Effector proteins of rapamycin
This invention comprises antibodies to rapamycin effector proteins, and preparations thereof. Novel Rapamycin-FKBP12 binding proteins, nucleic acids and their fragments are also described, as are related methods and therapeutic uses of the proteins, nucleic acids, and antibodies.
Latest Wyeth Patents:
- Chewable tablet containing phenylephrine
- LOCAL VASCULAR DELIVERY OF TRICHOSTATIN A ALONE OR IN COMBINATION WITH SIROLIMUS TO PREVENT RESTENOSIS FOLLOWING VASCULAR INJURY
- ANTINEOPLASTIC COMBINATIONS OF 4-ANILINO-3-CYANOQUINOLINES AND CAPECITABINE
- PERIPHERAL OPIOID RECEPTOR ANTAGONISTS AND USES THEREOF
- NEUTRALIZING ANTIBODIES AGAINST GDF-8 AND USES THEREFOR
[0001] This application is a continuation-in-part of co-pending patent application Ser. No. 08/384,524, filed Feb. 13, 1995, which is a continuation-in-part of patent application Ser. No. 08/312,023, filed Sep. 26, 1994, now abandoned, which is a continuation-in-part of patent application Ser. No. 08/207,975, filed Mar. 8, 1994, now abandoned.
[0002] This invention concerns effector proteins of Rapamycin. More particularly, this invention concerns novel Rapamycin-FKBP12 binding proteins of mammalian origin for identification, design and synthesis of immunomodulatory, anti-restenosis or anti-tumor agents.
BACKGROUND OF THE INVENTION[0003] Rapamycin is a macrolide antibiotic produced by Streptomyces hygroscopicus which was first characterized via its properties as an antifungal agent. It adversely affects the growth of fungi such as Candida albicans and Microsporum gypseum. Rapamycin, its preparation and its antibiotic activity were described in U.S. Pat. No. 3,929,992, issued Dec. 30, 1975 to Surendra Sehgal et al. In 1977 Martel, R. R. et al. reported on immunosuppressive properties of rapamycin against experimental allergic encephalitis and adjuvant arthritis in the Canadian Journal of Physiological Pharmacology, 55, 48-51 (1977). In 1989, Calne, R. Y. et al. in Lancet, 1989, no. 2, p. 227 and Morris, R. E. and Meiser, B. M. in Medicinal Science Research, 1989, No. 17, P. 609-10, separately reported on the effectiveness of rapamycin in inhibiting rejection in vivo in allograft transplantation. Numerous articles have followed describing the immunosuppressive and rejection inhibiting properties of rapamycin, and clinical investigation has begun for the use of rapamycin in inhibiting rejection in transplantation in man.
[0004] Rapamycin alone (U.S. Pat. No. 4,885,171) or in combination with picibanil (U.S. Pat. No. 4,401,653) has been shown to have antitumor activity. R. R. Martel et al. [Can. J. Physiol. Pharmacol. 55, 48 (1977)] disclosed that rapamycin is effective in the experimental allergic encephalomyelitis model, a model for multiple sclerosis; in the adjuvant arthritis model, a model for rheumatoid arthritis; and effectively inhibited the formation of IgE-like antibodies.
[0005] The immunosuppressive effects of rapamycin have been disclosed in FASEB 3, 3411 (1989). Cyclosporin A and FK-506, other macrocyclic molecules, also have been shown to be effective as immunosuppressive agents, therefore useful in preventing transplant rejection [FASEB 3, 3411 (1989); FASEB 3, 5256 (1989); R. Y. Calne et al., Lancet 1183 (1978); and U.S. Pat. No. 5,100,899].
[0006] Rapamycin has also been shown to be useful in preventing or treating systemic lupus erythematosus [U.S. Pat. No. 5,078,999], pulmonary inflammation [U.S. Pat. No. 5,080,899], insulin dependent diabetes mellitus [Fifth Int. Conf. Inflamm. Res. Assoc. 121 (Abstract), (1990)], and smooth muscle cell proliferation and intimal thickening following vascular injury [Morris, R. J. Heart Lung Transplant 11 (pt. 2): 197 (1q92)].
[0007] Mono- and diacylated derivatives of rapamycin (esterified at the 28 and 43 positions) have been shown to be useful as antifungal agents (U.S. Pat. No. 4,316,885) and used to make water soluble prodrugs of rapamycin (U.S. Pat. No. 4,650,803). Recently, the numbering convention for rapamycin has been changed; therefore according to Chemical Abstracts nomenclature, the esters described above would be at the 31- and 42-positions. U.S. Pat. No. 5,118,678 discloses carbamates of rapamycin that are useful as immunosuppressive, anti-inflammatory, antifungal, and antitumor agents. U.S. Pat. No. 5,100,883 discloses fluorinated esters of rapamycin. U.S. Pat. No. 5,118,677 discloses amide esters of rapamycin. U.S. Pat. No. 5,130,307 discloses aminoesters of rapamycin. U.S. Pat. No. 5,117,203 discloses sulfonates and sulfamates of rapamycin. U.S. Pat. No. 5,194,447 discloses sulfonylcarbamates of rapamycin.
[0008] U.S. Pat. No. 5,100,899 (Calne) discloses methods of inhibiting transplant rejection in mammals using rapamycin and derivatives and prodrugs thereof. Other chemotherapeutic agents listed for use with rapamycin are azathioprine, coricosteroids, cyclosporin (and cyclosporin A), and FK-506, or any combination thereof.
[0009] Rapamycin produces immunosuppressive effects by blocking intracellular signal transduction. Rapamycin appears to interfere with a calcium independent signalling cascade in T cells and mast cells [Schreiber et al. (1992) Tetrahedron 48:2545-2558]. Rapamycin has been shown to bind to certain immunophilins which are members of the FK-506 binding proteins (FKBP) family. In particular, Rapamycin has been shown to bind to the binding proteins, FKBP12, FKBP13, FKBP25 [Galat A. et al., (1992) Biochemistry 31(8);2427-2437 and Ferrera A, et al., (1992) Gene 113(1):125-127; Armistead and Harding, Ann. Reports in Med. Chem. 28:207-215, 1993], and FKBP52 [WO 93/07269]
[0010] Rapamycin is able to inhibit mitogen-induced T cell and B cell proliferation as well as proliferation induced by several cytokines, including IL-2, IL-3, IL-4 and IL-6 (reviewed by Sehgal et al., Med. Research Rev.14: 1-22, 1994). It can also inhibit antibody production. Rapamycin has been shown to block the cytokine-induced activation of p7056 kinase which appears to correlate with Rapamycin's ability to decrease protein synthesis accompanying cell cycle progression (Calvo et al., Proc. Natl. Acad. Sci. USA, 89:7571-7575,1992; Chung et al., Cell 69:1227-1236, 1992; Kuo et al., Nature 358:70-73,1992; Price et al., Science 257:973-977, 1992). It also inhibits the activation of cdk2/cyclin E complex (Flanagan et al., Ann. N.Y.Acad. Sci, in press; Flanagan et al, Mol. Cell biol., in press; Flanagan et al., J.Cell Biochem. 17A:292, 1993). Rapamycin's effects are not mediated by direct binding to p7056 kinase and cdk2/cyclin E, but by action of the Rapamycin-FKBP complex on upstream component(s) which regulate the activation status of the kinases.
[0011] It is generally accepted that the action of immunosuppressive drugs, such as Rapamycin, cyclosporine and FK506, is dependent upon the formation of a complex with their respective intracellular receptor proteins called immunophilins. While the binding of these immunosuppressants with their respective immunophilins inhibits the cis-trans peptidyl prolyl isomerase (PPIase) activity of immunophilins, PPIase inhibition is not sufficient to mediate the immunosuppressive activity (reviewed in Armistead and Harding, Annual Reports in Med. Chem, 28:207-215:1993). Two rapamycin analogs which are Diels Alder adducts, one with 4-phenyl-1,2,4-triazoline-3,5-dione, and the second with 4-methyl-1,2,4-triazoline-3,5-dione, bind to FKBP, inhibited its PPIase activity, yet they did not exhibit any detectable immunosuppressive activity. The phenyl-triazolinedione Diels Alder adduct at high molar excess has been shown to competitively inhibit rapamycin's effect on DNA synthesis in mitogen-stimulated murine thymocyte proliferation (Ocain et al., Biochem. Biophys. Res. Commun. 192:1340, 1993). Recent evidence suggests that the binary immunophilin-drug complex such as cyclophilin-cyclosporin A and FKBP-FK506 gains a new function that enables it to block signal transduction by acting on specific target proteins. The molecular target of both cyclophilin-cyclosporin A and FKBP-FK506 complexes such as has been identified as the Ca+2/calmodulin dependent serine/threonine phosphatase calcineurin (J. Liu et al, Cell 66, 807, 1991; J. Liu et al, Biochemistry 31, 3896, 1992; W. M. Flanagan, et al., Nature 352, 803, 1992; McCaffrey et al., J. Biol. Chem. 268, 3747, 1993; McCaffrey et al., Science 262:750, 1993).
[0012] Rapamycin's antifungal and immunosuppressive activities are mediated via a complex consisting of Rapamycin, a member of the FK506 binding protein (FKBP) family and at least one additional third protein, called the target of Rapamycin (TOR). The family of FKBPs is reviewed by Armistead and Harding (Annual Repons in Med. Chem, 28:207-215:1993). The relevant FKBP molecule in Rapamycin's antifungal activity has been shown to be FKBP12 (Heitman et al., Science 253:905-909:1993). In mammalian cells, the relevant FKBPs are being investigated. Although two TOR proteins (TOR1 and TOR2) have been identified in yeast (Kunz et al., Cell 73:585-596:1993), the target of Rapamycin in human cells remains elusive. The carboxy terminus of yeast TOR2 has been shown to exhibit 20% identity with two proteins, the p110 subunit of phosphatidylinositol 3-kinase and VPS34, a yeast vacuolar sorting protein also shown to have PI 3K activity. However, J. Blenis et al. (AAI meeting, May, 1993) have reported that Rapamycin-FKBP12 complex does not directly mediate its effects on PDGF stimulated cells via the p110, p85 PI 3K complex.
DESCRIPTION OF THE INVENTION[0013] This invention concerns isolated, cloned and expressed proteins which bind to a complex of GST-FKBP12-Rapamycin. These proteins are isolated from membrane preparations of Molt 4 T cell leukemia. The sizes of the four novel proteins are estimated by PAGE migration to be 125±12 kilodaltons (kDa), 148±14 kDa, 208+15 kDa and 210+220 kDa and will be referred to herein and in the claims that follow, as the 125 kDa, 148 kDa, 208 kDa, and 210 kDa, respectively. The four proteins may also be referred to herein as effector proteins.
[0014] The proteins of this invention can be used in screening assays, such as enzyme inhibitor assays and binding assays, to identify endogenous complexes and ligands and novel exogenous compounds (like Rapamycin) which modulate their functions. They can also be used in assays to identify compounds with therapeutic benefit for restenosis, immunomodulation and as antitumor agents. Cloning the proteins of this invention does not only allow the production of large quantities of the proteins, it also provides a basis for the development of related anti-sense therapeutics. The use of cDNA clones to generate anti-sense therapeutics with immunomodulatory activity (for use against transplantation rejection, graft versus host disease, autoimmune diseases such as lupus, myasthenia gravis, multiple sclerosis, rheumatoid arthritis, type I diabetes, and diseases of inflammation such as psoriasis, dermitis, eczema, seborrhea, inflammatory bowel disease, pulmonary inflammation, asthma, and eye uveitis), antirestenosis and anti-tumor activity is included within the scope of this invention.
[0015] The proteins of the present invention can be isolated from mammalian cells, such as cells of the T cell leukemia cell line, Molt 4 (ATCC 1582, American Type Cell Culture, 12301 Parklawn Drive, Rockville, Md., USA, 20852), the B cell lymphoma, BJAB, or normal human T cells. These mammalian cells can be lysed in a buffer containing protease inhibitors and reducing agent (2-ME), such as hypotonic buffer A (100 mM HEPES, pH 7.5, 20 mM KCl, 1 mM EDTA, 0.4 mM PMSF and 2 mM beta mercaptoethanol (2-ME)). The cell nuclei and unbroken cells are cleared by centrifugation at a temperature which minimizes protein degradation. The membrane fraction of the cells can then be concentrated or pelleted by ultracentrifugation at 100,000 g. Detergent solubilization of the membrane pellet is carried out in a detergent containing buffer such as buffer B (50 mM Tris, pH 7.2, 100 mM NaCl, 20 mM KCl, 0.2 mM PMSF, 1 mM 2-ME, 2 mM CaCl2, 2 mM MgCl2, 5 &mgr;g/ml aprotinin, leupeptin, pepstatin A and antipain), containing CHAPSO (3-[(3-cholamido-propyl)dimethylammonio]-1-propane sulfonate; 12 mM) or Triton X100 (polyethylene glycol 4-isooctylphenyl ether). The solubilized membrane proteins can then be separated from the debris by 100,000 g ultracentifugation at a temperature which minimizes protein degradation. The supernatant containing solubilized membrane proteins is then preabsorbed with an affinity resin, such as glutathione resin, in the presence of protease inhibitors at a temperature which minimizes protein degradation. After centrifuation to remove the resin from the supernatant, the supernatant is then incubated with complexed Rapamycin or Rapamycin analog to FKBP, such as GST-FKBP12—Rapamycin at a temperature which minimizes protein degradation. The mixture of solubilized membrane proteins, incubated with complexed Rapamycin or Rapamycin analog to FKBP, such as GST-FKBP12—Rapamycin, can then be incubated with the affinity resin to bind the complexes of rapamycin or rapamycin analog, FKBP fusion protein and binding proteins at a temperature which minimizes protein degradation. After most non-specific proteins are rinsed away using a detergent containing buffer, such as Buffer C (50 mM Tris, pH 7.2, 100 mM NaCl, 20 mM KCl, 0.2 mM PMSF, 1 mM 2-ME or 10 mM dithiothreitol, 0-5 mM CaCl2, 0-5 mM MgCl2, 5 &mgr;g/ml aprotinin, leupeptin, pepstatin A and antipain and 0.1% Triton X100) (Polyethylene glycol 4-isooctyl phenyl ether), the proteins are eluted from the resin under denaturing conditions, such as a buffer containing sufficient detergent to dissociate it from resin (e.g. Laehli buffer with or without glycerol or dye, as described by Laemli, Nature 227:680, 1970), or non-denaturing conditions such as a buffer containing an appropriate eluting compound for the affinity column, such as 5 mM glutathione. The proteins can then be separated by size using SDS polyacrylamide gel electrophoresis (SDS-PAGE).
[0016] The present invention also includes the genomic DNA sequences for the abovementioned proteins, as well as the cDNA and anti-sense RNA and DNA sequences which correspond to the genes for the abovementioned proteins. The present invention further includes the proteins of other mammalian species which are homologous or equivalent at least in function to the abovementioned proteins, as well as the DNA gene sequences for the homologous or equivalent proteins and the cDNA and anti-sense RNA and DNA sequences which correspond to the genes for the homologous or equivalent proteins.
[0017] For the purposes of this disclosure and the claims that follow, equivalents of the proteins of this invention are considered to be proteins, protein fragments and/or truncated forms with substantially similar, but not identical, amino acid sequences to the proteins mentioned above, the equivalents exhibiting rapamycin-FKBP complex binding characteristics and function similar to the proteins mentioned above. Therefore, in this specification and the claims below, references to the 125 kDa, 148 kDa, 208 kDa, and 210 kDa proteins of this invention are also to be understood to indicate and encompass homologous or equivalent proteins, as well as fragmented and/or truncated forms with substantially similar, but not identical, amino acid sequences of the 125 kDa, 148 kDa, 208 kDa, and 210 kDa proteins mentioned above.
[0018] These proteins or protein homologues or equivalents can be generated by similar isolation procedures from different cell types and/or by recombinant DNA methods and may be modified by techniques including site directed mutagenesis. For example, the genes of this invention can be engineered to express one or all of the proteins as a fusion protein with the fusion partner giving an advantage in isolation (e.g. HIS oligomer, immunoglobulin Fc, glutathione S-transferase, FLAG etc). Mutations or truncations which result in a soluble form can also be generated by site directed mutagenesis and would give advantages in isolation.
[0019] This invention further includes oligopeptide fragments, truncated forms and protein fragments that retain binding affinity vet have less than the active protein's amino acid sequences. This invention also includes monoclonal and polyclonal antibodies specific for the proteins and their uses. Such uses include methods for screening for novel agents for immunomodulation and/or anti-tumor activity and methods of measuring the parent compound and/or metabolites in biological samples obtained from individuals taking immunosuppressive drugs. The use of the cDNA clone to generate anti-sense therapeutics (Milligan et al, J. Med. Chem. 36:1923-1936, 1993) with immunomodulatory activity (transplantation rejection, graft versus host disease, autoimmune diseases such as lupus, myasthenia gravis, multiple sclerosis, rheumatoid arthritis, type I diabetes, and diseases of inflammation such as psoriasis, dermitis, eczema, seborrhea, inflammatory bowel disease, pulmonary inflammation, asthma, and eye uveitis), and anti-tumor activity is also included in the present invention.
[0020] The proteins of this invention can also be made by recombinant DNA techniques familiar to those skilled in the art. That is, the gene of the protein in question can be cloned by obtaining a partial amino acid sequence by digestion of the protein with a protease, such as Lysine C, and isolating the resulting protein fragments by microbore HPLC, followed by fragment sequencing (Matsudaira in A Practical Guide to Protein and Peptide Purification for Microsequencing, Academic Press (San Diego, Calif., 1989)). The determined sequence can then be used to make oligonucleotide probes which can be used to screen a human cDNA library directly or generate probes by polymerase chain reaction. The library can be generated from human T cells or the cell lines, Molt 4, Jurkat, or other etc. to obtain clones. These clones can be used to identify additional clones containing additional sequences until the protein's full gene, i.e. complete open reading frame, is cloned.
[0021] It is known in the art that some proteins can be encoded by an open reading frame which is longer than initially predicted by the size of the protein. These proteins may represent cleavage products of the precursor protein translated from the complete open reading frame (eg. IL-1 beta) or proteins translated using a downstream start codon (eg. Hepaptitis B surface antigen). In view of this knowledge, it is understood that the term cDNA as used herein and in the claims below refers to cDNA for the gene's complete open reading frame or any portions thereof which may code for a protein of this invention or the protein's fragments, together or separate, or truncated forms, as previously discussed.
[0022] In a complementary strategy, the gene(s) for the proteins of this invention may be identified by interactive yeast cloning techniques using FKBP12:RAPA as a trap for cloning. These strategies can also be combined to quicken the identification of the clones.
[0023] The relevant cDNA clone encoding the gene for any of the four proteins can also be expressed in E. coli, yeast, or baculovirus infected cells or mammalian cells using state of the art expression vectors. Isolation can be performed as above or the cDNA can be made as a fusion protein with the fusion partner giving an advantage in isolation (e.g. HIS oligomer, immunoglobulin Fc, glutathione S-transferase, etc). Mutations which result in a soluble form can also be generated by site directed mutagenesis and would give advantages in isolation.
[0024] The uses of such cDNA clones include production of recombinant proteins. Further, such recombinant proteins, or the corresponding natural proteins isolated from mammalian cells, or fragments thereof (including peptide oligomers) are useful in generation of antibodies to these proteins. Briefly, monoclonal or polyclonal antibodies are induced by immunization with recombinant proteins, or the corresponding natural proteins isolated from mammalian cells, or fragments thereof (including peptide oligomers conjugated to a carrier protein (e.g. keyhole limpet hemocyanin or bovine serum albumin)) of animals using state of the art techniques. The antibodies can be used in the purification process of the natural proteins isolated from mammalian cells or recombinant proteins from E. coli, yeast, or baculovirus infected cells or mammalian cells, or cell products.
[0025] The uses of such cDNA clones include production of recombinant proteins. Further, such recombinant proteins, or the corresponding natural proteins isolated from mammalian cells, are useful in methods of screening for novel agents such as synthetic compounds, natural products, exogenous or endogenous substrates for immunomodulation and/or antitumor activity. The natural products which may be screened may include, but are not limited to, cell lysates, cell supernatants, plant extracts and the natural broths of fungi or bacteria. As an example of a competitive binding assay, one of these proteins attached to a matrix (either covalently or noncovalently) can be incubated with a buffer containing the compounds, natural products, cell lysates or cell supernatants and a labeled rapamycin:FKBP complex. The ability of the compound, natural products, exogenous or endogenous substrates to competitively inhibit the binding of the complex or specific antibody can be assessed. Examples of methods for labeling the complex include radiolabeling, fluorescent or chemiluminescent tags, fusion proteins with FKBP such as luciferase, and conjugation to enzymes such as horse radish peroxidase, alkaline phosphatase, acetylcholine esterase (ACHE), etc. As an example of an enzymatic assay, the proteins are incubated in the presence or absence of novel agents such as synthetic compounds, natural products, exogenous or endogenous substrates with substrate and the enzymatic activity of the protein can be assessed. Methods of measuring the parent compound and/or metabolites in biological samples obtained from individuals taking immunosuppressive drugs can also be assessed using these proteins.
[0026] This invention includes a method for identifying substances which may be useful as immunomodulatory agents or anti-tumor agents, the method utilizing the following steps:
[0027] a) combining the substance to be tested with one of the four mammalian proteins (125 kDa, 148 kDa, 208 kDa or 210 kDa) of this invention, with the protein being bound to a solid support:
[0028] b) maintaining the substance to be tested and the protein bound to the solid support of step (a) under conditions appropriate for binding of the substance to be tested with the protein, and
[0029] c) determining whether binding of the substance to be tested occurred in step (b).
[0030] This invention also includes a method for identifying substances which may be useful as immunomodulatory or antitumor agents which involves the following steps:
[0031] a) combining a substance to be tested with one of the mammalian proteins of this invention, the protein being bound to a solid support:
[0032] b) maintaining the substance to be tested and the protein bound to the solid support of step (a) under conditions appropriate for binding of the substance to be tested with the protein, and
[0033] c) determining whether the presence of the substance to be tested modulated the activity of the mammalian protein.
[0034] This invention further includes a method for detecting, in a biological sample, rapamycin, rapamycin analogs or rapamycin metabolites which, when complexed with a FKBP, bind to one of the four listed proteins of this invention, the method comprising the steps of:
[0035] a) combining the biological sample with a FKBP to form a first mixture containing, if rapamycin, rapamycin analogs or rapamycin metabolites are present in the biological sample, a rapamycin:FKBP complexes, rapamycin analog:FKBP complexes, or rapamycin metabolite:FKBP complexes;
[0036] b) creating a second mixture by adding the first mixture to one of the proteins of this invention, the protein bound to a solid support;
[0037] c) maintaining the second mixture of step (b) under conditions appropriate for binding the rapamycin:FKBP complexes, rapamycin analog:FKBP complexes, or rapamycin metabolite:FKBP complexes, if present, to the protein of this invention; and
[0038] d) determining whether binding of the rapamycin:FKBP complexes, rapamycin analog:FKBP complexes, or rapamycin metabolite:FKBP complexes and the protein occurred in step (c).
[0039] Also included in this invention is the use of the cDNA clones to generate anti-sense therapeutics. This can be accomplished by using state of the art techniques, such as those described in Milliean et al, J. Med. Chem. 36:14:1924-1936. For the purposes of this disclosure and the claims that follow, antisense RNA and DNA are understood to include those RNA and DNA strands derived from a cDNA clone which encodes for one of the four proteins (125 kDa, 148 kDa, 208 kDa or 210 kDa) of the present invention which have a native backbone or those which utilize a modified backbone. Such modifications of the RNA and DNA backbones are described in Milligan et al, J. Med. Chem. 36:14:1924-1936. The antisense compounds created by the state of the art techniques recently described (Milligan et al, J. Med. Chem. 36:14:1924-1936) can be useful in modulating the immune response and thus useful in the treatment or inhibition of transplantation rejection such as kidney, heart, liver, lung, bone marrow, pancreas (islet cells), cornea, small bowel, and skin allografts, and heart valve xenografts; in the treatment or inhibition of autoimmune diseases such as lupus, rheumatoid arthritis, diabetes mellitus, myasthenia gravis, and multiple sclerosis; and diseases of inflammation such as psoriasis, dermatitis, eczema, seborrhea, inflammatory bowel disease, and eye uveitis. The antisense molecules of this invention can have antitumor, antifungal activities, and antiproliferative activities. The compounds of this invention therefore can be also useful in treating solid tumors, adult T-cell leukemia/lymphoma, fungal infections, and hyperproliferative vascular diseases such as restenosis and atherosclerosis. Thus, the present invention also comprises methods for treating the abovementioned maladies and conditions in mammals, preferably in humans. The method comprises administering to a mammal in need thereof an effective amount of the relevant antisense therapeutic agent of this invention.
[0040] When administered for the treatment or inhibition of the above disease states, the antisense molecules of this invention can be administered to a mammal orally, parenterally, intranasally, intrabronchially, transdermally, topically, intravaginally, or rectally.
[0041] It is contemplated that when the antisense molecules of this invention are used as an immunosuppressive or antiinflammatory agent, they can be administered in conjunction with one or more other immunoregulatory agents. Such other immunoregulatory agents include, but are not limited to azathioprine, corticosteroids, such as prednisone and methylprednisolone, cyclophosphamide, rapamycin, cyclosporin A, FK-506, OKT-3, and ATG. By combining the complexes of this invention with such other drugs or agents for inducing immunosuppression or treating inflammatory conditions, the lesser amounts of each of the agents are required to achieve the desired effect. The basis for Such combination therapy was established by Stepkowski whose results showed that the use of a combination of rapamycin and cyclosporin A at subtherapeutic doses significantly prolonged heart allograft survival time. [Transplantation Proc. 23: 507 (1991)].
[0042] Treatment with these antisense compounds will generally be initiated with small dosages less than the optimum dose of the compound. Thereafter the dosage is increased until the optimum effect under the circumstances is reached. Precise dosages will be determined by the administering physician based on experience with the individual subject treated. In general, the antisense compounds of this invention are most desirably administered at a concentration that will afford effective results without causing any harmful or deleterious side effects.
[0043] In light of the therapeutic value of the abovementioned antisense compounds, this invention also includes pharmaceutical compositions containing the antisense RNA and antisense DNA compounds derived from cDNA clones which encode for the 125 kDa, 148 kDa, 208 kDa and 210 kDa proteins of this invention.
[0044] This invention also comprises the following process for isolating the proteins of this invention, as well as the proteins isolated therefrom:
[0045] A process for isolating proteins from mammalian cells, the process comprising the steps of:
[0046] 1. The mammalian cells of interest are grown and harvested. As mentioned previously, the cells may be of T cell origin (e.g. T cell lymphomas, leukemias, normal human T cells), B cell origin (e.g. EBV transformed B cells, normal human B cells), mast cells, or other cell sources sensitive to rapamycin. The cells may be processed shortly after harvesting or may be stored frozen, such as in pellets, prior to processing. The cells which are kept frozen may be stored in a dry ice and ethanol bath, stored frozen at −70-80° C. until use. This step of growing and harvesting the cells of interest may be seen as the first step of this process or as merely preparatory for the present process.
[0047] 2. Cells are lysed in a buffer containing a buffering agent (e.g. HEPES, Tris, pH 7.5), low salt (e.g. 10-50 mM NaCl or KCl), chelating agent (e.g. 1-2 mM EDTA), protease inhibitors (e.g. 0.4 mM PMSF) and a reducing agent (e.g. 2 mM 2-ME or 1-20 &mgr;M Dithiothreitol) at a temperature which minimizes protein degradation (e.g. 4° C.). It should be understood that the mammalian cells may be treated in any manner capable of producing cell lysis, including sonic lysis and douncing.
[0048] 3. Unbroken cells and cell nuclei are precleared from lysates by centrifugation at a temperature which minimizes protein degradation (e.g. 4° C.). Centrifugation at, for example, 1600 g for 10 minutes has been found sufficient to preclear the unbroken cells and cell nuclei from the lysates. This step, while not mandatory, provides a clearer preparation for the steps that follow.
[0049] 4. The membrane fraction in the precleared lysate is then concentrated, such as by ultracentrifugation. An example of this concentration would be ultracentrifugation at 100,000 g for 1-1.5 hours.
[0050] 5. The membrane proteins (e.g. transmembrane, integral and membrane associated proteins) are then solubilized. This may be accomplished by incubating the pellet of Step 4 in a buffer containing a detergent which solubilizes the proteins without detrimentally denaturing them, a buffering agent (e.g. 20-50 mM Tris or HEPES, pH 7.2), salt (e.g. 100-200 mM NaCl+20 mM KCl), reducing agent (e.g. 1-2 mM 2-ME or 1-20 mM dithiothreitol), protease inhibitors (e.g. 0.2 mM PMSF, 5 &mgr;g/ml aprotinin, leupeptin, pepstatin A and antipain), divalent cations (e.g. 0-5 mM CaCl2, 0-5 mM MgCl2) at a temperature which minimizes protein degradation (e.g. 4° C.). Examples of detergents useful in this step are CHAPSO (3-[(3-cholamidopropyl)dimethylammonio]-1-propane sulfonate) or Triton X100 (polyethylene glycol 4-isooctylphenyl ether). After this step, the mixture contains solubilized membrane proteins and non-solubilized cellular debris.
[0051] 6. The solubilized membrane proteins are separated from the non-solubilized cellular debris, such as by ultracentrifugation (eg 100,000 g for 1-1.5 hours) at a temperature which minimizes protein degradation (e.g. 4° C.).
[0052] 7. The supernatant containing solubilized membrane proteins is incubated with an affinity resin in a buffer containing a buffering agent (e.g. 20-50 nM Tris or HEPES, pH 7.2), salt (e.g. 100-200 mM NaCl+20 mM KCl), reducing agent (e.g. 1-2 mM 2-ME or 10-20 mM dithiothreitol), protease inhibitors (e.g. 0.2 mM PMSF, 5 &mgr;g/ml aprotinin, leupeptin, pepstatin A and antipain), divalent cations (e.g. 0-5 mM CaCl2, 0-5 mM MgCl2) at a temperature and time which allows the absorption of the proteins which bind to affinity resin directly, and minimizes protein degradation (e.g. 4° C.).
[0053] 8. The resin is then removed from the supernatant by centrifugation at a temperature which minimizes protein degradation (e.g. 4° C.).
[0054] 9. The supernatant is then incubated with Rapamycin or Rapamycin analog (IC50 in LAF<500 nM) complexed to fusion protein of FKBP12+protein which enhances the isolation of the desired effector protein and through which the fusion protein binds to an affinity resin or affinity column, such as GST-FKBP12, Histidine oligomer-FKBP12, biotin-FKBP12, etc., in a buffer containing a buffering agent (e.g. 20-50 mM Tris or HEPES, pH 7.2), salt (e.g. 100-200 mM NaCl+20 mM KCl), reducing agent (e.g. 1-2 mM 2-ME or 1-20 mM dithiothreitol), protease inhibitors (e.g. 0.2 mM PMSF, 5 &mgr;g/ml aprotinin, leupeptin, pepstatin A and antipain), divalent cations (e.g. 0-5 mM CaCl2, 0-5 mM MgCl2) at a temperature and for a time which allows binding of the effector proteins to the fusion FKBP protein:Rapamycin or analog complexes and minimizes protein degradation (e.g. 4° C. and 1-2 hours).
[0055] 10. The mixture of Step 9 containing the effector proteins and fusion FKBP protein:Rapamycin complexes is incubated with an affinity resin at a temperature and for a time which allows binding of the complexes of the effector proteins and fusion FKBP protein:Rapamycin or analog to the affinity resin and minimizes protein degradation (e.g. 4° C. and 0.5-2 hours).
[0056] 11. Most non-specific proteins are rinsed away from the resin using a buffer which dissociates binding of non-specific proteins but not the complex between the desired proteins and RAPA-FKBP, such as a buffer containing a buffering agent (e.g. 20-50 mM Tris or HEPES, pH 7.2), silts (e.g. 100-1000 mM NaCl, KCl), reducing agent (e.g. 1-2 mM 2-ME or 10-20 mM dithiothreitol), protease inhibitors (e.g. 0.2 mM PMSF, 5 &mgr;g/ml aprotinin, leupeptin, pepstatin A and antipain), divalent cations (e.g. 0-5 mM CaCl2, 0-5 mM MgCl2) and detergent which dissociates binding of non-specific proteins but not the complex between the four proteins and RAPA-fusion FKBP protein such as Triton X100 (Polyethylene glycol 4-isooctyl phenyl ether).
[0057] 12. The effector proteins and the fusion FKBP protein:Rapamycin complexes are eluted from the resin using an appropriate buffer, such as a buffer containing sufficient detergent to dissociate it from resin (e.g. Laemli buffer with or without glycerol or dye, Laemli, Nature 227:680, 1970), or an appropriate eluting compound for the affinity column, such as glutathione, histidine.
[0058] 13. The effector proteins can then be separated by size. This may be accomplished in any manner which separates the proteins by size, including, but not limited to, polyacrylamide gel electrophoresis and size exclusion column chromatography.
[0059] It might also be useful to compare the proteins isolated by a control procedure, that is a procedure which substitutes buffer for the rapamycin or rapamycin analog with an IC50 in LAF<500 nM in step 8, can be used to more easily distinguish proteins which bind to the rapamycin:FKBP complex.
[0060] The proteins of this invention can also be made by recombinant DNA techniques familiar to those skilled in the art. That is, the gene of the protein in question can be cloned by obtaining a partial amino acid sequence by digestion of the protein with an appropriate endopeptidase, such as Lysine C, and isolating the resulting protein fragments by microbore HPLC, followed by fragment sequencing (Matsudaira in A Practical Guide to Protein and Peptide Purification for Microsequencing, Academic Press, San Diego, Calif. 1989). The determined sequence can then be used to make oligonucleotide probes which can be used to screen a human cDNA library, such as those for human T cells, Molt 4, Jurkat, etc, to obtain clones. (Sambrook, Fritsch, and Maniatas, Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Press, 1989) These clones can be used to identify additional clones containing additional sequences until the protein's full gene is cloned (Sambrook, Fritsch, and Maniatas, Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Press, 1989). In a complementary strategy, the gene(s) may be identified by interactive yeast cloning techniques using FKBP12:RAPA as a trap for cloning (Chien et al., Proc. Natl. Acad. Sci. 88: 9578-9582, 1991). These strategies can also be combined to quicken the identification of the clones.
[0061] The relevant cDNA clone can also be expressed in E. coli, yeast, or baculovirus infected cells or mammalian cells using state of the art expression vectors. Isolation can be performed as above or the cDNA can be made as a fusion protein with the fusion partner giving an advantage in isolation (e.g. HIS oligomer, immunoglobulin Fc, glutathione S-transferase, etc). Mutations which result in a soluble form can also be generated by site directed mutagenesis and would give advantages in isolation.
[0062] Homologs in the mouse, rat, monkey, dog and other mammalian species can be obtained using similar procedures. In addition, upon isolation of the human clone of the proteins, the clone can be used to screen for homologs in other mammalian species. These homologs can also be used to develop binding assays and to set up high through put screening assays for compounds, endogenous ligands, exogenous ligands with immunomodulatory activity.
[0063] Compounds, endogenous ligands and exogenous ligands having such immunomodulatory activity would can be useful in modulating the immune response and thus useful in the treatment or inhibition of transplantation rejection such as kidney, heart, liver, lung, bone marrow, pancreas (islet cells), cornea, small bowel, and skin allografts, and heart valve xenografts; in the treatment or inhibition of autoimmune diseases such as lupus, rheumatoid arthritis, diabetes mellitus, myasthenia gravis, and multiple sclerosis; and diseases of inflammation such as psoriasis, dermatitis, eczema, seborrhea, inflammatory bowel disease, and eye uveitis.
[0064] The compounds, endogenous 112 ands and exogenous ligands mentioned above can also have antitumor, antifungal activities, and antiproliferative activities. The compounds of this invention therefore can be also useful in treating solid tumors, adult T-cell leukemia/lymphoma, fungal infections, and hyperproliferative vascular diseases such as restenosis and atherosclerosis.
EXAMPLE 1[0065] The proteins of the present invention were isolated utilizing a fusion protein of glutathione S-transferase—FK506 binding protein 12 (GST-FKBP). GST-FKBP is produced by a recombinant E. coli containing the plasmid, pGEX-FKBP. The cells were grown, induced with IPTG and the fusion protein was isolated using standard technology described in D. B. Smith and K. S. Johnson, Gene 67, 31, 1988 and K. L. Guan and J. E. Dixon, Anal. Biochem. 192, 262, 1991. The solution containing glutathione and GST-FKBP12 was exchanged 5× using a Centricon 10 filtration unit (Amicon) to remove the glutathione and exchange the buffer.
[0066] Molt 4 cells (1×109) were grown in standard media (RPMI 1640 containing 100 U/ml pennicillin, 100 ug/ml L-glutamine, 10% FCS). The cells were harvested and rinsed 3× with PBS (50 mM phosphate buffer, pH 7.0, 150 mM NaCl), flash frozen in dry-ice ethanol bath and stored at −80° C. On ice, the cells were thawed and lysed using a dounce homogenizer with B pestle in 5 ml of buffer A (10 mM Hepes, pH 7.5, 20 mM KCl, 1 mM EDTA, 0.4 mM PMSF and 2 mM 2-ME). After the debris was cleared by centrifugation at 1600 g for 10 min. and the membrane fraction was concentrated by 100,000 g centrifugation (1 hour), the 100,000 g pellet was incubated in 3 ml buffer B (50 mM Tris, pH 7.2, 100 mM NaCl, 20 mM KCl, 0.2 mM PMSF, 1 mM 2-ME, 2 mM CaCl2, 2 mM MgCl2, 5 &mgr;g/ml aprotinin, leupeptin, pepstatin A and antipain), containing 12 mM CHAPSO for two hours at 4° C. The solubilized membrane proteins were separated from the debris by a 100,000 g centrifugation. After preabsorption of the supernatant for 3-18 hours with 0.4 ml glutathione sepharose resin swollen in buffer B, the supernatant was incubated with complexed Rapamycin-GST-FKBP12 (preformed by incubation of 660 ug GST-FKBP+60 ug RAPA in buffer B for 1-2 hours, 4° C.) for two hours at 4° C. The supernatant was then incubated for 2 hours at 4° C. with 100 ul glutathione resin (1:1 Buffer B). Nonspecific proteins were rinsed 5× with buffer C (buffer B+0.1% Triton x100) and the proteins eluted from the resin in Laemli buffer by incubation at 95° C. for 3 minutes and microcentrifugation. The proteins were separated by size using a 7% SDS-PAGE followed by silver stain. Four bands corresponding to proteins of molecular weights of 210 kDa, 208 kDa, 148 kDa, and 125 kDa were present in higher concentrations in the sample containing RAPA+GST-FKBP12 vs GST-FKBP alone.
[0067] The mito-en-stimulated thymocyte proliferation assay called the LAP, can be inhibited by rapamycin or analogs such as demethoxyrapamycin and indicates relative activity of rapamycin analogs in immunosuppression. The same proteins were isolated using GST-FKBP complexed with the immunosuppressive analog, demethoxyrapamycin (Table 1). The Diels Alder adducts bound to FKBP12 and inhibited PPlase activity of FKBP12 but did not exhibit detectable immunosuppressive activity and thus do not bind to the target of rapamycin. The use of these two compounds complexed with GST-FKBP12 in the analogous isolation procedure (ie. replacing rapamycin:GST-FKBP12) yielded background levels of the 210 kDa proteins (no rapamycin)(Table 1). FK506, is an immunosuppressive compound which binds to FKBP and and mediates at least some of its effects through the binding of the FK506-FKBP complex with calcineurin. FK506 when complexed with GST-FKBP in an analogous procedure yielded only background levels of the 210 kDa protein (Table 1). 1 TABLE 1 Comparison of Binding of Rapamycin Analog - FKBP12 complexes to 210 kDa Protein Compound 210 kDa LAF PPlase(Ki) RAPA +++ 6 nM 0.12 nM demethoxyrapamycin +++ 58 nM 4.4 nM Diels Alder adduct (phenyl) ± >1000 nM 12 nM Diels Alder adduct (methyl) ± >1000 nM 12 nM FK506 ± 3 nM* 0.4 nM none (FKBP) ± (* mechanism of action is different)
[0068] It is known that rapamycin must bind to a member of the FKBP family in order to mediate its effects. To verify that the proteins of this invention bind to the complex RAPA-GST-FKBP and not individually to rapamycin or FKBP12, a modified isolation procedure was employed. The modification consists of using (1) a rapamycin-42-biotin glycinate ester in place of rapamycin (both exhibit equivalent immunosuppressive activity in the LAF assay), (2) no exogenous FKBP and (3) a strepatavidin-conjugated resin in place of glutathione-resin. Only background levels of the 210 kDa protein was isolated using this modified isolation procedure.
[0069] The 210 kDa protein was isolated using the GST-FKBP12-rapamycin complex from BJAB cells (B cell lymphoma) and normal human T lymphocytes purified by Ficoll-Hypaque and T cell columns.
[0070] The results of the partial amino acid composition analysis are set forth in Table 2, below. It should be noted that the percentage of the basic amino acids was not determined. 2 TABLE 2 Com- Re- Re- Concen- Peak ponent tention Peak sponse Peak tration Number Name Time Area Factor Height No./50 &mgr;l 9.38 11.09 1 Asp/Asn 12.06 12.47076 0.02344 0.05142 0.30 2 Thr 13.05 2.92898 0.00000 0.00985 0.068 3 Ser 13.78 6.43968 0.00000 0.01995 0.15 15.68 4 Glu/Gln 16.87 25.47273 0.00000 0.05285 0.59 Prp 18.24 0.14 5 Gly 22.35 21.50384 0.00000 0.04645 0.44 22.90 6 Ala 23.73 16.69160 0.00000 0.03113 0.36 26.06 28.81 7 Val 29.39 4.83196 0.00000 0.00605 0.11 Met 32.28 8 Ile 34.10 3.00560 0.2326 0.00782 0.0699 9 Leu 35.09 5.73202 0.02331 0.01372 0.1383 10 nLeu 36.27 20.48232 0.02174 0.04286 0.4453 11 Tyr 38.33 1.44792 0.02618 0.00226 0.0379 12 Phe 40.05 1.25017 0.02703 0.00187 0.0338 13 His 47.79 1.50905 0.02553 0.00580 0.0385 14 51.80 12.66136 0.00000 0.01960 0.0000 15 Lys 53.34 9.90767 0.02283 0.02274 0.2262 Totals 146.53645 0.33436 Not Determined 144.29
EXAMPLE 2[0071] The 210 kDa (210±20 kDa) protein of this invention was isolated from 4×1011 Molt 4 cells using the affinity matrix protocol as described previously. Bound proteins were eluted from the affinity matrix with 1× Laemli buffer without glycerol and dye (0.0625 M Tris-HCl, ph 6.8, 2% SDS, 0.37M b-mercaptoethanol) and were concentrated 3 consecutive times by centrifugation using centricon 100 (Amicon, Beverly, Mass.) at 4° C. the first two times and at 18° C. the third time. The concentrated sample was eluted from the centricon 100 filter by incubating 2 hours at room temperature with an equal volume of 2× laemli buffer without glycerol and dye the first 2× and 2× laemli buffer the third time. The proteins in the sample were separated by PAGE on a 1.5 mm thick 7% polyacrylamide gel (38:1). The proteins were transferred to polyvinylidine difluoride, PVDF, (Biorad, Hercules, Calif.) in 10× Tris/glycine buffer (Biorad) containing 0.037% SDS at 50 mamps at 4° C. overnight. The proteins on the PVDF were stained with amido black (Biorad) in 10% ethanol, 2% acetic acid and the appropriate band was excised, rinsed with PBS and water and stored frozen.
Sequencing[0072] The protein (approx. 3 ug) on the PVDF membrane was digested in situ with trypsin using a modification described by J. Fernandez et al, (Anal.Biochem. 201: 255-64, 1992). Briefly, the PVDF was cut into 1 mm2 pieces, prewet, and the protein digested in a 100 mM Tris-HCl, pH buffer containing 10% acetonitrile, and 1% reduced triton (CalBiochem) with 0.2 &mgr;g trypsin at 37° C. for 6 hours followed by addition of 0.2 ug trypsin and incubation overnight. The fragments were eluted from the membrane by sonication and the buffer containing the fragments were separated by microfuge centifugation. The membranes were backextracted 2× (i.e., 50 ul buffer was added to membranes, sonicated, and centrifuged in a microfuge and solution pooled with the original buffer containing the eluted fragments.) The sample (140-145 ul) was separated by narrow bore high performance liquid chromatography using a Vydac C18 2.1 mm×150 mm reverse phase column on a Hewlett Packard HPLC 1090 with a 40 diode array detector as described previously by W. Lane et al, (J.Protein Chem., 10(2): 151-60, 1991). Multiple fractions were collected and measured for absorption at multiple wavelengths (210, 277 and 292 nm). Optimal fractions were chosen for sequencing based on resolution, symmetry, and ultraviolet absorption and spectra (2210 nm, 277 nm and 292 nm). An aliquot (5%) of the optimal fractions was analyzed for homogeneity and length of fragment by matrix assisted laser desorption time of flight mass spectrometry, MALDE-TOF-MS, on a Finnigan lasermat. Selected optimal fractions were sequenced by automated Edman degradation on an Applied Biosystems 477A protein sequencer using microcartridge and manufacturer's recommended chemistry cycle.
Sequence Comparison[0073] Comparison was performed using the Intelligenetics suite (Intelligenetics, CA)
Sequences[0074] Utilizing the methods mentioned above, it was determined that the 210 kDa (210+20 kDa) protein of this invention contains peptide fragments, four of which have amino acid sequences as shown below:
[0075] a) ILLNIEHR;
[0076] B) LIRPYMEPILK;
[0077] c) DXMEAQE; and
[0078] d) QLDHPLPTVHPQVTYAYM(K)
[0079] Those skilled in the art will recognize the one-letter symbols for the amino acids in question (the definitions for which can also be seen at page 21 of the text Biochemistry, Third Edition, W. H. Freeman and Company, ©1988 by Luberi Stryer). Those so skilled will also understand that the X in sequence c) indicates an as yet unidentified amino acid and the parentheses in sequence d) indicates that the amino acid in the position in question is possibly lysine.
[0080] As mentioned previously, the present invention includes fragmented or truncated forms of the proteins mentioned herein. This includes proteins which have as part or all of their amino acid sequence one or more of the four sequences listed as a)-d), above. For the purposes of the claims, below, the proteins referred to as including one or more of the “internal amino acid sequences” are understood to be any protein which contains one of the sequences listed above, whether the protein is comprised wholly of one or more of the sequences a)-d) or whether one or more of the sequences mentioned above form any portion of the protein. This is understood to include all locations on the protein's amino acid sequence including, but not limited to, those sections of the protein which initiate and terminate the protein's amino acid chain.
[0081] These partial amino acid sequences were compared with sequences in the Genbank database. There was identity with the sequence, accession number L34075 (Brown et al., Nature 369, 756-758 (1994)). The cDNA of the SEP gene was cloned as follows: Two micrograms of Molt 4 cDNA (Clontech, Palo Alto, Calif.) in 1×PCR buffer (10 mM Tris-HCl, pH 8.3, 50 mM KCl, 1 mM MgCl, 200 &mgr;M DATP, 200 &mgr;M dTTP, 200 &mgr;M dCTP, 200 &mgr;M dGTP; Perkin Elmer,) with 1 unit Taq polymerase (Perkin Elmer), was amplified by Polymerase chain reaction (PCR) at 94 C for 30 sec., 66 C for 4 min for 30 cycles, 72 C for 10 min by three separate reactions containing one of the following pairs of oligomers: 3 CGATCGGTCGACTGCAGCACTTTGGGGATTGTGCTCTC and GCGGCCGCAGCTTTCTTCATGCATGACAACAGCCCAGGC; or GCGGCCGCAAGCTTCAAGTATGCAAGCCTGTGCGGCAAGA and CGATCGGTCGACACCTTCTGCATCAGAGTCAAGTGGTCA; or GCGGCCGCAAGCTTCCTCAGCTCACATCCTTAGAGCTGCA and CGATCGGTCGACTTATTACCAGAAAGGGCACCAGCCAATATA.
[0082] The oligonucleotides were synthesized and isolated by methods previously described and known in the art (Chemical and Enzymatic Synthesis of Gene Fragments, ed. by H. G. Gassin and Anne Lang, Verlag Chemie, FLA, 1982). The resulting PCR products named SEP3, SEP4, and SEP5, respectively, were incubated at 15 C overnight in buffer containing T4 DNA ligase (I unit) and 50 ng pcII which was modified to efficiently ligate PCR products (TA cloning kit, Invitrogen, San Diego, Calif.) to yield PCR-pcII ligated products. The PCR-pcII products were transformed into competent E. coli INValphaF cells obtained commercially from Invitrogen. Miniprep DNA was prepared using the Quiagen miniprep kits (Quiagen, Chatsworth, Calif.) and the clones containing the appropriate sized PCR product were identified by restriction enzyme diaestion with commercially available HindIII or SalI electrophoresis, and comparison to standards. Sep2 and Sep1 cDNA was made using the TimeSaver cDNA synthesis Kit (Pharmacia, Piscataway, N.J.) with the first strand synthesis reaction containing oligodT (0.13 &mgr;g) and 250 pmoles of 4 CGATCGGTCGACCAGATGAGCACATCATAGCGCTGATGA or CGATCGGTCGACAAATTCAAAGCTGCCAAGCGTTCGGAG,
[0083] respectively. Sep2 and Sep1 second strand synthesis was performed using the TimeSaver cDNA synthesis kit with the addition of 250 pmoles of 5 GCGGCCGCAAGCTTTGGCTCGAGCAATGGGGCCAGGCA or GCGGCCGCAAGCTTAAGATGCTTGGAACCGCACCTGCCG, CGATCGGTCGACCAGATGAGCACATCATAGCGCTGATGA and GCGGCCGCAAGCTTTGGCTCGAGCAATGGGGCCAGGCA or GCGGCCGCAAGCTTAAGATGCTTGGAACCGCACCTGCCG and CGATCGGTCGACAAATTCAAAGCTGCCAAGCGTTCGGAG,
[0084] respectively. The Sep2 and Sep1 cDNA was then amplified by PCR using 6 CGATCGGTCGACCAGATGAGCACATCATAGCGCTGATGA and GCGGCCGCAAGCTTTGGCTCGAGCAATGGGGCCAGGCA or GCGGCCGCAAGCTTAAGATGCTTGGAACCGCACCTGCCG and CGATCGGTCGACAAATTCAAAGCTGCCAAGCGTTCGGAG,
[0085] respectively as described above. The Sep2 PCR products were cloned int the TA cloning kit (Invitrogen). The Sep 1 PCR products were digested with Hind III and SalI, separated from the pcII vector by agarose electrophoresis. The Sep1 (HindIII-SalI) fragment was isolated using the Sephaglas bandprep kit from Pharmacia and cloned into the HindIII and SalI sites of pUC19 as described (Sambrook et al., Molecular Cloning Cold Spring Harbor, 1989). Ligation of the isolated Sep2(HindIII, AspI) and Sep3(AspI, SalI) fragments or Sep4(HindIII, AccIII/MroI) and Sep5(AccIII/MroI, Sal I) fragments into pUC18(HindIII, SalI) vector and transformation of competent E. coli INValphaF cells (Invitrogen) was performed by techniques known to those skilled in the art (Sambrook et al., Molecular Cloning Cold Spring Harbor, 1989) to obtain pUC18-Sep 23 and pUC18-Sep45 which contain nucleotides 1468-5326 and 4964-7653, respectively, of the full length clone shown in the attached Sequence No. 1. Ligation of the pUC19-Sep1 (EcoRV, SalI), Sep2345 (EcoRV, SalI) fragments and transformation of competent E. coli INValphaF cells (Invitrogen) were performed by techniques known to those skilled in the art (as described by Sambrook et al., Molecular Cloning Cold Spring Harbor, 1989) to obtain the full length clone. The nucleic acid sequence coding for this protein and its amino acid sequence are shown in Sequence No. 1.
[0086] A fusion protein, called glutathione S transferase-sirolimus effector protein, GST-SEP, was engineered by subcloning the Sep4 and Sep5 fragments into the plasmid, pGEX-KG (Guan, K. and Dixon, JE. (1991) Anal. Biochem. 192, 262-267) as follows. Briefly, Sep4 was digested with commercially available HindIII restriction enzyme, the restriction site was filled in with the Klenow fragment of DNA polymerase (Gibco), and the DNA was extracted with phenol-chloroform and ethanol precipitated using techniques known by those skilled in the art (Sambrook et al., Molecular Cloning Cold Spring Harbor, 1989). The SEP4 (HindIII-Klenow) was further digested with MroI restriction enzyme, separated from the pcII vector by agarose electrophoresis and isolated as the fragment SEP4-HindIII-Klenow-MroI. Sep5 fragment was prepared by digestion with SalI and MroI, separated from die pcII vector by agarose electrophoresis and isolated as the fragment SEP5-SalI-MroI. pGEX-KG (Guan, K. and Dixon, J. E. (1991) Anal. Biochem. 192, 262-267) was digested with Nco 1, filled in with the Klenow fragment of DNA polymerase and the DNA was extracted with phenol-chloroform and ethanol precipitated, using techniques of those skilled in the art (Sambrook et al., Molecular Cloning Cold Spring Harbor, 1989). pGEX-KG (NcoI, Klenow) was further digested with Sal 1, separated from the undigested vector by agarose electrophoresis and isolated as the vector PGEX-KG-NcoI-Klenow-SalI, using techniques of those skilled in the art. Ligation of the vector, pGEX-KG-NcoI-Klenow-SalI and Sep 4 (HindIII, MroI) and Sep5 (MroI, SalI) fragments and transformation into E. coli strain INValphaF cells (Invitrogen) using techniques of those skilled in the art yielded the plasmid, pGEX-Sep45. Other E. coli hosts such as BL21 can also be used The DNA and protein sequence of this fusion protein is shown in Sequence No. 2.
[0087] Flag sequences and kinase recoginition domain of heart muscle kinase can be added at the amino terminal end, by methods known in the art (see Chen et al., Gene 1994 Feb. 11; 139 (1): 73-75) within SEP or at the carboxy terminus of SEP, SEP4,5 or other fragments using an oligonucleotide which includes the coding sequence for Asp Tyr Lys Asp Asp Asp Asp Lys. The fusion protein can be isolated by affinity chromatography with anti-flag specific antibodies using the commercially available kits from IBI, New Haven, Conn.
[0088] Transformed host cells containing sequences of this invention have been deposited with the American Type Culture Collection (ATCC), 12301 Parklawn Drive, Rockville, Md. 20852, USA, and have been given the ATCC designations listed below: 7 Sequence ATCC Designation a) pUC19-Sep1(nucleotides 1-1785 of ATCC 69756 Sequence No. 1) b) pUC18-Sep23 (nucleotides 1468-5326 of ATCC 69753 Sequence No. 1) c) pUC18-Sep45 (nucleotides 4964-7653 of ATCC 69754 Sequence No. 1) d) pUC19-Sep1-5 (ATCC 69756 1-7653 ATCC 69829 of sequence 1) e) pGEX-Sep45 plasmids (Sequence 2) ATCC 69755
EXAMPLE 3[0089] The 210 kDa protein of this invention was also isolated by the techniques described in Example 1 utilizing the following rapamycin analogs:
[0090] a) 42-Deoxy-42-[-(1,1-dimethyletlioxy)-2-oxoethoxy] rapamycin (which is described in U.S. Pat. No. 5,233,036);
[0091] b) 42-[O-[(1,1-Dimethylethyl)dimethylsilyl]] rapamycin (described in U.S. Pat. No. 5,120,842);
[0092] c) Rapamycin 42-ester with N-[1,1-dimethylethoxy)carbonyl]-N-methylglycine (described in U.S. Pat. No. 5,130,307);
[0093] d) Rapamycin 42-ester with 5-(1,1-dimethylethoxy)-2-[[(1,1-dimethylethoxy)carbonyl]amino]-5-oxopentanoic acid ethyl acetate solvate three quarter hydrate (see U.S. Pat. No. 5,130,307);
[0094] e) Rapamycin 42-ester with N-[(1,1-dimethylethoxy)carbonyl]glycylglycine hydrate (see U.S. Pat. No. 5,130,307); and
[0095] f) Rapamycin 42-ester with N2, N6-bis[(1,1-dimethylethoxy)carbonyl]-L-lysine (see U.S. Pat. No. 5,130,307).
Claims
1. A protein of mammalian origin having a molecular weight of about 125 kDa which binds to a GST-FKBP-Rapamycin complex.
2. A protein of claim 1 which is of human origin.
3. A recombinantly produced protein of mammalian origin having a molecular weight of about 125 kDa which binds to a GST-FKBP-Rapamycin complex.
4. A recombinantly produced protein comprising a partial amino acid sequence of the protein of claim 3.
5. cDNA of mammalian origin which encodes a 125 kDa protein which binds to a GST-FKBP-Rapamycin.
6. DNA encoding for a protein of mammalian origin having a molecular weight of about 125 kDa which binds to a GST-FKBP-Rapamycin complex.
7. Antisense RNA derived from a cDNA clone, the cDNA clone encoding for a protein of mammalian origin having a molecular weight of about 125 kDa which binds to a GST-FKBP-Rapamycin complex.
8. Antisense DNA derived from a cDNA clone, the cDNA clone encoding for a protein of mammalian origin having a molecular weight of about 125 kDa which binds to a GST-FKBP-Rapamycin complex.
9. A protein of mammalian origin having a molecular weight of about 148 kDa which binds to a GST-FKBP-Rapamycin complex.
10. A protein of claim 9 which is of human origin.
11. A recombinantly produced protein of mammalian origin having a molecular weight of about 148 kDa which binds to a GST-FKBP-Rapamycin complex.
12. A recombinantly produced protein comprising a partial amino acid sequence of the protein of claim 11.
13. cDNA of mammalian origin which encodes a 148 kDa protein which binds to a GST-FKBP-Rapamycin.
14. DNA encoding for a protein of mammalian origin having a molecular weight of about 148 kDa which binds to a GST-FKBP-Rapamycin complex.
15. Antisense RNA derived from a cDNA clone, the cDNA clone encoding for a protein of mammalian origin having a molecular weight of about 148 kDa which binds to a GST-FKBP-Rapamycin complex.
16. Antisense DNA derived from a cDNA clone, the cDNA clone encoding for a protein of mammalian origin having a molecular weight of about 148 kDa which binds to a GST-FKBP-Rapamycin complex.
17. A protein of mammalian origin having a molecular weight of about 208 kDa which binds to a GST-FKBP-Rapamycin complex.
18. A protein of claim 17 which is of human origin.
19. A recombinantly produced protein of mammalian origin having a molecular weight of about 208 kDa which binds to a GST-FKBP-Rapamycin complex.
20. A recombinantly produced protein comprising a partial amino acid sequence of the protein of claim 19.
21. cDNA of mammalian origin which encodes a 208 kDa protein which binds to a GST-FKBP-Rapamycin.
22. DNA encoding for a protein of mammalian origin having a molecular weight of about 208 kDa which binds to a GST-FKBP-Rapamycin complex.
23. Antisense RNA derived from a cDNA clone, the cDNA clone encoding for a protein of mammalian origin having a molecular weight of about 208 kDa which binds to a GST-FKBP-Rapamycin complex.
24. Antisense DNA derived from a cDNA clone, the cDNA clone encoding for a protein of mammalian origin having a molecular weight of about 208 kDa which binds to a GST-FKBP-Rapamycin complex.
25. A protein of mammalian origin having a molecular weight of about 210 kDa which binds to a GST-FKBP-Rapamycin complex.
26. A protein of claim 25 which is of human origin.
27. A protein of claim 25 which includes one or more of the following internal amino acid sequences:
- a) ILLNIEHR;
- B) LIRPYMEPILK;
- c) DXMEAQE; and
- d) QLDHPLPTVHPQVTYAYM(K)
28. A recombinantly produced protein of mammalian origin having a molecular weight of about 210 kDa which binds to a GST-FKBP-Rapamycin complex.
29. A recombinantly produced protein comprising a partial amino acid sequence of the protein of claim 28.
30. A recombinantly produced protein of claim 25 which includes one or more of the following internal amino acid sequences:
- a) ILLNIEHR;
- B) LIRPYMEPILK;
- c) DXMEAQE; and
- d) QLDHPLPTVHPQVTYAYM(K)
31. A cDNA of mammalian origin which encodes a 210 kDa protein which binds to a GST-FKBP-Rapamycin.
32. A cDNA of claim 31 which encodes a 210 kDa protein which includes one or more of the following internal amino acid sequences:
- a) ILLNIEHR;
- B) LIRPYMEPILK;
- c) DXMEAQE; and
- d) QLDHPLPTVHPQVTYAYM(K)
33. DNA encoding for a protein of mammalian origin having a molecular weight of about 210 kDa which binds to a GST-FKBP-Rapamycin complex.
34. A DNA of claim 33 in which the protein of mammalian origin includes one or more of the following internal amino acid sequences:
- a) ILLNIEHR;
- B) LIRPYMEPILK;
- c) DXMEAQE; and
- d) QLDHPLPTVHPQVTYAYM(K)
35. Antisense RNA derived from a cDNA clone, the cDNA clone encoding for a protein of mammalian origin having a molecular weight of about 210 kDa which binds to a GST-FKBP-Rapamycin complex.
36. An antisense RNA derived from a cDNA clone of claim 35 the cDNA clone encoding for a protein of mammalian origin which includes one or more of the following internal amino acid sequences:
- a) ILLNIEHR;
- B) LIRPYMEPILK:
- c) DXMEAQE; and
- d) QLDHPLPTVHPQVTYAYM(K)
37. Antisense DNA derived from a cDNA clone, the cDNA clone encoding for a protein of mammalian origin having a molecular weight of about 210 kDa which binds to a GST-FKBP-Rapamycin complex.
38. An antisense DNA derived from a cDNA clone of claim 37 the cDNA clone encoding for a protein of mammalian origin which includes one or more of the following internal amino acid sequences:
- a) ILLNIEHR;
- B) LIRPYMEPILK;
- c) DXMEAQE; and
- d) QLDHPLPTVHPQVTYAYM(K)
39. A process for isolating a protein having a molecular weight of about 125 kDa, about 148 kDa, about 208 kDa, or about 210 kDa which binds to a GST-FKBP-Rapamycin complex from mammalian cells, the process comprising:
- a) lysing the mammalian cells in the presence of a buffering agent, a low salt, a chelating agent, a protease inhibitor, and a reducing agent at a temperature which minimizes protein degradation, the Iysing creating unbroken cells, cell nuclei, and lysates, the lysates including cellular membrane fractions and cellular debris;
- b) preclearing unbroken cells and cell nuclei from the lysates at a temperature which minimizes protein degradation to create a precleared lysate;
- c) concentrating the cellular membrane fractions of the mammalian cells from the precleared lysate, the membrane fractions containing membrane proteins;
- d) solubilizing the membrane proteins in a buffer containing a detergent which solubilizes the proteins, without detrimentally denaturing the proteins, at a temperature which minimizes protein degradation, resulting in solubilized proteins and mammalian cellular debris;
- e) separating the solubilized proteins from the mammalian cellular debris;
- f) incubating a solution containing the solubilized proteins in a buffer, the buffer containing a buffering agent, a salt, a reducing agent, one or more protease inhibitor(s), divalent cations, with an affinity resin to absorb to the affinity resin those proteins which have an binding affinity to the affinity resin at a temperature which allows binding to the affinity resin and minimizes protein degradation;
- g) separating the affinity resin from the solution of step (f) at a temperature which minimizes protein degradation, yielding a solution (g) containing solubolized proteins which do not bind to the affinity resin in step (f);
- h) incubating the solution (g) with Rapamycin or a Rapamycin analog (IC50 in LAF<500 nM) complexed to a fusion protein of FKBP12+protein, the fusion protein enhancing the isolation of the desired about 125 kDa protein, about 148 kDa, about 208 kDa, or about 210 kDa yielding a mixture (h) containing the desired proteins having a molecular weight of about 125 kDa, about 148 kDa, about 208 kDa, or about 210 kDa bound to a fusion FKBP protein:Rapamycin complexes or fusion FKBP protein:Rapamycin analog complexes;
- i) incubating the mixture (h) containing the desired proteins having a molecular weight of about 125 kDa, about 148 kDa, about 208 kDa, or about 210 kDa bound to fusion FKBP protein:Rapamycin complexes or fusion FKBP protein:Rapamycin analog complexes with an affinity resin which binds to the fusion protein at a temperature and for a time which allows the binding to the affinity resin and minimizes protein degradation, bound to a fusion FKBP protein:Rapamycin complexes or fusion FKBP protein:Rapamycin analog complexes;
- j) rinsing the affinity resin (i) containing the bound complexes with a buffer which dissociates binding of proteins other than the desired about 125 kDa, about 148 kDa, about 208 kDa, or about 210 kDa proteins;
- k) eluting the about 125 kDa, about 148 kDa, about 208 kDa, or about 210 kDa protein: fusion FKBP protein:rapamycin complexes fusion or the 125 kDa protein:FKBP protein:rapamycin analog complexes from the affinity resin r) with a buffer;
- l) separating the proteins eluted in step (k) by size.
40. A method for identifying in immunomodulatory or anti-tumor agent, comprising the steps of:
- a) combining a substance to be tested with a mammalian protein having a molecular weight of about 125 kDa, about 148 kDa, about 208 kDa, or about 210 kDa which binds to an FKBP-Rapamycin complex, the protein being bound to a solid support:
- b) maintaining the substance to be tested and the protein bound to the solid support of step (a) under conditions appropriate for binding of the substance to be tested with the protein, and
- c) determining whether binding of the substance to be tested occurred in step (b).
41. A method of claim 40 in which the mammalian protein includes one or more of the following internal amino acid sequences:
- a) ILLNIEHR;
- B) LIRPYMEPILK;
- c) DXMEAQE; and
- d) QLDHPLPTVHPQVTYAYM(K)
42. A method for identifying an immunomodulatory or anti-tumor agent, comprising the steps of:
- a) combining a substance to be tested with a mammalian protein having a molecular weight of about 125 kDa, about 148 kDa, about 208 kDa, or about 210 kDa which binds to an FKBP-Rapamycin complex, the protein being bound to a solid support:
- b) maintaining the substance to be tested and the protein bound to the solid support of step (a) under conditions appropriate for binding of the substance to be tested with the protein, and
- c) determining whether the presence of the substance to be tested modulated the activity of the mammalian protein having a molecular weight of about 125 kDa which binds to an FKBP-Rapamycin complex.
43. A method of claim 42 in which the mammalian protein includes one or more of the following internal amino acid sequences:
- a) ILLNIEHR;
- B) LIRPYMEPILK;
- c) DXMEAQE; and
- d) QLDHPLPTVHPQVTYAYM(K)
44. A method for detecting, in a biological sample, rapamycin, rapamycin analogs or rapamycin metabolites which, when complexed with a FKBP, bind to a mammalian protein having a molecular weight of about 125 kDa, about 148 kDa, about 208 kDa, or about 210 kDa which binds to a GST-FKBP-Rapamycin complex, the method comprising the steps of:
- a) combining the biological sample with a FKBP to form a first mixture containing, if rapamycin, rapamycin analogs or rapamycin metabolites are present in the biological sample, a rapamycin:FKBP complexes, rapamycin analog:FKBP complexes, or rapamycin metabolite:PKBP complexes;
- b) creating a second mixture by adding the first mixture to a protein having a molecular weight of about 125 kDa, about 148 kDa, about 208 kDa, or about 210 kDa which binds to a GST-FKBP-Rapamycin complex, the protein having a molecular weight of about 125 kDa being bound to a solid support;
- c) maintaining the second mixture of step (b) under conditions appropriate for binding the rapamycin:FKBP complexes, rapamycin analog:FKBP complexes, or rapamycin metabolite:FKBP complexes, if present, to the protein having a molecular weight of about 125 kDa, about, 148 kDa, about 208 kDa, or about 210 kDa which binds to a GST-FKBP-Rapamycin complex; and
- d) determining whether binding of the rapamycin:FKBP complexes, rapamycin analog:FKBP complexes, or rapamycin metabolite:FKBP complexes and the protein occurred in step (c).
45. A method of claim 44 in which the protein includes one or more of the following internal amino acid sequences:
- a) ILLNIEHR;
- B) LIRPYMEPILK;
- c) DXMEAQE; and
- d) QLDHPLPTVHPQVTYAYM(K)
46. A method for modulating the immune system of a mammal in need thereof, the method comprising administering to the mammal an immunomodulatory amount of antisense RNA derived from a cDNA clone which encodes for a protein having a molecular weight of about 125 kDa, about 148 kDa, about 208 kDa, or about 210 kDa which binds to an FKBP-Rapamycin complex.
47. A method of claim 46 in which the protein includes one or more of the following internal amino acid sequences:
- a) ILLNIEHR;
- B) LIRPYMEPILK;
- c) DXMEAQE; and
- d) QLDHPLPTVHPQVTYAYM(K)
48. A method for modulating the immune system of a mammal in need thereof, the method comprising administering to the mammal an immunomodulatory amount of antisense DNA derived from a cDNA clone which encodes for a protein having a molecular weight of about 125 kDa, about 148 kDa, about 208 kDa, or about 210 kDa which binds to an FKBP-Rapamycin complex.
49. A method of claim 48 in which the protein includes one or more of the following internal amino acid sequences:
- a) ILLNIEHR;
- B) LIRPYMEPILK;
- c) DXMEAQE; and
- d) QLDHPLPTVHPQVTYAYM(K)
50. A protein of mammalian origin which includes one or more of the following internal amino acid sequences:
- a) ILLNIEHR;
- B) LIRPYMEPILK;
- c) DXMEAQE; and
- d) QLDHPLPTVHPQVTYAYM(K)
51. A recombinantly produced protein which includes one or more of the following internal amino acid sequences:
- a) ILLNIEHR;
- B) LIRPYMEPILK;
- c) DXMEAQE; and
- d) QLDHPLPTVHPQVTYAYM(K)
52. A cDNA which encodes a protein which includes one or more of the following internal amino acid sequences:
- a) ILLNIEHR;
- B) LIRPYMEPILK;
- c) DXMEAQE; and
- d) QLDHPLPTVHPQVTYAYM(K)
53. A DNA encoding for a protein of mammalian origin which includes one or more of the following internal amino acid sequences:
- a) ILLNIEHR;
- B) LIRPYMEPILK;
- c) DXMEAQE; and
- d) QLDHPLPTVHPQVTYAYM(K)
54. An antisense RNA derived from a cDNA clone encoding for a protein of mammalian origin which includes one or more of the following internal amino acid sequences:
- a) ILLNIEHR;
- B) LIRPYMEPILK;
- c) DXMEAQE; and
- d) QLDHPLPTVHPQVTYAYM(K)
55. An antisense DNA derived from a cDNA clone encoding for a protein of mammalian origin which includes one or more of the following internal amino acid sequences:
- a) ILLNIEHR;
- B) LIRPYMEPILK;
- c) DXMEAQE; and
- d) QLDHPLPTVHPQVTYAYM(K)
Type: Application
Filed: Oct 15, 2003
Publication Date: Aug 12, 2004
Applicants: Wyeth , The Trustees of Columbia University (New York, NY)
Inventors: Thomas J. Caggiano (Morrisville, PA), Yanqiu Chen (New York, NY), Amedeo A. Failli (Princeton, NJ), Katherine L. Molnar-Kimber (Glenside, PA), Koji Nakanishi (New York, NY)
Application Number: 10688016
International Classification: A61K048/00; A61K038/17; C07K014/705; C07H021/04;