INTERFERONS, USES AND COMPOSITIONS RELATED THERETO

The present disclosure provides isolated Interferonα nucleic acids and polypeptides. The disclosure also provides antibodies which specifically recognize the subject Interferonα polypeptides, expression vectors containing the subject nucleic acids, and host cells expressing the subject polypeptides. In addition, methods of treatment using Interferonα are provided.

Latest Pestka Biomedical Laboratories Patents:

Skip to: Description  ·  Claims  · Patent History  ·  Patent History
Description
BACKGROUND OF THE INVENTION

Interferons (IFNs) are a well known family of cytokines secreted by a large variety of eukaryotic cells upon exposure to various stimuli. The interferons have been classified by their chemical and biological characteristics into four groups: IFN-α (leukocytes), IFN-β (fibroblasts), IFN-γ (lymphocytes), and IFN-ω (leukocytes). IFN-α and β are known as Type I interferons: IFN-γ is known as a Type-II or immune interferon. The IFNs exhibit anti-viral, immunoregulatory, and antiproliferative activity. The clinical potential of interferons has been recognized.

Human leukocyte interferon was first discovered and prepared in the form of very crude fractions by Isaacs and Lindemann Efforts to purify and characterize the material have led to the preparation of relatively homogeneous leukocyte interferons derived from normal or leukemic (chronic myelogenous leukemia or “CML”) donor leukocytes. These interferons are a family of proteins characterized by a potent ability to confer a virus-resistant state in their target cells. In addition, interferon can inhibit cell proliferation, modulate immune responses and alter expression of proteins. These properties have prompted the clinical use of leukocyte interferon as a therapeutic agent for the treatment of viral infections and malignancies.

During the past several decades a large number of human and animal interferons have been produced, identified, purified and cloned. Several of the interferon preparations have been prepared for clinical trial in both crude form, for some of the original interferon preparations, as well as in purified form. Several individual recombinant interferon-α species have been cloned and expressed. The proteins have then been purified by various procedures and formulated for clinical use in a variety of formulations. Most of the interferons in clinical use that have been approved by various regulatory agencies throughout the world are mixtures or individual species of human a interferon (Hu-IFN-α). In some countries Hu-IFN-β and γ have also been approved for clinical trial and in some cases approved for therapeutic use. The major thesis underlying clinical use of these interferons was that they were natural molecules produced by normal individuals. Indeed, the specific thesis was that all the interferons prepared for clinical use, be they natural- or recombinant-generated products, represented interferons that were produced naturally by normal people. This is true for a large number of interferons as well as specific growth factors, lymphokines, cytokines, hormones, clotting factors and other proteins that have been produced.

SUMMARY OF THE INVENTION

The present invention provides isolated nucleic acid molecules comprising a polynucleotide encoding at least a portion of an Interferon polypeptide including an amino acid sequence shown in at least one of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86 or a fragment thereof. Thus, one aspect of the invention provides an isolated polynucleotide comprising a nucleotide sequence selected from the group consisting of: (a) a nucleotide sequence encoding an Interferon polypeptide including an amino acid sequence in at least one of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84 or 86; (b) a nucleotide sequence encoding a biologically active fragment of a polypeptide shown in at least one of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84 or 86; and (c) a nucleotide sequence complementary to at least one of any of the nucleotide sequences in (a) or (b) above.

Further embodiments of the invention include isolated nucleic acid molecules that comprise a polynucleotide having a nucleotide sequence at least 90% identical, and more preferably at least 95%, 96%, 97%, 98% or 99% identical, to any of the nucleotide sequences in (a), (b) or (c), above, or a polynucleotide which hybridizes under stringent hybridization conditions to a polynucleotide in (a), (b) or (c), above, and preferably to a polynucleotide shown in at least one of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83 or 85. By “stringent hybridization conditions” is intended overnight incubation at 42° C. in a solution comprising: 50% formamide, 5×SSC (150 mM NaCl, 15 mM trisodium citrate), 50 mM sodium phosphate (pH 7.6), 5× Denhardt's solution, 10% dextran sulfate, and 20 mu g/ml denatured, sheared salmon sperm DNA, followed by washing the filters in 0.1×SSC at about 65° C.

More generally, by a fragment of an isolated nucleic acid molecule having the nucleotide sequence shown in at least one of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83 or 85, is intended fragments at least about 15 nucleotides, and more preferably at least about 20 nucleotides, still more preferably at least about 30 nucleotides, and even more preferably, at least about 40 nucleotides in length which are useful as diagnostic probes and primers as discussed herein. Of course, larger fragments 50-300 nucleotides in length are also useful according to the present invention as are fragments corresponding to most, if not all, of at least one of the nucleotide sequences shown in at least one of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83 or 85. By a fragment at least 20 nucleotides in length, for example, is intended fragments which include 20 or more contiguous bases from at least one of the nucleotide sequences as shown in at least one of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83 or 85.

By a polynucleotide which hybridizes to a “portion” of a polynucleotide is intended a polynucleotide (either DNA or RNA) hybridizing to at least about 15 nucleotides, and more preferably at least about 20 nucleotides, still more preferably at least about 30 nucleotides, and even more preferably about 30-70 (e.g., 50) nucleotides of the reference polynucleotide. These are useful as diagnostic probes and primers as discussed above and in more detail below.

In another aspect, the present invention provides isolated nucleic acid molecules comprising a polynucleotide encoding at least a portion of a feline Interferon polypeptide including an amino acid sequence shown in at least one of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26 or a fragment thereof. Thus, one aspect of the invention provides an isolated polynucleotide comprising a nucleotide sequence selected from the group consisting of: (a) a nucleotide sequence encoding a feline Interferon polypeptide including an amino acid sequence in at least one of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24 or 26; (b) a nucleotide sequence encoding a biologically active fragment of a polypeptide shown in at least one of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24 or 26; and (c) a nucleotide sequence complementary to at least one of any of the nucleotide sequences in (a) or (b) above.

Further embodiments of the invention include isolated nucleic acid molecules that comprise a polynucleotide having a nucleotide sequence at least 90% identical, and more preferably at least 95%, 96%, 97%, 98% or 99% identical, to any of the nucleotide sequences in (a), (b) or (c), above, or a polynucleotide which hybridizes under stringent hybridization conditions to a polynucleotide in (a), (b) or (c), above, and preferably to a polynucleotide shown in at least one of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23 or 25. By “stringent hybridization conditions” is intended overnight incubation at 42° C. in a solution comprising: 50% formamide, 5×SSC (150 mM NaCl, 15 mM trisodium citrate), 50 mM sodium phosphate (pH 7.6), 5× Denhardt's solution, 10% dextran sulfate, and 20 mu g/ml denatured, sheared salmon sperm DNA, followed by washing the filters in 0.1×SSC at about 65° C.

More generally, by a fragment of an isolated nucleic acid molecule having the nucleotide sequence shown in at least one of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23 or 25, is intended fragments at least about 15 nucleotides, and more preferably at least about 20 nucleotides, still more preferably at least about 30 nucleotides, and even more preferably, at least about 40 nucleotides in length which are useful as diagnostic probes and primers as discussed herein. Of course, larger fragments 50-300 nucleotides in length are also useful according to the present invention as are fragments corresponding to most, if not all, of at least one of the nucleotide sequences shown in at least one of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23 or 25. By a fragment at least 20 nucleotides in length, for example, is intended fragments which include 20 or more contiguous bases from at least one of the nucleotide sequences as shown in at least one of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23 or 25.

By a polynucleotide which hybridizes to a “portion” of a polynucleotide is intended a polynucleotide (either DNA or RNA) hybridizing to at least about 15 nucleotides, and more preferably at least about 20 nucleotides, still more preferably at least about 30 nucleotides, and even more preferably about 30-70 (e.g., 50) nucleotides of the reference polynucleotide. These are useful as diagnostic probes and primers as discussed above and in more detail below.

In another aspect, the present invention further provides isolated nucleic acid molecules comprising a polynucleotide encoding at least a portion of a Rhesus Interferon polypeptide including an amino acid sequence shown in at least one of SEQ ID NO: 28, 30, 32, 34, 36 or a fragment thereof. Thus, one aspect of the invention provides an isolated polynucleotide comprising a nucleotide sequence selected from the group consisting of: (a) a nucleotide sequence encoding a Rhesus Interferon polypeptide including an amino acid sequence in at least one of SEQ ID NO: 28, 30, 32, 34 or 36; (b) a nucleotide sequence encoding a biologically active fragment of a polypeptide shown in at least one of SEQ ID NO: 28, 30, 32, 34 or 36; and (c) a nucleotide sequence complementary to any of the nucleotide sequences in (a) or (b) above.

Further embodiments of the invention include isolated nucleic acid molecules that comprise a polynucleotide having a nucleotide sequence at least 90% identical, and more preferably at least 95%, 96%, 97%, 98% or 99% identical, to any of the nucleotide sequences in (a), (b) or (c), above, or a polynucleotide which hybridizes under stringent hybridization conditions to a polynucleotide in (a), (b) or (c), above, and preferably to a polynucleotide shown in at least one of SEQ ID NO: 27, 29, 31, 33 or 35. By “stringent hybridization conditions” is intended overnight incubation at 42° C. in a solution comprising: 50% formamide, 5×SSC (150 mM NaCl, 15 mM trisodium citrate), 50 mM sodium phosphate (pH 7.6), 5× Denhardt's solution, 10% dextran sulfate, and 20 mu g/ml denatured, sheared salmon sperm DNA, followed by washing the filters in 0.1×SSC at about 65° C.

More generally, by a fragment of an isolated nucleic acid molecule having the nucleotide sequence shown in at least one of SEQ ID NO: 27, 29, 31, 33 or 35, is intended fragments at least about 15 nucleotides, and more preferably at least about 20 nucleotides, still more preferably at least about 30 nucleotides, and even more preferably, at least about 40 nucleotides in length which are useful as diagnostic probes and primers as discussed herein. Of course, larger fragments 50-300 nucleotides in length are also useful according to the present invention as are fragments corresponding to most, if not all, of the nucleotide sequence shown in at least one of SEQ ID NO: 27, 29, 31, 33 or 35. By a fragment at least 20 nucleotides in length, for example, is intended fragments which include 20 or more contiguous bases from the nucleotide sequence as shown in at least one of SEQ ID NO: 27, 29, 31, 33 or 35.

By a polynucleotide which hybridizes to a “portion” of a polynucleotide is intended a polynucleotide (either DNA or RNA) hybridizing to at least about 15 nucleotides, and more preferably at least about 20 nucleotides, still more preferably at least about 30 nucleotides, and even more preferably about 30-70 (e.g., 50) nucleotides of the reference polynucleotide. These are useful as diagnostic probes and primers as discussed above and in more detail below.

In another aspect, the present invention provides isolated nucleic acid molecules comprising a polynucleotide encoding at least a portion of a human Interferon polypeptide including an amino acid sequence shown in at least one of SEQ ID NO: 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86 or a fragment thereof. Thus, one aspect of the invention provides an isolated polynucleotide comprising a nucleotide sequence selected from the group consisting of: (a) a nucleotide sequence encoding a human Interferon polypeptide including an amino acid sequence in at least one of SEQ ID NO: 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84 or 86; (b) a nucleotide sequence encoding a biologically active fragment of a polypeptide shown in at least one of SEQ ID NO: 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84 or 86; and (c) a nucleotide sequence complementary to any of the nucleotide sequences in (a) or (b) above.

Further embodiments of the invention include isolated nucleic acid molecules that comprise a polynucleotide having a nucleotide sequence at least 90% identical, and more preferably at least 95%, 96%, 97%, 98% or 99% identical, to any of the nucleotide sequences in (a), (b) or (c), above, or a polynucleotide which hybridizes under stringent hybridization conditions to a polynucleotide in (a), (b) or (c), above, and preferably to a polynucleotide shown in at least one of SEQ ID NO: 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83 or 85. By “stringent hybridization conditions” is intended overnight incubation at 42° C. in a solution comprising: 50% formamide, 5×SSC (150 mM NaCl, 15 mM trisodium citrate), 50 mM sodium phosphate (pH 7.6), 5× Denhardt's solution, 10% dextran sulfate, and 20 mu g/ml denatured, sheared salmon sperm DNA, followed by washing the filters in 0.1×SSC at about 65° C.

More generally, by a fragment of an isolated nucleic acid molecule having the nucleotide sequence shown in at least one of SEQ ID NO: 37, 39, 41, 43, 45; 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83 or 85, is intended fragments at least about 15 nucleotides, and more preferably at least about 20 nucleotides, still more preferably at least about 30 nucleotides, and even more preferably, at least about 40 nucleotides in length which are useful as diagnostic probes and primers as discussed herein. Of course, larger fragments 50-300 nucleotides in length are also useful according to the present invention as are fragments corresponding to most, if not all, of the nucleotide sequence shown in at least one of SEQ ID NO: 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83 or 85. By a fragment at least 20 nucleotides in length, for example, is intended fragments which include 20 or more contiguous bases from the nucleotide sequence as shown in at least one of SEQ ID NO: 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79, 81, 83 or 85.

By a polynucleotide which hybridizes to a “portion” of a polynucleotide is intended a polynucleotide (either DNA or RNA) hybridizing to at least about 15 nucleotides, and more preferably at least about 20 nucleotides, still more preferably at least about 30 nucleotides, and even more preferably about 30-70 (e.g., 50) nucleotides of the reference polynucleotide. These are useful as diagnostic probes and primers as discussed above and in more detail below.

In another aspect, any of the nucleic acid molecules of the present invention which encode Interferon polypeptides may include, but are not limited to, those encoding the amino acid sequence of the complete polypeptide, by itself; and the coding sequence for the complete polypeptide and additional sequences, such as those encoding an added secretory leader sequence, such as a pre-, or pro- or prepro-protein sequence.

Also encoded by nucleic acids of the invention are the above protein sequences together with additional, non-coding sequences, including, for example, but not limited to introns and non-coding 5′ and 3′ sequences, such as the transcribed, non-translated sequences that play a role in transcription, mRNA processing, including splicing and polyadenylation signals, for example-ribosome binding and stability of mRNA; and an additional coding sequence which codes for additional amino acids, such as those which provide additional functionalities.

Thus, the sequence encoding the polypeptide may be fused to a marker sequence, such as a sequence encoding a peptide which facilitates purification of the fused polypeptide. In certain preferred embodiments of this aspect of the invention, the marker amino acid sequence is a hexa-histidine peptide, such as the tag provided in a pQE vector (QIAGEN, Inc., 9259 Eton Avenue, Chatsworth, Calif. 91311), among others, many of which are commercially available. For instance, hexa-histidine as described by Gentz et al. provides for convenient purification of the fusion protein (Gentz et al. (1989) Proc. Natl. Acad. Sci. USA 86: 821-824). The “HA” tag is another peptide useful for purification which corresponds to an epitope derived from the influenza hemagglutinin protein (Wilson et al. (1984) Cell 37: 767). As discussed below, other such fusion proteins include an Interferon fused to Fe at the N- or C-terminus.

The present invention also relates to recombinant vectors, which include the isolated nucleic acid molecules of the present invention, and to host cells containing the recombinant vectors, as well as to methods of making such vectors and host cells and for using them for production of Interferon polypeptides or peptides by recombinant techniques.

In another aspect, the invention further provides an isolated Interferon polypeptide comprising an amino acid sequence selected from: (a) the amino acid sequence of an Interferon polypeptide including an acid sequence shown in at least one of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84 or 86; and (b) the amino acid sequence of a biologically active fragment of a polypeptide shown in at least one of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84 or 86. The polypeptides of the present invention also include polypeptides having an amino acid sequence at least 80% identical, more preferably at least 90% identical, and still more preferably 95%, 96%, 97%, 98% or 99% identical to those described in (a) or (b) above, as well as polypeptides having an amino acid sequence with at least 90% similarity, and more preferably at least 95% similarity, to those above. Polynucleotides encoding such polypeptides are also provided.

An additional embodiment of this aspect of the invention relates to a peptide or polypeptide which comprises the amino acid sequence of an epitope-bearing portion of an Interferon polypeptide having an amino acid sequence described in (a) or (b), above. Peptides or polypeptides having the amino acid sequence of an epitope-bearing portion of an Interferon polypeptide of the invention include portions of such polypeptides with at least six or seven, preferably at least nine, and more preferably at least about 30 amino acids to about 50 amino acids, although epitope-bearing polypeptides of any length up to and including the entire amino acid sequence of a polypeptide of the invention described above also are included in the invention.

In another embodiment, the invention provides an isolated antibody that binds specifically to an Interferon polypeptide having an amino acid sequence described in (a) or (b) above. The invention further provides methods for isolating antibodies that bind specifically to an Interferon polypeptide having an amino acid sequence as described herein. Such antibodies are useful therapeutically as described below.

In another aspect, the invention further provides an isolated feline Interferon polypeptide comprising an amino acid sequence selected from: (a) the amino acid sequence of an Interferon polypeptide including an acid sequence shown in at least one of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24 or 26; and (b) the amino acid sequence of a biologically active fragment of a polypeptide shown in at least one of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24 or 26. The polypeptides of the present invention also include polypeptides having an amino acid sequence at least 80% identical, more preferably at least 90% identical, and still more preferably 95%, 96%, 97%, 98% or 99% identical to those described in (a) or (b) above, as well as polypeptides having an amino acid sequence with at least 90% similarity, and more preferably at least 95% similarity, to those above. Polynucleotides encoding such polypeptides are also provided.

An additional embodiment of this aspect of the invention relates to a peptide or polypeptide which comprises the amino acid sequence of an epitope-bearing portion of a feline Interferon polypeptide having an amino acid sequence described in (a) or (b), above. Peptides or polypeptides having the amino acid sequence of an epitope-bearing portion of a feline Interferon polypeptide of the invention include portions of such polypeptides with at least six or seven, preferably at least nine, and more preferably at least about 30 amino acids to about 50 amino acids, although epitope-bearing polypeptides of any length up to and including the entire amino acid sequence of a polypeptide of the invention described above also are included in the invention.

In another embodiment, the invention provides an isolated antibody that binds specifically to a feline Interferon polypeptide having an amino acid sequence described in (a) or (b) above. The invention further provides methods for isolating antibodies that bind specifically to a feline Interferon polypeptide having an amino acid sequence as described herein. Such antibodies are useful therapeutically as described below.

In another aspect, the invention further provides an isolated Rhesus Interferon polypeptide comprising an amino acid sequence selected from: (a) the amino acid sequence of an Interferon polypeptide including an acid sequence shown in at least one of SEQ ID NO: 28, 30, 32, 34 or 36; and (b) the amino acid sequence of a biologically active fragment of a polypeptide shown in at least one of SEQ ID NO: 28, 30, 32, 34 or 36. The polypeptides of the present invention also include polypeptides having an amino acid sequence at least 80% identical, more preferably at least 90% identical, and still more preferably 95%, 96%, 97%, 98% or 99% identical to those described in (a) or (b) above, as well as polypeptides having an amino acid sequence with at least 90% similarity, and more preferably at least 95% similarity, to those above. Polynucleotides encoding such polypeptides are also provided.

An additional embodiment of this aspect of the invention relates to a peptide or polypeptide which comprises the amino acid sequence of an epitope-bearing portion of a Rhesus Interferon polypeptide having an amino acid sequence described in (a) or (b), above. Peptides or polypeptides having the amino acid sequence of an epitope-bearing portion of a Rhesus Interferon polypeptide of the invention include portions of such polypeptides with at least six or seven, preferably at least nine, and more preferably at least about 30 amino acids to about 50 amino acids, although epitope-bearing polypeptides of any length up to and including the entire amino acid sequence of a polypeptide of the invention described above also are included in the invention.

In another embodiment, the invention provides an isolated antibody that binds specifically to a Rhesus Interferon polypeptide having an amino acid sequence described in (a) or (b) above. The invention further provides methods for isolating antibodies that bind specifically to a Rhesus Interferon polypeptide having an amino acid sequence as described herein. Such antibodies are useful therapeutically as described below.

In another aspect, the invention further provides an isolated human Interferon polypeptide comprising an amino acid sequence selected from: (a) the amino acid sequence of an Interferon polypeptide including an acid sequence shown in at least one of SEQ ID NO: 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58;60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84 or 86; and (b) the amino acid sequence of a biologically active fragment of at least one of a polypeptide shown in SEQ ID NO: 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84 or 86. The polypeptides of the present invention also include polypeptides having an amino acid sequence at least 80% identical, more preferably at least 90% identical, and still more preferably 95%, 96%, 97%, 98% or 99% identical to those described in (a) or (b) above, as well as polypeptides having an amino acid sequence with at least 90% similarity, and more preferably at least 95% similarity, to those above. Polynucleotides encoding such polypeptides are also provided.

An additional embodiment of this aspect of the invention relates to a peptide or polypeptide which comprises the amino acid sequence of an epitope-bearing portion of a human Interferon polypeptide having an amino acid sequence described in (a) or (b), above. Peptides or polypeptides having the amino acid sequence of an epitope-bearing portion of a human Interferon polypeptide of the invention include portions of such polypeptides with at least six or seven, preferably at least nine, and more preferably at least about 30 amino acids to about 50 amino acids, although epitope-bearing polypeptides of any length up to and including the entire amino acid sequence of a polypeptide of the invention described above also are included in the invention.

In another embodiment, the invention provides an isolated antibody that binds specifically to a human Interferon polypeptide having an amino acid sequence described in (a) or (b) above. The invention further provides methods for isolating antibodies that bind specifically to a human Interferon polypeptide having an amino acid sequence as described herein. Such antibodies are useful therapeutically as described below.

In another aspect, the invention further provides compositions comprising any of the Interferon polynucleotides or Interferon polypeptides, described herein, for administration to cells in vitro, to cells ex vivo and to cells in vivo, or to a multicellular organism. In certain particularly preferred embodiments of this aspect of the invention, the compositions comprise an Interferon polynucleotide for expression of an Interferon polypeptide in a host organism for treatment of disease. Particularly preferred in this regard is expression in a human patient for treatment of a dysfunction associated with loss of endogenous activity of an interferon.

The invention also provides for pharmaceutical compositions comprising Interferon polypeptides which may be employed, for instance, to treat immune system-related disorders such as viral infection, parasitic infection, bacterial infection, cancer, autoimmune disease, multiple sclerosis, lymphoma and allergy. Methods of treating individuals in need of interferon polypeptides are also provided. In certain preferred embodiments, the subject pharmaceutical composition is a veterinary composition for administration to a non-human animal, preferably a non-human primate. Exemplary conditions which can be treated with an Interferon include but are not limited to cell proliferation disorders, in particular cancer (e.g., hairy cell leukemia, Kaposi's sarcoma, chronic myelogenous leukemia, multiple myeloma, basal cell carcinoma and malignant melanoma, ovarian cancer, cutaneous T cell lymphoma), and viral infections. Without limitation, treatment with Interferon may be used to treat conditions which would benefit from inhibiting the replication of interferon-sensitive viruses. Viral infections which may be treated in accordance with the invention include hepatitis A, hepatitis B, hepatitis C, other non-A/non-B hepatitis, herpes virus, Epstein-Barr virus (EBV), cytomegalovirus (CMV), herpes simplex, human herpes virus type 6 (HHV-6), papilloma, poxvirus, picornavirus, adenovirus, rhinovirus, human T lymphotropic virus-type 1 and 2 (HTLV-1/-2), human rotavirus, rabies, retroviruses including human immunodeficiency virus (HIV), encephalitis and respiratory viral infections. The method of the invention can also be used to modify various immune responses.

In one embodiment, the subject interferons can be used as anti-viral agents. Interferons have been used clinically for anti-viral therapy, for example, in the treatment of acquired immune disorders, viral hepatitis including chronic hepatitis B, hepatitis C, hepatitis D, papilloma viruses, herpes, viral encephalitis, and in the prophylaxis of rhinitis and respiratory infections.

In another embodiment, the subject Interferon can be used as anti-parasitic agents. The subject Interferons may be used, for example, for treating Cryptosporidium parvum infection.

In still another embodiment, the subject Interferons can be used as anti-bacterial agents. Interferons have been used clinically for anti-bacterial therapy. For example, the subject Interferons can be used in the treatment of multidrug-resistant pulmonary tuberculosis.

In yet another embodiment, the subject Interferons can be used as anti-cancer agents. Interferon therapy using the subject Interferons can be used in the treatment of numerous cancers e.g., hairy cell leukemia, acute myeloid leukemia, osteosarcoma, basal cell carcinoma, glioma, renal cell carcinoma, multiple myeloma, melanoma, and Hodgkin's disease.

In yet another embodiment, the subject Interferons can be used as part of an immunotherapy protocol. The Interferons of the present invention may be used clinically for immunotherapy or more particularly, for example, to prevent graft vs. host rejection, or to curtail the progression of autoimmune diseases, such as arthritis, multiple sclerosis, or diabetes.

In another embodiment, the subject Interferons can be used as part of a program for treating allergies.

In still another embodiment, the subject Interferons can be used as vaccine adjuvants. The subject Interferons may be used as an adjuvant or coadjuvant to enhance or stimulate the immune response in cases of prophylactic or therapeutic vaccination.

In addition to the treatment of animals in general, the specific invention particularly contemplates the use of the subject Interferons for the treatment of primates as part of veterinary protocols. In one embodiment, the interferon is a Rhesus interferon.

In addition to the treatment of animals in general, the specific invention particularly contemplates the use of the subject Interferons for the treatment of cats as part of veterinarian protcols. In one embodiment, the Interferon is a feline Interferon.

In certain embodiments, the subject Interferons are used to treat cats for viral infections. For instance, cats with Feline Immunodeficiency Virus (FIV) require support therapies in order to maintain normal health. The subject interferons can be used as part of a treatment of cats infected with FIV.

Likewise, the subject Interferons can be used as part of a treatment of cats infected with Feline Leukemia Virus (FeLV). The feline leukemia virus (FeLV) is the causative agent of the most important fatal infectious disease complex of American domestic cats today.

Interferons can be used for treating feline panleukopenia. Also called feline infectious enteritis, feline “distemper,” and feline ataxia or incoordination, feline panleukopenia is a highly contagious viral disease of cats characterized by its sudden onset, fever, inappetence (loss of appetite), dehydration, depression, vomiting, decreased numbers of circulating white blood cells (leukopenia), and often a high mortality rate. Intrauterine (within the uterus) infection may result in abortions, stillbirths, early neonatal deaths, and cerebellar hypoplasia (underdevelopment of the cerebellum) manifested by incoordination (ataxia) in kittens beginning at two to three weeks of age. All members of the cat family (Felidae) are susceptible to infection with feline panleukopenia virus (FPV), as are raccoons, coatimundis, and ringtails, in the family Procyoniclae.

Interferons can be used for treating cats infected with feline infectious peritonitis.

Interferons can be used for treating cats infected with rabies.

In other embodiments directed to feline care, the subject Interferons can be used in treating inflammatory airway disease (IAD).

In still another embodiment, the subject Interferons can be used to treat dogs or other household pets.

In still another embodiment, the subject Interferons can be used to treat farm animals.

The subject invention also contemplates functional antagonists, e.g., wherein one or more amino acid residues are different from the wild-type Interferon, which inhibit one or more biological activities of the wild-type Interferon. Such antagonists can be used to treat disorders resulting from aberrant overexpression or other activation of an endogenous interferon. The functional antagonists may be formulated in a pharmaceutical preparation.

The present invention also provides a screening method for identifying compounds capable of enhancing or inhibiting a biological activity of an Interferon polypeptide, which involves contacting a receptor which is enhanced by an Interferon polypeptide with the candidate compound in the presence of an Interferon polypeptide, assaying, for example, anti-viral activity in the presence of the candidate compound and an Interferon polypeptide, and comparing the activity to a standard level of activity, the standard being assayed when contact is made between the receptor and Interferon in the absence of the candidate compound. In this assay, an increase in activity over the standard indicates that the candidate compound is an agonist of Interferon activity and a decrease in activity compared to the standard indicates that the compound is an antagonist of Interferon activity.

An additional aspect of the invention is related to a method for treating an animal in need of an increased level of interferon activity in the body comprising administering to such an animal a composition comprising a therapeutically effective amount of an isolated Interferon polypeptide of the invention or an agonist thereof.

A still further aspect of the invention is related to a method for treating an animal in need of a decreased level of interferon activity in the body comprising, administering to such an animal a composition comprising a therapeutically effective amount of an Interferon antagonist. Preferred antagonists for use in the present invention are Interferon-specific antibodies.

Administration of the described dosages may be every other day, but is preferably once or twice a week. Doses are usually administered over at least a 24 week period by injection.

Administration of the dose can be intravenous, subcutaneous, intramuscular, or any other acceptable systemic method. Based on the judgment of the attending clinician, the amount of drug administered and the treatment regimen used will, of course, be dependent on the age, sex and medical history of the patient being treated, the neutrophil count (e.g. the severity of the neutropenia), the severity of the specific disease condition and the tolerance of the patient to the treatment as evidenced by local toxicity and by systemic side-effects. Dosage amount and frequency may be determined during initial screenings of neutrophil count.

Conventional pharmaceutical formulations can be also prepared using the subject interferon compositions of the present invention. The formulations comprise a therapeutically effective amount of an Interferon polypeptide together with pharmaceutically acceptable carriers. For example, adjuvants, diluents, preservatives and/or solubilizers, if needed, may be used in the practice of the invention. Pharmaceutical compositions of interferon including those of the present invention may include diluents of various buffers (e.g., Tris-HCl, acetate, phosphate) having a range of pH and ionic strength, carriers (e.g., human serum albumin), solubilizers (e.g., Polyoxyethylene Sorbitin or TWEEN™ polysorbate), and preservatives (e.g., thimerosol, benzyl alcohol). See, for example, U.S. Pat. No. 4,496,537.

The amount of the Interferon composition administered to treat the conditions described above is based on the Interferon activity of the composition. It is an amount that is sufficient to significantly affect a positive clinical response. Although the clinical dose will cause some level of side effects in some patients, the maximal dose for mammals including humans is the highest dose that does not cause unmanageable clinically-important side effects. For purposes of the present invention, such clinically important side effects are those which would require cessation of therapy due to severe flu-like symptoms, central nervous system depression, severe gastrointestinal disorders, alopecia, severe pruritus or rash. Substantial white and/or red blood cell and/or liver enzyme abnormalities or anemia-like conditions are also dose limiting.

Naturally, the dosages of Interferon may vary somewhat depending upon the formulation selected. In general, however, the Interferon composition is administered in amounts ranging from about 100,000 to about several million IU/m2 per day, based on the mammal's condition. The range set forth above is illustrative and those skilled in the art will determine the optimal dosing of Interferon selected based on clinical experience and the treatment indication.

The pharmaceutical compositions may be in the form of a solution, suspension, tablet, capsule, lyophilized powder or the like, prepared according to methods well known in the art. It is also contemplated that administration of such compositions will be chiefly by the parenteral route although oral or inhalation routes may also be used depending upon the needs of the artisan.

The term “isolated” as used herein with respect to nucleic acids, such as DNA or RNA, refers to molecules separated from other DNAs or RNAs, respectively, that are present in the natural source of the macromolecule. The term isolated also refers to a nucleic acid or peptide that is substantially free of cellular material or culture medium when produced by recombinant DNA techniques, or chemical precursors or other chemicals when chemically synthesized. Moreover, an “isolated nucleic acid” is meant to include nucleic acid fragment which are not naturally occurring as fragments and would not be found in the natural state.

The practice of the present invention will employ, unless otherwise indicated, conventional techniques of cell biology, cell culture, molecular biology, transgenic biology, microbiology, recombinant DNA, and immunology, which are within the skill of the art. Such techniques are described in the literature. See, for example, Molecular Cloning A Laboratory Manual, 2nd Ed., ed. by Sambrook, Fritsch and Maniatis (Cold Spring Harbor Laboratory Press: 1989); DNA Cloning, Volumes I and II (D. N. Glover ed., 1985); Oligonucleotide Synthesis (M. J. Gait ed., 1984); Mullis et al. U.S. Pat. No. 4,683,195; Nucleic Acid Hybridization (B. D. Hames & S. J. Higgins eds. 1984); Transcription And Translation (B. D. Hames & S. J. Higgins eds. 1984); Culture Of Animal Cells (R. I. Freshney, Alan R Liss, Inc., 1987); Immobilized Cells And Enzymes (IRL Press, 1986); B. Perbal, Practical Guide To Molecular Cloning (1984); the treatise, Methods In Enzymology (Academic Press, Inc., N.Y.); Gene Transfer Vectors For Mammalian Cells (J. H. Miller and M. P. Calos eds., 1987, Cold Spring Harbor Laboratory); Methods In Enzymology, Vols. 154 and 155 (Wu et al. eds.), Immunochemical Methods In Cell And Molecular Biology (Mayer and Walker, eds., Academic Press, London, 1987); Handbook Of Experimental Immunology, Volumes I-IV (D. M. Weir and C. C. Blackwell, eds., 1986); Manipulating the Mouse Embryo, (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1986).

Other features and advantages of the invention will be apparent from the following detailed description, and from the claims.

BRIEF DESCRIPTION OF THE DRAWINGS

Table 1 shows the antiviral activity of the feline IFNα species.

Table 2 shows the antiviral activity of the Rhesus IFNα species.

Table 3 shows the sequence of the PCR primers used to amplify the human IFNα species.

Table 4 shows the primer pairs (described in detail in Table 3) used to identify each of the human IFNα species.

DETAILED DESCRIPTION OF THE INVENTION I. Exemplary Preparations

In another aspect, the present invention provides pharmaceutical preparations comprising Interferons, Interferon agonists or Interferon antagonists. The Interferons, Interferon agonists and/or Interferon antagonists for use in the subject method may be conveniently formulated for administration with a biologically acceptable medium, such as water, buffered saline, polyol (for example, glycerol, propylene glycol, liquid polyethylene glycol and the like) or suitable mixtures thereof. The optimum concentration of the active ingredient(s) in the chosen medium can be determined empirically, according to procedures well known to medicinal chemists. As used herein, “biologically acceptable medium” includes any and all solvents, dispersion media, and the like which may be appropriate for the desired route of administration of the pharmaceutical preparation. The use of such media for pharmaceutically active substances is known in the art. Except insofar as any conventional media or agent is incompatible with the activity of the compositions of the present invention, its use in the pharmaceutical preparation of the invention is contemplated. Suitable vehicles and their formulation inclusive of other proteins are described, for example, in the book Remington's Pharmaceutical Sciences (Remington's Pharmaceutical Sciences. Mack Publishing Company, Easton, Pa., USA 1985). These vehicles include injectable “deposit formulations”.

Pharmaceutical formulations of the present invention can also include veterinary compositions, e.g., pharmaceutical. preparations of the compositions of the present invention suitable for veterinary uses, e.g., for the treatment of livestock, non-human primate, or domestic animals, e.g., dogs and cats.

Rechargeable or biodegradable devices may also provide methods of introduction. Various slow release polymeric devices have been developed and tested in vivo in recent years for the controlled delivery of drugs, including proteinaceous biopharmaceuticals. A variety of biocompatible polymers (including hydrogels), including both biodegradable and non-degradable polymers, can be used to form an implant for sustained release at a particular target site.

The preparations of the present invention may be given orally, parenterally, topically, or rectally. They are of course given by forms suitable for each administration route. For example, they are administered in tablets or capsule form, by injection, inhalation, eye lotion, ointment, suppository, controlled release patch, etc., administration by injection, infusion or inhalation; topical by lotion or ointment; and rectal by suppositories. Oral and topical administrations are preferred.

The phrases “parenteral administration” and “administered parenterally” as used herein means modes of administration other than enteral and topical administration, usually by injection, and includes, without limitation, intravenous, intramuscular, intraarterial, intrathecal, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intraarticular, subcapsular, subarachnoid, intraspinal, and intrasternal injection and infusion.

The phrases “systemic administration,” “administered systemically,” “peripheral administration” and “administered peripherally” as used herein mean the administration of a compound, drug or other material other than directly into the central nervous system, such that it enters the patients system and, thus, is subject to metabolism and other like processes, for example, subcutaneous administration.

These compounds may be administered to humans and other animals for therapy by any suitable route of administration, including orally, nasally, as by, for example, a spray, rectally, intravaginally, parenterally, intracisternally and topically, as by powders, ointments or drops, including buccally and sublingually.

Regardless of the route of administration selected, the compounds of the present invention, which may be used in a suitable hydrated form, and/or the pharmaceutical compositions of the present invention, are formulated into pharmaceutically acceptable dosage forms such as described below or by other conventional methods luiown to those of skill in the art.

Actual dosage levels of the active ingredients in the pharmaceutical compositions of this invention may be varied so as to obtain an amount of the active ingredient which is effective to achieve the desired therapeutic response for a particular patient, composition, and mode of administration, without being toxic to the patient.

The selected dosage level will depend upon a variety of factors including the activity of the particular compound of the present invention employed, or the ester, salt or amide thereof, the route of administration, the time of administration, the rate of excretion of the particular compound being employed, the duration of the treatment, other drugs, compounds and/or materials used in combination with the particular composition employed, the age, sex, weight, condition, general health and prior medical history of the patient being treated, and like factors well known in the medical arts.

A physician or veterinarian having ordinary skill in the art can readily determine and prescribe the effective amount of the pharmaceutical composition required. For example, the physician or veterinarian could start doses of the compounds of the invention employed in the pharmaceutical composition at levels lower than that required in order to achieve the desired therapeutic effect and gradually increase the dosage until the desired effect is achieved.

In general, a suitable daily dose of a compound of the invention will be that amount of the compound which is the lowest dose effective to produce a therapeutic effect. Such an effective dose will generally depend upon the factors described above.

If desired, the effective daily dose of the active compound may be administered as two, three, four, five, six or more sub-doses administered separately at appropriate intervals throughout the day, optionally, in unit dosage forms.

The term “treatment” is intended to encompass also prophylaxis, therapy, and cure.

The patient receiving this treatment is any animal in need, including primates, in particular humans, and other mammals such as equines, cattle, swine and sheep; and poultry and pets in general.

The compound of the invention can be administered as such or in admixtures with pharmaceutically acceptable and/or sterile carriers and can also be administered in conjunction with other agents. Non-limiting examples of such agents include antimicrobial agents such as penicillins, cephalosporins, aminoglycosides, and glycopeptides. Conjunctive therapy, thus includes sequential, simultaneous and separate administration of the active compound in a way that the therapeutic effects of the first administered one is not entirely disappeared when the subsequent is administered.

II. Pharmaceutical Compositions

While it is possible for a compound of the present invention to be administered alone, it is preferable to administer the compound as a pharmaceutical formulation (composition). The compositions of the present invention may be formulated for administration in any convenient way for use in human or veterinary medicine. In certain embodiments, the compound included in the pharmaceutical preparation may be active itself, or may be a prodrug, e.g., capable of being converted to an active compound in a physiological setting.

Thus, another aspect of the present invention provides pharmaceutically acceptable compositions comprising a therapeutically effective amount of one or more of the compounds described above, formulated together with one or more pharmaceutically acceptable carriers (additives) and/or diluents. As described in detail below, the pharmaceutical compositions of the present invention may be specially formulated for administration in solid or liquid form, including those adapted for the following: (1) oral administration, for example, drenches (aqueous or non-aqueous solutions or suspensions), tablets, boluses, powders, granules, pastes for application to the tongue; (2) parenteral administration, for example, by subcutaneous, intramuscular or intravenous injection as, for example, a sterile solution or suspension; (3) topical application, for example, as a cream, ointment or spray applied to the skin; or (4) intravaginally or intrarectally, for example, as a pessary, cream or foam. However, in certain embodiments the subject compounds may be simply dissolved or suspended in sterile water. In certain embodiments, the pharmaceutical preparation is non-pyrogenic, i.e., does not elevate the body temperature of a patient.

The phrase “therapeutically effective amount” as used herein means that amount of a compound, material, or composition comprising a compound of the present invention which is effective for producing some desired therapeutic effect in at least a sub-population of cells in an animal and thereby blocking the biological consequences of that pathway in the treated cells, at a reasonable benefit/risk ratio applicable to any medical treatment.

The phrase “pharmaceutically acceptable” is employed herein to refer to those compounds, materials, compositions, and/or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit/risk ratio.

The phrase “pharmaceutically acceptable carrier” as used herein means a pharmaceutically acceptable material, composition or vehicle, such as a liquid or solid filler, diluent, excipient, solvent or encapsulating material, involved in carrying or transporting the subject agonists from one organ, or portion of the body, to another organ, or portion of the body. Each carrier must be “acceptable” in the sense of being compatible with the other ingredients of the formulation and not injurious to the patient. Some examples of materials which can serve as pharmaceutically acceptable carriers include: (1) sugars, such as lactose, glucose and sucrose; (2) starches, such as corn starch and potato starch; (3) cellulose, and its derivatives, such as sodium carboxymethyl cellulose, ethyl cellulose and cellulose acetate; (4) powdered tragacanth; (5) malt; (6) gelatin; (7) talc; (8) excipients, such as cocoa butter and suppository waxes; (9) oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil and soybean oil; (10) glycols, such as propylene glycol; (11) polyols, such as glycerin, sorbitol, mannitol and polyethylene glycol; (12) esters, such as ethyl oleate and ethyl laurate; (13) agar; (14) buffering agents, such as magnesium hydroxide and aluminum hydroxide; (15) alginic acid; (16) pyrogen-free water; (17) isotonic saline; (18) Ringer's solution; (19) ethyl alcohol; (20) phosphate buffer solutions; and (21) other non-toxic compatible substances employed in pharmaceutical formulations.

III. Variant Interferon Polypeptides

It is anticipated that certain mutant forms (or variants) of the Interferon polypeptides of the invention may act as agonist or antagonists. While not wishing to be bound to any particular theory, it is well known that mutant forms of protein signaling factors are capable of binding to the appropriate receptor and yet not capable of activating the receptor. Such mutant proteins act as antagonists by displacing the wild-type proteins and blocking the normal receptor activation. Additionally, it is well known that one or more amino acid substitutions can be made to many proteins inorder to enhance their activity in comparison to wildtype forms of the protein. Such agonists may have, for example, increased half-life, binding affinity, or activity in comparison to the wildtype protein. There are many well known methods for obtaining mutants (or variants) with a desired activity.

Methods for generating large pools of mutant/variant proteins are well known in the art. In one embodiment, the invention contemplates using Interferon polypeptides generated by combinatorial mutagenesis. Such methods, as are known in the art, are convenient for generating both point and truncation mutants, and can be especially useful for identifying potential variant sequences (e.g., homologs) that are functional in a given assay. The purpose of screening such combinatorial libraries is to generate, for example, Interferon variants homologs that can act as either agonists or antagonists. Thus, combinatorially derived variants can be generated to have an increased potency relative to a naturally occurring form of the protein. Likewise, Interferon variants can be generated by the present combinatorial approach to act as antagonists, in that they are able to mimic, for example, binding to other extracellular matrix components (such as receptors), yet not induce any biological response, thereby inhibiting the action of Interferon polypeptides or Interferon agonists. Moreover, manipulation of certain domains of Interferon by the present method can provide domains more suitable for use in fusion proteins, for example, domains demonstrated to have specific useful properties.

To further illustrate the state of the art of combinatorial mutagenesis, it is noted that the review article of Gallop et al. (1994) J Med Chem 37:1233 describes the general state of the art of combinatorial libraries as of the earlier 1990's. In particular, Gallop et al state at page 1239 “[s]creening the analog libraries aids in determining the minimum size of the active sequence and in identifying those residues critical for binding and intolerant of substitution”. In addition, the Ladner et al. PCT publication WO90/02809, the Goeddel et al. U.S. Pat. No. 5,223,408, and the Markland et al. PCT publication WO92/15679 illustrate specific techniques which one skilled in the art could utilize to generate libraries of variants which can be rapidly screened to identify variants/fragments which possess a particular activity. These techniques are exemplary of the art and demonstrate that large libraries of related variants/truncants can be generated and assayed to isolate particular variants without undue experimentation. Gustin et al. (1993) Virology 193:653, and Bass et al. (1990) Proteins: Structure, Function and Genetics 8:309-314 also describe other exemplary techniques from the art which can be adapted as a means for generating mutagenic variants of the Interferon polypeptides of the invention.

Indeed, it is plain from the combinatorial mutagenesis art that large scale mutagenesis of Interferon proteins, without any preconceived ideas of which residues were critical to the biological function, can generate wide arrays of variants having equivalent biological activity. Alternatively, such methods can be used to generate a wide array of variants having enhanced activity or antagonistic activity. Indeed, it is the ability of combinatorial techniques to screen billions of different variants by high throughout analysis that removes any requirement of a priori understanding or knowledge of critical residues.

IV Antibody Antagonists

It is anticipated that some antibodies can act as Interferon antagonists. Antibodies can have extraordinary affinity and specificity for particular epitopes. The binding of an antibody to its epitope on a protein may antagonize the function of that protein by competitively or non-competitively inhibiting the interaction of that protein with other proteins necessary for proper function.

Antibodies with Interferon antagonist activity can be identified in much the same way as other Interferon antagonists. For example, candidate antibodies can be administered to cells expressing a reporter gene, and antibodies that cause decreased reporter gene expression are antagonists.

In one variation, antibodies of the invention can be single chain antibodies (scFv), comprising variable antigen binding domains linked by a polypeptide linker. Single chain antibodies are expressed as a single polypeptide chain and can be expressed in bacteria and as part of a phage display library. In this way, phage that express the appropriate scFv will have Interferon antagonist activity. The nucleic acid encoding the single chain antibody can then be recovered from the phage and used to produce large quantities of the scFv. Construction and screening of scFv libraries is extensively described in various publications (U.S. Pat. Nos. 5,258,498; 5,482,858; 5,091,513; 4,946,778; 5,969,108; 5,871,907; 5,223,409; 5,225,539).

EXEMPLIFICATION

The invention now being generally described, it will be more readily understood by reference to the following examples which are included merely for purposes of illustration of certain aspects and embodiments of the present invention, and are not intended to limit the invention.

Example 1 Isolation of Feline IFNα Clones

Feline IFNα clones were isolated by PCR amplification of genomic DNA from a cat lung cell line (AKD) using standard methods. Nine distinct sequences were isolated and designated Fe-IFN-αA (SEQ ID NO: 9), Fe-IFN-αB (SEQ ID NO: 11), Fe-IFN-αC (SEQ ID NO: 13), Fe-IFN-αD (SEQ ID NO: 15), Fe-IFN-αE (SEQ ID NO: 17), Fe-IFN-αF (SEQ ID NO: 19), Fe-IFN-αG (SEQ ID NO: 21), Fe-IFN-αH (SEQ ID NO: 23), and Fe-IFN-αI (SEQ ID NO: 25). Amino acid sequences corresponding to each of these are also provided: Fe-IFN-αA (SEQ ID NO: 10), Fe-IFN-αB (SEQ ID NO: 12), Fe-IFN-αC (SEQ ID NO: 14), Fe-IFN-αD (SEQ ID NO: 16), Fe-IFN-αE (SEQ ID NO: 18), Fe-IFN-αF (SEQ ID NO: 20), Fe-IFN-αG (SEQ ID NO: 22), Fe-IFN-αH (SEQ ID NO: 24), and Fe-IFN-αI (SEQ ID NO: 26).

PCR was performed using standard procedure. Two rounds of amplification from genomic DNA were performed. Flanking primers used to amplify the feline sequences are:

5′ primer: 5′-CTCTTCCTTCTTGGTGGCCCTG-3′ 3′ primer: 5′-GTGATGAGTCAGTGAGAATCATTTC-3′

Example 2 Antiviral Activity of the Feline IFNα Species

The antiviral activity of the subject Interferon species was measured using a cytopathic effect assay (CPE). Briefly, serial dilution of Interferon were incubated with test cells for 1 to 4 hours at 37 C. Virus was then added to the cells and incubated for 16 hours at 37 C. The surviving cells were visualized by uptake of crystal violet stain, and the dilution of Interferon at which approximately 50% of the cells survive viral infection was determined.

Table 1 summarizes the results of these experiments which demonstrate that feline IFN-αA, IFN-αB, IFN-αC, IFN-αD, IFN-αE, IFN-αF, IFN-αG, and IFN-αI each possess antiviral activity as measured by CPE. The activity of feline IFN-αH was not determined in this assay. In this particular experiment, the test cells were AKD feline lung cells and the virus was vesicular stromatitis virus (VSV).

Example 3 Isolation of Rhesus IFNα Clones

Rhesus monkey IFNα clones were isolated by PCR amplification of genomic DNA from a Rhesus monkey kidney cell line (LLCMK-2) using standard methods. Two separate primer pairs were used to amplify sequences. Using the first primer pair, one sequence was isolated and designated Rh-IFN-α4b (SEQ ID 29). The amino acid sequence corresponding to the Rh-IFN-α4b nucleic acid sequence is designated in SEQ ID NO: 30.

PCR was performed using standard procedure. Two rounds of amplification from genomic DNA were performed. Flanking primers used to amplify this Rhesus sequence are:

5′ primer: 5′-CTTCAGAGAACCTGGAGCC-3′ 3′ primer: 5′-AATCATTTCCATGTTGAACCAG-3′

Three additional Rhesus IFNα clones were isolated by PCR amplification of genomic DNA from a Rhesus monkey kidney cell line (LLCMK-2) using standard methods and a second primer pair: Rh-IFN-αD1 (SEQ ID NO: 31), Rh-IFN-αD2 (SEQ ID NO: 33), and Rh-IFN-αD3 (SEQ ID NO: 35). Amino acid sequences corresponding to each of these are also provided: Rh-IFN-αD1 (SEQ ID NO: 32), Rh-IFN-αD2 (SEQ ID NO: 34), and Rh-IFN-αD3 (SEQ ID NO: 36).

PCR was performed using standard procedures. Two rounds of amplification from genomic DNA were performed. Flanking primers used to amplify these Rhesus sequences are:

5′ primer: 5′-AGAAGCATCTGCCTGCAATATC-3′ 3′ primer: 5′-GCTATGACCATGATTACGAATTC-3′

Example 4 Antiviral Activity of the Rhesus IFNα Species

The antiviral activity of the subject Interferon species was measured using a cytopathic effect assay (CPE). Briefly, serial dilution of Interferon were incubated with test cells for 1 to 4 hours at 37° C. Virus was then added to the cells and incubated for 16 hours at 37° C. The surviving cells were visualized by uptake of crystal violet stain, and the dilution of Interferon at which approximately 50% of the cells survive viral infection was determined.

Table 2 summarizes the results of experiments which demonstrate that Rhesus IFN-α4b possesses antiviral activity as measured by an anti-viral activity assay (CPE). The activities of Rhesus IFN-αD1, IFN-αD2, and IFN-αD3 were not determined in this assay. This assay was performed using as test cells either Madin-Darby bovine kidney endothelial cells (MDBK) or African green monkey kidney cells (Vero) infected with VSV.

Example 5 Isolation of Human IFNα Clones

Eighteen human Interferon-α species were isolated in accordance with the procedures described in U.S. Pat. Nos. 5,789,551, 5,869,293, and 6,001,589. Briefly, human genomic DNA was analyzed by PCR using standard methods. The primers used in this analysis are described in Tables 3 and 4.

The eighteen human Interferon-α species identified using this approach are: hu-IFN-α001 (SEQ ID No: 37), hu-IFN-α002 (SEQ ID No: 39), hu-IFN-α003 (SEQ ID No: 41), hu-IFN-α004 (SEQ ID No: 43), hu-IFN-α005 (SEQ ID No: 45), hu-IFN-α006 (SEQ ID No: 47), hu-IFN-α007 (SEQ ID No: 49), hu-IFN-α008 (SEQ ID No: 51), hu-IFN-α009 (SEQ ID No: 53), hu-IFN-α010 (SEQ ID No: 55), hu-IFN-α011 (SEQ ID No: 57), hu-IFN-α012 (SEQ ID No: 59), hu-IFN-α013 (SEQ ID No: 61), hu-IFN-α014 (SEQ ID No: 63), hu-IFN-α015 (SEQ ID No: 65), hu-IFN-α016 (SEQ ID No: 67), hu-IFN-α017 (SEQ ID No: 69), hu-IFN-α018 (SEQ ID No: 71). Amino acid sequences corresponding to each of these are also provided: IFN-α001 (SEQ ID No: 38), hu-IFN-α002 (SEQ ID No: 40), hu-IFN-α003 (SEQ ID No: 42), hu-IFN-α004 (SEQ ID No: 44), hu-IFN-α005 (SEQ ID No: 46), hu-IFN-α006 (SEQ ID No: 48), hu-IFN-α007 (SEQ ID No: 50), hu-IFN-α008 (SEQ ID No: 52), hu-IFN-α009 (SEQ ID No: 54), hu-IFN-α010 (SEQ ID No: 56), hu-IFN-α011 (SEQ ID No: 58), hu-IFN-α012 (SEQ ID No: 60), hu-IFN-α013 (SEQ ID No: 62), hu-IFN-α014 (SEQ ID No: 64), hu-IFN-α015 (SEQ ID No: 66), hu-IFN-α016 (SEQ ID No: 68), hu-IFN-α017 (SEQ ID No: 70), hu-IFN-α018 (SEQ ID No: 72).

Additionally, hu-IFN-α001 and hu-IFN-α012 were back translated using optimal E. coli codons and designated hu-IFN-α001-BT (SEQ ID No: 73) and hu-IFN-α012-BT (SEQ ID No: 75). Amino acid sequences corresponding to each of these are also provided: hu-IFN-α001-BT (SEQ ID No: 74) and hu-IFN-α012-BT (SEQ ID No: 76).

Example 6 Isolation of Human IFNα Variants

During the construction of expression vectors containing the human IFNα species described in detail above, the following clones containing mutations were generated. These IFNα variants can be tested for activity. IFNα variants can contain silent substitutions, and thus have identical activity to the wild type IFNα species. Alternatively, a variant may contain a substitution that alters the activity of the polypeptide. The substitution may increase, enhance or augment the activity, and thus be an IFNα agonist. Additionally, the substitution may decrease or interfere with the activity, and thus be an IFNα antagonist.

Nucleic acid sequences for the variant species are provided: hu-IFN-α019 (SEQ ID No: 77), hu-IFN-α020 (SEQ ID No: 79), hu-IFN-α021 (SEQ ID No: 81), hu-IFN-α022 (SEQ ID No: 83), and hu-IFN-α023 (SEQ ID No: 85). Amino acid sequences corresponding to each of these are also provided: hu-IFN-α019 (SEQ ID No: 78), hu-IFN-α020 (SEQ ID No: 80), hu-IFN-α021 (SEQ ID No: 82), hu-IFN-α022 (SEQ ID No: 84), and hu-IFN-α023 (SEQ ID No: 86).

The variants provided herein are generated from the human IFNα species described in detail in Example 5. hu-IFN-α002, hu-IFN-α005, hu-IFN-α007, hu-IFN-α013, and hu-IFN-α015 gave rise to the variants hu-IFN-α019, hu-IFN-α020, hu-IFN-α021, hu-IFN-α022, and hu-IFN-α023, respectively.

Example 7 Antiviral Activity of the Human IFNα Species

The antiviral activity of the human IFNα species was also determined using the CPE assay, as outlined in detail above. The assay was performed using the following test cell and virus combinations: MDBK test cells with VSV; human epithelial squamous (HEP-2) cells with VSV; mouse connective tissue fibroblasts (L929) with EMC; human lung squamous (H226) cells with VSV; and human lung fibroblasts with influenza virus.

Example 8 Additional Activities of the Human IFNα Species

In addition to the anti-viral activity outlined in detail in Example 7, the activity of the subject Interferona species was also tested in two additional assays.

a. MHC Class I induction assay: To examine the ability of human IFNs to induce MHC class I (HLA-B7) antigen expression in human amnion epithelial cells (WISH), HeLa, or HEP-2 cells, 2.5×105 cells per well (6-well plate) are incubated with IFN for 72 hours. Subsequently, cell surface expression of the HLA-B7 antigen is detected by treatment of cells with mouse anti-HLA (W6/32) monoclonal antibodies followed by treatment with fluorescein isothiocyanate-conjugated goat anti-mouse IgG. The cells are then subjected to flow cytometry to quantitate the level of cell surface MHC class I antigen expression per 10,000 cells.

b. Antiproliferative assay: To examine the ability of human IFNs to reduce cell proliferation rate, 5 to 10×104 H226 human mesothelioma cells are seeded per well of a 96-well plate and are incubated with IFN test samples or standards at 37° C. for 3 to 7 days. Viable cells are visualized by uptake of crystal violet stain. After washing off excess stain, the intensity of remaining color is proportional to the number of viable cells in the well and is measured vs. that produced by IFN standards.

hu-IFNα-012 demonstrated robust antiproliferative activity in this assay.

All publications and patents cited herein are hereby incorporated by reference in their entirety.

Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Such equivalents are intended to be encompassed by the following claims.

TABLE 1 Antiviral Activity of Fe-IFN-alpha Species Crude Lysate SA Protein Fe-IFN AVA (u/ml) (u/mg) (mg/ml) alphaA 1.87 * 107 2.23 * 108 8.4 * 10−2 alphaB 1.87 * 107 4.45 * 108 4.2 * 10−2 alphaC  1.7 * 107 1.06 * 109 1.6 * 10−2 alphaD 1.87 * 107 2.97 * 108 6.3 * 10−2 alphaE 2.59 * 106 2.47 * 108 1.1 * 10−2 alphaF 1.87 * 107 5.94 * 108 3.2 * 10−2 alphaG 3.74 * 107 5.94 * 108 6.3 * 10−2 alphaH No Activity Not determined Not determined alphaI 6.55 * 106 6.55 * 106 1.0 * 10−2

TABLE 2 Antiviral Activity of Rhesus Monkey-IFN-alpha Species Rhesus Monkey- AVA SA Protein IFN (u/ml) (u/mg) (mg/ml) Alpha4b 4.68 * 108 2.9 * 108 1.62 AlphaD1 Not determined Not determined Not determined AlphaD2 Not determined Not determined Not determined AlphaD3 Not determined Not determined Not determined

TABLE 3 Primers used for PCR Amplification of Human Interferons Forward/ Primer Sequence Reverse Designation 5′ GCGGGCCCCAATGGCCYTGYCCTTT 3′ Forward #1154 5′ GCTCTAGAAYTCATGAAAGYGTGA 3′ Reverse #1155 5′ GCTCAGCAGCATCCRCAACATC 3′ Forward #1349 5′ CATTTCCGTGTTGTACCAGGTC 3′ Reverse #1350 5′ TCAGAAAACCTAGAGGCCG 3′ Forward #1447 5′ TGGAAGAACTCATGAAAGTGTG 3′ Reverse #1448 5′ CTCAAGTAGCCTAGCAATATTGGC 3′ Forward #1351 5′ GTATTAGTCAATACAGATCATTTCC 3′ Reverse #1352 5′ GTTACCCCTCATCAACCAGC 3′ Forward #1480 5′ GAATCATTTCCATGATGAACCA 3′ Reverse #1481 The sequence of the primers are given in the 5′ to 3′ direction. The “Y” represents a pyrimidine (T or C). The “R” represents a purine (A or G).

TABLE 4 Primer Pairs Used for Amplification of Human Interferons Interferon Forward Primer (5′) Reverse Primer (3′) IFN-alpha001 #1154 #1155 IFN-alpha002 #1447 #1448 IFN-alpha003 #1447 #1448 IFN-alpha004 #1447 #1448 IFN-alpha005 #1447 #1448 IFN-alpha006 #1447 #1448 IFN-alpha007 #1447 #1448 IFN-alpha008 #1351 #1352 IFN-alpha009 #1351 #1352 IFN-alpha010 #1447 #1448 IFN-alpha011 #1480 #1481 IFN-alpha012 #1480 #1481 IFN-alpha013 #1351 #1352 IFN-alpha014 #1351 #1352 IFN-alpha015 #1349 #1350 IFN-alpha016 #1349 #1350 IFN-alpha017 #1154 #1155 IFN-alpha018 #1351 #1352 IFN-alpha019 #1447 #1448 IFN-alpha020 #1447 #1448 IFN-alpha021 #1447 #1448 IFN-alpha022 #1351 #1352 IFN-alpha023 #1349 #1350

Claims

1-60. (canceled)

61. An isolated polypeptide comprising an amino acid sequence greater than 99% identical to a complete sequence selected from the group consisting of SEQ ID NO: 58, 60, and 76, or a biologically active fragment thereof; wherein the polypeptide or fragment is a species with enhanced antiviral and/or antiproliferative activity compared to that of a wild-type interferon-alpha-14/alpha-H polypeptide or fragment.

62. The isolated polypeptide or biologically active fragment of claim 61, wherein the percent identity is 100% identity.

63. The isolated polypeptide or biologically active fragment of claim 61, wherein proteolytic cleavage of the polypeptide generates a polypeptide comprising an amino acid sequence greater than 99% identical to SEQ ID NO: 76.

64. An isolated polypeptide or a biologically active fragment thereof, wherein the polypeptide or fragment is a species with enhanced antiviral and/or antiproliferative activity compared to that of a wild-type interferon-alpha-14/alpha-H polypeptide or fragment, which species is encoded by a nucleic acid comprising a sequence selected from the group consisting of SEQ ID NO: 57, 59 and 75.

65. An isolated polypeptide or a biologically active fragment thereof, wherein the polypeptide or fragment is a species with enhanced antiviral and/or antiproliferative activity compared to that of a wild-type interferon-alpha-14/alpha-H polypeptide or fragment, which species is encoded by a nucleic acid which hybridizes under stringent hybridization conditions to a nucleic acid comprising a sequence selected from the group consisting of SEQ ID NO: 57, 59 and 75.

66. An isolated polypeptide or a biologically active fragment thereof, wherein the polypeptide or fragment is a species with enhanced antiviral and/or antiproliferative activity compared to that of a wild-type interferon-alpha-14/alpha-H polypeptide or fragment, which species is encoded by a nucleic acid which hybridizes under stringent hybridization conditions to a nucleic acid complementary to a sequence selected from the group consisting of SEQ ID NO: 57, 59 and 75.

67. The isolated polypeptide or biologically active fragment of claim 61, wherein (i) if the sequence identity is determined by comparison to SEQ ID NO: 76, then the polypeptide comprises tyrosine at the position corresponding to position 7 of SEQ ID NO: 76; (ii) if the sequence identity is determined by comparison to SEQ ID NO: 60, then the polypeptide comprises tyrosine at the position corresponding to position 30 of SEQ ID NO: 60; and (iii) if the sequence identity is determined by comparison to SEQ ID NO: 58, then the polypeptide comprises alanine at the position corresponding to position 103 of SEQ ID NO: 58.

68. The isolated polypeptide or biologically active fragment of any one of claims 61-67, wherein the biologically active fragment comprises at least one of antiviral activity, antiproliferative activity, and MHC class I antigen expression induction activity.

69. An isolated nucleic acid encoding the polypeptide of any one of claims 61-68.

70. An expression vector comprising the nucleic acid of claim 69, and capable of replicating in at least a prokaryotic cell or a eukaryotic cell.

71. A host cell comprising the expression vector of claim 70.

72. A method of producing an interferon polypeptide with enhanced antiviral and/or antiproliferative activity compared to that of a wild-type interferon-alpha-14/alpha-H polypeptide, the method comprising culturing the cell of claim 71 in a cell culture medium to express said polypeptide, and, optionally, isolating said polypeptide from said cell culture.

73. A polypeptide produced by the method of claim 72.

74. An isolated antibody that binds specifically to the polypeptide of any one of claims 61-68.

75. A composition comprising the polypeptide of any one of claims 61-68 and a pharmaceutically acceptable excipient.

76. A method for treatment of an immune system disorder in a patient comprising administering to the patient the polypeptide of any one of claims 61-68.

77. The method of claim 76, wherein the immune system disorder is selected from the group consisting of viral infection, parasitic infection, bacterial infection, cancer, autoimmune disease, multiple sclerosis, lymphoma and allergy.

78. The method of claim 76, wherein the patient is a human or non-human animal.

79. The method of claim 77, wherein the patient is a human or non-human animal.

Patent History
Publication number: 20100221222
Type: Application
Filed: Dec 23, 2009
Publication Date: Sep 2, 2010
Applicant: Pestka Biomedical Laboratories (Piscataway, NJ)
Inventor: Sidney Pestka (North Caldwell, NJ)
Application Number: 12/646,448