complete sequence gi|4335701|gb|AC006953.1|AC006953[4335701]

[6015] 11125: AF105367 Homo sapiens glucagon-like peptide-2 receptor precursor (GLP2R) mRNA, complete cds gi|4324490|gb|AF105367.1|AF105367[4324490]

[6016] 11434: AH007439 Homo sapiens chromosome X gi|4322454|gb|AH007439.1|SEG_HSIL2RGIN[4322454]

[6017] 11435: AF085452 Homo sapiens interleukin-2 receptor gamma chain (IL2RG) gene, intron 5, partial sequence gi|4322453|gb|AF085452.1|HSIL2RGIN2[4322453]

[6018] 11436: AF085451 Homo sapiens interleukin-2 receptor gamma chain (IL2RG) gene, intron 4, partial sequence gi|4322452|gb|AF085451.1|HSIL2RGIN1[4322452]

[6019] 11437: AF065213 Homo sapiens advanced glycosylation end product-specific receptor (RAGE) gene, intron 3, partial sequence gi|4321945|gb|AF065213.1|AF065213[4321945]

[6020] 11438: AF065212 Homo sapiens patient M1 advanced glycosylation end product-specific receptor (RAGE) gene, exon 3 and partial cds gi|4321943|gb|AF065212.1|AF065212[4321943]

[6021] 11439: AF065211 Homo sapiens patient M21 advanced glycosylation end product-specific receptor (RAGE) gene, exon 3 and partial cds gi|4321941 |gb|AF065211.1|AF065211[4321941]

[6022] 11440: AF065210 Homo sapiens patient M20 advanced glycosylation end product-specific receptor (RAGE) gene, exon 3 and partial cds gi|4321939|gb|AF065210.1|AF065210[4321939]

[6023] 11441: AF051305 Homo sapiens beta chemokine receptor (CCR1) gene, promoter region and exon 1 gi|4321648|gb|AF051305.1|AF051305[4321648]

[6024] 11442: U87223 Homo sapiens contactin associated protein (Caspr) mRNA, complete cds gi|1857707|gb|U87223.1|HSU87223[1857707]

[6025] 11443: AF022386 Homo sapiens p53-regulated DNA damage-inducible cell death receptor (killer) mRNA, complete cds gi|2460427|gb|AF022386.1|AF022386[2460427]

[6026] 11444: AF011368 Homo sapiens CEV14 mRNA, partial cds gi|2618824|gb|AF011368.1|AF011368[2618824]

[6027] 11445: AF016267 Homo sapiens TRAIL receptor 3 mRNA, complete cds gi|2529564|gb|AF016267.1|AF016267[2529564]

[6028] 11446: AF020502 Homo sapiens cytotoxic TRAIL receptor-3 (TRAIL-R3) mRNA, complete cds gi|2443819|gb|AF020502.1|AF020502[2443819]

[6029] 11447: AF020501 Homo sapiens cytotoxic TRAIL receptor-2 (DR5) mRNA, complete cds gi|24438171|gb|AF020501.1|AF020501[2443817]

[6030] 11454: AF075460 Homo sapiens type 1-like ryanodine receptor mRNA, partial cds gi|3328200|gb|AF075460.1|AF075460[3328200]

[6031] 11455: AF054830 Homo sapiens interleukin-1 type I receptor mRNA, partial sequence gi|3003026|gb|AF054830.1|AF054830[3003026]

[6032] 11456: AF099082 Homo sapiens xenotropic and polytropic murine retrovirus receptor (XPR1) mRNA, complete cds gi|4176765|gb|AF099082.1|AF099082[4176765]

[6033] 11501: AF089744 Homo sapiens xenotropic and polytropic murine leukemia virus receptor (X3) mRNA, complete cds gi|4154282|gb|AF089744.1|AF089744[4154282]

[6034] 11502: AF001095 Homo sapiens receptor for advanced glycation end products (RAGE) gene, promoter region and exon 1 gi|3093415|gb|AF001095.1|AF001095[3093415]

[6035] 11503: AF101784 Homo sapiens b-TRCP variant E3RS-IkappaB mRNA, partial cds gi|4165135|gb|AF101784.1|AF101784[4165135]

[6036] 11504: AF080586 Homo sapiens galanin receptor type 2 (GALR2) mRNA, complete cds gi|4165080|gb|AF080586.1|AF080586[4165080]

[6037] 11505: U71374 Homo sapiens HsPex13p mRNA, complete cds gi|3738269|gb|U71374.1|HSU71374[3738269]

[6038] 11506: AF111116 Homo sapiens silencer of death domains (SODD) mRNA, complete cds gi|4160013|gb|AF111116.1|AF111116[4160013]

[6039] 11507: AF110314 Homo sapiens herpesvirus immunoglobulin-like receptor HIgR mRNA, complete cds gi|4154345|gb|AF110314.1|AF110314[4154345]

[6040] 11518: AF069543 Homo sapiens IL-3/IL-5/GM-CSFR receptor beta chain promoter and exon 1 sequence gi|4071316|gb|AF069543.1|AF069543[4071316]

[6041] 11519: U81262 Homo sapiens LERK5 (LERK5) mRNA, complete cds gi|1809333|gb|U81262.1|HSU81262[1809333]

[6042] 11520: AF097358 Homo sapiens mast cell function-associated antigen homolog (MAFA) mRNA, complete cds gi|413919|gb|AF097358.1|AF097358[4139191]

[6043] 11521: AF029761 Homo sapiens decoy receptor 2 mRNA, complete cds gi|4106963|gb|AF029761.1|AF029761[4106963]

[6044] 11522: AF074483 Homo sapiens GABA-B receptor 2 mRNA, complete cds gi|4107511|gb|AF074483.1|AF074483[4107511]

[6045] 11523: AC006293 Homo sapiens chromosome 19, cosmid F15658, complete sequence gi|4106979|gb|AC006293.1|AC006293[4106979]

[6046] 11524: AF104419 Homo sapiens decoy receptor 3 (DcR3) mRNA, complete cds gi|4106877|gb|AF104419.1|AF104419[4106877]

[6047] 11525: AF046059 Homo sapiens cytokine receptor related protein 4 (CYTOR4) mRNA, complete cds gi|4105471|gb|AF046059.1|AF046059[4105471]

[6048] 11526: AF041262 Homo sapiens immunoglobulin-like transcript 8 mRNA, complete cds gi|4104892|gb|AF041262.1|AF041262[4104892]

[6049] 11527: AF041261 Homo sapiens immunoglobulin-like transcript 7 mRNA, complete cds gi|4104890|gb|AF041261.1|AF041261[4104890]

[6050] 11528: AH007196 Homo sapiens transforming growth factor-beta type I receptor gene, exon 6 gi|4104446|gb|AH007196.1|SEG_HSTGFRBI[4104446]

[6051] 11529: AF035670 Homo sapiens transforming growth factor-beta type I receptor gene, exon 9, and complete cds gi|4104445|gb|AF035670.1|HSTGFRBI9[4104445]

[6052] 11530: AF035669 Homo sapiens transforming growth factor-beta type I receptor gene, exon 8 gi|4104444|gb|AF035669.1|HSTGFRBI8[4104444]

[6053] 11531: AF035668 Homo sapiens transforming growth factor-beta type I receptor gene, exon 7 gi|4104443|gb|AF035668.1|HSTGFRBI7[4104443]

[6054] 11532: AF035667 Homo sapiens transforming growth factor-beta type I receptor gene, exon 6 gi|4104442|gb|AF035667.1|HSTGFRBI6[4104442]

[6055] 11533: AF035666 Homo sapiens transforming growth factor-beta type I receptor gene, exon 5 gi|4104441|gb|AF035666.1|HSTGFRBI5[4104441]

[6056] 11534: AF035665 Homo sapiens transforming growth factor-beta type I receptor gene, exon 4 gi|41044401|gb|AF035665.1|HSTGFRBI4[4104440]

[6057] 11535: AF035664 Homo sapiens transforming growth factor-beta type I receptor gene, exon 3 gi|4104439|gb|AF035664.1|HSTGFRBI3[4104439]

[6058] 11536: AF035663 Homo sapiens transforming growth factor-beta type I receptor gene, exon 2 gi|4104438|gb|AF035663.1|HSTGFRBI2[4104438]

[6059] 11537: AF035662 Homo sapiens transforming growth factor-beta type I receptor gene, exon 1 gi|4104437|gb|AF035662.1|HSTGFRBI1[4104437]

[6060] 11538: AF037332 Homo sapiens Eph-like receptor tyrosine kinase hEphB1b (EphB1) mRNA, complete cds gi|4104412|gb|AF037332.1|AF037332[4104412]

[6061] 11539: AF037331 Homo sapiens Eph-like receptor tyrosine kinase hEphB1 (EphB1) mRNA, complete cds gi|4104410|gb|AF037331.1|AF037331[4104410]

[6062] 11543: AH007119 Homo sapiens killer cell inhibitory receptor KIRCI gene, complete ads gi|37764731|gb|AH007119.1|SEG_HSKIRCI[3776473]

[6063] 11544: AF072410 Homo sapiens killer cell inhibitory receptor KIRCI gene, exons 6, 7 and 8 and complete ads gi|3776472|gb|AF072410.1|HSKIRCI4[3776472]

[6064] 11545: AF072409 Homo sapiens killer cell inhibitory receptor KIRCI gene, exon 5 gi|377647|gb|AF072409.1|HSKIRCI3[3776471]

[6065] 11546: AF072408 Homo sapiens killer cell inhibitory receptor KIRCI gene, exons 2, 3, and 4 gi|3776470|gb|AF072408.1|HSKIRCI2[3776470]

[6066] 11547: AF072407 Homo sapiens killer cell inhibitory receptor KIRCI gene, exon 1 gi|3776469|gb|AF072407.1|HSKIRCI1[3776469]

[6067] 11548: AH007118 Homo sapiens immunoglobulin-like transcript 10 protein gene, complete ads gi|3776467|gb|AH007118.1|SEG_HSILTX[3776467]

[6068] 11549: AF072101 Homo sapiens immunoglobulin-like transcript 10 protein gene, exons 7 and 8 and complete cds gi|3776466|gb|AF072101.1|HSILTX2[3776466]

[6069] 11550: AF072100 Homo sapiens immunoglobulin-like transcript 10 protein gene, exons 1 through gi|3776465|gb|AF072100.1|HSILTX1[3776465]

[6070] 11551: AF072099 Homo sapiens immunoglobulin-like transcript 3 protein variant 1 gene, complete cds gi|3776463|gb|AF072099.1|AF072099[3776463]

[6071] 11553: AF106941 Homo sapiens beta-arrestin 2 mRNA, complete cds gi|4092782|gb|AF106941.1|AF106941[4092782]

[6072] 11554: AF104304 Homo sapiens Smad anchor for receptor activation (SARA) mRNA, complete cds gi|4092766|gb|AF104304.1|AF104304[4092766]

[6073] 11555: AF034780 Homo sapiens lysosphingolipid receptor Edg5 mRNA, complete cds gi|4090955|gb|AF034780.1|AF034780[4090955]

[6074] 11556: AF109401 Homo sapiens neurotrophic factor artemin precursor (ARTN) mRNA, complete cds gi|4071352|gb|AF109401.1|AF109401[4071352]

[6075] 11557: AF099148 Homo sapiens GABA-B1a receptor mRNA, complete cds gi|4063891|gb|AF099148.1|AF099148[4063891]

[6076] 11558: AF095448 Homo sapiens putative G protein-coupled receptor (RAIG1) mRNA, complete cds gi|4063889|gb|AF095448.1|AF095448[4063889]

[6077] 11559: L34689 Homo sapiens somatostatin receptor isoform 2 (SSTR2) gene, partial cds gi|598233|gb|L34689.1|HUMSOREC2X[598233]

[6078] 11560: AF100161 Homo sapiens folate receptor type gamma' gene, partial cds gi|4063392|gb|AF100161.1|AF100161[4063392]

[6079] 11561: AF082076 Homo sapiens luteinizing hormone receptor (LHR) gene, partial cds gi|4063365|gb|AF082076.1|AF082076[4063365]

[6080] 11562: AC006132 Homo sapiens chromosome 19, cosmid R28204, complete sequence gi|3970930|gb|AC006132.1|AC006132[3970930]

[6081] 11563: AH007081 Homo sapiens lectin-type oxidized LDL receptor (OLR1) gene, complete cds gi|4050003|gb|AH007081.1|SEG_HSOLR[4050003]

[6082] 11564: AF079167 Homo sapiens lectin-type oxidized LDL receptor (OLR1) gene, exons 4, 5, and 6, and complete cds gi|4050002|gb|AF079167.1|HSOLR4[4050002]

[6083] 11565: AF079166 Homo sapiens lectin-type oxidized LDL receptor (OLR1) gene, exon 3 gi|4050001|gb|AF079166.1|HSOLR3[4050001]

[6084] 11566: AF079165 Homo sapiens lectin-type oxidized LDL receptor (OLR1) gene, exon 2 gi|4050000|gb|AF079165.1|HSOLR2[4050000]

[6085] 11567: AF079164 Homo sapiens lectin-type oxidized LDL receptor (OLR1) gene, exon 1 gi|4049999|gb|AF079164.1|HSOLR1[4049999]

[6086] 11568: AF099083 Homo sapiens growth hormone secretagogue receptor gene, 5′ flanking region and partial cds gi|4039145|gb|AF099083.1|AF099083[4039145]

[6087] 11569: AF058390 Homo sapiens neurotrophin 3 receptor truncated isoform (NTRK3) mRNA, partial cds gi|4027932|gb|AF058390.1|AF058390[4027932]

[6088] 11570: AF058389 Homo sapiens neurotrophin 3 receptor (NTRK3) mRNA, partial cds gi|4027930|gb|AF058389.1|AF058389[4027930]

[6089] 11877: AF029839 Homo sapiens alpha 7 neuronal nicotinic receptor mRNA sequence gi|3757794|gb|AF029839.1|AF029839[3757794]

[6090] 11878: AF029838 Homo sapiens alpha 7 neuronal nicotinic receptor mRNA sequence gi|3757793|gb|AF029838.1|AF029838[3757793]

[6091] 11880: AH007062 Homo sapiens galanin receptor (GALNR), complete cds gi|3064074|gb|AH007062.1|SEG_HSGALNRS[3064074]

[6092] 11881: U90660 Homo sapiens galanin receptor (GALNR) gene, exon 3 and complete cds gi|3064073|gb|U90660.1|HSGALNRS3[3064073]

[6093] 11882: U90659 Homo sapiens galanin receptor (GALNR) gene, exon 2 gi|3064072|gb|U90659.1|HSGALNRS2[3064072]

[6094] 11883: U90658 Homo sapiens galanin receptor (GALNR) gene, exon 1 gi|3064071|gb|U90658.1|HSGALNRS1[3064071]

[6095] 11884: AF041474 Homo sapiens BAF53a (BAF53a) mRNA, complete cds gi|4001802|gb|AF041474.1|AF041474[4001802]

[6096] 11886: AF097942 Homo sapiens monocyte antigen CD14 precursor (CD14) mRNA, complete cds gi|3983126|gb|AF097942.1|AF097942[3983126]

[6097] 11887: AH007044 Homo sapiens growth factor receptor (GRB10) gene, alternative splice products, complete cds gi|3982774|gb|AH007044.1|SEG_HSGRB[3982774]

[6098] 11904: AF084941 Homo sapiens pre-T cell receptor alpha chain 1 precursor, gene, complete cds gi|3978459|gb|AF084941.1|AF084941[3978459]

[6099] 11905: AH007043 Homo sapiens interleukin-7 receptor precursor (IL7R), complete cds gi|3978161|gb|AH007043.1|SEG_HSIL7R[3978161]

[6100] 11906: AF043129 Homo sapiens interleukin-7 receptor precursor (IL7R) gene, exons 7 and 8 and complete cds gi|3978160|gb|AF043129.1|HSIL7R7[3978160]

[6101] 11907: AF043128 Homo sapiens interleukin-7 receptor precursor (IL7R) gene, exon 6 gi|3978159|gb|AF043128.1|HSIL7R6[3978159]

[6102] 11908: AF043127 Homo sapiens interleukin-7 receptor precursor (IL7R) gene, exon 5 gi|3978158|gb|AF043127.1|HSIL7R5[3978158]

[6103] 11909: AF043126 Homo sapiens interleukin-7 receptor precursor (IL7R) gene, exon 4 gi|3978157|gb|AF043126.1|HSIL7R4[3978157]

[6104] 11910: AF043125 Homo sapiens interleukin-7 receptor precursor (IL7R) gene, exon 3 gi|3978156|gb|AF043125.1|HSIL7R3[3978156]

[6105] 11911: AF043124 Homo sapiens interleukin-7 receptor precursor (IL7R) gene, exon 2 gi|3978155|gb|AF043124.1|HSIL7R2[3978155]

[6106] 11912: AF043123 Homo sapiens interleukin-7 receptor precursor (IL7R) gene, exon 1 gi|3978154|gb|AF043123.1|HSIL7R1[3978154]

[6107] 11913: AH007033 Homo sapiens prostanoid FP receptor (PTGFR), partial cds gi|3941539|gb|AH007033.1|SEG_HSPTF2AGR[3941539]

[6108] 11914: AF068679 Homo sapiens prostanoid FP receptor (PTGFR) gene, exon and partial cds gi|3941538|gb|AF068679.1|HSPTF2AGR4[3941538]

[6109] 11915: AF068678 Homo sapiens prostanoid FP receptor (PTGFR) gene, exon gi|3941537|gb|AF068678.1|HSPTF2AGR3[3941537]

[6110] 11916: AF068677 Homo sapiens prostanoid FP receptor (PTGFR) gene, exon and partial 5′UTR gi|3941536|gb|AF068677.1|HSPTF2AGR2[3941536]

[6111] 11917: AF068676 Homo sapiens prostanoid FP receptor (PTGFR) gene, exon gi|3941535|gb|AF068676.1|HSPTF2AGR1[3941535]

[6112] 11918: AF035776 Homo sapiens oxidized low-density lipoprotein receptor mRNA, complete cds gi|3941299|gb|AF035776.1|AF035776[3941299]

[6113] 11920: AF091501 Homo sapiens receptor protein patched 2 (PTCH2) mRNA, complete cds gi|3929234|gb|AF091501.1|AF091501[3929234]

[6114] 11953: X98174 H. sapiens mRNA for MACH-alpha-3 protein gi|3928273|emb|X98174.1|HSMACHA3[3928273]

[6115] 11955: X68990 Homo sapiens CR2 mRNA for complement receptor gi|3928195|emb|X68990.1HSCR2AA[3928195]

[6116] 11956: X63128 H. sapiens mRNA for activin receptor gi|3928172|emb|X63128.1|HSACTREC[3928172]

[6117] 11958: AF074397 Homo sapiens anti-mullerian hormone type II receptor (AMHR2) gene, promoter region and partial cds gi|3916231|gb|AF074397.1|AF074397[3916231]

[6118] 11959: U72648 Homo sapiens alpha2-C4-adrenergic receptor gene, complete cds gi|3914602|gb|U72648.1|HSU72648[3914602]

[6119] 11960: Y10148 H. sapiens mRNA for NTR2 receptor gi|3901027|emb|Y10148.1|HSNTR2REC[3901027]

[6120] 11961: Y12476 Homo sapiens putative GPR37 gene (exon 1 and joined CDS) gi|2570029|emb|Y12476.1|HSY12476[2570029]

[6121] 11962: AJ000479 Homo sapiens mRNA for putative G-protein coupled receptor, EDG6 gi|3805931|emb|AJ000479.1|HSEDG4[3805931]

[6122] 11963: Y12477 Homo sapiens putative GPR37 gene, exon 2 gi|2570031|emb|Y12477.1|HSY12477[2570031]

[6123] 11964: X04329 Homo sapiens mRNA fragment for receptor-like furin gi|31479|emb|X04329.1|HSFUR1[31479]

[6124] 11965: AH007002 Homo sapiens chromosome 1 map 1q12-q13 gi|3892221|gb|AH007002.1|SEG_HSM1MUSR[3892221]

[6125] 11966: AF091493 Homo sapiens M1 muscarinic receptor gene, exons 2 and 3 gi|3892220|gb|AF091493.1|HSMIMUSR2[3892220]

[6126] 11967: AF091492 Homo sapiens M1 muscarinic receptor gene, promoter region and exon 1 gi|3892219|gb|AF091492.1|HSM1MUSRI[3892219]

[6127] 12129: AF077820 Homo sapiens LDL receptor member LR3 mRNA, complete cds gi|3831747|gb|AF077820.1|AF077820[3831747]

[6128] 12130: AF055992 Homo sapiens |Duffy antigen/chemokine receptor (FY) gene, FY*X allele, complete cds gi|3659623|gb|AF055992.1|AF055992[3659623]

[6129] 12131: U58675 Homo sapiens Chromosome 17p13 Cosmid Clone cos39, complete sequence gi|3849817|gb|U58675.1|U58675[3849817]

[6130] 12132: AF077346 Homo sapiens interleukin-18 receptor accessory protein-like mRNA, complete cds gi|3851059|gb|AF077346.1|AF077346[3851059]

[6131] 12136: Z17227 Homo sapiens mRNA for transmebrane receptor protein gi|393378|emb|Z17227.1|HSTRECP[393378]

[6132] 12137: AF082742 Homo sapiens CC chemokine receptor 5 (CCR5) gene, promoter region and partial sequence gi|3561057|gb|AF082742.1|AF082742[3561057]

[6133] 12139: Z34897 H. sapiens mRNA for H1 histamine receptor gi|510295|emb|Z34897.1|HSHISTR1[510295]

[6134] 12140: X76786 H. sapiens histamine H1 receptor gene gi|442517|emb|X76786.1|HSHISH1[442517]

[6135] 12141: AC005933 Homo sapiens chromosome 19, cosmid F15472, complete sequence gi|3845348|gb|AC005933.1|AC005933[3845348]

[6136] 12142: AF094755 Homo sapiens glycine receptor beta subunit precursor (GLRB), variant B mRNA, complete cds gi|3834636|gb|AF094755.1|AF094755[3834636]

[6137] 12143: AF094754 Homo sapiens glycine receptor beta subunit precursor (GLRB), variant A mRNA, complete cds gi|3834634|gb|AF094754.1|AF094754[3834634]

[6138] 12144: AF091512 Homo sapiens familial mediterranean fever locus genomic sequence gi|3834584|gb|AF091512.1|AF091512[3834584]

[6139] 12145: AF065876 Homo sapiens olfactory receptor (OR2D2) gene, partial cds gi|3831618|gb|AF065876.1|AF065876[3831618]

[6140] 12147: AF065874 Homo sapiens olfactory receptor (OR1OA1) gene, partial cds gi|3831615|gb|AF065874.1|AF065874[3831615]

[6141] 12151: AF065870 Homo sapiens olfactory receptor (OR6A1) gene, complete cds gi|3831610|gb|AF065870.1|AF065870[3831610]

[6142] 12158: AF065863 Homo sapiens olfactory receptor (OR5F1) gene, partial cds gi|3831602|gb|AF065863.1|AF065863[3831602]

[6143] 12160: AF065861 Homo sapiens olfactory receptor (ORSD4) gene, partial cds gi|3831599|gb|AF065861.1|AF065861[3831599]

[6144] 12161: AF065860 Homo sapiens olfactory receptor (OR5D3) gene, partial cds gi|3831597|gb|AF065860.1|AF065860[3831597]

[6145] 12170: AH006968 Homo sapiens gi|2828129|gb|AH006968.1|SEG_HSCRFR[2828129]

[6146] 12171: AF039523 Homo sapiens corticotropin-releasing factor type 1 receptor gene, exon 14 and complete cds gi|2828128|gb|AF039523.1|HSCRFR14[2828128]

[6147] 12172: AF039522 Homo sapiens corticotropin-releasing factor type 1 receptor gene, exon 13 gi|2828127|gb|AF039522.1|HSCRFR13[2828127]

[6148] 12173: AF039521 Homo sapiens corticotropin-releasing factor type 1 receptor gene, exon 12 gi|2828126|gb|AF039521.1|HSCRFR12[2828126]

[6149] 12174: AF039520 Homo sapiens corticotropin-releasing factor type 1 receptor gene, exon 11 gi|2828125|gb|AF039520.1|HSCRFR11[2828125]

[6150] 12175: AF039519 Homo sapiens corticotropin-releasing factor type 1 receptor gene, exon 10 gi|2828124|gb|AF039519.1|HSCRFR10[2828124]

[6151] 12176: AF039518 Homo sapiens corticotropin-releasing factor type 1 receptor gene, exon 9 gi|2828123|gb|AF039518.1|HSCRFR09[2828123]

[6152] 12177: AF039517 Homo sapiens corticotropin-releasing factor type 1 receptor gene, exon 8 gi|2828122|gb|AF039517.1|HSCRFR08[2828122]

[6153] 12178: AF039516 Homo sapiens corticotropin-releasing factor type 1 receptor gene, exon 7 gi|2828121|gb|AF039516.1|HSCRFR07[2828121]

[6154] 12179: AF039515 Homo sapiens corticotropin-releasing factor type 1 receptor gene, exon 6 gi|2828120|gb|AF039515.1|HSCRFR06[2828120]

[6155] 12180: AF039514 Homo sapiens corticotropin-releasing factor type 1 receptor gene, exon 5 gi|2828119|gb|AF039514.1|HSCRFR05[2828119]

[6156] 12181: AF039513 Homo sapiens corticotropin-releasing factor type 1 receptor gene, exon 4 gi|2828118|gb|AF039513.1|HSCRFR04[2828118]

[6157] 12182: AF039512 Homo sapiens corticotropin-releasing factor type 1 receptor gene, exon 3 gi|2828117|gb|AF039512.1|HSCRFR03[2828117]

[6158] 12183: AF039511 Homo sapiens corticotropin-releasing factor type 1 receptor gene, exon 2 gi|2828116|gb|AF039511.1|HSCRFR02[2828116]

[6159] 12184: AF039510 Homo sapiens corticotropin-releasing factor type 1 receptor gene, exon 1 gi|2828115|gb|AF039510.1HSCRFR01[2828115]

[6160] 12185: AF030186 Homo sapiens glypican-4 (GPC4) mRNA, complete cds gi|3831546|gb|AF030186.1|AF030186[3831546]

[6161] 12206: AJ006353 Homo sapiens mRNA for ephrin-A4 protein, soluble form gi|3821236|emb|AJ006353.1|HSA6353[3821236]

[6162] 12212: AF055634 Homo sapiens transmembrane receptor UNC5C (UNC5C) mRNA, complete cds gi|3789764|gb|AF055634.1|AF055634[3789764]

[6163] 12227: AH006936 Homo sapiens activin receptor type IIB (ACVR2B), complete cds gi|3769442|gb|AH006936.1|SEG_HSACVR2B[3769442]

[6164] 12228: AF060202 Homo sapiens activin receptor type IIB (ACVR2B) gene, exon 11 and complete cds gi|3769441|gb|AF060202.1|HSACVR2B4[3769441]

[6165] 12229: AF060201 Homo sapiens activin receptor type IIB (ACVR2B) gene, exons 8, 9, and 10 gi|3769440|gb|AF060201.1|HSACVR2B3[3769440]

[6166] 12230: AF060200 Homo sapiens activin receptor type IIB (ACVR2B) gene, exons 2 through 7 gi|3769439|gb|AF060200.1|HSACVR2B2[3769439]

[6167] 12231: AF060199 Homo sapiens activin receptor type IIB (ACVR2B) gene, exon 1 gi|3769438|gb|AF060199.1|HSACVR2B1[3769438]

[6168] 12232: AF037646 Homo sapiens alpha-7 neuronal nicotinic acetylcholine receptor precursor RNA, partial sequence gi|3757808|gb|AF037646.1|AF037646[3757808]

[6169] 12233: AF036903 Homo sapiens alpha-7 neuronal nicotinic acetylcholine receptor mRNA, alternatively spliced, partial sequence gi|3757807|gb|AF036903.1|AF036903[3757807]

[6170] 12234: AH006931 Homo sapiens lipoprotein receptor-related protein (LRP1) gene, complete cds gi|3493575|gb|AH006931.1|SEG_HSLRPSS[3493575]

[6171] 12235: AF058427 Homo sapiens lipoprotein receptor-related protein (LRP1), exons 80 through 89 and complete cds gi|3493574|gb|AF058427.1|HSLRPSS61[3493574]

[6172] 12236: AF058426 Homo sapiens lipoprotein receptor-related protein (LRP1), exons 78 and 79 gi|3493573|gb|AF058426.1|HSLRPSS59[3493573]

[6173] 12237: AF058425 Homo sapiens lipoprotein receptor-related protein (LRP1), exon 77 gi|3493572|gb|AF058425.1|HSLRPSS57[3493572]

[6174] 12238: AF058424 Homo sapiens lipoprotein receptor-related protein (LRP1), exon 76 gi|3493571|gb|AF058424.1|HSLRPSS55[3493571]

[6175] 12239: AF058423 Homo sapiens lipoprotein receptor-related protein (LRP1), exons 71 through 75 gi|34935701|gb|AF058423.1|HSLRPSS53[3493570]

[6176] 12240: AF058422 Homo sapiens lipoprotein receptor-related protein (LRP1), exons 61 through 70 gi|3493569|gb|AF058422.1|HSLRPSS51[3493569]

[6177] 12241: AF058421 Homo sapiens lipoprotein receptor-related protein (LRP1), exons 59 and 60 gi|3493568|gb|AF058421.1|HSLRPSS49[3493568]

[6178] 12242: AF058420 Homo sapiens lipoprotein receptor-related protein (LRP1), exons 56, 57, and gi|3493567|gb|AF058420.1|HSLRPSS47[3493567]

[6179] 12243: AF058419 Homo sapiens lipoprotein receptor-related protein (LRP1), exons 45 through 55 gi|3493566|gb|AF058419.1|HSLRPSS45[3493566]

[6180] 12244: AF058418 Homo sapiens lipoprotein receptor-related protein (LRP1), exons 43 and 44 gi|3493565|gb|AF058418.1|HSLRPSS43[3493565]

[6181] 12245: AF058417 Homo sapiens lipoprotein receptor-related protein (LRP1), exon 42 gi|3493564|gb|AF058417.1|HSLRPSS41[3493564]

[6182] 12246: AF058416 Homo sapiens lipoprotein receptor-related protein (LRP1), exons 39, 40, and gi|3493563|gb|AF058416.1|HSLRPSS39[3493563]

[6183] 12247: AF058415 Homo sapiens lipoprotein receptor-related protein (LRP1), exons 36, 37, and gi|3493562|gb|AF058415.1|HSLRPSS37[3493562]

[6184] 12248: AF058414 Homo sapiens lipoprotein receptor-related protein (LRP1), exons 27 through 34 gi|3493561|gb|AF058414.1|HSLRPSS35[3493561]

[6185] 12249: AF058413 Homo sapiens lipoprotein receptor-related protein (LRP1), exons 25 and 26 gi|34935601|gb|AF058413.1|HSLRPSS33[3493560]

[6186] 12250: AF058412 Homo sapiens lipoprotein receptor-related protein (LRP1), exons 23 and 24 gi|3493559|gb|AF058412.1|HSLRPSS31[3493559]

[6187] 12251: AF058411 Homo sapiens lipoprotein receptor-related protein (LRP1), exons 21 and 22 gi|3493558|gb|AF05841.1|HSLRPSS29[3493558]

[6188] 12252: AF058410 Homo sapiens lipoprotein receptor-related protein (LRP1), exon 20 gi|3493557|gb|AF058410.1|HSLRPSS27[3493557]

[6189] 12253: AF058409 Homo sapiens lipoprotein receptor-related protein (LRP1), exons 18 and 19 gi|3493556|gb|AF058409.1|HSLRPSS25[3493556]

[6190] 12254: AF058408 Homo sapiens lipoprotein receptor-related protein (LRP1), exons 16 and 17 gi|3493555|gb|AF058408.1|HSLRPSS23[3493555]

[6191] 12255: AF058407 Homo sapiens lipoprotein receptor-related protein (LRP1), exons 14 and 15 gi|3493554|gb|AF058407.1|HSLRPSS21[3493554]

[6192] 12256: AF058406 Homo sapiens lipoprotein receptor-related protein (LRP1), exon 13 gi|3493553|gb|AF058406.1|HSLRPSS19[3493553]

[6193] 12257: AF058405 Homo sapiens lipoprotein receptor-related protein (LRP1), exon 12 gi|3493552|gb|AF058405.1|HSLRPSS17[3493552]

[6194] 12258: AF058404 Homo sapiens lipoprotein receptor-related protein (LRP1), exon 11 gi|3493551|gb|AF058404.1|HSLRPSS15[3493551]

[6195] 12259: AF058403 Homo sapiens lipoprotein receptor-related protein (LRP1), exons 9 and 10 gi|3493550|gb|AF058403.1|HSLRPSS13[3493550]

[6196] 12260: AF058402 Homo sapiens lipoprotein receptor-related protein (LRP1), exons 7 and 8 gi|3493549|gb|AF058402.1|HSLRPSS11[3493549]

[6197] 12261: AF058401 Homo sapiens lipoprotein receptor-related protein (LRP1), exons 5 and 6 gi|3493548|gb|AF058401.1|HSLRPSS09[3493548]

[6198] 12262: AF058400 Homo sapiens lipoprotein receptor-related protein (LRP1), exon 4 gi|3493547|gb|AF058400.1|HSLRPSS07[3493547]

[6199] 12263: AF058399 Homo sapiens lipoprotein receptor-related protein (LRP1), exon 3 gi|3493546|gb|AF058399.1|HSLRPSS05[3493546]

[6200] 12264: AF058398 Homo sapiens lipoprotein receptor-related protein (LRP1), exon 2 gi|3493545|gb|AF058398.1|HSLRPSS03[3493545]

[6201] 12265: AF058397 Homo sapiens lipoprotein receptor-related protein (LRP1), exon 1 gi|3493544|gb|AF058397.1|HSLRPSS01[3493544]

[6202] 12267: Y11044 Homo sapiens mRNA for GABA-BR1a (hGB1a) receptor gi|2826760|emb|Y11044.1|HSGTHLA1[2826760]

[6203] 12277: AF073019 Homo sapiens clone 21 T cell signal transduction molecule SAP mRNA, complete cds gi|3695070|gb|AF073019.1|AF073019[3695070]

[6204] 12278: AF072930 Homo sapiens clone 14 T cell signal transduction molecule SAP mRNA, complete cds gi|3695068|gb|AF072930.1|AF072930[3695068]

[6205] 12279: Y12670 Homo sapiens mRNA for leptin receptor gene-related protein gi|2266637|emb|Y12670.1|HSOBRGRP[2266637]

[6206] 12280: AF091890 Homo sapiens G-protein coupled receptor RE2 mRNA, complete cds gi|3659902|gb|AF091890.1|AF091890[3659902]

[6207] 12281: Y09586 Homo sapiens mRNA for serotonin 4 receptor (h5-HT4(a)), splice variant gi|2584764|emb|Y09586.1|HS5HT4SAR[2584764]

[6208] 12282: X77777 H. sapiens intestinal VIP receptor related protein mRNA gi|456352|emb|X77777.1|HSVIPRRP[456352]

[6209] 12283: AJ001383 Homo sapiens activating NK-receptor (NK-p46) mRNA gi|3647278|emb|AJ001383.1|HSJ001383[3647278]

[6210] 12284: AJ224901 Homo sapiens mRNA for ZNF198 protein gi|3647276|emb|AJ224901.1|HSAJ4901[3647276]

[6211] 12285: AJ006123 Homo sapiens mRNA for NK receptor (NKp46), isoform d gi|3647272|emb|AJ006123.1|HSA6123[3647272]

[6212] 12286: AJ006122 Homo sapiens mRNA for NK receptor (NKp46) isoform c gi|3647270|emb|AJ006122.1|HSA6122[3647270]

[6213] 12287: AJ006121 Homo sapiens mRNA for NK receptor (NKp46), isoform b gi|3647268|emb|AJ006121.1|HSA6121[3647268]

[6214] 12289: X99906 Homo sapiens mRNA for alpha endosulfine gi|2764973|emb|X99906.1|HSALPEND[2764973]

[6215] 12292: U52064 Kaposi's sarcoma-associated herpes-like virus ORF73 homolog gene, complete cds gi|1633571|gb|U52064.1|KSU52064[1633571]

[6216] 12293: U29343 Homo sapiens hyaluronan receptor (RHAMM) mRNA, complete cds gi|2959555|gb|U29343.1|HSU29343[2959555]

[6217] 12294: AF035771 Homo sapiens Na+/H+ exchanger regulatory factor 2 (NHERF-2) mRNA, complete cds gi|2665825|gb|AF035771.1|AF035771[2665825]

[6218] 12296: AF023849 Homo sapiens TNF receptor-related receptor for TRAIL mRNA, complete cds gi|2653844|gb|AF023849.1|AF023849[2653844]

[6219] 12297: AH006710 Homo sapiens interferon-gamma receptor alpha chain (interferon-gamma receptor alpha chain gene), complete cds gi|2078444|gb|AH006710.1|ISEG_HSINFGRA[2078444]

[6220] 12298: U19247 Homo sapiens interferon-gamma receptor alpha chain gene, exon 7 and complete cds gi|632541|gb|U19247.1|HSINFGRA7[632541]

[6221] 12299: U19246 Homo sapiens interferon-gamma receptor alpha chain gene, exon 6 gi|632540|gb|U19246.1|HSINFGRA6[632540]

[6222] 12300: U19245 Homo sapiens interferon-gamma receptor alpha chain gene, exon 5 gi|632539|gb|U19245.1|HSINFGRA5[632539]

[6223] 12301: U19244 Homo sapiens interferon-gamma receptor alpha chain gene, exon 4 gi|632538|gb|U19244.1|HSINFGRA4[632538]

[6224] 12302: U19243 Homo sapiens interferon-gamma receptor alpha chain gene, exon 3 gi|632537|gb|U19243.1|HSINFGRA3[632537]

[6225] 12303: U19242 Homo sapiens interferon-gamma receptor alpha chain gene, exon 2 gi|632536|gb|U19242.1|HSINFGRA2[632536]

[6226] 12304: U19241 Homo sapiens interferon-gamma receptor alpha chain gene, exon 1 gi|632535|gb|U19241.1|HSINFGRA1[632535]

[6227] 12305: AF027957 Homo sapiens G protein-coupled receptor (GPR35) gene, complete cds gi|2739108|gb|AF027957.1|AF027957[2739108]

[6228] 12306: AF027956 Homo sapiens G protein-coupled receptor (GPR30) gene, complete cds gi|2739106|gb|AF027956.1|AF027956[2739106]

[6229] 12307: AF016709 Homo sapiens ATP receptor subunit (P2X5) mRNA, complete cds gi|2731560|gb|AF016709.1|AF016709[2731560]

[6230] 12308: AF035824 Homo sapiens vesicle soluble NSF attachment protein receptor (VTI1) mRNA, complete cds gi|2687399|gb|AF035824.1|AF035824[2687399]

[6231] 12309: U96845 Homo sapiens natual killer cell group 2-F (NKG2-F) mRNA, complete cds gi|2673988|gb|U96845.1|HSU96845[2673988]

[6232] 12310: AF022139 Homo sapiens lysosphingolipid receptor (EDG3) mRNA, partial cds gi|2668611|gb|AF022139.1|AF022139[2668611]

[6233] 12311: AF022137 Homo sapiens G protein-coupled receptor (EDG1) mRNA, partial cds gi|2668607|gb|AF022137.1|AF022137[2668607]

[6234] 12312: AF031556 Homo sapiens clone 17.30 immunoglobulin-like transcript 5 mRNA, complete cds gi|2665646|gb|AF031556.1|AF031556[2665646]

[6235] 12313: AF031555 Homo sapiens clone 17.23 immunoglobulin-like transcript 5 mRNA, complete cds gi|2665644|gb|AF031555.1|AF031555[2665644]

[6236] 12314: AF031554 Homo sapiens clone 17.18 immunoglobulin-like transcript 5 mRNA, complete cds gi|2665642|gb|AF031554.1|AF031554[2665642]

[6237] 12315: AF031553 Homo sapiens clone DC.1 immunoglobulin-like transcript 5 mRNA, complete cds gi|2665640|gb|AF031553.1|AF031553[2665640]

[6238] 12316: AF009644 Homo sapiens clone 41 immunoglobulin-like transcript 5 protein mRNA, complete cds gi|2662447|gb|AF009644.1|AF009644[2662447]

[6239] 12317: AF009643 Homo sapiens clone 6 immunoglobulin-like transcript 5 protein mRNA, complete cds gi|2662445|gb|AF009643.1|AF009643[2662445]

[6240] 12318: AF009642 Homo sapiens clone 40 immunoglobulin-like transcript 5 protein mRNA, complete cds gi|2662443|gb|AF009642.1|AF009642[2662443]

[6241] 12319: AF009641 Homo sapiens clone 36 immunoglobulin-like transcript 5 protein mRNA, complete cds gi|2662441|gb|AF009641.1|AF009641[2662441]

[6242] 12320: AF009640 Homo sapiens clone 33 immunoglobulin-like transcript 5 protein mRNA, complete cds gi|2662439|gb|AF009640.1|AF009640[2662439]

[6243] 12321: AF009639 Homo sapiens clone 31 immunoglobulin-like transcript 5 protein mRNA, complete cds gi|2662437|gb|AF009639.1|AF009639[2662437]

[6244] 12322: AF009638 Homo sapiens clone 22 immunoglobulin-like transcript 5 protein mRNA, complete cds gi|2662435|gb|AF009638.1|AF009638[2662435]

[6245] 12323: AF009637 Homo sapiens clone 19 immunoglobulin-like transcript 5 protein mRNA, complete cds gi|2662433|gb|AF009637.1|AF009637[2662433]

[6246] 12324: AF009636 Homo sapiens clone 17.8 immunoglobulin-like transcript 5 protein mRNA, complete cds gi|2662431|gb|AF009636.1|AF009636[2662431]

[6247] 12325: AF009635 Homo sapiens clone 17.7 immunoglobulin-like transcript 5 protein mRNA, complete cds gi|2662429|gb|AF009635.1|AF009635[2662429]

[6248] 12326: AF009634 Homo sapiens clone 17.6 immunoglobulin-like transcript 5 protein mRNA, complete cds gi|2662427|gb|AF009634.1|AF009634[2662427]

[6249] 12327: AF009633 Homo sapiens clone 17.11 immunoglobulin-like transcript 5 protein mRNA, complete cds gi|2662425|gb|AF009633.1|AF009633[2662425]

[6250] 12328: AF009632 Homo sapiens clone 17.10 immunoglobulin-like transcript 5 protein mRNA, complete cds gi|2662423|gb|AF009632.1|AF009632[2662423]

[6251] 12329: AF014924 Homo sapiens immunoglobulin-like transcript 6a (ILT6a) mRNA, complete cds gi|2661224|gb|AF014924.1|AF014924[2661224]

[6252] 12330: AF014923 Homo sapiens immunoglobulin-like transcript 6 (ILT6) mRNA, complete cds gi|2661222|gb|AF014923.1|AF014923[2661222]

[6253] 12331: AF011566 Homo sapiens clone 17 immunoglobulin-like transcript 4 mRNA, complete cds gi|2660709|gb|AF011566.1|AF011566[2660709]

[6254] 12332: AF011565 Homo sapiens clone 26 immunoglobulin-like transcript 4 mRNA, complete cds gi|2660707|gb|AF011565.1|AF011565[2660707]

[6255] 12333: AF009007 Homo sapiens immunoglobulin-like transcript 2c mRNA, complete cds gi|2660705|gb|AF009007.1|AF009007[2660705]

[6256] 12334: AF009006 Homo sapiens immunoglobulin-like transcript 2b mRNA, complete cds gi|2660703|gb|AF009006.1|AF009006[2660703]

[6257] 12335: AF009005 Homo sapiens immunoglobulin-like transcript 2a mRNA, complete cds gi|2660701|gb|AF009005.1|AF009005[2660701]

[6258] 12336: AH006705 Homo sapiens mu opioid receptor (OPRM1) and mu opioid receptor (OPRM1) s, partial cds gi|2655104|gb|AH006705.1|SEG_HSOPRMI[2655104]

[6259] 12338: AF024516 Homo sapiens mu opioid receptor (OPRM1) gene, partial cds, exons 2 and 3, complete IVS2 gi|2655102|gb|AF024516.1|HSOPRMI2[2655102]

[6260] 12339: AF024515 Homo sapiens mu opioid receptor (OPRM1) gene, partial cds, exon 1 gi|2655101|gb|AF024515.1|HSOPRMI1[2655101]

[6261] 12410: AF030625 Homo sapiens SCCL vasopressin subtype 1a receptor mRNA, complete cds gi|2623229|gb|AF030625.1|AF030625[2623229]

[6262] 12411: AF002986 Homo sapiens platelet activating receptor homolog (H963) mRNA, complete cds gi|2580587|gb|AF002986.1|AF002986[2580587]

[6263] 12412: AF023614 Homo sapiens transmembrane activator and CAML interactor (TACI) mRNA, complete cds gi|2554947|gb|AF023614.1|AF023614[2554947]

[6264] 12413: AF022860 Homo sapiens neuropilin-2(a17) mRNA, complete cds gi|2547131|gb|AF022860.1|AF022860[2547131]

[6265] 12414: AF022859 Homo sapiens neuropilin-2(a0) mRNA, complete cds gi|2547129|gb|AF022859.1|AF022859[2547129]

[6266] 12415: AF016849 Homo sapiens apoptosis inducing receptor TRAIL-R2 (TRAILR2) mRNA, complete cds gi|2465585|gb|AF016849.1|AF016849[2465585]

[6267] 12416: AF013171 Homo sapiens TNF-related ligand TRANCE mRNA, partial cds gi|2411499|gb|AF013171.1|AF013171[2411499]

[6268] 12417: AF018956 Homo sapiens neuropilin mRNA, complete cds gi|2407640|gb|AF018956.1|AF018956[2407640]

[6269] 12419: AF015257 Homo sapiens flow-induced endothelial G protein-coupled receptor (FEG-1) mRNA, complete cds gi|2353152|gb|AF015257.1|AF015257[2353152]

[6270] 12420: U75285 Homo sapiens apoptosis inhibitor survivin gene, complete cds gi|2315862|gb|U75285.1|HSU75285[2315862]

[6271] 12421: AF012270 Homo sapiens visual pigment-like receptor peropsin (Rrh) mRNA, complete cds gi|2307009|gb|AF012270.1|AF012270[2307009]

[6272] 12422: AH006692 Homo sapiens chromosome 19 clone PAC clone 72N6 map 19q13.42 gi|2290633|gb|AH006692.1|SEG_HSNKAT2A[2290633]

[6273] 12423: U97180 Homo sapiens NKAT-2a like protein (KIR) gene, exons 8 and 9 and complete cds gi|2290632|gb|U97180.1|HSNKAT2A8[2290632]

[6274] 12424: U97179 Homo sapiens NKAT-2a like protein (KIR) gene, exon 7 gi|2290631|gb|U97179.1|HSNKAT2A7[2290631]

[6275] 12425: U97178 Homo sapiens NKAT-2a like protein (KIR) gene, exon 6 gi|2290630|gb|U97178.1|HSNKAT2A6[2290630]

[6276] 12426: U97177 KIR Homo sapiens NKAT-2a like protein (KIR) gene, exon 5 gi|2290629|gb|U97177.1|HSNKAT2A5[2290629]

[6277] 12427: U97176 Homo sapiens NKAT-2a like protein (KIR) gene, exon 4 gi|2290628|gb|U97176.1|HSNKAT2A4[2290628]

[6278] 12429: U97174 KIR Homo sapiens NKAT-2a like protein (KIR) gene, exon 2 gi|2290626|gb|U97174.1|HSNKAT2A2[2290626]

[6279] 12430: U97173 Homo sapiens NKAT-2a like protein (KIR) gene, exon 1 gi|2290625|gb|U97173.1|HSNKAT2Al[2290625]

[6280] 12431: U97075 Homo sapiens FLICE-like inhibitory protein short form mRNA, complete cds gi|2253680|gb|U97075.1|U97075[2253680]

[6281] 12432: U97074 Homo sapiens FLICE-like inhibitory protein long form mRNA, complete cds gi|2253678|gb|U97074.1|U97074[2253678]

[6282] 12688: L76380 Homo sapiens (clone HSNME29) CGRP type 1 receptor mRNA, complete cds gi|1321593|gb|L76380.1|HUMCGRPB[1321593]

[6283] 12689: L49241 Homo sapiens fibroblast growth factor 2 (FGFR2) Ser354Cys mutant gene, exon IIIc gi|1129116|gb|L49241.1|HUMFGF354C[1129116]

[6284] 12690: L49240 Homo sapiens fibroblast growth factor 2 (FGFR2) Ala344Gly mutant gene, exon IIIc gi|1129114|gb|L49240.1|HUMFGF344G[1129114]

[6285] 12691: L49239 Homo sapiens fibroblast growth factor 2 (FGFR2) Cys342Tyr mutant gene, exon IIIc gi|1129112|gb|L49239.1|HUMFGF342Y[1129112]

[6286] 12692: L49238 Homo sapiens fibroblast growth factor 2 (FGFR2) Cys342Ser mutant gene, exon IIIc gi|129110|gb|L49238.1|HUMFGF342S[1129110]

[6287] 12693: L49242 Homo sapiens fibroblast growth factor 2 (FGFR2) Gly338Arg mutant gene, exon IIIc gi|1129108|gb|L49242.1|HUMFGF338R[1129108]

[6288] 12694: L49237 Homo sapiens fibroblast growth factor 2 (FGFR2) Gln289Pro mutant gene, exon IIIu gi|1129106|gb|L49237.1|HUMFGF289P[1129106]

[6289] 12842: L38734 Homo sapiens hepatoma transmembrane kinase ligand (HTK ligand) mRNA, complete cds gi|769675|gb|L38734.1|HUMHTK[769675]

[6290] 12843: L40764 Homo sapiens vasoactive intestinal polypeptide receptor 2 (VIPR2) mRNA, complete cds gi|712836|gb|L40764.1|HUMVIPR2A[712836]

[6291] 12844: AF068181 Homo sapiens B cell linker protein BLNK-s mRNA, alternatively spliced, complete cds gi|3406750|gb|AF068181.1|AF068181[3406750]

[6292] 12845: AF068180 Homo sapiens B cell linker protein BLNK mRNA, alternatively spliced, complete cds gi|3406748|gb|AF068180.1|AF068180[3406748]

[6293] 12846: AF064801 Homo sapiens multiple membrane spanning receptor TRC8 (TRC8) mRNA, complete cds gi|3395786|gb|AF064801.1|AF064801[3395786]

[6294] 12847: AH006513 Homo sapiens glycine receptor alpha 3 subunit (GLRA3) gene gi|3342791|gb|AH006513.1|SEG_HSGLRA3S[3342791]

[6295] 12848: AF017724 Homo sapiens glycine receptor alpha 3 subunit (GLRA3) gene, exon 10n, and complete cds gi|3342790|gb|AF017724.1|HSGLRA3S10[3342790]

[6296] 12849: AF017723 Homo sapiens glycine receptor alpha 3 subunit (GLRA3) gene, exon 9n gi|3342789|gb|AF017723.1|HSGLRA3S09[3342789]

[6297] 12850: AF017722 Homo sapiens glycine receptor alpha 3 subunit (GLRA3) gene, exon 8 gi|3342788|gb|AF017722.1|HSGLRA3S08[3342788]

[6298] 12851: AF017721 Homo sapiens glycine receptor alpha 3 subunit (GLRA3) gene, exon 7 gi|3342787|gb|AF017721.1|HSGLRA3S07[3342787]

[6299] 12852: AF017720 Homo sapiens glycine receptor alpha 3 subunit (GLRA3) gene, exon 6 gi|3342786|gb|AF01772.1|HSGLRA3S06[3342786]

[6300] 12853: AF017719 Homo sapiens glycine receptor alpha 3 subunit (GLRA3) gene, exon 5 gi|3342785|gb|AF017719.1|HSGLRA3S05[3342785]

[6301] 12854: AF017718 Homo sapiens glycine receptor alpha 3 subunit (GLRA3) gene, exon 4 gi|3342784|gb|AF017718.1|HSGLRA3S04[3342784]

[6302] 12855: AF017717 Homo sapiens glycine receptor alpha 3 subunit (GLRA3) gene, exon 3 gi|3342783|gb|AF017717.1|HSGLRA3S03[3342783]

[6303] 12856: AF017716 Homo sapiens glycine receptor alpha 3 subunit (GLRA3) gene, exon 2 gi|3342782|gb|AF017716.1|HSGLRA3S02[3342782]

[6304] 12857: AF017715 Homo sapiens glycine receptor alpha 3 subunit (GLRA3) gene, exon 1 gi|33427811|gb|AF017715.1|HSGLRA3S01[3342781]

[6305] 12858: AF018157 Homo sapiens glycine receptor alpha 3 subunit (GLRA3) mRNA, alternatively spliced, partial cds gi|3342237|gb|AF018157.1|AF018157[3342237]

[6306] 12861: AF045764 Homo sapiens orphan G protein-coupled receptor (GPR32) gene, complete cds gi|3282838|gb|AF045764.1|AF045764[3282838]

[6307] 12864: AF053004 Homo sapiens class I cytokine receptor (WSX1) mRNA, complete cds gi|3153240|gb|AF053004.1|AF053004[3153240]

[6308] 12865: AF055872 Homo sapiens Apo3/DR3 ligand (APO3L) mRNA, complete cds gi|3108230|gb|AF055872.1|AF055872[3108230]

[6309] 12866: AF057140 Homo sapiens cargo selection protein TIP47 (TIP47) mRNA, complete cds gi|3095185|gb|AF057140.1|AF057140[3095185]

[6310] 12870: AF028785 Homo sapiens phosphatidylinositol 3-kinase p55 gamma regulatory subunit mRNA, complete cds gi|3046405|gb|AF028785.1|AF028785[3046405]

[6311] 12872: AF027826 Homo sapiens putative seven pass transmembrane protein (TM7SF1) mRNA, complete cds gi|2992627|gb|AF027826.1|AF027826[2992627]

[6312] 12883: AF040630 Homo sapiens galanin receptor Ga1R2 mRNA, complete cds gi|2921759|gb|AF040630.1|AF040630[2921759]

[6313] 12904: U86281 Homo sapiens olfactory receptor (OR7-141) gene, partial cds gi|2921715|gb|U86281.1|U86281[2921715]

[6314] 12905: U86280 Homo sapiens olfactory receptor (OR7-140) gene, partial cds gi|2921713|gb|U86280.1|U86280[2921713]

[6315] 12906: U86279 Homo sapiens olfactory receptor (OR7-139) gene, partial cds gi|2921711|gb|U86279.1|U86279[2921711]

[6316] 12907: U86278 Homo sapiens olfactory receptor (OR7-138) gene, partial cds gi|2921709|gb|U86278.1|U86278[2921709]

[6317] 12911: U86274 Homo sapiens olfactory receptor (OR5-85) gene, partial cds gi|2921704|gb|U86274.1|U86274[2921704]

[6318] 12915: U86270 Homo sapiens olfactory receptor (OR5-40) gene, partial cds gi|2921699|gb|U86270.1|U86270[2921699]

[6319] 12921: U86264 Homo sapiens olfactory receptor (OR3-145) gene, partial cds gi|2921692|gb|U86264.1|U86264[2921692]

[6320] 12927: AH006491 Homo sapiens GPI-linked anchor protein (GFRA1), complete cds gi|2921544|gb|AH006491.1|SEG_HSGFRA1G[2921544]

[6321] 12928: AF038420 Homo sapiens GPI-linked anchor protein (GFRA1) gene, exon 11 and complete cds gi|2921543|gb|AF038420.1|HSGFRA1G1|[2921543]

[6322] 12929: AF038419 Homo sapiens GPI-linked anchor protein (GFRA1) gene, exon 10 gi|2921542|gb|AF038419.1|HSGFRAIG10[2921542]

[6323] 12930: AF038418 Homo sapiens GPI-linked anchor protein (GFRA1) gene, exon 9 gi|2921541|gb|AF038418.1|HSGFRA1G 9[2921541]

[6324] 12931: AF038417 Homo sapiens GPI-linked anchor protein (GFRA1) gene, exon 8 gi|2921540|gb|AF038417.1|HSGFRA1G 8[2921540]

[6325] 12932: AF038416 Homo sapiens GPI-linked anchor protein (GFRA1) gene, exon 7 gi|2921539|gb|AF038416.1|HSGFRA1G 7[2921539]

[6326] 12933: AF038415 Homo sapiens GPI-linked anchor protein (GFRA1) gene, exon 6 gi|2921538|gb|AF038415.1|HSGFRA1G 6[2921538]

[6327] 12934: AF038414 Homo sapiens GPI-linked anchor protein (GFRA1) gene, exon 5 gi|2921537|gb|AF038414.1|HSGFRA1G 5[2921537]

[6328] 12935: AF038413 Homo sapiens GPI-linked anchor protein (GFRA1) gene, exon 4 gi|2921536|gb|AF038413.1|HSGFRA1G 4[2921536]

[6329] 12936: AF038412 Homo sapiens GPI-linked anchor protein (GFRA1) gene, exon 3 gi|2921535|gb|AF038412.1|HSGFRA1G 3[2921535]

[6330] 12937: AF038411 Homo sapiens GPI-linked anchor protein (GFRA1) gene, exon 2 gi|29215341|gb|AF038411.1|HSGFRA1G 2[2921534]

[6331] 12938: AF036906 Homo sapiens linker for activation of T cells (LAT) mRNA, alternatively spliced form, complete cds gi|2828025|gb|AF036906.1|AF036906[2828025]

[6332] 12939: AF036905 Homo sapiens linker for activation of T cells (LAT) mRNA, complete cds gi|2828023|gb|AF036905.1|AF036905[2828023]

[6333] 12940: AF043724 Homo sapiens hepatitis A virus cellular receptor 1 (hHAVcr-l) mRNA, complete cds gi|2827453|gb|AF043724.1|AF043724[2827453]

[6334] 12954: U86239 Homo sapiens olfactory receptor (OR16-90) gene, partial cds gi|2921659|gb|U86239.1IU86239[2921659]

[6335] 12955: U86238 Homo sapiens olfactory receptor (OR16-89) gene, partial cds gi|2921657|gb|U86238.1|U86238[2921657]

[6336] 12956: U86237 Homo sapiens olfactory receptor (OR16-88) gene, partial cds gi|2921655|gb|U86237.1|U86237[2921655]

[6337] 12957: U86236 Homo sapiens olfactory receptor (OR16-37) gene, partial cds gi|2921653|gb|U86236.1|U86236[2921653]

[6338] 12958: U86235 Homo sapiens olfactory receptor (OR16-36) gene, partial cds gi|2921651|gb|U86235.1|U86235[2921651]

[6339] 12959: U86234 Homo sapiens olfactory receptor (OR16-35) gene, partial cds gi|2921649|gb|U86234.1|U86234[2921649]

[6340] 12971: U86222 Homo sapiens olfactory receptor (OR13-66) gene, partial cds gi|2921636|gb|U86222.1|U86222[2921636]

[6341] 12977: U86216 Homo sapiens olfactory receptor (OR1-26) gene, partial cds gi|2921629|gb|U86216.1|U86216[2921629]

[6342] 12978: U86215 Homo sapiens olfactory receptor (OR1-25) gene, partial cds gi|2921627|gb|U86215.1|U86215[2921627]

[6343] 12979: AF016261 Homo sapiens interleukin-1 receptor accessory protein (IL1RAP) gene, partial cds gi|2911297|gb|AF016261.1|AF016261[2911297]

[6344] 12980: AF041245 Homo sapiens orexin receptor-2 mRNA, complete cds gi|2897127|gb|AF041245.1|AF041245[2897127]

[6345] 12981: AF041243 Homo sapiens orexin receptor-1 mRNA, complete cds gi|2897123|gb|AF041243.1|AF041243[2897123]

[6346] 12982: U97123 Homo sapiens chemokine receptor mRNA, complete cds gi|2897070|gb|U97123.1|HSU97123[2897070]

[6347] 12983: AF009014 Homo sapiens glutamate receptor delta-2 subunit (GLURD2) mRNA, complete cds gi|2853314|gb|AF009014.1|AF009014[2853314]

[6348] 12984: AF036581 Homo sapiens tumor necrosis factor superfamily member LIGHT mRNA, complete cds gi|2815623|gb|AF036581.1|AF036581[2815623]

[6349] 12985: AF040991 Homo sapiens roundabout 2 (robo2) mRNA, partial cds gi|2804785|gb|AF040991.1|AF040991[2804785]

[6350] 12986: AF040990 Homo sapiens roundabout 1 (robo1) mRNA, complete cds gi|2804783|gb|AF040990.1|AF040990[2804783]

[6351] 12987: AF026070 Homo sapiens death receptor 3 beta (DR3) mRNA, complete cds gi|2570830|gb|AF026070.1|AF026070[2570830]

[6352] 12988: AF021818 Homo sapiens putative neurotransmitter receptor mRNA, complete cds gi|2465431|gb|AF021818.1|AF021818[2465431]

[6353] 12990: L48211 Homo Sapiens angiotensin II receptor gene, complete cds gi|1160612|gb|L48211.1|HUMAIR[1160612]

[6354] 12992: L47169 Homo sapiens neuropeptide Y receptor gene, exon, promoter C gi|976208|gb|L47169.1|HUMNPYAC[976208]

[6355] 12993: L47168 Homo sapiens neuropeptide Y receptor gene, exon, promoter B gi|976207|gb|L47168.1|HUMNPYAB[976207]

[6356] 12994: L47167 Homo sapiens neuropeptide Y receptor gene, exon, promoter A gi|976206|gb|L47167.1|HUMNPYAA[976206]

[6357] 12995: L37086 Homo sapiens FK-506 binding protein (fkbp12.6) gene, complete cds gi|965467|gb|L37086.1|HUMFK506B[965467]

[6358] 12996: L36566 Human helodermin-preferring VIP receptor (VIP2/PACAP receptor) mRNA, complete cds gi|550477|gb|L36566.1|HUMHVRP[550477]

[6359] 12997: L25647 Homo sapiens fibroblast growth factor receptor gene (located in the central MHC) signal peptide and consecutive exon gi|457233|gb|L25647.1|HUMFGFRZ[457233]

[6360] 12998: M85247 H. sapiens dopamine D1A receptor gene, complete exon 1, and exon 2, 5′ end gi|181652|gb|M85247.1|HUMDOPAM[181652]

[6361] 12999: L21195 Human serotonin 5-HT7 receptor mRNA, complete cds gi|413865|gb|L21195.1|HUMSHTR[413865]

[6362] 13000: L22647 Human prostaglandin receptor ep1 subtype mRNA, complete cds gi|410208|gb|L22647.1|HUMG[410208]

[6363] 13001: L10822 Human gastrin receptor gene, complete cds gi|406075|gb|L10822.1|HUMGARE[406075]

[6364] 13002: L19546 Human (IL2RG) gene, complete cds with repeats gi|349631|gb|L19546.1|HUMIL2RGA[349631]

[6365] 13003: M95667 Homo sapiens c-erb B2/neu protein (ERBB2) gene, partial cds gi|182168|gb|M95667.1|HUMERBB2[182168]

[6366] 13004: AF087138 Homo sapiens sulfonylurea receptor 1 (SUR1) mRNA, complete cds gi|3643189|gb|AF087138.1|AF087138[3643189]

[6367] 13005: AF042782 Homo sapiens galanin receptor type 2 (GALR2) gene, complete cds gi|3642913|gb|AF042782.1|AF042782[3642913]

[6368] 13007: AF064548 Homo sapiens low-density lipoprotein receptor-related protein 5 (LRP5) mRNA, complete cds gi|3641526|gb|AF064548.1|AF064548[3641526]

[6369] 13008: AF073799 Homo sapiens galanin receptor GALR3 mRNA, complete cds gi|3608409|gb|AF073799.1|AF073799[3608409]

[6370] 13009: D10202 Homo sapiens mRNA for platelet-activating factor receptor, complete cds gi|219975|dbj|D10202.1|HUMPAFRE[219975]

[6371] 13010: AB017498 Homo sapiens LRP5 mRNA for Lipoprotein Receptor Related Protein 5, complete cds gi|3582144|dbj|AB017498.1|AB017498[3582144]

[6372] 13011: AJ011041 Homo sapiens CHRM2 gene, satellite gi|3581973|emb|AJ011041.1|HSA011041[3581973]

[6373] 13012: AH006427 Homo sapiens chromosome 12 map 12q13-14 gi|3561040|gb|AH006427.1|SEG_HOMOVDR[3561040]

[6374] 13013: AF080456 Homo sapiens vitamin D receptor gene, exon 1f gi|3561039|gb|AF080456.1|HOMOVDR3[3561039]

[6375] 13014: AF080455 Homo sapiens vitamin D receptor gene, exon 1e gi|3561038|gb|AF080455.1|HOMOVDR2[3561038]

[6376] 13015: AF080454 Homo sapiens vitamin D receptor gene, exon 1d gi|3561037|gb|AF080454.1|HOMOVDR1[3561037]

[6377] 13025: AJ001689 Homo sapiens NKG2D gene, exon 10 gi|2980867|emb|AJ001689.1|HSAJ1689[2980867]

[6378] 13026: AJ001688 Homo sapiens NKG2D gene, exons 6-9 gi|2980866|emb|AJ001688.1|HSAJ1688[2980866]

[6379] 13027: AJ001687 Homo sapiens NKG2D gene, exons 2-5 and joined mRNA and CDS gi|2980864|emb|AJ001687.1|HSAJ1687[2980864]

[6380] 13028: AJ001686 Homo sapiens NKG2F gene gi|2980862|emb|AJ001686.1|HSAJ1686[2980862]

[6381] 13029: AJ001685 Homo sapiens NKG2E gene gi|2980860|emb|AJ001685.1|HSAJ1685[2980860]

[6382] 13030: AJ001684 Homo sapiens NKG2C gene gi|2980858|emb|AJ001684.1|HSAJ1684[2980858]

[6383] 13031: AJ001683 Homo sapiens NKG2F mRNA gi|2980856|emb|AJ001683.1|HSAJ1683[2980856]

[6384] 13032: Y12546 H. sapiens mRNA for P2Y-like G-protein coupled receptor gi|2687818|emb|Y12546.1|HSP2YLG[2687818]

[6385] 13033: AF015525 Homo sapiens putative chemokine receptor (CRAM-B) mRNA, complete cds gi|3550069|gb|AF015525.1|AF015525[3550069]

[6386] 13034: AF015524 Homo sapiens putative chemokine receptor (CRAM-A) mRNA, complete cds gi|3550066|gb|AF015524.1|AF015524[3550066]

[6387] 13035: AF068868 Homo sapiens TNFR-related death receptor-6 (DR6) mRNA, complete cds gi|3549262|gb|AF068868.1|AF068868[3549262]

[6388] 13036: AF052572 Homo sapiens chemokine receptor CXCR4 gene, promoter region and complete cds gi|3549254|gb|AF052572.1|AF052572[3549254]

[6389] 13037: AC005625 Homo sapiens chromosome 19, cosmid R27328, complete sequence gi|3549153|gb|AC005625.1|AC005625[3549153]

[6390] 13038: AF051152 Homo sapiens Toll/interleukin-1 receptor-like protein 4 (TIL4) mRNA, complete cds gi|3132527|gb|AF051152.1|AF051152[3132527]

[6391] 13039: AF051151 Homo sapiens Toll/interleukin-1 receptor-like protein 3 (TIL3) mRNA, complete cds gi|3132525|gb|AF051151.1|AF051151[3132525]

[6392] 13040: AC005601 Homo sapiens chromosome 5, BAC clone 343g16 (LBNL H180), complete sequence gi|3522917|gb|AC005601.1|AC005601[3522917]

[6393] 13042: U88540 Homo sapiens Toll-like receptor 1 (TLR1) mRNA, complete cds gi|2459617|gb|U88540.1|HSU88540[2459617]

[6394] 13066: Z94155 H. sapiens mRNA for P2Y-like G-protein coupled receptor (partial) gi|2695875|emb|Z94155.1|HSZ94155[2695875]

[6395] 13067: Z94154 H. sapiens mRNA for P2Y-like G-protein coupled receptor gi|2695873|emb|Z94154.1|HSZ94154[2695873]

[6396] 13068: AF074264 Homo sapiens LDL receptor-related protein 6 (LRP6) mRNA, complete cds gi|3462526|gb|AF074264.1|AF074264[3462526]

[6397] 13069: AF021233 Homo sapiens TRAIL-R4-B (TRAIL-R4) mRNA, complete cds gi|3452184|gb|AF021233.1|AF021233[3452184]

[6398] 13070: AF021232 Homo sapiens TRAIL-R4-A (TRAIL-R4) mRNA, complete cds gi|3452182|gb|AF021232.1|AF021232[3452182]

[6399] 13072: X98765 H. sapiens gene encoding secretory component of polymeric immunoglobulin receptor gi|2546984|emb|X98765.1|HSSC[2546984]

[6400] 13103: U50062 Homo sapiens RIP protein kinase mRNA, complete cds gi|3426026|gb|U50062.1|HSU50062[3426026]

[6401] 13104: AF078925 Homo sapiens P2X1 receptor gene, partial cds gi|3421366|gb|AF078925.1|AF078925[3421366]

[6402] 13106: AF061785 Homo sapiens gamma-aminobutyric acid receptor A5 subunit (GABRA5) gene, three alternative first exons and exons 2-3, partial cds gi|3420025|gb|AF061785.1|AF061785[3420025]

[6403] 13110: AB009462 Homo sapiens hLRp105 mRNA for LDL receptor related protein 105, complete cds gi|3413957|dbj|AB009462.1|AB009462[3413957]

[6404] 13111: AF075590 Homo sapiens MCF-7 peripheral-type benzodiazepine receptor (PBR) mRNA, partial cds gi|3411164|gb|AF075590.1|AF075590[3411164]

[6405] 13112: AF075589 Homo sapiens MDA-MB-231 peripheral-type benzodiazepine receptor (PBR) mRNA, partial cds gi|3411162|gb|AF075589.1|AF075589[3411162]

[6406] 13113: L39064 Homo sapiens interleukin 9 receptor precursor (IL9R) gene, complete cds gi|632992|gb|L39064.1|HUMIL9RA[632992]

[6407] 13114: AJ224878 Homo sapiens mRNA for T-cell receptor interacting molecule (TRIM) protein gi|3402215|emb|AJ224878.1|HSAJ4878[3402215]

[6408] 13115: AF080214 Homo sapiens protease-activated receptor 4 mRNA, complete cds gi|3396080|gb|AF080214.1|AF080214[3396080]

[6409] 13116: AF075005 Homo sapiens full length insert cDNA YH98E06 gi|3377544|gb|AF075005.1|HUMYH98E06[3377544]

[6410] 13133: AF062006 Homo sapiens orphan G protein-coupled receptor HG38 mRNA, complete cds gi|3366801|gb|AF062006.1|AF062006[3366801]

[6411] 13134: Y12815 H. sapiens mRNA for chemokine receptor D6 gi|2204204|emb|Y12815.1|HSY12815[2204204]

[6412] 13135: AC005338 Homo sapiens chromosome 19, cosmid R31646, complete sequence gi|3355457|gb|AC005338.1|AC005338[3355457]

[6413] 13137: AF078530 Homo sapiens receptor interacting protein 2 (RIP2) mRNA, complete cds gi|3342909|gb|AF078530.1|AF078530[3342909]

[6414] 13138: AF077526 Homo sapiens parathyroid hormone-related protein receptor gene, partial cds gi|3342553|gb|AF077526.1|AF077526[3342553]

[6415] 13139: AH006311 Homo sapiens chromosome 11 gastrincholecystokinin brain receptor (CCKBR), partial cds gi|3342089|gb|AH006311.1|SEG_HSCCKBR[3342089]

[6416] 13140: AF074029 Homo sapiens gastrincholecystokinin brain receptor (CCKBR) gene, exons 4 and and partial cds gi|3342088|gb|AF074029.1|HSCCKBR2[3342088]

[6417] 13141: AF074035 Homo sapiens gastrincholecystokinin brain receptor (CCKBR) gene, exons 2 and gi|3342087|gb|AF074035.1|HSCCKBR1[3342087]

[6418] 13142: U44132 Homo sapiens lung cancer suppressor region LCR11.1 satellite DNA gi|1174163|gb|U44132.1|HSU44132[1174163]

[6419] 13143: Y14930 Homo sapiens TCRAV28 gene, allele A4, partial gi|2664276|emb|Y14930.1|HSY14930[2664276]

[6420] 13144: Y14931 Homo sapiens TCRAV28 gene, allele A5, partial gi|2661832|emb|Y14931.1|HSY14931[2661832]

[6421] 13145: Y14929 Homo sapiens TCRAV28 gene, allele A3, partial gi|2661828|emb|Y14929.1|HSY14929[2661828]

[6422] 13146: AF074087 Homo sapiens killer cell inhibitory receptor short form (KIR2DS2) mRNA, alternatively spliced, partial cds gi|33281781|gb|AF074087.1|AF074087[3328178]

[6423] 13147: Y12507 H. sapiens mRNA for serotonin receptor 5-HT4D, splice variant gi|3326990|emb|Y12507.1|HSY12507[3326990]

[6424] 13148: Y12506 H. sapiens mRNA for serotonin receptor 5-HT4C, splice variant gi|3326988|emb|Y12506.1|HSY12506[3326988]

[6425] 13151: D85242 Homo sapiens mRNA for NOR-1 3′-variant, partial cds gi|3168581|dbj|D85242.1D85242[3168581]

[6426] 13152: D85241 Homo sapiens mRNA for NOR-1beta, partial cds gi|3168579|dbj|D85241.1D85241[3168579]

[6427] 13153: AF034633 Homo sapiens orphan G protein-coupled receptor (GPR39) mRNA, complete cds gi|2654160|gb|AF034633.1|AF034633[2654160]

[6428] 13154: AF034632 Homo sapiens orphan G protein-coupled receptor (GPR38) gene, complete cds gi|2654158|gb|AF034632.1|AF034632[2654158]

[6429] 13155: AF054633 Homo sapiens thrombin receptor gene, exon 1 and partial cds gi|3309036|gb|AF054633.1|AF054633[3309036]

[6430] 13156: AF073792 Homo sapiens CGRP-receptor component protein mRNA, complete cds gi|3300101|gb|AF073792.1|AF073792[3300101]

[6431] 13157: AF007575 Homo sapiens ES/130-related protein mRNA, partial cds gi|3299886|gb|AF007575.1|AF007575[3299886]

[6432] 13158: AF055917 Homo sapiens protease-activated receptor 4 mRNA, complete cds gi|3293321|gb|AF055917.1|AF055917[3293321]

[6433] 13160: AC005255 Homo sapiens chromosome 19, CIT-HSP-146e8, complete sequence gi|3289998|gb|AC005255.1|AC005255[3289998]

[6434] 13165: AB012724 Homo sapiens gene for endothelin-A receptor, cis_element region gi|3273319|dbj |AB012724.1|AB012724[3273319]

[6435] 13166: AB015745 Homo sapiens mRNA for human prolactin-releasing peptide receptor, complete cds gi|3273224|dbj|AB015745.1|AB015745[3273224]

[6436] 13167: AF020498 Homo sapiens P2X1 purinoceptor (P2X) mRNA, complete cds gi|3258622|gb|AF020498.1|AF020498[3258622]

[6437] 13170: AF051767 Homo sapiens GDNF family receptor alpha 3 (GFRA3) mRNA, complete cds gi|2961631|gb|AF051767.1|AF051767[2961631]

[6438] 13171: AH006188 Homo sapiens GABA-A receptor pi subunit (GABRP), partial cds gi|3252851|gb|AH006188.1|SEG_HSGABRP[3252851]

[6439] 13172: AF009702 Homo sapiens GABA-A receptor pi subunit gene (GABRP), exon 10 and complete cds gi|3252850|gb|AF009702.1|HSGABRP10[3252850]

[6440] 13173: AF009701 Homo sapiens GABA-A receptor pi subunit gene (GABRP), exon 9 gi|3252849|gb|AF009701.1|HSGABRP09[3252849]

[6441] 13174: AF009700 Homo sapiens GABA-A receptor pi subunit gene (GABRP), exon 8 gi|3252848|gb|AF009700.1|HSGABRP08[3252848]

[6442] 13175: AF009699 Homo sapiens GABA-A receptor pi subunit gene (GABRP), exon 7 gi|3252847|gb|AF009699.1|HSGABRP07[3252847]

[6443] 13176: AF009698 Homo sapiens GABA-A receptor pi subunit gene (GABRP), exon 6 gi|3252846|gb|AF009698.1|HSGABRP06[3252846]

[6444] 13177: AF009697 Homo sapiens GABA-A receptor pi subunit gene (GABRP), exon 5 gi|3252845|gb|AF009697.1|HSGABRP05[3252845]

[6445] 13178: AF009696 Homo sapiens GABA-A receptor pi subunit gene (GABRP), exon 4 gi|3252844|gb|AF009696.1|HSGABRP04[3252844]

[6446] 13179: AF009695 Homo sapiens GABA-A receptor pi subunit gene (GABRP), exon 3 gi|3252843|gb|AF009695.1|HSGABRP03[3252843]

[6447] 13180: AF009694 Homo sapiens GABA-A receptor pi subunit gene (GABRP), exon 2 gi|3252842|gb|AF009694.1|HSGABRP02[3252842]

[6448] 13181: AF009693 Homo sapiens GABA-A receptor pi subunit gene (GABRP), exon 1 gi|3252841|gb|AF009693.1|HSGABRP01[3252841]

[6449] 13182: E13909 cDNA encoding human MCP-1 receptor protein gi|3252676|dbj|E13909.1|E13909[3252676]

[6450] 13183: E13892 cDNA encoding human novel G protein-coupling receptor protein gi|3252659|dbj|E13892.1|E13892[3252659]

[6451] 13184: E13385 cDNA encoding human MIP-1 alpha /RANTES receptor gi|3252190|dbj|E13385.1|E13385[3252190]

[6452] 13185: E13006 cDNA encoding human G-protein coupling receptor protein gi|3251830|dbj|E13006.1|E13006[3251830]

[6453] 13186: E13005 cDNA encoding human G-protein-coupling receptor protein gi|3251829|dbj|E13005.1E13005[3251829]

[6454] 13187: E12979 cDNA encoding human interleukin-6 receptor gi|3251803|dbj|E12979.1|E12979[3251803]

[6455] 13188: E12916 Human cDNA encoding a denatured low-density lipoprotein receptor gi|3251747|dbj|E12916.1|E12916[3251747]

[6456] 13189: E12845 cDNA encoding melatonin receptor gi|3251677|dbj|E12845.1|E12845[3251677]

[6457] 13190: E12752 A novel human Corticotropin Releasing Factor 2 (CRF2) receptor mRNA, complete cds gi|3251584|dbj|E12752.1|E12752[3251584]

[6458] 13191: E12750 A novel human Corticotropin Releasing Factor 2 (CRF2) receptor mRNA, complete cds gi|3251582|dbj|E12750.1|E12750[3251582]

[6459] 13192: E12703 cDNA encoding asialoglycoprotein receptor L-H2,AGPR L-H2 gi|3251535|dbj|E12703.1|E12703[3251535]

[6460] 13193: E12702 cDNA encoding asialoglycoprotein receptor H1, AGPR H1 gi|3251534|dbj|E12702.1|E12702[3251534]

[6461] 13197: E12658 cDNA encoding galanin receptor gi|3251490|dbj|E12658.1|E12658[3251490]

[6462] 13198: E12487 Human cDNA encoding a G protein-coupled receptor gi|3251320|dbj|E12487.1|E12487[3251320]

[6463] 13199: E12484 Human cDNA encoding a G protein-coupled receptor gi|3251317|dbj|E12484.1E12484[3251317]

[6464] 13200: E12354 cDNA encoding receptor of luteinizing hormone-releasing hormone,LH-RH receptor gi|3251188|dbj|E12354.1|E12354[3251188]

[6465] 13201: E12281 cDNA encoding human growth hormone-releasing hormone receptor gi|3251115|dbj|E12281.1|E12281[3251115]

[6466] 13202: E12186 A novel ligand for receptor type tyrosine kinase gi|3251020|dbj|E12186.1|E12186[3251020]

[6467] 13203: E12185 cDNA encoding a receptor type tyrosine kinase gi|3251019|dbj|E12185.1|E12185[3251019]

[6468] 13204: AF009962 Homo sapiens CC-chemokine receptor (CCR-5) gene, delta-32 allele, complete cds gi|3243092|gb|AF009962.1|AF009962[3243092]

[6469] 13205: AF050525 Homo sapiens proteinase activated receptor-3 (PAR-3) gene, 5′ regulatory sequence gi|3241996|gb|AF050525.1|AF050525[3241996]

[6470] 13206: U33328 Homo sapiens killer cell Ig-like receptor variant (KIR3DL1) mRNA, complete cds gi|995756|gb|U33328.1|HSU33328[995756]

[6471] 13207: U31416 Homo sapiens killer cell Ig-like receptor (KIR3DL1) mRNA, complete cds gi|973405|gb|U31416.1|HSU31416[973405]

[6472] 13208: U50748 Homo sapiens leptin receptor short form (db) mRNA, complete cds gi|3236285|gb|U50748.1|HSU50748[3236285]

[6473] 13215: Y14838 Homo sapiens ChemR23 gene gi|3219597|emb|Y14838.1|HSCHEMR23[3219597]

[6474] 13216: Y12505 H. sapiens mRNA for serotonin receptor 5-HT4B, splice variant gi|2661756|emb|Y12505.1|HSY12505[2661756]

[6475] 13217: Y08756 H. sapiens mRNA for serotonin receptor 5-HT4 gi|2661732|emb|Y08756.1|HS5HT4AR[2661732]

[6476] 13218: X85785 H. sapiens DARC gene gi|929624|emb|X85785.1|HSDARC[929624]

[6477] 13219: AH006173 Homo sapiens Type II integral membrane protein (NKG2-F), complete cds gi|2674028|gb|AH006173.1|SEG_HSNKG2F[02674028]

[6478] 13220: AF001298 Homo sapiens type II integral membrane protein (NKG2-D) gene, exons 9-13 gi|2674027|gb|AF001298.1HSNKG2F02[2674027]

[6479] 13221: AF001297 Homo sapiens type II integral membrane protein (NKG2-D) gene, exons 5-8 gi|2674026|gb|AF001297.1|HSNKG2F01[2674026]

[6480] 13222: AF048704 Homo sapiens lamin B receptor homolog TM7SF2 gene, complete cds gi|3211743|gb|AF048704.1|AF048704[3211743]

[6481] 13223: AF023676 Homo sapiens lamin B receptor homolog TM7SF2 (TM7SF2) mRNA, complete cds gi|3211721|gb|AF023676.1|AF023676[3211721]

[6482] 13224: AJ001016 Homo sapiens mRNA encoding RAMP3 gi|3171913|emb|AJ001016.1|HSRAMP3[3171913]

[6483] 13236: Y13584 Homo sapiens mRNA for serotin receptor 4, short splice variant gi|3183985|emb|Y13584.1|HSY13584[3183985]

[6484] 13237: AF030339 Homo sapiens receptor for viral semaphorin protein (VESPR) mRNA, complete cds gi|3176761|gb|AF030339.1|AF030339[3176761]

[6485] 13239: AC004782 Homo sapiens chromosome 5, BAC clone 205e20 (LBNL H170), complete sequence gi|3172145|gb|AC004782.1|AC004782[3172145]

[6486] 13240: AF009662 Homo sapiens T cell receptor beta locus, TCRBV13S1 to TCRBV6S9 region gi|2275573|gb|AF009662.1|HSTCRBB27[2275573]

[6487] 13241: AJ001015 Homo sapiens mRNA encoding RAMP2 gi|3171911|emb|AJ001015.1|HSRAMP2[3171911]

[6488] 13242: AJ001014 Homo sapiens mRNA encoding RAMP1 gi|3171909|emb|AJ001014.1|HSRAMP1[3171909]

[6489] 13243: AF011333 Homo sapiens DEC-205 mRNA, complete cds gi|3165456|gb|AF011333.1|AF011333[3165456]

[6490] 13244: AJ001902 Homo sapiens mRNA for TRIP6 (thyroid receptor interacting protein) gi|2558591|emb|AJ001902.1|HSTRIP6[2558591]

[6491] 13245: AF002216 AF002216 AP20 melanoma mRNA Homo sapiens cDNA, mRNA sequence gi|2895065|gb|AF002216.1|AF002216[2895065]

[6492] 13246: AF002215 AF002215 AP20 melanoma mRNA Homo sapiens cDNA, mRNA sequence gi|2895064|gb|AF002215.1|AF002215[2895064]

[6493] 13247: AF002214 AF002214 AP20 melanoma mRNA Homo sapiens cDNA, mRNA sequence gi|2895063|gb|AF002214.1|AF002214[2895063]

[6494] 13248: AC002411 Arabidopsis thaliana chromosome 1 BAC F20D22 sequence, complete sequence gi|2570223|gb|AC002411.1F20D22[2570223]

[6495] 13249: AF058927 Homo sapiens clone hvRNA92 vRNA sequence gi|3138979|gb|AF058927.1|AF058927[3138979]

[6496] 13250: AF058926 Homo sapiens clone hvRNA82 VRNA sequence gi|3138978|gb|AF058926.1|AF058926[3138978]

[6497] 13252: AC004699 Homo sapiens chromosome 19, cosmid R31973, complete sequence gi|3138892|gb|AC004699.1|AC004699[3138892]

[6498] 13253: Y13472 Homo sapiens mRNA for FIM protein gi|3135791|emb|Y13472.1|HSRIMP[3135791]

[6499] 13254: AF015452 Homo sapiens Usurpin-gamma mRNA, complete cds gi|3133284|gb|AF015452.1|AF015452[3133284]

[6500] 13255: AF015451 Homo sapiens Usurpin-beta mRNA, complete cds gi|3133282|gb|AF015451.1|AF015451[3133282]

[6501] 13256: AF015450 Homo sapiens Usurpin-alpha mRNA, complete cds gi|3133280|gb|AF015450.1|AF015450[3133280]

[6502] 13257: AF063658 Homo sapiens vascular endothelial growth factor receptor 2 (KDR) mRNA, complete cds gi|3132832|gb|AF063658.1|AF063658[3132832]

[6503] 13258: AJ224869 Homo sapiens CXCR4 gene encoding receptor CXCR4 gi|3059119|emb|AJ224869.1|HSA224869[3059119]

[6504] 13259: AH006106 Homo sapiens apoptosis signaling receptor FAS (FAS) and apoptosis signaling receptor FAS (FAS)s, partial cds gi|3128402|gb|AH006106.1|SEG_HSASRFAS[3128402]

[6505] 13260: AF061979 Homo sapiens apoptosis signaling receptor FAS (FAS) gene, exon 7 and partial cds gi|3128401|gb|AF061979.1|HSASRFAS2[3128401]

[6506] 13261: AF061978 Homo sapiens apoptosis signaling receptor FAS (FAS) gene, exons 6 and 7 and partial cds gi|3128400|gb|AF061978.1|HSASRFAS1[3128400]

[6507] 13262: AH006105 Homo sapiens sulfonylurea receptor type (SUR2) gene, alternative splice products, complete cds gi|3127174|gb|AH006105.1|SEG_HSSUR2G[3127174]

[6508] 13263: AF061324 Homo sapiens sulfonylurea receptor 2B (SUR2) gene, alternatively spliced product, exon 38b and complete cds gi|3127173|gb|AF061324.1|HSSUR2G71[3127173]

[6509] 13264: AF061323 Homo sapiens sulfonylurea receptor 2A (SUR2) gene, alternatively spliced product, exon 38a and complete cds gi|3127172|gb|AF061323.1|HSSUR2G69[3127172]

[6510] 13265: AF061322 Homo sapiens sulfonylurea receptor (SUR2) gene, exon 37 gi|3127171|gb|AF061322.1|HSSUR2G67[3127171]

[6511] 13266: AF061321 Homo sapiens sulfonylurea receptor (SUR2) gene, exon 36 gi|3127170|gb|AF061321.1|HSSUR2G65[3127170]

[6512] 13267: AF061320 Homo sapiens sulfonylurea receptor (SUR2) gene, exon 35 gi|3127169|gb|AF061320.1HSSUR2G63[3127169]

[6513] 13268: AF061319 Homo sapiens sulfonylurea receptor (SUR2) gene, exon 34 gi|3127168|gb|AF061319.1|HSSUR2G61[3127168]

[6514] 13269: AF061318 Homo sapiens sulfonylurea receptor (SUR2) gene, exon 33 gi|3127167|gb|AF061318.1|HSSUR2G59[3127167]

[6515] 13270: AF061317 Homo sapiens sulfonylurea receptor (SUR2) gene, exon 32 gi|3127166|gb|AF061317.1|HSSUR2G57[3127166]

[6516] 13271: AF061316 Homo sapiens sulfonylurea receptor (SUR2) gene, exon 31 gi|3127165|gb|AF061316.1 HSSUR2G55[3127165]

[6517] 13272: AF061315 Homo sapiens sulfonylurea receptor (SUR2) gene, exon 30 gi|3127164|gb|AF061315.1|HSSUR2G53[3127164]

[6518] 13273: AF061314 Homo sapiens sulfonylurea receptor (SUR2) gene, exon 29 gi|3127163|gb|AF061314.1|HSSUR2G51[3127163]

[6519] 13274: AF061313 Homo sapiens sulfonylurea receptor (SUR2) gene, exon 28 gi|3127162|gb|AF061313.1|HSSUR2G49[3127162]

[6520] 13275: AF061312 Homo sapiens sulfonylurea receptor (SUR2) gene, exon 27 gi|3127161|gb|AF061312.1|HSSUR2G47[3127161]

[6521] 13276: AF061311 Homo sapiens sulfonylurea receptor (SUR2) gene, exons 25 and 26 gi|3127160|gb|AF061311.1|HSSUR2G45[3127160]

[6522] 13277: AF061310 Homo sapiens sulfonylurea receptor (SUR2) gene, exon 24 gi|3127159|gb|AF061310.1|HSSUR2G43[3127159]

[6523] 13278: AF061309 Homo sapiens sulfonylurea receptor (SUR2) gene, exon 23 gi|3127158|gb|AF061309.1|HSSUR2G41[3127158]

[6524] 13279: AF061308 Homo sapiens sulfonylurea receptor (SUR2) gene, exons 21 and 22 gi|3127157|gb|AF061308.1|HSSUR2G39[3127157]

[6525] 13280: AF061307 Homo sapiens sulfonylurea receptor (SUR2) gene, exon 20 gi|3127156|gb|AF061307.1|HSSUR2G37[3127156]

[6526] 13281: AF061306 Homo sapiens sulfonylurea receptor (SUR2) gene, exon 19 gi|3127155|gb|AF061306.1|HSSUR2G35[3127155]

[6527] 13282: AF061305 Homo sapiens sulfonylurea receptor (SUR2) gene, exon 18 gi|3127154|gb|AF061305.1|HSSUR2G33[3127154]

[6528] 13283: AF061304 Homo sapiens sulfonylurea receptor (SUR2) gene, exon 17 gi|3127153|gb|AF061304.1|HSSUR2G31[3127153]

[6529] 13284: AF061303 Homo sapiens sulfonylurea receptor (SUR2) gene, exon 16 gi|3127152|gb|AF061303.1|HSSUR2G29[3127152]

[6530] 13285: AF061302 Homo sapiens sulfonylurea receptor (SUR2) gene, exon 15 gi|3127151|gb|AF061302.1|HSSUR2G27[3127151]

[6531] 13286: AF061301 Homo sapiens sulfonylurea receptor (SUR2) gene, exon 14 gi|3127150|gb|AF061301.1|HSSUR2G25[3127150]

[6532] 13287: AF061300 Homo sapiens sulfonylurea receptor (SUR2) gene, exon 13 gi|3127149|gb|AF061300.1|HSSUR2G23[3127149]

[6533] 13288: AF061299 Homo sapiens sulfonylurea receptor (SUR2) gene, exon 12 gi|3127148|gb|AF061299.1|HSSUR2G21[3127148]

[6534] 13289: AF061298 Homo sapiens sulfonylurea receptor (SUR2) gene, exon 11 gi|3127147|gb|AF061298.1|HSSUR2G19[3127147]

[6535] 13290: AF061297 Homo sapiens sulfonylurea receptor (SUR2) gene, exon 10 gi|3127146|gb|AF061297.1|HSSUR2G17[3127146]

[6536] 13291: AF061296 Homo sapiens sulfonylurea receptor (SUR2) gene, exon 9 gi|3127145|gb|AF061296.1|HSSUR2G15[3127145]

[6537] 13292: AF061295 Homo sapiens sulfonylurea receptor (SUR2) gene, exons 7 and 8 gi|3127144|gb|AF061295.1|HSSUR2G13[3127144]

[6538] 13293: AF061294 Homo sapiens sulfonylurea receptor (SUR2) gene, exon 6 gi|3127143|gb|AF061294.1|HSSUR2G11[3127143]

[6539] 13294: AF061293 Homo sapiens sulfonylurea receptor (SUR2) gene, exon 5 gi|3127142|gb|AF061293.1|HSSUR2G09[3127142]

[6540] 13295: AF061292 Homo sapiens sulfonylurea receptor (SUR2) gene, exon 4 gi|312714|gb|AF061292.1|HSSUR2G07[3127141]

[6541] 13296: AF061291 Homo sapiens sulfonylurea receptor (SUR2) gene, exon 3 gi|3127140|gb|AF061291.1|HSSUR2G05[3127140]

[6542] 13297: AF061290 Homo sapiens sulfonylurea receptor (SUR2) gene, exon 2 gi|3127139|gb|AF061290.1HSSUR2G03[31271391

[6543] 13298: AF061289 Homo sapiens sulfonylurea receptor (SUR2) gene, exon 1 gi|3127138|gb|AF061289.1|HSSUR2G01[3127138]

[6544] 13299: U77783 Homo sapiens N-methyl-D-aspartate receptor 2D subunit precursor (NMDAR2D) mRNA, complete cds gi|2444025|gb|U77783.1|HSU77783[2444025]

[6545] 13300: AJ001515 Homo sapiens mRNA for ryanodine receptor 3, complete CDS gi|3123583|emb|AJ001515.1|HSRYR3[3123583]

[6546] 13302: AJ002512 Homo sapiens mRNA for ryanodine receptor 3, partial gi|2582750|emb|AJ002512.1|HSAJ2512[2582750]

[6547] 13303: AJ002511 Homo sapiens mRNA for ryanodine receptor 2, partial gi|2582748|emb|AJ002511.1|HSAJ2511[2582748]

[6548] 13315: Z81148 H. sapiens mRNA for gonadotropin-releasing hormone receptor, splice variant gi|1628389|emb|Z81148.1|HSGTRHSV[1628389]

[6549] 13316: U71092 Homo sapiens somatostatin receptor-like protein (GPR24) gene, complete cds gi|1737178|gb|U71092.1|HSU71092[1737178]

[6550] 13317: AH006056 Homo sapiens chromosome 10 clone BAC 73106 map 10q25-q26 gi|3068782|gb|AH006056.1|SEG_HSGFRA1H[3068782]

[6551] 13318: AF058999 Homo sapiens glial cell line-derived neurotrophic factor receptor alpha (GFRA1) gene, exon 11 and complete cds gi|3068781|gb|AF058999.1|HSGFRA1H10[3068781]

[6552] 13319: AF058998 Homo sapiens glial cell line-derived neurotrophic factor receptor alpha (GFRA1) gene, exon 10 gi|3068780|gb|AF058998.1|HSGFRA1H09[3068780]

[6553] 13320: AF058997 Homo sapiens glial cell line-derived neurotrophic factor receptor alpha (GFRA1) gene, exon 9 gi|3068779|gb|AF058997.1|HSGFRA1H08[3068779]

[6554] 13321: AF058996 Homo sapiens glial cell line-derived neurotrophic factor receptor alpha (GFRA1) gene, exon 8 gi|3068778|gb|AF058996.1|HSGFRA1H07[3068778]

[6555] 13322: AF058995 Homo sapiens glial cell line-derived neurotrophic factor receptor alpha (GFRA1) gene, exon 7 gi|3068777|gb|AF058995.1|HSGFRA1H06[3068777]

[6556] 13323: AF058994 Homo sapiens glial cell line-derived neurotrophic factor receptor alpha (GFRA1) gene, exon 6 gi|3068776|gb|AF058994.1|HSGFRA1H05[3068776]

[6557] 13324: AF058993 Homo sapiens glial cell line-derived neurotrophic factor receptor alpha (GFRA1) gene, exon 5 gi|3068775|gb|AF058993.1|HSGFRA1H04[3068775]

[6558] 13325: AF058992 Homo sapiens glial cell line-derived neurotrophic factor receptor alpha (GFRA1) gene, exon 4 gi|3068774|gb|AF058992.1|HSGFRA1H03[3068774]

[6559] 13326: AF058991 Homo sapiens glial cell line-derived neurotrophic factor receptor alpha (GFRA1) gene, exon 3 gi|3068773|gb|AF058991.1|HSGFRA1H02[3068773]

[6560] 13327: AF058990 Homo sapiens glial cell line-derived neurotrophic factor receptor alpha (GFRA1) gene, exon 2 gi|3068772|gb|AF058990.1|HSGFRA1H01[3068772]

[6561] 13328: AF044197 Homo sapiens B lymphocyte chemoattractant BLC mRNA, complete cds gi|2911375|gb|AF044197.1|AF044197[2911375]

[6562] 13329: Y16280 Homo sapiens mRNA for G protein-coupled receptor ETBR-LP-2 gi|3059117|emb|Y16280.1|HSETBRLP2[3059117]

[6563] 13330: U16260 Neisseria gonorrheae lactoferrin receptor precursor (1bpA) gene, complete cds gi|915277|gb|U16260.1|NGU16260[915277]

[6564] 13331: AF057177 Homo sapiens T-cell receptor gamma V1 gene region gi|3047019|gb|AF057177.1|AF057177[3047019]

[6565] 13333: AF057168 Homo sapiens type II interleukin-1 receptor antagonist (IL-1ra3) gene, partial cds gi|3046605|gb|AF057168.1|AF057168[3046605]

[6566] 13334: L06155 Homo sapiens melanocortin receptor gene, complete cds gi|188673|gb|L06155.1|HUMMR[188673]

[6567] 13335: L27490 Homo sapiens prostanoid EP3-I receptor mRNA, complete cds gi|440313|gb|L27490.1|HUMPEIRB[440313]

[6568] 13336: L27489 Homo sapiens prostanoid EP3-III receptor mRNA, complete cds gi|440311|gb|L27489.1|HUMPEIRA[440311]

[6569] 13337: L27488 Homo sapiens prostanoid EP3-II receptor mRNA, complete cds gi|440309|gb|L27488.1|HUMPEIR[440309]

[6570] 13338: AF009664 Homo sapiens T cell receptor beta locus, 3′ trypsinogen repeats gi|2275594|gb|AF009664.1|HSTCRB1H[2275594]

[6571] 13339: AF009660 Homo sapiens T cell receptor beta locus, TCRBV7S3A2 to TCRBV12S2 region gi|2275560|gb|AF009660.1|HSTCRBK17[2275560]

[6572] 13340: AB006537 Homo sapiens mRNA for interleukin 1 receptor accessory protein, complete cds gi|3041772|dbj|AB006537.1|AB006537[3041772]

[6573] 13341: AF016098 Homo sapiens vascular endothelial cell growth factor 165 receptor 2 (VEGF165R2) mRNA, complete cds gi|2978561|gb|AF016098.1|AF016098[2978561]

[6574] 13342: AF016050 Homo sapiens vascular endothelial cell growth factor 165 receptor/neuropilin (VEGF165) mRNA, complete cds gi|2978559|gb|AF016050.1|AF016050[2978559]

[6575] 13343: U90941 Homo sapiens cell-type natural killer cells Fc gamma receptor RIIc4 (Fc-gammaRIIC) mRNA, complete cds gi|214963|gb|U90941.1|HSU90941[2149631]

[6576] 13344: U90940 Homo sapiens cell-type natural killer cells Fc gamma receptor IIc3 (Fc-gammaRIIC) mRNA, complete cds gi|2149629|gb|U90940.1HSU90940[2149629]

[6577] 13345: U90939 Homo sapiens cell-type natural killer cells Fc gamma receptor IIc2 (Fc-gammaRIIC) mRNA, complete cds gi|2149627|gb|U90939.1|HSU90939[2149627]

[6578] 13346: U90938 Homo sapiens cell-type natural killer cells Fc gamma receptor IIc1 (Fc-gammaRIIC) mRNA, complete cds gi|2149625|gb|U90938.1|HSU90938[2149625]

[6579] 13348: Y14739 Homo sapiens CXCR4 gene gi|3021393|emb|Y14739.1|HSCXCR4[3021393]

[6580] 13349: Y07683 H. sapiens mRNA for P2X3 purinoceptor gi|2370146|emb|Y07683.1|HSP2X3PC[2370146]

[6581] 13350: AF027390 Homo sapiens 7q telomere, complete sequence gi|3004858|gb|AF027390.1|AF027390[3004858]

[6582] 13351: U04357 Homo sapiens arginine vasopressin receptor type II, V2 antidiuretic hormone receptor (AVPR2) gene, complete cds gi|3004498|gb|U04357.1|HSU04357[3004498]

[6583] 13352: AH006005 Homo sapiens TGF-beta type I receptor (TGFBR1), complete cds gi|3003037|gb|AH006005.1|SEG_HSTGFBR1G[3003037]

[6584] 13353: AF054598 Homo sapiens TGF-beta type I receptor (TGFBR1) gene, exon 9 and complete cds gi|3003036|gb|AF054598.1|HSTGFBR1G9[3003036]

[6585] 13354: AF054597 Homo sapiens TGF-beta type I receptor (TGFBR1) gene, exon 8 gi|3003035|gb|AF054597.1|HSTGFBR1G8[3003035]

[6586] 13355: AF054596 Homo sapiens TGF-beta type I receptor (TGFBR1) gene, exon 7 gi|3003034|gb|AF054596.1|HSTGFBR1G7[3003034]

[6587] 13356: AF054595 Homo sapiens TGF-beta type I receptor (TGFBR1) gene, exon 6 gi|3003033|gb|AF05459S.1|HSTGFBR1G6[3003033]

[6588] 13357: AF054594 Homo sapiens TGF-beta type I receptor (TGFBR1) gene, exon 5 gi|3003032|gb|AF054594.1|HSTGFBR1G5[3003032]

[6589] 13358: AF054593 Homo sapiens TGF-beta type I receptor (TGFBR1) gene, exon 4 gi|3003031|gb|AF054593.1|HSTGFBR1G4[3003031]

[6590] 13359: AF054592 Homo sapiens TGF-beta type I receptor (TGFBR1) gene, exon 3 gi|3003030|gb|AF054592.1|HSTGFBR1G3[3003030]

[6591] 13360: AF054591 Homo sapiens TGF-beta type I receptor (TGFBR1) gene, exon 2 gi|3003029|gb|AF054591.1|HSTGFBR1G2[3003029]

[6592] 13361: AF054590 Homo sapiens TGF-beta type I receptor (TGFBR1) gene, exon 1 gi|3003028|gb|AF054590.1|HSTGFBR1G1[3003028]

[6593] 13362: L12406 Homo sapiens chemoattractant receptor (fMLP) gene sequence gi|348164|gb|L12406.1|HUMCR[348164]

[6594] 13363: AC004510 Homo sapiens chromosome 19, cosmid R30385, complete sequence gi|2996651|gb|AC004510.1|AC004510[2996651]

[6595] 13364: U84721 Homo sapiens interferon gamma receptor 1 gene, microsatellite sequence gi|2982188|gb|U84721.1|HSU84721[2982188]

[6596] 13365: AF013261 Homo sapiens alpha 1A adrenergic receptor isoform 4 mRNA, complete cds gi|2978555|gb|AF013261.1|AF013261[2978555]

[6597] 13369: AF014794 Homo sapiens TNF related TRAIL receptor (TRAIL-R3) mRNA, complete cds gi|2957263|gb|AF014794.1|AF014794[2957263]

[6598] 13372: AC003658 Homo sapiens Xp22 BAC GS-607H18 (Genome Systems Human BAC library) complete sequence gi|2935592|gb|AC003658.1|AC003658[2935592]

[6599] 13375: AH005897 Homo sapiens type I sigma receptor, complete cds gi|2914739|gb|AH005897.1|SEG_HSTIRG[2914739]

[6600] 13376: AF001977 Homo sapiens type I sigma receptor gene, exon 4 and complete cds gi|2914738|gb|AF001977.1|HSTIRG3[2914738]

[6601] 13377: AF001976 Homo sapiens type I sigma receptor gene, exons 1, 2 and 3 gi|2914737|gb|AF001976.1|HSTIRG2[2914737]

[6602] 13486: U78192 Homo sapiens Edg-2 receptor mRNA, complete cds gi|1688304|gb|U78192.1|HSU78192[1688304]

[6603] 13488: AF044492 Homo sapiens olfactory receptor-like protein (OLFR42A) gene, allele 9092.1, partial cds gi|2828698|gb|AF044492.1|AF044492[2828698]

[6604] 13489: AF044491 Homo sapiens olfactory receptor-like protein (OLFR42A) gene, allele 9004.14, partial cds gi|2828696|gb|AF044491.1|AF044491[2828696]

[6605] 13490: AF042078 Homo sapiens olfactory receptor-like protein (OLFR42A) gene, OLFR42A-9026.2 allele, partial cds gi|2828681|gb|AF042078.1|AF042078[2828681]

[6606] 13491: AB010710 Homo sapiens mRNA for lectin-like oxidized LDL receptor, complete cds gi|2828355|dbj|AB010710.1|AB010710[2828355]

[6607] 13492: AF041462 Homo sapiens I-FLICE isoform 5 mRNA, complete cds gi|2827297|gb|AF041462.1|AF041462[2827297]

[6608] 13493: AF041461 Homo sapiens I-FLICE isoform 4 mRNA, complete cds gi|2827295|gb|AF041461.1|AF041461[2827295]

[6609] 13494: AF041460 Homo sapiens I-FLICE isoform 3 mRNA, complete cds gi|2827293|gb|AF041460.1|AF041460[2827293]

[6610] 13495: AF041459 Homo sapiens I-FLICE isoform 2 mRNA, complete cds gi|2827291|gb|AF041459.1|AF041459[2827291]

[6611] 13496: AF041458 Homo sapiens I-FLICE mRNA, complete cds gi|2827289|gb|AF041458.1|AF041458[2827289]

[6612] 13497: Z73157 H. sapiens mRNA for C3a anaphylatoxin receptor gi|2826756|emb|Z73157.1|HSC3AAREC[2826756]

[6613] 13498: U58917 Homo sapiens IL-17 receptor mRNA, complete cds gi|2826475|gb|U58917.1|HSU58917[2826475]

[6614] 13524: Y16282 Homo sapiens mRNA for nicotinic acetylcholine receptor alpha6 subunit precursor gi|2815224|emb|Y16282.1|HSY16282[2815224]

[6615] 13525: Y16281 Homo sapiens mRNA for nicotinic acetylcholine receptor alpha2 subunit precursor gi|2815222|emb|Y16281.1|HSY16281[2815222]

[6616] 13526: X98858 H. sapiens mRNA for HLA-C specific activatory NK receptor gi|1419593|emb|X98858.1|HSNKREC[1419593]

[6617] 13527: M76676 Homo sapiens leukocyte platelet-activating factor receptor mRNA, complete cds gi|2810988|gb|M76676.1|HUMNPIIY20[2810988]

[6618] 13528: Y08420 H. sapiens mRNA for nicotinic acetylcholine receptor alpha7 subunit precursor gi|2808623|emb|Y08420.1|HSNACHRA7[2808623]

[6619] 13529: Y08419 H. sapiens mRNA for nicotinic acetylcholine receptor alpha5 subunit precursor gi|1702913|emb|Y08419.1|HSNACHRA5[1702913]

[6620] 13530: Y08421 H. sapiens mRNA for nicotinic acetylcholine receptor alpha4 subunit precursor gi|1702911|emb|Y08421.1|HSNACHRA4[1702911]

[6621] 13531: Y08417 H. sapiens mRNA for nicotinic acetylcholine receptor beta3 subunit precursor gi|1702909|emb|Y08417.1|HSNACHR3B[1702909]

[6622] 13532: Y08416 H. sapiens mRNA for nicotinic acetylcholine receptor beta4 subunit precursor gi|1702919|emb|Y08416.1|HSNACHRB4[1702919]

[6623] 13533: Y08415 H. sapiens mRNA for nicotinic acetylcholine receptor beta2 subunit precursor gi|1702917|emb|Y08415.1|HSNACHRB2[1702917]

[6624] 13534: Y08418 H. sapiens mRNA for nicotinic acetylcholine receptor alpha3 subunit precursor gi|1702907|emb|Y08418.1|HSNACHR3A[1702907]

[6625] 13536: AF042077 Homo sapiens olfactory receptor-like protein (OLFR 42B) gene, OLFR 42B-9079.6 allele, partial cds gi|2801710|gb|AF042077.1|AF042077[2801710]

[6626] 13537: AF042076 Homo sapiens olfactory receptor-like protein (OLFR 42B) gene, OLFR 42B-9108.1 allele, partial cds gi|2801708|gb|AF042076.1|AF042076[2801708]

[6627] 13538: AF042075 Homo sapiens olfactory receptor-like protein (OLFR 42B) gene, OLFR 42B-9110 allele, partial cds gi|2801706|gb|AF042075.1|AF042075[2801706]

[6628] 13539: AF042074 Homo sapiens olfactory receptor-like protein (OLFR 42A) gene, OLFR 42A-9079.3 allele, partial cds gi|2801704|gb|AF042074.1|AF042074[2801704]

[6629] 13540: AF042073 Homo sapiens olfactory receptor-like protein (OLFR 42A) gene, OLFR 42A-9049 allele, partial cds gi|2801702|gb|AF042073.1|AF042073[2801702]

[6630] 13600: Y10530 H. sapiens gene encoding putative olfactory receptor (clone htpcr2) gi|2792017|emb|Y10530.1|HSHTPCR2[2792017]

[6631] 13601: Y10529 H. sapiens mRNA for putative olfactory receptor (clone ht2) gi|2792015|emb|Y10529.1(HSHT2[2792015]

[6632] 13614: Z26876 H. sapiens gene for ribosomal protein L38 gi|407422|emb|Z26876.1|HSRPL38[407422]

[6633] 13615: Z50150 H. sapiens mRNA for tyrosine kinase activator protein 1 (TKA-1) gi|1246762|emb|Z50150.1|HSTKA1MR[1246762]

[6634] 13616: Y13055 Homo sapiens mRNA for NKG2-CII activating NK receptor gi|2765292|emb|Y13055.1|HSNKG2CII[2765292]

[6635] 13617: Y13054 Homo sapiens mRNA for NK receptor, clone GR #29 gi|2765290|emb|Y13054.1|HSNKREC29[2765290]

[6636] 13618: Y10437 H. sapiens mRNA for serotonin receptor 4 gi|2765076|emb|Y10437.1|HSSERR4[2765076]

[6637] 13619: AJ002105 Homo sapiens mRNA for NK receptor, clone library TG14#13 gi|2764706|emb|AJ002105.1|HSAJ2105[2764706]

[6638] 13620: AJ002104 Homo sapiens mRNA for NK receptor, clone library TG14#6 gi|2764704|emb|AJ002104.1|HSAJ2104[2764704]

[6639] 13621: AJ002103 Homo sapiens mRNA for NK receptor, clone library TG14#35 gi|2764702|emb|AJ002103.1|HSAJ2103[2764702]

[6640] 13622: AJ002102 Homo sapiens mRNA for NK receptor, clone library TG14#8 gi|2764700|emb|AJ002102.1|HSAJ2102[2764700]

[6641] 13623: AJ000001 Homo sapiens mRNA for CD94-B NK receptor gi|2764393|emb|AJ000001.1|HSCD94B[2764393]

[6642] 13624: Y10141 H. sapiens DAT1 gene, partial, VNTR gi|1752665|emb|Y10141.1|HSDAT1[1752665]

[6643] 13625: Z97213 Homo sapiens mRNA for T-cell receptor gi|2239129|emb|Z97213.1|HSTCRBV2S[2239129]

[6644] 13627: AF026263 Homo sapiens muscarinic receptor (CHRM5) mRNA, complete cds gi|2605721|gb|AF026263.1|AF026263[2605721]

[6645] 13628: AF026261 Homo sapiens histamine H1 receptor mRNA, complete cds gi|2605717|gb|AF026261.1|AF026261[2605717]

[6646] 13629: AF026260 Homo sapiens vitamin D receptor (VDR) mRNA, complete cds gi|2605715|gb|AF026260.1|AF026260[2605715]

[6647] 13630: AH005786 Homo sapiens CC chemokine receptor 5 (CCR5) gene, complete cds gi|2739498|gb|AH005786.1|SEG_HSCCR5AB[2739498]

[6648] 13631: AF031237 Homo sapiens CC chemokine receptor 5 (CCR5) gene, complete cds gi|2739497|gb|AF031237.1|HSCCR5AB3[2739497]

[6649] 13633: AH005782 Homo sapiens chromosome X map Xq28 gi|2735348|gb|AH005782.1|SEG_HSGABRE[2735348]

[6650] 13634: AF037334 Homo sapiens Eph-like receptor tyrosine kinase hEphB1d (EphB1) mRNA, complete cds gi|2739209|gb|AF037334.1|AF037334[2739209]

[6651] 13635: AF037333 Homo sapiens Eph-like receptor tyrosine kinase hEphB1c (EphB1) mRNA, complete cds gi|2739207|gb|AF037333.1|AF037333[2739207]

[6652] 13636: AF011406 Homo sapiens corticotropin releasing hormone receptor type 2 beta isoform (CRH2R) mRNA, complete cds gi|2738557|gb|AF011406.1|AF011406[2738557]

[6653] 13637: U59632 Homo sapiens H5 mRNA, partial cds; and platelet glycoprotein Ib beta chain mRNA, complete cds gi|1809264|gb|U59632.1|HSU59632[1809264]

[6654] 13638: D86864 Homo sapiens mRNA for acetyl LDL receptor, complete cds gi|2723468|dbj|D86864.1|D86864[2723468]

[6655] 13639: AF027208 Homo sapiens AC133 antigen mRNA, complete cds gi|2688948|gb|AF027208.1|AF027208[2688948]

[6656] 13640: AB001025 Homo sapiens mRNA for brain ryanodine receptor, complete cds gi|2696014|dbj|AB001025.1|AB3001025[2696014]

[6657] 13641: D00017 Homo sapiens mRNA for lipocortin II, complete cds gi|219909|dbj|D00017.1|HUMLIC[219909]

[6658] 13642: Y08236 H. sapiens LRP gene, polymorphisms in intron 24 gi|2125808|emb|Y08236.1|HSLRPIN24[2125808]

[6659] 13644: AF025998 Homo sapiens atrial natriuretic peptide clearance receptor (ANPRC) mRNA, complete cds gi|2570851|gb|AF025998.1|AF025998[2570851]

[6660] 13645: AD000671 Homo sapiens |DNA from chromosome 19-cosmid f24109 containing HRX2, genomic sequence gi|1905893|gb|AD000671.1|AD000671[1905893]

[6661] 13646: Z49119 H. sapiens mRNA for serotonin 6 receptor (5-HT6; partial) gi|984128|emb|Z49119.1|HS5HT6[984128]

[6662] 13647: Z48150 H. sapiens 5-HT4 mRNA for serotonin 4 receptor (5-HT4) gi|984126|emb|Z48150.1|HS5HT4[984126]

[6663] 13648: Y15743 Homo sapiens RET proto-oncogene, exon 13 containing two mutations gi|2665353|emb|Y15743.1|HSRET13[2665353]

[6664] 13649: AF000575 Homo sapiens clone 16 immunoglobulin-like transcript 5 mRNA, complete cds gi|2264428|gb|AF000575.1|AF000575[2264428]

[6665] 13650: AF000574 Homo sapiens clone 1 immunoglobulin-like transcript 4 mRNA, complete cds gi|2264426|gb|AF000574.1|AF000574[2264426]

[6666] 13651: Z26652 H. sapiens FLT3 mRNA for FLT3 receptor tyrosine kinase gi|406322|emb|Z26652.1|HSFLT3RTK[406322]

[6667] 13653: X82208 H. sapiens mRNA for beta-centractin (ATCC# HHCPJ76) gi|563887|emb|X82208.1HSBCENTR[563887]

[6668] 13654: AF035261 Homo sapiens thyroid stimulating hormone receptor (TSHR) mRNA, partial cds gi|2654195|gb|AF035261.1|HSTSHR[2654195]

[6669] 13655: AF032388 Homo sapiens vasopressin receptor type 2 mRNA, alternatively spliced, complete cds gi|2654030|gb|AF032388.1|AF032388[2654030]

[6670] 13656: AF025534 Homo sapiens leucocyte immunoglobulin-like receptor-8 (LIR-8) mRNA, complete cds gi|2653874|gb|AF025534.1|AF025534[2653874]

[6671] 13657: AF025533 Homo sapiens leucocyte immunoglobulin-like receptor-3 (LIR-3) mRNA, complete cds gi|2653872|gb|AF025533.1|AF025533[2653872]

[6672] 13658: AF025532 Homo sapiens leucocyte immunoglobulin-like receptor-S (LIR-5) mRNA, complete cds gi|2653870|gb|AF025532.1|AF025532[2653870]

[6673] 13659: AF025531 Homo sapiens leucocyte immunoglobulin-like receptor-7 (LIR-7) mRNA, complete cds gi|2653868|gb|AF025531.1|AF025531[2653868]

[6674] 13660: AF025530 Homo sapiens leucocyte immunoglobulin-like receptor-6a (LIR-6) mRNA, complete cds gi|2653866|gb|AF025530.1|AF025530[2653866]

[6675] 13661: AF025529 Homo sapiens leucocyte immunoglobulin-like receptor-6b (LIR-6) mRNA, complete cds gi|2653864|gb|AF025529.1|AF025529[2653864]

[6676] 13662: AF025528 Homo sapiens leucocyte immunoglobulin-like receptor-2 (LIR-2) mRNA, complete cds gi|2653862|gb|AF025528.1|AF025528[2653862]

[6677] 13663: AF025527 Homo sapiens leucocyte immunoglobulin-like receptor-4 (LIR-4) mRNA, complete cds gi|2653860|gb|AF025527.1|AF025527[2653860]

[6678] 13664: Y13583 Homo sapiens mRNA for G-protein coupled receptor gi|2652933|emb|Y13583.1|HSGPCP[2652933]

[6679] 13665: Y13367 H. sapiens mRNA for phosphoinositide 3-kinase gi|2143259|emb|Y13367.1|HSPHOSI3K[2143259]

[6680] 13666: X82207 H. sapiens mRNA for beta-centractin (PC3) gi|563885|emb|X82207.1|HSBCENT[563885]

[6681] 13667: AF033854 Homo sapiens lymphocyte inhibitor of TRAIL (LIT) mRNA, complete cds gi|2645841|gb|AF033854.1|AF033854[2645841]

[6682] 13668: X81882 H. sapiens mRNA for for vasopressin activated calcium mobilizing receptor-like protein gi|1628414|emb|X81882.1|HSVACM1[1628414]

[6683] 13669: AF024690 Homo sapiens putative G protein-coupled receptor (GPR43) gene, complete cds gi|2612951|gb|AF024690.1|AF024690[2612951]

[6684] 13670: AF024689 Homo sapiens putative G protein-coupled receptor (GPR42) gene, complete cds gi|2612949|gb|AF024689.1|AF024689[2612949]

[6685] 13671: AF024688 Homo sapiens putative G protein-coupled receptor (GPR41) gene, complete cds gi|2612947|gb|AF024688.1|AF024688[2612947]

[6686] 13672: AF024687 Homo sapiens putative G protein-coupled receptor (GPR40) gene, complete cds gi|2612945|gb|AF024687.1|AF024687[2612945]

[6687] 13673: D87513 Homo sapiens mRNA for Grb7 protein, partial cds gi|1526534|dbj|D87513.1|D87513[1526534]

[6688] 13674: D49919 Homo sapiens mRNA for C-C chemokine receptor type 2, complete cds gi|2626807|dbj|D49919.1|D49919[2626807]

[6689] 13675: AF030512 Homo sapiens small cell vasopressin subtype 1b receptor mRNA, complete cds gi|2613124|gb|AF030512.1|AF030512[2613124]

[6690] 13676: Y12852 Homo sapiens P2X7 gene, exon 2 and 3 gi|2612788|emb|Y12852.1|HSP2X7E23[2612788]

[6691] 13677: Y12851 Homo sapiens P2X7 gene, exon 1 and joined CDS gi|2597926|emb|Y12851.1|HSP2X7EX1[2597926]

[6692] 13678: Y12854 Homo sapiens P2X7 gene, exon 9-11 gi|2612787|emb|Y12854.1|HSP2X7911[2612787]

[6693] 13679: Y12853 Homo sapiens P2X7 gene, exon 4-8 gi|2612786|emb|Y12853.1|HSP2X748[2612786]

[6694] 13680: Y12855 Homo sapiens P2X7 gene, exon 12 and 13 gi|2612785|emb|Y12855.1|HSP2X7123[2612785]

[6695] 13681: AB005520 Homo sapiens ppar gamma2 gene for peroxisome proliferator activated-receptor gamma, partial cds and 5′ flanking gi|2605488|dbj|AB005520.1|AB005520[2605488]

[6696] 13682: Y09765 Homo sapiens mRNA for putative GABA receptor epsilon subunit gi|2285960|emb|Y09765.1|HSY09765[2285960]

[6697] 13683: Y09764 Homo sapiens GABRE gene, exon 2-8 gi|2285959|emb|Y09764.1|HSY09764[2285959]

[6698] 13684: Y09763 Homo sapiens GABRE gene, exon 1 (and joined CDS) gi|2285957|emb|Y09763.1|HSY09763[2285957]

[6699] 13685: AF026535 Homo sapiens chemokine receptor (CCR3) mRNA, complete cds gi|2582565|gb|AF026535.1|AF026535[2582565]

[6700] 13686: AF026071 Homo sapiens soluble death receptor 3 beta (DR3) mRNA, complete cds gi|2570832|gb|AF026071.1|AF026071[2570832]

[6701] 13687: AF022956 Homo sapiens beta2-adrenergic receptor (ADRB2) gene, complete cds gi|2570532|gb|AF022956.1|AF022956[2570532]

[6702] 13688: AF022955 Homo sapiens beta2-adrenergic receptor (ADRB2) gene, complete cds gi|2570530|gb|AF022955.1|AF022955[2570530]

[6703] 13689: AF022954 Homo sapiens beta2-adrenergic receptor (ADRB2) gene, complete cds gi|2570528|gb|AF022954.1|AF022954[2570528]

[6704] 13690: AF022953 Homo sapiens beta2-adrenergic receptor (ADRB2) gene, complete cds gi|2570526|gb|AF022953.1|AF022953[2570526]

[6705] 13691: AF014958 Homo sapiens chemokine receptor X (CKRX) mRNA, complete cds gi|2305263|gb|AF014958.1|AF014958[2305263]

[6706] 13692: AB000712 Homo sapiens hCPE-R mRNA for CPE-receptor, complete cds gi|2570124|dbj|AB000712.1|AB000712[2570124]

[6707] 13693: X94609 H. sapiens mRNA for activatory NK receptor/KKA3 p50.3 gi|1495414|embrX94609.1|HSANKRMR[1495414]

[6708] 13694: AF025375 Homo sapiens chemokine receptor-4 (CXCR4) mRNA, complete cds gi|2565335|gb|AF025375.1|AF025375[2565335]

[6709] 13695: AF000380 Homo sapiens folate binding protein mRNA, complete cds gi|2565193|gb|AF000380.1|HSAF000380[2565193]

[6710] 13696: U35875 Homo sapiens B2 bradykinin receptor mRNA, 5′ sequence gi|1353391|gb|U35875.1|HSU35875[1353391]

[6711] 13697: AF010193 Homo sapiens MAD-related gene SMAD7 (SMAD7) mRNA, complete cds gi|225282|gb|AF010193.1|AF010193[2252821]

[6712] 13698: X94634 H. sapiens CD97 gene exon 7 gi|1165087|emb|X94634.1|HSX94634[1165087]

[6713] 13699: X94633 H. sapiens CD97 gene exon 4 gi|1165086|emb|X94633.1|HSX94633[1165086]

[6714] 13700: X94632 H. sapiens CD97 gene exon 3 gi|1165085|emb|X94632.1|HSX94632[1165085]

[6715] 13702: AF007892 Homo sapiens P2Y6 receptor, long splice variant mRNA, complete cds gi|2258421|gb|AF007892.11[2258421]

[6716] 13703: AF007891 Homo sapiens P2Y6 receptor, short splice variant mRNA, complete cds gi|2258419|gb|AF007891.1|[2258419]

[6717] 13704: AF022383 Homo sapiens complexin I mRNA, complete cds gi|2465458|gb|AF022383.1|AF022383[2465458]

[6718] 13709: X89860 H. sapiens mRNA for T-cell receptor alpha chain gi|927420|emb|X89860.1|HSNP7TCR2[927420]

[6719] 13710: Y08456 H. sapiens ChemR1 gene gi|2465081|emb|Y08456.1|HSCHEMR1[2465081]

[6720] 13711: U95025 Homo sapiens metabotropic glutamate receptor 8 (GRM8) mRNA, complete cds gi|2435409|gb|U95025.1|HSU95025[2435409]

[6721] 13712: AF021799 Homo sapiens interleukin 17 receptor-like mRNA sequence gi[2460201|gb|AF021799.1|AF021799[2460201]

[6722] 13714: U73443 Homo sapiens 5HT3 serotonin receptor gene, partial cds gi|2459549|gb|U73443.1|MMU73443[2459549]

[6723] 13715: AB000520 Homo sapiens mRNA for APS, complete cds gi|2447035|dbj|AB000520.1|AB000520[2447035]

[6724] 13716: X98172 H. sapiens mRNA for MACH-alpha-1 protein gi|1403318|emb|X98172.1|HSMACHA1[1403318]

[6725] 13728: AH005567 Homo sapiens chromosome 4 map 4q13 gi|2290767|gb|AH005567.1|SEG_HSGNRHR[2290767]

[6726] 13729: AF001952 Homo sapiens gonadotropin releasing hormone receptor (GNRHR) gene, exon 3 and complete cds gi|2290766|gb|AF001952.1|HSGNRHR3[2290766]

[6727] 13730: AF001951 Homo sapiens gonadotropin releasing hormone receptor (GNRHR) gene, exon 2 gi|2290765|gb|AF001951.1|HSGNRHR2[2290765]

[6728] 13731: AF001950 Homo sapiens gonadotropin releasing hormone receptor (GNRHR) gene, exon 1 gi|2290764|gb|AF001950.1|HSGNRHR1[2290764]

[6729] 13733: AF020201 Homo sapiens Jagged 2 mRNA, complete cds gi|2432001|gb|AF020201.1|AF020201[2432001]

[6730] 13734: Y14442 Homo sapiens mRNA for olfactory receptor protein, partial gi|2370144|emb|Y14442.1|HSOLFMF[2370144]

[6731] 13736: AF017061 Homo sapiens vasopressin-activated calcium mobilizing putative receptor protein (VACM-1) mRNA, complete cds gi|2394273|gb|AF017061.1|AF017061[2394273]

[6732] 13737: AF017262 Homo sapiens putative G protein-coupled receptor mRNA, complete cds gi|2388705|gb|AF017262.1|AF017262[2388705]

[6733] 13738: AF016917 Homo sapiens GABA-A receptor delta subunit (GABRD) mRNA, complete cds gi|2388692|gb|AF016917.1|AF016917[2388692]

[6734] 13739: Y13248 Homo sapiens mRNA for orphan chemokine receptor TYMSTR gi|2370179|emb|Y13248.1|HSY13248[2370179]

[6735] 13740: D83492 Homo sapiens mRNA for Eph-family protein, complete cds gi|2281007|dbj|D83492.1|D83492[2281007]

[6736] 13741: AB002058 Homo sapiens mRNA for HUMAN P2XM, complete cds gi|2350846|dbj |AB002058.1|AB002058[2350846]

[6737] 13742: AF015251 Homo sapiens breast cancer-related unknown protein mRNA, partial cds gi|2345090|gb|AF015251.1|AF015251[2345090]

[6738] 13743: AF004231 Homo sapiens monocyte/macrophage Ig-related receptor MIR-10 (MIR cl-10) mRNA, complete cds gi|2343110|gb|AF004231.1|AF004231[2343110]

[6739] 13744: AF004230 Homo sapiens monocyte/macrophage Ig-related receptor MIR-7 (MIR cl-7) mRNA, complete cds gi|2343108|gb|AF004230.1|AF004230[2343108]

[6740] 13745: X90563 H. sapiens mRNA for peroxisome proliferactor activated receptor gamma gi|1480099|emb|X90563.1|HSPPARGAM[1480099]

[6741] 13746: AF012629 Homo sapiens antagonist decoy receptor for TRAIL/Apo-2L (TRID) mRNA, complete cds gi|2338430 |gb|AF012629.1|AF012629[2338430]

[6742] 13747: AF012628 Homo sapiens death domain containing receptor for TRAIL/Apo-2L (DR5) mRNA, complete cds gi|2338428|gb|AF012628.1|AF012628[2338428]

[6743] 13748: AF012536 Homo sapiens decoy receptor 1 (DcR1) mRNA, complete cds gi|2338421|gb|AF012536.1|AF012536[2338421]

[6744] 13749: AF012535 Homo sapiens death receptor 5 (DR5) mRNA, complete cds gi|2338419|gb|AF012535.1|AF012535[2338419]

[6745] 13750: AF012903 Homo sapiens P2X4 ATP-gated cation channel protein mRNA, partial cds gi|2331043|gb|AF012903.1|AF012903[2331043]

[6746] 13751: X69316 H. sapiens KIT proto-oncogene for mast/stem cell growth factor receptor, exon gi|34105|emb|X69316.1|HSKITPO16[34105]

[6747] 13752: X69315 H. sapiens KIT proto-oncogene for mast/stem cell growth factor receptor, exons 18, 19, 20 gi|34104|emb|X69315.1|HSKITPO15[34104]

[6748] 13753: X69314 H. sapiens KIT proto-oncogene for mast/stem cell growth factor receptor, exon gi|34103|emb|X69314.1|HSKITPO14[34103]

[6749] 13754: X69313 H. sapiens KIT proto-oncogene for mast/stem cell growth factor receptor, exon gi|34102|emb|X69313.1|HSKITPO13[34102]

[6750] 13755: X69312 H. sapiens KIT proto-oncogene for mast/stem cell growth factor receptor, exon gi|34101|emb|X69312.1|HSKITPO12[34101]

[6751] 13756: X69311 H. sapiens KIT proto-oncogene for mast/stem cell growth factor receptor, exon gi|34100|emb|X69311.1|HSKITPO11[34100]

[6752] 13757: X69310 H. sapiens KIT proto-oncogene for mast/stem cell growth factor receptor, exons 10, 11, 12, 13 gi|34099|emb|X69310.1|HSKITPO10[34099]

[6753] 13758: X69309 H. sapiens KIT proto-oncogene for mast/stem cell growth factor receptor, exon gi|34098|emb|X69309.1|HSKITPO09[34098]

[6754] 13759: X69308 H. sapiens KIT proto-oncogene for mast/stem cell growth factor receptor, exon gi|34097|emb|X69308.1|HSKITPO08[34097]

[6755] 13760: X69307 H. sapiens KIT proto-oncogene for mast/stem cell growth factor receptor, exon gi|34096|emb|X69307.1|HSKITPO07[34096]

[6756] 13761: X69306 H. sapiens KIT proto-oncogene for mast/stem cell growth factor receptor, exon gi|34095|emb|X69306.1|HSKITPO06[34095]

[6757] 13762: X69305 H. sapiens KIT proto-oncogene for mast/stem cell growth factor receptor, exon gi|34094|emb|X69305.1|HSKITPO05[34094]

[6758] 13763: AF005419 Homo sapiens P2Y5-like receptor gene, complete cds gi|2240034|gb|AF005419.1|AF005419[2240034]

[6759] 13764: L42324 Homo sapiens (clone GPCR W) G protein-linked receptor gene (GPCR) gene, 5′ end of cds gi|1066730|gb|L42324.1|HUMFRCG[1066730]

[6760] 13766: AF015910 Homo sapiens unknown protein mRNA, partial cds gi|2286201|gb|AF015910.1|AF015910[2286201]

[6761] 13767: X99250 H. sapiens mRNA for endothelin-B receptor splice variant gi|2285955|emb|X99250.1|HSX99250[2285955]

[6762] 13768: AF007545 Homo sapiens SIV/HIV receptor Bonzo (Bonzo) mRNA, complete cds gi|225342|gb|AF007545.1|AF007545[2253421]

[6763] 13769: Z79783 H. sapiens G protein-coupled receptor CKR-L2 gi|2281709|emb|Z79783.1|HSCKRL2[2281709]

[6764] 13778: Z49994 H. sapiens partial gene for proteinase-activated receptor 2 (1289 BP) gi|1008086|emb|Z49994.1|HSPAR2B[1008086]

[6765] 13779: AF007555 Homo sapiens IAR/receptor-like protein-tyrosine phosphatase precursor mRNA, complete cds gi|2262074|gb|AF007555.1|AF007555[2262074]

[6766] 13780: AF008556 Homo sapiens interleukin-2 receptor mRNA, alternatively spliced, partial cds gi|2266932|gb|AF008556.1|AF008556[2266932]

[6767] 13891: Y10152 H. sapiens mRNA for CRF2 receptor, beta isoform, aberrantly spliced, (94 bp deletion) gi|1785640|emb|Y10152.1|HSCRF294[1785640]

[6768] 13892: Y10153 H. sapiens mRNA for CRF2 receptor, beta isoform, aberrantly spliced, (227 bp insertion) gi|1785639|emb|Y10153.1|HSCRF2227[1785639]

[6769] 13893: Y10151 H. sapiens mRNA for CRF2 receptor, beta isoform, partial gi|l785637|emb|Y10151.1|HSCRF2[1785637]

[6770] 13894: M17325 Homo sapiens T-cell receptor gamma-chain constant region (TCRGC1) mRNA, partial cds gi|2072752|gb|M17325.1|HUMTCGCJ[2072752]

[6771] 13895: M17324 Homo sapiens T-cell receptor gamma-chain constant region (TCRGC2) mRNA, partial cds gi|2072751|gb|M17324.1|HUMTCGCI[2072751]

[6772] 13896: M17323 Homo sapiens T-cell receptor gamma-chain constant region (TCRGC2) mRNA, partial cds gi|2072750|gb|M17323.1|HUMTCGCH[2072750]

[6773] 13897: AF004327 Homo sapiens angiopoietin-2 mRNA, complete cds gi|2257932|gb|AF004327.1|AF004327[2257932]

[6774] 13898: AF004021 Homo sapiens prostaglandin F2 alpha receptor mRNA, complete cds gi|2257849|gb|AF004021.1|AF004021[2257849]

[6775] 13899: AF006464 Homo sapiens muscle specific tyrosine kinase receptor (MUSK) mRNA, complete cds gi|225331|gb|AF006464.1|AF006464[2253311]

[6776] 13900: AF005637 Homo sapiens endothelin A receptor gene, 5′ flanking region and exon 1 gi|2253289|gb|AF005637.1|AF005637[2253289]

[6777] 13902: Z24461 H. sapiens MTCP-1 gene gi|406866|emb|Z24461.1|HSMTCP1I[406866]

[6778] 13903: Z24463 H. sapiens MTCP-1 gene gi|406865|emb|Z24463.1|HSMTCP1H[406865]

[6779] 13904: Z24457 H. sapiens of TCRA gene MTCP-1 gene gi|406860|emb|Z24457.1|HSMTCP1D[406860]

[6780] 13905: Z24456 H. sapiens of MTCP-1 gene MTCP-1 gene gi|406859|emb|Z24456.1|HSMTCP1C[406859]

[6781] 13906: U45984 Homo sapiens CCR6 chemokine receptor (CMKBR6) gene, complete cds gi|2246432|gb|U45984.1|HSU45984[2246432]

[6782] 13908: AF005900 Homo sapiens alpha2B-adrenergic receptor (alpha2C2AR) gene, complete cds gi|2245627|gb|AF005900.1|AF005900[2245627]

[6783] 13909: AF005210 Homo sapiens CC chemokine receptor CCR8 (CMKBR8) mRNA, partial cds gi|2245579|gb|AF005210.1|AF005210[2245579]

[6784] 13524: Y16282 Homo sapiens mRNA for nicotinic acetylcholine receptor alpha6 subunit precursor gi|2815224|emb|Y16282.1|HSY16282[2815224]

[6785] 13525: Y16281 Homo sapiens mRNA for nicotinic acetylcholine receptor alpha2 subunit precursor gi|2815222|emb|Y16281.1|HSY16281[2815222]

[6786] 13526: X98858 H. sapiens mRNA for HLA-C specific activatory NK receptor gi|1419593|emb|X98858.1|HSNKREC[1419593]

[6787] 13527: M76676 Homo sapiens leukocyte platelet-activating factor receptor mRNA, complete cds gi|2810988|gb|M76676.1|HUMNPIIY20[2810988]

[6788] 13528: Y08420 H. sapiens mRNA for nicotinic acetylcholine receptor alpha7 subunit precursor gi|2808623|emb|Y08420.1|HSNACHRA7[2808623]

[6789] 13529: Y08419 H. sapiens mRNA for nicotinic acetylcholine receptor alpha5 subunit precursor gi|1702913|emb|Y08419.1|HSNACHRA5[1702913]

[6790] 13530: Y08421 H. sapiens mRNA for nicotinic acetylcholine receptor alpha4 subunit precursor gi|1702911|emb|Y08421.1|HSNACHRA4[1702911]

[6791] 13531: Y08417 H. sapiens mRNA for nicotinic acetylcholine receptor beta3 subunit precursor gi|1702909|emb|Y08417.1|HSNACHR3B[1702909]

[6792] 13532: Y08416 H. sapiens mRNA for nicotinic acetylcholine receptor beta4 subunit precursor gi|1702919|emb|Y08416.1|HSNACHRB4[1702919]

[6793] 13533: Y08415 H. sapiens mRNA for nicotinic acetylcholine receptor beta2 subunit precursor gi|1702917|emb|Y08415.1|HSNACHRB2[1702917]

[6794] 13534: Y08418 H. sapiens mRNA for nicotinic acetylcholine receptor alpha3 subunit precursor gi|1702907|emb|Y08418.1|HSNACHR3A[1702907]

[6795] 13535: AF001985 Homo sapiens CD38 gene, 5′ upstream sequence gi|2804672|gb|AF001985.1|AF001985[2804672]

[6796] 13536: AF042077 Homo sapiens olfactory receptor-like protein (OLFR 42B) gene, OLFR 42B-9079.6 allele, partial cds gi|2801710|gb|AF042077.1|AF042077[2801710]

[6797] 13537: AF042076 Homo sapiens olfactory receptor-like protein (OLFR 42B) gene, OLFR 42B-9108.1 allele, partial cds gi|2801708|gb|AF042076.1|AF042076[2801708]

[6798] 13538: AF042075 Homo sapiens olfactory receptor-like protein (OLFR 42B) gene, OLFR 42B-9110 allele, partial cds gi|2801706|gb|AF042075.1|AF042075[2801706]

[6799] 13539: AF042074 Homo sapiens olfactory receptor-like protein (OLFR 42A) gene, OLFR 42A-9079.3 allele, partial cds gi|2801704|gb|AF042074.1|AF042074[2801704]

[6800] 13540: AF042073 Homo sapiens olfactory receptor-like protein (OLFR 42A) gene, OLFR 42A-9049 allele, partial cds gi|2801702|gb|AF042073.1|AF042073[2801702]

[6801] 13600: Y10530 H. sapiens gene encoding putative olfactory receptor (clone htpcr2) gi|2792017|emb|Y10530.1|HSHTPCR2[2792017]

[6802] 13601: Y10529 H. sapiens mRNA for putative olfactory receptor (clone ht2) gi|2792015|emb|Y10529.1|HSHT2[2792015]

[6803] 13614: Z26876 H. sapiens gene for ribosomal protein L38 gi|407422|emb|Z26876.1|HSRPL38[407422]

[6804] 13615: Z50150 H. sapiens mRNA for tyrosine kinase activator protein 1 (TKA-1) gi|1246762|emb|Z50150.1|HSTKA1MR[1246762]

[6805] 13616: Y13055 Homo sapiens mRNA for NKG2-CII activating NK receptor gi|2765292|emb|Y13055.1|HSNKG2CII[2765292]

[6806] 13617: Y13054 Homo sapiens mRNA for NK receptor, clone GR #29 gi|2765290|emb|Y13054.1|HSNKREC29[2765290]

[6807] 13618: Y10437 H. sapiens mRNA for serotonin receptor 4 gi|2765076|emb|Y10437.1|HSSERR4[2765076]

[6808] 13619: AJ002105 Homo sapiens mRNA for NK receptor, clone library TG14#13 gi|2764706|emb|AJ002105.1|HSAJ2105[2764706]

[6809] 13620: AJ002104 Homo sapiens mRNA for NK receptor, clone library TG14#6 gi|2764704|emb |AJ002104.1|HSAJ2104[2764704]

[6810] 13621: AJ002103 Homo sapiens mRNA for NK receptor, clone library TG14#35 gi|2764702|emb|AJ002103.1|HSAJ2103[2764702]

[6811] 13622: AJ002102 Homo sapiens mRNA for NK receptor, clone library TG14#8 gi|2764700|emb|AJ002102.1|HSAJ2102[2764700]

[6812] 13623: AJ000001 Homo sapiens mRNA for CD94-B NK receptor gi|2764393|emb|AJ000001.1|HSCD94B[2764393]

[6813] 13624: Y10141 H. sapiens DAT1 gene, partial, VNTR gi|1752665|emb|Y10141.1|HSDAT1[1752665]

[6814] 13625: Z97213 Homo sapiens mRNA for T-cell receptor gi|2239129|emb|Z97213.1|HSTCRBV2S[2239129]

[6815] 13627: AF026263 Homo sapiens muscarinic receptor (CHRM5) mRNA, complete cds gi|2605721|gb|AF026263.1|AF026263[2605721]

[6816] 13628: AF026261 Homo sapiens histamine H1 receptor mRNA, complete cds gi|2605717|gb|AF026261.1|AF026261[2605717]

[6817] 13629: AF026260 Homo sapiens vitamin D receptor (VDR) mRNA, complete cds gi|2605715|gb|AF026260.1|AF026260[2605715]

[6818] 13630: AH005786 Homo sapiens CC chemokine receptor 5 (CCR5) gene, complete cds gi|2739498|gb|AH005786.1|SEG_HSCCR5AB[2739498]

[6819] 13631: AF031237 Homo sapiens CC chemokine receptor 5 (CCR5) gene, complete cds gi|2739497|gb|AF031237.1|HSCCR5AB3[2739497]

[6820] 13633: AH005782 Homo sapiens chromosome X map Xq28 gi|2735348|gb|AH005782.1|SEG_HSGABRE[2735348]

[6821] 13634: AF037334 Homo sapiens Eph-like receptor tyrosine kinase hEphB1d (EphB1) mRNA, complete cds gi|2739209|gb|AF037334.1|AF037334[2739209]

[6822] 13635: AF037333 Homo sapiens Eph-like receptor tyrosine kinase hEphB1c (EphB1) mRNA, complete cds gi|2739207|gb|AF037333.1|AF037333[2739207]

[6823] 13636: AF011406 Homo sapiens corticotropin releasing hormone receptor type 2 beta isoform (CRH2R) mRNA, complete cds gi|2738557|gb|AF011406.1|AF011406[2738557]

[6824] 13637: U59632 Homo sapiens H5 mRNA, partial cds; and platelet glycoprotein Ib beta chain mRNA, complete cds gi|1809264|gb|U59632.1|HSU59632[1809264]

[6825] 13638: D86864 Homo sapiens mRNA for acetyl LDL receptor, complete cds gi|2723468|dbj|D86864.1|D86864[2723468]

[6826] 13639: AF027208 Homo sapiens AC133 antigen mRNA, complete cds gi|2688948|gb|AF027208.1|AF027208[2688948]

[6827] 13640: AB001025 Homo sapiens mRNA for brain ryanodine receptor, complete cds gi|2696014|dbj|AB001025.1|AB001025[2696014]

[6828] 13641: D00017 Homo sapiens mRNA for lipocortin II, complete cds gi|219909|dbj|D00017.1|HUMLIC[219909]

[6829] 13644: AF025998 Homo sapiens atrial natriuretic peptide clearance receptor (ANPRC) mRNA, complete cds gi|2570851|gb|AF025998.1|AF025998[2570851]

[6830] 13645: AD000671 Homo sapiens DNA from chromosome 19-cosmid f24109 containing HRX2, genomic sequence gi|1905893|gb|AD000671.1|AD000671[1905893]

[6831] 13646: Z49119 H. sapiens mRNA for serotonin 6 receptor (5-HT6; partial) gi|984128|emb|Z49119.1|HS5HT6[984128]

[6832] 13647: Z48150 H. sapiens 5-HT4 mRNA for serotonin 4 receptor (5-HT4) gi|984126|emb|Z48150.1|HS5HT4[984126]

[6833] 13648: Y15743 Homo sapiens RET proto-oncogene, exon 13 containing two mutations gi|2665353|emb|Y15743.1|HSRET13[2665353]

[6834] 13649: AF000575 Homo sapiens clone 16 immunoglobulin-like transcript 5 mRNA, complete cds gi|2264428|gb|AF000575.1|AF000575[2264428]

[6835] 13650: AF000574 Homo sapiens clone 1 immunoglobulin-like transcript 4 mRNA, complete cds gi|2264426|gb|AF000574.1|AF000574[2264426]

[6836] 13651: Z26652 H. sapiens FLT3 mRNA for FLT3 receptor tyrosine kinase gi|406322|emb|Z26652.1|HSFLT3RTK[406322]

[6837] 13653: X82208 H. sapiens mRNA for beta-centractin (ATCC# HHCPJ76) gi|563887|emb|X82208.1|HSBCENTR[563887]

[6838] 13654: AF035261 Homo sapiens thyroid stimulating hormone receptor (TSHR) mRNA, partial cds gi|2654195|gb|AF035261.1|HSTSHR[2654195]

[6839] 13655: AF032388 Homo sapiens vasopressin receptor type 2 mRNA, alternatively spliced, complete cds gi|2654030|gb|AF032388.1|AF032388[2654030]

[6840] 13656: AF025534 Homo sapiens leucocyte immunoglobulin-like receptor-8 (LIR-8) mRNA, complete cds gi|2653874|gb|AF025534.1|AF025534[2653874]

[6841] 13657: AF025533 Homo sapiens leucocyte immunoglobulin-like receptor-3 (LIR-3) mRNA, complete cds gi|2653872|gb|AF025533.1|AF025533[2653872]

[6842] 13658: AF025532 Homo sapiens leucocyte immunoglobulin-like receptor-5 (LIR-5) mRNA, complete cds gi|2653870|gb|AF025532.1|AF025532[2653870]

[6843] 13659: AF025531 Homo sapiens leucocyte immunoglobulin-like receptor-7 (LIR-7) mRNA, complete cds gi|2653868|gb|AF025531.1|AF025531[2653868]

[6844] 13660: AF025530 Homo sapiens leucocyte immunoglobulin-like receptor-6a (LIR-6) mRNA, complete cds gi|2653866|gb|AF025530.1|AF025530[2653866]

[6845] 13661: AF025529 Homo sapiens leucocyte immunoglobulin-like receptor-6b (LIR-6) mRNA, complete cds gi|2653864|gb|AF025529.1|AF025529[2653864]

[6846] 13662: AF025528 Homo sapiens leucocyte immunoglobulin-like receptor-2 (LIR-2) mRNA, complete cds gi|2653862|gb|AF025528.1|AF025528[2653862]

[6847] 13663: AF025527 Homo sapiens leucocyte immunoglobulin-like receptor-4 (LIR-4) mRNA, complete cds gi|2653860|gb|AF025527.1|AF025527[2653860]

[6848] 13664: Y13583 Homo sapiens mRNA for G-protein coupled receptor gi|2652933|emb|Y13583.1|HSGPCP[2652933]

[6849] 13665: Y13367 H. sapiens mRNA for phosphoinositide 3-kinase gi|2143259|emb|Y13367.1|HSPHOSI3K[2143259]

[6850] 13666: X82207 H. sapiens mRNA for beta-centractin (PC3) gi|563885|emb|X82207.1|HSBCENT[563885]

[6851] 13667: AF033854 Homo sapiens lymphocyte inhibitor of TRAIL (LIT) mRNA, complete cds gi|2645841|gb|AF033854.1|AF033854[2645841]

[6852] 13668: X81882 H. sapiens mRNA for for vasopressin activated calcium mobilizing receptor-like protein gi|1628414|emb|X81882.1|HSVACM1[1628414]

[6853] 13669: AF024690 Homo sapiens putative G protein-coupled receptor (GPR43) gene, complete cds gi|2612951|gb|AF024690.1|AF024690[2612951]

[6854] 13670: AF024689 Homo sapiens putative G protein-coupled receptor (GPR42) gene, complete cds gi|2612949|gb|AF024689.1|AF024689[2612949]

[6855] 13671: AF024688 Homo sapiens putative G protein-coupled receptor (GPR41) gene, complete cds gi|2612947|gb|AF024688.1|AF024688[2612947]

[6856] 13672: AF024687 Homo sapiens putative G protein-coupled receptor (GPR40) gene, complete cds gi|2612945|gb|AF024687.1|AF024687[2612945]

[6857] 13673: D87513 Homo sapiens mRNA for Grb7 protein, partial cds gi|1526534|dbj|D87513.1D87513[1526534]

[6858] 13674: D49919 Homo sapiens mRNA for C-C chemokine receptor type 2, complete cds gi|2626807|dbj|D49919.1|D49919[2626807]

[6859] 13675: AF030512 Homo sapiens small cell vasopressin subtype 1b receptor mRNA, complete cds gi|2613124|gb|AF030512.1|AF030512[2613124]

[6860] 13676: Y12852 Homo sapiens P2X7 gene, exon 2 and 3 gi|2612788|emb|Y12852.1|HSP2X7E23[2612788]

[6861] 13677: Y12851 Homo sapiens P2X7 gene, exon 1 and joined CDS gi|2597926|emb|Y1285.1|HSP2X7EX1[2597926]

[6862] 13678: Y12854 Homo sapiens P2X7 gene, exon 9-11 gi|2612787|emb|Y12854.1|HSP2X7911[2612787]

[6863] 13679: Y12853 Homo sapiens P2X7 gene, exon 4-8 gi|2612786|emb|Y12853.1|HSP2X748[2612786]

[6864] 13680: Y12855 Homo sapiens P2X7 gene, exon 12 and 13 gi|2612785|emb|Y12855.1|HSP2X7123[2612785]

[6865] 13681: AB005520 Homo sapiens ppar gamma2 gene for peroxisome proliferator activated-receptor gamma, partial cds and 5′ flanking gi|2605488|dbj|AB005520.1|AB005520[2605488]

[6866] 13682: Y09765 Homo sapiens mRNA for putative GABA receptor epsilon subunit gi|2285960|emb|Y09765.1|HSY09765[2285960]

[6867] 13683: Y09764 Homo sapiens GA]BRE gene, exon 2-8 gi|2285959|emb|Y09764.1|HSY09764[2285959]

[6868] 13684: Y09763 Homo sapiens GABRE gene, exon 1 (and joined CDS) gi|2285957|emb|Y09763.1|HSY09763[2285957]

[6869] 13685: AF026535 Homo sapiens chemokine receptor (CCR3) mRNA, complete cds gi|2582565|gb|AF026535.1|AF026535[2582565]

[6870] 13686: AF026071 Homo sapiens soluble death receptor 3 beta (DR3) mRNA, complete cds gi|2570832|gb|AF026071.1|AF026071[2570832]

[6871] 13687: AF022956 Homo sapiens beta2-adrenergic receptor (ADRB2) gene, complete cds gi|2570532|gb|AF022956.1|AF022956[2570532]

[6872] 13688: AF022955 Homo sapiens beta2-adrenergic receptor (ADRB2) gene, complete cds gi|2570530|gb|AF022955.1|AF022955[2570530]

[6873] 13689: AF022954 Homo sapiens beta2-adrenergic receptor (ADRB2) gene, complete cds gi|2570528|gb|AF022954.1|AF022954[2570528]

[6874] 13690: AF022953 Homo sapiens beta2-adrenergic receptor (ADRB2) gene, complete cds gi|2570526|gb|AF022953.1|AF022953[2570526]

[6875] 13691: AF014958 Homo sapiens chemokine receptor X (CKRX) mRNA, complete cds gi|2305263|gb|AF014958.1|AF014958[2305263]

[6876] 13692: AB000712 Homo sapiens hCPE-R mRNA for CPE-receptor, complete cds gi|2570124|dbj|AB000712.1 |AB000712[2570124]

[6877] 13693: X94609 H. sapiens mRNA for activatory NK receptor/KKA3 p50.3 gi|1495414|emb|X94609.1 HSANKRMR[1495414]

[6878] 13694: AF025375 Homo sapiens chemokine receptor-4 (CXCR4) mRNA, complete cds gi|2565335|gb|AF025375.1|AF025375[2565335]

[6879] 13695: AF000380 Homo sapiens folate binding protein mRNA, complete cds gi|2565193|gb|AF000380.1|HSAF000380[2565193]

[6880] 13696: U35875 Homo sapiens B2 bradykinin receptor mRNA, 5′ sequence gi|1353391|gb|U35875.1|HSU35875[1353391]

[6881] 13697: AF010193 Homo sapiens MAD-related gene SMAD7 (SMAD7) mRNA, complete cds gi|2252821|gb|AF010193.1|AF010193[2252821]

[6882] 13698: X94634 H. sapiens CD97 gene exon 7 gi|1165087|emb|X94634.1|HSX94634[1165087]

[6883] 13699: X94633 H. sapiens CD97 gene exon 4 gi|1165086|emb|X94633.1|HSX94633[1165086]

[6884] 13700: X94632 H. sapiens CD97 gene exon 3 gi|1165085|emb|X94632.1|HSX94632[1165085]

[6885] 13702: AF007892 Homo sapiens P2Y6 receptor, long splice variant mRNA, complete cds gi|2258421|gb|AF007892.1|[2258421]

[6886] 13703: AF007891 Homo sapiens P2Y6 receptor, short splice variant mRNA, complete cds gi|2258419|gb|AF007891.1|[2258419]

[6887] 13704: AF022383 Homo sapiens complexin I mRNA, complete cds gi|2465458|gb|AF022383.1|AF022383[2465458]

[6888] 13709: X89860 H. sapiens mRNA for T-cell receptor alpha chain gi|927420|emb|X89860.1|HSNP7TCR2[927420]

[6889] 13710: Y08456 H. sapiens ChemR1 gene gi|2465081|emb|Y08456.1|HSCHEMR1[2465081]

[6890] 13711: U95025 Homo sapiens metabotropic glutamate receptor 8 (GRM8) mRNA, complete cds gi|2435409|gb|U95025.1|HSU95025[2435409]

[6891] 13712: AF021799 Homo sapiens interleukin 17 receptor-like mRNA sequence gi|246020|gb|AF021799.1|AF021799[2460201]

[6892] 13714: U73443 Homo sapiens SHT3 serotonin receptor gene, partial cds gi|2459549|gb|U73443.1|MMU73443[2459549]

[6893] 13715: AB000520 Homo sapiens mRNA for APS, complete cds gi|2447035|dbj |AB000520.1|A1000520[2447035]

[6894] 13716: X98172 H. sapiens mRNA for MACH-alpha-1 protein gi|1403318|emb|X98172.1|HSMACHA1[1403318]

[6895] 13727: X92883 H. sapiens mRNA for T cell receptor alpha (clone XPHC46IV) gi|1061141|emb|X92883.1|HSPHC46A1[1061141]

[6896] 13728: AH005567 Homo sapiens chromosome 4 map 4q13 gi|2290767|gb|AH005567.1|SEG_HSGNRHR[2290767]

[6897] 13729: AF001952 Homo sapiens gonadotropin releasing hormone receptor (GNRHR) gene, exon 3 and complete cds gi|2290766|gb|AF001952.1|HSGNRHR3[2290766]

[6898] 13730: AF001951 Homo sapiens gonadotropin releasing hormone receptor (GNRHR) gene, exon 2 gi|2290765|gb|AF001951.1|HSGNRHR2[2290765]

[6899] 13731: AF001950 Homo sapiens gonadotropin releasing hormone receptor (GNRHR) gene, exon 1 gi|2290764|gb|AF001950.1|HSGNRHR1[2290764]

[6900] 13732: AF017263 Homo sapiens putative G protein-coupled receptor gene, partial intron sequence gi|2435439|gb|AF017263.1|AF017263[2435439]

[6901] 13733: AF020201 Homo sapiens Jagged 2 mRNA, complete cds gi|2432001|gb|AF020201.1|AF020201[2432001]

[6902] 13734: Y14442 Homo sapiens mRNA for olfactory receptor protein, partial gi|2370144|emb|Y14442.1|HSOLFMF[2370144]

[6903] 13735: AF017264 Homo sapiens putative G protein-coupled receptor gene, intronic sequence gi|2407224|gb|AF017264.1|AF017264[2407224]

[6904] 13736: AF017061 Homo sapiens vasopressin-activated calcium mobilizing putative receptor protein (VACM-1) mRNA, complete cds gi|2394273|gb|AF017061.1|AF017061[2394273]

[6905] 13737: AF017262 Homo sapiens putative G protein-coupled receptor mRNA, complete cds gi|2388705|gb|AF017262.1|AF017262[2388705]

[6906] 13738: AF016917 Homo sapiens GABA-A receptor delta subunit (GABRD) mRNA, complete cds gi|2388692|gb|AF016917.1|AF016917[2388692]

[6907] 13739: Y13248 Homo sapiens mRNA for orphan chemokine receptor TYMSTR gi|2370179|emb|Y13248.1|HSY13248[2370179]

[6908] 13740: D83492 Homo sapiens mRNA for Eph-family protein, complete cds gi|2281007|dbj|D83492.1|D83492[2281007]

[6909] 13741: AB002058 Homo sapiens mRNA for HUMAN P2XM, complete cds gi|2350846|dbj|AB002058.1|A]B002058[2350846]

[6910] 13742: AF015251 Homo sapiens breast cancer-related unknown protein mRNA, partial cds gi|2345090|gb|AF015251.1|AF015251[2345090]

[6911] 13743: AF004231 Homo sapiens monocyte/macrophage Ig-related receptor MIR-10 (MIR cl-10) mRNA, complete cds gi|2343110|gb|AF004231.1|AF004231[2343110]

[6912] 13744: AF004230 Homo sapiens monocyte/macrophage Ig-related receptor MIR-7 (MIR cl-7) mRNA, complete cds gi|2343108|gb|AF004230.1|AF004230[2343108]

[6913] 13745: X90563 H. sapiens mRNA for peroxisome proliferactor activated receptor gamma gi|1480099|emb|X90563.1|HSPPARGAM[1480099]

[6914] 13746: AF012629 Homo sapiens antagonist decoy receptor for TRAIL/Apo-2L (TRID) mRNA, complete cds gi|2338430|gb|AF012629.1|AF012629[2338430]

[6915] 13747: AF012628 Homo sapiens death domain containing receptor for TRAIL/Apo-2L (DR5) mRNA, complete cds gi|2338428|gb|AF012628.1|AF012628[2338428]

[6916] 13748: AF012536 Homo sapiens decoy receptor 1 (DcR1) mRNA, complete cds gi|2338421|gb|AF012536.1|AF012536[2338421]

[6917] 13749: AF012535 Homo sapiens death receptor 5 (DR5) mRNA, complete cds gi|2338419|gb|AF012535.1|AF012535[2338419]

[6918] 13750: AF012903 Homo sapiens P2X4 ATP-gated cation channel protein mRNA, partial cds gi|2331043|gb|AF012903.1|AF012903[2331043]

[6919] 13751: X69316 H. sapiens KIT proto-oncogene for mast/stem cell growth factor receptor, exon gi|34105|emb|X69316.1|HSKITPO16[3410S]

[6920] 13752: X69315 H. sapiens KIT proto-oncogene for mast/stem cell growth factor receptor, exons 18, 19, 20 gi|34104|emb|X69315.1|HSKITPO15[34104]

[6921] 13753: X69314 H. sapiens KIT proto-oncogene for mast/stem cell growth factor receptor, exon gi|34103|emb|X69314.1|HSKITPO14[34103]

[6922] 13754: X69313 H. sapiens KIT proto-oncogene for mast/stem cell growth factor receptor, exon gi|34102|emb|X69313.1|HSKITPO13[34102]

[6923] 13755: X69312 H. sapiens KIT proto-oncogene for mast/stem cell growth factor receptor, exon gi|34101|emb|X69312.1|HSKITPO12[34101]

[6924] 13756: X69311 H. sapiens KIT proto-oncogene for mast/stem cell growth factor receptor, exon gi|34100|emb|X69311.1|HSKITPO11[34100]

[6925] 13757: X69310 H. sapiens KIT proto-oncogene for mast/stem cell growth factor receptor, exons 10, 11, 12, 13 gi|34099|emb|X69310.1|HSKITPO10[34099]

[6926] 13758: X69309 H. sapiens KIT proto-oncogene for mast/stem cell growth factor receptor, exon gi|34098|emb|X69309.1|HSKITP009[34098]

[6927] 13759: X69308 H. sapiens KIT proto-oncogene for mast/stem cell growth factor receptor, exon gi|34097|emb|X69308.1|HSKITPO08[34097]

[6928] 13760: X69307 H. sapiens KIT proto-oncogene for mast/stem cell growth factor receptor, exon gi|34096|emb|X69307.1|HSKITPO07[34096]

[6929] 13761: X69306 H. sapiens KIT proto-oncogene for mast/stem cell growth factor receptor, exon gi|34095Semb|X69306.1|HSKITPO06[34095]

[6930] 13762: X69305 H. sapiens KIT proto-oncogene for mast/stem cell growth factor receptor, exon gi|34094|emb|X69305.1|HSKITPO05[34094]

[6931] 13763: AF005419 Homo sapiens P2Y5-like receptor gene, complete cds gi|2240034|gb|AF005419.1|AF005419[2240034]

[6932] 13764: L42324 Homo sapiens (clone GPCR W) G protein-linked receptor gene (GPCR) gene, 5′ end of cds gi|1066730|gb|L42324.1|HUMFRCG[1066730]

[6933] 13766: AF015910 Homo sapiens unknown protein mRNA, partial cds gi|2286201|gb|AF015910.1|AF015910[2286201]

[6934] 13767: X99250 H. sapiens mRNA for endothelin-B receptor splice variant gi|2285955|emb|X99250.1|HSX99250[2285955]

[6935] 13768: AF007545 Homo sapiens SIV/HIV receptor Bonzo (Bonzo) mRNA, complete cds gi|2253421|gb|AF007545.1|AF007545[2253421]

[6936] 13769: Z79783 H. sapiens G protein-coupled receptor CKR-L2 gi|2281709|emb|Z79783.1|HSCKRL2[2281709]

[6937] 13778: Z49994 H. sapiens partial gene for proteinase-activated receptor 2 (1289 BP) gi|1008086|emb|Z49994.1|HSPAR2B[1008086]

[6938] 13779: AF007555 Homo sapiens IAR/receptor-like protein-tyrosine phosphatase precursor mRNA, complete cds gi|2262074|gb|AF007555.1|AF007555[2262074]

[6939] 13780: AF008556 Homo sapiens interleukin-2 receptor mRNA, alternatively spliced, partial cds gi|2266932|gb|AF008556.1|AF008556[2266932]

[6940] 13891: Y10152 H. sapiens mRNA for CRF2 receptor, beta isoform, aberrantly spliced, (94 bp deletion) gi|1785640|emb|Y10152.1|HSCRF294[1785640]

[6941] 13892: Y10153 H. sapiens mRNA for CRF2 receptor, beta isoform, aberrantly spliced, (227 bp insertion) gi|1785639|emb|Y10153.1|HSCRF2227[1785639]

[6942] 13893: Y10151 H. sapiens mRNA for CRF2 receptor, beta isoform, partial gi|1785637|emb|Y10151.1|HSCRF2[1785637]

[6943] 13894: M17325 Homo sapiens T-cell receptor gamma-chain constant region (TCRGC1) mRNA, partial cds gi|2072752|gb|M17325.1|HUMTCGCJ[2072752]

[6944] 13895: M17324 Homo sapiens T-cell receptor gamma-chain constant region (TCRGC2) mRNA, partial cds gi|207275|gb|M17324.1|HUMTCGCI[2072751]

[6945] 13896: M17323 Homo sapiens T-cell receptor gamma-chain constant region (TCRGC2) mRNA, partial cds gi|2072750|gb|M17323.1|HUMTCGCH[2072750]

[6946] 13897: AF004327 Homo sapiens angiopoietin-2 mRNA, complete cds gi|2257932|gb|AF004327.1|AF004327[2257932]

[6947] 13898: AF004021 Homo sapiens prostaglandin F2 alpha receptor mRNA, complete cds gi|2257849|gb|AF004021.1|AF004021[2257849]

[6948] 13899: AF006464 Homo sapiens muscle specific tyrosine kinase receptor (MUSK) mRNA, complete cds gi|2253311|gb|AF006464.1|AF006464[2253311]

[6949] 13900: AF005637 Homo sapiens endothelin A receptor gene, 5′ flanking region and exon 1 gi|2253289|gb|AF005637.1|AF005637[2253289]

[6950] 13902: Z24461 H. sapiens MTCP-1 gene gi|406866|emb|Z24461.1|HSMTCP1[406866]

[6951] 13903: Z24463 H. sapiens MTCP-1 gene gi|406865|emb|Z24463.1|HSMTCP1H[406865]

[6952] 13904: Z24457 H. sapiens of TCRA gene MTCP-1 gene gi|406860|emb|Z24457.1|HSMTCP1D[406860]

[6953] 13905: Z24456 H. sapiens of MTCP-1 gene MTCP-1 gene gi|406859|emb|Z24456.1|HSMTCP1C[406859]

[6954] 13906: U45984 Homo sapiens CCR6 chemokine receptor (CMKBR6) gene, complete cds gi|2246432|gb|U45984.1|HSU45984[2246432]

[6955] 13908: AF005900 Homo sapiens alpha2B-adrenergic receptor (alpha2C2AR) gene, complete cds gi|2245627|gb|AF005900.1|AF005900[2245627]

[6956] 13909: AF005210 Homo sapiens CC chemokine receptor CCR8 (CMKBR8) mRNA, partial cds gi|2245579|gb|AF005210.1|AF005210[2245579]

[6957] 14010: Y13758 Homo sapiens mRNA for transient receptor potential related channel 3 protein gi|2225936|emb|Y13758.1|HSY13758[2225936]

[6958] 14012: AF000546 Homo sapiens purinergic receptor P2Y5 mRNA, complete cds gi|2232068|gb|AF000546.1|HSAF000546[2232068]

[6959] 14013: U45983 Homo sapiens CCR8 chemokine receptor (CMKBR8) gene, complete cds gi|2231165|gb|U45983.1|HSU45983[2231165]

[6960] 14015: X63819 H. sapiens mRNA for Lipoxin A4 receptor gi|31460|emb|X63819.1|HSLIPA4R[31460]

[6961] 14016: X15274 H. sapiens TRGV9 gene, allele V9* A2 gi|1848091|emb|X15274.1|HSTRGV9F[1848091]

[6962] 14020: X80282 H. sapiens gene for oxytocin receptor gi|609014|emb|X80282.1|HSOXYTOC[609014]

[6963] 14021: X81086 H. sapiens PCaR1 gene gi|599819|emb|X81086.1|HSPCAR1[599819]

[6964] 14023: X65857 H. sapiens HGMP07E gene for olfactory receptor gi|425220|emb|X65857.1|HSHGM07EG[425220]

[6965] 14024: X65858 H. sapiens gene for high affinity IL-8 receptor gi|312046|emb|X65858.1|HSHAIL8G[312046]

[6966] 14026: Z69640 H. sapiens fgfr2 gene (exon 5) gi|1200062|emb|Z69640.1|HSFGFR2UB[1200062]

[6967] 14027: Z69641 H. sapiens fgfr2 gene gi|1200061emb|Z69641.1|HSFGFR2UA[1200061]

[6968] 14029: Z70243 H. sapiens enhancer region for interleukin-2 receptor alpha chain gi|1769435|emb|Z70243.1|HSENHREG1[1769435]

[6969] 14030: Z38109 H. sapiens DNA for CD69, exon 1 gi|793837|emb|Z38109.1|HSCD69X1[793837]

[6970] 14031: AC002306 Homo sapiens |DNA from chromosome 19-cosmid R33799, genomic sequence, complete sequence gi|2213634|gb|AC002306.1|AC002306[2213634]

[6971] 14032: AF002256 Homo sapiens killer cell inhibitory receptor homolog cl-9 mRNA, complete cds gi|2197058|gb|AF002256.1|AF002256[2197058]

[6972] 14033: AF002255 Homo sapiens killer cell inhibitory receptor cl-17 mRNA, complete cds gi|2197056|gb|AF002255.1|AF002255[2197056]

[6973] 14034: D89079 Homo sapiens mRNA for leukotriene b4 receptor, complete cds gi|2196450|dbj|D89079.1|D89079[2196450]

[6974] 14035: D89078 Homo sapiens mRNA for leukotriene b4 receptor, complete cds gi|2196448|dbj|D89078.1|D89078[2196448]

[6975] 14036: AB004662 Homo sapiens mRNA for adenosine A1-receptor, complete cds gi|2196442|dbj|AB004662.1 |AB004662[2196442]

[6976] 14037: Y07909 H. sapiens mRNA for Progression Associated Protein gi|1542882|emb|Y07909.1|HSPAPR[1542882]

[6977] 14038: L17411 Human complement receptor type 1 (alleles S and F) gene, exon 40 gi|1199855|gb|L17411.1|HUMCR1SF34[1199855]

[6978] 14039: L17425 Human complement receptor type 1 (allele S) gene, exon 11 gi|451301|gb|L17425.1|HUMCR1SF10[451301]

[6979] 14040: L17418 Human complement receptor type 1 (alleles S and F) gene, exon 47 and complete cds's gi|3066781|gb|L17418.1|HUMCR1SF41[306678]

[6980] 14041: L17417 Human complement receptor type 1 (alleles S and F) gene, exon 46 gi|306677|gb|L17417.1|HUMCR1SF40[306677]

[6981] 14042: L17416 Human complement receptor type 1 (alleles S and F) gene, exon 45 gi|306676|gb|L17416.1|HUMCR1SF39[306676]

[6982] 14043: L17415 Human complement receptor type 1 (alleles S and F) gene, exon 44 gi|306675|gb|L17415.1|HUMCR1SF38[306675]

[6983] 14044: L17414 Human complement receptor type 1 (alleles S and F) gene, exon 43 gi|306674|gb|L17414.1|HUMCR1SF37[306674]

[6984] 14045: L17413 Human complement receptor type 1 (alleles S and F) gene, exon 42 gi|306673|gb|L17413.1|HUMCR1SF36[306673]

[6985] 14046: L17412 Human complement receptor type 1 (alleles S and F) gene, exon 41 gi|306672|gb|L17412.1|HUMCR1SF35[306672]

[6986] 14047: L17410 Human complement receptor type 1 (alleles S and F) gene, exons 38 and 39 gi|306670|gb|L17410.1|HUMCR1SF33[306670]

[6987] 14048: L17408 Human complement receptor type 1 (alleles S and F) gene, exon 37 gi|306669|gb|L17408.1|HUMCR1SF32[306669]

[6988] 14049: L17407 Human complement receptor type 1 (alleles S and F) gene, exon 36 gi|306668|gb|L17407.1|HUMCR1SF31[306668]

[6989] 14050: L17406 Human complement receptor type 1 (alleles S and F) gene, exon 35 gi|306667|gb|L17406.1|HUMCR1SF30[306667]

[6990] 14051: L17405 Human complement receptor type 1 (alleles S and F) gene, exon 34 gi|306666|gb|L17405.1|HUMCR1SF29[306666]

[6991] 14052: L17404 Human complement receptor type 1 (alleles S and F) gene, exon 33 gi|306665|gb|L17404.1|HUMCR1SF28[306665]

[6992] 14053: L17403 Human complement receptor type 1 (alleles S and F) gene, exon 32 gi|306664|gb|L17403.1|HUMCR1SF27[306664]

[6993] 14054: L17402 Human complement receptor type 1 (alleles S and F) gene, exons 30 and 31 gi|306663|gb|L17402.1|HUMCR1SF26[306663]

[6994] 14055: L17401 Human complement receptor type 1 (alleles S and F) gene, exon 29 gi|306662|gb|L17401.1|HUMCR1SF25[306662]

[6995] 14056: L17400 Human complement receptor type 1 (alleles S and F) gene, exon 28 gi|306661|gb|L17400.1|HUMCR1SF24[306661]

[6996] 14057: L17398 Human complement receptor type 1 (alleles S and F) gene, exons 26 and 27 gi|306660|gb|L17398.1|HUMCR1SF23[306660]

[6997] 14058: L17397 Human complement receptor type 1 (alleles S and F) gene, exon 25 gi|306659|gb|L17397.1|HUMCR1SF22[306659]

[6998] 14059: L17396 Human complement receptor type 1 (alleles S and F) gene, exon 24 gi|306658|gb|L17396.1|HUMCR1SF21[306658]

[6999] 14060: L17395 Human complement receptor type 1 (alleles S and F) gene, exons 22 and 23 gi|306657|gb|L17395.1|HUMCR1SF20[306657]

[7000] 14061: L17394 Human complement receptor type 1 (alleles S and F) gene, exon 21 gi|306656|gb|L17394.1|HUMCR1SF19[306656]

[7001] 14062: L17393 Human complement receptor type 1 (alleles S and F) gene, exon 20 gi|306655|gb|L17393.1|HUMCR1SF18[306655]

[7002] 14063: L17392 Human complement receptor type 1 (alleles S and F) gene, exon 19 gi|306654|gb|L17392.1|HUMCR1SF17[306654]

[7003] 14064: L17391 Human complement receptor type 1 (alleles S and F) gene, exon 18 gi|306653|gb|L17391.1|HUMCR1SF16[306653]

[7004] 14065: L17430 Human complement receptor type 1 (allele S) gene, exon 17 gi|306652|gb|L17430.1|HUMCR1SF15[306652]

[7005] 14066: L17429 Human complement receptor type 1 (allele S) gene, exon 16 gi|306651|gb|L17429.1|HUMCR1SF14[306651]

[7006] 14067: L17428 Human complement receptor type 1 (allele S) gene, exons 14 and 15 gi|3066501|gb|L17428.1|HUMCR1SF13[306650]

[7007] 14068: L17427 Human complement receptor type 1 (allele S) gene, exon 13 gi|306649|gb|L17427.1|HUMCR1SF12[306649]

[7008] 14069: L17426 Human complement receptor type 1 (allele S) gene, exon 12 gi|306648|gb|L17426.1|HUMCR1SF11[306648]

[7009] 14070: L17424 Human complement receptor type 1 (allele S) gene, exon 10 gi|306646|gb|L17424.1|HUMCR1SF09[306646]

[7010] 14071: L17423 Human complement receptor type 1 (alleles S and F) gene, exon 9 gi|306645|gb|L17423.1|HUMCR1SF08[306645]

[7011] 14072: L17422 Human complement receptor type 1 (alleles S and F) gene, exon 8 gi|306644|gb|L17422.1|HUMCR1SF07[306644]

[7012] 14073: L17421 Human complement receptor type 1 (alleles S and F) gene, exons 6 and 7 gi|306643|gb|L17421.1|HUMCR1SF06[306643]

[7013] 14074: L17420 Human complement receptor type 1 (alleles S and F) gene, exon 5 gi|306642|gb|L17420.1|HUMCR1SF05[306642]

[7014] 14075: L17419 Human complement receptor type 1 (alleles S and F) gene, exon 4 gi|306641|gb|L17419.1|HUMCR1SF04[306641]

[7015] 14076: L17409 Human complement receptor type 1 (alleles S and F) gene, exon 3 gi|306640|gb|L17409.1|HUMCR1SF03[306640]

[7016] 14077: L17399 Human complement receptor type 1 (alleles S and F) gene, exon 2 gi|306639|gb|L17399.1|HUMCR1SF02[306639]

[7017] 14078: L17390 Human complement receptor type 1 (alleles S and F) gene, enhancer and exon 1 gi|3066381|gb|L17390.1|HUMCR1SF01[306638]

[7018] 14081: M14764 Human nerve growth factor receptor mRNA, complete cds gi|189204|gb|M14764.1|HUMNGFR[189204]

[7019] 14082: M11025 Human asialoglycoprotein receptor H2 mRNA, complete cds gi|179080|gb|M11025.1|HUMASGPR2[179080]

[7020] 14083: L31772 Human alpha-1a/d adrenergic receptor mRNA, complete cds gi|666894|gb|L31772.1|HUMA1DA[666894]

[7021] 14084: L31774 Human alpha-1c-adrenergic receptor mRNA, complete cds gi|666892|gb|L31774.1|HUMA1ARA[666892]

[7022] 14085: L31773 Human alpha-1B-adrenergic receptor mRNA, complete cds gi|666890|gb|L31773.1|HUMA1AR[666890]

[7023] 14093: L07868 Homo sapiens receptor tyrosine kinase (ERBB4) gene, complete cds gi|337359|gb|L07868.1|HUMRETYKIN[337359]

[7024] 14094: L19593 Homo sapiens interleukin 8 receptor beta (IL8RB) mRNA, complete cds gi|559053|gb|L19593.1|HUMIL8RB[559053]

[7025] 14095: L19591 Homo sapiens interleukin 8 receptor alpha (IL8RA) mRNA, complete cds gi|559049|gb|L19591.1|HUMIL8RAA[559049]

[7026] 14096: M69229 Human insulin-like growth factor I receptor gene, promoter region and 5′ end gi|184837|gb|M69229.1|HUMIGFR1PR[184837]

[7027] 14097: L03840 Human fibroblast growth factor receptor 4 (FGFR4) mRNA, complete cds gi|182570|gb|L03840.1|HUMFGFR4X[182570]

[7028] 14098: L13268 Homo sapiens N-methyl-d-aspartate receptor (NR1-3) mRNA, 3′ end gi|292286|gb|L13268.1|HUMMARB[292286]

[7029] 14099: L13266 Homo sapiens N-methyl-d-aspartate receptor (NR1-1) mRNA, complete cds gi|292282|gb|L13266.1|HUMMAR[292282]

[7030] 14100: Y13426 Homo sapiens TCRDV2 gene, partial gi|2181879|emb|Y13426.1|HSTCRDV2[2181879]

[7031] 14101: Y08768 H. sapiens mRNA for IL-13 receptor gi|1877211|emb|Y08768.1|HSIL13[1877211]

[7032] 14102: Y08110 H. sapiens mRNA for mosaic protein LR11 gi|1552323|emb|Y08110.1|HSLR11[1552323]

[7033] 14103: E08844 Histamine H1 receptor gene gi|2176948|dbj |E08844.1|E08844[2176948]

[7034] 14104: E08843 cDNA encoding Histamine H1 receptor gi|2176947|dbj|E08843.1|E08843[2176947]

[7035] 14106: E07873 cDNA encoding cholecystokinin B/gastrin receptor gi|2176006|dbj|E07873.1|E07873[2176006]

[7036] 14107: E07650 cDNA encoding endothelin receptor,ETB-receptor gi|2175785|dbj|E07650.1|E07650[2175785]

[7037] 14108: E07649 cDNA encoding endothelin receptor,ETA-receptor gi|2175784|dbj|E07649.1|E07649[2175784]

[7038] 14109: E07358 gDNA encoding adrenaline alpha2CII receptor gi|2175498|dbj|E07358.1|E07358[2175498]

[7039] 14110: E07278 cDNA encoding human cholecystokinin(CCK) receptor gi|2175419|dbj|E07278.1|E07278[2175419]

[7040] 14111: E06799 DNA encoding human Interleukin-5 receptor gi|2174981|dbj|E06799.1|E06799[2174981]

[7041] 14112: E06798 DNA encoding human Interleukin-5 receptor gi|2174980|dbj|E06798.1|E06798[2174980]

[7042] 14113: E06797 DNA encoding human Interleukin-5 receptor gi|2174979|dbj|E06797.1|E06797[2174979]

[7043] 14114: E06796 DNA encoding human Interleukin-5 receptor gi|2174978|dbj|E06796.1|E06796[2174978]

[7044] 14115: E05678 cDNA encoding human LH-hCG(luteinizing hormone-human choriogonadotropic hormone) receptor gi|2173865|dbj|E05678.1|E05678[2173865]

[7045] 14116: E05211 DNA encoding human scavenger receptor II gi|2173401|dbj|E05211.1|E05211[2173401]

[7046] 14117: E05210 DNA encoding human scavenger receptor I gi|2173400|dbj |E05210.1|E05210[2173400]

[7047] 14118: E05109 cDNA encoding human oxytocin receptor gi|2173303|dbj|E05109.1|E05109[2173303]

[7048] 14189: E04823 cDNA encoding interleukin 6 receptor gi|2173019|dbj|E04823.1|E04823[2173019]

[7049] 14190: E03879 cDNA encoding platelet activating factor receptor gi|2172093|dbj|E03879.1|E03879[2172093]

[7050] 14191: E03829 cDNA encoding human thromboxane receptor gi|2172043|dbj|E03829.1|E03829[2172043]

[7051] 14192: E03378 DNA encoding N-terminal fragment of human growth hormone receptor gi|2171595|dbj |E03378.1|E03378[2171595]

[7052] 14193: E03377 DNA encoding C-terminal fragment of human growth hormone receptor gi|2171594|dbj|E03377.1|E03377[2171594]

[7053] 14194: E03335 Human b-FGF receptor gene gi|2171552|dbj E03335.1|E03335[2171552]

[7054] 14195: E03268 cDNA sequence coding for human scavenger receptor,type II gi|2171485|dbj|E03268.1|E03268[2171485]

[7055] 14196: E03267 cDNA sequence coding for human scavenger receptor,type I gi|2171484|dbj|E03267.1|E03267[2171484]

[7056] 14197: E02673 cDNA encoding human B cell stimulating factor 2 receptor protein gi|21709011dbj|E02673.1|E02673[2170901]

[7057] 14198: E02541 cDNA encoding human Interleukin-2 receptor L chain gi|2170771|dbj|E02541.1|E02541[2170771]

[7058] 14199: E02151 Terminal sequence of constant region of T cell receptor beta chain(c beta-1) gi|2170389|dbj|E02151.1|E02151[2170389]

[7059] 14200: E01646 cDNA encoding Fc epsilon receptor gi|2169899|dbj|E01646.1|E01646[2169899]

[7060] 14201: E01052 DNA encoding human mature TNF gi|2169311|dbj|E01052.1|E01052[2169311]

[7061] 14202: E00999 cDNA encoding human insulin receptor gi|21692581dbj|E00999.1|E00999[2169258]

[7062] 14203: E00990 cDNA encoding alpha chain of T-cell receptor gi|2169251|dbj|E00990.1|E00990[2169251]

[7063] 14204: E00727 cDNA encoding human IL-2 receptor gi|2169004|dbj|E00727.1|E00727[2169004]

[7064] 14205: E00723 cDNA encoding human interleukin-2 receptor gi|2169000|dbj|E00723.1|E00723[2169000]

[7065] 14206: E00685 cDNA encoding human T-cell antigen receptor protein gi|2168964|dbj|E00685.1|E00685[2168964]

[7066] 14207: D31833 Human mRNA for vasopressin V1b receptor, complete cds gi|563981|dbj|D31833.1|HUMVV1BR[563981]

[7067] 14208: D16845 Human mRNA for thyrotropin-releasing hormone receptor, complete cds gi|577631|dbj|D16845.1|HUMTRHR1[577631]

[7068] 14209: D28131 Human mRNA for TGF-beta receptor type IIB, partial sequence gi|456708|dbj|D28131.1|HUMTGFBRII[456708]

[7069] 14211: D17517 Human sky mRNA for Sky, complete cds gi|624880|dbj|D17517.1|HUMSKY[624880]

[7070] 14214: D30780 Human mRNA for phospholipase A2 receptor, partial cds gi|565645|dbj|D30780.1HUMPLA2IR[565645]

[7071] 14215: D38299 Homo sapiens mRNA for prostaglandin E receotor EP3 subtype 2 isoform, complete cds gi|1389574|dbj|D38299.1|HUMPEREFC[1389574]

[7072] 14216: D38298 Homo sapiens mRNA for prostaglandin E receotor EP3 subtype 1b isoform, complete cds gi|1389573|dbj|D38298.1|HUMPEREEB[1389573]

[7073] 14217: D38301 Homo sapiens mRNA for prostaglandin E receptor EP3 subtype 3 isoform, complete cds gi|1389572|dbj|D38301.1|HUMPERECE[1389572]

[7074] 14218: D38300 Homo sapiens mRNA for prostaglandin E receotor EP3 subtype 4 isoform, complete cds gi|1389571|dbj|D38300.1|HUMPEREBD[1389571]

[7075] 14219: D38297 Homo sapiens mRNA for prostaglandin E receotor EP3 subtype 1a isoform, complete cds gi|1389570|dbj|D38297.1|HUMPEREA[1389570]

[7076] 14220: D28538 Human mRNA for metabotropic glutamate receptor subtype 5a, complete cds gi|1408051|dbj|D28538.1|HUMMGRS5A[1408051]

[7077] 14221: D14872 Human DNA for fibroblast growth factor receptor 2 (K-sam-II) exon C3, partial sequence gi|511927|dbj |D14872.1|HUMKSAMC3[511927]

[7078] 14222: D50582 Human gene for inward rectifier K channel, complete cds gi|188444|dbj|D50582.1|HUMIRKCB[1088444]

[7079] 14223: D26070 Human mRNA for type 1 inositol 1,4,5-trisphosphate receptor, complete cds gi|559322|dbj|D26070.1|HUMINSP3R1[559322]

[7080] 14232: D26156 Human mRNA for transcriptional activator hSNF2b, complete cds gi|505087|dbj|D26156.1|HUMHSNF2B[505087]

[7081] 14233: D26155 Human mRNA for transcriptional activator hSNF2a, complete cds gi|505086|dbj|D26155.1|HUMHSNF2A[505086]

[7082] 14234: D263S1 Human mRNA for type 3 inositol 1,4,5-trisphosphate receptor, complete cds gi|450470|dbj|D26351.1|HUMHT3I[450470]

[7083] 14235: D26350 Human mRNA for type 2 inositol 1,4,5-trisphosphate receptor, complete cds gi|450468|dbj|D26350.1|HUMHT2I[450468]

[7084] 14236: D25418 Human mRNA for prostacyclin receptor, complete cds gi|467509|dbj|D25418.1|HUMHPR[467509]

[7085] 14237: D10924 Human mRNA for HM89 gi|219868|dbj|D10924.1|HUMHM89[219868]

[7086] 14238: D10923 Human mRNA for HM74 gi|219866|dbj|D10923.1|HUMHM74[219866]

[7087] 14239: D10922 Human mRNA for FMLP-related receptor (HM63) gi|219864|dbj|D10922.1|HUMHM63[219864]

[7088] 14240: D10925 Human mRNA for HM145 gi|219862|dbj|D10925.1|HUMHM145[219862]

[7089] 14241: D28481 Human mRNA for histamine H1 receptor, complete cds gi|457654|dbj|D28481.1|HUMHH1R[457654]

[7090] 14242: D10995 Human gene for serotonin 1B receptor, complete cds gi|219678|dbj|D10995.1|HUMHGCR[219678]

[7091] 14243: D38449 Human mRNA for G protein-coupled receptor, complete cds gi|556519|dbj|D38449.1|HUMGPCRAA[556519]

[7092] 14245: D37827 Homo sapiens mRNA for large erk/cek5 tyrosine kinase, partial cds gi|1060894|dbj|D37827.1|HUMERK1P[1060894]

[7093] 14246: D13305 Human mRNA for brain cholecystokinin receptor gi|436039|dbj|D13305.1|HUMBRACHRE[436039]

[7094] 14247: D32201 Human mRNA for alpha 1C adrenergic receptor isoform 3, complete cds gi|927210|dbj|D32201.1|HUMAICAR3[927210]

[7095] 14248: D16354 Human mRNA for Ah receptor, complete cds gi|464179|dbj|D16354.1|HUMAHRE[464179]

[7096] 14249: D25235 Human mRNA for alpha1C adrenergic receptor, complete cds gi|433200|dbj|D25235.1|HUMACAR[433200]

[7097] 14250: D13538 Human alpha2CII-adrenergic receptor gene, complete cds gi|219405|dbj|D13538.1|HUMA2CIIA[219405]

[7098] 14251: D32202 Human mRNA for alpha 1C adrenergic receptor isoform 2, complete cds gi|927208|dbj|D32202.1|HUMA1CAR2 [927208]

[7099] 14253: D86519 Human mRNA for neuropeptide y/peptide YY Y6 receptor, complete cds gi|731789|dbj|D86519.1|D86519[1731789]

[7100] 14254: D50683 Homo sapiens mRNA for TGF-betaIIR alpha, complete cds gi|1827474|dbj|D50683.1|D50683[1827474]

[7101] 14255: D50682 Homo sapiens mRNA for TGF-betaIIR beta, partial cds gi|1827472|dbj|D50682.1|D50682[1827472]

[7102] 14256: D28472 Human mRNA for prostaglandin E receptor EP4 subtype, complete cds gi|1486234|dbj|D28472.1|D28472[1486234]

[7103] 14257: D29634 Human lung mRNA for receptor for prostacyclin, complete cds gi|577629|dbj|D29634.1|D29634[577629]

[7104] 14258: D28539 Human mRNA for metabotropic glutamate receptor subtype 5b, complete cds gi|1408053|dbj|D28539.1|HUMMGRS5B[1408053]

[7105] 14259: Y09479 H.sapiens mRNA for G protein-coupled receptor Edg-2 gi|1679601|emb|Y09479.1|HSEDG2[1679601]

[7106] 14260: U97197 Homo sapiens asialoglycoprotein receptor (ASGPR) mRNA, complete cds gi|2121249|gb|U97197.1|HSU97197[2121249]

[7107] 14261: X81892 H.sapiens mRNA for HE6 Tm7 receptor gi|2117160|emb|X81892.1|HSHE6[2117160]

[7108] 14262: Y07619 H.sapiens mRNA for peroxisome proliferator-activated receptor alpha gi|1514594|emb|Y07619.1|HSPPARAGE[1514594]

[7109] 14263: D16815 Homo sapiens mRNA for EAR-1r, complete cds gi|2116671|dbj|D16815.1|D16815[2116671]

[7110] 14264: X95876 H.sapiens mRNA for G-protein coupled receptor gi|1552845|emb|X95876.1|HSGPCRIN8[1552845]

[7111] 14265: AF000545 Homo sapiens putative purinergic receptor P2Y10 gene, complete cds gi|2104786|gb|AF000545.1|HSAF000545[2104786]

[7112] 14267: U95626 Homo sapiens ccr2b (ccr2), ccr2a (ccr2), ccr5 (ccr5) and ccr6 (ccr6) genes, complete cds, and lactoferrin (lactoferrin) gene, partial cds, complete sequence gi|2104517|gb|U95626.1|HSU95626[2104517]

[7113] 14268: U77352 Homo sapiens MAP kinase-activating death domain protein (MADD) mRNA, complete cds gi|2102697|gb|U77352.1|HSU77352[2102697]

[7114] 14269: D86098 Homo sapiens mRNA for prostaglandin EP3 receptor subtype isoform, complete cds gi|2102646|dbj|D86098.1|D86098[2102646]

[7115] 14270: D86097 Homo sapiens mRNA for prostaglandin EP3 receptor subtype isoform, complete cds gi|2102644|dbj|D86097.1|D86097[2102644]

[7116] 14271: X98510 H.sapiens mRNA for G protein-coupled receptor gi|1894788|emb|X98510.1|HSX98510[1894788]

[7117] 14272: D89675 Homo sapiens mRNA for bone morphogenetic protein type IB receptor, complete cds gi|2055308|dbj|D89675.1|D89675[2055308]

[7118] 14273: D43772 Human squamous cell carcinoma of esophagus mRNA for GRB-7 SH2 domain protein, complete cds gi|601890|dbj|D43772.1|HUMGRB7[601890]

[7119] 14274: X89677 H.sapiens mRNA for TPCR92 protein gi|902337|emb|X89677.1|HSTPCR92P[902337]

[7120] 14275: X89676 H.sapiens mRNA for TPCR86 protein gi|902335|emb|X89676.1|HSTPCR86P[902335]

[7121] 14276: X89675 H.sapiens mRNA for TPCR85 protein gi|902333|emb|X89675.1|HSTPCR85P[902333]

[7122] 14277: X89674 H.sapiens mRNA for TPCR27 protein gi|902331|emb|X89674.1|HSTPCR27P[902331]

[7123] 14278: X89673 H.sapiens mRNA for TPCR26 protein gi|902329|emb|X89673.1|HSTPCR26P[902329]

[7124] 14279: X89672 H.sapiens mRNA for TPCR25 protein gi|902327|emb|X89672.1|HSTPCR25P[902327]

[7125] 14280: X89671 H.sapiens mRNA for TPCR24 protein gi|902325|emb|X89671.1|HSTPCR24P[902325]

[7126] 14281: X89670 H.sapiens mRNA for TPCR16 protein gi|902323|emb|X89670.1|HSTPCR16P[902323]

[7127] 14282: X89669 H.sapiens mRNA for TPCR120 protein gi|902321|emb|X89669.1|HSTPCR120[902321]

[7128] 14283: X89668 H.sapiens mRNA for TPCR110protein gi|902319|emb|X89668.1|HSTPCR110[902319]

[7129] 14284: X89667 H.sapiens mRNA for TPCR106 protein gi|902317|emb|X89667.1|HSTPCR106[902317]

[7130] 14285: X89666 H.sapiens mRNA for TPCR100 protein gi|902315|emb|X89666.1|HSTPCR100[902315]

[7131] 14291: X73617 H.sapiens mRNA for T-cell receptor delta gi|402624|emb|X73617.1|HSTCRDE[402624]

[7132] 14292: Z79612 H.sapiens DNA for muscle nicotinic acetylcholine receptor gene promotor, clone DBLambda20gi|1922318|emb|Z79612.1|HSMNAR3[1922318]

[7133] 14293: Z79611 H.sapiens DNA for muscle nicotinic acetylcholine receptor gene promotor, clone DBLambda23 gi|1922317|emb|Z79611.1|HSMNAR2[1922317]

[7134] 14294: Z79610 H.sapiens DNA for muscle nicotinic acetylcholine receptor gene promotor, clone ICRFc105F02104 gi|1922316|emb|Z79610.1|HSMNAR1[1922316]

[7135] 14295: Y09852 H.sapiens FGFR3 gene, partial gi|1922307|emb|Y09852.1|HSFGFR3I2[1922307]

[7136] 14309: Z46223 H.sapiens DNA for immunoglobulin G Fc receptor IIIB gi|559446|emb|Z46223.1|HSIGGRE3B[559446]

[7137] 14310: Z46222 H.sapiens DNA for immunoglobulin G Fc receptor IIIA gi|559445|emb|Z46222.1|HSIGGRE3A[559445]

[7138] 14311: Y09561 H.sapiens mRNA for P2X7 receptor gi|1854511|emb|Y09561.1|HSP2X7[1854511]

[7139] 14312: Y09328 H.sapiens mRNA for IL13 receptor alpha-1 chain gi|1885307|emb|Y09328.1|HSIL13RA1[1885307]

[7140] 14313: Y07593 H.sapiens mRNA for 46 kDa coxsackievirus and adenovirus receptor (CAR) protein gi|1881446|emb|Y07593.1|HS46KDA[1881446]

[7141] 14314: X07205 H.sapiens TRGV9 gene, allele V9A1 gi|1848089|emb|X07205.1|HSTRGV9[1848089]

[7142] 14315: X15272 H.sapiens TRGV4F gene gi|1841921|emb|X15272.1|HSTRGV4F[1841921]

[7143] 14316: Y11227 H.sapiens TRGV11 gene gi|1848086|emb|Y11227.1|HSTRGV11G[1848086]

[7144] 14317: X74798 H.sapiens TRGV10 gene, allele V10A2 gi|1848083|emb|X74798.1|HSTRGV[1848083]

[7145] 14321: X80878 H.sapiens R kappa B mRNA gi|695578|emb|X80878.1|HSRKAPB[695578]

[7146] 14324: X70070 H.sapiens mRNA for neurotensin receptor gi|35020|emb|X70070.1|HSNEURA[35020]

[7147] 14325: X94552 H.sapiens mRNA for metabotropic glutamate receptor type 7 gi|1370110|emb|X94552.1|HSMGLU7[1370110]

[7148] 14326: X89105 H.sapiens krag-like mRNA gi|939922|emb|X89105.1|HSKRAGGEN[939922]

[7149] 14327: X92562 H.sapiens mRNA for myeloid IgA Fc receptor, CD89 (539bp) gi|1296655|emb|X92562.1|HSIGAFCR5[1296655]

[7150] 14328: X92561 H.sapiens mRNA for myeloid IgA Fc receptor, CD89 (585bp) gi|1296654|emb|X92561.1|HSIGAFCR4[1296654]

[7151] 14329: X92560 H.sapiens mRNA for myeloid IgA Fc receptor, CD89 (807bp) gi|1296653|emb|X92560.1|HSIGAFCR3[1296653]

[7152] 14330: X92559 H.sapiens mRNA for myeloid IgA Fc receptor, CD89 (771bp) gi|1296652|emb|X92559.1|HSIGAFCR2[1296652]

[7153] 14331: X92558 H.sapiens mRNA for myeloid IgA Fc receptor, CD89 (837bp) gi|1296651|emb|X92558.1|HSIGAFCR1[1296651]

[7154] 14332: Z50197 H.sapiens FGFR2, Bek gene (partial; mutation C) gi|929635|emb|Z50197.1|HSFGFR2XC[929635]

[7155] 14333: Z50196 H.sapiens FGFR2, Bek gene (partial; mutation B) gi|929634|emb|Z50196.1|HSFGFR2XB[929634]

[7156] 14334: Z50201 H.sapiens FGFR2 gene (partial; mutation A) gi|929633|emb|Z50201.1|HSFGFR2XA[929633]

[7157] 14335: X72304 H.sapiens mRNA for corticotrophin releasing factor receptor gi|436118|emb|X72304.1|HSCRFA[436118]

[7158] 14336: X86169 H.sapiens B2-bradykinin receptor gene, exon 2, C allele gi|1220165|emb|X86169.1|HSB2BRX2C[1220165]

[7159] 14342: X03131 H.sapiens interleukin 2 receptor gene 5′ flanking region and exon 1 (and joined CDS) gi|33818|emb|X03131.1|HSIL2RG1[33818]

[7160] 14343: X57740 H.sapiens rearranged T-cell receptor gamma chain gene, V3RS-J1 (hybrid joint) gi|505478|emb|X57740.1|HSTCRHJD[505478]

[7161] 14344: X01719 H.sapiens gene fragment for the acetylcholine receptor gamma subunit (exon 7 and 8) gi|28278|emb|X01719.1|HSACHG5[28278]

[7162] 14345: X01715 H.sapiens gene fragment for the acetylcholine receptor gamma subunit precursor (exons 1 and 2) gi|28268|emb|X01715.1|HSACHG1[28268]

[7163] 14535: Z30429 H.sapiens gene for early lymphocyte activation antigen CD69, exon 4 gi|534947|emb|Z30429.1|HSLACD694[534947]

[7164] 14536: X89744 H.sapiens mRNA for neuronal acetylcholine receptor alpha-4 subunit, exon 4 gi|1279462|emb|X89744.1|HSCHRNA44[1279462]

[7165] 14537: X87765 H.sapiens CD89 gene, exon TM/C gi|963045|emb|X87765.1|HSCD89EX5[963045]

[7166] 14538: X87766 H.sapiens CD89 gene, exon EC2 gi|963044|emb|X87766.1|HSCD89EX4[963044]

[7167] 14539: X87769 H.sapiens CD89 gene, exon EC1 gi|963043|emb|X87769.1|HSCD89EX3[963043]

[7168] 14540: X87768 H.sapiens CD89 gene, exon S2 gi|963042|emb|X87768.1|HSCD89EX2[963042]

[7169] 14541: X87767 H.sapiens CD89 gene, exon S1 gi|963041|emb|X87767.1|HSCD89EX1[963041]

[7170] 14542: AH004970 Homo sapiens (clone Q-20D3) interferon receptor (IFNAR2) gene gi|995299|gb|AH004970.1|SEG_HUMIFNAMO[995299]

[7171] 14543: L42243 Homo sapiens (clone 51H8) alternatively spliced interferon receptor (IFNAR2) gene, exon 9 and complete cds's gi|995298|gb|L42243.1|HUMIFNAM08[995298]

[7172] 14544: L41944 Homo sapiens interferon receptor ifnar2-1 (splice variant IFNAR2-1) mRNA, complete cds gi|995296|gb|L41944.1|HUMIFNAL[995296]

[7173] 14545: L41943 Homo sapiens interferon receptor ifnar2-3 (splice variant IFNAR2-3) mRNA, complete cds gi|995294|gb|L41943.1|HUMIFNAK[995294]

[7174] 14546: L41942 Homo sapiens interferon receptor ifnar2-2 (splice variant IFNAR2-2) mRNA, complete cds gi|995292|gb|L41942.1|HUMIFNAJ[995292]

[7175] 14547: L42242 Homo sapiens (clone Q-20D3) interferon receptor (IFNAR2) gene, exon 8 gi|994722|gb|L42242.1|HUMIFNAM07[994722]

[7176] 14548: L42241 Homo sapiens (clone Q-20D3) interferon receptor (IFNAR2) gene, exon 7 gi|994721|gb|L42241.1|HUMIFNAM06[994721]

[7177] 14549: L42323 Homo sapiens (clone 20D3) interferon receptor (IFNAR2) gene, exon 6 gi|994720|gb|L42323.1|HUMIFNAM05[994720]

[7178] 14550: L42240 Homo sapiens (clone Q-20D3) interferon receptor (IFNAR2) gene, exon 5 gi|994719|gb|L42240.1|HUMIFNAM04[994719]

[7179] 14551: L42239 Homo sapiens (clone Q-20D3) interferon receptor (IFNAR2) gene, exons 3-4 gi|994718|gb|L42239.1|HUMIFNAM03[994718]

[7180] 14552: L42238 Homo sapiens (clone Q-20D3) interferon receptor (IFNAR2) gene, exon 2 gi|994717|gb|L42238.1|HUMIFNAM02[994717]

[7181] 14553: L42237 Homo sapiens (clone Q-20D3) interferon receptor (IFNAR2) gene, exon 1 gi|994716|gb|L42237.1|HUMIFNAM01[994716]

[7182] 14557: X94647 H.sapiens CD97 gene exon 20 gi|1165083|emb|X94647.1|HSX94647[1165083]

[7183] 14558: X94630 H.sapiens CD97 gene exon 1 (and joined CDS) gi|1165073|emb|X94630.1|HSX94630[1165073]

[7184] 14560: X91747 H.sapiens gene for FSH receptor (exon 10) gi|1009412|emb|X91747.1|HSFSHRX10[1009412]

[7185] 14561: X74979 H.sapiens TRK E mRNA gi|400462|emb|X74979.1|HSTRKE[400462]

[7186] 14562: Y10100 H.sapiens ACTH receptor promoter & exon 1 gi|1743254|emb|Y10100.1|HSACTHPRO[1743254]

[7187] 14563: Y09028 H.sapiens NTRK1 gene, exon 1 (and joined mRNA) gi|1785644|emb |Y09028.1|HSNTRK11[1785644]

[7188] 14564: Y07684 H.sapiens mRNA for P2X4 purinoceptor gi|1781008|emb|Y07684.1|HSP2X4PC[1781008]

[7189] 14565: X95712 H.sapiens mRNA for receptor protein tyrosine phosphatase gi|1666422|emb|X95712.1|HSRPTYRPH[1666422]

[7190] 14568: X97232 H.sapiens mRNA for NK receptor, clone library D97.10 gi|1770483|emb|X97232.1|HSNKRD9[1770483]

[7191] 14569: X97233 H.sapiens mRNA for NK receptor, clone library C97.12#5 gi|1770481|emb|X97233.1|HSNKRC9[1770481]

[7192] 14570: X97231 H.sapiens mRNA for NK receptor, clone library 59C/K3 gi|1770479|emb|X97231.1|HSNKR59[1770479]

[7193] 14571: X97230 H.sapiens mRNA for NK receptor, clone library 4M1#6 gi|1770477|emb|X97230.1|HSNKR4M[1770477]

[7194] 14572: X97229 H.sapiens mRNA for NK receptor, clone library 15.212 gi|1770475|emb|X97229.1|HSNKR15[1770475]

[7195] 14573: X99481 H.sapiens mRNA for NK receptor, clone GR #19 gi|1770473|emb|X99481.1|HSNKGR19[1770473]

[7196] 14574: X99480 H.sapiens mRNA for NK receptor, clone NK3.3 #27 gi|1770471|emb|X99480.1|HSNK3327[1770471]

[7197] 14575: X99479 H.sapiens mRNA for NK receptor, clone 12.11C gi|1770469|emb|X99479.1|HSNK1211C[1770469]

[7198] 14576: X98118 H.sapiens GRK4A gene gi|1770421|emb|X98118.1|HSGRK4AGE[1770421]

[7199] 14589: X83864 H.sapiens EDG-3 gene gi|1770395|emb|X83864.1|HSEDG3[1770395]

[7200] 14590: Z48923 H.sapiens mRNA for BMPR-II gi|1009409|emb|Z48923.1|HSBMPRII[1009409]

[7201] 14592: X84939 H.sapiens mRNA for fibroblast growth factor receptor-3 gi|695548|emb|X84939.1|HSFGFR3EX[695548]

[7202] 14593: X89604 H.sapiens mRNA for metallothionein-III gi|914850|emb|X89604.1|HSMTIII[914850]

[7203] 14594: Z70276 H.sapiens mRNA for fibroblast growth factor 12 (partial) gi|1749790|emb|Z70276.1|HSFGF12CR[1749790]

[7204] 14595: Z70275 H.sapiens mRNA for fibroblast growth factor 11 (partial) gi|1749788|emb|Z70275.1|HSFGF11CR[1749788]

[7205] 14596: Y09392 H.sapiens mRNA for WSL-LR, WSL-S1 and WSL-S2 proteins gi|1669690|emb|Y09392.1|HSWSL1[1669690]

[7206] 14597: X99031 H.sapiens gene encoding discoidin receptor tyrosine kinase, exon 14 gi|1480251|emb|X99031.1|HSDRTK14[1480251]

[7207] 14598: X99029 H.sapiens gene encoding discoidin receptor tyrosine kinase, exon 11 gi|1480247|emb|X99029.1|HSDRTK11[1480247]

[7208] 14599: Y08162 H.sapiens mRNA for heptahelix receptor gi|1707499|emb|Y08162.1|HSHHR[1707499]

[7209] 14600: X98194 H.sapiens gene encoding serotonin receptor, 5-HT7, exon 3 gi|1707470|emb|X98194.1|HS5HT73[1707470]

[7210] 14601: X99025 H.sapiens gene encoding discoidin receptor tyrosine kinase, exons 6 & 7 gi|1480257|emb|X99025.1|HSDRTK6[1480257]

[7211] 14615: X98147 H.sapiens gene encoding serotonin receptor, 5-HT7, exon 2 gi|1707469|emb|X98147.1|HS5HT72[1707469]

[7212] 14616: X98193 H.sapiens gene encoding serotonin receptor, 5-HT7, exon 1 (and joined CDS) gi|1707467|emb|X98193.1|HS5HT71[1707467]

[7213] 14617: X90753 H.sapiens mRNA for alternatively spliced IgA Fc receptor (CD89) gi|951268|emb|X90753.1|HSIGAFCGN[951268]

[7214] 14618: X70812 H.sapiens gene for beta 3 adrenergic receptor gi|312398|emb|X70812.1|HSBARED[312398]

[7215] 14619: Z22971 H.sapiens mRNA for M130 antigen extracellular variant gi|312147|emb|Z22971.1|HSM130AE[312147]

[7216] 14620: Z22970 H.sapiens mRNA for M130 antigen cytoplasmic variant 2 gi|312145|emb|Z22970.1|HSM130AC2[312145]

[7217] 14621: Z22969 H.sapiens mRNA for M130 antigen cytoplasmic variant 1 gi|312143|emb|Z22969.1|HSM130AC1[312143]

[7218] 14622: Z22968 H.sapiens mRNA for M130 antigen gi|312141|emb|Z22968.1|HSM130A[312141]

[7219] 14623: X69680 H.sapiens mRNA for bradykinin receptor gi|288798|emb|X69680.1|HSBKR[288798]

[7220] 14624: Z79784 H.sapiens G protein-coupled receptor CKR-L3 gi|1668737|emb|Z79784.1|HSCKRL3[1668737]

[7221] 14625: Z79782 H.sapiens G protein-coupled receptor CKR-L1 gi|1668735|emb|Z79782.1|HSCKRL1[1668735]

[7222] 14626: X94374 H.sapiens mRNA for HLA class I inhibitory NK receptor (AMC5) gi|1495480|emb|X94374.1|HSNKRAMC5[1495480]

[7223] 14627: X94373 H.sapiens mRNA for HLA class I inhibitory NK receptor (1.1) gi|1495478|emb|X94373.1|HSNKR11[1495478]

[7224] 14628: X93596 H.sapiens mRNA for HLA specific NK receptor gi|1495476|emb|X93596.1|HSNKI8[1495476]

[7225] 14629: X93595 H.sapiens mRNA for NK receptor (clone 17.1C) gi|1495474|emb|X93595.1|HSNKI7[1495474]

[7226] 14630: X94262 H.sapiens mRNA for HLA-Bw4 specific inhibitory NK cell receptor gi|1495472|emb|X94262.1|HSNKCRMR[1495472]

[7227] 14631: X89772 H.sapiens mRNA for interferon alpha/beta receptor (long form) gi|1620400|emb|X89772.1|HSRNAIABR[1620400]

[7228] 14632: X69516 H.sapiens gene for folate receptor gi|2888761emb|X69516.1|HSFOLA[288876]

[7229] 14633: X97671 H.sapiens mRNA for erythropoietin receptor gi|1310666|emb|X97671.1|HSERYTHR[1310666]

[7230] 14639: X97874 H.sapiens EP4 prostaglandin receptor gene, exon III gi|1359732|emb|X97874.1|HSEP4EX3[1359732]

[7231] 14640: X97873 H.sapiens EP4 prostaglandin receptor gene, exons I & II (and joined CDS) gi|1359730|emb|X97873.1|HSEP4EX12[1359730]

[7232] 14646: X99404 H.sapiens mRNA for early response gene, Berg36 gi|1480242|emb|X99404.1|HSBERG36[1480242]

[7233] 14647: Z49205 H.sapiens mRNA for purinergic receptor gi|798835|emb|Z49205.1|HSATPRMR[798835]

[7234] 14650: X89066 H.sapiens mRNA for TRPC1 protein gi|1370118|emb|X89066.1|HSTRPC1GN[1370118]

[7235] 14671: Y08218 H.sapiens mRNA for ryanodine receptor 2 gi|1561613|emb |Y08218.1|HSRYAN2[1561613]

[7236] 14678: X96586 H.sapiens mRNA for FAN protein gi|1556398|emb|X96586.1|HSFAN[1556398]

[7237] 14679: Z48226 H.sapiens partial gene for receptor-type protein tyrosine phosphatase IA-2 gi|667014|emb|Z48226.1|HSPTPAIA2[667014]

[7238] 14680: X91665 H.sapiens B2-bradykinin receptor gene (allele BE-R33) gi|1216151emb|X91665.1|HSB2BER33[1216151]

[7239] 14681: L05424 Human cell surface glycoprotein CD44 (CD44) gene, 3′ end of long tailed isoform gi|337956|gb|L05424.1|HUMSCG19[337956]

[7240] 14682: L05423 Human cell surface glycoprotein CD44 (CD44) gene, exon 18, 3′ end of short tailed isoform gi|337955|gb|L05423.1|HUMSCG18[337955]

[7241] 14683: L05422 Human cell surface glycoprotein CD44 (CD44) gene, exon 17 gi|337954|gb|L05422.1|HUMSCG17[337954]

[7242] 14684: L05421 Human cell surface glycoprotein CD44 (CD44) gene, exon 16 gi|337953|gb|L05421.1|HUMSCG16[337953]

[7243] 14685: L05420 Human cell surface glycoprotein CD44 (CD44) gene, exon 15 gi|337952|gb|L05420.1|HUMSCG15[337952]

[7244] 14686: L05419 Human cell surface glycoprotein CD44 (CD44) gene, exon 14 gi|337951|gb|L05419.1|HUMSCG14[337951]

[7245] 14687: L05418 Human cell surface glycoprotein CD44 (CD44) gene, exon 13 gi|337950|gb|L05418.1|HUMSCG13[337950]

[7246] 14688: L05417 Human cell surface glycoprotein CD44 (CD44) gene, exon 12 gi|337949|gi|L05417.1|HUMSCG12[337949]

[7247] 14689: L05416 Human cell surface glycoprotein CD44 (CD44) gene, exon 11 gi|337948|gi|L05416.1|HUSCG11[337948]

[7248] 14690: L05415 Human cell surface glycoprotein CD44 (CD44) gene, exon 10 gi|337947|gb|L05415.1|HUMSCG10[337947]

[7249] 14691: L05414 Human cell surface glycoprotein CD44 (CD44) gene, exon 9 gi|337946|gb|L05414.1|HUMSCG09[337946]

[7250] 14692: L05413 Human cell surface glycoprotein CD44 (CD44) gene, exon 8 gi|337945|gb|L05413.1|HUMSCG08[337945]

[7251] 14693: L05412 Human cell surface glycoprotein CD44 (CD44) gene, exon 7 gi|337944|gb|L05412.1|HUMSCG07[337944]

[7252] 14694: L05411 Human cell surface glycoprotein CD44 (CD44) gene, exon 6 gi|337943|gb|L05411.1|HUMSCG06[337943]

[7253] 14695: L05410 Human cell surface glycoprotein CD44 (CD44) gene, exon 5 gi|337942|gb|L05410.1|HUMSCG05[337942]

[7254] 14696: L05409 Human cell surface glycoprotein CD44 (CD44) gene, exon 4 gi|337941|gb|L05409.1|HUMSCG04[337941]

[7255] 14697: L05408 Human cell surface glycoprotein CD44 (CD44) gene, exon 3 gi|337940|gb|L05408.1|HUMSCG03[337940]

[7256] 14698: L05407 Human cell surface glycoprotein CD44 (CD44) gene, exon 2 gi|337939|gb|L05407.1|HUMSCG02[337939]

[7257] 14699: M69215 Human hyaluronate receptor (CD44) gene, exon 1 gi|180127|gb|M69215.1|HUMSCG01[180127]

[7258] 14700: X91492 H.sapiens ChemR13 gene gi|1262810|emb|X91492.1|HSCCCKR4G[1262810]

[7259] 14701: X91742 H.sapiens gene for FSH receptor (exon 5) gi|1051149|emb|X91742.1|HSFSHRX5[1051149]

[7260] 14702: X91746 H.sapiens gene for FSH receptor (exon 9) gi|1009420|emb|X91746.1|HSFSHRX9[1009420]

[7261] 14703: X91745 H.sapiens gene for FSH receptor (exon 8) gi|1009419|emb|X91745.1|HSFSHRX8[1009419]

[7262] 14704: X91744 H.sapiens gene for FSH receptor (exon 7) gi|1009418|emb|X91744.1|HSFSHRX7[1009418]

[7263] 14705: X91743 H.sapiens gene for FSH receptor (exon 6) gi|1009417|emb |X91743.1|HSFSHRX6 [1009417]

[7264] 14706: X91741 H.sapiens gene for FSH receptor (exon 4) gi|1009415|emb|X91741.1|HSFSHRX4[1009415]

[7265] 14707: X91740 H.sapiens gene for FSH receptor (exon 3) gi|1009414|emb|X91740.1|HSFSHRX3[1009414]

[7266] 14708: X91739 H.sapiens gene for FSH receptor (exon 2) gi|1009413|emb|X91739.1|HSFSHRX2[1009413]

[7267] 14709: X91738 H.sapiens gene for FSH receptor (exon 1) gi|1009411|emb|X91738.1|HSFSHRX1[1009411]

[7268] 14710: A34990 H.sapiens TSH receptor gi|1568335|emb|A34990.1|A34990[1568335]

[7269] 14729: A23337 H.sapiens mRNA for 5-HT2 receptor gi|1566776|emb|A23337.1|A23337[1566776]

[7270] 14730: X95095 H.sapiens mRNA for PDGFRalpha protein gi|1403334|emb|X95095.1|HSPDGFRAL[1403334]

[7271] 14731: X91875 H.sapiens IGF2R gene exon & intron 1 gi|1017421|emb|X91875.1|HSIGF2R1[1017421]

[7272] 14733: L40636 Homo sapiens (clone FBK III 16) protein tyrosine kinase (NET PTK) mRNA, complete cds gi|1100111|gi|L40636.1|HUMEPHT2R[1100111]

[7273] 14734: X55077 H.sapiens mRNA fragment for alpha-2 macroglobulin receptor gi|24762|emb|X55077.1|HSA2MR[24762]

[7274] 14735: X98330 H.sapiens mRNA for ryanodine receptor 2 gi|1526977|emb|X98330.1|HSRR2[1526977]

[7275] 14737: X80038 H.sapiens PRR2 mRNA gi|1524087|emb|X80038.1|HSPRR2[1524087]

[7276] 14738: Z15017 H.sapiens mRNA for glycoprotein 39 (gp39) gi|38483|emb|Z15017.1|HSGP39MR[38483]

[7277] 14740: Z36748 H.sapiens mRNA for serotonin receptor gi|558382|emb|Z36748.1|HSSERRC[558382]

[7278] 14741: X97198 H.sapiens mRNA for receptor phosphate PCP-2 gi|1502342|emb|X97198.1|HSRECPCP2[1502342]

[7279] 14742: X81870 H.sapiens DNA for macrophage stimulating protein receptor gi|1491705|emb|X81870.1|HSDNAMSPR[1491705]

[7280] 14743: Z11168 H.sapiens 5HT1A receptor region gi|1033027|emb|Z11168.1|HS5HT1A[1033027]

[7281] 14744: M75105 Human neurokinin-2 receptor (TAC2R) gene, exon 5 gi|189219|gb|M75105.1|HUMNK25[189219]

[7282] 14745: M75104 Human neurokinin-2 receptor (NK-2) gene, exon 4 gi|189218|gb|M75104.1|HUMNK24[189218]

[7283] 14746: M75103 Human neurokinin-2 receptor (NK-2) gene, exon 3 gi|189217|gb|M75103.1|HUMNK23[189217]

[7284] 14747: M75102 Human neurokinin-2 receptor (NK-2) gene, exon 2 gi|189216|gi|M75102.1|HUMNK22[189216]

[7285] 14748: M75101 Human neurokinin-2 receptor (TAC2R) gene, exon 1 gi|189215|gb|M75101.1|HUMNK21[189215]

[7286] 14750: X76981 H.sapiens mRNA for adenosin receptor A3 gi|440547|emb|X76981.1|HSRADRA3[440547]

[7287] 14751: X95302 H.sapiens mRNA for IL13 receptor gi|1483349|emb|X95302.1|HSIL13REC[1483349]

[7288] 14752: X51469 H.sapiens cell receptor gamma-chain J1-C1 DNA fragment (Raji cell line) gi|1480294|emb|X51469.1|HSRAJI[1480294]

[7289] 14753: X99027 H.sapiens gene encoding discoidin receptor tyrosine kinase, exon 9 gi|1480259|emb|X99027.1|HSDRTK9[1480259]

[7290] 14754: X99026 H.sapiens gene encoding discoidin receptor tyrosine kinase, exon 8 gi|1480258|emb|X99026.1|HSDRTK8[1480258]

[7291] 14755: X99024 H.sapiens gene encoding discoidin receptor tyrosine kinase, exon 5 gi|1480256|emb|X99024.1|HSDRTK5[1480256]

[7292] 14756: X99023 H.sapiens gene encoding discoidin receptor tyrosine kinase, exon 4 gi|1480255|emb|X99023.1|HSDRTK4[1480255]

[7293] 14757: X99034 H.sapiens gene encoding discoidin receptor tyrosine kinase, exon 17 gi|1480254|emb|X99034.1|HSDRTK17[1480254]

[7294] 14758: X99033 H.sapiens gene encoding discoidin receptor tyrosine kinase, exon 16 gi|1480253|emb|X99033.1|HSDRTK16[1480253]

[7295] 14759: X99032 H.sapiens gene encoding discoidin receptor tyrosine kinase, exon 15 gi|1480252|emb|X99032.1|HSDRTK15[1480252]

[7296] 14760: X98208 H.sapiens gene encoding discoidin receptor tyrosine kinase, exons 1,2,3 and joined CDS gi|1480249|emb|X98208.1|HSDRTK123[1480249]

[7297] 14761: X99030 H.sapiens gene encoding discoidin receptor tyrosine kinase, exons 12 & 13 gi|1480248|emb|X99030.1|HSDRTK12[1480248]

[7298] 14762: X99028 H.sapiens gene encoding discoidin receptor tyrosine kinase, exon 10 gi|1480246|emb|X99028.1|HSDRTK10[1480246]

[7299] 14763: X51470 H.sapiens T-cell receptor gamma-chain J1-C1 DNA fragment (D-PLL cell line) gi|1480245|emb|X51470.1|HSDPLL[1480245]

[7300] 14764: L76631 Homo sapiens metabotropic glutamate receptor 1 beta (mGluR1beta) mRNA, complete cds gi|1477389|gb|L76631.1|HUMMGLUB[1477389]

[7301] 14765: L76627 Homo sapiens metabotropic glutamate receptor 1 alpha (mGluR1alpha) mRNA, complete cds gi|1477387|gb|L76627.1|HUMMGLUA[1477387]

[7302] 14766: L57508 Homo sapiens Cak receptor kinase mRNA, complete cds gi|1160924|gb|L57508.1|HUMCAKA[1160924]

[7303] 14767: L38019 Homo sapiens (clone HUM-IP3R1) inositol 1,4,5-trisphosphate receptor type 1 mRNA, complete cds gi|1464750|gb|L38019.1|HUMITR[1464750]

[7304] 14768: X77748 H.sapiens mRNA for metabotropic glutamate receptor type 3 gi|1171563|emb|X77748.1|HSMGLUR3[1171563]

[7305] 14769: M26016 Human CR2/CD21/C3d/Epstein-Barr virus receptor gene, exon IC gi|181935|gb|M26016.1|HUMEBUR13[181935]

[7306] 14770: X63717 H.sapiens mRNA for APO-1 cell surface antigen gi|28741|emb|X63717.1|HSAPO1[28741]

[7307] 14771: L03718 Human G protein-coupled receptor (kinase-like) gene, complete cds gi|183598|gb|L03718.1|HUMGPRKLG[183598]

[7308] 14773: X99269 H.sapiens NPYY1 gene gi|1430810|emb|X99269.1|HSNPYY1[1430810]

[7309] 14774: X95536 H.sapiens ear1 gene gi|1418937|emb|X95536.1|HSREOR[1418937]

[7310] 14775: X63745 H.sapiens ERD2.2 mRNA for KDEL receptor gi|31217|emb|X63745.1|HSERD22[31217]

[7311] 14777: X98133 H.sapiens gene encoding histamine H2 receptor gi|13597581|emb|X98133.1|HSH2R[1359758]

[7312] 14778: X89893 H.sapiens mRNA for NK receptor (183 ActI) gi|1103680|emb|X89893.1|HSNKRECT2[1103680]

[7313] 14779: X89892 H.sapiens mRNA for NK receptor (Eb6 ActI) gi|1103678|emb|X89892.1|HSNKRECT1[1103678]

[7314] 14780: X98178 H.sapiens mRNA for MACH-beta-4 protein gi|1403330|emb|X98178.1|HSMACHB4[1403330]

[7315] 14781: X98177 H.sapiens mRNA for MACH-beta-3 protein gi|1403328|emb|X98177.1|HSMACHB3[1403328]

[7316] 14782: X98175 H.sapiens mRNA for MACH-beta-2 protein gi|1403326|emb|X98175.1|HSMACHB2[1403326]

[7317] 14783: X98176 H.sapiens mRNA for MACH-beta-1 protein gi|1403324|emb|X98176.1|HSMACHB1[1403324]

[7318] 14784: X98173 H.sapiens mRNA for MACH-alpha-2 protein gi|1403320|emb|X98173.1|HSMACHA2[1403320]

[7319] 14785: X67594 H.sapiens mRNA for MSH receptor gi|1405733|emb|X67594.1|HSMSHRECA[1405733]

[7320] 14786: X96597 H.sapiens gene encoding G protein coupled receptor gi|1296631|emb|X96597.1|HSGPCRE[1296631]

[7321] 14789: M88714 Human bradykinin receptor (BK-2) mRNA, complete cds gi|1387999|gb|M88714.1|HUMBK2A[1387999]

[7322] 14790: AH003589 Homo sapiens sulfonylurea receptor (SUR1) gene gi|1374918|gb|AH003589.1|SEG_HUMSUR1G[1374918]

[7323] 14791: L78243 Homo sapiens sulfonylurea receptor (SUR1) gene, exon 39 gi|1374917|gb|L78243.1|HUMSUR1G38[1374917]

[7324] 14792: L78242 Homo sapiens sulfonylurea receptor (SUR1) gene, exon 38 gi|1374916|gb|L78242.1|HUMSUR1G37[1374916]

[7325] 14793: L78241 Homo sapiens sulfonylurea receptor (SUR1) gene, exon 37 gi|1374915|gb|L78241.1|HUMSUR1G36[1374915]

[7326] 14794: L78240 Homo sapiens sulfonylurea receptor (SUR1) gene, exons 34, 35, and 36 gi|1374914|gb|L78240.1|HUMSUR1G35[1374914]

[7327] 14795: L78239 Homo sapiens sulfonylurea receptor (SUR1) gene, exon 33 gi|1374913|gb|L78239.1|HUMSUR1G34[1374913]

[7328] 14796: L78238 Homo sapiens sulfonylurea receptor (SUR1) gene, exon 32 gi|1374912|gb|L78238.1|HUMSUR1G33[1374912]

[7329] 14797: L78237 Homo sapiens sulfonylurea receptor (SUR1) gene, exon 31 gi|1374911|gb|L78237.1|HUMSUR1G32[1374911]

[7330] 14798: L78236 Homo sapiens sulfonylurea receptor (SUR1) gene, exon 30 gi|1374910|gb|L78236.1|HUMSUR1G31[1374910]

[7331] 14799: L78235 Homo sapiens sulfonylurea receptor (SUR1) gene, exon 29 gi|1374909|gb|L78235.1|HUMSUR1G30[1374909]

[7332] 14800: L78234 Homo sapiens sulfonylurea receptor (SUR1) gene, exon 28 gi|1374908|gb|L78234.1|HUMSUR1G29[1374908]

[7333] 14801: L78233 Homo sapiens sulfonylurea receptor (SUR1) gene, exon 27 gi|1374907|gb|L78233.1|HUMSUR1G28[1374907]

[7334] 14802: L78232 Homo sapiens sulfonylurea receptor (SUR1) gene, exon 26 gi|1374906|gb|L78232.1|HUMSUR1G27[1374906]

[7335] 14803: L78231 Homo sapiens sulfonylurea receptor (SUR1) gene, exon 25 gi|1374905|gb|L78231.1|HUMSUR1G26[1374905]

[7336] 14804: L78230 Homo sapiens sulfonylurea receptor (SUR1) gene, exon 24 gi|1374904|gb|L78230.1|HUMSUR1G25[1374904]

[7337] 14805: L78229 Homo sapiens sulfonylurea receptor (SUR1) gene, exon 23 gi|1374903|gb|L78229.1|HUMSUR1G24[1374903]

[7338] 14806: L78228 Homo sapiens sulfonylurea receptor (SUR1) gene, exon 22 gi|1374902|gb|L78228.1|HUMSUR1G23[1374902]

[7339] 14807: L78227 Homo sapiens sulfonylurea receptor (SUR1) gene, exon 21 gi|1374901|gb|L78227.1|HUMSUR1G22[1374901]

[7340] 14808: L78226 Homo sapiens sulfonylurea receptor (SUR1) gene, exon 20 gi|1374900|gb|L78226.1|HUMSUR1G21[1374900]

[7341] 14809: L78254 Homo sapiens sulfonylurea receptor (SUR1) gene, exon 19 gi|1374899|gi|L78254.1|HUMSUR1G20[1374899]

[7342] 14810: L78225 Homo sapiens sulfonylurea receptor (SUR1) gene, exon 18 gi|1374898|gb|L78225.1|HUMSUR1G19[1374898]

[7343] 14811: L78224 Homo sapiens sulfonylurea receptor (SUR1) gene, exon 17 (alternative) gi|1374897|gb|L78224.1|HUMSUR1G18[1374897]

[7344] 14812: L78223 Homo sapiens sulfonylurea receptor (SUR1) gene, exon 17 gi|1374896|gb|L78223.1|HUMSUR1G17[1374896]

[7345] 14813: L78222 Homo sapiens sulfonylurea receptor (SUR1) gene, exon 16 gi|1374895|gi|L78222.1|HUMSUR1G16[1374895]

[7346] 14814: L78221 Homo sapiens sulfonylurea receptor (SUR1) gene, exon 15 gi|1374894|gb|L78221.1|HUMSUR1G15[1374894]

[7347] 14815: L78220 Homo sapiens sulfonylurea receptor (SUR1) gene, exon 14 gi|1374893|gb|L78220.1|HUMSUR1G14[1374893]

[7348] 14816: L78219 Homo sapiens sulfonylurea receptor (SUR1) gene, exon 13 gi|1374892|gi|L78219.1|HUMSUR1G13[1374892]

[7349] 14817: L78218 Homo sapiens sulfonylurea receptor (SUR1) gene, exon 12 gi|1374891|gi|L78218.1|HUMSUR1G12[1374891]

[7350] 14818: L78217 Homo sapiens sulfonylurea receptor (SUR1) gene, exon 11 gi|1374890|gb|L78217.1|HUMSUR1G11[1374890]

[7351] 14819: L78216 Homo sapiens sulfonylurea receptor (SUR1) gene, exon 10 gi|1374889|gb|L78216.1|HUMSUR1G10[1374889]

[7352] 14820: L78215 Homo sapiens sulfonylurea receptor (SUR1) gene, exon 9 gi|1374888|gb|L78215.1|HUMSUR1G09[1374888]

[7353] 14821: L78214 Homo sapiens sulfonylurea receptor (SUR1) gene, exon 8 gi|1374887|gb|L78214.1|HUMSUR1G08[1374887]

[7354] 14822: L78213 Homo sapiens sulfonylurea receptor (SUR1) gene, exon 7 gi|1374886|gb|L78213.1|HUMSUR1G07[1374886]

[7355] 14823: L78255 Homo sapiens sulfonylurea receptor (SUR1) gene, exon 6 gi|1374885|gb|L78255.1|HUMSUR1G06[1374885]

[7356] 14824: L78212 Homo sapiens sulfonylurea receptor (SUR1) gene, exon 5 gi|1374884|gb|L78212.1|HUMSUR1G05[1374884]

[7357] 14825: L78211 Homo sapiens sulfonylurea receptor (SUR1) gene, exon 4 gi|1374883|gb|L78211.1|HUMSUR1G04[1374883]

[7358] 14826: L78210 Homo sapiens sulfonylurea receptor (SUR1) gene, exon 3 gi|1374882|gb|L78210.1|HUMSUR1G03[1374882]

[7359] 14827: L78209 Homo sapiens sulfonylurea receptor (SUR1) gene, exon 2 gi|1374881|gb|L78209.1|HUMSUR1G02[1374881]

[7360] 14828: L78208 Homo sapiens sulfonylurea receptor (SUR1) gene, exon 1 gi|1374880|gb|L78208.1|HUMSUR1G01[1374880]

[7361] 14829: L78207 Homo sapiens sulfonylurea receptor (SUR1) mRNA, complete cds gi|1374674|gb|L78207.1|HUMSUR1RNA[1374674]

[7362] 14830: X80818 H.sapiens mRNA for metabotropic glutamate receptor type 4 gi|1160182|emb|X80818.1|HSMGLUR4[1160182]

[7363] 14831: X89068 H.sapiens mRNA for TRPC3 protein gi|1019789|emb|X89068.1|HSTRPC3GN[1019789]

[7364] 14832: X85740 H.sapiens mRNA for C-C chemokine receptor-4 gi|1370103|emb|X85740.1|HSCCCR3[1370103]

[7365] 14833: X72924 H.sapiens STS in the vicinity of the ADRA2C gene, sequence tagged site gi|458814|emb|X72924.1|HSADRASTS[458814]

[7366] 14834: A27282 H.sapiens TGR-CL3C gi|1247129|emb|A27282.1|A27282[1247129]

[7367] 14835: A27278 H.sapiens TGR-CL5 gi|1247127|emb|A27278.1|A27278[1247127]

[7368] 14836: A27276 H.sapiens TGR-CL1 gi|1247125|emb|A27276.1|A27276[1247125]

[7369] 14837: A27270 H.sapiens TGR-CL10C gi|1247123|emb|A27270.1|A27270[1247123]

[7370] 14838: A10542 H.sapiens low affinity Fc-epsilon-receptor gi|489152|emb|A10542.1|A10542[489152]

[7371] 14839: X84700 H.sapiens mRNA for leucocyte antigen CD97 gi|840770|emb|X84700.1|HSCD97[840770]

[7372] 14841: X56794 H.sapiens CD44R mRNA gi|29798|emb|X56794.1|HSCD441[29798]

[7373] 14842: Z22924 H.sapiens of CD36 gene, partial CDS gi|397604|emb|Z22924.1|HSCD36AA[397604]

[7374] 14843: X81121 H.sapiens mRNA for central cannabinoid receptor, short isoform gi|736238|emb|X81121.1|HSCB1A[736238]

[7375] 14844: X74328 H.sapiens mRNA for CB2 (peripheral) cannabinoid receptor gi|407806|emb|X74328.1|HSCB2CANR[407806]

[7376] 14852: X81120 H.sapiens mRNA for central cannabinoid receptor gi|736236|emb|X81120.1|HSCANN6[736236]

[7377] 14853: X82466 H.sapiens mRNA for calcitonin receptor gi|565026|emb|X82466.1|HSCALRECR[565026]

[7378] 14854: X69920 H.sapiens mRNA for calcitonin receptor gi|474931|emb|X69920.1|HSCALRE[474931]

[7379] 14855: Z22672 H.sapiens cacnl1a3 gene encoding skeletal muscle dhp-receptor alpha 1 subunit gi|297467|emb|Z22672.1|HSCACN1A[297467]

[7380] 14856: Z35761 H.sapiens TEL/ABL fusion protien gi|601903|emb|Z35761.1|HSBREAKP3 [601903]

[7381] 14862: X62515 H.sapiens mRNA for basement membrane heparan sulfate proteoglycan gi|29469|emb|X62515.1|HSBMHSP[29469]

[7382] 14887: X70811 H.sapiens mRNA for beta 3 adrenergic receptor gi|312396|emb|X70811.1|HSBARE[312396]

[7383] 14888: X69117 H.sapiens mRNA for beta-adrenergic kinase 2 gi|312394|emb|X69117.1|HSBADRK2[312394]

[7384] 14889: X61157 H.sapiens mRNA for beta-adrenergic receptor kinase gi|288307|emb|X61157.1|HSBARK[288307]

[7385] 14891: X77584 H.sapiens mRNA for ATL-derived factor/thiredoxin gi|453963|emb|X77584.1|HSATLRED[453963]

[7386] 14894: X70297 H.sapiens mRNA for neuronal nicotinic acetylcholine receptor alpha-7 subunit gi|496606|emb|X70297.1|HSARA7A[496606]

[7387] 14901: Z11162 H.sapiens gene for angiotensin II gi|28709|emb|Z11162.1|HSANTENII[28709]

[7388] 14902: X91162 H.sapiens anti-mullerian hormone type II receptor exon 9 gi|1107682|emb|X91162.1|HSAMREX09[1107682]

[7389] 14903: X91164 H.sapiens anti-mullerian hormone type II receptor exon 11 gi|11076811emb|X91164.1|HSAMREX11[1107681]

[7390] 14904: X91163 H.sapiens anti-mullerian hormone type II receptor exon 10 gi|1107680|emb|X91163.1|HSAMREX10[1107680]

[7391] 14905: X91161 H.sapiens anti-mullerian hormone type II receptor exon 8 gi|1107679|emb|X91161.1|HSAMREX08[1107679]

[7392] 14906: X91160 H.sapiens anti-mullerian hormone type II receptor exon 7 gi|1107678|emb|X91160.1|HSAMREX07[1107678]

[7393] 14907: X91159 H.sapiens anti-mullerian hormone type II receptor exon 6 gi|1107677|emb|X91159.1|HSAMREX06[1107677]

[7394] 14908: X91158 H.sapiens anti-mullerian hormone type II receptor exon 5 gi|1107676|emb|X91158.1|HSAMREX05[1107676]

[7395] 14909: X91157 H.sapiens anti-mullerian hormone type II receptor exon 4 gi|1107675|emb|X91157.1|HSAMREX04[1107675]

[7396] 14910: X91165 H.sapiens anti-mullerian hormone type II receptor exon 3 gi|1107674|emb|X91165.1|HSAMREX03[1107674]

[7397] 14911: X91166 H.sapiens anti-mullerian hormone type II receptor exon 2 gi|1107673|emb|X91166.1|HSAMREX02[1107673]

[7398] 14912: X65699

[7399] H.sapiens mRNA for angiotensin II receptor gi|510983|emb|X65699.1|HSANGII[510983]

[7400] 14913: X91156 H.sapiens anti-mullerian hormone type II receptor exon 1 gi|1107671|emb|X91156.1|HSAMREX01[1107671]

[7401] 14914: Z22533 H.sapiens ALK-1 mRNA gi|14021961|emb|Z22533.1|HSALK1A[402196]

[7402] 14915: Z22536 Homo sapiens ALK-4 mRNA, complete CDS gi|4021881|emb |Z22536.1|HSALK4A[402188]

[7403] 14916: Z22535 H.sapiens ALK-3 mRNA gi|4021861|emb|Z22535.1|HSALK3A [402186]

[7404] 14917: Z22534 H.sapiens ALK-2 mRNA gi|4021841|emb|Z22534.1|HSALK2A [402184]

[7405] 14918: X59684 H.sapiens DNA for alpha2-1.8 adrenergic receptor gene gi|28635|emb|X59684.1|HSALPH218[28635]

[7406] 14919: Z11687 H.sapiens mRNA for antidiuretic hormone receptor gi|28417|emb|Z11687.1|HSADHRMR[28417]

[7407] 14920: X77533 H.sapiens mRNA for activin type II receptor gi|825619|emb|X77533.1|HSACTIIRE[825619]

[7408] 14921: X62381 H.sapiens mRNA for activin receptor gi|28347|emb|X62381.1|HSACTR[28347]

[7409] 14922: X65633 H.sapiens ACTH-R gene for adrenocorticotropic hormone receptor gi|28343|emb|X65633.1|HSACTHR[28343]

[7410] 14923: X55019 H.sapiens mRNA for acetylcholine receptor delta subunit gi|297401|emb|X55019.1|HSACHRG[29740]

[7411] 14924: X02508 H.sapiens gene fragment for acetylcholine receptor (AChR) alpha subunit exons 8, 9 and 3′ flanking region gi|28306|emb|X02508.1|HSACHR8[28306]

[7412] 14925: X02507 H.sapiens gene fragment for acetylcholine receptor (AChR) alpha subunit exon 7 gi|28304|emb|X02507.1|HSACHR7[28304]

[7413] 14926: X02506 H.sapiens gene fragment for acetylcholine receptor (AChR) alpha-subunit exon 6 gi|28302|emb|X02506.1|HSACHR6[28302]

[7414] 14927: X83956 H.sapiens ACCA gene gi|1061125|emb|X83956.1|HSACCAGEN[1061125]

[7415] 14928: X66403 H.sapiens mRNA for acetylcholine receptor (epsilon subunit) gi|560152|emb|X66403.1|HSACETR[560152]

[7416] 14929: X02505 H.sapiens gene fragment for acetylcholine receptor (AChR) alpha subunit exon 5 gi|28300|emb|X02505.1|HSACHR5[28300]

[7417] 14930: X02504 H.sapiens gene fragment for acetylcholine receptor (AChR) alpha-subunit exon 4 gi|28298|emb|X02504.1|HSACHR4[28298]

[7418] 14931: X02503 H.sapiens gene fragment for acetylcholine receptor (AChR) alpha-subunit exons 2 and 3 gi|28293|emb|X02503.1|HSACHR2[28293]

[7419] 14932: X02502 H.sapiens gene fragment for acetylcholine receptor (AChR) alpha-subunit exon 1 gi|28291|emb|X02502.1|HSACHR[28291]

[7420] 14933: X04759 H.sapiens gene fragment for the acetylcholine receptor gamma subunit (exon 12 gi|28288|emb|X04759.1|HSACHG8[28288]

[7421] 14934: X01721 H.sapiens gene fragment for the acetylcholine receptor gamma subunit (exons 10 and 11) gi|28286|emb|X01721.1|HSACHG7[28286]

[7422] 14935: X01720 H.sapiens gene fragment for the acetylcholine receptor gamma subunit (exon 9) gi|28283|emb|X01720.1|HSACHG6[28283]

[7423] 14936: X01718 H.sapiens gene fragment for the acetylcholine receptor gamma subunit (exon 6) gi|28276|emb|X01718.1|HSACHG4[28276]

[7424] 14937: X01717 H.sapiens gene fragment for the acetylcholine receptor gamma subunit (exon 5) gi|28274|emb|X01717.1|HSACHG3[28274]

[7425] 14938: X01716 H.sapiens gene fragment for the acetylcholine receptor gamma subunit (exon 3 and 4) gi|28271|emb|X01716.1|HSACHG2[28271]

[7426] 14939: X77018 H.sapiens mRNA for anti-acetylcholine receptor monoclonal autoantibody V lambda region gi|441251|emb|X77018.1|HSAARMA2[441251]

[7427] 14941: X68487 H.sapiens mRNA for A2b adenosine receptor gi|400453|emb|X68487.1|HSA2BREC[400453]

[7428] 14942: X68486 H.sapiens mRNA for A2a adenosine receptor gi|400451|emb|X68486.1|HSA2AREC[400451]

[7429] 14943: X68485 H.sapiens mRNA for A1 adenosine receptor gi|400449|emb|X68485.1|HSA1ADREC[400449]

[7430] 14948: X87197 H.sapiens mRNA for 6.3 gene gi|854083|emb|X87197.1|HS63MRNAG[854083]

[7431] 14949: X81412 H.sapiens DNA for 5-HT5A exon2 gi|541777|emb|X81412.1|HS5HT5A2[541777]

[7432] 14950: X81411 H.sapiens DNA for 5-HT5A exon1 gi|541776|emb|X81411.1|HS5HT5A1[541776]14952: X77307 H.sapiens mRNA for 5-HT2B serotonin receptor gi|475197|emb|X77307.1|HS5HT2BSR[475197]

[7433] 14968: X75299 H.sapiens HIVR mRNA for vasoactive intestinal peptide (VIP) receptor gi|407461|emb|X75299.1|HSVIPRE[407461]

[7434] 14969: X94216 H.sapiens mRNA for VEGF-C protein gi|1177488|emb|X94216.1|HSVEGFC[1177488]

[7435] 14971: X67482 H.sapiens mRNA for 1,25-dihydroxyvitamin D-3 receptor gi|37653|emb|X67482.1|HSVD3R[37653]

[7436] 14976: Z46797 H.sapiens gene for urokinase receptor (partial) gi|732804|emb|Z46797.1|HSUPAR5[732804]

[7437] 14977: X74039 H.sapiens mRNA for urokinase plasminogen activator receptor gi|456192|emb|X74039.1|HSUPAR[456192]

[7438] 14984: X51675 H.sapiens urokinase plasminogen activator surface receptor (uPAR) mRNA gi|37604|emb|X51675.1|HSUPARAA[37604]

[7439] 14985: X76498 H.sapiens gene for uterine bombesin receptor gi|468753|emb|X76498.1|HSUBR[468753]

[7440] 14986: X66029 H.sapiens mRNA for tyrosine kinase receptor gi|37596|emb|X66029.1|HSUFOR[37596]

[7441] 14987: X66030 Homo sapiens partial ufo gene encoding tyrosine kinase receptor gi|37594|emb|x66030.1|HSUFOD[37594]

[7442] 14998: X72089 H.sapiens mRNA for TRH receptor gi|440155|emb|X72089.1|HSTRHREC[440155]

[7443] 15005: X72018 H.sapiens hTGR 1 mRNA gi|1200088|emb|X72018.1|HSTGR1[1200088]

[7444] 15006: X69178 H.sapiens mRNA for thyrotropin receptor, partial gi|288212|emb|X69178.1|HSTHREC[288212]

[7445] 15007: X69177 H.sapiens mRNA for thyrotropin receptor, partial gi|288211|emb|X69177.1|HSTHRE[288211]

[7446] 15246: X65181 H.sapiens gene for substance P receptor (exon 5) gi|36640|emb|X65181.1|HSSUBP5G[36640]

[7447] 15247: X65180 H.sapiens gene for substance P receptor (exon 4) gi|36639|emb|X65180.1|HSSUBP4G[36639]

[7448] 15248: X65179 H.sapiens gene for substance P receptor (exon 3) gi|36638|emb|X65179.1|HSSUBP3G[36638]

[7449] 15249: X65177 H.sapiens gene for substance P receptor (exon 1) gi|36636|emb|X65177.1|HSSUBP1G[36636]

[7450] 15253: X62156 H.sapiens mRNA for soluble interleukin-5 receptor gi|36465|emb|X62156.1|HSSILR5[36465]

[7451] 15254: X57830 H.sapiens serotonin 5-HT2 receptor mRNA gi|36430|emb|X57830.1|HSSERR52[36430]

[7452] 15255: Z11166 H.sapiens S31 gene for serotonin receptor gi|36264|emb|Z11166.1|HSS31G[36264]

[7453] 15256: X91869 H.sapiens mRNA for ryanodine receptor gi|1022320|emb|X91869.1|HSRYR2[1022320]

[7454] 15257: X74269 H.sapiens RYR3 mRNA for ryanodine receptor type 3 (partial) gi|405718|emb|X74269.1|HSRYR3MR[405718]

[7455] 15258: X74270 H.sapiens RYR3 gene for ryanodine receptor type 3 (partial) gi|405716|emb|X74270.1|HSRYR3G[405716]

[7456] 15261: Z27409 H.sapiens mRNA for receptor tyrosine kinase eph (partial) gi|482916|emb|Z27409.1|HSRTKEPH[482916]

[7457] 15262: X74764 H.sapiens mRNA for receptor protein tyrosine kinase gi|433337|emb|X74764.1|HSRPTK[433337]

[7458] 15265: X59155 H.sapiens retroviral receptor mRNA gi|36160|emb|X59155.1|HSRRMRNA[36160]

[7459] 15267: X70040 H.sapiens RON mRNA for tyrosine kinase gi|36109|emb|X70040.1|HSRON[36109]

[7460] 15268: X75071 H.sapiens mRNA for human thyrotropin-releasing hormone receptor gi|404157|emb|X75071.1|HSRNAHTRH[404157]

[7461] 15269: X86446 H.sapiens mRNA for 55.11 binding protein gi|1008088|emb|X86446.1|HSRNA5511[1008088]

[7462] 15270: Z29093 H.sapiens EDDR1 gene for receptor tyrosine kinase gi|732799|emb|Z29093.1|HSRETYK1[732799]

[7463] 15274: X64123 H.sapiens PVR gene for poliovirus receptor (exon 8) gi|35819|emb|X64123.1|HSPVR8G[35819]

[7464] 15275: X64122 H.sapiens PVR gene for poliovirus receptor (exon 7) gi|35818|emb|X64122.1|HSPVR7G[35818]

[7465] 15276: X64121 H.sapiens PVR gene for poliovirus receptor (exon 6) gi|35817|emb|X64121.1|HSPVR6G[35817]

[7466] 15277: X64120 H.sapiens PVR gene for poliovirus receptor (exon 5) gi|35816|emb|X64120.1|HSPVR5G[35816]

[7467] 15278: X64119 H.sapiens PVR gene for poliovirus receptor (exon 4) gi|35815|emb|X64119.1|HSPVR4G[35815]

[7468] 15279: X64118 H.sapiens PVR gene for poliovirus receptor (exon 3) gi|35814|emb|X64118.1|HSPVR3G[35814]

[7469] 15280: X64117 H.sapiens PVR gene for poliovirus receptor (exon 2) gi|35813|emb|X64117.1|HSPVR2G[35813]

[7470] 15281: X64116 H.sapiens PVR gene for poliovirus receptor (exon 1) gi|35809|emb|X64116.1|HSPVR1G[35809]

[7471] 15283: X75208 H.sapiens HEK2 mRNA for protein tyrosine kinase receptor gi|406867|emb|X75208.1|HSPTKR[406867]

[7472] 15284: X65178 H.sapiens gene for substance P receptor (exon 2) gi|35653|emb|X65178.1|HSPREC2G[35653]

[7473] 15285: X94226 H.sapiens poliovirus receptor gene gi|1185121|emb|X94226.1|HSPOLR[1185121]

[7474] 15288: X73079 Homo sapiens encoding Polymeric immunoglobulin receptor gi|4563451|emb|X73079.1|HSPIR[456345]

[7475] 15291: X68596 H.sapiens mRNA for parathyroid hormone receptor gi|396812|emb|X68596.1|HSPHR[396812]

[7476] 15302: X76079 H.sapiens mRNA for platelet derived growth factor alpha receptor gi|433494|emb|X76079.1|HSPDGF[433494]

[7477] 15311: Z49993 H.sapiens partial gene for proteinase-activated receptor 2 (292 BP) gi|1008084|emb|Z49993.1|HSPAR2A[1008084]

[7478] 15321: X80022 H.sapiens p75 TNF receptor, exon 2 gi|666045|emb|X80022.1|HSP75NFR2[666045]

[7479] 15322: X80021 H.sapiens p75 TNF receptor, exon 1 gi|666044|emb|X80021.1|HSP75NFR1[666044]

[7480] 15323: X69810 H.sapiens gene for p55 tumor necrosis factor receptor, exon 1 gi|288493|emb|X69810.1|HSP55TNF[288493]

[7481] 15324: X83688 H.sapiens mRNA for ATP receptor gi|1166437|emb|X83688.1|HSP2XRCPR[1166437]

[7482] 15325: X77130 H.sapiens mRNA for ORL1 receptor gi|471316|emb|X77130.1|HSORL1[471316]

[7483] 15327: X71635 H.sapiens mRNA for neuropeptide Y-like receptor gi|297099|emb|X71635.1|HSNPYRLA[297099]

[7484] 15328: X71445 H.sapiens partial NTRK1 gene, involved in oncogenic rearrangements gi|296536|emb|X71445.1|HSNTRK1[296536]

[7485] 15329: X66945 H.sapiens N-sam mRNA for fibroblast growth factor receptor gi|35109|emb|X66945.1|HSNSAMTK[35109]

[7486] 15330: X75918 H.sapiens mRNA for NOT gi|415822|emb|X75918.1|HSNOT[415822]

[7487] 15331: Z32774 H.sapiens gene for N-methyl-D-aspartate receptor R1 exons 6-21 gi|807894|emb|Z32774.1|HSNMDAR1C[807894]

[7488] 15332: Z32773 H.sapiens gene for N-methyl-D-aspartate receptor R1 exons 3, 4, 5 gi|807893|emb|Z32773.1|HSNMDAR1B[807893]

[7489] 15333: Z32772 H.sapiens gene for N-methyl-D-aspartate receptor RI, exon1, exon2 gi|807892|emb|Z32772.1|HSNMDAR1A[807892]

[7490] 15334: X68275 H.sapiens mRNA for nicotinic receptor beta 4 subunit gi|35054|emb|X68275.1|HSNICRB[35054]

[7491] 15335: X65176 H.sapiens gene for neuromedin K receptor (exon 5) gi|35027|emb|X65176.1|HSNEURK5[35027]

[7492] 15336: X65175 H.sapiens gene for neuromedin K receptor (exon 4) gi|35026|emb|X65175.1|HSNEURK4[35026]

[7493] 15337: X65174 H.sapiens gene for neuromedin K receptor (exon 3) gi|35025|emb|X65174.1|HSNEURK3[35025]

[7494] 15338: X65173 H.sapiens gene for neuromedin K receptor (exon 2) gi|35024|emb|X65173.1|HSNEURK2[35024]

[7495] 15339: X65172 H.sapiens gene for neuromedin K receptor (exon 1) gi|35022|emb|X65172.1|HSNEURK1[35022]

[7496] 15340: X87629 H.sapiens mRNA for nicotinic acetylcholine receptor alpha4 subunit gi|854158|emb|X87629.1|HSNACRA4G[854158]

[7497] 15341: X70108 H.sapiens gene for nicotinic acetylcholine receptor alpha subunit, partial gi|312470|emb|X70108.1|HSNACHRA[312470]

[7498] 15342: X67513 H.sapiens mRNA for neuronal nAChR beta-3 subunit gi|34987|emb|X67513.1|HSNACHRB3[34987]

[7499] 15343: X53559 H.sapiens Hachr alpha-3 mRNA for mature neuronal nicotinic acetylcholine receptor alpha-3 subunit gi|34985|emb|X53559.1|HSNACHRA3[34985]

[7500] 15344: X63131 H.sapiens My1 (PML) mRNA gi|34813|emb|X63131.1|HSMY1[34813]

[7501] 15345: X65634 H.sapiens MSH-R gene for melanocyte stimulating hormone receptor gi|34790|emb|X65634.1|HSMSHR[34790]

[7502] 15346: X64878 H.sapiens mRNA for oxytocin receptor gi|34764|emb|X64878.1|HSMRNAOXY[34764]

[7503] 15347: X84709 H.sapiens mRNA for mediator of receptor-induced toxicity gi|791037|emb|X84709.1|HSMRINTX[791037]

[7504] 15348: X55635 H.sapiens mRNA for macrophage mannose receptor gi|34702|emb|X55635.1|HSMMR[34702]

[7505] 15349: Z25470 H.sapiens melanocortin 5 receptor gene, complete CDS gi|939924|emb|Z25470.1|HSMELRECA[939924]

[7506] 15350: X68829 H.sapiens mRNA for MDR15 protein gi|840783|emb|X68829.1|HSMDCR[840783]

[7507] 15351: X61615 H.sapiens mRNA for leukemia inhibitory factor (LIF) receptor gi|34365|emb|X61615.1|HSLIFR[34365]

[7508] 15374: X86128 H.sapiens mRNA for ood T lymphocyte gi|1197254|emb|X86128.1|HSLAB2725[1197254]

[7509] 15375: Z30428 H.sapiens gene for early lymphocyte activation antigen CD69, exon 5 gi|536775|emb|Z30428.1|HSLACD695[536775]

[7510] 15376: Z30430 H.sapiens gene for early lymphocyte activation antigen CD69, exon 2 gi|535122|emb|Z30430.1|HSLACD692[535122]

[7511] 15398: X69304 H.sapiens KIT proto-oncogene for mast/stem cell growth factor receptor, exon gi|34093|emb|X69304.1|HSKITPO04[34093]

[7512] 15399: X69303 H.sapiens KIT proto-oncogene for mast/stem cell growth factor receptor, exon gi|34092|emb|X69303.1|HSKITPO03[34092]

[7513] 15400: X69302 H.sapiens KIT proto-oncogene for mast/stem cell growth factor receptor, exon gi|34091|emb|X69302.1|HSKITPO02[34091]

[7514] 15401: X69301 H.sapiens KIT proto-oncogene for mast/stem cell growth factor receptor, exon gi|34089|emb|X69301.1|HSKITPO01[34089]

[7515] 15405: X03138 H.sapiens interleukin 2 receptor gene exon 8 and 3′ untranslated region gi|33830|emb|X03138.1|HSIL2RG8[33830]

[7516] 15406: X03137 H.sapiens interleukin 2 receptor gene exon 7 gi|33829|emb|X03137.1|HSIL2RG7[33829]

[7517] 15407: X03136 H.sapiens interleukin 2 receptor gene exon 6 gi|33827|emb|X03136.1|HSIL2RG6[33827]

[7518] 15408: X03135 H.sapiens interleukin 2 receptor gene exon 5 gi|33825|emb|X03135.1|HSIL2RG5[33825]

[7519] 15409: X03134 H.sapiens interleukin 2 receptor gene exon 4 gi|33823|emb|X03134.1|HSIL2RG4[33823]

[7520] 15410: X03133 H.sapiens interleukin 2 receptor gene exon 3 gi|33822|emb|X03133.1|HSIL2RG3[33822]

[7521] 15411: X03132 H.sapiens interleukin 2 receptor gene exon 2 gi|33820|emb|X03132.1|HSIL2RG2[33820]

[7522] 15412: X84348 H.sapiens mRNA for intracellular IL-1 receptor antagonist type II gi|1008970|emb|X84348.1|HSIL1RAII[1008970]

[7523] 15413: Z46595 H.sapiens mRNA for interleukin 11 receptor isoform (incomplete) gi|995655|emb|Z46595.1|HSIL11RR[995655]

[7524] 15414: Z38102 H.sapiens mRNA for interleukin-11 receptor gi|995653|emb|Z38102.1|HSIL11RM[995653]

[7525] 15415: Z46596 H.sapiens gene for interleukin 11 receptor gi|995652|emb|Z46596.1|HSIL11RGN[995652]

[7526] 15416: X59770 H.sapiens IL-1R2 mRNA for type II interleukin-1 receptor, (cell line CB23) gi|33796|emb|X59770.1|HSIL1R2II[33796]

[7527] 15421: X77722 H.sapiens mRNA for interferon alpha/beta receptor gi|488363|emb|X77722.1|HSIFNABR[488363]

[7528] 15423: X53296 H.sapiens mRNA for IRAP gi|32578|emb|X53296.1|HSI1RAP[325781

[7529] 15424: X52015 H.sapiens mRNA for interleukin-1 receptor antagonist gi|32576|emb|X52015.1|HSI1RA[32576]

[7530] 15425: X64993 H.sapiens mRNA HTPCRX19 for olfactory receptor gi|32523|emb|X64993.1|HSHTPRX19[32523]

[7531] 15426: X64992 H.sapiens mRNA HTPCRX18 for olfactory receptor gi|32522|emb|X64992.1|HSHTPRX18[32522]

[7532] 15427: X64991 H.sapiens mRNA HTPCRX17 for olfactory receptor gi|32521|emb|X64991.1|HSHTPRX17[32521]

[7533] 15428: X64990 H.sapiens mRNA HTPCRX16 for olfactory receptor gi|32520|emb|X64990.1|HSHTPRX16[32520]

[7534] 15429: X64989 H.sapiens mRNA HTPCRX15 for olfactory receptor gi|32519|emb|X64989.1|HSHTPRX15[32519]

[7535] 15430: X64988 H.sapiens mRNA HTPCRX14 for olfactory receptor gi|32518|emb|X64988.1|HSHTPRX14[32518]

[7536] 15431: X64987 H.sapiens mRNA HTPCRX13 for olfactory receptor gi|32517|emb|X64987.1|HSHTPRX13[32517]

[7537] 15432: X64986 H.sapiens mRNA HTPCRX12 for olfactory receptor gi|32516|emb|X64986.1|HSHTPRX12[32516]

[7538] 15433: X64985 H.sapiens mRNA HTPCRX11 for olfactory receptor gi|32515|emb|X64985.1|HSHTPRX11[32515]

[7539] 15434: X64984 H.sapiens mRNA HTPCRX10 for olfactory receptor gi|32514|emb|X64984.1|HSHTPRX10[32514]

[7540] 15435: X64983 H.sapiens mRNA HTPCRX09 for olfactory receptor gi|32513|emb|X64983.1|HSHTPRX09[32513]

[7541] 15436: X64982 H.sapiens mRNA HTPCRX06 for olfactory receptor gi|32512|emb|X64982.1|HSHTPRX06[32512]

[7542] 15437: X64981 H.sapiens mRNA HTPCRX03 for olfactory receptor gi|32511|emb|X64981.1|HSHTPRX03[32511]

[7543] 15438: X64980 H.sapiens mRNA HTPCRX02 for olfactory receptor gi|32510|emb|X64980.1|HSHTPRX02[32510]

[7544] 15439: X64979 H.sapiens mRNA HTPCRX01 for olfactory receptor gi|32509|emb|X64979.1|HSHTPRX01[32509]

[7545] 15440: X64974 H.sapiens mRNA HTPCRH02 for olfactory receptor gi|32508|emb|X64974.1|HSHTPRH02[32508]

[7546] 15441: X64978 H.sapiens mRNA HTPCRH07 for olfactory receptor gi|32507|emb|X64978.1|HSHTPRH07[32507]

[7547] 15442: X64977 H.sapiens mRNA HTPCRH06 for olfactory receptor gi|32506|emb|X64977.1|HSHTPRH06[32506]

[7548] 15443: X64976 H.sapiens mRNA HTPCRH04 for olfactory receptor gi|32505|emb|X64976.1|HSHTPRH04[32505]

[7549] 15444: X64975 H.sapiens mRNA HTPCRH03 for olfactory receptor gi|32504|emb|X64975.1|HSHTPRH03[32504]

[7550] 15445: X58288 H.sapiens hR-PTPu gene for protein tyrosine phosphatase gi|32455|emb|X58288.1|HSHRPTPU[32455]

[7551] 15449: X64995 H.sapiens HGMP07J gene for olfactory receptor gi|32092|emb|X64995.1|HSHGMP07J[32092]

[7552] 15450: X64994 H.sapiens HGMP07I gene for olfactory receptor gi|32085|emb|X64994.1|HSHGM071[32085]

[7553] 15451: X17653 H.sapiens hFcRII-C isoform mRNA for IgG Fc receptor hFcRII gi|32076|emb|X17653.1|HSHFCRIIC[32076]

[7554] 15452: X17652 H.sapiens hFcRII-B isoform mRNA for IgG Fc receptor hFcRII gi|32073|emb|X17652.1|HSHFCRIIB[32073]

[7555] 15453: X53364 H.sapiens HePTP mRNA for tyrosine phosphatase gi|32066|emb|X53364.1|HSHEPTP[32066]

[7556] 15454: X64830 H.sapiens mRNA for GLU-R2 glutamate receptor subunit, ‘flop’ exon gi|31911|emb|X64830.1|HSGRSFLOP[31911]

[7557] 15455: X64829 H.sapiens mRNA for GLU-R2 glutamate receptor subunit, ‘flop’ exon gi|31910|emb|X64829.1|HSGRSFLIP[31910]

[7558] 15456: X75897 H.sapiens mRNA for G-protein coupled kinase 4 gi|483764|emb|X75897.1|HSGRK4[483764]

[7559] 15460: X52009 H.sapiens alpha-1 strychnine binding subunit of inhibitory glycine receptor mRNA gi|31850|emb|X52009.1|HSGLYRA2[31850]

[7560] 15461: X52008 H.sapiens alpha-2 strychnine binding subunit of inhibitory glycine receptor mRNA gi|31848|emb|X52008.1|HSGLYRA1[31848]

[7561] 15462: X82068 H.sapiens mRNA for glutamate receptor subunit GluRC gi|558587|emb|X82068.1|HSGLURC[558587]

[7562] 15463: X58633 H.sapiens mRNA for glutamate receptor GLUR1 gi|414892|emb|X58633.1|HSGLUR1[414892]

[7563] 15464: X81832 H.sapiens mRNA for glucose-dependant insulinotropic polypeptide receptor gene gi|1030050|emb|X81832.1|HSGDIPR[1030050]

[7564] 15465: X61656 H.sapiens mRNA for growth factor receptor tyrosine kinase gi|31717|emb|X61656.1|HSGFRTK[31717]

[7565] 15466: X55037 H.sapiens GATA-3 mRNA gi|31661|emb|X55037.1|HSGATA3[31661]

[7566] 15467: X63670 H.sapiens DNA sequence for polymorphism at the GABA receptor B3 gi|31638|emb|X63670.1|HSGABRB3[31638]

[7567] 15472: Z34260 H.sapiens DNA for follicle stimulating hormone (FSH) receptor gi|1052701|emb|Z34260.1|HSFSHX1[1052701]

[7568] 15473: X68044 H.sapiens mRNA for follicle-stimulating hormone receptor gi|31473|emb|X68044.1|HSFSTHR[31473]

[7569] 15474: Z46619 H.sapiens mRNA for immunoglobulin kappa chain (fsa10) gi|575235|emb|Z46619.1|HSFSA10KA[575235]

[7570] 15475: Z46615 H.sapiens DNA for immunoglobulin kappa chain (fsa10 glk) gi|575234|emb|Z46615.1|HSFSA10GL[575234]

[7571] 15476: Z32633 H.sapiens FRGAMMA′ mRNA for folate receptor (817bp) gi|474060|emb|Z32633.1|HSFRGAM2[474060]

[7572] 15477: Z32564 H.sapiens FRGAMMA mRNA (819bp) for folate receptor gi|473235|emb|Z32564.1|HSFRGAM1[473235]

[7573] 15478: X69878 H.sapiens Flt4 mRNA for transmembrane tyrosine kinase gi|297049|emb|X69878.1|HSFLT4X[297049]

[7574] 15479: X68203 H.sapiens mRNA for FLT4, class III receptor tyrosine kinase gi|3l433|emb|X68203.1|HSFLT4[31433]

[7575] 15480: X62573 H.sapiens RNA for Fc receptor, TC9 gi|31339|emb|X62573.1|HSFCTC6[31339]

[7576] 15481: X66187 H.sapiens FceRI mRNA, partial CDS gi|396463|emb|X66187.1|HSFCERIGB[396463]

[7577] 15482: X62572 H.sapiens RNA for Fc receptor, PC23 gi|31328|emb|X62572.1|HSFCPC23[31328]

[7578] 15483: Z46618 H.sapiens mRNA for immunoglobulin lambda chain (f29) gi|575230|emb|Z46618.1|HSF29LAM[575230]

[7579] 15484: Z46634 H.sapiens mRNA for immunoglobulin kappa chain (f29) gi|575228|emb|Z46634.1|HSF29KAP[575228]

[7580] 15485: X61950 H.sapiens mRNA for endothelin-1 receptor gi|288312|emb|X61950.1|HSET1R[288312]

[7581] 15486: X83863 H.sapiens mRNA for prostaglandin E receptor (EP3f) gi|633219|emb|X83863.1|HSEP3F[633219]

[7582] 15487: X83862 H.sapiens mRNA for prostaglandin E receptor (EP3e) gi|633217|emb|X83862.1|HSEP3E[633217]

[7583] 15488: X83861 H.sapiens mRNA for prostaglandin E receptor (EP3d) gi|633215|emb|X83861.1|HSEP3D[633215]

[7584] 15489: X83860 H.sapiens mRNA for prostaglandin E receptor (EP3c) gi|633213|emb|X83860.1|HSEP3C[633213]

[7585] 15490: X83859 H.sapiens mRNA for prostaglandin E receptor (EP3b) gi|633211|emb|X83859.1|HSEP3B[633211]

[7586] 15491: X83858 H.sapiens mRNA for prostaglandin E receptor (EP3a2) gi|633209|emb|X83858.1|HSEP3A2[633209]

[7587] 15492: X83857 H.sapiens mRNA for prostaglandin E receptor (EP3a1) gi|633207|emb|X83857.1|HSEP3A1[633207]

[7588] 15493: X83868 H.sapiens mRNA for EP2 prostaglandin receptor gi|633205|emb|X83868.1|HSEP2PR[633205]

[7589] 15494: X81479 H.sapiens mRNA for EMR1 hormone receptor gi|784993|emb|X81479.1|HSEMR1[784993]

[7590] 15518: Z28613 H.sapiens (dhpa215) cacnl2a gene for dihydropyridine receptor alpha-2 subunit gi|472953|emb|Z28613.1|HSDPRA25[472953]

[7591] 15519: Z28609 H.sapiens (dhpa22hd) cacnl2a gene for dihydropyridine receptor alpha 2-subunit gi|472952|emb|Z28609.1|HSDPRA24[472952]

[7592] 15520: Z28605 H.sapiens (dhpa23) cacnl2a gene for dihydropyridine receptor alpha2 subunit gi|472951|emb|Z28605.1|HSDPRA23[472951]

[7593] 15521: Z28602 H.sapiens (dhpa2hb) cacnl2a gene for dihydropyridine receptor alpha 2-subunit gi|472950|emb|Z28602.1|HSDPRA22[472950]

[7594] 15522: Z28599 H.sapiens (a225eh) cacnl2a gene for dihydropyridine receptor alpha2 subunit gi|472949|emb|z28599.1|HSDPRA21[472949]

[7595] 15526: X55758 H.sapiens dopamine D1 receptor gene gi|288931|emb|X55758.1|HSDOPD1[288931]

[7596] 15529: Z23025 H.sapiens cacnl1a3 gene encoding skeletal muscle DHP-receptor alpha 1 subunit (exon) gi|312285|emb|Z23025.1|HSDHPRA1S[312285]

[7597] 15530: X84076 H.sapiens mRNA for DGCR2 gi|809021|emb|X84076.1|HSDGCR2[809021]

[7598] 15532: X63523 H.sapiens mRNA DAUDI6 3′-region gi|30449|emb|X63523.1|HSDAUDI63[30449]

[7599] 15533: X66171 H.sapiens CMRF35 mRNA, complete CDS gi|396169|emb|X66171.1|HSCMRF35A[396169]

[7600] 15534: Z23141 H.sapiens CHRNA7 mRNA, 3′ end gi|457736|emb|Z23141.1|HSCHRNA7A[457736]

[7601] 15550: X56777 H.sapiens mRNA for ZP3 gene gi|297790|emb|X56777.1|HSZP3G[297790]

[7602] 15551: X77155 H.sapiens genomic DNA (YAC end 63 with high affinity Fc-receptor for IgG) gi|450533|emb|X77155.1|HSYACFC[450533]

[7603] 15582: M31165 Human tumor necrosis factor-inducible (TSG-6) mRNA fragment, adhesion receptor CD44 putative CDS gi|339994|gb|M31165.1|HUMTSG6A[339994]

[7604] 15594: A31613 H.sapiens beta-adrenergic receptor gene gi|1247565|emb|A31613.1|A31613[1247565]

[7605] 15595: A29216 H.sapiens DNA for bFGF receptor from patent WO9111459 gi|1247528|emb|A29216.1|A29216[1247528]

[7606] 15596: A29103 H.sapiens mRNA for TNF-binding polypeptide from patent EP0393438 gi|1247517|emb|A29103.1|A29103[1247517]

[7607] 15597: A28489 H.sapiens mRNA for IL-2R-beta-chain from patent EP0395853 gi|1247509|emb|A28489.1|A28489[1247509]

[7608] 15598: A28003 H.sapiens HEK gene gi|1247486|emb|A28003.1|A28003[1247486]

[7609] 15599: A27284 H.sapiens TGR-CLH gi|1247482|emb|A27284.1|A27284[1247482]

[7610] 15600: A27280 H.sapiens TGR-CL3 gi|1247480|emb|A27280.1|A27280[1247480]

[7611] 15601: A27274 H.sapiens TGR-CL11/TGR-C15 gi|1247478|emb|A27274.1|A27274[1247478]

[7612] 15602: A27272 H.sapiens TGR-CL11 gi|1247476|emb|A27272.1|A27272[1247476]

[7613] 15603: A27268 H.sapiens TGR-CL10 gi|1247474|emb|A27268.1|A27268[1247474]

[7614] 15604: A27266 H.sapiens TGR-CL7 gi|1247472|emb|A27266.1|A27266[1247472]

[7615] 15605: A27264 H.sapiens TGR-CL6 gi|1247470|emb|A27264.1|A27264[1247470]

[7616] 15606: A27262 H.sapiens TGR-CL5bis gi|1247468|emb|A27262.1|A27262[1247468]

[7617] 15607: A27260 H.sapiens TGR-CL4 gi|1247466|emb|A27260.1|A27260[1247466]

[7618] 15608: A27258 H.sapiens TGR-CL1bis gi|1247464|emb|A27258.1|A27258[1247464]

[7619] 15609: A19671 H.sapiens DNA for D3 receptor fragment gi|579581|emb|A19671.1|A19671[579581]

[7620] 15610: A19670 H.sapiens DNA for D3 receptor fragment gi|579580|emb|A19670.1|A19670[579580]

[7621] 15611: A19667 H.sapiens gene for dopaminergic receptor D-3 gi|579578|emb|A19667.1|A19667[579578]

[7622] 15612: A09781 H.sapiens (clone 18-4-3) mRNA interferon-gamma receptor segment gi|412192|emb|A09781.1|A09781[412192]

[7623] 15613: A09779 H.sapiens (clone 15-21-1) mRNA for interferon-gamma receptor segment binding interferon-gamma gi|412190|emb|A09779.1|A09779[412190]

[7624] 15614: A07799 H.sapiens IL-2R-beta mRNA for interleukin-2 beta-chain gi|1247399|emb|A07799.1|A07799[1247399]

[7625] 15615: A07801 H.sapiens IL-2R-beta mRNA for interleukin-2 beta-chain gi|490067|emb|A07801.1|A07801[490067]

[7626] 15616: A07795 H.sapiens IL-2R-beta mRNA for interleukin-2 receptor beta-chain gi|412175|emb|A07795.1|A07795[412175]

[7627] 15617: L11573 Human surfactant protein B mRNA, complete cds gi|1220354|gb|L11573.1|HUMPSPBQ[1220354]

[7628] 15618: L40625 Homo sapiens sulfonylurea receptor (SUR) mRNA, 3′ end of cds gi|784881|gb|L40625.1|HUMSUR[784881]

[7629] 15620: L34579 Homo sapiens (clone HC1) angiotensin II type-2 receptor (AGTR2) gene, complete cds gi|510700|gb|L34579.1|HUMAIRS[510700]

[7630] 15621: X97058 H.sapiens mRNA for P2Y6 receptor gi|1296659|emb|X97058.1|HSP2Y6[1296659]

[7631] 15622: X96588 H.sapiens mRNA for H-RYK receptor tyrosine kinase gi|1296649|emb|X96588.1|HSHRYKG[1296649]

[7632] 15623: X80391 H.sapiens OR17-40 gene gi|516319|emb|X80391.1|HSOR1740[516319]

[7633] 15624: L41690 Homo sapiens TNF receptor-i associated protein (TRADD) mRNA, 3′ end of cds gi|808914|gb|L41690.1|HUMTRADD[808914]

[7634] 15630: X89746 H.sapiens mRNA for neuronal acetylcholine receptor alpha-4 subunit, exon 6 gi|1279464|emb|X89746.1|HSCHRNA46[1279464]

[7635] 15631: X89745 H.sapiens mRNA for neuronal acetylcholine receptor alpha-4 subunit, exon 5 gi|1279463|emb|X89745.1|HSCHRNA45[1279463]

[7636] 15632: X89743 H.sapiens mRNA for neuronal acetylcholine receptor alpha-4 subunit, exon 3 gi|1279461|emb|X89743.1|HSCHRNA43[1279461]

[7637] 15633: X89742 H.sapiens mRNA for neuronal acetylcholine receptor alpha-4 subunit, exon 2 gi|1279460|emb|X89742.1|HSCHRNA42[1279460]

[7638] 15634: X89741 H.sapiens mRNA for neuronal acetylcholine receptor alpha-4 subunit, exon 1 gi|1279458|emb|X89741.1|HSCHRNA41[1279458]

[7639] 15644: M21574 Human platelet-derived growth factor receptor alpha (PDGFRA) mRNA, complete cds gi|189733|gb|M21574.1|HUMPDGFRAA[189733]

[7640] 15645: X94635 H.sapiens CD97 gene exon 8 gi|4379070|emb|X94635.1|HSX94635[4379070]

[7641] 15646: X94638 H.sapiens CD97 gene exon 11 gi|1165091|emb|X94638.1|HSX94638[1165091]

[7642] 15647: X94637 H.sapiens CD97 gene exon 10 gi|1165090|emb|X94637.1|HSX94637[1165090]

[7643] 15648: X94636 H.sapiens CD97 gene exon 9 gi|1165089|emb|X94636.1|HSX94636[1165089]

[7644] 15649: X94631 H.sapiens CD97 gene exon 2 gi|1165084|emb|X94631.1|HSX94631[1165084]

[7645] 15650: X94646 H.sapiens CD97 gene exon 19 gi|1165082|emb|X94646.1|HSX94646[1165082]

[7646] 15651: X94645 H.sapiens CD97 gene exon 18 gi|1165081|emb|X94645.1|HSX94645[1165081]

[7647] 15652: X94644 H.sapiens CD97 gene exon 17 gi|1165080|emb|X94644.1|HSX94644[1165080]

[7648] 15653: X94643 H.sapiens CD97 gene exon 16 gi|1165079|emb|X94643.1|HSX94643[1165079]

[7649] 15654: X94642 H.sapiens CD97 gene exon 15 gi|1165078|emb|X94642.1|HSX94642[1165078]

[7650] 15655: X94641 H.sapiens CD97 gene exon 14 gi|1165077|emb|X94641.1|HSX94641[1165077]

[7651] 15656: X94640 H.sapiens CD97 gene exon 13 gi|1165076|emb|X94640.1|HSX94640[1165076]

[7652] 15657: X94639 H.sapiens CD97 gene exon 12 gi|1165075|emb|X94639.1|HSX94639[1165075]

[7653] 15658: L40949 Homo sapiens (clone AT7-5eu) opioid-receptor-like protein mRNA, 5′ end gi|725265|gb|L40949.1|HUMOPRLP[725265]

[7654] 15659: X57282 H.sapiens mRNA for soluble erythropoietin receptor gi|36426|emb|X57282.1|HSSER[36426]

[7655] 15660: Z66526 H.sapiens pancreatic polypeptide receptor PP1 gene gi|1107699|emb|Z66526.1|HSPP1GN[1107699]

[7656] 15661: X89013 H.sapiens gene for anti-mullerian hormone type II receptor gi|1212943|emb|X89013.1|HSDNAAMHI[1212943]

[7657] 15662: X86163 H.sapiens mRNA for B2-bradykinin receptor, 3 ′ gi|1220163|emb|X86163.1|HSB2BRRNA[1220163]

[7658] 15663: X86165 H.sapiens mRNA for B2-bradykinin receptor, R14 allele gi|1220160|emb|X86165.1|HSB2BRR14[1220160]

[7659] 15664: X86164 H.sapiens mRNA for B2-bradykinin receptor, C14 allele gi|1220155|emb|X86164.1|HSB2BRC14[1220155]

[7660] 15665: L08187 Human cytokine receptor (EBI3) mRNA, complete cds gi|632973|gb|L08187.1|HUMEBI3X[632973]

[7661] 15666: L41147 Homo sapiens 5-HT6 serotonin receptor mRNA, complete cds gi|1162923|gb|L41147.1|HUM5HSR[1162923]

[7662] 15698: X84755 H.sapiens LHCGR gene, exon 3 gi|1225986|emb|X84755.1|HSLHCGRX3[1225986]

[7663] 15699: L25829 Human platelet-derived growth factor alpha-receptor (PDGFRA) mRNA, exons 13-16 gi|1220351|gb|L25829.1|HUMPDGFRAX[1220351]

[7664] 15700: L07746 Human cholecystokinin B receptor (CCK-B) mRNA, complete cds gi|1220298|gb|L07746.1|HUMCCKBR[1220298]

[7665] 15701: X86172 H.sapiens B2-bradykinin receptor gene, exon 3, allele R48 gi|1220162|emb|X86172.1|HSB2BRR48[1220162]

[7666] 15702: X86180 H.sapiens B2-bradykinin receptor gene, promoter region and exon 1 gi|1220159|emb|X86180.1|HSB2BRPX1[1220159]

[7667] 15703: X86173 H.sapiens B2-bradykinin receptor gene, promotor region and exon 1 gi|1220158|emb|X86173.1|HSB2BREX1[1220158]

[7668] 15704: X86162 H.sapiens B2-bradykinin receptor gene, 3′ gi|1220157|emb|X86162.1|HSB2BRDNA[1220157]

[7669] 15705: X86171 H.sapiens B2-bradykinin receptor gene, exon 3, BE3-R43 allele gi|1220154|emb|X86171.1|HSB2BRBE3[1220154]

[7670] 15706: X86170 H.sapiens B2-bradykinin receptor gene, exon 2, T allele gi|1220153|emb|X86170.1|HSB2BRAXT[1220153]

[7671] 15707: X86168 H.sapiens B2-bradykinin receptor gene, exon 1, 3T allele gi|1220152|emb|X86168.1|HSB2BR3T[1220152]

[7672] 15708: X86167 H.sapiens B2-bradykinin receptor gene, exon 1, 3G allele gi|1220151|emb|X86167.1|HSB2BR3G[1220151]

[7673] 15709: X86166 H.sapiens B2-bradykinin receptor gene, exon 1, 2G allele gi|1220150|emb|X86166.1|HSB2BR2G[1220150]

[7674] 15710: Z69891 H.sapiens mRNA (clone ICRFp507G10101) gi|1213610|emb|Z69891.1|HSBRN3B2[1213610]

[7675] 15711: L18983 Homo sapiens tyrosine phosphatase (IA-2/PTP) mRNA, complete cds gi|662362|gb|L18983.1|HUMTYROPHO[662362]

[7676] 15712: L76224 Homo sapiens NMDA receptor mRNA, complete cds gi|1196448|gb|L76224.1|HUMNMRE[1196448]

[7677] 15715: M73481 Human gastrin releasing peptide receptor (GRPR) mRNA, complete cds gi|183649|gb|M73481.1|HUMGRPR[183649]

[7678] 15717: M30625 Human dopamine D2 receptor, mRNA, complete cds gi|181431|gb|M30625.1|HUMD2A[181431]

[7679] 15718: J02960 Human beta-2-adrenergic receptor gene, complete cds gi|178203|gb|J02960.1|HUMADRBRA[178203]

[7680] 15719: M15169 Human beta-2-adrenergic receptor mRNA, complete cds gi|178201|gi|M15169.1|HUMADRBR[178201]

[7681] 15720: L18973 Human acetylcholine receptor mRNA, partial cds gi|441143|gb|L18973.1|HUMACETYL[441143]

[7682] 15723: M73969 Human interleukin-8 receptor type B (IL8RB) mRNA, complete cds gi|186516|gb|M73969.1|HUMINTLEU8[186516]

[7683] 15752: L35233 Homo sapiens autocrine motility factor receptor (AMFR) mRNA, complete cds gi|521220|gb|L35233.1|HUMNGP78A[521220]

[7684] 15754: U35399 Human G protein-coupled receptor mRNA, complete cds gi|1015420|gb|U35399.1|HSU35399[1015420]

[7685] 15755: L35318 Human rearranged metabotropic glutamate receptor type II (GLUR2) mRNA, complete cds gi|999415|gb|L35318.1|HUMGLUR2A[999415]

[7686] 15756: M11730 Human tyrosine kinase-type receptor (HER2) mRNA, complete cds gi|183986|gb|M11730.1|HUMHER2A[183986]

[7687] 15759: U33017 Human signaling lymphocytic activation molecule (SLAM) mRNA, complete cds gi|984968|gb|U33017.1|HSU33017[984968]

[7688] 15761: L47220 Homo sapiens inositol triphosphate receptor type 1 gene fragment gi|976275|gi|L47220.1|HUMITRT1F[976275]

[7689] 15762: M37722 Human shorter form basic fibroblast growth factor (bFGF) receptor mRNA, complete cds gi|179413|gb|M37722.1|HUMBFGFS[179413]

[7690] 15765: L09753 Homo sapiens CD30 ligand mRNA, complete cds gi|349277|gb|L09753.1|HUMCD30[349277]

[7691] 15767: L36645 Homo sapiens receptor protein-tyrosine kinase (HEK8) mRNA, complete cds gi|551613|gb|L36645.1IHUMRPTKC[551613]

[7692] 15768: L36644 Homo sapiens receptor protein-tyrosine kinase (HEK7) mRNA, 3′ end gi|551611|gb|L36644.1|HUMRPTKB[551611]

[7693] 15769: L36643 Homo sapiens receptor protein-tyrosine kinase (HEK5) mRNA, 3′ end gi|551609|gb|L36643.1|HUMRPTKA[551609]

[7694] 15770: L36642 Homo sapiens receptor protein-tyrosine kinase (HEK11) mRNA, complete cds gi|551607|gb|L36642.1|HUMRPTK[551607]

[7695] 15771: L31581 Human G protein-coupled receptor (EBI 1) mRNA, complete cds gi|468319|gb|L31581.1|HUMEBI1CDN[468319]

[7696] 15772: L29301 Homo sapiens opioid receptor mRNA, complete cds gi|459831|gb|L29301.1|HUMOPIOIDA[459831]

[7697] 15773: L32831 Homo sapiens G protein-coupled receptor (GPR3) gene, complete cds gi|602311|gb|L32831.1|HUMGPCRD[602311]

[7698] 15774: L32830 Homo sapiens G protein-coupled receptor (GPR3) gene, exon gi|602310|gb|L32830.1|HUMGPCRC[602310]

[7699] 15775: M88461 Human neuropeptide Y peptide YY receptor mRNA, complete cds gi|189155|gb|M88461.1|HUMNEYPEPY[189155]

[7700] 15779: M73747 Homo sapiens thyroid stimulating hormone receptor (TSHR) mRNA, complete cds gi|903759|gi|M73747.1|HUMTSHR[903759]

[7701] 15780: M73746 Homo sapiens lutropin/choriogonadotropin receptor (LHCGR) mRNA, complete cds gi|903745|gb|M73746.1|HUMLHCGR[903745]

[7702] 15781: M90103 Human (clones 18, 23, 27, 24) c-myeloproliferative leukemia virus type K (c-mpl-K) mRNA, complete cds gi|184262|gb|M90103.1|HSHMPLK[184262]

[7703] 15782: M90102 Human (clones 15, 39, 41) c-myeloproliferative leukemia virus type P (c-mpl-P) mRNA, complete cds gi|184260|gb|M90102.1|HSHMPLP[184260]

[7704] 15796: M98512 Human NFG genomic fragment gi|292359|gb|M98512.1|HUMNF1FRAG[292359]

[7705] 15797: M98511 Human NFE genomic fragment gi|292358|gb|M98511.1|HUMNF1FRAE[292358]

[7706] 15798: M98510 Human NFC genomic fragment gi|292357|gb|M98510.1|HUMNF1FRAC[292357]

[7707] 15799: M98508 Human NFA genomic fragment gi|292355|gi|M98508.1|HUMNF1FRAA[292355]

[7708] 15801: L32662 Human prostaglandin E2 receptor EP3 subtype isoform IV mRNA, complete cds gi|484163|gb|L32662.1|HUMEP3IV[484163]

[7709] 15802: L32661 Human prostaglandin E2 receptor EP3 subtype isoform III mRNA, 3′ end gi|484161|gi|L32661.1IHUMEP3III[484161]

[7710] 15803: L32660 Human prostaglandin E2 receptor EP3 subtype isoform II mRNA, partial cds gi|484159|gb|L32660.1|HUMEP3II[484159]

[7711] 15822: L07594 Human transforming growth factor-beta type III receptor (TGF-beta) mRNA, complete cds gi|818001|gb|L07594.1|HUMTGFB3C[818001]

[7712] 15823: M83181 Human serotonin receptor gene, complete cds gi|808000gb|M83181.1|HUMHTRB[808000]

[7713] 15824: M33602 Human T-cell leukemia t(10:14)(q24:q11) chromosomal translocation gi|339907|gb|M33602.1|HUMTRANSX[339907]

[7714] 15828: L37112 Homo sapiens vasopressin V3 receptor mRNA, complete cds gi|791151|gb|L37112.1 HUMVVR[791151]

[7715] 15829: L35901 Human nicotinic acetylcholine receptor alpha 4 subunit (nAChR) mRNA, complete cds gi|755647|gb|L35901.1|HUMNACHR4A[755647]

[7716] 15830: U13666 Human G protein-coupled receptor (GPR1) gene, complete cds gi|577412|gb|U13666.1|HSU13666[577412]

[7717] 15831: L35903 Human dopamine D3 receptor gene, exon 6 gi|532478|gb|L35903.1|UMDOPD3OS2[532478]

[7718] 15832: L35902 Human dopamine D3 receptor gene, exon 5 gi|532477|gb|L35902.1|UMDOPD3OS1[532477]

[7719] 15833: L37362 Homo sapiens (clone d2-115) kappa opioid receptor (OPRK1) mRNA, complete cds gi|722617|gb|L37362.1|HUMOPRK1B[722617]

[7720] 15834: L35545 Homo sapiens endothelial cell protein C/APC receptor (EPCR) mRNA, complete cds gi|565267|gb|L35545.1|HUMECPC[565267]

[7721] 15835: L36130 Homo sapiens kappa opiate receptor mRNA, partial cds gi|598184|gb|L36130.1|HUMKOR[598184]

[7722] 15836: L36150 Homo sapiens G protein-coupled receptor (GPR6) gene, complete cds gi|598156|gb|L36150.1|HUMGPR6A[598156]

[7723] 15837: L36148 Homo sapiens G protein-coupled receptor (GPR4) gene, complete cds gi|598152|gb|L36148.1|HUMGPR4A[598152]

[7724] 15839: L36149 Homo sapiens G protein-coupled receptor (GPR5) gene, complete cds gi|598154|gb|L36149.1|HUMGPR5A[598154]

[7725] 15840: M64749 Human homologue of the canine orphan receptor (RDC1) mRNA, 5′ end gi|292418|gb|M64749.1|HUMRDC1A[292418]

[7726] 15841: L35848 Homo sapiens IgE receptor beta chain (HTm4) mRNA, complete cds gi|561638|gb|L35848.1|HUMIERB(561638]

[7727] 16011: L22431 Human very low density lipoprotein receptor, complete cds gi|437386|gb|L22431.1|HUMVLDLRX[437386]

[7728] 16012: M90366 Human zona pellucida glycoprotein 2 (ZP2) mRNA, complete cds gi|292939|gb|M90366.1|HUMZP2GP[292939]

[7729] 16015: M76125 Human tyrosine kinase receptor (axl) mRNA, complete cds gi|292869|gb|M76125.1|HUMTYRKINR[292869]

[7730] 16016: L04489 Homo sapiens (clone NCD18) tumor necrosis factor receptor related protein mRNA, complete exon and repeat region gi|340022|gb|L04489.1|HUMTUMNEC[340022]

[7731] 16017: M31163 Human tumor necrosis factor-inducible (TSG-12) mRNA fragment gi|339990|gb|M31163.1|HUMTSG12A[339990]

[7732] 16019: M75866 Human tumor necrosis factor receptor 1 (TNFR1) gene, complete cds gi|339748|gb|M75866.1|HUMTNFR103[339748]

[7733] 16020: M75865 Human tumor necrosis factor receptor 1 (TNFR1) gene, exons 2-5 gi|339747|gb|M75865.1|HUMTNFR102[339747]

[7734] 16021: M75864 Human tumor necrosis factor receptor 1 (TNFR1) gene, exon 1 gi|339746|gb|M75864.1|HUMTNFR101[339746]

[7735] 16026: M85079 Human TGF-beta type II receptor mRNA, complete cds gi|339569|gb|M85079.1|HUMTGFBIIR[339569]

[7736] 16027: L06139 Homo sapiens receptor protein-tyrosine kinase (TEK) mRNA, complete cds gi|292823|gb|L06139.1|HUMTEKRPTK[292823]

[7737] 16204: L29349 Homo sapiens granulocyte-macrophage colony-stimulating factor receptor alpha-subunit 3 (GM-CSF-RA3) mRNA, complete cds gi|460284|gb|L29349.1|HUMGMCSA[460284]

[7738] 16205: L29348 Homo sapiens granulocyte-macrophage colony-stimulating factor receptor alpha-subunit soluble isoform 2 (GM-CSF-RAS2) mRNA, complete cds gi|460282|gb|L29348.1|HUMGMCS[460282]

[7739] 16270: M74290 Human substance P receptor protein mRNA gi|338612|gb|M74290.1|HUMSUBPRA[338612]

[7740] 16271: M96738 Human somatostatin receptor subtype 3 (SSTR3) gene, complete cds gi|338498|gb|M96738.1|HUMSSTR3X[338498]

[7741] 16272: L13033 Homo sapiens somatostatin receptor isoform 2 gene, alternatively spliced exon gi|292515|gb|L13033.1|HUMSSTR23X[292515]

[7742] 16273: L07833 Homo sapiens somatostatin receptor (SSTR4) gene, complete cds gi|307429|gb|L07833.1|HUMSOMATA[307429]

[7743] 16274: L10126 Human serine/threonine kinase receptor-2-3 (SKR2-3) mRNA, complete cds gi|558102|gb|L10126.1|HUMSKR23A[558102]

[7744] 16275: L10125 Human serine/threonine kinase receptor-2-2 (SKR2-2) mRNA, complete cds gi|558101|gb|L10125.1|HUMSKR22A[558101]

[7745] 16276: J04132 Human T cell receptor zeta-chain mRNA, complete cds gi|623041|gb|J04132.1|HUMTCRZCN[623041]

[7746] 16277: M93221 Human macrophage mannose receptor (MRC1) gene, exon 30 gi|187332|gb|M93221.1|HUMMANR30[187332]

[7747] 16278: M93220 Human macrophage mannose receptor (MRC1) gene, exon 29 gi|187331|gb|M93220.1|HUMMANR29[187331]

[7748] 16279: M93219 Human macrophage mannose receptor (MRC1) gene, exon 28 gi|187330|gb|M93219.1|HUMMANR28[187330]

[7749] 16280: M93218 Human macrophage mannose receptor (MRC1) gene, exon 27 gi|187329|gb|M93218.1|HUMMANR27[187329]

[7750] 16281: M93217 Human macrophage mannose receptor (MRC1) gene, exon 26 gi|187328|gb|M93217.1|HUMMANR26[187328]

[7751] 16282: M93216 Human macrophage mannose receptor (MRC1) gene, exon 25 gi|187327|gb|M93216.1|HUMMANR25[187327]

[7752] 16283: M93215 Human macrophage mannose receptor (MRC1) gene, exon 24 gi|187326|gb|M93215.1|HUMMANR24[187326]

[7753] 16284: M93214 Human macrophage mannose receptor (MRC1) gene, exon 23 gi|187325|gb|M93214.1|HUMMANR23[187325]

[7754] 16285: M93213 Human macrophage mannose receptor (MRC1) gene, exon 22 gi|187324|gb|M93213.1|HUMMANR22[187324]

[7755] 16286: M93212 Human macrophage mannose receptor (MRC1) gene, exon 21 gi|187323|gb|M93212.1|HUMMANR21[187323]

[7756] 16287: M93211 Human macrophage mannose receptor (MRC1) gene, exon 20 gi|187322|gb|M93211.1|HUMMANR20[187322]

[7757] 16288: M93210 Human macrophage mannose receptor (MRC1) gene, exon 19 gi|187321|gb|M93210.1|HUMMANR19[187321]

[7758] 16289: M93209 Human macrophage mannose receptor (MRC1) gene, exon 18 gi|187320|gb|M93209.1|HUMMANR18[187320]

[7759] 16290: M93208 Human macrophage mannose receptor (MRC1) gene, exon 17 gi|187319|gb|M93208.1|HUMMANR17[187319]

[7760] 16291: M93207 Human macrophage mannose receptor (MRC1) gene, exon 16 gi|187318|gb|M93207.1|HUMMANR16[187318]

[7761] 16292: M93206 Human macrophage mannose receptor (MRC1) gene, exon 15 gi|187317|gb|M93206.1|HUMMANR15[187317]

[7762] 16293: M93205 Human macrophage mannose receptor (MRC1) gene, exon 14 gi|187316|gb|M93205.1|HUMMANR14[187316]

[7763] 16294: M93204 Human macrophage mannose receptor (MRC1) gene, exon 13 gi|187315|gb|M93204.1|HUMMANR13[187315]

[7764] 16295: M93203 Human macrophage mannose receptor (MRC1) gene, exon 12 gi|187314|gb|M93203.1|HUMMANR12[187314]

[7765] 16296: M93202 Human macrophage mannose receptor (MRC1) gene, exon 11 gi|187313|gb|M93202.1|HUMMANR11[187313]

[7766] 16297: M93201 Human macrophage mannose receptor (MRC1) gene, exon 10 gi|187312|gb|M93201.1|HUMMANR10[187312]

[7767] 16298: M93200 Human macrophage mannose receptor (MRC1) gene, exon 9 gi|187311|gb|M93200.1|HUMMANR09[187311]

[7768] 16299: M93199 Human macrophage mannose receptor (MRC1) gene, exon 8 gi|187310|gb|M93199.1|HUMMANR08[187310]

[7769] 16300: M93198 Human macrophage mannose receptor (MRC1) gene, exon 7 gi|187309|gb|M93198.1|HUMMANR07[187309]

[7770] 16301: M93197 Human macrophage mannose receptor (MRC1) gene, exon 6 gi|187308|gb|M93197.1|HUMMANR06[187308]

[7771] 16302: M93196 Human macrophage mannose receptor (MRC1) gene, exon 5 gi|187307|gb|M93196.1|HUMMANR05[187307]

[7772] 16303: M93195 Human macrophage mannose receptor (MRC1) gene, exon 4 gi|187306|gb|M93195.1|HUMMANR04[187306]

[7773] 16304: M93194 Human macrophage mannose receptor (MRC1) gene, exon 3 gi|187305|gb|M93194.1|HUMMANR03[187305]

[7774] 16305: M93193 Human macrophage mannose receptor (MRC1) gene, exon 2 gi|187304|gb|M93193.1|HUMMANR02[187304]

[7775] 16306: M93192 Human macrophage mannose receptor (MRC1) gene, exon 1 gi|187303|gb|M93192.1|HUMMANR01[187303]

[7776] 16307: L05198 Homo sapiens insulin receptor substrate 1 (IRS1) gene, repeat polymorphism gi|307396|gb|L05198.1|HUMIRS1RPT[307396]

[7777] 16308: M15365 Human low density lipoprotein receptor mutant gene recombination site gi|187107|gb|M15365.1|HUMLDLRM[187107]

[7778] 16309: M80637 Human keratinocyte growth factor receptor gene, exon K gi|186758|gb|M80637.1|HUMKKGFRA[186758]

[7779] 16310: M81778 Human serotonin 5-HT1C receptor mRNA, complete cds gi|338027|gb|M81778.1|HUMSER5R[338027]

[7780] 16311: M81590 Homo sapiens serotonin 1D receptor (5-HT1D˜) mRNA, complete cds gi|338025|gb|M81590.1|HUMSER1DRB[338025]

[7781] 16312: M81589 Homo sapiens serotonin 1D receptor (5-HT1D˜) mRNA, complete cds gi|338023|gb|M81589.1|HUMSER1DRA[338023]

[7782] 16313: M91455 Human ryanodine receptor (RYR1) gene, exons 17 and 18 gi|337723|gb|M91455.1|HUMRYR1[337723]

[7783] 16316: M97639 Human transmembrane receptor (ror2) mRNA, complete cds gi|337466|gb|M97639.1|HUMROR2A[337466]

[7784] 16317: M97675 Human transmembrane receptor (ror1) mRNA, complete cds gi|337464|gb|M97675.1|HUMROR1A[337464]

[7785] 16318: M74721 Human B-cell antigen receptor (MB-1) mRNA, complete cds gi|337419|gb|M74721.1|HUMRIGMAMB[337419]

[7786] 16319: M89796 Human high affinity IgE receptor beta chain gene, complete cds gi|337417|gb|M89796.1|HUMRIGBCHA[337417]

[7787] 16329: L09247 Human receptor-type protein tyrosine phosphatase gamma (PTPRG) mRNA, complete cds gi|292410|gb|L09247.1|HUMPTPRG[292410]

[7788] 16330: M93426 Human protein tyrosine phosphatase zeta-polypeptide (PTPRZ) mRNA, complete cds gi|190743|gb|M93426.1|HUMPTPRZ[190743]

[7789] 16331: M88177 Human platelet activating factor receptor (PTAFR) gene, complete cds gi|190697|gb|M88177.1|HUMPTAFR[190697]

[7790] 16332: L16862 Homo sapiens G protein-coupled receptor kinase (GRK6) mRNA, complete cds gi|388766|gb|L16862.1|HUMPROCRKI[388766]

[7791] 16333: M86528 Human neurotrophin-4 (NT-4) gene, complete cds gi|190264|gb|M86528.1|HUMPPNT4P[190264]

[7792] 16334: L07334 Human platelet-activating factor receptor mRNA, complete cds gi|190014|gb|L07334.1|HUMPLACTFR[190014]

[7793] 16335: L26976 Human prostaglandin receptor (PGE-2) mRNA, complete cds gi|473428|gb|L26976.1|HUMPGE2REP[473428]

[7794] 16336: M88107 Human formyl peptide receptor (FPR2) mRNA, complete cds gi|189862|gb|M88107.1|HUMPFPR2A[189862]

[7795] 16337: M76674 Human platelet activating factor receptor (PAFR) mRNA, complete cds gi|456293|gb|M76674.1|HUMPAFRX[456293]

[7796] 16338: M80436 Human platelet activating factor receptor mRNA, complete cds gi|189537|gb|M80436.1|HUMPAFR[189537]

[7797] 16339: L26079 Homo sapiens (clone hSR4-1) kappa opioid receptor (OPRK1) gene, complete exon gi|416143|gb|L26079.1|HUMOPRK1A[416143]

[7798] 16340: L07615 Human neuropeptide Y receptor Y1 (NPYY1) mRNA, exon 2-3 and complete cds gi|189284|gb|L07615.1|HUMNPYY1A2[189284]

[7799] 16341: L07614 Human neuropeptide Y receptor Y1 (NPYY1) mRNA, exon 1 gi|189283|gb|L07614.1|HUMNPYY1A1[189283]

[7800] 16342: M37981 Human alpha-3 neuronal nicotinic acetylcholine receptor subunit mRNA, complete cds gi|189252|gb|M37981.1 HUMNNAR[189252]

[7801] 16343: M73482 Human neuromedin B receptor (NMB-R) mRNA, complete cds gi|189241|gb|M73482.1|HUMNMBR[189241]

[7802] 16344: M76675 Human neurokinin 1 receptor (NKIR) mRNA, complete cds gi|189231|gb|M76675.1|HUMNKIRX[189231]

[7803] 16345: M81797 Human NK-1 receptor mRNA, complete cds gi|189213|gb|M81797.1|HUMNK1A[189213]

[7804] 16346: M32315 Human tumor necrosis factor receptor mRNA, complete cds gi|189185|gb|M32315.1|HUMNFR[189185]

[7805] 16347: M84755 Human neuropeptide y receptor mRNA, complete cds gi|189153|gb|M84755.1|HUMNEUYREC[189153]

[7806] 16348: M83246 Human monocyte activation antigen (Mo3) mRNA, complete cds gi|188623|gb|M83246.1|HUMMO3A[188623]

[7807] 16350: L27080 Human melanocortin 5 receptor (MC5R) gene, complete cds gi|435599|gb|L27080.1|HUMMC5R[4355991

[7808] 16351: M28219 Homo sapiens low density lipoprotein receptor (FH 10 mutant causing familial hypercholesterolemia) mRNA, 3′ end gi|619785|gb|M28219.1|HUMLDLRFMT[619785]

[7809] 16352: M12626 Human low density lipoprotein receptor gene, FH381 (deletion mutant) allele gi|187103|gb|M12626.1|HUMLDLRFH[187103]

[7810] 16353: M93189 Human acetylated low density lipoprotein (AcLDL) receptor (LDLR) gene, promoter and exon 1 gi|187100|gb|M93189.1|HUMLDLRAC[187100]

[7811] 16354: M87772 Human secreted fibroblast growth factor receptor (K-sam-IV) mRNA, complete cds gi|186783|gb|M87772.1|HUMKSAMIV[186783]

[7812] 16355: M87771 Human secreted fibroblast growth factor receptor (K-sam-III) mRNA, complete cds gi|186781|gb|M87771.1|HUMKSAMIII[186781]

[7813] 16356: M87770 Human fibroblast growth factor receptor (K-sam) mRNA, complete cds gi|186779|gb|M87770.1|HUMKSAMI[186779]

[7814] 16357: L04947 Homo sapiens (clones BT3.081.8, BT3.129.5 and BT4.169) receptor tyrosine kinase (KDR) mRNA, 3′ end cds gi|186674|gb|L04947.1|HUMKDRZ[186674]

[7815] 16358: M32972 Human insulin receptor (INSR) gene, exon 22, clones lambda-hINSR-(1-13) gi|186462|gb|M32972.1|HUMINSR22[186462]

[7816] 16359: M32842 Human insulin receptor (INSR) gene, exon 21, clones lambda-hINSR-(1-13) gi|186461|gb|M32842.1|HUMINSR21[186461]

[7817] 16360: M32841 Human insulin receptor (INSR) gene, exon 20, clones lambda-hINSR-(1-13) gi|186460|gb|M32841.1|HUMINSR20[186460]

[7818] 16361: M32840 Human insulin receptor (INSR) gene, exon 19, clones lambda-hINSR-(1-13) gi|186459|gb|M32840.1|HUMINSR19[186459]

[7819] 16362: M32839 Human insulin receptor (INSR) gene, exon 18, clones lambda-hINSR-(1-13) gi|186458|gb|M32839.1|HUMINSR18[186458]

[7820] 16363: M32838 Human insulin receptor (hINSR) gene, exon 17, clones lambda-hINSR-(1-13) gi|186457|gb|M32838.1|HUMINSR17[186457]

[7821] 16364: M32837 Human insulin receptor (INSR) gene, exon 16, clones lambda-hINSR-(1-13) gi|186456|gb|M32837.1|HUMINSR16[186456]

[7822] 16365: M32836 Human insulin receptor (INSR) gene, exon 15, clones lambda-hINSR-(1-13) gi|186455|gb|M32836.1|HUMINSR15[186455]

[7823] 16366: M32835 Human insulin receptor (INSR) gene, exon 14, clones lambda-hINSR-(1-13) gi|186454|gb|M32835.1|HUMINSR14[186454]

[7824] 16367: M32834 Human insulin receptor (INSR) gene, exon 13, clones lambda-hINSR-(1-13) gi|186453|gb|M32834.1|HUMINSR13[186453]

[7825] 16368: M32833 Human insulin receptor (INSR) gene, exon 12, clones lambda-hINSR-(1-13) gi|186452|gb|M32833.1|HUMINSR12[186452]

[7826] 16369: M32832 Human insulin receptor (INSR) gene, exon 11, clones lambda-hINSR-(1-13) gi|186451|gb|M32832.1|HUMINSR11[186451]

[7827] 16370: M32831 Human insulin receptor (INSR) gene, exon 10, clones lambda-hINSR-(1-13) gi|186450|gb|M32831.1|HUMINSR10[186450]

[7828] 16371: M32830 Human insulin receptor (hINSR) gene, exon 9, clones lambda-hINSR-(1-13) gi|186449|gb|M32830.1|HUMINSR09[186449]

[7829] 16372: M32829 Human insulin receptor (INSR) gene, exon 8, clones lambda-hINSR-(1-13) gi|186448|gb|M32829.1|HUMINSR08[186448]

[7830] 16373: M32828 Human insulin receptor (INSR) gene, exon 7, clones lambda-hINSR-(1-13) gi|186447|gb|M32828.1|HUMINSR07[186447]

[7831] 16374: M32827 Human insulin receptor (INSR) gene, exon 6, clones lambda-hINSR-(1-13) gi|186446|gb|M32827.1|HUMINSR06[186446]

[7832] 16375: M32826 Human insulin receptor (INSR) gene, exon 5, clones lambda-hINSR-(1-13) gi|186445|gb|M32826.1|HUMINSR05[186445]

[7833] 16376: M32825 Human insulin receptor (INSR) gene, exon 4, clones lambda-hINSR-(1-13) gi|186444|gb|M32825.1|HUMINSR04[186444]

[7834] 16377: M32824 Human insulin receptor (INSR) gene, exon 3, clones lambda-hINSR-(1-13) gi|186443|gb|M32824.1|HUMINSR03[186443]

[7835] 16378: M32823 Human insulin receptor (INSR) gene, exon 2, clones lambda-hINSR-(1-13) gi|186442|gb|M32823.1|HUMINSR02[186442]

[7836] 16379: M23100 Human insulin receptor (INSR) gene, exon 1, clones lambda-hINSR-(1-13) gi|186441|gb|M23100.1|HUMINSR01[186441]

[7837] 16380: J05043 Human insulin receptor (IR) gene, exon 1 gi|186556|gb|J05043.1|HUMIRSRE[186556]

[7838] 16381: M24555 Human insulin receptor (INSR) mRNA, partial cds gi|186480|gb|M24555.1|HUMINSRZ[186480]

[7839] 16382: L07782 Human insulin receptor gene, last exon gi|186475|gb|L07782.1|HUMINSRE[186475]

[7840] 16383: J03466 Human insulin receptor gene, exon 1, clone p-lambda EA2 gi|186469|gb|J03466.1|HUMINSRB[186469]

[7841] 16384: L19592 Homo sapiens interleukin 8 receptor alpha (IL8RA) gene, complete cds gi|559051|gb|L19592.1|HUMIL8RAB[559051]

[7842] 16385: M15864 Human interleukin-2 receptor alpha (IL2R-alpha) gene, exon 1 and promoter region gi|186375|gb|M15864.1|HUMILA2R1A[186375]

[7843] 16387: M68932 Human IL-8 receptor mRNA, complete cds gi|186369|gb|M68932.1|HUMIL8RA[186369]

[7844] 16388: L12183 Human interleukin 2 receptor gamma chain (IL2RG) gene, exon 8 and complete cds gi|307056|gb|L12183.1|HUMIL2RG08[307056]

[7845] 16389: L12182 Human interleukin 2 receptor gamma chain (IL2RG) gene, exon 7 gi|307055|gb|L12182.1|HUMIL2RG07[307055]

[7846] 16390: L12181 Human interleukin 2 receptor gamma chain (IL2RG) gene, exon 6 gi|307054|gb|L12181.1|HUMIL2RG06[307054]

[7847] 16391: L12180 Human interleukin 2 receptor gamma chain (IL2RG) gene, exon 5 gi|307053|gb|L12180.1|HUMIL2RG05[307053]

[7848] 16392: L12179 Human interleukin 2 receptor gamma chain (IL2RG) gene, exon 4 gi|307052|gb|L12179.1|HUMIL2RG04[307052]

[7849] 16393: L12177 Human interleukin 2 receptor gamma chain (IL2RG) gene, exon 3 gi|307051|gb|L12177.1|HUMIL2RG03[307051]

[7850] 16394: L12176 Human interleukin 2 receptor gamma chain (IL2RG) gene, exon 2 gi|307050|gb|L12176.1|HUMIL2RG02[307050]

[7851] 16395: L12178 Human interleukin 2 receptor gamma chain (IL2RG) gene, exon 1 and promoter region gi|307049|gb|L12178.1|HUMIL2RG01[307049]

[7852] 16396: M96652 Human interleukin 5 receptor alpha-subunit (IL5R) mRNA, complete cds gi|186344|gb|M96652.1|HUMIL5RB[1863441

[7853] 16397: M96651 Human interleukin 5 receptor alpha-subunit (IL5R) mRNA, complete cds gi|186342|gb|M96651.1|HUMIL5RA[186342]

[7854] 16398: M74782 Human interleukin 3 receptor (hIL-3Ra) mRNA, complete cds gi|186330|gb|M74782.1|HUMIL3B[186330]

[7855] 16405: M84967 Human acrosin-trypsin inhibitor (HUSI-II) gene gi|553347|gb|M84967.1|HUMHUSIIIA[553347]

[7856] 16406: M84747 Human interleukin 9 receptor mRNA, complete cds gi|184508|gb|M84747.1|HUMI9R[184508]

[7857] 16407: M75128 Human serotonin 1Db receptor (HTR1D) gene, complete cds gi|184459|gb|M75128.1|HUMHTR1DB[184459]

[7858] 16408: M64799 Human histamine H2 receptor gene, complete cds gi|184087|gb|M64799.1|HUMHISH2R[184087]

[7859] 16409: M83941 Human receptor tyrosine kinase (HEK) mRNA, complete cds gi|183931|gb|M83941.1|HUMHEK[183931]

[7860] 16410: L20814 Human glutamate receptor 2 (HBGR2) mRNA, complete cds gi|493133|gb|L20814.1|HUMHBGR2A[493133]

[7861] 16412: L09237 growth hormone releasing hormone receptor, human, G-protein coupled receptor, secretin family gi|337134|gb|L09237.1|HUMGRFREC1[337134]

[7862] 16413: L15388 Human G protein-coupled receptor kinase (GRK5) mRNA, complete cds gi|306804|gb|L15388.1|HUMGRK5A[306804]

[7863] 16415: L08176 Human Epstein-Barr virus induced G-protein coupled receptor mRNA, complete cds gi|183484|gb|L08176.1|HUMGPCRA[183484]

[7864] 16416: M64752 Human glutamate receptor subunit (GluH1) mRNA, complete cds gi|183280|gb|M64752.1|HUMGLURS[183280]

[7865] 16417: L34075 Human FKBP-rapamycin associated protein (FRAP) mRNA, complete cds gi|508481|gb|L34075.1|HUMFRAPX[508481]

[7866] 16418: L08485 Human GABA-benzodiazepine receptor alpha-5-subunit (GABRA5) mRNA, complete cds gi|182915|gb|L08485.1|HUMGABRA5Y[182915]

[7867] 16419: M93435 Human gamma-aminobutyric acid receptor A5 subunit (GABRA5) gene gi|182914|gb|M93435.1|HUMGABRA5X[182914]

[7868] 16421: M76673 Human RMLP-related receptor I (RMLP R I) mRNA, complete cds gi|182668|gb|M76673.1|HUMFMLPY[182668]

[7869] 16422: M76672 Human FMLP-related receptor II (FMLP R II) mRNA, complete cds gi|182666|gb|M76672.1|HUMFMLPX[182666]

[7870] 16423: M64347 Human novel growth factor receptor mRNA, 3′ cds gi|182564|gb|M64347.1|HUMFGFLR[182564]

[7871] 16424: M74921 Human endothelin receptor mRNA, complete cds gi|182275|gb|M74921.1|HUMETSR[182275]

[7872] 16427: M96995 Homo sapiens epidermal growth factor receptor-binding protein GRB2 (EGFRBP-GRB2) mRNA sequence gi|181975|gb|M96995.1|HUMEGFGRBA[181975]

[7873] 16428: L06622 Homo sapiens endothelin receptor type A (EDNRA) mRNA, complete cds gi|181956|gb|L06622.1|HUMEDNRA[181956]

[7874] 16434: M26317 Homo sapiens (clone lambda-6.11) complement receptor 2 (CR2) allele, mRNA fragment gi|541647|gb|M26317.1|HUMCR2ALLE[541647]

[7875] 16435: M25785 Homo sapiens transmembrane glycoprotein (c-fms) gene, exon 1, and platelet-derived growth factor receptor (PDGF) gene, 3′UTR gi|349453|gb|M25785.1|HUMCFMS01[349453]

[7876] 16436: M91555 Human Fc gamma receptor type I (CD64) gene, exon 6 gi|180160|gb|M91555.1|HUMCD6406[180160]

[7877] 16437: M91554 Human Fc gamma receptor type I (CD64) gene, exon 5 gi|180159|gb|M91554.1|HUMCD6405[180159]

[7878] 16438: M91553 Human Fc gamma receptor type I (CD64) gene, exon 4 gi|180158|gb|M91553.1|HUMCD6404[180158]

[7879] 16439: M91552 Human Fc gamma receptor type I (CD64) gene, exon 3 gi|180157|gb|M91552.1|HUMCD6403[180157]

[7880] 16440: M91551 Human Fc gamma receptor type I (CD64) gene, exon 2 gi|180156|gb|M91551.1|HUMCD6402[180156]

[7881] 16441: M91550 Human Fc gamma receptor type I (CD64) gene, exon 1 gi|180155|gb|M91550.1|HUMCD6401[180155]

[7882] 16442: M63928 Homo sapiens T cell activation antigen (CD27) mRNA, complete cds gi|180084|gb|M63928.1|HUMCD27A(180084]

[7883] 16443: M95293 Homo sapiens integrin beta subunit (CD18) gene, exon 1 gi|180022|gb|M95293.1|HUMCD18EX[180022]

[7884] 16444: M76724 Human leukocyte adhesion receptor alpha subunit (CD11b) gene, 5′ end gi|180018gb|M76724.1|HUMCD11B[180018]

[7885] 16447: L09230 Human C-C chemokine receptor type 1 (C-C CKR-1) mRNA, complete cds gi|179984|gb|L09230.1|HUMCCCKR1A[179984]

[7886] 16448: M81886 Human glutamate receptor type 1 (HBGR1) mRNA, complete cds gi|179441|gb|M81886.1|HUMBGR1A[179441]

[7887] 16449: M80776 Human beta-adrenergic receptor kinase 1 mRNA, complete cds gi|179334|gb|M80776.1|HUMBARK1A[179334]

[7888] 16450: L25259 Human CTLA4 counter-receptor (B7-2) mRNA, complete cds gi|416368|gb|L25259.1|HUMB72A[416368]

[7889] 16451: M93394 Human angiotensin II type-1 receptor (AT1) mRNA, complete cds gi|178680|gb|M93394.1|HUMANTIIR[178680]

[7890] 16452: M83712 H.sapiens nicotinic receptor alpha 5 subunit mRNA, complete cds gi|177925|gb|M83712.1|HUMA5NICRC[177925]

[7891] 16453: M97370 Human adenosine receptor (A2) gene, complete cds gi|177891|gb|M97370.1|HUMA2XXX[177891]

[7892] 16454: M92826 Human serotonin receptor (5-HTR1E) gene, complete cds gi|177777|gb|M92826.1|HUM5HTR1E[177777]

[7893] 16455: M86841 Human serotonin receptor type 2 (5HT2) mRNA, complete cds gi|177775|gb|M86841.1|HUM5HT2A[177775]

[7894] 16456: M91467 Human serotonin receptor (5HT1E) mRNA, complete cds gi|177773|gb|M91467.1|HUM5HT1E[177773]

[7895] 16457: M81830 Human somatostatin receptor isoform 2 (SSTR2) gene, complete cds gi|307435|gb|M81830.1|HUMSRI2A[307435]

[7896] 16458: M81829 Human somatostatin receptor isoform 1 gene, complete cds gi|307433|gb|M81829.1|HUMSRI1A[307433]

[7897] 16463: L20470 Human very low density lipoprotein receptor mRNA, complete cds gi|409425|gb|L20470.1|HUMVLDLR[409425]

[7898] 16464: L20316 Human glucagon receptor mRNA, complete cds gi|405189|gb|L20316.1|HUMGLUCREC[405189]

[7899] 16465: M24853 Homo sapiens (clone H12) low affinity IgG receptor CD16 (FcGRIII) mRNA, 3′ end gi|184849|gb|M24853.1|HUMIGGRLA[184849]

[7900] 16466: M80635 Human fibroblast growth factor receptor-2 (FGFR2) gene, exon B gi|182572|gb|M80635.1|HUMFGFRA[182572]

[7901] 16467: L31848 Homo sapiens serine/threonine kinase receptor 2 (SKR2) gene, 3 alternative splices, 3′ ends gi|576680|gb|L31848.1|HUMSKR2[576680]

[7902] 16472: M29066 Human dopamine D2 receptor (DRD2) mRNA, complete cds gi|181828|gb|M29066.1|HUMDRD2A[181828]

[7903] 16473: M85289 Human heparan sulfate proteoglycan (HSPG2) mRNA, complete cds gi|184426|gb|M85289.1|HUMHSPG2B[184426]

[7904] 16474: L02931 Human hepatocyte growth factor heavy chain (HGF) gene mRNA, complete cds gi|184033|gb|L02931.1|HUMHGFX[184033]

[7905] 16475: L19058 Human glutamate receptor (GLUR5) mRNA, complete cds gi|455447|gb|L19058.1|HUMGLUR5X[455447]

[7906] 16476: L20859 Human leukemia virus receptor 1 (GLVR1) mRNA, complete cds gi|306769|gb|L20859.1|HUMGLVR1X[306769]

[7907] 16477: M82919 Human gamma amino butyric acid (GABAA) receptor beta-3 subunit mRNA, complete cds gi|182924|gb|M82919.1|HUMGABRB3A[182924]

[7908] 16478: M86868 Human gamma amino butyric acid (GABA rho2) gene mRNA, complete cds gi|182912|gb|M86868.1|HUMGABARHO[182912]

[7909] 16479: L14061 Human N-formyl receptor-like 2 protein (FPRL2) gene, complete cds gi|292034|gb|L14061.1|HUMFRPL2[292034]

[7910] 16480: M95489 H.sapiens follicle stimulating hormone receptor mRNA, complete cds gi|182772|gb|M95489.1|HUMFSHREC[182772]

[7911] 16481: M84562 Human formyl peptide receptor-like receptor (FPRL1) mRNA, complete cds gi|182741|gb|M84562.1|HUMFPRL1A[182741]

[7912] 16482: M97193 Homo sapiens fibroblast growth factor receptor 2 IIIb (FGFR2) mRNA, complete cds gi|182566|gb|M97193.1|HUMFGFR2A[182566]

[7913] 16483: M23562 Human IgE Fc-epsilon-RIIa gene, exon 2, and Fc-epsilon-RIIb gene, exon 1 gi|182444|gb|M23562.1|HUMFCEIIA[182444]

[7914] 16484: M76595 Human erythropoietin receptor mRNA sequence derived from DNA, 5′ end gi|182147|gb|M76595.1|HUMEPR[182147]

[7915] 16485: M77244 H.sapiens erythropoietin receptor (EPOR) gene, 5′ end gi|182133|gb|M77244.1|HUMEPOR[182133]

[7916] 16486: M24736 Human endothelial leukocyte adhesion molecule 1 (ELAM-1) mRNA, complete cds gi|537523|gb|M24736.1|HUMELAM1A[537523]

[7917] 16487: L37361 Homo sapiens (clone hELK-L) ELK receptor tyrosine kinase ligand (EFL-3) mRNA, complete cds gi|567005|gb|L37361.1|HUMEFL3[567005]

[7918] 16488: L37360 Homo sapiens (clone hEHK1-L) EHK1 receptor tyrosine kinase ligand (EFL-2) mRNA, complete cds gi|567003|gb|L37360.1|HUMEFL2[567003]

[7919] 16489: K03193 Human aberrant (short) epidermal growth factor receptor mRNA, complete cds gi|181984|gb|K03193.1|HUMEGFRS[181984]

[7920] 16490: M11234 Human epidermal growth factor receptor (EGFR) gene, exon 1 gi|181981|gb|M11234.1|HUMEGFRG[181981]

[7921] 16491: L06623 Homo sapiens endothelin receptor type B (EDNRB) mRNA, complete cds gi|181958|gb|L06623.1|HUMEDNRB[181958]

[7922] 16494: M67439 Human D5 dopamine receptor (DRD5) gene, complete cds gi|181830|gb|M67439.1|HUMDRD5A[181830]

[7923] 16495: M77250 Human dopamine D2 receptor gene, intron 6/exon 7 boundary gi|181825|gb|M77250.1|HUMDRD24[181825]

[7924] 16496: M77249 Human dopamine D2 receptor gene, exon 3 gi|181824|gb|M77249.1|HUMDRD23[181824]

[7925] 16497: M77247 Human dopamine D2 receptor gene, exon 2 gi|181823|gb|M77247.1|HUMDRD22[181823]

[7926] 16498: M77248 Human dopamine D2 receptor gene, exon 1 gi|181822|gb|M77248.1|HUMDRD21[181822]

[7927] 16499: M33210 Human colony stimulating factor 1 receptor (CSF1R) gene, exon 5 gi|532591|gb|M33210.1|HUMCSF1R03[532591]

[7928] 16500: M33209 Human colony stimulating factor 1 receptor (CSF1R) gene, exon 4 gi|532590|gb|M33209.1|HUMCSF1R02[532590]

[7929] 16501: M33208 Human colony stimulating factor 1 receptor (CSF1R) gene, exon 2 gi|532589|gb|M33208.1|HUMCSF1R01[532589]

[7930] 16502: M83328 Human cell surface glycoprotein CD44 mRNA, (variant F) exons 1, 2, 3, and 5 gi|180135|gb|M83328.1|HUMCD44J[180135]

[7931] 16503: M83327 Human cell surface glycoprotein CD44 mRNA, (variant E) exons 1, 2, 3, and 4 gi|180134|gb|M83327.1|HUMCD44I[180134]

[7932] 16504: M83326 Human cell surface glycoprotein CD44 mRNA, (variant D) exon 1, 2, and 3 gi|180133|gb|M83326.1|HUMCD44H[180133]

[7933] 16505: M83325 Human cell surface glycoprotein CD44 mRNA, (variant C) exons 1 and 2 gi|180132|gb|M83325.1|HUMCD44G[180132]

[7934] 16506: M83324 Human cell surface glycoprotein CD44 mRNA, (variant B) exon 1 gi|180131|gb|M83324.1|HUMCD44F[180131]

[7935] 16507: M83554 H.sapiens lymphocyte activation antigen CD30 mRNA, complete cds gi|180095|gb|M83554.1|HUMCD30A[180095]16512: M97759 Human adenosine A2b receptor (ADORA2) mRNA, complete cds gi|178149|gb|M97759.1|HUMADORA1[178149]

[7936] 16513: M80333 Human m5 muscarinic acetylcholine receptor gene, complete cds gi|177987|gb|M80333.1|HUMACHRM[177987]

[7937] 16527: L34339 Human galanin receptor mRNA, complete cds gi|559047|gb|L34339.1|HUMGALAREC[559047]

[7938] 16528: L17033 Human heparin-binding epidermal growth factor gene sequence gi|348176|gb|L17033.1|HUMHBEGFF[348176]

[7939] 16529: L17032 Human heparin-binding epidermal growth factor gene sequence gi|348175|gb|L17032.1|HUMHBEGFE[348175]

[7940] 16530: L17031 Human heparin-binding epidermal growth factor gene, 31 end gi|348173|gb|L17031.1|HUMHBEGFD[348173]

[7941] 16531: L17030 Human heparin-binding epidermal growth factor gene, partial cds gi|348171|gb|L17030.1|HUMHBEGFC[348171]

[7942] 16532: L17029 Human heparin-binding epidermal growth factor gene, partial cds gi|348169|gb|L17029.1|HUMHBEGFB[348169]

[7943] 16533: L17028 Human heparin-binding epidermal growth factor gene, 5′ end gi|348168|gb|L17028.1|HUMHBEGFA[348168]

[7944] 16534: L13288 Human vasoactive intestial peptide receptor mRNA, complete cds gi|292903|gb|L13288.1|HUMVIPR[292903]

[7945] 16545: M31164 Human tumor necrosis factor-inducible (TSG-37) mRNA fragment gi|339993|gb|M31164.1|HUMTSG37A[339993]

[7946] 16547: L04270 Homo sapiens (clone CD18) tumor necrosis factor receptor 2 related protein mRNA, complete cds gi|33976|gb|L04270.1|HUMTNFRRP[339761]

[7947] 16548: M58286 Homo sapiens tumor necrosis factor receptor mRNA, complete cds gi|339753|gb|M58286.1|HUMTNFRB[339753]

[7948] 16562: L07062 Human somatostatin receptor 3 (SSTR3) gene gi|348713|gb|L07062.1|HUMSSTR3Y[348713]

[7949] 16563: L07061 Human somatostatin receptor 4 (SSTR4) gene gi|348712|gb|L07061.1|HUMSSTR4Z[348712]

[7950] 16564: M73489 Human heat-stable enterotoxin receptor mRNA, complete cds gi|338501|gb|M73489.1|HUMSTAR[338501]

[7951] 16565: L04962 Homo sapiens serotonin receptor (HTR1F) gene, complete cds gi|338464|gb|L04962.1|HUMSRCPT1F[338464]

[7952] 16566: M84426 Homo sapiens substance P receptor (short form) mRNA, complete cds gi|338435|gb|M84426.1|HUMSPRSHOR[338435]

[7953] 16567: M84425 Homo sapiens substance P receptor (long form) mRNA, complete cds gi|338427|gb|M84425.1|HUMSPRLONG[338427]

[7954] 16568: M97190 Human Sp2 protein mRNA, complete cds gi|338300|gb|M97190.1|HUMSP2A[338300]

[7955] 16569: L05521 Human somatostatin receptor subtype 2 gene related dinucleotide repeat gi|292502|gb|L05521.1|HUMSOMREPB[292502]

[7956] 16570: L05520 Human somatostatin receptor subtype 1 gene related dinucleotide repeat gi|292501|gb|L05520.1|HUMSOMREPA[292501]

[7957] 16571: L14856 Human somatostatin receptor gene, complete cds gi|292499|gb|L14856.1|HUMSOMAT[292499]

[7958] 16572: L02911 Human novel serine kinase receptor mRNA, complete cds gi|338218|gb|L02911.1|HUMSKRN[338218]

[7959] 16573: L05597 Human serotonin receptor gene, complete cds gi|307419|gb|L05597.1|HUMSEROTON[307419]

[7960] 16576: L10918 Homo sapiens macrophage inflammatory protein-1-alpha/RANTES receptor mRNA, complete cds gi|292416|gb|L10918.1|HUMRANTES[292416]

[7961] 16577: L28824 Homo sapiens protein tyrosine kinase (Syk) mRNA, complete cds gi|479012|gb|L28824.1|HUMPTK[479012]

[7962] 16578: L04308 Human parathyroid hormone receptor mRNA, complete cds gi|190721|gb|L04308.1|HUMPTHR[190721]

[7963] 16579: L02932 Human peroxisome proliferator activated receptor mRNA, complete cds gi|307340|gb|L02932.1|HUMPPAR[307340]

[7964] 16580: L07592 Human peroxisome proliferator activated receptor mRNA, complete cds gi|190229|gb|L07592.1|HUMPPARA[190229]

[7965] 16581: L29016 Homo sapiens prostanoid IP receptor, complete cds gi|495042|gb|L29016.1|HUMPIR[495042]

[7966] 16582: L25124 Homo sapiens prostaglandin E2 receptor mRNA, complete cds gi|435049|gb|L25124.1|HUMPGE2R[435049]

[7967] 16583: L28175 Homo sapiens prostaglandin E2 receptor EP2 subtype mRNA, complete cds gi|452495|gb|L28175.1|HUMPERE[452495]

[7968] 16584: M84986 Human DNA sequence from 5-hydroxytryptamine 1B receptor region gi|189401|gb|M84986.1|HUMORFZ[189401]

[7969] 16585: M84605 Human putative opioid receptor mRNA, complete cds gi|189391|gb|M84605.1|HUMOPIODRE[189391]

[7970] 16587: M89473 Human neurokinin 3 receptor (NK3R) mRNA, complete cds gi|189223|gb|M89473.1|HUMNK3R[189223]

[7971] 16588: L12214 Human N-formyl receptor gene gi|189182|gb|L12214.1|HUMNFORECB[189182]

[7972] 16589: L12213 Human N-formyl receptor gene gi|189181|gb|L12213.1|HUMNFORECA[189181]

[7973] 16590: L13267 Homo sapiens N-methyl-d-aspartate receptor (NR1-2) mRNA, 3′ end gi|292284|gb|L13267.1|HUMMARA[292284]

[7974] 16591: M80634 Human keratinocyte growth factor receptor mRNA, complete cds gi|186740|gb1M80634.1|HUMKGFRA[186740]

[7975] 16592: M80638 Human keratinocyte growth factor receptor and fibroblast growth factor receptor-2 gene, exon gi|186737|gb|M80638.1|HUMKFGFRB[186737]

[7976] 16593: M80636 Human keratinocyte growth factor receptor and fibroblast growth factor receptor-2 gene, exon gi|186736|gb|M80636.1|HUMKFGFRA[186736]

[7977] 16594: M59911 Human integrin alpha-3 chain mRNA, complete cds gi|186496|gb|M59911.1|HUMINTA3A[186496]

[7978] 16595: M75914 Human interleukin 5 receptor alpha mRNA, complete cds gi|186387|gb|M75914.1|HUMILSRAA[186387]

[7979] 16596: M73724 Human insulin-like growth factor-I receptor gene, exon 1 gi|186383|gb|M73724.1|HUMILGFIR[186383]

[7980] 16597: M94582 Human interleukin 8 receptor B mRNA, complete cds gi|186377|gb|M94582.1|HUMILEU8R[186377]

[7981] 16599: M24559 Human poly-Ig receptor transmembrane secretory component mRNA, 3′ end gi|514365|gb|M24559.1|HUMIGRPOLY[514365]

[7982] 16600: L03418 Human Fc-gamma receptor I A1 mRNA, complete cds gi|184840|gb|L03418.1|HUMIGGFCIA[184840]

[7983] 16601: M73780 Human integrin beta-8 subunit mRNA, complete cds gi|184520Igb|M73780.1|HUMIB8SUA[184520]

[7984] 16602: L09732 Homo sapiens 5-hydroxytryptamine 1D receptor gene, complete cds gi|184467|gb|L09732.1|HUMHTRD1A[184467]

[7985] 16603: M83180 Human serotonin receptor gene, complete cds gi|184463|gb|M83180.1|HUMHTRA[184463]

[7986] 16605: M63889 Human heparin-binding growth factor receptor (HBGF-R-alpha-a3) mRNA, complete cds gi|183882|gb|M63889.1|HUMHBGFC[183882]

[7987] 16606: L22607 Homo sapiens A3 adenosine receptor mRNA, complete cds gi|413863|gb|L22607.1|HUMHAAR[413863]

[7988] 16607: M82819 Human DNA sequence gi|183778|gb|M82819.1|HUMHAIGGR[183778]

[7989] 16608: L13436 Homo sapiens guanylate cyclase mRNA, complete mature peptide gi|292071|gb|L13436.1|HUMGUANCYC[292071]

[7990] 16609: L08177 Human EBV induced G-protein coupled receptor (EBI2) mRNA, complete cds gi|292056|gb|L08177.1|HUMGPCRB[292056]

[7991] 16610: L07949 Homo sapiens GnRH receptor mRNA, complete cds gi|292052|gb|L07949.1|HUMGNRHR[292052]

[7992] 16611: L03380 Human gonadotropin-releasing hormone receptor mRNA, complete cds gi|183421|gb|L03380.1|HUMGNRHREC[183421]

[7993] 16612: M73832 Human GM-CSF receptor (GM-CSF receptor) mRNA, complete cds gi|306773|gb|M73832.1|HUMGMCSFRA[306773]

[7994] 16613: M64445 Human GM-CSF receptor mRNA, complete cds gi|183361|gb|M64445.1|HUMGMCSF[183361]

[7995] 16614: L24751 Homo sapiens glucagon receptor gene, partial cds gi|404723|gb|L24751.1|HUMGLCGNR[404723]

[7996] 16615: L01406 Human growth hormone-releasing hormone receptor mRNA, complete cds gi|183172|gb|L01406.1|HUMGHRHREC[183172]

[7997] 16616: L08109 Human low-affinity Fc-gamma receptor IIC gene, exons 4-7 gi|183090|gb|L08109.1|HUMGFCIIC[183090]

[7998] 16617: L08108 Human low-affinity Fc-receptor IIB gene, exons 4-7 gi|183089|gb|L08108.1|HUMGFCIIB[183089]

[7999] 16618: L08107 Human low-affinity Fc-gamma receptor IIA gene, exons 4-7 gi|183088|gb|L08107.1|HUMGFCIIA[183088]

[8000] 16619: M69106 Human Gata3 enhancer-binding protein mRNA, complete cds gi|182999|gb|M69106.1|HUMGATA3BP[182999]

[8001] 16620: M59216 Human gamma-aminobutyric acid-A (GABA-A) receptor beta-1 subunit, exon 9 gi|18292|gb|M59216.1|HUMGABRB15[182921]

[8002] 16621: M59215 Human gamma-aminobutyric acid-A (GABA-A) receptor beta-1 subunit, exons 6, 7 and 8 gi|18292o0gbIM59215.1|HUMGABRB14[182920]

[8003] 16622: M59214 Human gamma-aminobutyric acid-A (GABA-A) receptor beta-1 subunit, exon 5 gi|182919|gb|M59214.1|HUMGABRB13[182919]

[8004] 16623: M59213 Human gamma-aminobutyric acid-A (GABA-A) receptor beta-1 subunit, exon 4 gi|182918|gb|M59213.1|HUMGABRB12[182918]

[8005] 16624: M59212 Human gamma-aminobutyric acid-A (GABA-A) receptor beta-1 subunit, exons 1, 2 and 3 gi|182917|gb|M59212.1|HUMGABRB11[182917]

[8006] 16625: M11067 Human c-fms proto-oncogene, exon 2, partial cds gi|182674|gb|M11067.1|HUMFMSB[182674]

[8007] 16626: M91647 Human high-affinity Fc IgG receptor gamma polypeptide (FcgammaRI) gene gi|182486|gb|M91647.1|HUMFCIGGHC[182486]

[8008] 16627: M91646 Human high-affinity Fc IgG receptor gamma polypeptide (FcgammaRI) gene gi|182485|gb|M91646.1|HUMFCIGGHB[182485]

[8009] 16628: M91645 Human high-affinity Fc IgG receptor gamma polypeptide (FcgammaRI) gene gi|182484|gb|M91645.1|HUMFCIGGHA[182484]

[8010] 16629: L03420 Human Fc-gamma receptor I B2 mRNA, complete cds gi|182461|gb|L03420.1|HUMFCGR1BB[182461]

[8011] 16630: L03419 Human Fc-gamma receptor I B1 mRNA, complete cds gi|182460|gb|L03419.1|HUMFCGR1B[182460]

[8012] 16632: L08603 Human melanocortin 4 receptor gene, complete cds gi|291977|gb|L08603.1|HUMEL4REC[291977]

[8013] 16633: M93111 Human endothelial cell-derived thrombin receptor cDNA, 5′ additional sequence gi|181945|gb|M93111.1|HUMECTR[181945]

[8014] 16635: M94915 Human dinucleotide repeat polymorphism gene gi|181836|gb|M94915.1|HUMDRP[181836]

[8015] 16636: L12116 Homo sapiens dinucleotide polymorphism in the G-protein coupled receptor gene (d20s32e) gi|181631|gb|L12116.1|HUMDNP[181631]

[8016] 16637: M25945 Human DNA sequence, C-beta locus gi|181627|gb|M25945.1|HUMDNAZ[181627]

[8017] 16639: L22303 Human dopamine receptor D2 gene, repeat polymorphism gi|441061|gb|L22303.1|HUMD2RP[441061]

[8018] 16640: L23333 Human corticotropin releasing factor receptor mRNA, complete cds gi|40869l|gb|L23333.1|HUMCRFRB[408691]

[8019] 16641: L23332 Human corticotropin releasing factor receptor mRNA, complete cds gi|408689|gb|L23332.1|HUMCRFRA[408689]

[8020] 16642: M73238 Human ciliary neurotrophic factor receptor (CNTFR) mRNA, complete cds gi|180710|gb|M73238.1|HUMCNTFR[180710]

[8021] 16643: M63835 Human IgG Fc receptor I gene, exon 6 and complete cds gi|180277|gb|M63835.1|HUMCFCGRI6[180277]

[8022] 16644: M63834 Human IgG Fc receptor I gene, exon 5 gi|180276|gb|M63834.1|HUMCFCGRI5[180276]

[8023] 16645: M63833 Human IgG Fc receptor I gene, exon 4 gi|180275|gb|M63833.1|HUMCFCGRI4[180275]

[8024] 16646: M63832 Human IgG Fc receptor I gene, exon 3 gi|180274|gb|M63832.1|HUMCFCGRI3[180274]

[8025] 16647: M63831 Human IgG Fc receptor I gene, exon 2 gi|180273|gb|M63831.1|HUMCFCGRI2[180273]

[8026] 16648: M63830 Human IgG Fc receptor I gene, exon 1 gi|180272|gb|M63830.1|HUMCFCGRI1[180272]

[8027] 16649: L13605 Human cholecystokinin A receptor mRNA, complete cds gi|306490|gb|L13605.1|HUMCCKAR[306490]

[8028] 16650: L08112 Human brain cholecystokinin-B/gastrin receptor mRNA, complete cds gi|306488|gb|L08112.1|HUMCCBGR[306488]

[8029] 16651: L04473 Human cholecystokinin receptor mRNA, complete cds gi|179997|gb|L04473.1 HUMCCKR[179997]

[8030] 16652: L00587 Human calcitonin receptor mRNA, complete cds gi|179879|gb|L00587.1|HUMCALREC[179879]

[8031] 16653: L08893 Human bombesin receptor subtype-3 mRNA, complete cds gi|291876|gb|L08893.1|HUMBOMB3S[291876]

[8032] 16654: L27594 Homo sapiens bradykinin B2 receptor gene sequence gi|508475|gb|L27594.1|HUMBB2R[508475]

[8033] 16656: M28639 Human autoimmune thyroid disease-related antigen mRNA gi|291864|gb|M28639.1|HUMATDRAGA[291864]

[8034] 16657: M91464 Human angiotensinogen II type-1A receptor gene, complete cds gi|179121|gb|M91464.1|HUMAT1A[179121]

[8035] 16658: M87290 Human angiotensin II type 1 receptor mRNA, complete cds gi|178682|gb|M87290.1|HUMANTIR[178682]

[8036] 16659: M26228 Human anti-angiotensinogen mRNA, partial cds gi|178641|gb|M26228.1|HUMANGA[178641]

[8037] 16661: M99590 Homo sapiens (clone pmt2-huma1b) alpha-1B adrenergic receptor gene sequence gi|178211|gb|M99590.1|HUMADRENB[178211]

[8038] 16663: M93415 Human activin type II receptor mRNA, complete cds gi|178049|gb|M93415.1|HUMACTIIA[178049]

[8039] 16664: M74954 Human alpha-S-beta-1 fibronectin receptor gi|177940|gb|M74954.1|HUMABFIREC[177940]

[8040] 16665: L25827 Human a7 nicotinic acetylcholine receptor mRNA gi|438616|gb|L25827.1|HUMA7NAR[438616]

[8041] 16666: M76446 Human alpha-A1-adrenergic receptor mRNA, complete cds gi|177806|gb|M76446.1|HUMA1AADR[177806]

[8042] 16667: M89955 Human 5-HT1D-type serotonin receptor gene, complete cds gi|177771|gb|M89955.1|HUM5HT1DA[177771]

[8043] 16668: M89478 Human 5-HT1B serotonin receptor gene gi|177770|gb|M89478.1|HUM5HT1BSR[177770]

[8044] 16669: L36162 Homo sapiens (clone TH3L) receptor tyrosine kinase type III (DID) mRNA gi|537326|gb|L36162.1|HUM3RTK[537326]

[8045] 16670: L05666 Homo sapiens NMDA receptor subunit (NR1) mRNA, complete cds gi|307302|gb|L05666.1|HUMNMDAREC[307302]

[8046] 16671: L14865 Human somatostatin receptor (SST) gene, complete cds gi|431094|gb|L14865.1|HUMSST28A[431094]

[8047] 16672: L24894 Human myelin protein zero (PO) gene, exon 1 gi|454413|gb|L24894.1|HUMAAC01[454413]

[8048] 16673: L24893 Human myelin protein zero (PO) gene, exons 2, 3, 4, 5, and 6 gi|454412|gb|L24893.1|HUMAAC02[454412]

[8049] 16674: L25119 Human Mu opiate receptor (MOR1) mRNA, complete cds gi|452072|gb|L25119.1|HUMMOR1X[452072]

[8050] 16676: L24804 Human (p23) mRNA, complete cds gi|438651|gb|L24804.1|HUMPRA[438651]

[8051] 16677: L21954 Human peripheral benzodiazepine receptor gene, exon 4 gi|483405|gb|L21954.1|HSPBR4[483405]

[8052] 16678: L21953 Human peripheral benzodiazepine receptor gene, exon 3 gi|483404|gb|L21953.1|HSPBR3[483404]

[8053] 16679: L21952 Human peripheral benzodiazepine receptor gene, exon 2 gi|483403|gb|L21952.1|HSPBR2[483403]

[8054] 16680: L21951 Human peripheral benzodiazepine receptor gene, exon 1 gi|483402|gb|L21951.1|HSPBR1[483402]

[8055] 16681: L21950 Human peripheral benzodiazepine receptor related mRNA sequence gi|483401|gb|L21950.1|HUMBENZA[483401]

[8056] 16682: L20817 Homo sapiens tyrosine protein kinase (CAK) gene, complete cds gi|306474|gb|L20817.1|HUMCAK[306474]

[8057] 16683: L20852 Human leukemia virus receptor 2 (GLVR2) mRNA, complete cds gi|306771|gb|L20852.1|HUMGLVR2X[306771]

[8058] 16684: L24470 Homo sapiens prostanoid FP receptor mRNA, complete cds gi|456563|gb|L24470.1|HUMPF2AR[456563]

[8059] 16685: L22214 Human adenosine A1 receptor (ADORA1) mRNA exons 1-6, complete cds gi|347520|gb|L22214.1|HUMADORA1X[347520]

[8060] 16687: L23503 Human glucagon-like peptide-1 receptor (GLP-1) mRNA, complete cds gi|402480|gb|L23503.1|HUMGLP1R[402480]

[8061] 16689: L10820 Human N-formyl peptide receptor (FPR1) gene, complete cds and Alu repeats gi|182739|gb|L10820.1|HUMFPR1A[182739]

[8062] 16690: M99293 Homo sapiens seven transmembrane segment receptor mRNA, complete cds gi|292516|gb|M99293.1|HUMSTSR[292516]

[8063] 16691: L01639 Human (clone HSY3RR) neuropeptide Y receptor (NPYR) mRNA, complete cds gi|189313|gb|L01639.1 HUMNYRECA[189313]

[8064] 16692: L20463 Human A3 adenosine receptor mRNA, complete cds gi|349448|gb|L20463.1|HUMA3ADENR[349448]

[8065] 16693: L19872 Human AH-receptor mRNA, complete cds gi|416141|gb|L19872.1|HUMAHREC[416141]

[8066] 16694: L17075 Human TGF-b superfamily receptor type I mRNA, complete cds gi|425147|gb|L17075.1|HUMTGFBRS[425147]

[8067] 16695: L14075 Homo sapiens immunoglobulin receptor alpha chain gene, complete cds gi|410211|gb|L14075.1|HUMIGERA[410211]

[8068] 16696: L11695 Human activin receptor-like kinase (ALK-5) mRNA, complete cds gi|431034|gb|L11695.1|HUMALK5A[431034]

[8069] 16697: L22206 Human vasopressin receptor V2 gene, complete cds gi|347522|gb|L22206.1|HUMV2R[347522]

[8070] 16698: M91211 Human receptor for advanced glycosylation end products (RAGE) mRNA, partial cds gi|190845|gb|M91211.1|HUMRAGE[190845]

[8071] 16699: L20469 Human truncated dopamine D3 receptor mRNA, complete cds gi|306688|gb|L20469.1|HUMD3DR[306688]

[8072] 16701: L11315 Homo sapiens receptor tyrosine kinase mRNA, complete cds gi|403386|gb|L11315.1|HUMRTK[403386]

[8073] 16702: L19315 Human cholecystokinin A receptor mRNA, complete cds gi|306595|gb|L19315.1|HUMCHOLREC[306595]

[8074] 16724: L15310 Homo sapiens glucagon-like peptide-1 receptor gene gi|292051|gb|L15310.1|HUMGLP1RGA[292051]

[8075] 16725: M99624 Human epidermal growth factor receptor-related gene, 5′ end gi|178251|gb|M99624.1|HUMAGGCRB[178251]Appendix II

[8076] 1: NM—017882 Homo sapiens ceroid-lipofuscinosis, neuronal 6, late infantile, variant (CLN6), mRNA gi|8923531|ref|NM—017882.1|[8923531]

[8077] 2: BI480800 H2RPE-0436 Human Retinal Pigment Epithelium (2]Homo sapiens cDNA 5′ similar to glycoprotein (transmembrane) nmb (GPNMB), mRNA sequence gi|18998609|gb|BI480800.1|BI480800[18998609]

[8078] 4: AC096780 Tcc1l8, complete sequence gi|18958727|gb|AC096780.1|[18958727]

[8079] 5: AC113243 Tcc1a22, complete sequence gi|18958719|gb|AC113243.1|[18958719]

[8080] 6: AF347029 Homo sapiens transmembrane protein (C60RF33) mRNA, complete cds gi|18873730|gb|AF347029.1|[18873730]

[8081] 8: NM—001183 Homo sapiens ATPase, H+transporting, lysosomal (vacuolar proton pump), subunit 1: (ATP6S1), mRNA gi|17136147|ref|NM—001183.2|[17136147]

[8082] 13: NM—005765 Homo sapiens ATPase, H+ transporting, lysosomal (vacuolar proton pump) membrane sector associated protein M8-9 (ATP6M8-9), mRNA gi|15011917|ref|NM—005765.2|[15011917]

[8083] 14: AB028140 Homo sapiens mRNA for spinesin, complete cds gi|12248916|dbj|FAB028140.1|[12248916]

[8084] 15: NM—002846 Homo sapiens protein tyrosine phosphatase, receptor type, N (PTPRN), mRNA gi|18860905|ref|NM—002846.2|[18860905]

[8085] 16: NM—002845 Homo sapiens protein tyrosine phosphatase, receptor type, M (PTPRM), mRNA gi|18860903|ref|NM—002845.2|[18860903]

[8086] 7: NM—002844 Homo sapiens protein tyrosine phosphatase, receptor type, K (PTPRK), mRNA gi|18860901|ref|NM—002844.2|[18860901]

[8087] 8: NM—002843 Homo sapiens protein tyrosine phosphatase, receptor type, J (PTPRJ), mRNA gi|18860899|ref|NM—002843.2|[18860899]

[8088] 9: NM—002841 Homo sapiens protein tyrosine phosphatase, receptor type, G (PTPRG), mRNA gi|18860897|ref|NM—002841.2|[18860897]

[8089] 20: NM—130440 Homo sapiens protein tyrosine phosphatase, receptor type, F (PTPRF), transcript variant 2, mRNA gi|18860895|ref|NM—130440.1|[18860895]

[8090] 21: NM—130393 Homo sapiens protein tyrosine phosphatase, receptor type, D (PTPRD), transcript variant 4, mRNA gi|18860893|ref|NM—130393.1|[18860893]

[8091] 22: NM—130392 Homo sapiens protein tyrosine phosphatase, receptor type, D (PTPRD), transcript variant 3, mRNA gi|18860891|ref|NM—130392.1|[18860891]

[8092] 23: NM—130391 Homo sapiens protein tyrosine phosphatase, receptor type, D (PTPRD), transcript variant 2, mRNA gi|18860889|ref|NM—130391.1|[18860889]

[8093] 24: NM—002840 Homo sapiens protein tyrosine phosphatase, receptor type, F (PTPRF), transcript variant 1, mRNA gi|18860871|ref|NM—002840.2|[18860871]

[8094] 25: NM—006504 Homo sapiens protein tyrosine phosphatase, receptor type, E (PTPRE), transcript variant 1, mRNA gi|18860860|ref|NM—006504.2|[18860860]

[8095] 26: NM—130435 Homo sapiens protein tyrosine phosphatase, receptor type, E (PTPRE), transcript variant 2, mRNA gi|18860858|ref|NM—130435.1|[18860858]

[8096] 27: NM—002842 Homo sapiens protein tyrosine phosphatase, receptor type, H (PTPRH), mRNA gi|4506312|ref|NM—002842.1|[4506312]

[8097] 28: NM—002839 Homo sapiens protein tyrosine phosphatase, receptor type, D (PTPRD), transcript variant 1, mRNA gi|4506308|ref|NM—002839.1|[4506308]

[8098] 29: BC024191 Homo sapiens, Similar to transmembrane protein HTMP10, clone IMAGE:4799785, mRNA gi|18848306|gb|BC024191.1|[18848306]

[8099] 30: NM—023068 Homo sapiens sialoadhesin (SN), mRNA gi|18765743|ref|NM—023068.2|[18765743]

[8100] 31: NM—032646 Homo sapiens tweety homolog 2 (Drosophila) (TTYH2), mRNA gi|17939343|ref|NM—032646.4|[17939343]

[8101] 32: NM—022006 Homo sapiens FXYD domain-containing ion transport regulator 7 (FXYD7), mRNA gi|11612658|ref|NM—022006.1|[11612658]

[8102] 33: NM—022003 Homo sapiens FXYD domain-containing ion transport regulator 6 (FXYD6), mRNA gi|11612654|ref|NM—022003.1|[11612654]

[8103] 34: NMO02127 Homo sapiens HLA-G histocompatibility antigen, class I, G (HLA-G), mRNA gi|18765718|ref|NM—002127.2|[18765718]

[8104] 35: NM—005516 Homo sapiens major histocompatibility complex, class I, E (HLA-E), mRNA gi|18765717|ref|NM—005516.2|[18765717]

[8105] 36: NM—002121 Homo sapiens major histocompatibility complex, class II, DP beta 1 (HLA-DPB1), mRNA gi|18765716|ref|NM—002121.3|[18765716]

[8106] 37: NM—006120 Homo sapiens major histocompatibility complex, class II, DM alpha (HLA-DMA), mRNA gi|18765714|ref|NM—006120.2|[18765714]

[8107] 38: NM—002116 Homo sapiens major histocompatibility complex, class I, A (HLA-A), mRNA gi|18765713|ref|NM—002116.3|[18765713]

[8108] 39: NM—130797 Homo sapiens dipeptidylpeptidase VI (DPP6), transcript variant 1, mRNA gi|18765697|ref|NM—130797.1|[18765697]

[8109] 40: NM—001936 Homo sapiens dipeptidylpeptidase VI (DPP6), transcript variant 2, mRNA gi|18765695|ref|NM—001936.2|[18765695]

[8110] 41: NM—018593 Homo sapiens solute carrier family 16 (monocarboxylic acid transporters), member 10 (SLC16A10), mRNA gi|18699729|ref|NM—018593.2|[18699729]

[8111] 42: BM510040 ig97b09.x1 HR85 islet Homo sapiens cDNA clone IMAGE: 3′ similar to TR:O60478 O60478 PUTATIVE SEVEN PASS TRANSMEMBRANE PROTEIN.;, mRNA sequence gi|18681183|gb|BM510040.1|BM510040[18681183]

[8112] 43: BM509858 ig94h01.y1 HR85 islet Homo sapiens cDNA clone IMAGE: 5′ similar to SW:MTRP_HUMAN Q15012 GOLGI 4-TRANSMEMBRANE SPANNING TRANSPORTER MTP;, mRNA sequence gi|18681001|gb|BM509858.1|BM509858[18681001]

[8113] 44: BM509717 ig93b05.y1 HR85 islet Homo sapiens cDNA clone IMAGE: 5′ similar to SW:MTRP_HUMAN Q15012 GOLGI 4-TRANSMEMBRANE SPANNING TRANSPORTER MTP;, mRNA sequence gi|18680860|gb|BM509717.1|BM509717[18680860]

[8114] 45: BM508064 ij38f06.x1 Human insulinoma Homo sapiens cDNA clone IMAGE:5633410 3′ similar to TR:P97544 P97544 ER TRANSMEMBRANE PROTEIN.;, mRNA sequence gi|18679207|gb|BM508064.1|BM508064[18679207]

[8115] 46: NM033543 Homo sapiens hypothetical protein R29124—1 (R29124—1), mRNA gi|16117774|ref|NM—033543.1|[16117774]

[8116] 47: NM—032732 Homo sapiens hypothetical protein MGC10763 (IL17RL), mRNA gi|14249349|ref|NM—032732.1|[14249349]

[8117] 48: NM—018676 Homo sapiens TMTSP for transmembrane molecule with thrombospondin module (LOC55901), mRNA gi|8923893|ref|NM—018676.1|[8923893]

[8118] 49: NM—016372 Homo sapiens seven transmembrane domain orphan receptor (TPRA40), mRNA gi|7705964|ref|NM—016372.1|[7705964]

[8119] 50: L47337 Homo sapiens transmembrane protein (TMC) mRNA, complete cds gi|18654193|gb|L47337.1|HUMTMC[18654193]

[8120] 56: Y13567 Homo sapiens HLA-B*07022 gene exon 1-5 gi|4007617|emb|Y13567.1|HSY13567[4007617]

[8121] 57: NM—032027 Homo sapiens beta-amyloid binding protein precursor (BBP), mRNA gi|17738309|ref|NM—032027.2|[17738309]

[8122] 58: NM—030913 Homo sapiens sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6C (SEMA6C), mRNA gi|16306551|ref|NM—030913.2|[16306551]

[8123] 59: NM—021203 Homo sapiens APMCF1 protein (APMCF1), mRNA gi|14917112|ref|NM—021203.2|[14917112]

[8124] 60: NM—006854 Homo sapiens KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 2 (KDELR2), mRNA gi|8051609|ref|NM—006854.2|[8051609]

[8125] 61: NM—014394 Homo sapiens growth hormone inducible transmembrane protein (GHITM), mRNA gi|7657479|ref|NM—014394.1|[7657479]

[8126] 62: NM—014399 Homo sapiens tetraspan NET-6 protein (NET-6), mRNA gi|7657372|ref|NM—014399.1|[7657372]

[8127] 63: NM—014478 Homo sapiens calcitonin gene-related peptide-receptor component protein (CGRP-RCP), mRNA gi|7656976|ref|NM—014478.1|[7656976]

[8128] 64: NM—007324 Homo sapiens MAD, mothers against decapentaplegic homolog (Drosophila) interacting protein, receptor activation anchor (MADHIP), transcript variant 1, mRNA gi|6552338|ref|NM—007324.1|[6552338]

[8129] 65: NM—007323 Homo sapiens MAD, mothers against decapentaplegic homolog (Drosophila) interacting protein, receptor activation anchor (MADHIP), transcript variant 2, mRNA gi|6552336|ref|NM—007323.1|[6552336]

[8130] 66: NMO06876 Homo sapiens UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 6 (B3GNT6), mRNA gi|5802983|ref|NM—006876.1|[5802983]

[8131] 67: NM—006675 Homo sapiens tetraspan transmembrane 4 super family (NET-5), mRNA gi|5729940|ref|NM—006675.1|[5729940]

[8132] 68: NM—006405 Homo sapiens transmembrane 9 superfamily member 1 (TM9SF1), mRNA gi|5453741|ref|NM—006405.1|[5453741]

[8133] 69: NM—005761 Homo sapiens plexin C1 (PLXNC1), mRNA gi|5032222|ref|NM—005761.1|[5032222]

[8134] 70: NM—005814 Homo sapiens glycoprotein A33 (transmembrane)(GPA33), mRNA gi|5031560|ref|NM—005814.1|[5031560]

[8135] 71: NM—004799 Homo sapiens MAD, mothers against decapentaplegic homolog (Drosophila) interacting protein, receptor activation anchor (MADHIP), transcript variant 3, mRNA gi|4759059|ref|NM—004799.1|[4759059]

[8136] 72: NM—003764 Homo sapiens syntaxin 11 (STX11), mRNA gi|4507286|ref|NM—003764.1|[4507286]

[8137] 73: NM—003622 Homo sapiens PTPRF interacting protein, binding protein 1 (liprin beta 1) (PPFIBP1), mRNA gi|4505986|ref|NM—003622.1|[4505986]

[8138] 74: NM—003626 Homo sapiens protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1 (PPFIA1), mRNA gi|4505982|ref|NM—003626.1|[4505982]

[8139] 75: NM—033266 Homo sapiens ER to nucleus signalling 2 (ERN2), mRNA gi|15149481|ref|NM—033266.1|[15149481]

[8140] 76: NM—030780 Homo sapiens folate transporter/carrier (LOC81034), mRNA gi|13540550|ref|NM—030780.1|[13540550]

[8141] 77: NM—025179 Homo sapiens plexin A2 (PLXNA2), mRNA gi|13378152|ref|NM—025179.1|[13378152]

[8142] 78: NM—022097 Homo sapiens hepatocellular carcinoma antigen gene 520 (LOC63928), mRNA gi|11545810|ref|NM—022097.1|[11545810]

[8143] 79: NM—019111 Homo sapiens major histocompatibility complex, class II, DR alpha (HLA-DRA), mRNA gi|18641378|ref|NM—019111.2|[18641378]

[8144] 80: NM—002120 Homo sapiens major histocompatibility complex, class II, DO beta (HLA-DOB), mRNA gi|18641377|ref|NM—002120.2|[18641377]

[8145] 81: NM—002118 Homo sapiens major histocompatibility complex, class II, DM beta (HLA-DMB), mRNA gi|18641376|ref|NM—002118.3|[18641376]

[8146] 82: NM—002125 Homo sapiens major histocompatibility complex, class II, DR beta 5 (HLA-DRB5), mRNA gi|18641374|ref|NM—002125.2|[18641374]

[8147] 83: NM—021983 Homo sapiens major histocompatibility complex, class II, DR beta 4 (HLA-DRB4), mRNA gi|18641372|ref|NM—021983.3|[18641372]

[8148] 84: NM—022555 Homo sapiens major histocompatibility complex, class II, DR beta 3 (HLA-DRB3), mRNA gi|18641371|ref|NM—022555.3|[18641371]

[8149] 85: NM—080923 Homo sapiens protein tyrosine phosphatase, receptor type, C (PTPRC), transcript variant 4, mRNA gi|18641365|ref|NM—080923.1|[18641365]

[8150] 86: NM—080922 Homo sapiens protein tyrosine phosphatase, receptor type, C (PTPRC), transcript variant 3, mRNA gi|18641363|ref|NM—080922.1|[18641363]

[8151] 87: NM—080921 Homo sapiens protein tyrosine phosphatase, receptor type, C (PTPRC), transcript variant 2, mRNA gi|18641361|ref|NM—080921.1|[18641361]

[8152] 88: NM—130778 Homo sapiens collagen, type XVII, alpha 1 (COL17A1), transcript variant short, mRNA gi|18641355|ref|NM—130778.1|[18641355]

[8153] 89: NM—000494 Homo sapiens collagen, type XVII, alpha 1 (COL17A1), transcript variant long, mRNA gi|18641353|ref|NM—000494.2|[18641353]

[8154] 90: NM—002838 Homo sapiens protein tyrosine phosphatase, receptor type, C (PTPRC), transcript variant 1, mRNA gi|18641346|ref|NM—002838.2|[18641346]

[8155] 91: NM—030950 Homo sapiens ret finger protein (RFP), transcript variant beta, mRNA gi|18641280|ref|NM—030950.2|[18641280]

[8156] 92: NM—130785 Homo sapiens TPTE and PTEN homologous inositol lipid phosphatase (TPIP), mRNA gi|18640755|ref|NM—130785.1|[18640755]

[8157] 93: AB057445 Homo sapiens hTAT1 mRNA for aromatic amino acid transporter, complete cds gi|18640046|dbj|AB057445.1|[18640046]

[8158] 94: NM—006510 Homo sapiens ret finger protein (RFP), transcript variant alpha, mRNA gi|17105396|ref|NM—006510.3|[17105396]

[8159] 95: NM—033554 Homo sapiens major histocompatibility complex, class II, DP alpha 1 (HLA-DPA1), mRNA gi|15809045|ref|NM—033554.1|[15809045]

[8160] 96: NM—005608 Homo sapiens protein tyrosine phosphatase, receptor type, C-associated protein (PTPRCAP), mRNA gi|5032004|ref|NM—005608.1|[5032004]

[8161] 97: BM491907 pgp2n.pk007.m20 Normalized Chicken Pituitary/Hypothalamus/Pineal Library (pgp2n) Gallus gallus cDNA clone pgp2n.pk007.m20 5′ similar to gb|AAH17476.1|AAH17476 (BC017476) sema domain, immunoglobulin domain (Ig), transmembrane domain TM) and short cytoplasmic domain, (semaphorin) 4C [Homo sapiens], mRNA sequence gi|18612838|gb|BM491907.1|BM491907[18612838]

[8162] 98: BM491823 pgp2n.pk007.i6 Normalized Chicken Pituitary/Hypothalamus/Pineal Library (pgp2n) Gallus gallus cDNA clone pgp2n.pk007.i6 5′ similar to ref|NP—055070.1 (NM—014255) transmembrane protein 4; putative type II membrane protein [Homo sapiens] |dbj|BAA76498.1|(AB015631) type II membrane protein [Homo sapiens], mRNA sequence gi|18612754|gb|BM491823.1|BM491823[18612754]

[8163] 99: BM491746 pgp2n.pk007.f14 Normalized Chicken Pituitary/Hypothalamus/Pineal Library (pgp2n) Gallus gallus cDNA clone pgp2n.pk007.f14 5′ similar to ref|XP—044533.2 (XM—044533) sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4B [Homo sapiens], mRNA sequence gi|18612677|gb|BM491746.1|BM491746[18612677]

[8164] 100: BM491722 pgp2n.pk007.d9 Normalized Chicken Pituitary/Hypothalamus/Pineal Library (pgp2n) Gallus gallus cDNA clone pgp2n.pk007.d9 5′ similar to ref|XP—032285.1 (XM—032285) similar to putative transmembrane protein; homolog of yeast Golgi membrane protein Yif1p (Yip1p-interacting factor) [Homo sapiens], mRNA sequence gi|18612653|gb|BM491722.1|BM491722[18612653]

[8165] 101: BM491453 pgp2n.pk006.h11 Normalized Chicken Pituitary/Hypothalamus/Pineal Library (pgp2n) Gallus gallus cDNA clone pgp2n.pk006.h11 5′ similar to ref|XP—058189.1 (XM—058189) similar to Similar to transmembrane 4 superfamily member 1 (H. sapiens) [Homo sapiens] gb|AAH14339.1|AAH14339 (BC014339) Similar to transmembrane 4 superfamily member 1[Homo sapiens], mRNA sequence gi|18612384|gb|BM491453.1|BM491453[18612384]

[8166] 102: BM490974 pgp2n.pk005.all Normalized Chicken Pituitary/Hypothalamus/Pineal Library (pgp2n) Gallus gallus cDNA clone pgp2n.pk005.a11 5′ similar to ref|XP—008022.1 (XM—008022) chromosome 16 open reading frame 5[Homo sapiens] gb|AAG35583.1|AF195661—1 (AF195661) transmembrane protein I1[Homo sapiens] gb|AAH02882.1|AAH02882 (BC002882) chromosome 16 open reading frame 5[Homo sapiens], mRNA sequence gi|18611905|gb|BM490974.1|BM490974[18611905]

[8167] 103: BM490515

[8168] pgp2n.pk003.k2 Normalized Chicken Pituitary/Hypothalamus/Pineal Library (pgp2n) Gallus gallus cDNA clone pgp2n.pk003.k2 5′ similar to ref|NP—055070.1 (NM—014255) transmembrane protein 4; putative type II membrane protein [Homo sapiens] |dbj|BAA76498.1| (AB015631) type II membrane protein [Homo sapiens], mRNA sequence gi|18611446|gb|BM490515.1|BM490515[18611446]

[8169] 104: BM490496 pgp2n.pk003.j21 Normalized Chicken Pituitary/Hypothalamus/Pineal Library (pgp2n) Gallus gallus cDNA clone pgp2n.pk003.j21 5′ similar to ref|XP—015557.1 (XM—015557) transmembrane gamma-carboxyglutamic acid protein 3[Homo sapiens], mRNA sequence gi|18611427|gi|BM490496.1|BM490496[18611427]

[8170] 105: BM490381 pgp2n.pk003.e10 Normalized Chicken Pituitary/Hypothalamus/Pineal Library (pgp2n) Gallus gallus cDNA clone pgp2n.pk003.e10 5′ similar to ref|NP—057641.1 (NM—016557) orphan seven-transmembrane receptor, chemokine related [Homo sapiens] ref|XP—016022.1| (XM—016022) orphan seven-transmembrane receptor, chemokine related [Homo sapiens] sp|Q9NPB9|CKRB_HUMAN C-C CHEMOKINE RECEPTOR TYPE, mRNA sequence gi|18611312|gb|BM490381.1|BM490381[18611312]

[8171] 106: BM489618 pgm2n.pk011.h5 Normalized Chicken Breast Muscle, Leg Muscle, and Epiphyseal Growth Plate cDNA library (pgm2n) Gallus gallus cDNA clone pgm2n.pk011.h5 5′ similar to ref|NP—114131.1 (NM—031925) transmembrane protein induced by tumor necrosis factor alpha [Homo sapiens] gb|AAK16442.1|AF327923—1 (AF327923) transmembrane protein induced by tumor necrosis factor alpha [Homo sapiens], mRNA sequence gi|18610549|gb|BM489618.1|BM489618[18610549]

[8172] 107: BM489501 pgm2n.pk011.b24 Normalized Chicken Breast Muscle, Leg Muscle, and Epiphyseal Growth Plate cDNA library (pgm2n) Gallus gallus cDNA clone pgm2n.pk011.b24 5′ similar to ref|NP—055070.1 (NM—014255) transmembrane protein 4; putative type II membrane protein [Homo sapiens] |dbj|BAA76498.1|(AB015631) type II membrane protein [Homo sapiens], mRNA sequence gi|18610432|gb|BM489501.1|BM489501[18610432]

[8173] 108: BM489487 pgm2n.pk011.a8 Normalized Chicken Breast Muscle, Leg Muscle, and Epiphyseal Growth Plate cDNA library (pgm2n) Gallus gallus cDNA clone pgm2n.pk011.a8 5′ similar to gb|AAC64943.1 (AF084481) transmembrane protein [Homo sapiens], mRNA sequence gi|18610418|gb|BM489487.1|BM489487[18610418]

[8174] 09: BM489466 pgm2n.pk010.p5 Normalized Chicken Breast Muscle, Leg Muscle, and Epiphyseal Growth Plate cDNA library (pgm2n) Gallus gallus cDNA clone pgm2n.pk010.p5 5′ similar to|dbj|AK056595.1|AK056595 Homo sapiens cDNA FLJ32033 fis, clone NTONG2000265, weakly similar to Probable transmembrane protein of fission yeast, mRNA sequence gi|18610397|gb|BM489466.1|BM489466[18610397]

[8175] 110: BM489443 pgm2n.pk010.o4 Normalized Chicken Breast Muscle, Leg Muscle, and Epiphyseal Growth Plate cDNA library (pgm2n) Gallus gallus cDNA clone pgm2n.pk010.o4 5 ′ similar to ref|XP—008022.1 (XM—008022) chromosome 16 open reading frame 5 [Homo sapiens] gb|AAG35583.1|AF195661—1 (AF195661) transmembrane protein I1[Homo sapiens] gb|AAH02882.1|AAH02882 (BC002882) chromosome 16 open reading frame 5[Homo sapiens], mRNA sequence gi|18610374|gb|BM489443.1|BM489443[18610374]

[8176] 111: BM489432 pgm2n.pk010.o15 Normalized Chicken Breast Muscle, Leg Muscle, and Epiphyseal Growth.Plate cDNA library (pgm2n) Gallus gallus cDNA clone pgm2n.pk010.o15 5′ similar to ref|NP—055070.1 (NM—014255) transmembrane protein 4; putative type II membrane protein [Homo sapiens] |dbj|BAA76498.1|(AB015631) type II membrane protein [Homo sapiens], mRNA sequence gi|18610363|gb|BM489432.1|BM489432[18610363]

[8177] 112: BM489389 pgm2n.pk010.m15 Normalized Chicken Breast Muscle, Leg Muscle, and Epiphyseal Growth Plate cDNA library (pgm2n) Gallus gallus cDNA clone pgm2n.pk010.m15 5′ similar to ref|XP—028438.1 (XM—028438) CGI-101 protein [Homo sapiens] gb|AAF99603.1|AF242523—1 (AF242523) hypothetical transmembrane protein SBBI53 [Homo sapiens] gb|AAG43049.1|AF132289—1 (AF132289) F-LAN-1 [Homo sapiens] gb|AAH10890.1|AAH10890 (BC010890), mRNA sequence gi|18610320|gb|BM489389.1|BM489389[18610320]

[8178] 113: BM489272 pgm2n.pk010.g4 Normalized Chicken Breast Muscle, Leg Muscle, and Epiphyseal Growth Plate cDNA library (pgm2n) Gallus gallus cDNA clone pgm2n.pk010.g4 5′ similar to ref|NP—055070.1 (NM—014255) transmembrane protein 4; putative type II membrane protein [Homo sapiens] |dbj|BAA76498.1|(AB015631) type II membrane protein [Homo sapiens], mRNA sequence gi|18610203|gb|BM489272.1|BM489272[18610203]

[8179] 114: BM489267 pgm2n.pk010.g2 Normalized Chicken Breast Muscle, Leg Muscle, and Epiphyseal Growth Plate cDNA library (pgm2n) Gallus gallus cDNA clone pgm2n.pk010.g2 5′ similar to ref|NP—055070.1 (NM—014255) transmembrane protein 4; putative type II membrane protein [Homo sapiens]dbj|BAA76498.1| (AB015631) type II membrane protein [Homo sapiens], mRNA sequence gi|18610198|gb|BM489267.1|BM489267[18610198]

[8180] 115: BM488196 pgm2n.pk006.n2 Normalized Chicken Breast Muscle, Leg Muscle, and Epiphyseal Growth Plate cDNA library (pgm2n) Gallus gallus cDNA clone pgm2n.pk006.n2 5′ similar to ref|NP114434.1 (NM—032045) kringle-containing transmembrane protein; kringle-coding gene marking the eye and the nose [Homo sapiens] dbj|BAB40969.1|(AB059618) kringle-containing transmembrane protein [Homo sapiens], mRNA sequence gi|18609127|gb|BM488196.1|BM488196[18609127]

[8181] 116: BM488072 pgm2n.pk006.h15 Normalized Chicken Breast Muscle, Leg Muscle, and Epiphyseal Growth Plate cDNA library (pgm2n) Gallus gallus cDNA clone pgm2n.pk006.h15 5′ similar to ref|XP—044533.2 (XM—044533) sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4B [Homo sapiens], mRNA sequence gi|18609003|gb|BM488072.1|BM488072[18609003]

[8182] 117: BM487945 pgm2n.pk006.b16 Normalized Chicken Breast Muscle, Leg Muscle, and Epiphyseal Growth Plate cDNA library (pgm2n) Gallus gallus cDNA clone pgm2n.pk006.b16 5′ similar to ref|NP—055070.1 (NM—014255) transmembrane protein 4; putative type II membrane protein [Homo sapiens] |dbj|BAA76498.1|(AB015631) type II membrane protein [Homo sapiens], mRNA sequence gi|18608876|gb|BM487945.1|BM487945[18608876]

[8183] 118: BM487175 pgm2n.pk003.m18 Normalized Chicken Breast Muscle, Leg Muscle, and Epiphyseal Growth Plate cDNA library (pgm2n) Gallus gallus cDNA clone pgm2n.pk003.ml8 5′ similar to ref|NP—055070.1 (NM—014255) transmembrane protein 4; putative type II membrane protein [Homo sapiens] |dbj|BAA76498.1|(AB015631) type II membrane protein [Homo sapiens], mRNA sequence gi|18608105|gb|BM487175.1|BM487175[18608105]

[8184] 119: BM487035 pgm2n.pk003.f7 Normalized Chicken Breast Muscle, Leg Muscle, and Epiphyseal Growth Plate cDNA library (pgm2n) Gallus gallus cDNA clone pgm2n.pk003.f7 5′ similar to emb|CAC88191.1 (AL136141) bA138E2.2 (novel protein (lung seven transmembrane receptor 1 (LUSTR1), KIAA1623, FLJ22591, MGC15440)) [Homo sapiens], mRNA sequence gi|18607965|gb|BM487035.1|BM487035[18607965]

[8185] 120: BM486914 pgm2n.pk003.all Normalized Chicken Breast Muscle, Leg Muscle, and Epiphyseal Growth Plate cDNA library (pgm2n) Gallus gallus cDNA clone pgm2n.pk003.a11 5′ similar to ref|NP055070.1 (NM—014255) transmembrane protein 4; putative type II membrane protein [Homo sapiens] |dbj|BAA76498.1|(AB015631) type II membrane protein [Homo sapiens], mRNA sequence gi|18607844|gb|BM486914.1|BM486914[18607844]

[8186] 121: NT—009151 Homo sapiens chromosome 11 working draft sequence segment gi|18604868|ref|NT—009151.8|Hs11—9308[18604868]

[8187] 122: NT—010823 Homo sapiens chromosome 17 working draft sequence segment gi|18604211|ref|NT—010823.8|Hs17—10980[18604211]

[8188] 123: XM—008517 Homo sapiens similar to transmembrane 4 superfamily member 5 (H. sapiens) (LOC147059), mRNA gi|18604159|ref|XM—008517.4|[18604159]

[8189] 124: NT—009482 Homo sapiens chromosome 12 working draft sequence segment gi|18601829|ref|NT—009482.8|Hs12—9639[18601829]

[8190] 125: NT—009458 Homo sapiens chromosome 12 working draft sequence segment gi|18601539|ref|NT—009458.7|Hs12—9615[18601539]

[8191] 126: NT—005428 Homo sapiens chromosome 2 working draft sequence segment gi|18600405|ref|NT—005428.7|Hs2—5585[18600405]

[8192] 127: XM—087234 Homo sapiens sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4F (SEMA4F), mRNA gi|18600294|ref|XM—087234.1|[18600294]

[8193] 128: NT—030593 Homo sapiens chromosome 2 working draft sequence segment gi|18599598|ref|NT—030593.2|Hs2—30849[18599598]

[8194] 129: XM—092364 Homo sapiens similar to seven transmembrane receptor (LOC165082), mRNA gi|18599578|ref|XM—092364.1|[18599578]

[8195] 30: NT—025667 Homo sapiens chromosome 3 working draft sequence segment gi|18599563|ref|NT—025667.2|Hs3—25823[18599563]

[8196] 131: NT—010478 Homo sapiens chromosome 16 working draft sequence segment gi|18598685|ref|NT—010478.8|Hs16—10635[18598685]

[8197] 132: NT—010422 Homo sapiens chromosome 16 working draft sequence segment gi|18598469|ref|NT—010422.8|Hs16—10579[18598469]

[8198] 133: NT—030136 Homo sapiens chromosome 14 working draft sequence segment gi|18597657|ref|NT—030136.3|Hs14—30391[18597657]

[8199] 134: XM—090902 Homo sapiens similar to transmembrane 9 superfamily member 1 (H. sapiens) (LOC161426), mRNA gi|18597655|ref|XM—090902.1|[18597655]

[8200] 135: XM—085169 Homo sapiens similar to seven transmembrane receptor BLTR2; leukotriene B4 receptor BLT2 (H. sapiens) (LOC145549), mRNA gi|18597626|ref|XM—085169.1|[18597626]

[8201] 136: NT—026437 Homo sapiens chromosome 14 working draft sequence segment gi|18597566|ref|NT—026437.6|Hs14—26604[18597566]

[8202] 137: XM—085149 Homo sapiens similar to fibronectin leucine rich transmembrane protein 2 (H. sapiens)(LOC145535), mRNA gi|18597448|ref|XM—085149.1|[18597448]

[8203] 138: NT—025892 Homo sapiens chromosome 14 working draft sequence segment gi|18597282|ref|NT—025892.7|Hs14—26048[18597282]

[8204] 139: NT—019583 Homo sapiens chromosome 14 working draft sequence segment gi|18596851|ref|NT—019583.8|Hs14—19739[18596851]

[8205] 140: XM—093204 Homo sapiens similar to G protein-coupled receptor 64; G protein-coupled receptor, epididymis-specific (seven transmembrane family) (LOC170247), mRNA gi|18596481|ref|XM—093204.1|[18596481]

[8206] 141: NT—025319 Homo sapiens chromosome X working draft sequence segment gi|18596220|ref|NT—025319.8|HsX—25475[18596220]

[8207] 142: NT—011719 Homo sapiens chromosome X working draft sequence segment gi|18595448|ref|NT—011719.6|HsX—11876[18595448]

[8208] 143: XM—093073 Homo sapiens similar to TRANSMEMBRANE 9 SUPERFAMILY PROTEIN MEMBER 2 PRECURSOR (LOC170048), mRNA gi|18595444|ref|XM—093073.1|[18595444]

[8209] 144: XM—060026 Homo sapiens similar to transmembrane 9 superfamily member 2; 76 kDa membrane protein; transmembrane protein 9 superfamily member 2 (LOC139375), mRNA gi|18595426|ref|XM—060026.2|[18595426]

[8210] 145: NT—011687 Homo sapiens chromosome X working draft sequence segment gi|18595291|ref|NT—011687.8|HsX—11844[18595291]

[8211] 146: NT—011657 Homo sapiens chromosome X working draft sequence segment gi|18595178|ref|NT—011657.8|HsX—11814[18595178]

[8212] 147: XM—032382 Homo sapiens transmembrane 4 superfamily member 2 (TM4SF2), mRNA gi|18595108|ref|XM—032382.3|[18595108]

[8213] 148: XM—055073 Homo sapiens similar to transmembrane phosphatase with tensin homology (H. sapiens) (LOC150132), mRNA gi|18593511|ref|XM—055073.3|[18593511]

[8214] 149: XM—009671 Homo sapiens transmembrane, prostate androgen induced RNA (TMEPAI), mRNA gi|18591987|ref|XM—009671.7|[18591987]

[8215] 150: NT—011296 Homo sapiens chromosome 19 working draft sequence segment gi|18591133|ref|NT—011296.8|Hs19—11453[18591133]

[8216] 151: NT—011295 Homo sapiens chromosome 19 working draft sequence segment gi|18591086|ref|NT—011295.5|Hs19—11452[18591086]

[8217] 152: NT—011294 Homo sapiens chromosome 19 working draft sequence segment gi|18591029|ref|NT—011294.7|Hs19—11451[18591029]

[8218] 153: NT—011255 Homo sapiens chromosome 19 working draft sequence segment gi|18590680|ref|NT—011255.8|Hs19—11412[18590680]

[8219] 154: NT—011233 Homo sapiens chromosome 19 working draft sequence segment gi|18590500|ref|NT—011233.8|Hs19—11390[18590500]

[8220] 155: XM—032285 Homo sapiens similar to putative transmembrane protein; homolog of yeast Golgi membrane protein Yif1p (Yip1p-interacting factor) (LOC90522), mRNA gi|18590452|ref|XM—032285.2|[18590452]

[8221] 156: NT—011151 Homo sapiens chromosome 19 working draft sequence segment gi|18590324|ref|NT—011151.8|Hs19—11308[18590324]

[8222] 157: NT—011109 Homo sapiens chromosome 19 working draft sequence segment gi|18589940|ref|NT—011109.8|Hs19—11266[18589940]

[8223] 158: NT—030157 Homo sapiens chromosome 17 working draft sequence segment gi|18588299|ref|NT—030157.3|Hs17—30412[18588299]

[8224] 159: XM—096100 Homo sapiens transmembrane activator and CAML interactor (TACI), mRNA gi|18588295|ref|XM—096100.1|[18588295]

[8225] 160: NT—010672 Homo sapiens chromosome 17 working draft sequence segment gi|18586808|ref|NT—010672.8|Hs17—10829[18586808]

[8226] 161: NT—024776 Homo sapiens chromosome 16 working draft sequence segment gi|18585964|ref|NT—024776.4|Hs16—24932[18585964]

[8227] 162: NT—015360

[8228] Homo sapiens chromosome 16 working draft sequence segment gi|18585813|ref|NT—015360.8|Hs16—15516[18585813]

[8229] 163: NT—010552 Homo sapiens chromosome 16 working draft sequence segment gi|18585429|ref|NT—010552.8|Hs16—10709[18585429]

[8230] 164: NT—010356 Homo sapiens chromosome 15 working draft sequence segment gi|18584698|ref|NT—010356.8|Hs15—10513[18584698]

[8231] 165: NT—010351 Homo sapiens chromosome 15 working draft sequence segment gi|18584556|ref|NT—010351.8|Hs15—10508[18584556]

[8232] 166: NT—010224 Homo sapiens chromosome 15 working draft sequence segment gi|18583998|ref|NT—010224.7|Hs15—10381[18583998]

[8233] 167: XM—083914 Homo sapiens transmembrane 6 superfamily member 1 (TM6SF1), mRNA gi|18583986|ref|XM—083914.1|[18583986]

[8234] 168: XM—083903 Homo sapiens transmembrane 9 superfamily member 1 (TM9SF1), mRNA gi|18583350|ref|XM—083903.1|[18583350]

[8235] 169: NT—010036 Homo sapiens chromosome 14 working draft sequence segment gi|18583080|ref|NT—010036.8|Hs14—10193[18583080]

[8236] 170: XM—028295 Homo sapiens calponin like transmembrane domain protein (calmin), mRNA gi|18582992|ref|XM—028295.3|[18582992]

[8237] 171: NT—029430 Homo sapiens chromosome 13 working draft sequence segment gi|18582622|ref|NT—029430.4|Hs13—29589[18582622]

[8238] 172: NT—009967 Homo sapiens chromosome 13 working draft sequence segment gi|18582005|ref|NT—009967.8|Hs13—10124[18582005]

[8239] 173: NT—009952 Homo sapiens chromosome 13 working draft sequence segment gi|18581926|ref|NT—009952.8|Hs13—10109[18581926]

[8240] 174: NT—009917 Homo sapiens chromosome 13 working draft sequence segment gi|18581517|ref|NT—009917.8|Hs13—10074[18581517]

[8241] 175: XM—084974 Homo sapiens transmembrane phosphatase with tensin homology (TPTE), mRNA gi|18581435|ref|XM—084974.1|[18581435]

[8242] 176: NT—009910 Homo sapiens chromosome 13 working draft sequence segment gi|18581383|ref|NT—009910.8|Hs13—10067[18581383]

[8243] 177: NT—009711 Homo sapiens chromosome 12 working draft sequence segment gi|18580591|ref|NT—009711.8|Hs12—9868[18580591]

[8244] 178: NT—009540 Homo sapiens chromosome 12 working draft sequence segment gi|18579972|ref|NT—009540.8|Hs12—9697[18579972]

[8245] 179: NT—009487 Homo sapiens chromosome 12 working draft sequence segment gi|18579817|ref|NT—009487.8|Hs12—9644[18579817]

[8246] 180: XM—084852 Homo sapiens similar to transmembrane protein induced by tumor necrosis factor alpha (LOC144404), mRNA gi|18579801|ref|XM—084852.1|[18579801]

[8247] 181: NT—009471 Homo sapiens chromosome 12 working draft sequence segment gi|18579778|ref|NT—009471.8|Hs12—9628[18579778]

[8248] 182: XM—084845 Homo sapiens similar to interferon induced transmembrane protein 3 (1-8U) (LOC144383), mRNA gi|18579688|ref|XM—084845.1|[18579688]

[8249] 183: XM—006748 Homo sapiens seven transmembrane protein TM7SF3 (TM7SF3), mRNA gi|18579647|ref|XM—006748.5|[18579647]

[8250] 184: NT—030809 Homo sapiens chromosome 12 working draft sequence segment gi|18579377|ref|NT—030809.2|Hs12—31065[18579377]

[8251] 185: NT—024394 Homo sapiens chromosome 12 working draft sequence segment gi|18579035|ref|NT—024394.7|Hs12—24550[18579035]

[8252] 186: NT—009237 Homo sapiens chromosome 11 working draft sequence segment gi|18578641|ref|NT—009237.8|Hs11—9394[18578641]

[8253] 187: NT—009215 Homo sapiens chromosome 11 working draft sequence segment gi|18578584|ref|NT—009215.8|Hs11—9372[18578584]

[8254] 188: NT—008992 Homo sapiens chromosome 11 working draft sequence segment gi|18578338|ref|NT—008992.7|Hs11—9149[18578338]

[8255] 189: XM—055266 Homo sapiens putative transmembrane protein; homolog of yeast Golgi membrane protein Yif1p (Yip1p-interacting factor) (54TM), mRNA gi|18578177|ref|XM—055266.2|[18578177]

[8256] 190: XM—045525 Homo sapiens transmembrane 7 superfamily member 2 (TM7SF2), mRNA gi|18578063|ref|XM—045525.4|[18578063]

[8257] 191: XM—006111 Homo sapiens fibronectin leucine rich transmembrane protein 1 (FLRT1), mRNA gi|18578050|ref|XM—006111.5|[18578050]

[8258] 192: NT—008804 Homo sapiens chromosome 10 working draft sequence segment gi|18576536|ref|NT—008804.8|Hs10—8961[18576536]

[8259] 193: XM—084484 Homo sapiens similar to sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4G; sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, 4G (LOC143288), mRNA gi|18576428|ref|XM—084484.1|[18576428]

[8260] 194: NT—008609 Homo sapiens chromosome 10 working draft sequence segment gi|18575857|ref|NT—008609.8|Hs10—8766[18575857]

[8261] 195: NT—029394 Homo sapiens chromosome 10 working draft sequence segment gi|18574577|ref|NT—029394.3|Hs10—29553[18574577]

[8262] 196: NT—024089 Homo sapiens chromosome 10 working draft sequence segment gi|18574182|ref|NT—024089.8|Hs10—24245[18574182]

[8263] 197: NT—024064 Homo sapiens chromosome 10 working draft sequence segment gi|18574077|ref|NT—024064.8|Hs10—24220[18574077]

[8264] 198: XM—084331 Homo sapiens similar to growth hormone inducible transmembrane protein (H. sapiens) (LOC170427), mRNA gi|18574063|ref|XM—084331.1|[18574063]

[8265] 199: XM—043589 Homo sapiens growth hormone inducible transmembrane protein (GHITM), mRNA gi|18574061|ref|XM—043589.3|[18574061]

[8266] 200: NT—008554 Homo sapiens chromosome 9 working draft sequence segment gi|18573734|ref|NT—008554.8|Hs9—8711[18573734]

[8267] 201: XM—071188 Homo sapiens similar to mucin 1, transmembrane (LOC138940), mRNA gi|18573702|ref|XM—071188.2|[18573702]

[8268] 202: NT—008476 Homo sapiens chromosome 9 working draft sequence segment gi|18573649|ref|NT—008476.8|Hs9—8633[18573649]

[8269] 203: NT—008421 Homo sapiens chromosome 9 working draft sequence segment gi|18573390|ref|NT—008421.8|Hs9—8578[18573390]

[8270] 204: NT—031831 Homo sapiens chromosome 9 working draft sequence segment gi|18572946|ref|NT—031831.1|Hs9—32002[18572946]

[8271] 205: NT—031830 Homo sapiens chromosome 9 working draft sequence segment gi|18572933|ref|NT—031830.1|Hs9—32001[18572933]

[8272] 206: NT—029366 Homo sapiens chromosome 9 working draft sequence segment gi|18572447|ref|NT—029366.4|Hs9—29525[18572447]

[8273] 207: NT—027082 Homo sapiens chromosome 9 working draft sequence segment gi|18572282|ref|NT—027082.5|Hs9—27242[18572282]

[8274] 208: NT—024010 Homo sapiens chromosome 9 working draft sequence segment gi|18572162|ref|NT—024010.7|Hs9—24166[18572162]

[8275] 209: XM—108898 Homo sapiens sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4D (SEMA4D), mRNA gi|18572160|ref|XM—108898.1|[18572160]

[8276] 210: NT—023967 Homo sapiens chromosome 9 working draft sequence segment gi|18571929|ref|NT—023967.8|Hs9—24123[18571929]

[8277] 211: XM—095756 Homo sapiens similar to transmembrane protein 2 (H. sapiens)(LOC169529), mRNA gi|18571901|ref|XM—095756.1|[18571901]

[8278] 212: NT—008253 Homo sapiens chromosome 8 working draft sequence segment gi|18571429|ref|NT—008253.8|Hs8—8410[18571429]

[8279] 213: NT—008079 Homo sapiens chromosome 8 working draft sequence segment gi|18570812|ref|NT—008079.8|Hs8—8236[18570812]

[8280] 214: NT—007997 Homo sapiens chromosome 8 working draft sequence segment gi|18570417|ref|NT—007997.8|Hs8—8154[18570417]

[8281] 215: XM—095564 Homo sapiens similar to transmembrane trafficking protein (LOC169193), mRNA gi|18570401|ref|XM—095564.1|[18570401]

[8282] 216: NT—007978 Homo sapiens chromosome 8 working draft sequence segment gi|18570256|ref|NT—007978.8|Hs8—8135[18570256]

[8283] 217: NT—030735 Homo sapiens chromosome 8 working draft sequence segment gi|8569963|ref|NT—030735.2|Hs8—30991[18569963]

[8284] 218: NT—007905 Homo sapiens chromosome 7 working draft sequence segment gi|18568542|ref|NT—007905.8|Hs7—8062[18568542]

[8285] 219: NT—007902 Homo sapiens chromosome 7 working draft sequence segment gi|18568515|ref|NT—007902.8|Hs7—8059[18568515]

[8286] 220: AF132746 Homo sapiens transmembrane protein mRNA, complete cds gi|18568116|gb|AF132746.1|[18568116]

[8287] 221: NT—007867 Homo sapiens chromosome 7 working draft sequence segment gi|18568101|ref|NT—007867.8|Hs7—8024[18568101]

[8288] 222: NT—007751 Homo sapiens chromosome 7 working draft sequence segment gi|18567173|ref|NT—007751.8|Hs7—7908[18567173]

[8289] 223: NT—031815 Homo sapiens chromosome 7 working draft sequence segment gi|18566709|ref|NT—031815.1|Hs7—31986[18566709]

[8290] 224: NT—031811 Homo sapiens chromosome 7 working draft sequence segment gi|18566667|ref|NT—031811.1|Hs7—31982[18566667]

[8291] 225: XM—095132 Homo sapiens similar to dM538M10.1 (novel 7 transmembrane receptor (rhodopsin family) (olfactory receptor like) protein similar to human HS6Ml-21) (LOC154958), mRNA gi|18566661|ref|XM—095132.1|[18566661]

[8292] 226: NT—031807 Homo sapiens chromosome 7 working draft sequence segment gi|18566613|ref|NT—031807.1|Hs7—31978[18566613]

[8293] 227: NT—030004 Homo sapiens chromosome 7 working draft sequence segment gi|18566403|ref|NT—030004.3|Hs7—30259[18566403]

[8294] 228: NT—027064 Homo sapiens chromosome 7 working draft sequence segment gi|18566143|ref|NT—027064.5|Hs7—27224[18566143]

[8295] 229: NT—017168 Homo sapiens chromosome 7 working draft sequence segment gi|18565551|ref|NT—017168.8|Hs7—17324[18565551]

[8296] 230: NT—007592 Homo sapiens chromosome 6 working draft sequence segment gi|18565438|ref|NT—007592.8|Hs6—7749[18565438]

[8297] 231: XM—094938 Homo sapiens similar to 573K1.2 (mm17M1-3 (novel 7 transmembrane receptor (rhodopsin family) (olfactory receptor LIKE) protein)) (LOC168233), mRNA gi|18565395|ref|XM—094938.1|[18565395]

[8298] 232: XM—094903 Homo sapiens similar to 573K1.15 (mm17M1-6 (novel 7 transmembrane receptor (rhodopsin family) (olfactory receptor LIKE) protein)) (LOC168189), mRNA gi|18565249|ref|XM—094903.1|[18565249]

[8299] 233: XM—094939 Homo sapiens similar to dM538M10.7 (novel 7 transmembrane receptor (rhodopsin family)(olfactory receptor like) protein) (LOC154634), mRNA gi|18565093|ref|XM—094939.1|[18565093]

[8300] 234: NT—007402 Homo sapiens chromosome 6 working draft sequence segment gi|18564193|ref|NT—007402.8|Hs6—7559[18564193]

[8301] 235: XM—069322 Homo sapiens similar to transmembrane protein 2 (LOC135381), mRNA gi|18564165|ref|XM—069322.2|[18564165]

[8302] 236: XM—087914 Homo sapiens similar to dJ402H5.1 (novel 7 transmembrane receptor of the rhodopsin family) (LOC154354), mRNA gi|18564052|ref|XM—087914.1|[18564052]

[8303] 237: XM—087917 Homo sapiens similar to embryonic seven-span transmembrane protein-like protein (LOC154344), mRNA gi|18564031|ref|XM—087917.1|[18564031]

[8304] 238: XM 094741 Homo sapiens similar to 573K1.15 (mm17M1-6 (novel 7 transmembrane receptor (rhodopsin family) (olfactory receptor LIKE) protein)) (LOC167905), mRNA gi|18563541|ref|XM—094741.1|[18563541]

[8305] 239: NT—025741 Homo sapiens chromosome 6 working draft sequence segment gi|18563240|ref|NT—025741.7|Hs6—25897[18563240]

[8306] 240: NT—023451 Homo sapiens chromosome 6 working draft sequence segment gi|18563080|ref|NT—023451.8|Hs6—23607[18563080]

[8307] 241: XM—069021 Homo sapiens similar to putative transmembrane protein PTG (LOC134801), mRNA gi|18563039|ref|XM—069021.2|[18563039]

[8308] 242: NT—006725 Homo sapiens chromosome 5 working draft sequence segment gi|18561712|ref|NT—006725.8|Hs5—6882[18561712]

[8309] 243: XM—094515 Homo sapiens similar to transmembrane receptor Unc5H1 (LOC167476), mRNA gi|18561698|ref|XM—094515.1|[18561698]

[8310] 244: NT—006576 Homo sapiens chromosome 5 working draft sequence segment gi|18561313|ref|NT—006576.8|Hs5—6733[18561313]

[8311] 245: XM—004042 Homo sapiens sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5A (SEMA5A), mRNA gi|18561264|ref|XM—004042.7|[18561264]

[8312] 246: XM—087665 Homo sapiens similar to semaphorin 6A1; sema domain, transmembrane domain (TM), and cytoplasmic domain, 6A; semaphorin 6A-1 (LOC153420), mRNA gi|18560683|ref|XM—087665.1|[18560683]

[8313] 247: NT—006169 Homo sapiens chromosome 4 working draft sequence segment gi|18558377|ref|NT—006169.8|Hs4—6326[18558377]

[8314] 248: NT—022836 Homo sapiens chromosome 4 working draft sequence segment gi|18557125|ref|NT—022836.7|Hs4—22992[18557125]

[8315] 249: XM—093891 Homo sapiens similar to interferon induced transmembrane protein 3 (1-8U) (LOC166482), mRNA gi|18557119|ref|XM—093891.1|[18557119]

[8316] 250: AF456925 Homo sapiens USH3 region, partial sequence gi|17901944|gb|AF456925.1|AF411849S2[17901944]

[8317] 251: AF411849 Homo sapiens USH3 region, partial sequence gi|17901943|gb|AF411849.1|AF411849S1[17901943]

[8318] 252: AH011260 Homo sapiens gi|17901942|gb|AH011260.1|SEG_AF411849S[17901942]

[8319] 253: XM—064062 Homo sapiens similar to putative transmembrane receptor (LOC124274), mRNA gi|17488065|ref|XM—064062.1|[17488065]

[8320] 254: XM—063875 Homo sapiens similar to interferon induced transmembrane protein 3 (1-8U) (LOC123862), mRNA gi|17487213|ref|XM—063875.1|[17487213]

[8321] 255: XM—066655 Homo sapiens similar to G protein-coupled receptor 64; G protein-coupled receptor, epididymis-specific (seven transmembrane family) (LOC139378), mRNA gi|17485715|ref|XM—066655.1|[17485715]

[8322] 256: NT—011519 Homo sapiens chromosome 22 working draft sequence segment gi|17484914|ref|NT—011519.9|Hs22—11676[17484914]

[8323] 257: NT—011362 Homo sapiens chromosome 20 working draft sequence segment gi|17484369|ref|NT—011362.7|Hs20—11519[17484369]

[8324] 258: XM—063355 Homo sapiens similar to transmembrane 7 superfamily member 1 (upregulated in kidney); transmembrane 7 superfamily member 1 (upregulated in (LOC122791), mRNA gi|17476790|ref|XM—063355.1|[17476790]

[8325] 259: XM—062544 Homo sapiens similar to transmembrane protein 4; putative secreted protein ZSIG9 (LOC121255), mRNA gi|17474559|ref|XM—062544.1|[17474559]

[8326] 260: XM—062443 Homo sapiens similar to interferon induced transmembrane protein 3 (1-8U) (LOC121062), mRNA gi|17474137|ref|XM—062443.1|[17474137]

[8327] 261: XM—070446 Homo sapiens similar to interferon induced transmembrane protein 3 (1-8U) (LOC137474), mRNA gi|17466780|ref|XM—070446.1|[17466780]

[8328] 262: XM—070130 Homo sapiens similar to transmembrane protein 4; putative secreted protein ZSIG9 (LOC136903), mRNA gi|17465836|ref|XM—070130.1|[17465836]

[8329] 263: XM—069635 Homo sapiens similar to interferon induced transmembrane protein 3 (1-8U) (LOC135982), mRNA gi|17465065|ref|XM—069635.1|[17465065]

[8330] 264: XM—069633 Homo sapiens similar to interferon induced transmembrane protein 3 (1-8U); interferon-inducible (LOC135976), mRNA gi|17465055|ref|XM—069633.1|[17465055]

[8331] 265: XM—069470 Homo sapiens similar to interferon induced transmembrane protein 3 (1-8U) (LOC135637), mRNA gi|17464370|ref|XM—069470.1|[17464370]

[8332] 266: XM—069460 Homo sapiens similar to dM53BM10.7 (novel 7 transmembrane receptor (rhodopsin family) (olfactory receptor like) protein) (LOC135626), mRNA gi|17464346|ref|XM—069460.1|[17464346]

[8333] 267: XM—064220 Homo sapiens similar to putative transmembrane receptor (LOC124601), mRNA gi|17457972|ref|XM—064220.1|[17457972]

[8334] 268: XM—063652 Homo sapiens similar to leucine zipper-EF-hand containing transmembrane protein 1; leucine zipper-EF-hand containing transmembrane protein 1 (LOC123430), mRNA gi|17456715|ref|XM—063652.1|[17456715]

[8335] 269: XM—062703 Homo sapiens similar to tetraspan transmembrane 4 super family (LOC121590), mRNA gi|17456679|ref|XM—062703.1|[17456679]

[8336] 270: XM—051362 Homo sapiens transmembrane 6 superfamily member 2 (TM6SF2), mRNA gi|17456138|ref|XM—051362.2|[17456138]

[8337] 271: NT—011288 Homo sapiens chromosome 19 working draft sequence segment gi|17455923|ref|NT—011288.7|Hs19—11445[17455923]

[8338] 272: XM—031933 Homo sapiens transmembrane protein vezatin (VEZATIN), mRNA gi|17454769|ref|XM—031933.3|[17454769]

[8339] 273: XM—068785 Homo sapiens similar to transmembrane receptor Unc5H1 (LOC134307), mRNA gi|17446928|ref|XM—068785.1|[17446928]

[8340] 274: NT—030685 Homo sapiens chromosome 5 working draft sequence segment gi|17443457|ref|NT—030685.1|Hs5—30941[17443457]

[8341] 275: NT—011387 Homo sapiens chromosome 20 working draft sequence segment gi|16195112|ref|NT—011387.6|Hs20—11544[16195112]

[8342] 276: NT—011512 Homo sapiens chromosome 21 working draft sequence segment gi|16170824|ref|NT—011512.4|Hs21—11669[16170824]

[8343] 277: XM—049793 Homo sapiens transmembrane protease, serine 2 (TMPRSS2), mRNA gi|16170797|ref|XM—049793.2|[16170797]

[8344] 278: NT—011520

[8345] Homo sapiens chromosome 22 working draft sequence segment gi|16168698|ref|NT—011520.8|Hs22—11677[16168698]

[8346] 279: NT—030188 Homo sapiens chromosome 21 working draft sequence segment gi|16166749|ref|NT—030188.1|Hs21—30443[16166749]

[8347] 280: NT—029490 Homo sapiens chromosome 21 working draft sequence segment gi|16166567|ref|NT—029490.2|Hs21—29649[16166567]

[8348] 281: NT—011515 Homo sapiens chromosome 21 working draft sequence segment gi|16166537|ref|NT—011515.6|Hs21—11672[16166537]

[8349] 282: XM—009794 Homo sapiens transmembrane protein 1 (TMEM1), mRNA gi|16166381|ref|XM—009794.4|[16166381]

[8350] 283: NT—009407 Homo sapiens chromosome 11 working draft sequence segment gi|16164445|ref|NT—009407.5|Hs11—9564[16164445]

[8351] 284: NT—027220 Homo sapiens chromosome X working draft sequence segment gi|16163830|ref|NT—027220.2|HsX—27380[16163830]

[8352] 285: XM—055222 Homo sapiens region containing sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4G; mitochondrial ribosomal protein L32 (LOC143289), mRNA gi|16156787|ref|XM—055222.1|[16156787]

[8353] 286: XM—008123 Homo sapiens tryptase gamma 1 (TPSG1), mRNA gi|15317318|ref|XM—008123.5|[15317318]

[8354] 287: NT—009738 Homo sapiens chromosome 12 working draft sequence segment gi|15307319|ref|NT—009738.5|Hs12—9895[15307319]

[8355] 288: XM—006991 Homo sapiens tetraspan transmembrane 4 super family (NET-5), mRNA gi|15307297|ref|XM—006991.5|[15307297]

[8356] 289: NT—009513 Homo sapiens chromosome 12 working draft sequence segment gi|15303938|ref|NT—009513.5|Hs12—9670[15303938]

[8357] 290: NT—029317 Homo sapiens chromosome 6 working draft sequence segment gi|15300889|ref|NT—029317.1|Hs6—29476[15300889]

[8358] 291: XM—040419 Homo sapiens transmembrane trafficking protein (TMP21), mRNA gi|14784589|ref|XM—040419.1|[14784589]

[8359] 292: XM—030300 Homo sapiens similar to transmembrane receptor Unc5H1 (LOC90249), mRNA gi|14781377|ref|XM—030300.1|[14781377]

[8360] 293: XM—036570 Homo sapiens type I transmembrane protein Fn14 (FN14), mRNA gi|14777984|ref|XM—036570.1|[14777984]

[8361] 294: XM—027469 Homo sapiens transmembrane protein 8 (five membrane-spanning domains) (TMEM8), mRNA gi|14777199|ref|XM—027469.1|[14777199]

[8362] 295: XM—009839 Homo sapiens claudin 5 (transmembrane protein deleted in velocardiofacial syndrome) (CLDN5), mRNA gi|14777026|ref|XM—009839.4|[14777026]

[8363] 296: NT—025911 Homo sapiens chromosome 17 working draft sequence segment gi|14776336|ref|NT—025911.3|Hs17—26067[14776336]

[8364] 297: XM—041427 Homo sapiens transmembrane protease, serine 5 (spinesin) (TMPRSS5), mRNA gi|14770562|ref|XM—041427.1|[14770562]

[8365] 298: XM—006940 Homo sapiens cytoskeleton-associated protein 4 (CKAP4), mRNA gi|14766392|ref|XM—006940.4|[14766392]

[8366] 299: NT—011598 Homo sapiens chromosome X working draft sequence segment gi|14759313|ref|NT—011598.4|HsX—11755[14759313]

[8367] 300: XM—033157 Homo sapiens transmembrane 4 superfamily member 6 (TM4SF6), mRNA gi|14757314|ref|XM—033157.1|[14757314]

[8368] 301: XM—044358 Homo sapiens similar to cleft lip and palate associated transmembrane protein 1 (LOC92330), mRNA gi|14755905|ref|XM—044358.1|[14755905]

[8369] 302: XM—004980 Homo sapiens cystic fibrosis transmembrane conductance regulator, ATP-binding cassette (sub-family C, member 7)(CFTR), mRNA gi|14753226|ref|XM—004980.4|[14753226]

[8370] 303: XM—002838 Homo sapiens similar to orphan seven-transmembrane receptor, chemokine related (H. sapiens) (LOC154103), mRNA gi|14750021|ref|XM—002838.6|[14750021]

[8371] 304: XM—005949 Homo sapiens sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4G (SEMA4G), mRNA gi|14747317|ref|XM—005949.4|[14747317]

[8372] 305: XM—035329 Homo sapiens similar to transmembrane trafficking protein (LOC90981), mRNA gi|14744677|ref|XM—035329.1|[14744677]

[8373] 306: XM—038156 Homo sapiens transmembrane protein 2 (TMEM2), mRNA gi|14743733|ref|XM—038156.1|[14743733]

[8374] 307: XM—005346 Homo sapiens transmembrane protein with EGF-like and two follistatin-like domains 1 (TMEFF1), mRNA gi|14738782|ref|XM—005346.4|[14738782]

[8375] 308: XM—045505 Homo sapiens transmembrane 4 superfamily member (tetraspan NET-7)(NET-7), mRNA gi|14738519|ref|XM—045505.1|[14738519]

[8376] 311: NT—026472 Homo sapiens chromosome 17 working draft sequence segment gi|13654226|ref|NT—026472.1|Hs17—26639[13654226]

[8377] 312: XM—012718 Homo sapiens secreted and transmembrane 1 (SECTM1), mRNA gi|13654161|ref|XM—012718.2|[13654161]

[8378] 313: XM—016506 Homo sapiens fibronectin leucine rich transmembrane protein 2 (FLRT2), mRNA gi|13648109|ref|XM—016506.1|[13648109]

[8379] 314: XM—005187 Homo sapiens ankyrin-like with transmembrane domains 1 (ANKTM1), mRNA gi|13645787|ref|XM—005187.3|[13645787]

[8380] 315: NT—025803 Homo sapiens chromosome 8 working draft sequence segment gi|3642635|ref|NT—025803.2|Hs8—25959[13642635]

[8381] 316: XM—017003 Homo sapiens interferon induced transmembrane protein 3 (1-8U) (IFITM3), mRNA gi|13642630|ref|XM—017003.1|[13642630]

[8382] 317: NT—022761 Homo sapiens chromosome 4 working draft sequence segment gi|8556805|ref|NT—022761.8|Hs4—22917[18556805]

[8383] 318: XM—093853 Homo sapiens similar to transmembrane tryptase (LOC166415), mRNA gi|18556799|ref|XM—093853.1|[18556799]

[8384] 319: NT—005997 Homo sapiens chromosome 3 working draft sequence segment gi|18556520|ref|NT—005997.8|Hs3—6154[18556520]

[8385] 320: XM—087464 Homo sapiens similar to transmembrane protein 7 (LOC152408), mRNA gi|18556483|ref|XM—087464.1|[18556483]

[8386] 321: NT—005986 Homo sapiens chromosome 3 working draft sequence segment gi|18556440|ref|NT—005986.8|Hs3—6143[18556440]

[8387] 322: NT—005678 Homo sapiens chromosome 3 working draft sequence segment gi|18555423|ref|NT—005678.7|Hs3—5835[18555423]

[8388] 323: XM—093638 Homo sapiens similar to orphan seven transmembrane receptor (LOC166071), mRNA gi|18555421|ref|XM—093638.1|[18555421]

[8389] 324: XM—093637 Homo sapiens similar to orphan seven transmembrane receptor (LOC166070), mRNA gi|18555419|ref|XM—093637.1|[18555419]

[8390] 325: NT—005654 Homo sapiens chromosome 3 working draft sequence segment gi|18555355|ref|NT—005654.8|Hs3—5811[18555355]

[8391] 326: NT—005616 Homo sapiens chromosome 3 working draft sequence segment gi|18555281|ref|NT—005616.8|Hs3—5773[18555281]

[8392] 327: NT—005543 Homo sapiens chromosome 3 working draft sequence segment gi|18555061|ref|NT—005543.7|Hs3—5700[18555061]

[8393] 328: XM—098155 Homo sapiens similar to seven transmembrane domain orphan receptor (H. sapiens) (LOC152010), mRNA gi|18555022|ref|XM—098155.1|[18555022]

[8394] 329: NT—022531 Homo sapiens chromosome 3 working draft sequence segment gi|18554079|ref|NT—022531.4|Hs3—22687[18554079]

[8395] 330: XM—096181 Homo sapiens transmembrane 4 superfamily member 4 (TM4SF4), mRNA gi|18554072|ref|XM—096181.1|[18554072]

[8396] 331: NT—022412 Homo sapiens chromosome 3 working draft sequence segment gi|18553606|ref|NT—022412.6|Hs3—22568[18553606]

[8397] 332: NT—022393 Homo sapiens chromosome 3 working draft sequence segment gi|18553572|ref|NT—022393.7|Hs3—22549[18553572]

[8398] 333: NT—005423 Homo sapiens chromosome 2 working draft sequence segment gi|18553407|ref|NT—005423.8|Hs2—5580[18553407]

[8399] 334: NT—005387 Homo sapiens chromosome 2 working draft sequence segment gi|18553071|ref|NT—005387.8|Hs2—5544[18553071]

[8400] 335: NT—05289 Homo sapiens chromosome 2 working draft sequence segment gi|18552655|ref|NT—005289.8|Hs2—5446[18552655]

[8401] 336: NT—005214 Homo sapiens chromosome 2 working draft sequence segment gi|18552351|ref|NT—005214.8|Hs2—5371[18552351]

[8402] 337: NT—005138 Homo sapiens chromosome 2 working draft sequence segment gi|18552129|ref|NT—005138.8|Hs2—5295[18552129]

[8403] 338: NT—022180 Homo sapiens chromosome 2 working draft sequence segment gi|18550124|ref|NT—022180.8|Hs2—22336[18550124]

[8404] 339: NT—004858 Homo sapiens chromosome 1 working draft sequence segment gi|18549451|ref|NT—004858.8|Hs1—5015[18549451]

[8405] 340: XM—053256 Homo sapiens mucin 1, transmembrane (MUC1), mRNA gi|18549380|ref|XM—053256.4|[18549380]

[8406] 341: NT—04836 Homo sapiens chromosome 1 working draft sequence segment gi|18549182|ref|NT—004836.8|Hs1—4993[18549182]

[8407] 342: NT—004811 Homo sapiens chromosome 1 working draft sequence segment gi|18549145|ref|NT—004811.8|Hs1—4968[18549145]

[8408] 343: XM—041879 Homo sapiens similar to AF1Q protein; transmembrane protein (LOC149430), mRNA gi|18549121|ref|XM—041879.2|[18549121]

[8409] 344: NT—004668 Homo sapiens chromosome 1 working draft sequence segment gi|18548894|ref|NT—004668.8|Hs1—4825[18548894]

[8410] 345: NT—004441 Homo sapiens chromosome 1 working draft sequence segment gi|18547758|ref|NT—004441.8|Hs1—4598[18547758]

[8411] 346: NTO04434 Homo sapiens chromosome 1 working draft sequence segment gi|18547724|ref|NT—004434.8|Hs1—4591[18547724]

[8412] 347: NT—004391 Homo sapiens chromosome 1 working draft sequence segment gi|18547557|ref|NT—004391.8|Hs1—4548[18547557]

[8413] 348: NT—021907 Homo sapiens chromosome 1 working draft sequence segment gi|18544452|ref|NT—021907.8|Hs1—22063[18544452]

[8414] 349: XM—053163 Homo sapiens sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6C (SEMA6C), mRNA gi|18544383|ref|XM—053163.4|[18544383]

[8415] 350: NM—016155 Homo sapiens matrix metalloproteinase 17 (membrane-inserted) (MMP17), mRNA gi|18543372|ref|NM—016155.2|[18543372]

[8416] 351: XM—060507 Homo sapiens similar to putative integral membrane transporter; lysosomal-associated transmembrane protein 4 beta (LOC127480), mRNA gi|17443784|ref|XM—060507.1|[17443784]

[8417] 352: XM—060501 Homo sapiens similar to bM332P19.3 (novel 7 transmembrane receptor (rhodopsin family)(olfactory receptor like) protein (mm17M1-14)(LOC127469), mRNA gi|17443690|ref|XM—060501.1|[17443690]

[8418] 353: XM—060442 Homo sapiens similar to interferon induced transmembrane protein 3 (1-8U); interferon-inducible (LOC127360), mRNA gi|17441370|ref|XM—060442.1|[17441370]

[8419] 354: XM—065294 Homo sapiens similar to Transmembrane protease, serine 3 (Serine protease TADG-12)(Tumor associated differentially-expressed gene-12 protein) (LOC129566), mRNA gi|17439790|ref|XM—065294.1|[17439790]

[8420] 355: XM—032249

[8421] Homo sapiens sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5B (SEMASB), mRNA gi|17438489|ref|XM—032249.3|[17438489]

[8422] 356: XM 058189 Homo sapiens similar to TRANSMEMBRANE 4 SUPERFAMILY, MEMBER 1 (TUMOR-ASSOCIATED ANTIGEN L6)(MEMBRANE COMPONENT, SURFACE MARKER 1)(M3S1)(LOC116441), mRNA gi|17437690|ref|XM—058189.2|[17437690]

[8423] 357: NT—011903 Homo sapiens chromosome Y working draft sequence segment gi|17433681|ref|NT—011903.8|HsY—12060[17433681]

[8424] 358: XM—034757 Homo sapiens similar to transmembrane phosphatase with tensin homology (H. sapiens)(LOC159185), mRNA gi|16164045|ref|XM—034757.2|[16164045]

[8425] 359: XM—003025 Homo sapiens mucin 13, epithelial transmembrane (MUC13), mRNA gi|16159511|ref|XM—003025.5|[16159511]

[8426] 360: NT—015169 Homo sapiens chromosome 4 working draft sequence segment gi|16156888|ref|NT—015169.5|Hs4—15325[16156888]

[8427] 361: NM—002837 Homo sapiens protein tyrosine phosphatase, receptor type, B (PTPRB), mRNA gi|18491009|ref|NM—002837.2|[18491009]

[8428] 362: BC022439 Homo sapiens, interferon induced transmembrane protein 3 (1-8U), clone MGC:24755 IMAGE:4282809, mRNA, complete cds gi|18490258|gb|BC022439.1|[18490258]

[8429] 363: NM—005031 Homo sapiens FXYD domain containing ion transport regulator 1 (phospholemman) (FXYD1), transcript variant a, mRNA gi|11612671|ref|NM—005031.2|[11612671]

[8430] 364: NM 021902 Homo sapiens FXYD domain containing ion transport regulator 1 (phospholemman) (FXYD1), transcript variant b, mRNA gi|1612669|ref|NM—021902.1|[11612669]

[8431] 365: NM—014164 Homo sapiens FXYD domain-containing ion transport regulator 5 (FXYD5), mRNA gi|11612664|ref|NM—014164.2|[11612664]

[8432] 366: NM—020399 Homo sapiens PDZ/coiled-coil domain binding partner for the rho-family GTPase TC10 (PIST), mRNA gi|9966876|ref|NM—020399.1|[9966876]

[8433] 367: BM439879 pgr1n.pk001.i17 Normalized Chicken Reproductive Tract cDNA Library (pgr1n) Gallus gallus cDNA clone pgr1n.pk001.i17 5′ similar to gi|7657373 ref|NP—055214.1|tetraspan NET-6 protein; transmembrane 4 superfamily protein [Homo sapiens] gi|13628481 ref|XP—004793.3| tetraspan NET-6 protein [Homo sapiens] gi|14747013 ref|XP—049585.1| tetraspan NET-6 protein [Homo sapiens] gi|14, mRNA sequence gi|18470654|gb|BM439879.1|BM439879[18470654]

[8434] 368: BM439852 pgr1n.pk001.h13 Normalized Chicken Reproductive Tract cDNA Library (pgr1n) Gallus gallus cDNA clone pgr1n.pk001.h13 5′ similar to gi|7657176 ref|NP—055070.1| transmembrane protein 4; putative type II membrane protein [Homo sapiens] dbj|BAA76498.1|(AB015631) type II membrane protein [Homo sapiens], mRNA sequence gi|18470627|gb|BM439852.1|BM439852[18470627]

[8435] 369: BM439375 pgr1c.pk001.a9 Primary Chicken Reproductive Tract cDNA Library (pgr1c) Gallus gallus cDNA clone pgr1c.pk001.a9 5′ similar to gi|3994300 ref|NP—114131.1| transmembrane protein induced by tumor necrosis factor alpha [Homo sapiens] gb|AAK16442.1|AF327923—1 (AF327923) transmembrane protein induced by tumor necrosis factor alpha [Homo sapiens], mRNA sequence gi|18470150|gb|BM439375.1|BM439375[18470150]

[8436] 370: NM—080841 Homo sapiens protein tyrosine phosphatase, receptor type, A (PTPRA), transcript variant 3, mRNA gi|18450370|ref|NM—080841.1|[18450370]

[8437] 371: NM—080840 Homo sapiens protein tyrosine phosphatase, receptor type, A (PTPRA), transcript variant 2, mRNA gi|18450368|ref|NM—080840.1|[18450368]

[8438] 372: NM—002836 Homo sapiens protein tyrosine phosphatase, receptor type, A (PTPRA), transcript variant 1, mRNA gi|18450367|ref|NM—002836.2|[18450367]

[8439] 373: NM—018490 Homo sapiens G protein-coupled receptor 48 (GPR48), mRNA gi|8923700|ref|NM—018490.1|[8923700]

[8440] 374: NM—006065 Homo sapiens signal-regulatory protein beta 1 (SIRPB1), mRNA gi|5174678|ref|NM—006065.1|[5174678]

[8441] 375: NM—004648 Homo sapiens protein tyrosine phosphatase, non-receptor type substrate 1 (PTPNS1), mRNA gi|4758977|ref|NM—004648.1|[4758977]

[8442] 376: NM—003667 Homo sapiens G protein-coupled receptor 49 (GPR49), mRNA gi|4504378|ref|NM—003667.1|[4504378]

[8443] 377: BM427439 pgf2n.pk006.m15 Normalized Chicken Abdominal Fat Library (pgf2n) Gallus gallus cDNA clone pgf2n.pk006.m15 5′ similar to gi|13994300 ref|NP—114131.1| transmembrane protein induced by tumor necrosis factor alpha [Homo sapiens] gb|AAK16442.1|AF327923—1 (AF327923) transmembrane protein induced by tumor necrosis factor alpha [Homo sapiens], mRNA sequence gi|18432616|gb|BM427439.1|BM427439[18432616]

[8444] 378: BM427410 pgf2n.pk006.k5 Normalized Chicken Abdominal Fat Library (pgf2n) Gallus gallus cDNA clone pgf2n.pk006.k5 5′ similar to gi|13994300 ref|NP—114131.1| transmembrane protein induced by tumor necrosis factor alpha [Homo sapiens] gb|AAK16442.1|AF327923—1 (AF327923) transmembrane protein induced by tumor necrosis factor alpha [Homo sapiens], mRNA sequence gi|18432562|gb|BM427410.1|BM427410[18432562]

[8445] 379: BM427358 pgf2n.pk006.i13 Normalized Chicken Abdominal Fat Library (pgf2n) Gallus gallus cDNA clone pgf2n.pk006.i13 5′ similar to gi|7705965 ref|NP—057456.1| seven transmembrane domain orphan receptor [Homo sapiens] |dbj|BAA89782.1| (AB037108) seven transmembrane domain orphan receptor [Homo sapiens], mRNA sequence gi|18432475|gb|BM427358.1|BM427358[18432475]

[8446] 380: NM—02122 Homo sapiens major histocompatibility complex, class II, DQ alpha 1 (HLA-DQA1), mRNA gi|18426974|ref|NM—002122.2|[18426974]

[8447] 381: NM—080815 Homo sapiens collagen, type XIII, alpha 1 (COL13A1), transcript variant 19, mRNA gi|18426960|ref|NM—080815.1|[18426960]

[8448] 382: NM—080814 Homo sapiens collagen, type XIII, alpha 1 (COL13A1), transcript variant 18, mRNA gi|18426958|ref|NM—080814.1|[18426958]

[8449] 383: NM—080813 Homo sapiens collagen, type XIII, alpha 1 (COL13A1), transcript variant 17, mRNA gi|18426956|ref|NM—080813.1|[18426956]

[8450] 384: NM—080812 Homo sapiens collagen, type XIII, alpha 1 (COL13A1), transcript variant 16, mRNA gi|18426954|ref|NM—080812.1|[18426954]

[8451] 385: NM080811 Homo sapiens collagen, type XIII, alpha 1 (COL13A1), transcript variant 15, mRNA gi|18426952|ref|NM—080811.1|[18426952]

[8452] 386: NM080810 Homo sapiens collagen, type XIII, alpha 1 (COL13A1), transcript variant 14, mRNA gi|18426950|ref|NM—080810.1|[18426950]

[8453] 387: NM—080809 Homo sapiens collagen, type XIII, alpha 1 (COL13A1), transcript variant 13, mRNA gi|18426948|ref|NM—080809.1|[18426948]

[8454] 388: NM—080808 Homo sapiens collagen, type XIII, alpha 1 (COL13A1), transcript variant 12, mRNA gi|18426946|ref|NM—080808.1|[18426946]

[8455] 389: NM—080807 Homo sapiens collagen, type XIII, alpha 1 (COL13A1), transcript variant 11, mRNA gi|18426944|ref|NM—080807.1|[18426944]

[8456] 390: NM—080806 Homo sapiens collagen, type XIII, alpha 1 (COL13A1), transcript variant 10, mRNA gi|18426942|ref|NM—080806.1|[18426942]

[8457] 391: NM—080805 Homo sapiens collagen, type XIII, alpha 1 (COL13A1), transcript variant 9, mRNA gi|18426940|ref|NM—080805.1|[18426940]

[8458] 392: NM—080804 Homo sapiens collagen, type XIII, alpha 1 (COL13A1), transcript variant 8, mRNA gi|18426938|ref|NM—080804.1|[18426938]

[8459] 393: NM—080803 Homo sapiens collagen, type XIII, alpha 1 (COL13A1), transcript variant 7, mRNA gi|18426936|ref|NM—080803.1|[18426936]

[8460] 394: NM—080802 Homo sapiens collagen, type XIII, alpha 1 (COL13A1), transcript variant 6, mRNA gi|18426934|ref|NM—080802.1|[18426934]

[8461] 395: NM—080801 Homo sapiens collagen, type XIII, alpha 1 (COL13A1), transcript variant 5, mRNA gi|18426932|ref|NM—080801.1|[18426932]

[8462] 396: NM—080800 Homo sapiens collagen, type XIII, alpha 1 (COL13A1), transcript variant 4, mRNA gi|18426930|ref|NM—080800.1|[18426930]

[8463] 397: NM—080799 Homo sapiens collagen, type XIII, alpha 1 (COL13A1), transcript variant 3, mRNA gi|18426928|ref|NM—080799.1|[18426928]

[8464] 398: NM—080798 Homo sapiens collagen, type XIII, alpha 1 (COL13A1), transcript variant 2, mRNA gi|18426926|ref|NM—080798.1|[18426926]

[8465] 399: NM—005203 Homo sapiens collagen, type XIII, alpha 1 (COL13A1), transcript variant 1, mRNA gi|18426924|ref|NM—005203.2|[18426924]

[8466] 400: NM—080792 Homo sapiens brain-immunoglobulin-like molecule with tyrosine-based activation motifs (BIT), mRNA gi|18426910|ref|NM—080792.1|[18426910]

[8467] 401: NM—080816 Homo sapiens signal-regulatory protein beta 2 (SIRPB2), transcript variant 2, mRNA gi|18426908|ref|NM—080816.1|[18426908]

[8468] 402: NM—018556 Homo sapiens signal-regulatory protein beta 2 (SIRPB2), transcript variant 1, mRNA gi|18426907|ref|NM—018556.2|[18426907]

[8469] 406: AF367761 Homo sapiens transmembrane protein HTMP10 (HTMP10) mRNA, complete cds gi|16356924|gb|AF367761.2|[16356924]

[8470] 409: NM—002124 Homo sapiens major histocompatibility complex, class II, DR beta 1 (HLA-DRB1), mRNA gi|4504410|ref|NM—002124.1|[4504410]

[8471] 411: NM—016235 Homo sapiens G protein-coupled receptor, family C, group 1, member B (GPRC5B), mRNA gi|7706450|ref|NM—016235.1|[7706450]

[8472] 412: NM—003105 Homo sapiens sortilin-related receptor, L(DLR class) A repeats-containing (SORL1), mRNA gi|18379347|ref|NM—003105.3|[18379347]

[8473] 413: NM—004843 Homo sapiens class I cytokine receptor (WSX1), mRNA gi|18379338|ref|NM—004843.2|[18379338]

[8474] 414: AF450008 Homo sapiens CFTR-associated ligand (CAL) mRNA, complete cds gi|17865153|gb|AF450008.1|AF450008[17865153]

[8475] 415: NM—033056 Homo sapiens protocadherin 15 (PCDH15), mRNA gi|16933554|ref|NM—033056.2|[16933554]

[8476] 416: NM—022349 Homo sapiens membrane-spanning 4-domains, subfamily A, member 6A (MS4A6A), mRNA gi|11641258|ref|NM—022349.1|[11641258]

[8477] 417: NM—005438 Homo sapiens FOS-like antigen 1 (FOSL1), mRNA gi|4885242|ref|NM—005438.1|[4885242]

[8478] 418: BC021208 Homo sapiens, leucine zipper-EF-hand containing transmembrane protein 1, clone MGC:12631 IMAGE:4126510, mRNA, complete cds gi|18204588|gb|BC021208.1|BC021208[18204588]

[8479] 419: BC021557 Homo sapiens, transmembrane protein 8 (five membrane-spanning domains), clone MGC:31822 IMAGE:4899167, mRNA, complete cds gi|18204291|gb|BC021557.1|BC021557[18204291]

[8480] 420: BC020870 Homo sapiens, fibronectin leucine rich transmembrane protein 3, clone MGC:24073 IMAGE:4606852, mRNA, complete cds gi|18088787|gb|BC020870.1|BC020870[18088787]

[8481] 421: BC020960 Homo sapiens, sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4G, clone MGC:8849 IMAGE:3851526, mRNA, complete cds gi|18088075|gb|BC020960.1|BC020960[18088075]

[8482] 422: AF444779 Homo sapiens myocyte inner nuclear membrane protein (MYNE1) mRNA, complete cds gi|17227153|gb|AF444779.1|AF444779[17227153]

[8483] 423: AF329637 Homo sapiens mitofusin 1 mRNA, nuclear gene for mitochondrial protein, complete cds gi|12744895|gb|AF329637.1|AF329637[12744895]

[8484] 424: NM—019074 Homo sapiens delta-like 4 (Drosophila)(DLL4), mRNA gi|9506544|ref|NM—019074.1|[9506544]

[8485] 425: NM—017789 Homo sapiens sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4C (SEMA4C), mRNA gi|8923345|ref|NM—017789.1|[8923345]

[8486] 426: NM—003836 Homo sapiens delta-like 1 homolog (Drosophila)(DLK1), mRNA gi|4503338|ref|NM—003836.1|[4503338]

[8487] 427: NM—024021 Homo sapiens membrane-spanning 4-domains, subfamily A, member 4 (MS4A4A), mRNA gi|13430865|ref|NM—024021.1|[13430865]

[8488] 432: NM—021950 Homo sapiens membrane-spanning 4-domains, subfamily A, member 2 (Fc fragment of IgE, high affinity I, receptor for; beta polypeptide)(MS4A1), mRNA gi|1386186|ref|NM—021950.1|[11386186]

[8489] 433: AY046529 Homo sapiens melanocortin 1 receptor mutant V122M (MC1R) gene, complete cds gi|18138241|gb|AY046529.1|[18138241]

[8490] 434: AY046528 Homo sapiens melanocortin 1 receptor mutant I40T (MC1R) gene, complete cds gi|18138239|gb|AY046528.1|[18138239]

[8491] 436: AY028261 Homo sapiens delta transmembrane LIGHT mRNA, complete cds, alternatively spliced gi|14278834|gb|AY028261.1|[14278834]

[8492] 437: AF296875 Gallus gallus fas ligand receptor soluble form mRNA, partial cds gi|9931641|gb|AF296875.1|AF296875[9931641]

[8493] 439: BM315073 ig43b07.y1 HR85 islet Homo sapiens cDNA 5′ similar to SW:MTRP_HUMAN Q15012 GOLGI 4-TRANSMEMBRANE SPANNING TRANSPORTER MTP ;, mRNA sequence gi|18049418|gb|BM315073.1|BM315073[18049418]

[8494] 440: BM314493 ig51c05.y1 HR85 islet Homo sapiens cDNA 5′ similar to TR:Q9Y287 Q9Y287 TRANSMEMBRANE PROTEIN BRI.;, mRNA sequence gi|18048838|gb|BM314493.1|BM314493[18048838]

[8495] 441: BM313985 ih05d09.y1 Human insulinoma Homo sapiens cDNA 5′ similar to SW:MTRP_HUMAN Q15012 GOLGI 4-TRANSMEMBRANE SPANNING TRANSPORTER MTP;, mRNA sequence gi|18048330|gb|BM313985.1|BM313985[18048330]

[8496] 442: AF267740 Homo sapiens transmembrane protein H4 mRNA, complete cds gi|18032260|gb|AF267740.1|AF267740[18032260]

[8497] 443: AF350504 Homo sapiens four-span transmembrane protein 4 (4SPAN4) mRNA, complete cds gi|18028935|gb|AF350504.1|AF350504[18028935]

[8498] 444: AF350503 Homo sapiens four-span transmembrane protein 3.2 (4SPAN3) mRNA, complete cds gi|18028933|gb|AF350503.1|AF350503[18028933]

[8499] 445: AF350502 Homo sapiens four-span transmembrane protein 3.1 (4SPAN3) mRNA, complete cds gi|1802893l|gb|AF350502.1|AF350502[18028931]

[8500] 446: AF350501 Homo sapiens four-span transmembrane protein 2 (4SPAN2) mRNA, complete cds gi|18028929|gb|AF350501.1|AF350501[18028929]

[8501] 447: AF350500 Homo sapiens four-span transmembrane protein 1 (4SPAN1) mRNA, complete cds gi|18028927|gb|AF350500.1|AF350500[18028927]

[8502] 448: NM—078470 Homo sapiens COX15 homolog, cytochrome c oxidase assembly protein (yeast) (COX15), nuclear gene encoding mitochondrial protein, transcript variant 1, mRNA gi|17921984|ref|NM—078470.1|[17921984]

[8503] 449: NM—004375 Homo sapiens COX11 homolog, cytochrome c oxidase assembly protein (yeast) (COX11), nuclear gene encoding mitochondrial protein, mRNA gi|17921983|ref|NM—004375.2|[17921983]

[8504] 450: NM—001303 Homo sapiens COX10 homolog, cytochrome c oxidase assembly protein, heme A: farnesyltransferase (yeast)(COX10), nuclear gene encoding mitochondrial protein, mRNA gi|17921981|ref|NM—001303.2|[17921981]

[8505] 451: NM031999 Mus musculus transmembrane 7 superfamily member 1 (Tm7sf1), mRNA gi|14269573|ref|NM—031999.1|[14269573]

[8506] 452: NM—020659 Homo sapiens tweety homolog 1 (Drosophila)(TTYH1), mRNA gi|10257436|ref|NM—020659.1|[10257436]

[8507] 453: NM—052945 Homo sapiens BAFF receptor (BAFFR), mRNA gi|17978517|ref|NM—052945.2|[17978517]

[8508] 454: NM—078481 Homo sapiens CD97 antigen (CD97), transcript variant 1, mRNA gi|17978490|ref|NM—078481.1|[17978490]

[8509] 455: NM—001784 Homo sapiens CD97 antigen (CD97), transcript variant 2, mRNA gi|17978488|ref|NM—001784.2|[17978488]

[8510] 456: NM—004444 Homo sapiens EphB4 (EPHB4), mRNA gi|17975769|ref|NM—004444.2|[17975769]

[8511] 457: NM—004443 Homo sapiens EphB3 (EPHB3), mRNA gi|17975767|ref|NM—004443.2|[17975767]

[8512] 458: NM—004442 Homo sapiens EphB2 (EPHB2), transcript variant 1, mRNA gi|17975766|ref|NM—004442.2|[17975766]

[8513] 459: NM—017449 Homo sapiens EphB2 (EPHB2), transcript variant 2, mRNA gi|17975764|ref|NM—017449.1|[17975764]

[8514] 460: BM273281 if28f09.y1 Melton Normalized Human Islet 4 N4-HIS 1 Homo sapiens cDNA 5′ similar to TR:Q9Z112 Q9Z112 SEVEN TRANSMEMBRANE DOMAIN ORPHAN RECEPTOR.;, mRNA sequence gi|17966574|gb|BM273281.1|BM27328|[17966574]

[8515] 461: BM271899 ig36e08.y1 HR85 islet Homo sapiens cDNA 5′ similar to SW:MTRP_HUMAN Q15012 GOLGI

[8516] 4-TRANSMEMBRANE SPANNING TRANSPORTER MTP;, mRNA sequence gi|17965175|gb|BM271899.1|BM271899[17965175]

[8517] 462: BM271817 ig35e06.y1 HR85 islet Homo sapiens cDNA 5′ similar to SW:MTRP_HUMAN Q15012 GOLGI 4-TRANSMEMBRANE SPANNING TRANSPORTER MTP;, mRNA sequence gi|17965091|gb|BM271817.1|BM271817[17965091]

[8518] 463: BM271771 ig38h09.x1 HR85 islet Homo sapiens cDNA 3′ similar to TR:O08721 008721 TRANSMEMBRANE RECEPTOR UNC5H1.;, mRNA sequence gi|17965045|gb|BM271771.1|BM271771[17965045]

[8519] 464: BC019314 Homo sapiens, transmembrane 4 superfamily member 7, clone MGC:4337 IMAGE:2821236, mRNA, complete cds gi|17939509|gb|BC019314.1|BC019314[17939509]

[8520] 465: BM263743 ig29h12.y1 HR85 islet Homo sapiens cDNA 5′ similar to SW:NMB_HUMAN Q14956 PUTATIVE TRANSMEMBRANE PROTEIN NMB PRECURSOR.;, mRNA sequence gi|17926783|gb|BM263743.1|BM263743[17926783]

[8521] 466: NM—004376 Homo sapiens COX15 homolog, cytochrome c oxidase assembly protein (yeast) (COX15), nuclear gene encoding mitochondrial protein, transcript variant 2, mRNA gi|17921986|ref|NM—004376.2|[17921986]

[8522] 467: AY062295 Homo sapiens prolactin receptor (PRLR) mRNA, partial cds; alternatively spliced gi|17887307|gb|AY062295.1|[17887307]

[8523] 468: NM—078474 Homo sapiens BBP-like protein 2 (BLP2), transcript variant 1, mRNA gi|17865799|ref|NM—078474.1|[17865799]

[8524] 469: NM—025141 Homo sapiens BBP-like protein 2 (BLP2), transcript variant 2, mRNA gi|17865798|ref|NM—025141.2|[17865798]

[8525] 470: NM—078473 Homo sapiens BBP-like protein 1 (BLP1), transcript variant 1, mRNA gi|17865796|ref|NM—078473.1|[17865796]

[8526] 471: NM—031940 Homo sapiens BBP-like protein 1 (BLP1), transcript variant 2, mRNA gi|17865794|ref|NM—031940.2|[17865794]

[8527] 472: NM—003728 Homo sapiens unc-5 homolog B (C. elegans)(UNC5C), mRNA gi|6933524|ref|NM—003728.2|[16933524]

[8528] 473: NM—054027 Homo sapiens ankylosis, progressive homolog (mouse)(ANKH), transcript variant 2, mRNA gi|16905506|ref|NM—054027.1|[16905506]

[8529] 474: NM—019847 Homo sapiens ankylosis, progressive homolog (mouse)(ANKH), transcript variant 1, mRNA gi|16905505|ref|NM—019847.3|[16905505]

[8530] 475: NM—018440 Homo sapiens phosphoprotein associated with glycosphingolipid-enriched microdomains (PAG), mRNA gi|16753228|ref|NM—018440.2|[16753228]

[8531] 478: NM—019894 Homo sapiens transmembrane protease, serine 4 (TMPRSS4), mRNA gi|15451939|ref|NM—019894.1|[15451939]

[8532] 479: NM—006577 Homo sapiens UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 1 (B3GNT1), transcript variant 1, mRNA gi|15451893|ref|NM—006577.3|[15451893]

[8533] 480: NM—033252 Homo sapiens UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 1 (B3GNT1), transcript variant 2, mRNA gi|15451863|ref|NM—033252.1|[15451863]

[8534] 481: NM—014302 Homo sapiens Sec6l gamma (SEC61G), mRNA gi|14591933|ref|NM—014302.2|[14591933]

[8535] 482: NM—014459 Homo sapiens protocadherin 17 (PCDH17), mRNA gi|14589926|ref|NM—014459.2|[14589926]

[8536] 483: NM—032961 Homo sapiens protocadherin 10 (PCDH10), transcript variant 1, mRNA gi|14589915|ref|NM—032961.1|[14589915]

[8537] 484: NM—020815 Homo sapiens protocadherin 10 (PCDH10), transcript variant 2, mRNA gi|14589913|ref|NM—020815.1|[14589913]

[8538] 485: NM—032966 Homo sapiens Burkitt lymphoma receptor 1, GTP binding protein (BLR1), transcript variant 2, mRNA gi|14589868|ref|NM—032966.1|[14589868]

[8539] 486: NM—001716 Homo sapiens Burkitt lymphoma receptor 1, GTP binding protein (BLR1), transcript variant 1, mRNA gi|14589867|ref|NM—001716.2|[14589867]

[8540] 487: NM—031866 Homo sapiens frizzled homolog 8 (Drosophila)(FZD8), mRNA gi|13994189|ref|NM—031866.1|[13994189]

[8541] 488: NM—030770 Homo sapiens transmembrane protease, serine 5 (spinesin)(TMPRSS5), mRNA gi|13540534|ref|NM—030770.1|[13540534]

[8542] 489: NM—001407 Homo sapiens cadherin, EGF LAG seven-pass G-type receptor 3 (flamingo homolog, Drosophila)(CELSR3), mRNA gi|13325065|ref|NM—001407.1|[13325065]

[8543] 490: NM—001408 Homo sapiens cadherin, EGF LAG seven-pass G-type receptor 2 (flamingo homolog, Drosophila)(CELSR2), mRNA gi|13325063|ref|NM—001408.1|[13325063]

[8544] 491: NM—005971 Homo sapiens FXYD domain-containing ion transport regulator 3 (FXYD3), transcript variant 1, mRNA gi|11612675|ref|NM—005971.2|[11612675]

[8545] 492: NM—021910 Homo sapiens FXYD domain-containing ion transport regulator 3 (FXYD3), transcript variant 2, mRNA gi|11612673|ref|NM—021910.1|[11612673]

[8546] 493: NM—021778 Homo sapiens a disintegrin and metalloproteinase domain 28 (ADAM28), transcript variant 2, mRNA gi|11496995|ref|NM—021778.1|[11496995]

[8547] 494: NM—021777 Homo sapiens a disintegrin and metalloproteinase domain 28 (ADAM28), transcript variant 3, mRNA gi|11496993|ref|NM—021777.1|[11496993]

[8548] 495: NM—021783 Homo sapiens ectodysplasin A2 isoform receptor (XEDAR), mRNA gi|11140822|ref|NM—021783.1|[11140822]

[8549] 496: NM—020182 Homo sapiens transmembrane, prostate androgen induced RNA (TMEPAI), mRNA gi|9910497|ref|NM—020182.1|[9910497]

[8550] 497: NM—003857 Homo sapiens galanin receptor 2 (GALR2), mRNA gi|8051600|ref|NM—003857.2|[8051600]

[8551] 498: NM—015727 Homo sapiens tachykinin receptor 1 (TACR1), transcript variant short, mRNA gi|7669545|ref|NM—015727.1|[7669545]

[8552] 499: NM—001058 Homo sapiens tachykinin receptor 1 (TACR1), transcript variant long, mRNA gi|7669544|ref|NM—001058.2|[7669544]

[8553] 501: NM—014246 Homo sapiens cadherin, EGF LAG seven-pass G-type receptor 1 (flamingo homolog, Drosophila)(CELSR1), mRNA gi|7656966|ref|NM—014246.1|[7656966]

[8554] 502: NM—014265 Homo sapiens a disintegrin and metalloproteinase domain 28 (ADAM28), transcript variant 1, mRNA gi|7656862|ref|NM—014265.1|[7656862]

[8555] 503: NM—007264 Homo sapiens adrenomedullin receptor (ADMR), mRNA gi|6466448|ref|NM—007264.2|[6466448]

[8556] 504: NM—004733 Homo sapiens acetyl-Coenzyme A transporter (ACATN), mRNA gi|6042194|ref|NM—004733.2|[6042194]

[8557] 505: NM—003801 Homo sapiens GPAA1P anchor attachment protein 1 homolog (yeast)(GPAA1), mRNA gi|6031166|ref|NM—003801.2|[6031166]

[8558] 506: NM—007197 Homo sapiens frizzled homolog 10 (Drosophila)(FZD10), mRNA gi|6005761|ref|NM—007197.1|[6005761]

[8559] 507: NM—001466 Homo sapiens frizzled homolog 2 (Drosophila)(FZD2), mRNA gi|5922012|ref|NM—001466.2|[5922012]

[8560] 508: NM—006579 Homo sapiens emopamil binding protein (sterol isomerase)(EBP), mRNA gi|5729809|ref|NM—006579.1|[5729809]

[8561] 509: NM—006017 Homo sapiens prominin-like 1 (mouse)(PROML1), mRNA gi|5174386|ref|NM—006017.1|[5174386]

[8562] 510: NM—005228 Homo sapiens epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian)(EGFR), mRNA gi|4885198|ref|NM—005228.1|[4885198]

[8563] 511: NM—004617 Homo sapiens transmembrane 4 superfamily member 4 (TM4SF4), mRNA gi|4759239|ref|NM—004617.1|[4759239]

[8564] 512: NM—004787 Homo sapiens slit homolog 2 (Drosophila)(SLIT2), mRNA gi|4759145|ref|NM—004787.1|[4759145]

[8565] 513: NM—004445 Homo sapiens EphB6 (EPHB6), mRNA gi|4758291|ref|NM—004445.1|[4758291]

[8566] 514: NM—004338 Homo sapiens chromosome 18 open reading frame 1 (C18orf1), mRNA gi|4757883|ref|NM—004338.1|[4757883]

[8567] 515: NM—002982 Homo sapiens small inducible cytokine A2 (monocyte chemotactic protein 1) (SCYA2), mRNA gi|4506840|ref|NM—002982.1|[4506840]

[8568] 516: NM—002944 Homo sapiens v-ros UR2 sarcoma virus oncogene homolog 1 (avian)(ROS1), mRNA gi|4506578|ref|NM—002944.1|[4506578]

[8569] 517: NM—000264 Homo sapiens patched homolog (Drosophila)(PTCH), mRNA gi|4506246|ref|NM—000264.1|[4506246]

[8570] 518: NM—003508 Homo sapiens frizzled homolog 9 (Drosophila)(FZD9), mRNA gi|4503834|ref|NM—003508.1|[4503834]

[8571] 519: NM—003507 Homo sapiens frizzled homolog 7 (Drosophila)(FZD7), mRNA gi|4503832|ref|NM—003507.1|[4503832]

[8572] 520: NM—003506 Homo sapiens frizzled homolog 6 (Drosophila)(FZD6), mRNA gi|4503830|ref|NM—003506.1|[4503830]

[8573] 521: NM—003468 Homo sapiens frizzled homolog 5 (Drosophila)(FZD5), mRNA gi|4503828|ref|NM—003468.1|[4503828]

[8574] 522: NM—003505 Homo sapiens frizzled homolog 1 (Drosophila)(FZD1), mRNA gi|4503824|ref|NM—003505.1|[4503824]

[8575] 523: NM—001982 Homo sapiens v-erb-b2 erythroblastic leukemia viral oncogene homolog 3 (avian) (ERBB3), mRNA gi|4503596|ref|NM—001982.1|[4503596]

[8576] 524: NM—003859 Homo sapiens dolichyl-phosphate mannosyltransferase polypeptide 1, catalytic subunit (DPM1), mRNA gi|4503362|ref|NM—003859.1|[4503362]

[8577] 525: NM—003915 Homo sapiens copine I (CPNE1), mRNA gi|4503012|ref|NM—003915.1|[4503012]

[8578] 527: NM—052959 Homo sapiens pannexin 3 (PANX3), mRNA gi|16418452|ref|NM—052959.1|[16418452]

[8579] 528: NM—052859 Homo sapiens putative endoplasmic reticulum multispan transmembrane protein (RFT1), mRNA gi|16418360|ref|NM—052859.1|[16418360]

[8580] 531: NM—032108 Homo sapiens sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6B (SEMA6B), mRNA gi|14165267|ref|NM—032108.1|[14165267]

[8581] 532: NM—031925 Homo sapiens transmembrane protein induced by tumor necrosis factor alpha (TMPIT), mRNA gi|13994299|ref|NM—031925.1|[13994299]

[8582] 533: NM—030960 Homo sapiens sperm acrosome associated 1 (SPACA1), mRNA gi|13569933|ref|NM—030960.1|[13569933]

[8583] 534: NM—030755 Homo sapiens thioredoxin domain-containing (TXNDC), mRNA gi|13559515|ref|NM—030755.1|[13559515]

[8584] 535: NM—024734 Homo sapiens calponin like transmembrane domain protein (calmin), mRNA gi|13376053|ref|NM—024734.1|[13376053]

[8585] 536: NM—023003 Homo sapiens transmembrane 6 superfamily member 1 (TM6SF1), mRNA gi|13194198|ref|NM—023003.1|[13194198]

[8586] 537: NM—021034 Homo sapiens interferon induced transmembrane protein 3 (1-8U)(IFITM3), mRNA gi|11995467|ref|NM—021034.1|[11995467]

[8587] 538: NM—006435 Homo sapiens interferon induced transmembrane protein 2 (1-8D)(IFITM2), mRNA gi|10835237|ref|NM—006435.1|[10835237]

[8588] 539: NM—016326 Homo sapiens chemokine-like factor 1 (CKLF1), mRNA gi|10092611|ref|NM—016326.2|[10092611]

[8589] 540: NM—016951 Homo sapiens chemokine-like factor 1 (CKLF1), mRNA gi|10092593|ref|NM—016951.2|[10092593]

[8590] 541: NM—000888 Homo sapiens integrin, beta 6 (ITGB6), mRNA gi|9966771|ref|NM—000888.3|[9966771]

[8591] 542: NM—020241 Homo sapiens sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6B (SEMA6B), mRNA gi|9910379|ref|NM—020241.1|[9910379]

[8592] 543: NM—018407 Homo sapiens putative integral membrane transporter (LC27), mRNA gi|8923827|ref|NM—018407.1|[8923827]

[8593] 544: NM—017514 Homo sapiens SEX gene (HSSEXGENE), mRNA gi|8923792|ref|NM—017514.1|[8923792]

[8594] 545: NM—017893 Homo sapiens sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4G (SEMA4G), mRNA gi|8923550|ref|NM—017893.1|[8923550]

[8595] 546: NM—017599 Homo sapiens transmembrane protein vezatin (VEZATIN), mRNA gi|8922162|ref|NM—017599.1|[8922162]

[8596] 547: NM—014254 Homo sapiens transmembrane protein 5 (TMEM5), mRNA gi|7657177|ref|NM—014254.1|[7657177]

[8597] 548: NM—012339 Homo sapiens transmembrane 4 superfamily member (tetraspan NET-7)(NET-7), mRNA gi|6912529|ref|NM—012339.1|[6912529]

[8598] 549: NM—012338 Homo sapiens transmembrane 4 superfamily member (tetraspan NET-2)(NET-2), mRNA gi|6912527|ref|NM—012338.1|[6912527]

[8599] 550: NM—002673 Homo sapiens plexin B1 (PLXNB1), mRNA gi|6631105|ref|NM—002673.1|[6631105]

[8600] 551: NM—006825 Homo sapiens cytoskeleton-associated protein 4 (CKAP4), mRNA gi|5803112|ref|NM—006825.1|[5803112]

[8601] 552: NM—004785 Homo sapiens solute carrier family 9 (sodium/hydrogen exchanger), isoform 3 regulatory factor 2 (SLC9A3R2), mRNA gi|4759141|ref|NM—004785.1|[4759141]

[8602] 553: NM—004263 Homo sapiens sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4F (SEMA4F), mRNA gi|4759093|ref|NM—004263.1|[4759093]

[8603] 554: NM—004800 Homo sapiens transmembrane 9 superfamily member 2 (TM9SF2), mRNA gi|4758873|ref|NM—004800.1|[4758873]

[8604] 555: NM—000950 Homo sapiens proline-rich Gla (G-carboxyglutamic acid) polypeptide 1 (PRRG1), mRNA gi|4506134|ref|NM—000950.1|[4506134]

[8605] 556: NM—003625 Homo sapiens protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 2 (PPF|A2), mRNA gi|4505984|ref|NM—003625.1|[4505984]

[8606] 558: NM—032518 Homo sapiens collagen-like Alzheimer amyloid plaque component precursor (LOC84570), mRNA gi|14210525|ref|NM—032518.1|[14210525]

[8607] 559: NM—023945 Homo sapiens membrane-spanning 4-domains, subfamily A, member 5 (MS4A5), mRNA gi|12965204|ref|NM—023945.1|[12965204]

[8608] 560: NM—016158 Homo sapiens erythrocyte transmembrane protein (LOC51145), mRNA gi|7705856|ref|NM—016158.1|[7705856]

[8609] 561: AK056649 Homo sapiens cDNA FLJ32087 fis, clone OCBBF2000467, highly similar to Fibronectin leucine rich transmembrane protein 2 gi|16552109|dbj|AK056649.1|AK056649[16552109]

[8610] 562: AK056595 Homo sapiens cDNA FLJ32033 fis, clone NTONG2000265, weakly similar to Probable transmembrane protein of fission yeast gi|16552042|dbj|AK056595.1|AK056595[16552042]

[8611] 563: AK055648 Homo sapiens cDNA FLJ31086 fis, clone IMR321000044, highly similar to Human transmembrane receptor precursor (PTK7) mRNA gi|16550428|dbj|AK055648.1|AK055648[16550428]

[8612] 564: AK055208 Homo sapiens cDNA FLJ30646 fis, clone CTONG2004716, weakly similar to Rattus norvegicus mRNA for seven transmembrane receptor gi|16549884|dbj|AK055208.1|AK055208[16549884]

[8613] 565: AK054712 Homo sapiens cDNA FLJ30150 fis, clone BRACE2000300, highly similar to TRANSMEMBRANE PROTEIN PFT27 gi|16549313|dbj|AK054712.1|AK054712[16549313]

[8614] 566: AK054646 Homo sapiens cDNA FLJ30084 fis, clone BGGI12001682, highly similar to Homo sapiens transmembrane protein TENB2 (TENB2) mRNA gi|16549231|dbj|AK054646.1|AK054646[16549231]

[8615] 567: NM—019035 Homo sapiens protocadherin 18 (PCDH18), mRNA gi|14589928|ref|NM—019035.1|[14589928]

[8616] 568: NM—030943 Homo sapiens amnionless protein (AMN), mRNA gi|13569914|ref|NM—030943.1|[13569914]

[8617] 570: BC018361 Homo sapiens, sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4F, clone MGC:21849 IMAGE:4215248, mRNA, complete cds gi|17390842|gb|BC018361.1|BC018361[17390842]

[8618] 571: AF214006 Homo sapiens TDC1 (TDC1) mRNA, complete cds gi|17221828|gb|AF214006.1|AF214006[17221828]

[8619] 572: NM—021201 Homo sapiens membrane-spanning 4-domains, subfamily A, member 7 (MS4A7), mRNA gi|11139298|ref|NM—021201.1|[11139298]

[8620] 573: AF289028 Homo sapiens transmembrane protein B7-H2 ICOS ligand mRNA, complete cds gi|9858866|gb|AF289028.1|AF289028[9858866]

[8621] 574: NM—016941 Homo sapiens delta-like 3 (Drosophila)(DLL3), mRNA gi|8393263|ref|NM—016941.1|[8393263]

[8622] 575: NM—014450 Homo sapiens SHP2 interacting transmembrane adaptor (SIT), mRNA gi|7657576|ref|NM—014450.1|[7657576]

[8623] 576: NM—021259 Homo sapiens transmembrane protein 8 (five membrane-spanning domains) (TMEM8), mRNA gi|10864068|ref|NM—021259.1|[10864068]

[8624] 577: NMO02959 Homo sapiens sortilin 1 (SORT1), mRNA gi|17149833|ref|NM—002959.3|[17149833]

[8625] 578: NM—000675 Homo sapiens adenosine A2a receptor (ADORA2A), mRNA gi|17136146|ref|NM—000675.3|[17136146]

[8626] 579: BM128846 if17e06.x1 Melton Normalized Human Islet 4 N4-HIS 1 Homo sapiens cDNA 3′ similar to SW:PF27_MOUSE P52875 TRANSMEMBRANE PROTEIN PFT27. [1];, mRNA sequence gi|17123398|gb|BM128846.1|BM128846[17123398]

[8627] 580: BM127423 ie95b07.y1 Melton Normalized Human Islet 4 N4-HIS 1 Homo sapiens cDNA 5′ similar to TR:060639 060639 PUTATIVE TRANSMEMBRANE GTPASE ;, mRNA sequence gi|17121975|gb|BM127423.1|BM127423[17121975]

[8628] 581: AY016020 Gallus gallus alpha globin gene cluster, complete sequence gi|17104478|gb|AY016020.1|[17104478]

[8629] 582: M86631 Homo sapiens (clone ST-18-5(9/16) cystic fibrosis transmembrane conductance regulator (CFTR) gene, 3′ end intron 17B; complete exon 18; complete intron 18 gi|180296|gb|M86631.1|HUMCFTR[180296]

[8630] 584: BC017476 Homo sapiens, sema domain, immunoglobulin domain (Ig), transmembrane domain TM) and short cytoplasmic domain, (semaphorin) 4C, clone MGC:15189 IMAGE:3528227, mRNA, complete cds gi|17028345|gb|BC017476.1|BC017476[17028345]

[8631] 585: NM—000420 Homo sapiens Kell blood group (KEL), mRNA gi|17025233|ref|NM—000420.2|[17025233]

[8632] 586: BM090614 ig16b09.y1 Human Fetal Pancreas 1A Homo sapiens cDNA 5′ similar to TR:Q9Y287 Q9Y287 TRANSMEMBRANE PROTEIN BRI.;, mRNA sequence gi|17019580|gb|BM090614.1|BM090614[17019580]

[8633] 587: AF217288 Homo sapiens protocadherin-S mRNA, complete cds, alternatively spliced gi|15054520|gb|AF217288.1|AF217288[15054520]

[8634] 588: AF206516 Homo sapiens protocadherin-S mRNA, complete cds gi|15054518|gb|AF206516.1|AF206516[15054518]

[8635] 589: NM—021153 Homo sapiens cadherin 19, type 2 (CDH19), mRNA gi|16306535|ref|NM—021153.2|[16306535]

[8636] 590: AY048509 Homo sapiens pannexin 1 (PANX1) gene, partial cds gi|15808666|gb|AY048509.1|[15808666]

[8637] 591: NG—000012 Homo sapiens genomic protocadherin gamma cluster (PCDHG®) on chromosome 5 gi|14861871|ref|NG—000012.1|[14861871]

[8638] 592: AEO06466 Homo sapiens 16p13.3 sequence section 5 of 8 gi|14336735|gb|AE006466.1|AE006466[14336735]

[8639] 593: AF376725 Homo sapiens lung seven transmembrane receptor 1 (LUSTR1) mRNA, complete cds gi|14248996|gb|AF376725.1|AF376725[14248996]

[8640] 594: NM—004776 Homo sapiens UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 5 (B4GALT5), mRNA gi|13929470|ref|NM—004776.2|[13929470]

[8641] 595: NM—030587 Homo sapiens UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 2 (B4GALT2), transcript variant 1, mRNA gi|13929464|ref|NM—030587.1|[13929464]

[8642] 596: NM—003780 Homo sapiens UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 2 (B4GALT2), transcript variant 2, mRNA gi|13929463|ref|NM—003780.2|[13929463]

[8643] 597: NM—002590 Homo sapiens protocadherin 8 (PCDH8), transcript variant 1, mRNA gi|6631101|ref|NM—002590.2|[6631101]

[8644] 598: L42572 Homo sapiens transmembrane protein (p87/89) mRNA, complete cds gi|1160962|gb|L42572.1|HUMP8789R[1160962]

[8645] 599: AF106202 Homo sapiens endothelial cell protein C receptor precursor (EPCR) gene, promoter region and complete cds gi|16950557|gb|AF106202.2|AF106202[16950557]

[8646] 600: NM—033207 Homo sapiens transmembrane protein HTMP10 (HTMP10), mRNA gi|16945967|ref|NM—033207.2|[16945967]

[8647] 601: AF153440 Mus musculus Nma (Nma) mRNA, complete cds gi|14328906|gb|AF153440.1|AF153440[14328906]

[8648] 604: NM—005086 Homo sapiens sarcospan (Kras oncogene-associated gene)(SSPN), mRNA gi|16933560|ref|NM—005086.3|[16933560]

[8649] 605: NM—018153 Homo sapiens tumor endothelial marker 8 (TEM8), transcript variant 3, mRNA gi|16933552|ref|NM—018153.2|[16933552]

[8650] 606: NM—053034 Homo sapiens tumor endothelial marker 8 (TEM8), transcript variant 2, mRNA gi|16933550|ref|NM—053034.1|[16933550]

[8651] 607: NM—032208 Homo sapiens tumor endothelial marker 8 (TEM8), transcript variant 1, mRNA gi|14149903|ref|NM—032208.1|[14149903]

[8652] 608: AV225853 AV225853 RIKEN full-length enriched, 18 days pregnant, placenta and extra embryonic tissue Mus musculus cDNA clone 3830432D01 3′ similar to X69910 H.sapiens p63 mRNA for transmembrane protein, mRNA sequence gi|6177168|dbj|AV225853.1|AV225853[6177168]

[8653] 609: AV222771 AV222771 RIKEN full-length enriched, 18 days pregnant, placenta and extra embryonic tissue Mus musculus cDNA clone 3830404C12 3′ similar to X69910 H.sapiens p63 mRNA for transmembrane protein, mRNA sequence gi|6171948|dbj|AV222771.1|AV22277[6171948]

[8654] 611: BC017058 Homo sapiens, Similar to seven transmembrane domain orphan receptor, clone MGC:9442 IMAGE:3904719, mRNA, complete cds gi|16877618|gb|BC017058.1|BC017058[16877618]

[8655] 612: BM055437 ie94h04.y1 Melton Normalized Human Islet 4 N4-HIS 1 Homo sapiens cDNA 5′ similar to SW:CFTR_HUMAN P13569 CYSTIC FIBROSIS TRANSMEMBRANE CONDUCTANCE REGULATOR;, mRNA sequence gi|16813328|gb|BM055437.1|BM055437[16813328]

[8656] 614: AF328788 Homo sapiens amnionless mRNA, complete cds gi|13507258|gb|AF328788.1|AF328788[13507258]

[8657] 615: NM—052836 Homo sapiens cadherin related 23 (CDH23), transcript variant 2, mRNA gi|16507963|ref|NM—052836.1|[16507963]

[8658] 616: NM—022124 Homo sapiens cadherin related 23 (CDH23), transcript variant 1, mRNA gi|16507961|ref|NM—022124.2|[16507961]

[8659] 617: NM—004063 Homo sapiens cadherin 17, LI cadherin (liver-intestine)(CDH17), mRNA gi|16507959|ref|NM—004063.2|[16507959]

[8660] 618: NM—004062 Homo sapiens cadherin 16, KSP-cadherin (CDH16), mRNA gi|16507958|ref|NM—004062.2|[16507958]

[8661] 619: NM—004933 Homo sapiens cadherin 15, M-cadherin (myotubule)(CDH15), mRNA gi|16507957|ref|NM—004933.2|[16507957]

[8662] 620: NM—001257 Homo sapiens cadherin 13, H-cadherin (heart)(CDH13), mRNA gi|16507956|ref|NM—001257.2|[16507956]

[8663] 621: BC009704 Homo sapiens, transmembrane 4 superfamily member 9, clone MGC:9300 IMAGE:3895933, mRNA, complete cds gi|16307230|gb|BC009704.1|BC009704[16307230]

[8664] 622: BC001496 Homo sapiens, transmembrane trafficking protein, clone MGC:1979 IMAGE:2959718, mRNA, complete cds gi|16306639|gb|BC001496.1|BC001496[16306639]

[8665] 623: BC013577 Homo sapiens, claudin 11 (oligodendrocyte transmembrane protein), clone MGC:9232 IMAGE:3895040, mRNA, complete cds gi|15488893|gb|BC013577.1|BC013577[15488893]

[8666] 624: NM—053002 Homo sapiens no opposite paired repeat protein (NOPAR), mRNA gi|16506292|ref|NM—053002.1|[16506292]

[8667] 625: NM—052995 Homo sapiens Usher syndrome 3A (USH3A), mRNA gi|16506280|ref|NM—052995.1|[16506280]

[8668] 639: NM—014879 Homo sapiens G protein-coupled receptor 105 (GPR105), mRNA gi|7661847|ref|NM—014879.1|[7661847]

[8669] 640: NM—052891 Homo sapiens peptidoglycan recognition protein-I-alpha precursor (PGLYRPIalpha), mRNA gi|16418404|ref|NM—052891.1|[16418404]

[8670] 642: BI964203 ie66b09.y1 Melton Normalized Human Islet 4 N4-HIS 1 Homo sapiens cDNA 5′ similar to TR:Q99989 Q99989 TRANSMEMBRANE CHLORIDE CONDUCTOR PROTEIN;, mRNA sequence gi|16338608|gb|BI964203.1|BI964203[16338608]

[8671] 643: BI963913 ie66e08.x1 Melton Normalized Human Islet 4 N4-HIS 1 Homo sapiens cDNA 3′ similar to SW:PF27MOUSE P52875 TRANSMEMBRANE PROTEIN PFT27. [1];, mRNA sequence gi|16338318|gb|BI963913.1|BI963913[16338318]

[8672] 644: AF293372 Pan troglodytes sialic acid-binding lectin Siglec-L1 mRNA, complete cds gi|15824309|gb|AF293372.1|AF293372[15824309]

[8673] 645: BC009696 Homo sapiens, interferon induced transmembrane protein 2 (1-8D), clone MGC:9196 IMAGE:3876542, mRNA, complete cds gi|16307214|gb|BC009696.1|BC009696[16307214]

[8674] 646: NM—031891 Homo sapiens cadherin 20, type 2 (CDH20), mRNA gi|16306536|ref|NM—031891.2|[16306536]

[8675] 647: NM—004361 Homo sapiens cadherin 7, type 2 (CDH7), transcript variant b, mRNA gi|16306488|ref|NM—004361.2|[16306488]

[8676] 648: NM—033646 Homo sapiens cadherin 7, type 2 (CDH7), transcript variant a, mRNA gi|16306486|ref|NM—033646.1|[16306486]

[8677] 649: AF319952 Homo sapiens tweety-like protein 2 mRNA, complete cds gi|16303747|gb|AF319952.1|AF319952[16303747]

[8678] 651: NM—005756 Homo sapiens G protein-coupled receptor 64 (GPR64), mRNA gi|5031732|ref|NM—005756.1|[5031732]

[8679] 652: AF416903 Homo sapiens SH2 domain-containing phosphatase anchor protein 2c mRNA, complete cds, alternatively spliced gi|16033593|gb|AF416903.1|AF416903[16033593]

[8680] 653: AF416902 Homo sapiens SH2 domain-containing phosphatase anchor protein 2b mRNA, complete cds, alternatively spliced gi|16033590|gb|AF416902.1|AF416902[16033590]

[8681] 654: AF416901 Homo sapiens SH2 domain-containing phosphatase anchor protein 2a mRNA, complete cds, alternatively spliced gi|16033587|gb|AF416901.1|AF41690|[16033587]

[8682] 655: AF264740 Homo sapiens MHC class I chain-related protein A (MICA) gene, MICA*015 allele, exon 6 and partial cds gi|16032983|gb|AF264740.1|AF264738S3[16032983]

[8683] 656: AF264739 Homo sapiens MHC class I chain-related protein A (MICA) gene, MICA*015 allele, exons 4 and 5 gi|16032982|gb|AF264739.1|AF264738S2[16032982]

[8684] 657: AF264738 Homo sapiens MHC class I chain-related protein A (MICA) gene, MICA*015 allele, exons 2 and 3 gi|16032981|gb|AF264738.1|AF264738S1[16032981]

[8685] 658: AH011143 Homo sapiens MHC class I chain-related protein A (MICA) gene, MICA*015 allele, partial cds gi|16032980|gb|AH011143.1|SEG_AF264738S[16032980]

[8686] 659: NM—033467 Homo sapiens membrane metallo-endopeptidase-like 2 (MMEL2), mRNA gi|15991812|ref|NM—033467.1|[15991812]

[8687] 660: AF378755 Homo sapiens tumor endothelial marker 5 precursor (TEM5) mRNA, complete cds gi|15987490|gb|AF378755.1|AF378755[15987490]

[8688] 661: NM—016227 Homo sapiens chromosome 1 open reading frame 9 (C1orf9), mRNA gi|7705321|ref|NM—016227.1|[7705321]

[8689] 662: NM—014283 Homo sapiens chromosome 1 open reading frame 9 (C1orf9), mRNA gi|7656939|ref|NM—014283.1|[7656939]

[8690] 663: NM—018475 Homo sapiens TPA regulated locus (TPARL), mRNA gi|8923860|ref|NM—018475.1|[8923860]

[8691] 664: D83783 Human mRNA for KIAA0192 gene, partial cds gi|1663693|dbj|D83783.1|D83783[1663693]

[8692] 665: D79997 Human mRNA for KIAA0175 gene, complete cds gi|1136409|dbj|D79997.1|D79997[1136409]

[8693] 666: D13626 Human mRNA for KIAA0001 gene, complete cds gi|285994|dbj|D13626.1|HUMRSC338[285994]

[8694] 679: BI793175 ie48h08.y1 Melton Normalized Human Islet 4 N4-HIS 1 Homo sapiens cDNA 5′ similar to SW:NMB_HUMAN Q14956 PUTATIVE TRANSMEMBRANE PROTEIN NMB PRECURSOR.;, mRNA sequence gi|15820900|gb|BI793175.1|BI793175[15820900]

[8695] 680: U40271 Homo sapiens transmembrane receptor precursor (PTK7) mRNA, complete cds gi|15808058|gb|U40271.2|HSU4027|[15808058]

[8696] 681: BC014554 Homo sapiens, calponin like transmembrane domain protein, clone IMAGE:3837453, mRNA gi|15778950|gb|BC014554.1|BC014554[15778950]

[8697] 682: NM—018916 Homo sapiens protocadherin gamma subfamily A, 3 (PCDHGA3), transcript variant 1, mRNA gi|14589879|ref|NM—018916.3|[14589879]

[8698] 683: NM—032407 Homo sapiens protocadherin gamma subfamily C, 5 (PCDHGC5), transcript variant 2, mRNA gi|14277684|ref|NM—032407.1|[14277684]

[8699] 684: NM—018929 Homo sapiens protocadherin gamma subfamily C, 5 (PCDHGC5), transcript variant 1, mRNA gi|14277683|ref|NM—018929.2|[14277683]

[8700] 685: NM—032406 Homo sapiens protocadherin gamma subfamily C, 4 (PCDHGC4), transcript variant 2, mRNA gi|14277681|ref|NM—032406.1|[14277681]

[8701] 686: NM—018928 Homo sapiens protocadherin gamma subfamily C, 4 (PCDHGC4), transcript variant 1, mRNA gi|14277680|ref|NM—018928.2|[14277680]

[8702] 687: NM—032101 Homo sapiens protocadherin gamma subfamily B, 7 (PCDHGB7), transcript variant 2, mRNA gi|14270507|ref|NM 032101.1|[14270507]

[8703] 688: NM—018927 Homo sapiens protocadherin gamma subfamily B, 7 (PCDHGB7), transcript variant 1, mRNA gi|14270506|ref|NM—018927.2|[14270506]

[8704] 689: NM—032099 Homo sapiens protocadherin gamma subfamily B, 5 (PCDHGB5), transcript variant 2, mRNA gi|14270504|ref|NM—032099.1|[14270504]

[8705] 690: NM—018925 Homo sapiens protocadherin gamma subfamily B, 5 (PCDHGB5), transcript variant 1, mRNA gi|14270503|ref|NM—018925.2|[14270503]

[8706] 691: NM—032100 Homo sapiens protocadherin gamma subfamily B, 6 (PCDHGB6), transcript variant 2, mRNA gi|14270501|ref|NM—032100.1|[14270501]

[8707] 692: NM—018926 Homo sapiens protocadherin gamma subfamily B, 6 (PCDHGB6), transcript variant 1, mRNA gi|14270500|ref|NM—018926.2|[14270500]

[8708] 693: NM—032097 Homo sapiens protocadherin gamma subfamily B, 3 (PCDHGB3), transcript variant 2, mRNA gi|14270495|ref|NM—032097.1|[14270495]

[8709] 694: NM—018924 Homo sapiens protocadherin gamma subfamily B, 3 (PCDHGB3), transcript variant 1, mRNA gi|14270494|ref|NM—018924.2|[14270494]

[8710] 695: NM—032096 Homo sapiens protocadherin gamma subfamily B, 2 (PCDHGB2), transcript variant 2, mRNA gi|14270492|ref|NM—032096.1|[14270492]

[8711] 696: NM—018923 Homo sapiens protocadherin gamma subfamily B, 2 (PCDHGB2), transcript variant mRNA gi|14270491|ref|NM—018923.2|[14270491]

[8712] 697: NM—032095 Homo sapiens protocadherin gamma subfamily B, 1 (PCDHGB1), transcript variant 2, mRNA gi|14270489|ref|NM—032095.1|[14270489]

[8713] 698: NM—018922 Homo sapiens protocadherin gamma subfamily B, 1 (PCDHGB1), transcript variant 1, mRNA gi|14270488|ref|NM—018922.2|[14270488]

[8714] 699: NM—032089 Homo sapiens protocadherin gamma subfamily A, 9 (PCDHGA9), transcript variant 2, mRNA gi|14270486|ref|NM—032089.1|[14270486]

[8715] 700: NM—018921 Homo sapiens protocadherin gamma subfamily A, 9 (PCDHGA9), transcript variant 1, mRNA gi|14270485|ref|NM—018921.2|[14270485]

[8716] 701: NM—032088 Homo sapiens protocadherin gamma subfamily A, 8 (PCDHGA8), transcript variant 1, mRNA gi|14270483|ref|NM—032088.1|[14270483]

[8717] 702: NM—014004 Homo sapiens protocadherin gamma subfamily A, 8 (PCDHGA8), transcript variant 2, mRNA gi|14270482|ref|NM—014004.2|[14270482]

[8718] 703: NM—032087 Homo sapiens protocadherin gamma subfamily A, 7 (PCDHGA7), transcript variant 2, mRNA gi|14196476|ref|NM—032087.1|[14196476]

[8719] 704: NM—018920 Homo sapiens protocadherin gamma subfamily A, 7 (PCDHGA7), transcript variant 1, mRNA gi|14196475|ref|NM—018920.2|[14196475]

[8720] 705: NM—032086 Homo sapiens protocadherin gamma subfamily A, 6 (PCDHGA6), transcript variant 2, mRNA gi|14196473|ref|NM—032086.1|[14196473]

[8721] 706: NM—018919 Homo sapiens protocadherin gamma subfamily A, 6 (PCDHGA6), transcript variant 1, mRNA gi|14196472|ref|NM—018919.2|[14196472]

[8722] 707: NM—032054 Homo sapiens protocadherin gamma subfamily A, 5 (PCDHGA5), transcript variant 2, mRNA gi|14196470|ref|NM—032054.1|[14196470]

[8723] 708: NM—018918 Homo sapiens protocadherin gamma subfamily A, 5 (PCDHGA5), transcript variant 1, mRNA gi|14196469|ref|NM—018918.2|[14196469]

[8724] 709: NM—032053 Homo sapiens protocadherin gamma subfamily A, 4 (PCDHGA4), transcript variant 2, mRNA gi|14196467|ref|NM—032053.1|[14196467]

[8725] 710: NM—018917 Homo sapiens protocadherin gamma subfamily A, 4 (PCDHGA4), transcript variant 1, mRNA gi|14196466|ref|NM—018917.2|[14196466]

[8726] 711: NM—032011 Homo sapiens protocadherin gamma subfamily A, 3 (PCDHGA3), transcript variant 2, mRNA gi|14196464|ref|NM—032011.1|[14196464]

[8727] 712: NM—032009 Homo sapiens protocadherin gamma subfamily A, 2 (PCDHGA2), transcript variant 2, mRNA gi|14196461|ref|NM—032009.1|[14196461]

[8728] 713: NM—018915 Homo sapiens protocadherin gamma subfamily A, 2 (PCDHGA2), transcript variant 1, mRNA gi|14196460|ref|NM—018915.2|[14196460]

[8729] 714: NM—031993 Homo sapiens protocadherin gamma subfamily A, 1 (PCDHGA1), transcript variant 2, mRNA gi|14196458|ref|NM—031993.1|[14196458]

[8730] 715: NM—032092 Homo sapiens protocadherin gamma subfamily A, 11 (PCDHGA11), transcript variant 3, mRNA gi|14196454|ref|NM—032092.1|[14196454]

[8731] 716: NM—018912 Homo sapiens protocadherin gamma subfamily A, 1 (PCDHGA1), transcript variant 1, mRNA gi|14196453|ref|NM—018912.2|[14196453]

[8732] 717: NM—032091 Homo sapiens protocadherin gamma subfamily A, 11 (PCDHGA11), transcript variant 2, mRNA gi|14196450|ref|NM—032091.1|[14196450]

[8733] 718: NM—018914 Homo sapiens protocadherin gamma subfamily A, 11 (PCDHGA11), transcript variant 1, mRNA gi|14196449|ref|NM—018914.2|[14196449]

[8734] 719: NM—032090 Homo sapiens protocadherin gamma subfamily A, 10 (PCDHGA10), transcript variant

[8735] 2, mRNA gi|14196447|ref|NM—032090.1|[14196447]

[8736] 720: NM018913 Homo sapiens protocadherin gamma subfamily A, 10 (PCDHGA10), transcript variant 1, mRNA gi|14196446|ref|NM—018913.2|[14196446]

[8737] 721: NM—031411 Homo sapiens protocadherin alpha 1 (PCDHA1), transcript variant 3, mRNA gi|14165401|ref|NM—031411.1|[14165401]

[8738] 722: NM—031849 Homo sapiens protocadherin alpha 6 (PCDHA6), transcript variant 3, mRNA gi|14165393|ref|NM—031849.1|[14165393]

[8739] 723: NM—031860 Homo sapiens protocadherin alpha 10 (PCDHA10), transcript variant 3, mRNA gi|14165382|ref|NM—031860.1|[14165382]

[8740] 724: NM—031442 Homo sapiens brain cell membrane protein 1 (BCMP1), mRNA gi|13899272|ref|NM—031442.1|[13899272]

[8741] 725: NM—007000 Homo sapiens uroplakin 1A (UPK1A), mRNA gi|5902147|ref|NM—007000.1|[5902147]

[8742] 726: NM—003332 Homo sapiens TYRO protein tyrosine kinase binding protein (TYROBP), mRNA gi|4507754|ref|NM—003332.1|[4507754]

[8743] 727: AF264747 Homo sapiens MHC class I chain-related protein A (MICA) gene, MICA*00901 allele, exon 6 and partial cds gi|14279228|gb|AF264747.1|AF264744S3[14279228]

[8744] 728: AF264746 Homo sapiens MHC class I chain-related protein A (MICA) gene, MICA*00901 allele, exons 4 and 5 gi|14279227|gb|AF264746.1|AF264744S2[14279227]

[8745] 729: AF264744 Homo sapiens MHC class I chain-related protein A (MICA) gene, MICA*00901 allele, exons 2 and 3 gi|14279226|gb|AF264744.1|AF264744S1[14279226]

[8746] 730: AH010821 Homo sapiens MHC class I chain-related protein A (MICA) gene, MICA*00901 allele, partial cds gi|14279225|gb|AH010821.1|SEG_AF264744S[14279225]

[8747] 731: AF264743 Homo sapiens MHC class I chain-related protein A (MICA) gene, MICA*048 allele, exon 6 and partial cds gi|14279223|gb|AF264743.1|AF264741S3[14279223]

[8748] 732: AF264742 Homo sapiens MHC class I chain-related protein A (MICA) gene, MICA*048 allele, exons 4 and 5 gi|14279222|gb|AF264742.1|AF264741S2[14279222]

[8749] 733: AF264741 Homo sapiens MHC class I chain-related protein A (MICA) gene, MICA*048 allele, exons 2 and 3 gi|14279221|gb|AF264741.1|AF264741S1[14279221]

[8750] 734: AH010820 Homo sapiens MHC class I chain-related protein A (MICA) gene, MICA*048 allele, partial cds gi|14279220|gb|AH010820.1|SEG_AF264741S[14279220]

[8751] 735: AF264737 Homo sapiens MHC class I chain-related protein A (MICA) gene, MICA*017 allele, exon 6 and partial cds gi|14279218|gb|AF264737.1|AF264735S3[14279218]

[8752] 736: AF264736 Homo sapiens MHC class I chain-related protein A (MICA) gene, MICA*017 allele, exons 4 and 5 gi|14279217|gb|AF264736.1|AF264735S2[14279217]

[8753] 737: AF264735 Homo sapiens MHC class I chain-related protein A (MICA) gene, MICA*017 allele, exons 2 and 3 gi|14279216|gb|AF264735.1|AF264735S1[4279216]

[8754] 738: AH010819 Homo sapiens MHC class I chain-related protein A (MICA) gene, MICA*017 allele, partial cds gi|14279215|gb|AH010819.1|SEG_AF264735S[14279215]

[8755] 739: AF336080 Homo sapiens MHC class I chain-related protein A (MICA) gene, MICA*019 allele, exon 6 and partial cds gi|13469855|gb|AF336080.1|AF336079S2[13469855]

[8756] 740: AF336079 Homo sapiens MHC class I chain-related protein A (MICA) gene, MICA*019 allele, exons 2 through 5 gi|13469854|gb|AF336079.1|AF336079S1[13469854]

[8757] 741: AH010587 Homo sapiens MHC class I chain-related protein A (MICA) gene, MICA*019 allele, partial cds gi|13469853|gb|AH010587.1|SEG_AF336079S[13469853]

[8758] 742: AF336086 Homo sapiens MHC class I chain-related protein A (MICA) gene, MICA*001 allele, exon 6 and partial cds gi|13445651|gb|AF336086.1|AF336085S2[13445651]

[8759] 743: AF336085 Homo sapiens MHC class I chain-related protein A (MICA) gene, MICA*001 allele, exons 2 through 5 gi|13445650|gb|AF336085.1|AF336085S1[13445650]

[8760] 744: AH010572 Homo sapiens MHC class I chain-related protein A (MICA) gene, MICA*001 allele, partial cds gi|13445649|gb|AH010572.1|SEG_AF336085S[13445649]

[8761] 745: AF336084 Homo sapiens MHC class I chain-related protein A (MICA) gene, MICA*002 allele, exon 6 and partial cds gi|13445647|gb|AF336084.1|AF336083S2[13445647]

[8762] 746: AF336083 Homo sapiens MHC class I chain-related protein A (MICA) gene, MICA*002 allele, exons 2 through 5 gi|13445646|gb|AF336083.1|AF336083S1[13445646]

[8763] 747: AH010571 Homo sapiens MHC class I chain-related protein A (MICA) gene, MICA*002 allele, partial cds gi|13445645|gb|AH010571.1|SEG_AF336083S[13445645]

[8764] 748: AF336070 Homo sapiens MHC class I chain-related protein A (MICA) gene, MICA*009 allele, exon 6 and partial cds gi|13430213|gb|AF336070.1|AF336069S2[13430213]

[8765] 749: AF336069 Homo sapiens MHC class I chain-related protein A (MICA) gene, MICA*009 allele, exons 2 through 5 gi|13430212|gb|AF336069.1|AF336069S1[13430212]

[8766] 750: AH010569 Homo sapiens MHC class I chain-related protein A (MICA) gene, MICA*009 allele, partial cds gi|13430211|gb|AH010569.1|SEG_AF336069S[13430211]

[8767] 751: AF336068 Homo sapiens MHC class I chain-related protein A (MICA) gene, MICA*008 allele, exon 6 gi|13430209|gb|AF336068.1|AF336067S2[13430209]

[8768] 752: AF336067 Homo sapiens MHC class I chain-related protein A (MICA) gene, MICA*008 allele, exons 2 through 5 and partial cds gi|13430208|gb|AF336067.1|AF336067S1[3430208]

[8769] 753: AH010568 Homo sapiens MHC class I chain-related protein A (MICA) gene, MICA*008 allele, partial cds gi|13430207|gb|AH010568.1|SEG_AF336067S[13430207]

[8770] 754: AF336082 Homo sapiens MHC class I chain-related protein A (MICA) gene, MICA*012 allele, exon 6 and partial cds gi|13378046|gb|AF336082.1|AF336081S2[13378046]

[8771] 755: AF336081 Homo sapiens MHC class I chain-related protein A (MICA) gene, MICA*012 allele, exons 2 through 5 gi|13378045|gb|AF336081.1|AF336081S1[13378045]

[8772] 756: AH010562 Homo sapiens MHC class I chain-related protein A (MICA) gene, MICA*012 allele, partial cds gi|13378044|gb|AH010562.1|SEG_AF336081S[13378044]

[8773] 757: AF336078 Homo sapiens MHC class I chain-related protein A (MICA) gene, MICA*018 allele, exon 6 and partial cds gi|13378042|gb|AF336078.1|AF336077S2[13378042]

[8774] 758: AF336077 Homo sapiens MHC class I chain-related protein A (MICA) gene, MICA*018 allele, exons 2 through 5 gi|1337804l|gb|AF336077.1|AF336077S1[13378041]

[8775] 759: AH010561 Homo sapiens MHC class I chain-related protein A (MICA) gene, MICA*018 allele, partial cds gi|13378040|gb|AH010561.1|SEG_AF336077S[13378040]

[8776] 760: AF336076 Homo sapiens MHC class I chain-related protein A (MICA) gene, MICA*016 allele, exon 6 and partial cds gi|13378038|gb|AF336076.1|AF336075S2[13378038]

[8777] 761: AF336075 Homo sapiens MHC class I chain-related protein A (MICA) gene, MICA*016 allele, exons 2 through 5 gi|13378037|gb|AF336075.1|AF336075S1[13378037]

[8778] 762: AH010560 Homo sapiens MHC class I chain-related protein A (MICA) gene, MICA*016 allele, partial cds gi|13378036|gb|AH010560.1|SEG_AF336075S[13378036]

[8779] 763: AF336074 Homo sapiens MHC class I chain-related protein A (MICA) gene, MICA*011 allele, exon 6 and partial cds gi|13346205|gb|AF336074.1|AF336073S2[13346205]

[8780] 764: AF336073 Homo sapiens MHC class I chain-related protein A (MICA) gene, MICA*011 allele, exons 2 through 5 gi|13346204|gb|AF336073.1|AF336073S1[13346204]

[8781] 765: AH010546 Homo sapiens MHC class I chain-related protein A (MICA) gene, MICA*011 allele, partial cds gi|13346203|gb|AH010546.1|SEG_AF336073S[13346203]

[8782] 766: AF336064 Homo sapiens MHC class I chain-related protein A (MICA) gene, MICA*002 allele, exon 6 and partial cds gi|13346201|gb|AF336064.1|AF336063S2[13346201]

[8783] 767: AF336063 Homo sapiens MHC class I chain-related protein A (MICA) gene, MICA*002 allele, exons 2 through 5 gi|13346200|gb|AF336063.1|AF336063S1[13346200]

[8784] 768: AH010545 Homo sapiens MHC class I chain-related protein A (MICA) gene, MICA*002 allele, partial cds gi|13346199|gb|AH010545.1|SEG_AF336063S[13346199]

[8785] 769: AF336072 Homo sapiens MHC class I chain-related protein A (MICA) gene, MICA*010 allele, exon 6 and partial cds gi|13310419|gb|AF336072.1|AF336071S2[13310419]

[8786] 770: AF336071 Homo sapiens MHC class I chain-related protein A (MICA) gene, MICA*010 allele, exons 2 through 5 gi|13310418|gb|AF336071.1|AF336071S1[13310418]

[8787] 771: AH010532 Homo sapiens MHC class I chain-related protein A (MICA) gene, MICA*010 allele, partial cds gi|13310417|gb|AH010532.1|SEG_AF336071S[13310417]

[8788] 772: AF336066 Homo sapiens MHC class I chain-related protein A (MICA) gene, MICA*006 allele, exon 6 and partial cds gi|13274608|gb|AF336066.1|AF336065S2[13274608]

[8789] 773: AF336065 Homo sapiens MHC class I chain-related protein A (MICA) gene, MICA*006 allele, exons 2 through 5 gi|13274607|gb|AF336065.1|AF336065S1[13274607]

[8790] 774: AH010526 Homo sapiens MHC class I chain-related protein A (MICA) gene, MICA*006 allele, partial cds gi|13274606|gb|AH010526.1|SEG_AF336065S[13274606]

[8791] 775: NM—022059 Homo sapiens chemokine (C-X-C motif) ligand 16 (CXCL16), mRNA gi|11545764|ref|NM—022059.1|[11545764]

[8792] 776: NM—000024 Homo sapiens adrenergic, beta-2-, receptor, surface (ADRB2), mRNA gi|15718673|ref|NM—000024.3|[15718673]

[8793] 777: AF257472 Homo sapiens transmembrane protein MT75 mRNA, complete cds gi|15718477|gb|AF257472.1|AF257472[15718477]

[8794] 778: AJ301609 Homo sapiens partial mRNA for GluR6 kainate receptor (GRIK2 gene), exons 10, and 13 gi|15485589|emb|AJ301609.1|HSA301609[15485589]

[8795] 779: AJ301608 Homo sapiens partial mRNA for GluR6 kainate receptor (GRIK2 gene), exons 11, and 14 gi|15485587|emb|AJ301608.1|HSA301608[15485587]

[8796] 780: BI713761 ie03f09.y1 HR85 islet Homo sapiens cDNA 5′ similar to TR:Q9Y287 Q9Y287 TRANSMEMBRANE PROTEIN BRI.;, mRNA sequence gi|15689456|gb|BI713761.1|BI713761[15689456]

[8797] 781: BI713497 ie03f09.x1 HR85 islet Homo sapiens cDNA 3′ similar to TR:Q9Y287 Q9Y287 TRANSMEMBRANE PROTEIN BRI.;, mRNA sequence gi|15689192|gb|BI713497.1|BI713497[15689192]

[8798] 782: BI712829 ie09g03.y1 HR8S islet Homo sapiens cDNA 5′ similar to TR:Q9Y287 Q9Y287 TRANSMEMBRANE PROTEIN BRI.;, mRNA sequence gi|15688524|gb|BI712829.1|BI712829[15688524]

[8799] 783: BI712748 ie08g08.y1 HR85 islet Homo sapiens cDNA 5′ similar to SW:TM21_RAT Q63584 TRANSMEMBRANE PROTEIN TMP21 PRECURSOR;, mRNA sequence gi|15688443|gb|BI712748.1|BI712748[15688443]

[8800] 784: BI711750 id97b10.y1 Human insulinoma Homo sapiens cDNA 5′ similar to TR:Q9Y287 Q9Y287 TRANSMEMBRANE PROTEIN BRI.;, mRNA sequence gi|15687445|gb|BI711750.1|BI711750[15687445]

[8801] 785: BI711468 id97b10.x1 Human insulinoma Homo sapiens cDNA 3′ similar to TR:Q9Y287 Q9Y287 TRANSMEMBRANE PROTEIN BRI.;, mRNA sequence gi|15687163|gb|BI711468.1|BI711468[15687163]

[8802] 786: BI711211 id93c12.x1 Human insulinoma Homo sapiens cDNA 3′ similar to TR:P97544 P97544 ER TRANSMEMBRANE PROTEIN.;, mRNA sequence gi|15686906|gb|BI711211.1|BI711211[15686906]

[8803] 787: BI710795 id92a02.yl Human insulinoma Homo sapiens cDNA 5′ similar to SW:NMB_HUMAN Q14956 PUTATIVE TRANSMEMBRANE PROTEIN NMB PRECURSOR.;, mRNA sequence gi|15686490|gb|BI710795.1|BI710795[15686490]

[8804] 788: BC014500 Homo sapiens, Similar to leucine zipper-EF-hand containing transmembrane protein 1, clone MGC:23613 IMAGE:4860194, mRNA, complete cds gi|15680274|gb|BC014500.1|BC014500[15680274]

[8805] 789: BC014443 Homo sapiens, Similar to transmembrane protein vezatin, clone IMAGE:4851150, mRNA gi|15680188|gb|BC014443.1|BC014443[15680188]

[8806] 790: BC014339 Homo sapiens, Similar to transmembrane 4 superfamily member 1, clone MGC:23935 IMAGE:3828466, mRNA, complete cds gi|15680043|gb|BC014339.1|BC014339[15680043]

[8807] 791: NM—032405 Homo sapiens transmembrane protease, serine 3 (TMPRSS3), transcript variant D, mRNA gi|14602456|ref|NM—032405.1|[14602456]

[8808] 792: NM—032404 Homo sapiens transmembrane protease, serine 3 (TMPRSS3), transcript variant C, mRNA gi|14602454|ref|NM—032404.1|[14602454]

[8809] 793: NM—032401 Homo sapiens transmembrane protease, serine 3 (TMPRSS3), transcript variant B, mRNA gi|14602452|ref|NM—032401.1|[14602452]

[8810] 794: NM—024022 Homo sapiens transmembrane protease, serine 3 (TMPRSS3), transcript variant A, mRNA gi|13173470|ref|NM—024022.1|[13173470]

[8811] 795: AF325418 Ovis aries cystic fibrosis transmembrane conductance regulator (CFTR) gene, intron 21 gi|15637182|gb|AF325418.1|F325416S08[15637182]

[8812] 796: AF325419 Ovis aries cystic fibrosis transmembrane conductance regulator (CFTR) gene, intron 10 gi|15637180|gb|AF325419.1|F325416S06[15637180]

[8813] 797: AH011064 Ovis aries gi|15637174|gb|AH011064.1|SEG_F325416S[15637174]

[8814] 798: NM—022570 Homo sapiens C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 12 (CLECSF12), mRNA gi|13384603|ref|NM—022570.2|[13384603]

[8815] 799: AF360695 Homo sapiens keratinocyte growth factor receptor 2 (FGFR2) gene, exons 3 through 22 and complete cds, alternatively spliced gi|15620559|gb|AF360695.3|AF410480S2[15620559]

[8816] 800: AH010989 Homo sapiens keratinocyte growth factor receptor 2 (FGFR2) gene, complete cds, alternatively spliced gi|15620558|gb|AH010989.3|SEG_AF410480S[15620558]

[8817] 801: AY035377 Homo sapiens peptidoglycan recognition protein-I-beta precursor (PGLYRPIbeta) mRNA, complete cds gi|15590685|gb|AY035377.1|[15590685]

[8818] 802: AY035376 Homo sapiens peptidoglycan recognition protein-I-alpha precursor (PGLYRPIalpha) mRNA, complete cds gi|15590683|gb|AY035376.1|[15590683]

[8819] 803: NM—013317 Homo sapiens lung type-I cell membrane-associated glycoprotein (T1A-2), transcript variant 1, mRNA gi|7019416|ref|NM—013317.1|[7019416]

[8820] 804: AJ318099 Homo sapiens mRNA for putative endoplasmic reticulum multispan transmembrane protein (RFT1 gene) gi|15558857|emb|AJ318099.1|HSA318099[15558857]

[8821] 807: NM—021808 Homo sapiens UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 9 (GalNAc-T9)(GALNT9), mRNA gi|11141878|ref|NM—021808.1|[11141878]

[8822] 808: AF275150 Homo sapiens transmembrane-type protein tyrosine phosphatase H (PTPRH) gene, exon 20 and complete cds gi|9652146|gb|AF275150.1|F275131S20[9652146]

[8823] 809: AF275149 Homo sapiens transmembrane-type protein tyrosine phosphatase H (PTPRH) gene, exon 19 gi|9652145|gb|AF275149.1|F275131S19[9652145]

[8824] 810: AF275148 Homo sapiens transmembrane-type protein tyrosine phosphatase H (PTPRH) gene, exon 18 gi|9652144|gb|AF275148.1|F275131S18[9652144]

[8825] 811: AF275147 Homo sapiens transmembrane-type protein tyrosine phosphatase H (PTPRH) gene, exon 17 gi|9652143|gb|AF275147.1|F275131S17[9652143]

[8826] 812: AF275146 Homo sapiens transmembrane-type protein tyrosine phosphatase H (PTPRH) gene, exon 16 gi|9652142|gb|AF275146.1|F275131S16[9652142]

[8827] 813: AF275145 Homo sapiens transmembrane-type protein tyrosine phosphatase H (PTPRH) gene, exon 15 gi|9652141|gb|AF275145.1|F275131S15[9652141]

[8828] 814: AF275144 Homo sapiens transmembrane-type protein tyrosine phosphatase H (PTPRH) gene, exon 14 gi|9652140|gb|AF275144.1|F275131S14[9652140]

[8829] 815: AF275143 Homo sapiens transmembrane-type protein tyrosine phosphatase H (PTPRH) gene, exon 13 gi|9652139|gb|AF275143.1|F275131S13[9652139]

[8830] 816: AF275142 Homo sapiens transmembrane-type protein tyrosine phosphatase H (PTPRH) gene, exon 12 gi|9652138|gb|AF275142.1|F275131S12[9652138]

[8831] 817: AF275141 Homo sapiens transmembrane-type protein tyrosine phosphatase H (PTPRH) gene, exon 11 gi|9652137|gb|AF275141.1|F275131S1[9652137]

[8832] 818: AF275140 Homo sapiens transmembrane-type protein tyrosine phosphatase H (PTPRH) gene, exon 10 gi|9652136|gb|AF275140.1|F275131S10[9652136]

[8833] 819: AF275139 Homo sapiens transmembrane-type protein tyrosine phosphatase H (PTPRH) gene, exon 9 gi|9652135|gb|AF275139.1|F275131S09[9652135]

[8834] 820: AF275138 Homo sapiens transmembrane-type protein tyrosine phosphatase H (PTPRH) gene, exon 8 gi|9652134|gb|AF275138.1|F275131S08[9652134]

[8835] 821: AF275137 Homo sapiens transmembrane-type protein tyrosine phosphatase H (PTPRH) gene, exon 7 gi|9652133|gb|AF275137.1|F275131S07[9652133]

[8836] 822: AF275136 Homo sapiens transmembrane-type protein tyrosine phosphatase H (PTPRH) gene, exon 6 gi|9652132|gb|AF275136.1|F275131S06[9652132]

[8837] 823: AF275135 Homo sapiens transmembrane-type protein tyrosine phosphatase H (PTPRH) gene, exon 5 gi|9652131|gb|AF275135.1|F275131S05[9652131]

[8838] 824: AF275134 Homo sapiens transmembrane-type protein tyrosine phosphatase H (PTPRH) gene, exon 4 gi|9652130|gb|AF275134.1|F275131S04[9652130]

[8839] 825: AF275133 Homo sapiens transmembrane-type protein tyrosine phosphatase H (PTPRH) gene, exon 3 gi|9652129|gb|AF275133.1|F275131S03[9652129]

[8840] 826: AF275132 Homo sapiens transmembrane-type protein tyrosine phosphatase H (PTPRH) gene, exon 2 gi|9652128|gb|AF275132.1|F275131S02[9652128]

[8841] 827: AF275131 Homo sapiens transmembrane-type protein tyrosine phosphatase H (PTPRH) gene, exon 1 gi|9652127|gb|AF275131.1|F275131S01[9652127]

[8842] 828: AH009676 Homo sapiens transmembrane-type protein tyrosine phosphatase H (PTPRH) gene, complete cds gi|9652126|gb|AH009676.1|SEG_F275131S[9652126]

[8843] 829: NM—017417 Homo sapiens UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 8 (GalNAc-T8)(GALNT8), mRNA gi|8393411|ref|NM—017417.1|[8393411]

[8844] 830: NM—033346 Homo sapiens bone morphogenetic protein receptor, type II (serine/threonine kinase)(BMPR2), transcript variant 2, mRNA gi|15451917|ref|NM033346.1|[15451917]

[8845] 831: NM—001204 Homo sapiens bone morphogenetic protein receptor, type II (serine/threonine kinase)(BMPR2), transcript variant 1, mRNA gi|15451915|ref|NM—001204.3|[15451915]

[8846] 832: NM—003933 Homo sapiens BAI1-associated protein 3 (BAIAP3), mRNA gi|15451913|ref|NM—003933.3|[15451913]

[8847] 833: NM—014256 Homo sapiens UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 3 (B3GNT3), mRNA gi|15451894|ref|NM—014256.2|[15451894]

[8848] 834: NM—033274 Homo sapiens a disintegrin and metalloproteinase domain 19 (meltrin beta) (ADAM19), transcript variant 2, mRNA gi|15451843|ref|NM—033274.1|[15451843]

[8849] 835: NM—023038 Homo sapiens a disintegrin and metalloproteinase domain 19 (meltrin beta) (ADAM19), transcript variant 1, mRNA gi|15451841|ref|NM—023038.2|[15451841]

[8850] 836: NM—030765 Homo sapiens UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 4 (B3GNT4), mRNA gi|13540526|ref|NM—030765.1|[13540526]

[8851] 837: AB048207 Homo sapiens mRNA for TIGA1, complete cds gi|15425668|dbj|AB048207.1|AB048207[15425668]

[8852] 838: NM—006005 Homo sapiens Wolfram syndrome 1 (wolframin)(WFS1), mRNA gi|13376995|ref|NM—006005.2|[13376995]

[8853] 839: NM—015722 Homo sapiens calcyon; Di dopamine receptor-interacting protein (CALCYON), mRNA gi|9257200|ref|NM—015722.2|[9257200]

[8854] 840: AY038990 Homo sapiens ER-localized type I transmembrane adaptor precursor (CAPER) mRNA, complete cds gi|15418959|gb|AY038990.1|[15418959]

[8855] 841: BB226825 BB226825 RIKEN full-length enriched, adult male aorta and vein Mus musculus cDNA clone A530098L04 3′ similar to AF169676 Homo sapiens leucine-rich repeat transmembrane protein FLRT2 (FLRT2) mRNA, mRNA sequence gi|15410201|dbj|BB226825.2|BB226825[15410201]

[8856] 843: AF059274 Homo sapiens neuroglycan C mRNA, complete cds gi|3820499|gb|AF059274.1|AF059274[3820499]

[8857] 844: BC013152 Homo sapiens, Similar to transmembrane protein 5, clone MGC:17085 IMAGE:3919181, mRNA, complete cds gi|15341928|gb|BC013152.1|BC013152[15341928]

[8858] 845: AH011005 Homo sapiens gi|15341629|gb|AH011005.1|SEG_L11671S[15341629]

[8859] 846: AF406650 Homo sapiens putative gap junction protein pannexin 3 (PANX3) mRNA, complete cds gi|1534153|gb|AF406650.1|AF406650[15341531]

[8860] 847: L11671 Homo sapiens transmembrane glycoprotein (CD53) gene, exon 1 gi|291896|gb|L11671.1|L11671S1[291896]

[8861] 848: L11670 Homo sapiens transmembrane glycoprotein (CD53) gene, exons 2 through 8 gi|180145|gb|L11670.1|L11671S2[180145]

[8862] 849: BI468287 id87a04.y1 Human insulinoma Homo sapiens cDNA 5′ similar to TR:Q9Y287 Q9Y287 TRANSMEMBRANE PROTEIN BRI.;, mRNA sequence gi|15284396|gb|BI468287.1|BI468287[15284396]

[8863] 850: BI468286 id87a04.x1 Human insulinoma Homo sapiens cDNA 3′ similar to TR:Q9Y287 Q9Y287 TRANSMEMBRANE PROTEIN BRI.;, mRNA sequence gi|15284395|gb|BI468286.1|BI468286[15284395]

Claims

1. An expression vector comprising a nucleic acid encoding a fusion polypeptide, said fusion polypeptide comprising

a first amino acid sequence which is selected from: a carbohydrate binding domain of a collectin; a carbohydrate binding domain of a galectin; a carbohydrate binding domain of a C-type lectin; or an amino acid sequence which can bind to a carbohydrate on a glycoprotein, said carbohydrate being chosen from the group: D-mannose, D-glucose, D-fucose, L-fucose, N-acetyl-beta-D-glucosamine, N-acetyl-beta-D-glucosamine, a sialic acid; and

a second amino acid sequence comprising a ligand for a cell surface polypeptide, said ligand being chosen from the group: a ligand for a cytokine receptor, a ligand for CD40, a ligand for an adhesion molecule, a ligand for a defensin receptor, a ligand for a heat shock protein receptor, a ligand for a counterreceptor for a T cell costimulatory molecule.

2. The expression vector of claim 1, wherein said first amino acid sequence is N-terminal to said second amino acid sequence.

3. The expression vector of claim 1, wherein said first amino acid sequence is C-terminal to said second amino acid sequence.

4. The expression vector of claim 1, wherein said first amino acid sequence can bind to a sialic acid on a glycoprotein, said sialic acid comprising at least one of the following carbohydrate structures: N-acetylneuraminic acid, alpha-NeuNAc-[2->6]-Gal, alpha-NeuNAc-[2->6]-GalNAc, alpha-NeuNAc-[2->3]-Gal.

5. The expression vector of claim 1, wherein said first amino acid sequence comprises a carbohydrate-binding domain of a naturally occuring lectin.

6. The expression vector of claim 1, wherein said first amino acid sequence comprises at least about 10 contiguous amino acids of a hemagglutinin.

7. The expression vector of claim 6, wherein said hemagglutinin is an influenza virus hemagglutinin.

8. The expression vector of claim 7, wherein said contiguous amino acids of an influenza hemagglutinin are contiguous amino acids of an influenza hemagglutinin HA1 domain.

9. The expression vector of claim 7, wherein said influenza virus is an influenza A virus.

10. The expression vector of claim 9, wherein said influenza virus is of a subtype that infects humans.

11. The expression vector of claim 9, wherein said influenza virus is of an H1 subtype.

12. The expression vector of claim 11, wherein said influenza virus is from the strain A/PR/8/34.

13. The expression vector of claim 10, wherein said influenza virus is of an H2 or H3 subtype.

14. The expression vector of claim 7, wherein said influenza virus is of a subtype that does not infect humans.

15. The expression vector of claim 1, wherein said ligand for a cell surface polypeptide is a ligand for a mammalian cell surface polypeptide.

16. The expression vector of claim 15, wherein said ligand for a cell surface polypeptide is a ligand for a mouse cell surface polypeptide.

17. The expression vector of claim 15, wherein said ligand for a cell surface polypeptide is a ligand for a human cell surface polypeptide.

18. The expression vector of claim 1, wherein said ligand for a cell surface polypeptide is a ligand for a cell surface polypeptide of a leukocyte.

19. The expression vector of claim 1, wherein said ligand for a cell surface polypeptide is a ligand for a cell surface polypeptide of an antigen presenting cell.

20. The expression vector of claim 19, wherein said ligand for a cell surface polypeptide is a ligand for a cell surface polypeptide of a professional antigen presenting cell.

21. The expression vector of claim 18, wherein said ligand for a cell surface polypeptide is a ligand for a cell surface polypeptide of a dendritic cell.

22. The expression vector of claim 1, wherein said ligand for a cell surface polypeptide is a ligand for a mouse GM-CSF receptor.

23. The expression vector of claim 1, wherein said ligand for a cell surface polypeptide comprises at least about five contiguous amino acids of a mouse GM-CSF.

24. The expression vector of claim 1, wherein said ligand for a cell surface polypeptide comprises a mouse GM-CSF.

25. The expression vector of claim 1, wherein said ligand for a cell surface polypeptide is a ligand for a human GM-CSF receptor.

26. The expression vector of claim 1, wherein said ligand for a cell surface polypeptide comprises at least about five contiguous amino acids of a human GM-CSF.

27. The expression vector of claim 1, wherein said ligand for a cell surface polypeptide comprises a human GM-CSF.

28. The expression vector of claim 1, wherein said ligand for a cell surface polypeptide is a ligand for a receptor for an interleukin.

29. The expression vector of claim 1, wherein said ligand for a cell surface polypeptide is a ligand for a receptor for a mouse interleukin.

30. The expression vector of claim 1, wherein said ligand for a cell surface polypeptide is a ligand for a receptor for a human interleukin.

31. The expression vector of claim 28, wherein said interleukin is chosen from the group: IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11, IL12, IL-13, IL14, IL-15, IL-16, IL-17, IL-18, IL-19, IL-20, IL-21, IL-22, IL-23, IL-24, IL-25.

32. The expression vector of claim 28, wherein said ligand for a cell surface polypeptide comprises at least about 5 contiguous amino acids of an interleukin.

33. The expression vector of claim 32, wherein said interleukin is chosen from the group: IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11, IL12, IL-13, IL14, IL-15, IL-16, IL-17, IL-18, IL-19, IL-20, IL-21, IL-22, IL-23, IL-24, IL-25.

34. The expression vector of claim 28, wherein said ligand for a cell surface polypeptide comprises an interleukin.

35. The expression vector of claim 34, wherein said interleukin is chosen from the group: IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11, IL12, IL-13, IL14, IL-15, IL-16, IL-17, IL-18, IL-19, IL-20, IL-21, IL-22, IL-23, IL-24, IL-25.

36. The expression vector of claim 1, wherein said ligand for a cell surface polypeptide is a ligand for a receptor for a chemokine.

37. The expression vector of claim 1, wherein said ligand for a cell surface polypeptide is a ligand for a receptor for a mouse chemokine.

38. The expression vector of claim 1, wherein said ligand for a cell surface polypeptide is a ligand for a receptor for a human chemokine.

39. The expression vector of claim 36, wherein said chemokine is a C-C cytokine.

40. The expression vector of claim 36, wherein said chemokine is a C-X-C cytokine.

41. The expression vector of claim 36, wherein said cell surface polypeptide is chosen from the group: CXCR-1, CXCR-2, CXCR-3, CXCR-4, CCR-1, CCR-2, CCR-3, CCR-4, CCR-5, CCR-6, CCR-7, CCR-8.

42. The expression vector of claim 36, wherein said chemokine is chosen from the group: 9E3, AMCF, beta-thromboglobulin, ENA-78, eotaxin, eotaxin-2, IP-10, KC, LIX, mig, MGSA, mob-1, NAP-2, NAP-3, NAP-4, PBSF, MGSA, mouse KC, MIP-2, MIP-1 alpha, NAP-2, ENA-78, GCP-2, ACT-2, C10, CCF18, DC-CK1, ELC, Exodus, FIC, GDCF, GDCF-2, HC-21, HCC-1, I-309, JE, LAG-1, MARC, MCAF, MCP-1, MCP-2, MCP-3, MCP-4, MCP-5, MRP-2, RANTES SDF, TARC, ATAC, Ltn, SCM-1, neurotactin.

43. The expression vector of claim 36, wherein said ligand for a cell surface polypeptide comprises at least about 5 contiguous amino acids of a chemokine.

44. The expression vector of claim 43, wherein said chemokine is chosen from the group: 9E3, AMCF, beta-thromboglobulin, ENA-78, eotaxin, eotaxin-2, IP-10, KC, LIX, mig, MGSA, mob-1, NAP-2, NAP-3, NAP-4, PBSF, MGSA, mouse KC, MIP-2, MIP-1 alpha, NAP-2, ENA-78, GCP-2, ACT-2, C10, CCF18, DC-CK1, ELC, Exodus, FIC, GDCF, GDCF-2, HC-21, HCC-1, I-309, JE, LAG-1, MARC, MCAF, MCP-1, MCP-2, MCP-3, MCP-4, MCP-5, MRP-2, RANTES SDF, TARC, ATAC, Ltn, SCM-1, neurotactin.

45. The expression vector of claim 36, wherein said ligand for a cell surface polypeptide comprises a chemokine.

46. The expression vector of claim 45, wherein said chemokine is chosen from the group: 9E3, AMCF, beta-thromboglobulin, ENA-78, eotaxin, eotaxin-2, IP-10, KC, LIX, mig, MGSA, mob-1, NAP-2, NAP-3, NAP-4, PBSF, MGSA, mouse KC, MIP-2, MIP-1 alpha, NAP-2, ENA-78, GCP-2, ACT-2, C10, CCF18, DC-CK1, ELC, Exodus, FIC, GDCF, GDCF-2, HC-21, HCC-1, I-309, JE, LAG-1, MARC, MCAF, MCP-1, MCP-2, MCP-3, MCP-4, MCP-5, MRP-2, RANTES SDF, TARC, ATAC, Ltn, SCM-1, neurotactin.

47. The expression vector of claim 1,wherein said ligand for a cell surface polypeptide is a ligand for a receptor for an interferon.

48. The expression vector of claim 1, wherein said ligand for a cell surface polypeptide is a ligand for a receptor for a mouse interferon.

49. The expression vector of claim 1, wherein said ligand for a cell surface polypeptide is a ligand for a receptor for a human interferon.

50. The expression vector of claim 47, wherein said interferon is chosen from the group: an interferon-alpha, an interferon-beta, an interferon gamma.

51. The expression vector of claim 47, wherein said ligand for a cell surface polypeptide comprises at least about 5 contiguous amino acids of an interferon.

52. The expression vector of claim 51, wherein said interferon is chosen from the group: an interferon-alpha, an interferon-beta, an interferon gamma.

53. The expression vector of claim 47, wherein said ligand for a cell surface polypeptide comprises an interferon.

54. The expression vector of claim 53, wherein said interferon is chosen from the group: an interferon-alpha, an interferon-beta, an interferon gamma.

55. The expression vector of claim 1, wherein said ligand for a cell surface polypeptide is a ligand for a mouse TNF-alpha receptor.

56. The expression vector of claim 1, wherein said ligand for a cell surface polypeptide comprises at least about five contiguous amino acids of a mouse TNF-alpha.

57. The expression vector of any claim 1, wherein said ligand for a cell surface polypeptide comprises a mouse TNF-alpha.

58. The expression vector of claim 1, wherein said ligand for a cell surface polypeptide is a ligand for a human TNF-alpha receptor.

59. The expression vector of claim 1, wherein said ligand for a cell surface polypeptide comprises at least about five contiguous amino acids of a human TNF-alpha.

60. The expression vector of claim 1, wherein said ligand for a cell surface polypeptide comprises a human TNF-alpha.

61. The expression vector of claim 1, wherein said ligand for a cell surface polypeptide is a ligand for a mouse flt-3 receptor.

62. The expression vector of claim 1, wherein said ligand for a cell surface polypeptide comprises at least about five contiguous amino acids of a mouse flt-3.

63. The expression vector of claim 1, wherein said ligand for a cell surface polypeptide comprises a mouse flt-3.

64. The expression vector of claim 1, wherein said ligand for a cell surface polypeptide is a ligand for a human flt-3 receptor.

65. The expression vector of claim 1, wherein said ligand for a cell surface polypeptide comprises at least about five contiguous amino acids of a human flt-3.

66. The expression vector of claim 1, wherein said ligand for a cell surface polypeptide comprises a human flt-3.

67. The expression vector of claim 1, wherein said encoded fusion polypeptide further comprises a linker interposed between said first and second amino acid sequences.

68. The expression vector of claim 67, wherein said linker has the formula (GlyxSer)n, wherein n is an integer between 1 and 15, and x is an integer between 1 and 10.

69. The expression vector of claim 1, wherein said encoded fusion polypeptide further comprises a secretory signal sequence.

70. The expression vector of claim 1, which is a eukaryotic expression vector.

71. The expression vector of claim 70, which is a yeast expression vector.

72. The expression vector of claim 70, which is a mammalian expression vector.

73. The expression vector of claim 1, which comprises an inducible promoter.

74. A host cell comprising a nucleic acid molecule encoding a fusion polypeptide, said fusion polypeptide comprising

a first amino acid sequence which is selected from: a carbohydrate binding domain of a collectin; a carbohydrate binding domain of a galectin; a carbohydrate binding domain of a C-type lectin; or an amino acid sequence which can bind to a carbohydrate on a glycoprotein, said carbohydrate being chosen from the group: D-mannose, D-glucose, D-fucose, L-fucose, N-acetyl-beta-D-glucosamine, N-acetyl-beta-D-glucosamine, a sialic acid; and

a second amino acid sequence comprising a ligand for a cell surface polypeptide, said ligand being chosen from the group: a ligand for a cytokine receptor, a ligand for CD40, a ligand for an adhesion molecule, a ligand for a defensin receptor, a ligand for a heat shock protein receptor, a ligand for a T cell costimulatory molecule, a ligand for a counterreceptor for a T cell costimulatory molecule.

75. The host cell of claim 74, wherein said first amino acid sequence is N-terminal to said second amino acid sequence.

76. The host cell of claim 74, wherein said first amino acid sequence is C-terminal to said second amino acid sequence.

77. The host cell of claim 74, wherein said first amino acid sequence can bind to a sialic acid on a glycoprotein, said sialic acid comprising at least one of the following carbohydrate structures: N-acetylneuraminic acid, alpha-NeuNAc-[2->6]-Gal, alpha-NeuNAc-[2->6]-GalNAc, alpha-NeuNAc-[2->3]-Gal.

78. The host cell of claim 74, wherein said first amino acid sequence comprises a carbohydrate-binding domain of a naturally occuring lectin.

79. The host cell of claim 74, wherein said first amino acid sequence comprises at least about 10 contiguous amino acids of a hemagglutinin.

80. The host cell of claim 79, wherein said hemagglutinin is an influenza virus hemagglutinin.

81. The host cell of claim 80, wherein said contiguous amino acids of an influenza hemagglutinin are contiguous amino acids of an influenza hemagglutinin HA1 domain.

82. The host cell of claim 80, wherein said influenza virus is an influenza A virus.

83. The host cell of claim 80, wherein said influenza virus is of a subtype that infects humans.

84. The host cell of claim 82, wherein said influenza virus is of an H1 subtype.

85. The host cell of claim 83, wherein said influenza virus is from the strain A/PR/8/34.

86. The host cell of claim 82, wherein said influenza virus is of an H2 or H3 subtype.

87. The host cell of claim 80, wherein said influenza virus is of a subtype that does not infect humans.

88. The host cell of claim 74, wherein said ligand for a cell surface polypeptide is a ligand for a mammalian cell surface polypeptide.

89. The host cell of claim 88, wherein said ligand for a cell surface polypeptide is a ligand for a mouse cell surface polypeptide.

90. The host cell of claim 88, wherein said ligand for a cell surface polypeptide is a ligand for a human cell surface polypeptide.

91. The host cell of claim 74, wherein said ligand for a cell surface polypeptide is a ligand for a cell surface polypeptide of a leukocyte.

92. The host cell of claim 74, wherein said ligand for a cell surface polypeptide is a ligand for a cell surface polypeptide of an antigen presenting cell.

93. The host cell of claim 19, wherein said ligand for a cell surface polypeptide is a ligand for a cell surface polypeptide of a professional antigen presenting cell.

94. The host cell of claim 91, wherein said ligand for a cell surface polypeptide is a ligand for a cell surface polypeptide of a dendritic cell.

95. The host cell of claim 74, wherein said ligand for a cell surface polypeptide is a ligand for a mouse GM-CSF receptor.

96. The host cell of claim 74, wherein said ligand for a cell surface polypeptide comprises at least about five contiguous amino acids of a mouse GM-CSF.

97. The host cell of claim 74, wherein said ligand for a cell surface polypeptide comprises a mouse GM-CSF.

98. The host cell of claim 74, wherein said ligand for a cell surface polypeptide is a ligand for a human GM-CSF receptor.

99. The host cell of claim 74, wherein said ligand for a cell surface polypeptide comprises at least about five contiguous amino acids of a human GM-CSF.

100. The host cell of claim 74, wherein said ligand for a cell surface polypeptide comprises a human GM-CSF.

101. The host cell of claim 74, wherein said ligand for a cell surface polypeptide is a ligand for a receptor for an interleukin.

102. The host cell of claim 74, wherein said ligand for a cell surface polypeptide is a ligand for a receptor for a mouse interleukin.

103. The host cell of claim 74, wherein said ligand for a cell surface polypeptide is a ligand for a receptor for a human interleukin.

104. The host cell of claim 101, wherein said interleukin is chosen from the group: IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-12, IL-13, IL-14, IL-15, IL-16, IL-17, IL-18, IL-19, IL-20, IL-21, IL-22, IL-23, IL-24, IL-25.

105. The host cell of claim 101, wherein said ligand for a cell surface polypeptide comprises at least about 5 contiguous amino acids of an interleukin.

106. The host cell of claim 105, wherein said interleukin is chosen from the group: IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-12, IL-13, IL-14, IL-15, IL-16, IL-17, IL-18, IL-19, IL-20, IL-21, IL-22, IL-23, IL-24, IL-25.

107. The host cell of claim 101, wherein said ligand for a cell surface polypeptide comprises an interleukin.

108. The host cell of claim 107, wherein said interleukin is chosen from the group: IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-12, IL-13, IL-14, IL-15, IL-16, IL-17, IL-18, IL-19, IL-20, IL-21, IL-22, IL-23, IL-24, IL-25.

109. The host cell of claim 74, wherein said ligand for a cell surface polypeptide is a ligand for a receptor for a chemokine.

110. The host cell of claim 74, wherein said ligand for a cell surface polypeptide is a ligand for a receptor for a mouse chemokine.

111. The host cell of claim 74, wherein said ligand for a cell surface polypeptide is a ligand for a receptor for a human chemokine.

112. The host cell of claim 109, wherein said chemokine is a C-C cytokine.

113. The host cell of claim 109, wherein said chemokine is a C-X-C cytokine.

114. The host cell of claim 109, wherein said cell surface polypeptide is chosen from the group: CXCR-1, CXCR-2, CXCR-3, CXCR4, CCR-1, CCR-2, CCR-3, CCR-4, CCR-5, CCR-6, CCR-7, CCR-8.

115. The host cell of claim 109, wherein said chemokine is chosen from the group: 9E3, AMCF, beta-thromboglobulin, ENA-78, eotaxin, eotaxin-2, IP-10, KC, LIX, mig, MGSA, mob-1, NAP-2, NAP-3, NAP-4, PBSF, MGSA, mouse KC, MIP-2, MIP-1 alpha, NAP-2, ENA-78, GCP-2, ACT-2, C10, CCF18, DC-CK1, ELC, Exodus, FIC, GDCF, GDCF-2, HC-21, HCC-1, I-309, JE, LAG-1, MARC, MCAF, MCP-1, MCP-2, MCP-3, MCP-4, MCP-5, MRP-2, RANTES SDF, TARC, ATAC, Ltn, SCM-1, neurotactin.

116. The host cell of claim 109, wherein said ligand for a cell surface polypeptide comprises at least about 5 contiguous amino acids of a chemokine.

117. The host cell of claim 116, wherein said chemokine is chosen from the group: 9E3, AMCF, beta-thromboglobulin, ENA-78, eotaxin, eotaxin-2, IP-10, KC, LIX, mig, MGSA, mob-1, NAP-2, NAP-3, NAP-4, PBSF, MGSA, mouse KC, MIP-2, MIP-1 alpha, NAP-2, ENA-78, GCP-2, ACT-2, C10, CCF18, DC-CK1, ELC, Exodus, FIC, GDCF, GDCF-2, HC-21, HCC-1, I-309, JE, LAG-1, MARC, MCAF, MCP-1, MCP-2, MCP-3, MCP-4, MCP-5, MRP-2, RANTES SDF, TARC, ATAC, Ltn, SCM-1, neurotactin.

118. The host cell of claim 109, wherein said ligand for a cell surface polypeptide comprises a chemokine.

119. The host cell of claim 118, wherein said chemokine is chosen from the group: 9E3, AMCF, beta-thromboglobulin, ENA-78, eotaxin, eotaxin-2, IP-10, KC, LIX, mig, MGSA, mob-1, NAP-2, NAP-3, NAP-4, PBSF, MGSA, mouse KC, MIP-2, MIP-1 alpha, NAP-2, ENA-78, GCP-2, ACT-2, C10, CCF18, DC-CK1, ELC, Exodus, FIC, GDCF, GDCF-2, HC-21, HCC-1, I-309, JE, LAG-1, MARC, MCAF, MCP-1, MCP-2, MCP-3, MCP-4, MCP-5, MRP-2, RANTES SDF, TARC, ATAC, Ltn, SCM-1, neurotactin.

120. The host cell of claim 74, wherein said ligand for a cell surface polypeptide is a ligand for a receptor for an interferon.

121. The host cell of claim 74, wherein said ligand for a cell surface polypeptide is a ligand for a receptor for a mouse interferon.

122. The host cell of claim 74, wherein said ligand for a cell surface polypeptide is a ligand for a receptor for a human interferon.

123. The host cell of claim 120, wherein said interferon is chosen from the group: an interferon-alpha, an interferon-beta, an interferon gamma.

124. The host cell of claim 120, wherein said ligand for a cell surface polypeptide comprises at least about 5 contiguous amino acids of an interferon.

125. The host cell of claim 124, wherein said interferon is chosen from the group: an interferon-alpha, an interferon-beta, an interferon gamma.

126. The host cell of claim 120, wherein said ligand for a cell surface polypeptide comprises an interferon.

127. The host cell of claim 126, wherein said interferon is chosen from the group: an interferon-alpha, an interferon-beta, an interferon gamma.

128. The host cell of claim 74, wherein said ligand for a cell surface polypeptide is a ligand for a mouse TNF-alpha receptor.

129. The host cell of claim 74, wherein said ligand for a cell surface polypeptide comprises at least about five contiguous amino acids of a mouse TNF-alpha.

130. The host cell of claim 74, wherein said ligand for a cell surface polypeptide comprises a mouse TNF-alpha.

131. The host cell of claim 74, wherein said ligand for a cell surface polypeptide is a ligand for a human TNF-alpha receptor.

132. The host cell of claim 74, wherein said ligand for a cell surface polypeptide comprises at least about five contiguous amino acids of a human TNF-alpha.

133. The host cell of claim 74, wherein said ligand for a cell surface polypeptide comprises a human TNF-alpha.

134. The host cell of claim 74, wherein said ligand for a cell surface polypeptide is a ligand for a mouse flt-3 receptor.

135. The host cell of claim 74, wherein said ligand for a cell surface polypeptide comprises at least about five contiguous amino acids of a mouse flt-3.

136. The host cell of any claim 74, wherein said ligand for a cell surface polypeptide comprises a mouse flt-3.

137. The host cell of claim 74, wherein said ligand for a cell surface polypeptide is a ligand for a human flt-3 receptor.

138. The host cell of claim 74, wherein said ligand for a cell surface polypeptide comprises at least about five contiguous amino acids of a human flt-3.

139. The host cell of claim 74, wherein said ligand for a cell surface polypeptide comprises a human flt-3.

140. The host cell of claim 74, wherein said encoded fusion polypeptide further comprises a linker interposed between said first and second amino acid sequences.

141. The host cell of claim 140, wherein said linker has the formula (GlyySer)n, wherein n is an integer between 1 and 15, and x is an integer between 1 and 10.

142. The host cell of claim 74, wherein said encoded fusion polypeptide further comprises a secretory signal sequence.

143. The host cell of claim 74, which is a prokaryotic cell.

144. The host cell of claim 74, which is a eukaryotic cell.

145. The host cell of claim 144, which is a yeast cell.

146. The host cell of claim 144, which is a mammalian cell.

147. The host cell of claim 144, which is an insect cell.