Method for changing nitrogen utilization efficiency in plants
The present invention provides a method for changing nitrogen utilization efficiency in a plant comprises regulating the expression of Arabidopsis NRT 1.7 or an orthologue thereof so that the nitrate remobilization from older leaves to young leaves in the plant is regulated, thereby the nitrogen utilization efficiency is changed. The present invention also provides a transgenic plant obtainable by transforming a plant with an expression construct with a high or low level of expression of NRT 1.7. On the other hand, the present invention yet provides a chimera nitrate transporter, a DNA molecule coding for this chimera transporter and an expression vector thereof.
Latest Academia Sinica Patents:
This application claims benefit of U.S. Provisional Application 61/223,744, filed on Jul. 8, 2009, which is incorporated by reference in its entirety herein.
SUBMISSION OF SEQUENCE LISTINGThe Sequence Listing associated with this application is filed in electronic format via EFS-Web and hereby incorporated by reference into the specification in its entirety. The name of the text file containing the Sequence Listing is Sequence_List—16024—00012_US_ST25.txt. The size of the text file is 39 KB, and the text file was created on Jul. 8, 2010.
FIELD OF THE INVENTIONThe present invention is related to a method for changing nitrogen utilization efficiency in a plant by regulating expression of a nitrate transporter.
BACKGROUND OF THE INVENTIONNitrogen fertilizer is one of the most expensive nutrients to supply. 50-70% of the applied nitrogen is lost from the plant-soil system and causes water pollution (Peoples, 1995, in: P. E. Bacon, Editor, Nitrogen Fertilizer in the Environment, Marcel Dekker, 565-606). Improving nitrogen utilization efficiency (“NUE”) is important to reduce the cost of crop production as well as environmental damage. Nitrogen remobilization is one of the key steps to improve NUE (Mickelson et al., 2003, J Exp Bot 54, 801-812; Masclaux-Daubresse et al., 2008, Plant Biol (Stuttg) 10 Suppl 1, 23-36).
When plants encounter nutrient deficiency, nitrogen can be recycled from older to younger leaves to sustain the growth of developing tissues. Nitrate remobilization occurs not only from leaf to leaf during the vegetative stage, but also from leaf to seeds during the reproductive stage. High nutrient demand during reproductive stage cannot be satisfied by Nitrogen uptake, and nitrogen recycled from senescent tissue plays an important role in sustaining grain production. Although several studies showed that nitrate remobilization was important to increase grain yield and withstand nitrogen deprivation, little was known about nitrate remobilization. Thus, it is important to find out how the stored nitrate is retrieved to withstand nitrogen deficiency and to sustain high nitrogen demand in the reproductive stage, thereby to regulate the growth of nitrogen use efficiency in a plant.
BRIEF SUMMARY OF THE INVENTIONAccordingly, the invention relates to a discovery of Arabidopsis nitrate transporter NRT1.7 that is expressed in phloem, and is responsible for source-to-sink remobilization of nitrate. It is unexpectedly found in the present invention that the expression and activity of NRT1.7 involves nitrate remobilization from older leaves to young leaves in the plant so as to regulate plant growth.
In one aspect, the present invention provides a method for changing nitrogen utilization efficiency in a plant comprising regulating the expression of Arabidopsis NRT1.7 or an orthologue thereof, so that the nitrogen remobilization from older leaves to young leaves in the plant is regulated, and thereby the nitrogen utilization efficiency is changed. According to an embodiment of the invention, a transgenic plant is prepared by transforming a plant with a construct for a high or low level of expression of NRT1.7. In one example of the invention, a transgenic plant having an enhanced plant growth is prepared by transforming a plant with an expression construct comprising a DNA sequence encoding Arabidopsis NRT1.7 or an orthologue thereof in a high level of expression, thereby the transgenic plant has an improved nitrate remobilization from older leaves to young leaves in the plant and nitrogen utilization efficiency. In another example of the invention, the transgenic plant having a retarded plant growth is prepared by transforming a plant with a construct for inhibiting the expression of NRT1.7 gene or orthologue thereof, whereby the transgenic plant has decreased nitrogen utilization efficiency.
In another aspect, the present invention provides a new chimera nitrate transporter of a NRT1.1 and NRT1.2, providing a high nitrate transport efficiency, wherein the chimera nitrate transporter has the amino acid sequence of SEQ ID NO: 11. In one embodiment of the invention, a transgenic plant having enhanced nitrogen utilization efficiency by transforming a plant with the chimera nitrate transporter, whereby the transgenic plant has an enhanced growth.
According to the present invention, the nitrogen utilization efficiency in a plant is enhanced by overexpression of NRT1.7 or an enhanced expression of the NRT 1.7, whereby the nitrate remobilization from older leaves to young leaves in the plant is enhanced, and then the plant growth is improved.
The invention also provides an isolated DNA molecule encoding a chimera nitrate transporter having a amino acid sequence of SEQ ID NO:11, which was evidenced in Example 9 to provide high nitrate uptake so that it is believed that the nitrogen utilization efficiency can be enhanced. In one example of the invention, the nucleotide sequence encoding NRT 1.7 has a nucleotide sequence of SEQ ID NO: 10.
In a further yet aspect, the present invention provides a transgenic plant, which is transformed with an expression construct causing overexpression of NRT1.7 or enhancement of NRT1.7 function within the transgenic plant, whereby the transgenic plant enhances the nitrate remobilization from older leaves to young leaves in the plant, and the nitrogen utilization efficiency is improved. On the other hand, the present invention also provide a transgenic plant, which is transformed with an construct that has a defect in the gene of NRT1.7, wherein the defect results in inhibiting the expression of NRT1.7 or NRT1.7 mRNA to decrease quantity or availability of functional NRT1.7, whereby the nitrogen remobilization from older leaves to younger leaves in the transgenic plant is defective.
The foregoing summary, as well as the following detailed description of the invention, will be better understood when read in conjunction with the appended drawings. It should be understood, however, that the invention is not limited to the precise arrangements and instrumentalities shown.
In the drawings:
In the present invention, it is unexpectedly found that the Arabidopsis thaliana nitrate transporter NRT1.7 provides new insights into nitrate remobilization. Accordingly, the present invention provides a method for changing nitrogen utilization efficiency in a plant comprising regulating the expression of Arabidopsis NRT1.7 or an orthologue thereof, so that the nitrogen remobilization from older leaves to young leaves in the plant is regulated, and thereby the nitrogen utilization efficiency is changed.
The term “Arabidopsis NRT1.7” or “NRT1.7” as used herein refers to Arabidopsis nitrate transporter NRT1.7, having the amino acid sequence of SEQ ID NO:2, or a protein encoded by a nucleic acid sequence of SEQ ID NO:1.
The term “orthologue” used herein refers to one of two or more homologous gene sequences found in different species. In the invention, the orthologue of Arabidopsis thaliana nitrate transporter NRT1.7 includes but not limited to any transporter having an amino acid sequence that is at least 40% homologous to the consensus amino acid sequence of NRT1.7 (such as the transporter having the amino acid sequence of SEQ ID NO: 2), preferably at least 60%, most preferably 80% homologous to the consensus amino acid sequence of NRT1.7, such as those shown in
According to an embodiment of the invention, a transgenic plant is prepared by transforming a plant with an expression construct for a high or low level of expression of NRT1.7. In one example of the invention, a transgenic plant having an enhanced plant growth is prepared by transforming a plant with an expression construct comprising a DNA sequence encoding Arabidopsis NRT1.7 or an orthologue thereof in a high level of expression, thereby the transgenic plant has an improved nitrate remobilization and nitrogen utilization efficiency. In another example of the invention, the transgenic plant having a retarded plant growth is prepared by transforming a plant with an expression construct comprising null mutation of the NRT1.7 gene, whereby the transgenic plant has a decreased nitrogen utilization efficiency.
Based on the several quantitative trait locus analyses as obtained, the grain yield and nitrogen utilization efficiency were well correlated with nitrate storage capacity and efficient remobilization. Western blotting, quantitative RT-PCR, and □-glucuronidase reporter analysis as obtained in the present invention indicated that NRT1.7 was expressed in the phloem of the leaf. In nrt1.7 mutants, more nitrate was present in the older leaves, less 15NO3— spotted on old leaves was remobilized into N-demanding tissues, and less nitrate was detected in the phloem exudates of old leaves. Meanwhile, nrt1.7 mutants also showed growth retardation when external nitrogen was depleted. It is concluded that nitrate remobilization is important to sustain vigorous growth during nitrogen deficiency, and the nitrogen utilization efficiency can be changed by regulating the expression of NRT1.7 in a plant.
According to the present invention, a method of enhancing nitrogen utilization efficiency in a plant comprises overexpressing NRT1.7 or enhancing NRT1.7 function in a plant, wherein the nitrogen remobilization from older leaves to young leaves in the plant is enhanced, thereby the nitrogen utilization efficiency is improved.
In the invention, NRT1.7 gene expression is regulated to produce more NRT1.7 protein than ordinary conditions in the corresponding wild type plants. Methods for overexpression of a protein in vivo are well known in the art. Thus the invention also encompasses all possible methodology for overexpression NRT1.7 gene or modulating activity of NRT1.7 protein in a plant, including regulation of transcription and post-translation regulation. For example, the modulating of gene expression may be used, i.e. by modulating the expression of the gene itself by a suitable promoter and/or a transcription enhancer or a translation enhancer. Alternatively, the modulation of expression as mentioned above is effected in an indirect way, for example as a result of increased levels and/or activity of factors that control the expression of NRT1.7 gene. In one example of the invention, the enhancer may be used to enhance transcription levels of genes in a gene cluster.
According to the invention, any enhancer for enhancing the expression of NRT1.7 may be used to prepare an expression construct for transforming a plant to produce a transgenic plant. For example, CaMV 35S enhancers (Weigel et al., Plant Physiol. 122(4):1003-1013. 2000, April) may be used for enhancing the expression of NRT1.7. In one example of the present invention, 35S enhancer (SEQ ID NO:4) can be modified to link with NRT1.7 promoter (SEQ ID NO:3) or inserted into downstream of NRT1.7 coding region alone. In one embodiment of the invention, 35S enhancer is operatedly linked with NRT1.7 promoter to produce an artificial nucleic acid sequence of SEQ ID NO: 5. One can prepare an expression construct comprising the chimera DNA sequence of SEQ ID NO: 5, inserted to an expression construct to overexpress NRT1.7.
According to the invention, if a transgenic plant has the overexpression of NRT1.7 or enhancing the activity of NRT1.7, the nitrogen remobilization from older leaves to younger leaves in the transgenic plant will be enhanced; and accordingly it is believed that the transgenic plant has faster growth and higher yield. Therefore, the present invention provides a transgenic plant transformed with an expression construct comprising a nucleic acid sequence causing a high level of expression, such as overexpression, of NRT1.7 or enhancement of NRT1.7 function within the transgenic plant, wherein expression of the DNA molecule in the transgenic plant enhances the nitrogen remobilization from older leaves to young leaves in the plant, thereby the nitrogen utilization efficiency is improved.
The phrase/clause “faster growth” or “the growth is enhanced” used herein refers to the increase either in weight or size, for example fresh weight, or in biomass per time unit is greater that that of the plant of same species.
The term “yield” used herein refers to the amount of harvested material per area of production. The term “higher yield” means an increase in biomass in one or more parts of a plant relative to that of corresponding wild type plants. The harvested parts of the plant can be such as seed (e.g. rice, sorghum or corn), root (e.g. sugar beet), fruit (e.g. apple), flowers, or any other part of the plant, which is of economic value.
Transformation of a plant species is now fairly routine technique. Advantageously, any of several transformation methods may be used to introduce the gene of interest into a suitable ancestor cell. Transformation methods include, but not limited to, the use of liposomes, electroporation, chemicals that increase free DNA uptake, injection of the DNA directly into the plant, particle gun bombardment, viruses or pollen and microinjection. In one embodiment of the present invention, plant transformation was performed as described in Clough et al, 1998, Plant J 16, 735-743.
It is found in the present invention that NRT1.7 involves in nitrate remobilization from the old leaves to young leaves in a plant. In one example of the present invention, a mutant of nrt1.7 defective in this process was prepared to retard the plant growth when the plants encountered long-term severe nitrogen deficiency during vegetative growth. It was indicated that internal nitrate remobilization between leaves was important for plants to cope with nitrogen deficiency and the importance of enhanced nitrogen use efficiency for maximum growth. The present invention further provides a method for retarding growth in a plant comprising decreasing quantity or activity of NRT1.7, or inhibiting the expression of a gene encoding NRT1.7 within the plant, thereby causes the defect in remobilizing nitrogen from older leaves to younger leaves so as to retard growth in the plant.
Techniques for decreasing quantity or activity of a protein, or inhibiting the expression of a gene in vivo are also well known and envisaged in the art, whether by a direct or indirect approach. Examples of decreasing expression includes, but not limited, by anti-sense techniques, co-suppression techniques, RNAi techniques, small interference RNAs (siRNAs), micor RNA (miRNA), the use of ribozymes, etc. According to one embodiment of the present invention, the growth of a plant was modified by introducing into a plant an additional copy (in full or in part) of a NRT1.7 gene fragment already present in a host plant. The additional gene silences the endogenous gene, giving rise to a phenomenon known as co-suppression. In another embodiment of the present invention, gene silencing may also be achieved by insertion mutagenesis, e.g., T-DNA insertion or transposon insertion, or by gene silencing strategies as described in published prior arts.
The present invention also provides a transgenic plant obtainable by the methods for decreasing quantity or activity of a protein, or inhibiting the expression of a gene in vivo above. In one example of the invention, the transgenic plant had defects in the gene of NRT1.7, wherein the defects in the gene resulted in inhibiting the expression of NRT1.7 mRNA or proteins to decrease quantity or availability of functional NRT1.7, thereby the nitrogen remobilization from older leaves to younger leaves in the transgenic plant is defective. According to the invention, such transgenic plant performs growth retardation during nitrogen starvation.
The present invention provides a new chimera nitrate transporter having the amino acid sequence of SEQ ID NO: 11, and the DNA molecule having the sequence coding for this chimera protein. In one example of the invention, an isolated DNA molecule encoding a chimera nitrate transporter named as NC4N is provided, which comprises the nucleotide sequence of SEQ ID NO:10, coding for the chimera nitrate transporter having the amino acid sequence of SEQ ID NO: 11. According to the invention, the chimera protein is prepared from NRT1.1 and NRT1.2 with NRT1.2-NRT1.1-NRT1.2 shuffling form, in which at the residues of 76-195 positions of NRT1.2 amino acid sequences (SEQ ID NO: 9) was replaced by at the residues of 78-200 positions of NRT1.1 amino acid sequences (SEQ ID NO: 7).
Arabidopsis NRT1.1 and NRT1.2 participate in nitrate uptake using a proton gradient as a driving force to transport nitrate from the soil into plant cells. Unexpectedly, the inventors found that the chimera protein performed better activity on nitrate uptake than wild type NRT1.1 and NRT1.2. In one embodiment of the invention, functional Analysis of the chimera protein was determined by Xenopus laevis oocytes test as described in the Example 9. As evidenced in
Furthermore, the present invention provides a method enhancing nitrogen utilization efficiency in a plant comprising transforming a plant with the DNA molecule encoding the claimed chimera transporter having the amino acid sequence of SEQ ID NO: 11 to produce a transgenic plant, wherein the nitrogen utilization efficiency is enhanced in the transgenic plant, and subsequently, the transgenic plant has faster growth and higher yield. Preferably, the DNA molecule encoding the claimed chimera transporter is driven by a NRT1.7 promoter in the transgenic plant.
The present invention is further illustrated by the following examples, which are provided for the purpose of demonstration rather than limitation.
EXAMPLES Methods and MaterialsFunctional Analysis of NRT1.7 in Xenopus laevis Oocytes
A full length cDNA fragment of NRT1.7 (SEQ ID NO:1) was cloned into the pGEMHE vector (Liman et al., 1992, Neuron 9, 861-871) to generate pGEMHE-NRT1.7. The pGEMHE-NRT1.7 was linearized using NheI, and capped mRNA was transcribed in vitro using mMESSAGE mMACHINE kits (Ambion). Oocytes were injected with 100 ng of NRT1.7 cRNA as described previously (Tsay et al., 1993, Cell 72, 705-713). Electrophysiological analyses of injected oocytes were performed as described previously (Huang et al., 1999, Plant Cell 11, 1381-1392). Nitrate uptake assays using 15N-nitrate were performed as described previously using a continuous-flow isotope ratio mass spectrometer coupled with a carbon nitrogen elemental analyzer (ANCA-GSL MS; PDZ Europa; (Lin et al., 2008, Plant Cell 20, 2514-2528)), and oocytes injected with CRL1 cRNA (Liu et al., 1999, Plant Cell 11, 865-874) were used as a positive control.
Plant Growth Condition and nrt1.7 Mutants
Unless otherwise indicated, most Arabidopsis thaliana plants used in this study were grown in soil containing compost:humus at 3:1, at 22° C., with 16-hr photoperiod, and 60% relative humidity, and irrigated with HYPONeX #2 fertilizer at final concentrations of 6 mM nitrate, 5.3 mM potassium, and 3.5 mM phosphate. For nitrogen starvation experiments, plants were grown in soil containing perlite:vermiculite at 1:2 and covered with a thin layer of fine vermiculite, irrigated with HYPONeX #2 fertilizer for 10 or 25 days as indicated in the figure legends, and then watered with a nitrogen-depleted solution containing 5 mM K2HPO4/KH2PO4, pH 5.5, and the basal nutrients (1 mM MgSO4, 0.1 mM FeSO4-EDTA, 0.5 mM CaCl2, 50 μM H3BO3, 12 μM MnSO4, 1 μM ZnCl2, 1 μM CuSO4.5H2O, and 0.2 μM Na2MoO4.2H2O). For phloem exudates collection and measurement of NRT1.7 expression in response to starvation, plants were grown hydroponically in a solution containing 1 mM K2HPO4/KH2PO4 at pH 5.5, the basal nutrients described above and with or without 1 mM NH4NO3. All experiments compared wild-type and mutant plants grown in the same pot.
The nrt1.7-1 was obtained from the ALPHA population (WS ecotype) of T-DNA-tagged plants generated by the Arabidopsis Knockout Facility at the University of Wisconsin Biotech Center (Krysan et al., 1999, Plant Cell 11, 2283-2290). The primers used for PCR screening were JL202 (Lin et al., 2008, Plant Cell 20, 2514-2528) and the NRT1.7 forward primer (SEQ ID NO:12: 5′-CCACACCCACCATATATTATCTACTCACT-3′). The second mutant nrt1.7-2 (SALK—053264) was provided by the Salk Institute Genomic Analysis Laboratory (Alonso et al., 2003, Science 301, 653-657).
Antibody and Western Blot
The anti-NRT1.7 rabbit polyclonal antibody was generated using a peptide corresponding to the first N-terminal 50 amino acids. The cDNA fragment encoding the N-terminal 1-50 a.a. was amplified by PCR using primers pair of (SEQ ID NO:13: forward 5′-gaattctaATGGTTTTGGAGGATAG-3′ and SEQ ID NO:14: reverse 5′-aaGCTTTTTCTCTACCTTCTCAG-3′), which introduced EcoRI and HindIII restriction sites respectively, and subcloned into pGEX-KG in frame with the GST to generate pGEX-KG-NRT1.7-N50. GST-fusion protein was isolated from E. coli (BL21) transformant and purified by GST-beads. Purified GST-fusion protein was emulsified with Freund's adjuvant and injected into New Zealand rabbits according to the protocol of Spindler et al. (Spindler et al., 1984, J Virol 49, 132-141).
For protein gel blot analysis, tissues were homogenized in ice cold extraction buffer consisting of 15 mM Tris-HCl, pH 7.8, 250 mM sucrose, 1 mM EDTA, 2 mM DTT, 1 mM phenylmethylsulfonyl fluoride, 0.6% polyvinylpyrrolidone, and protease inhibitor cocktail (Roche). The homogenate was then centrifuged at 10,000×g for 10 min and the supernatant was collected into a chilled tube. The supernatant was centrifuged at 100,000×g for 1 h, and then the pellet, the microsomal fraction, was dissolved in 4% SDS. 10 micrograms of protein were analyzed by SDS-PAGE. Detections were performed using the ECL protein gel blotting system (Amersham, GE Healthcare, UK). Anti-NRT1.7, Anti-BiP and horseradish peroxidase-labeled anti-rabbit IgG antibody were used at dilutions of 1:2000, 1:2000 and 1:10000, respectively.
RT-PCR and Quantitative RT-PCR
The ImProm-II reverse transcriptase (Promega), oligo(dT) primers, and the RNA isolated from different developmental stages of leaves and flowers were used to synthesize the first-strand cDNAs. Primers across the intron of Histone were used to exclude genomic contamination. Primers specific for the NRT1.7, NIA2 and UBQ10 gene were designed by ABI software. Quantitative PCR was performed in AB7500 using Power SYBR Green (ABI System). The primers used were as follows:
Promoter-GUS Analysis
A 1.35-kb genomic fragment of NRT1.7 promoter (−1346 to +3 bp) was generated by PCR using the primers forward 5′-gtcgaCAAATATTTTCCTATAACATA-3′ (SEQ ID NO: 23:) and reverse 5′-ggatcctCATCTCTAAGATATTACT-3′ (SEQ ID NO: 24), cut with XbaI and BamHI, and then inserted in-frame in front of uidA (GUS) of pBI101. Plant transformation was performed as described (Clough et al, 1998, Plant J 16, 735-743). Homozygous transgenic plants (T3) 28-32 days old cultivated in soil with full nutrient were used for GUS histochemical assay, with GUS staining as described previously (Lagarde et al., 1996, The Plant Journal 9, 195-203). Cross-sections of 2 μm thickness were prepared using a microtome (Ultracut E, Reichert-Jung) from tissues embedded in LR white.
Whole-Mount Immunolocalization
To enhance the specificity, anti-NRT1.7 antiserum was affinity purified first by the antigen used to raise antiserum (a GST fusion of the first 50 amino acids of NRT1.7) and then by HA-tagged full-length NRT1.7 protein. Older (40 d old) Col and nrt1.7-2 leaves were used for whole mount immunohybridization. For antigen retrieval before hybridization, tissues were incubated in 1 mM EDTA at 95° for 5 min and then blocked for 2 hours in blocking buffer (50 mM Tris-HCL, pH 7.5, 150 mM NaCl, and 1% gelatin). After 36 hours incubation with affinity-purified anti-NRT1.7 antiserum in 1:10 dilution at 4°, tissues were washed three times with blocking buffer and then hybridized with Alexa Fluor 488 goat anti-rabbit IgG (Molecular Probes) in 1:500 dilution. Green fluorescence was detected by a Zeiss LSM META-510 microscope with excitation at 488 nm. Fluorescence emission signals were detected using a band-pass filter of 505 to 530 nm Sieve plates were stained with 0.2% aniline blue (Water Blue; Fluka) in 50 mM Na—PO4 buffer for 30 min. Aniline blue fluorescence was detected with an excitation light of 405 nm and band-pass filter of 420 to 480 nm.
GFP Fusion and Subcellular Localization
To construct the plasmid encoding NRT1.7-GFP fusion protein, NRT1.7 cDNA was amplified by PCR using the primers NRT1.7NF (SEQ ID NO:25: 5′-tctagATGGTTTTGGAGGATAGA-3′) and NRT1.7NR (SEQ ID NO:26: 5′-ggatccCATTTCATCGATTTCTT-3′); the former primer introduces a XbaI restriction site and the latter removes the stop codon and introduces a BamHI restriction site. The amplified DNA fragment was then cloned in frame in front of the GFP coding region in the vector 326-GFP, leading to the final pNRT1.7-GFP construct under the control of the 35S promoter. The fusion linker between NRT1.7 and GFP contained seven amino acids (YIQGDIT). To construct the plasmid encoding pGFP-NRT1.7 fusion protein, the NRT1.7 cDNA was amplified by PCR with primers NRT1.7CF (SEQ ID NO:27: 5′-ctcgagATGGTTTTGGAGGATAGA-3′ and NRT1.7CR (SEQ ID NO:28: 5′-ctcgagTCATTTCATCGATTTCTT-3′) which introduced XhoI restriction sites, then cloned in frame into vector 326-GFP-nt (no termination codon) behind the GFP. The fusion linker between GFP and NRT1.7 contained thirteen amino acids (PRAIKLIDTVDLE). The vector 326-GFP was used as a free GFP control.
Transient transformation of Arabidopsis protoplasts with polyethylene glycol was performed as described (Yoo et al., 2007, Nat Protoc 2, 1565-1572). After transformation, protoplasts were incubated overnight at room temperature under illumination (25 μE), and then observed by a Zeiss LSM510 microscope with excitation at 488 nm Fluorescence emission signals were detected using a band-pass filter of 500 to 530 nm for GFP and a long-pass filter of 650 nm for the far-red autoflourescence of the chloroplast.
Measurement of the Nitrate Content in Arabidopsis Leaves
The rosette leaves were collected and immediately frozen in liquid nitrogen. To extract nitrate, samples were boiled in water (100 μl/mg FW) and then freeze-thawed once. After filtering through 0.2 μm PVDF membrane (Pall Corporation), nitrate content of the samples was determined by HPLC using a PARTISIL 10 SAX (strong anion exchanger) column (Whatman) and 50 mM phosphate buffer, pH 3.0, as the mobile phase.
15NNitrate Tracing Assay
Three days after bolting, 10 μl of 50 mM K15NO3 with a 98% atom excess of 15N was spotted on distal parts of the oldest leaf. About 20 hr after spotting, individual leaves and flowers were collected and dried at 80° C. for 24 hr., at which point 15N contents were analyzed as described above.
Collection and Analysis of Phloem Exudates
Three days after bolting, phloem exudates were collected from excised leaves using procedures modified from the protocol described by Deeken et al. (Deeken et al., 2008, Plant J 55, 746-759). The third and fourth leaves were cut and the tip of the petiole was re-cut in EDTA buffer (5 mM Na2EDTA, pH 7.5, osmotically adjusted to 270 mOsmol with sorbitol) with fresh razor blades without wounding. The leaves were washed with a large volume of sterile EDTA buffer to remove contaminants and then placed in 200 μl new EDTA buffer. During phloem sap exudation, the leaves were illuminated (25 μE) and incubated in CO2— and H2O-saturated air. After 1 h of bleeding, the buffer solution containing phloem exudates were analyzed for nitrate and sugar content. Nitrate contents were measured by HPLC as described above. Sucrose and glucose content were measured by the DNS method as described elsewhere (Bernfeld, 1995, Methods Enzymol. 1, 149-158).
Construction of Chimera NRT Protein by Fusing NRT1.1 and NRT1.1
pGEMHE-05N was made by replacing 1-701 nucleotides of AtNRT1.2 (SEQ ID NO: 8) with AtNRT1.1 (SEQ ID NO:6). The shuffling region was generated by PCR using pGEMHE-AtNRT1.1 as template and T7 (AATACGACTCACTATAG) (SEQ ID NO: 29) and primer1 (GGCTACTAGTGCGCCAACGTTGATACAA) (SEQ ID NO: 30) as primer set and digestion by BamHI and SpeI.
pGEMHE-NC4N was made by replacing 1-231 nucleotides of pGEMHE-CSN with AtNRT1.2. The N-terminal region of pGEMHE-NC4N was generated by 1st PCR, using pGEMHE-AtNRT1.2 as the template and primer2 (CCCGGATCCGAATGGAAGTGGAAGAAG) (SEQ ID NO: 31) and primer3 (AGAAGTTCCGAGGAAATTGGTGACGTCATTTGCCGA) (SEQ ID NO: 32) as the primer set. The C-terminal region of pGEMHE-NC4N was made by 2nd PCR with pGEMHE-05N as template, and primer4 (TCGGCAAATGACGTC ACCAATTTCCTCGGAACTTCT) (SEQ ID NO: 33) and primer 5 (CCCGAATTCTTTAGCTTCTTGAACCAG) (SEQ ID NO: 34) as the primer set. The 3rd PCR of pGEMHE-NC4N construction was done by using the product of 1st and 2nd PCR products as the template and primer2 and primer 5 as the primer set. The chimeric fragment (SEQ ID NO: 10) was digested by BamHI and EcoRI and then ligated into pGEMHE vector to obtain pGEMHE-NC4N.
In order to make the pGEMHE constructs with HA tag, the AtNRT1.1-HA fragment was done by PCR with pGEMHE-AtNRT1.1 as the template, primer6 (CCCGGATCCAAAACAGCCTTTTACATA) (SEQ ID NO: 35) and primer 7 (CCCGAATTCTCAAGCGTAATCTGGAACATCGTATGGGTACCCCCCATGACCCA TTGGAATACTCG) (SEQ ID NO: 36) as primer set; NC4N-HA was done by PCR with pGEMHE-NC4N as the template primer2 and primer8 (CCCGAATTCTTAAGCGTAATCTGGAACATCGTATGGGTACCCCCCGCTTCTTG AACCAGTTGATC) (SEQ ID NO: 37) as the primer set. The fragments with HA tag were digested by BamHI and EcoRI and then ligated into pGEMHE vector.
The final NC4N chimera protein has 588 amino acids represented by SEQ ID NO:11 with NRT1.2-NRT1.1-NRT1.2 shuffling form, in which at the residues of 76-195 positions of NRT1.2 amino acid sequences (SEQ ID NO: 9) was replaced by at the residues of 78-200 positions of NRT1.1 amino acid sequences (SEQ ID NO: 7).
Accession Numbers
Sequence data enclosed herein can be found in the GeneBank/EMBL data libraries under the following accession numbers: At1g69870 (NRT1.7), At1g12110 (CHL1, NRT1.1), At1g69850 (NRT1.2), At3g21670 (NTP3, NRT1.3), At2g26690 (NTP2, NRT1.4), At1g32450 (NRT1.5), At1g27080 (NRT1.6), At1g08090 (NRT2.1), At1g08100 (NRT2.2), At1g12940 (NRT2.7), At3g45650 (NAXT1), At3g54140 (PTR1), At2g02040 (PTR2), At5g46050 (PTR3), At5g40890 (CLCa), At5g40780 (LHT1), At4g05320 (UBQ10), At1g22710 (SUC2), At4g22200 (AKT2), At4g40040 (Histone), and At5g42020 (BiP).
Example 1 NRT1.7 Encodes a Low Affinity Nitrate TransporterIn Arabidopsis, there are 53 NRT1 (PTR) genes, some of which are known to transport nitrate, while others transport dipeptides. To determine the substrate specificity of NRT1.7, in vitro-synthesized cRNA was injected into Xenopus oocytes for electrophysiological analysis. After 2-day incubation in ND96, oocytes were voltage clamped at −60 mV, and then subjected to 300 ms voltage pulses from 0˜160 mV in −20 mV increments. NRT1.7-injected oocytes responded to 10 mM nitrate at pH 5.5 with inward currents. And the inward currents were elicited by nitrate but not by the dipeptides tested (
Most of the nitrate transporters in NRT1 (PTR1) family function as a low-affinity transporter with exception of NRT1.1 (CHL1), which is a dual-affinity nitrate transporter. To determine the affinity of NRT1.7, the high- and low-affinity nitrate transport activities of cRNA-injected oocytes were assessed by incubating the oocytes with 10 mM 15N-nitrate for 2 hours or 250 μmM 15N-nitrate for 1 hour, respectively. Consistent with the previous data, CHL1 cRNA-injected oocytes showed both high- and low-affinity nitrate transport, while NRT1.7 cRNA-injected oocytes were found to take up nitrate only with low affinity (
Microarray data from the public resource A. thaliana Expression Database CSB.DB shows that little or no expression of NRT1.7 can be detected in root, and that transcription levels in leaves increased as leaves age (
To determine where NRT1.7 is expressed, 13 independent transgenic lines expressing GUS driven by NRT1.7 promoter were analyzed. Consistent with Western Blot result, GUS staining was stronger in the older leaves, while no staining was detected in the younger leaves. In between, there were a few transition leaves with GUS staining extending from the tip to the base of the leaves (indicated by arrows in
Closer examination of the GUS staining indicated that NRT1.7 was mainly expressed in minor veins (
To investigate the subcellular localization of NRT1.7, green fluorescent protein (GFP) fused either N-terminally or C-terminally to NRT 1.7 was transiently expressed in Arabidopsis protoplasts under the control of the cauliflower mosaic virus 35S promoter. Green fluorescence was seen in cytoplasm in the GFP control, while the green fluorescence of NRT1.7-GFP and GFP-NRT1.7 (
Shoot of plants grown under 12/12 day/night cycle for 20 days were collected to determine the diurnal changes in the expression of NRT1.7 and nitrate reductase gene NIA2. Q-PCR analysis indicated that the NRT1.7 transcript level increased gradually during the light period, reached a maximum in the early part of the dark period, and declined thereafter (
To determine the in vivo function of nrt1.7, two T-DNA insertion mutants were isolated. Mutant nrt1.7-1 in the Wassilewskija (WS) ecotype was isolated by PCR-based screening (Krysan et al., 1999, Plant Cell 11, 2283-2290), and a second mutant nrt1.7-2, SALK 053264, in the Columbia (Col) ecotype was obtained from ABRC (Alonso et al., 2003, Science 301, 653-657). In nrt1.7-1 and nrt1.7-2 mutants, one copy and three contiguous copies of T-DNA, respectively, were inserted in the second intron of NRT1.7 gene (
The nitrate content in each leaf was analyzed in wild type and mutants. Compared to the wild type, higher amounts of nitrate accumulated in old leaves of the mutants (
That NRT1.7 functions in nitrate remobilization was further confirmed by a 15N-nitrate spotting experiment. 15N-nitrate was spotted on distal parts of the oldest non-senescent leaf, and 20 hours after spotting, 15N contents of different leaves and organs were analyzed. In the wild type, 15N-nitrate spotted on the old leaf moved to young leaves; in the mutants, little or no 15N could be found in the young leaves (
Since NRT1.7 is expressed in the phloem of old leaves, the amount of nitrate in the phloem sap was compared between wild type and mutants. In a slight modification of an older protocol (Deeken et al., 2008, Plant J 55, 746-759), the third and fourth leaves were cut, recut in EDTA buffer, washed and then placed into tubes with 200 μl EDTA buffer. After phloem bleeding for 1 h, the buffer solution, which contained diluted phloem sap, was used for composition analyses. The glucose content in the phloem exudates was lower than the detection limit (50 nmole/g fresh weight [FW]), suggesting that the concentration of damaged cell extract in the exudates was low. Nitrate contents in the exudates were 159.9±9.7 n mole/g FW in WS, 96.8±7.4 in nrt1.7-1; 193.2±11.5 in Col, and 123.9±5.0 in nrt1.7-2 (
Under nutrient-sufficient conditions, no growth difference was seen between mutants and wild type. However, when plants were starved of nitrogen at an early stage (10 days after germination), compared to wild type, both nrt1.7 mutants showed growth retardation (
According to the studies of Example 8, nrt1.7 gene mutation can result in the growth retardation of the transgenic plant. From this fact, it reasonably deduces that overexpression of NRT1.7 in a plant might enhance nitrate remobilization thereby the growth of the plant is enhanced and resistant to nitrogen starvation.
To this aim, i.e., the expression of NRT1.7 can be put under the control of its own promoter operatedly linked with 35S enhancer (see Weigel et al., Plant Physiol. 122(4):1003-1013. 2000, April). Plant transformation was performed as described (Clough et al, 1998, Plant J 16, 735-743). Briefly, NRT1.7 promoter was eluted from NRT1.7 promoter-GUS by digesting with BamHI and XbaI as described above. NRT1.7 cDNA was generated by PCR using pGEMHE-AtNRT1.7 as the template and the primers forward 5′-ATCAAGCTTGCTCTAGAG-3′ (SEQ ID NO: 38) and reverse 5′-GGGATCCAGATGGTTTTGGA-3′ (SEQ ID NO: 39). The PCR product was cut with XbaI and BamHI. The XbaI ligated fragment containing NRT1.7::NRT1.7 was inserted into a mini-binary vector pCB302 for transform into Arabidopsis Col wild type and nrt1.7-2. Another binry vector, pSKI015, with 4×35S enhancer (SEQ ID NO: 4) was digested with SpeI and ligated with the XbaI fragment containing NRT1.7::NRT1.7 to obtain an expression vector. A transgenic plant overexpression of NRT1.7 shall be obtainable by transforming this expression vector in which.
Example 9 AtNRT1.1 and AtNRT1.2 Fused Protein (NC4N) Exhibiting Greater Transport ActivityTo determine the transport activity of the fused protein (NC4N) in vivo, a full length cDNA fragment encoding AtNRT1.1 and AtNRT1.2 fused protein was cloned into the pGEMHE vector to generate pGEMHE-NC4N. The pGEMHE-NC4N was linearized using NheI, and capped mRNA was transcribed in vitro using mMESSAGE mMACHINE kits (Ambion). Oocytes were injected with 50 ng of NC4N cRNA as described previously. Nitrate uptake assays using 10 mM 15N-nitrate were performed as described previously using a continuous-flow isotope ratio mass spectrometer coupled with a carbon nitrogen elemental analyzer, and oocytes injected with NRT1.1 cRNA or water (H2O) were used as a positive or negative control, respectively. The result was shown in the
As shown in
It will be appreciated by those skilled in the art that changes could be made to the embodiments described above without departing from the broad inventive concept thereof. It is understood, therefore, that this invention is not limited to the particular embodiments disclosed, but it is intended to cover modifications within the spirit and scope of the present invention as defined by the appended claims.
Claims
1. A method for changing nitrogen utilization efficiency in a plant comprises regulating the expression of Arabidopsis NRT1.7 or an orthologue thereof so that the nitrate remobilization from older leaves to young leaves in the plant is regulated, thereby the nitrogen utilization efficiency is changed.
2. The method of claim 1, which comprises transforming a plant with an expression construct with a high level of expression of Arabidopsis NRT1.7 or an orthologue thereof to enhance the nitrogen utilization efficiency.
3. The method of claim 1, which comprises transforming a plant with an expression construct with a low level of expression of Arabidopsis NRT1.7 or an orthologue thereof to decrease the nitrogen utilization efficiency.
4. The method of claim 2, wherein the expression of NRT1.7 or an orthologue thereof is enhanced by an enhancer.
5. The method of claim 2, wherein NRT1.7 is overexpressed in a plant by transforming an expression construct comprising a nucleic acid sequence of NRT1.7 and an enhance into the plant to produce a transgenic plant.
6. The method of claim 4, wherein the enhancer is 35S enhancer.
7. The method of claim 5, wherein the 35S enhancer has a nucleotide sequence of SEQ ID NO: 4.
8. The method of claim 3, wherein the quantity or activity of NRT1.7 is decreased or the expression of NRT1.7 is inhibited to causes a defect in remobilizing nitrogen from older leaves to younger leaves so as to retard growth in the plant.
9. The method of claim 3, wherein the expression of NRT1.7 mRNA is inhibited to decrease quantity or availability of functional NRT1.7.
10. A transgenic plant, which is transformed with an expression construct causing overexpression of NRT1.7 or enhancement of NRT1.7 function within the transgenic plant, whereby the transgenic plant enhances the nitrogen remobilization from older leaves to young leaves in the plant, and the nitrogen use efficiency is improved.
11. The transgenic plant of claim 10, wherein the growth of the transgenic plant is enhanced.
12. A transgenic plant, which is transformed with an construct that has a defect in the gene of NRT1.7, wherein the defect results in inhibiting the expression of NRT 1.7 or NRT1.7 mRNA to decrease quantity or availability of functional NRT1.7, whereby the nitrogen remobilization from older leaves to younger leaves in the transgenic plant is defective.
13. The transgenic plant of claim 12, wherein the growth of the transgenic plant is retarded.
14. A chimera nitrate transporter protein having the amino acid sequence of SEQ ID NO: 11.
15. An isolated DNA molecule encoding the chimera nitrate transporter protein having the amino acid sequence of SEQ ID NO: 11 of claim 14.
16. The DNA molecule of claim 15 comprising the nucleotide sequence of SEQ ID NO:10.
17. An expression vector comprising the DNA molecule having the nucleotide sequence coding for NRT1.7 operatively liked to a promoter.
18. The expression vector of claim 17, wherein the promoter is a NRT1.7 promoter.
19. The expression vector of claim 17, which further comprises an enhancer.
20. The expression vector of claim 19, wherein the enhancer is 35S enhancer.
21. A transgenic plant, which is transformed with an expression construct comprising a DNA molecule encoding the chimera nitrate transporter protein having the amino acid sequence of SEQ ID NO:11, whereby the nitrogen utilization efficiency in the transgenic plant is improved.
22. The transgenic plant of claim 21, wherein the DNA molecule is driven by a NRT 1.7 promoter.
Type: Application
Filed: Jul 8, 2010
Publication Date: Jan 13, 2011
Applicant: Academia Sinica (Taipei)
Inventors: Yi-Fang Tsay (Taipei), Shu-Chun Fan (Taipei), Hui-Yu Chen (Jung Li City)
Application Number: 12/832,234
International Classification: A01H 5/00 (20060101); C12N 15/82 (20060101); C07K 14/415 (20060101); C07H 21/04 (20060101);