PLASMID-ENCODED NEUROTOXIN GENES IN CLOSTRIDIUM BOTULINUM SEROTYPE A SUBTYPES
The present invention provides a novel isolated plasmid, wherein the plasmid is a native plasmid found in unique C. botulinum type A strains and encode either BoNT/A3 or BoNT/A4 and BoNT/B. The present invention also provides a method of obtaining a plasmid-encoded botulinum neurotoxin and botulinum neurotoxin complex comprising the step of isolating a plasmid encoding the cntA/A or cntA/B neurotoxin gene and genes encoding protein components of the toxin complex from a C. botulinum type A strain. The inventors performed comparative analyses of representative BoNT/A subtype strains by pulsed-field gel electrophoresis (PFGE) and Southern hybridizations with probes specific for the BoNT/A and B genes, cntA/A and cntA/B. Unexpectedly, the inventors determined that the genes encoding BoNT/A3 in the A3 strain, and BoNT/A4 and BoNT/B in the A4 strain, are on plasmids.
Latest WISCONSIN ALUMNI RESEARCH FOUNDATION Patents:
This application is a continuation of U.S. application Ser. No. 12/664,800, filed Jun. 30, 2010, which is a national stage application of PCT/US2008/68532, filed Jun. 27, 2008, which claims priority to U.S. Provisional Application No. 60/947,090, filed Jun. 29, 2007, all of which are hereby incorporated by reference herein in their entirety for all purposes.
STATEMENT REGARDING FEDERALLY-SPONSORED RESEARCH OR DEVELOPMENTNot Applicable.
FIELD OF THE INVENTIONThis invention is directed to isolated plasmid encoding neurotoxin genes in Clostridium botulinum serotypes.
BACKGROUND OF THE INVENTIONClostridium botulinum produces botulinum neurotoxin (BoNT), the causative agent of the debilitating disease botulism that affects humans and animals. BoNTs have also been considered as potential bioterrorism (BT) agents. For instance, in 2001 C. botulinum was listed as a category A select agent due to its potential use as a BT agent [1]. In addition to its importance as a pathogen and potential BT agent, BoNTs are now widely used as pharmaceuticals to treat a myriad of neuronal disorders.
Seven distinguishable serotypes of BoNT, designated A-G, are produced by C. botulinum. The serotypes are described as BoNT/A, BoNT/B, BoNT/C, etc. BoNTs are produced as progenitor toxin complexes in which the neurotoxin is associated with nontoxic components: nonhemagglutinin (NTNH), hemagglutinin (HA), other uncharacterized protein components, and nucleic acids [2]. The genes encoding the neurotoxin and associated protein components of the toxin complexes are organized in a cluster, and their location and composition varies among the different serotypes and strains [3]. For further information concerning the properties of the various C. botulinum toxins, reference is made to the article by Jankovic and Brin, The New England Journal of Medicine, No. 17, 1990, pp. 1186-1194, and to the review by Charles L. Hatheway in Chapter 1 of the book entitled Botulinum Neurotoxin and Tetanus Toxin, L. L. Simpson, Ed., published by Academic Press Inc. of San Diego, Calif., 1989, the disclosures in which are incorporated herein by reference.
The neurotoxic component of C. botulinum has a molecular weight of about 150 kilodaltons (kD) and is comprised of a polypeptide chain of about 50 kD (Lc) which is considered to be responsible for the toxic properties of the toxin (i.e., by interfering with the exocytosis of acetylcholine, by decreasing the frequency of acetylcholine release) and a larger polypeptide chain of about 100 kD (Hc), which is believed to be necessary to enable the toxin to bind to the pre-synaptic membrane and to enter into neurons. The neurotoxin gene clusters for C. botulinum serotypes A, B, E and F are believed to be located on the chromosome, while the neurotoxin gene clusters for C. botulinum serotypes Cl and D are carried on bacteriophages [4]. In C. botulinum BoNT/G, the neurotoxin gene (cntA/G) was shown to reside on a large plasmid of approximately 114 kb [5].
Four BoNT/A subtypes (A1-A4) have recently been identified [6, 7, 8]. Although BoNT/A subtypes exhibit a high degree of sequence conservation, variations in substrate recognition and receptor binding regions are sufficient to significantly affect efficient vaccine and countermeasure development [6, 8], as well as potentially affecting pharmaceutical activity. It has also been observed that different type A strains, even within the same subtype, produce varying quantities of BoNT [9]. For instance, experiments have determined that C. botulinum subtype A3 strain Loch Maree, and subtype A4 strain 657Ba, produce considerably less BoNT than most A1 and A2 subtype strains. Interestingly, the dual neurotoxin strain 657Ba produces primarily BoNT/B and even lower quantities of BoNT/A than the Loch Maree strain. This complicates purification of sufficient quantities of these proteins, as required for fundamental molecular biology and structural studies, as well as commercial and therapeutic uses of the proteins.
Therapeutic uses of BoNT include dystonias, chronic facial pain, strabismus, chronic headache, spastic muscle disorders, and other chronic ailments that require repeated administration of BoNT-complexes. Commercially available pharmaceuticals comprising BoNT-complexes (as distinct from purified neurotoxin), i.e., BOTOX (Allergan, Inc.) are serotype A1. Stereotype B has also been commercially marketed as NEUROBLOC or MYOBLOC (Solstice, Inc.), but is mainly used secondary to stereotype A because of the large number of Units required for treatment and its relatively short duration of action compared to serotype A, which has the longest duration of action compared to the other six serotypes of BoNT. Although it is the predominant currently approved type of BoNT, serotype A is immunogenic, meaning that people become resistant to it after repeated use. Accordingly, a need exists for a BoNT/A subtype that is not neutralized from antibodies present against BoNT/A1 after repeated use, an isolated and purified source thereof, as well as methods of obtaining and using said BoNT/A subtype.
SUMMARY OF THE INVENTIONThe present invention provides a novel isolated plasmid, wherein the plasmid is a native plasmid found in a C. botulinum type A strain. In one embodiment the plasmid encodes BoNT/A3. In an alternate embodiment the plasmid encodes BoNT/A4 and BoNT/B. The C. botulinum type A strain is preferably selected from the group consisting of ATCC 3502 [subtype A1], 62A [subtype A1], KyotoF [subtype A2], 5328A [subtype A1/A2], Loch Maree [subtype A3] and similar or identical subtype A3 isolates obtained from culture collections and governmental agencies, 657Ba [subtype A4] and NCTC 2916 [subtype A(B)]. The plasmids harboring the gene for BoNTs in these strains range from approximately 60 to 280 kb.
In an alternate embodiment, the present invention also provides a method of obtaining a plasmid-encoded botulinum neurotoxin complex (BoNT-complex). The method comprises the step of isolating a plasmid encoding the cntA/A or cntA/B neurotoxin gene as well as the associated protein complexes from a C. botulinum type A strain. The C. botulinum type A strain is preferably selected from the group consisting of ATCC 3502 [subtype A1], 62A [subtype A1], KyotoF [subtype A2], 5328A [subtype A1/A2], Loch Maree [subtype A3] and similar or identical strains, 657Ba [subtype A4] and NCTC 2916 [subtype A(B)]. In one embodiment the C. botulinum type A strains are other C. botulinum strains that produce BoNT/A3 and BoNT/A3-complexes from plasmid-encoded genes. In an alternative embodiment the C. botulinum type A strain is 657Ba or other Ba strains carrying BoNT genes from plasmids.
In another embodiment, the invention provides a novel method of producing botulinum neurotoxin comprising the steps of isolating a plasmid encoding the cntA/A or cntA/B gene and those genes encoding the protein complexes from a C. botulinum type A strain; and introducing the plasmid to into a clostridium bacteria wherein the BoNT or complex is produced. The C. botulinum type A strain is preferably selected from the group consisting of ATCC 3502 [subtype A1], 62A [subtype A1], KyotoF [subtype A2], 5328A [subtype A1/A2], Loch Maree [subtype A3] and related or identical strains from various sources, 657Ba [subtype A4] and NCTC 2916 [subtype A(B)].
The present invention offers multiple advantages over the prior art. For instance, the isolated plasmid and method of obtaining the isolated plasmid provide useful methods for procuring sufficient quantities of the purified neurotoxin for use in therapeutic and research applications. In addition, the isolated plasmid provides a BoNT/A-complex and BoNT subtype that is not neutralized by antibodies to BoNT/A1 after repeated use, increasing the therapeutic applications of the plasmid of the present invention.
While multiple embodiments are disclosed, still other embodiments of the present invention will become apparent to those skilled in the art from the following detailed description. As will be apparent, the invention is capable of modifications in various obvious aspects, all without departing from the spirit and scope of the present invention. Accordingly, the detailed descriptions are to be regarded as illustrative in nature and not restrictive.
The present invention provides a novel isolated plasmid, wherein the plasmid is a native plasmid found in a C. botulinum type A strain and encodes either BoNT/A3 or BoNT/A4 and BoNT/B. The present invention also provides a method of obtaining a plasmid-encoded botulinum neurotoxin complex or isolated botulinum neurotoxin comprising the step of isolating a plasmid encoding the cntA/A or cntA/B neurotoxin gene from a C. botulinum type A strain and expressing the genes encoding for BoNT/A3, BoNT/A4 and BoNT/B neurotoxins and associated proteins of the neurotoxin complexes. The neurotoxin complex and the neurotoxin are purified and formulated in a manner suitable for use, such as in pharmaceuticals or vaccine preparation.
I. IN GENERALIn the specification and in the claims, the terms “including” and “comprising” are open-ended terms and should be interpreted to mean “including, but not limited to . . . .” These terms encompass the more restrictive terms “consisting essentially of” and “consisting of.”
As used herein and in the appended claims, the singular forms “a”, “an”, and “the” include plural reference unless the context clearly dictates otherwise. As well, the terms “a” (or “an”), “one or more” and “at least one” can be used interchangeably herein. It is also to be noted that the terms “comprising”, “including”, “characterized by” and “having” can be used interchangeably.
Unless defined otherwise, all technical and scientific terms used herein have the same meanings as commonly understood by one of ordinary skill in the art to which this invention belongs. All publications and patents specifically mentioned herein are incorporated by reference in their entirety for all purposes including describing and disclosing the chemicals, instruments, statistical analyses and methodologies which are reported in the publications which might be used in connection with the invention. All references cited in this specification are to be taken as indicative of the level of skill in the art. Nothing herein is to be construed as an admission that the invention is not entitled to antedate such disclosure by virtue of prior invention.
II. THE INVENTIONThe present invention provides a novel isolated plasmid, wherein the plasmid is a native plasmid found in a C. botulinum type A strain and encodes either BoNT/A3 (plasmid pCLK) or BoNT/A4 and BoNT/B (plasmid pCLI) and the associated protein complexes. The present invention also provides a method of obtaining a plasmid-encoded BoNT comprising the step of isolating a plasmid encoding the cntA/A or cntA/B neurotoxin and genes encoding BoNT-complexes from a C. botulinum type A strain. The two plasmids pCLK and pCLI, which encode the BoNT and BoNT-complex genes, are uniquely distinct plasmids and each is found in a separate C. botulinum strain.
The inventors performed comparative analyses of representative BoNT/A subtype strains by pulsed-field gel electrophoresis (PFGE) and Southern hybridizations with probes specific for the BoNT/A and B genes, cntA/A and cntA/B. Unexpectedly, the inventors determined that the genes encoding BoNT/A3 in the A3 strain, and BoNT/A4 and BoNT/B in the A4 strain, are on plasmids. This is the first demonstration of a plasmid-located gene for BoNT in C. botulinum type A strains. This is advantageous for many reasons, such as providing an increased utility for protein production.
In a first embodiment, the present invention provides a novel, isolated plasmid, wherein the plasmid is a native plasmid found in a C. botulinum type A strain and encodes either BoNT/A3 or BoNT/A4 and BoNT/B.
A native plasmid, pCLK, has been discovered in C. botulinum strain Loch Maree which encodes the BoNT/A3 gene, cntA/A3 (Marshall et al. 2007; Smith et al. 2007). A separate native plasmid, pCLI, has also been discovered in C. botulinum strain 657Ba that harbors both the BoNT/A4 and BoNT/bvB genes, cntA/A4 and cntA/bvB (by stands for bivalent B). These plasmids share significant homology, but are two separate and distinct entities. The plasmid pCLK is 266,805 bp and the plasmid pCLI is 270,346 bp. Although plasmids have been observed in C. botulinum strains ATCC 3502, 62A and 5328A the BoNT gene has not been found to be associated with these plasmids; instead BoNT/A is located on the chromosome in these strains (Marshall et al. 2007).
By “plasmid” we mean an autonomously replicating, extrachromosomal, circular DNA molecule, distinct from the normal bacterial genome and nonessential for cell survival under nonselective conditions. Some plasmids are capable of integrating into the host genome. A number of artificially constructed plasmids are used as cloning vectors. The plasmids of the present invention that possess genes encoding for BoNTs range in size from approximately 60 to 280 kb. The sizes of the plasmids that encode the neurotoxin genes as well as the toxin complex genes are 266,805 bp (pCLK, C. botulinum strain Loch Maree) and 270,346 bp (pCLI, C. botulinum strain 657Ba). The inventors have shown that only pCLK of C. botulinum strain Loch Maree is capable of conjugal transfer (
By “isolated” we mean a plasmid that is identified and separated from at least one component or contaminant with which it is ordinarily associated in its natural source. An isolated plasmid is present in a form or setting that is different from that in which it is found in nature. In contrast, non-isolated plasmids are found in the state they exist in nature. The plasmids of the present invention may be isolated by any known method of isolating plasmids found in bacteria. One of skill in molecular biology will understand that there are numerous suitable methods for isolating large plasmids found in bacteria known in the art [5, 20, 21].
By a “C. botulinum type A strain” we mean a type A strain known to the art, including but not limited to those strains selected from the group consisting of ATCC 3502 [subtype A1], 62A [subtype A1], KyotoF [subtype A2], 5328A [subtype A1/A2], Loch Maree (GenBank Accession No. ABA29017) [subtype A3], 657Ba (GenBank Accession No. ABA29018) [subtype A4] and NCTC 2916 [subtype A(B)]. In a preferred embodiment the type A strain is a type A3 strain such as Loch Maree or a type A4 strain such as 657Ba. Other A3 and A4 strains that contain plasmids containing neurotoxin gene clusters are also envisioned as acceptable for this invention.
In a second embodiment, the present invention provides a novel method of obtaining a plasmid-encoded botulinum neurotoxin and neurotoxin protein complex. The method comprises the step of isolating a plasmid encoding the cntA/A or cntA/B neurotoxin genes and genes for the complex proteins from a C. botulinum type A strain. In a preferred method the C. botulinum type A strain is selected from the group consisting of ATCC 3502 [subtype A1], 62A [subtype A1], KyotoF [subtype A2], 5328A [subtype A1/A2], Loch Maree [subtype A3], 657Ba [subtype A4] and NCTC 2916 [subtype A(B)]. In a preferred embodiment the type A strain is a type A3 strain such as Loch Maree or a type A4 strain such as 657Ba. Other A3 and A4 strains that contain plasmids containing neurotoxin gene clusters are also envisioned as acceptable for this invention.
The plasmid may be isolated by any known method of isolating plasmids found in bacteria. One of skill in molecular biology will understand that there are numerous suitable methods for isolating large plasmids found in bacteria known in the art [5, 20, 21].
In a third embodiment, the present invention provides methods of producing botulinum neurotoxin and their proteins complexes. In one embodiment, the isolated plasmid of the present invention may be modified to increase protein production. In particular, one may wish to manufacture proteins in clostridia. The isolated plasmids of the present invention may also be useful for genetic manipulations in Clostridium species.
III. EXAMPLESThe following examples are, of course, offered for illustrative purposes only, and are not intended to limit the scope of the present invention in any way. Indeed, various modifications of the invention in addition to those shown and described herein will become apparent to those skilled in the art from the foregoing description and the following examples and fall within the scope of the appended claims.
Bacterial strains. The following C. botulinum type A subtype strains from the inventors laboratory culture collection were used: ATCC 3502 [subtype A1], 62A [subtype A1], KyotoF [subtype A2], 5328A [subtype A1/A2], Loch Maree (GenBank Accession No. ABA29017) [subtype A3], 657Ba (GenBank Accession No. ABA29018) [subtype A4] and NCTC 2916 [subtype A(B)]. All cultures were maintained as frozen stocks at −80° C. in TPGY (50g/liter trypticase peptone, 5 g/liter Bacto peptone, 4 g/liter D-glucose, 20 g/liter yeast extract, 1 g/liter cysteine-HCl, pH 7.4) broth supplemented with 40% glycerol. All bacterial media components and chemicals were purchased from Becton Dickinson Microbiology Systems, Sparks, Md. and Sigma-Aldrich, St. Louis, Mo.
Preparation of agarose plugs for PFGE analysis. Bacterial cultures were grown anaerobically, PFGE plugs prepared, and PFGE performed as previously described [10].
Southern Hybridization. Type A neurotoxin gene sequences of all four C. botulinum type A subtype strains [6] were aligned and primers were designed to anneal to a conserved region of the C-terminal trefoil subdomain in the binding domain of the heavy chain. The forward primer: 5′GCTACTAATGCATCACAGGCAGGCG3′ (SEQ ID NO: 1) and reverse primer: 5′CCCATGAGCAACCCAAAGTCC3′ (SEQ ID NO: 2) were used in PCR amplification to generate a 268 bp DNA probe for cntA/A. A portion of the light chain of cntA/B was PCR amplified from the genomic DNA of C. botulinum strain 657Ba to generate a fragment of 592 bp using: forward primer: 5′TTTGCATCAAGGGAAGGCTTCG3′ (SEQ ID NO: 3) and reverse primer: 5′AGGAATCACTAAAATAAGAA3′ (SEQ ID NO: 4). A 16S rDNA probe for C. botulinum type A was amplified by PCR using genomic DNA from an A1 subtype strain as a template to yield a DNA fragment of 1020 bp using primers: forward primer: 5′GCGGCGTGCCTAACACATGC3′ (SEQ ID NO: 5) and reverse primer: 5′ATCTCACGACACGAGCTGAC3′ (SEQ ID NO: 6).
The PCR products were purified from agarose gels using Qiagen extraction kit (Qiagen, Valencia, Calif.), and were radioactively labeled with 32P using the Megaprime DNA labeling system (GE Healthcare Bio-Sciences, Piscataway, N.J.). The DNA samples separated by PFGE were transferred to a positively charged nylon membrane (Immobilon-NY+, Millipore, Bedford, Mass.) overnight by downward capillary transfer in 0.4 M NaOH, 1.5 M NaCl. The membranes were neutralized in 2 M Tris-HCl, pH 7.0 for 10 minutes, rinsed with 2×SSC and fixed at 80° C. for 30 minutes under vacuum. Hybridization was performed at 42° C. for 16 hours in a solution containing 5×Denhardt, 6×SSC, 50% formamide, 1% SDS, 100 μg/ml herring sperm DNA (Promega, Madison, Wis.) and 32P-labeled probes.
All hybridization solutions and buffers were prepared according to standard protocols [11]. After hybridizations the membranes were washed twice for 5 minutes each at room temperature with 2×SSC, 0.1% SDS and twice for 15 minutes each at 42° C. The membranes hybridized with the ribosomal probe were washed twice for 27 hours each at 65° C. with 0.1×SSC, 0.1% SDS. Autoradiography of the membranes was performed for 16 to 48 hours at −70° C. using Kodak BioMax MS film with a BioMax intensifying screen (Eastman Kodak, Rochester, N.Y.).
Bacteriophage Induction. Bacterial cultures of C. botulinum strains Loch Maree (subtype A3) and 657Ba (subtype A4) were grown anaerobically at 37° C. in 10 ml tubes of TPGY media to an OD600 of 0.2. Mitomycin C at a final concentration of 5 μg/ml was added to the cultures to induce cell lysis. The cultures were further incubated at 37° C. for 4-6 hours or until lysis was complete. The OD600 of the cultures was measured at 1 hour intervals. When lysis was complete the cultures were cooled to room temperature and bacteriophage particles were isolated following a standard protocol [11]. Bacteriophage particles were embedded in agarose plugs, treated as described above, and subjected to PFGE analysis and Southern hybridization.
Results and Discussion. C. botulinum strains Loch Maree and 657Ba produce very low quantities of BoNT/A3 and BoNT/A4, respectively, compared to other BoNT/A strains (unpublished data). Therefore, purification of sufficient quantities of these neurotoxins required for development of therapeutics and countermeasures is obstructed. Evaluating the genetic location of the neurotoxin genes in these strains could impact the levels of BoNTs. Previous studies have observed significant variations in growth patterns and BoNT production levels among different C. botulinum serotypes and even between strains within the same serotype [9]. Kinetic studies of C. botulinum type A1 and A2 strains showed a temporal regulation of BoNT production that begins during late log and early stationary phase [9]. Neurotoxin production differed between the strains and was found to be primarily dependent on nutritional factors, cell lysis, and sporulation [3, 9].
In typical A1 and A2 subtype strains, neurotoxin expression and the formation of the progenitor toxin complex increased upon prolonged incubation reaching maximum quantities at 96 hours. C. botulinum strains Loch Maree and 657Ba showed no increase in the levels of neurotoxin produced after 24 hours, and consistent quantities were rarely detected between different batch cultures (data not shown). The neurotoxin gene clusters in C. botulinum serotypes C and D are carried by bacteriophages [4].
The bacteriophage carrier state in these serotypes has been termed pseudolysogeny because of the unstable nature of the prophage-bacterium relationship in which the prophage is often lost resulting in a nontoxigenic state [4]. The inventors hypothesized that a similar pseudolysogenic state may be responsible for the inconsistent production of BoNTs in strains Loch Maree and 657Ba. To test this hypothesis, bacterial cultures were treated with mitomycin C and bacteriophage particles were isolated from the culture lysates. Upon induction, the C. botulinum strain Loch Maree displayed a typical lysis pattern achieving complete lysis after six hours (
PFGE analysis revealed a DNA band of 48.5 kb in the bacteriophage DNA preparations from both strains (
The neurotoxins among the four BoNT/A subtypes show 84 to 93% identity [6]. The organization and composition of genes within the neurotoxin gene clusters also differ among the subtypes [3]. Presently, the nucleotide sequence of the entire genome has been determined for only one C. botulinum strain, ATCC 3502 [12], therefore the extent of sequence variation at the genome level between different subtype strains is not known.
To compare the genomes of representative C. botulinum strains producing BoNT/A1-A4 neurotoxins, PFGE and Southern hybridization analyses with neurotoxin gene specific probes were performed. In clostridia, preparation of high quality DNA plugs for PFGE analysis is challenging and some strains cannot be readily typed because they contain very high levels of endogenous DNases [3, 10]. To minimize the nucleolytic degradation of DNA samples, bacterial cultures were fixed with formaldehyde [10]. Typically, PFGE is performed with DNA samples that have been digested with rare cutting restriction endonucleases (RE), but to verify the quality of the DNA prior to restriction analysis, nondigested samples were first analyzed.
The inventors observed that a significant portion of DNA remained in the wells of the gel, representing intact chromosomal DNA. However, a portion of chromosomal DNA migrated a short distance into the gel, most likely corresponding to sheared DNA due to DNase activity (
It has been determined that supercoiled plasmids migrate independently of the pulse time in PFGE, but large circular DNA molecules that are nicked or enzymatically relaxed fail to enter the gel matrix [13]. To verify the nature of these extrachromosomal elements, PFGE of nondigested DNA of these strains was performed several times employing different pulse times (data not shown). However, these extrachromosomal DNA molecules consistently migrated through the gels at the same size relative to the marker bands, suggesting that these bands may correspond to linear DNA plasmids. Cryptic plasmids ranging in size from 3 kb to 125 kb have been isolated from all C. botulinum serotypes but is strain dependent [14]. C. botulinum type G is the only serotype to date known to harbor a large plasmid (114 kb), which contains the BoNT/G gene cluster [5].
Clostridium tetani also carries a large plasmid (74 kb) possessing the tetanus neurotoxin (TeNT) gene [15]. It has been assumed that the neurotoxin gene clusters in C. botulinum serotypes A, B, E and F are located on the chromosomes. This has been confirmed for C. botulinum serotype A (subtype A1) through sequencing of the genome of the strain ATCC 3502 [12]. Prior to the present study, plasmids larger than that occurring in C. botulinum type G have not been identified in neurotoxigenic clostridia. The solventogenic Clostridium acetobuytlicum contains a megaplasmid (210 kb) which carries solventogenic genes encoding proteins involved in the production of acetone and butanol [16].
The finding of large extrachromosomal elements in C. botulinum type A strains 62A, 5328A, Loch Maree and 657Ba, prompted the inventors to investigate in more detail their potential role in neurotoxin production. Southern hybridizations were performed using probes specific for cntA/A, and cntA/B first using nondigested DNA samples (
C. botulinum NCTC 2916 is an A(B) strain that produces active BoNT/A and carries a silent, unexpressed type B toxin gene cluster that is likely located on the chromosome [17]. Hybridization of cntA/B with the DNA of NCTC 2916 revealed strong signals at the level of sheared chromosomal DNA and at the well position supporting the location of cntA/B on the chromosome in this strain (
To provide further evidence that the ˜280 kb DNA elements in C. botulinum strains Loch Maree and 657Ba are plasmids and not sheared fragments of genomic DNA, the inventors also performed Southern hybridization of the nondigested DNA using a probe specific for 16S rDNA. Ribosomal DNA is specific to chromosomes and rarely found on plasmids [18]. Only sheared chromosomal DNA and DNA that remained at the well position hybridized with the 16S rDNA probe in all strains (
To confirm the presence of cntA/A and cntA/B genes on these extrachromosomal DNA molecules in strains Loch Maree and 657Ba, seventeen rare cutting RE were chosen for the restriction analysis and Southern hybridizations of DNA preparations from these strains (
Four additional REs apparently cleaved the plasmid more than once in strain Loch Maree because hybridization signals were observed with DNA bands smaller than ˜280 kb (
Plasmids from several C. botulinum type A strains have been isolated, but none of the plasmids have been associated with neurotoxin production [19]. This is the first demonstration that cntA/A, and cntA/B genes are located on a large plasmid (˜280 kb) in type A neurotoxin producing C. botulinum strains. This finding has important implications for the evolution and pathogenicity of C. botulinum, including acquisition and expression of the toxins, and lateral transfer of toxin genes to nonpathogenic bacteria. As mentioned above, BoNT-encoding plasmids have also been obtained that very considerably in size from 60 to 280 kb.
REFERENCES
- [1] Arnon et al., JAMA. 285 (2001) 1059-1081.
- [2] Schantz et al., Microbiol. Rev. 56 (1992) 80-99.
- [3] Johnson et al., Toxicon 39 (2001) 1703-1722.
- [4] Johnson et al., Phages: Their Role in Bacterial Pathogenesis and Biotechnology, ASM Press, Washington, D.C., 2005, pp. 280-296.
- [5] Zhou et al., Infect. Immun. 63 (1995) 2087-2091.
- [6] Arndt et al., J. Mol. Biol. 362 (2006) 733-742.
- [7] Hill et al., J. Bacteriol. 189 (2007) 818-237.
- [8] Smith et al., Infect. Immun. 73 (2005) 5450-5457.
- [9] Bradshaw et al., Anaerobe. 10 (2004) 321-333.
- [10] Johnson et al., J. Clin. Microbiol. 43 (2005) 2602-2607.
- [11] Sambrook, D. W. Russell, Molecular Cloning—A Laboratory Manual, third ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 2001.
- [12] Sebaihia et al., Genome Res. 2007 (epub ahead of print) 1-11.
- [13] Beverly, Nucleic Acids Res. 16 (1988) 925-939.
- [14] Strom et al., Appl. Environ. Microbiol. 48 (1984) 956-963.
- [15] Finn et al., Science. 224 (1984) 881-884.
- [16] Cornillot et al., J. Bacteriol. 179 (1997) 5442-5447.
- [17] Rodriguez et al., Curr. Microbiol. 36 (1998) 226-231.
- [18] Ochman et al., Curr. Biol. 12 (2002) R427-R428.
- [19] Weickert et al., Appl. Environ. Microbiol. 51 (1986) 52-56.
- [20] Johnson et al., J. Mol Biol, 362 (2006) 733-742.
- [21] Rasko et al., J. Bacteriol. 189 (2007) 52-64.
Claims
1. An isolated plasmid, wherein the plasmid is a native plasmid found in a Clostridium botulinum type A strain and encodes BoNT/A3.
2. The plasmid of claim 1 wherein the Clostridium botulinum type A strain is selected from the group consisting of ATCC 3502 [subtype A1], 62A [subtype A1], KyotoF [subtype A2], 5328A [subtype A1/A2], Loch Maree [subtype A3], 657Ba [subtype A4] and NCTC 2916 [subtype A(B)].
3. The plasmid of claim 1 wherein the plasmid ranges in size from 60 to 280 kb.
4. An isolated plasmid, wherein the plasmid is a native plasmid found in a Clostridium botulinum type A strain and encodes BoNT/A4 and BoNT/B5.
5. The plasmid of claim 4 wherein the Clostridium botulinum type A strain is selected from the group consisting of ATCC 3502 [subtype A1], 62A [subtype A1], KyotoF [subtype A2], 5328A [subtype A1/A2], subtype A3, subtype A4 and NCTC 2916 [subtype A(B)].
6. The plasmid of claim 5 wherein the Clostridium botulinum type A strain is type A3.
7. The plasmid of claim 6 wherein the Clostridium botulinum type A3 strain is Loch Maree.
8. The plasmid of claim 5 wherein the Clostridium botulinum type A strain is type A4.
9. The plasmid of claim 8 wherein the Clostridium botulinum type A strain is 657Ba.
10. The plasmid of claim 5 wherein the plasmid ranges in size from 60 to 280 kb.
11. A method of obtaining a plasmid-encoded botulinum neurotoxin comprising the step of isolating a plasmid encoding the cntA/A or cntA/B gene from a Clostridium botulinum type A strain.
12. The method of claim 11 wherein the Clostridium botulinum type A strain is selected from the group consisting of ATCC 3502 [subtype A1], 62A [subtype A1], KyotoF [subtype A2], 5328A [subtype A1/A2], subtype A3, subtype A4 and NCTC 2916 [subtype A(B)].
13. The method of claim 11 wherein the Clostridium botulinum is type A strain is A3.
14. The method of claim 13 wherein the Clostridium botulinum type A strain is Loch Maree.
15. The method of claim 11 wherein the Clostridium botulinum type A strain is type A4.
16. The method of claim 15 wherein the Clostridium botulinum type A strain is 657Ba.
17. A method of producing botulinum neurotoxins and botulinum neurotoxin complexes comprising the steps of:
- a) isolating a plasmid encoding the cntA/A or cntA/B gene from a Clostridium botulinum type A strain;
- b) introducing the plasmid pinto a clostridium bacteria wherein the botulinum toxin complex and neurotoxins are produced.
18. The method of claim 17 wherein the Clostridium botulinum type A strain is selected from the group consisting of ATCC 3502 [subtype A1], 62A [subtype A1], KyotoF [subtype A2], 5328A [subtype A1/A2], Loch Maree [subtype A3], 657Ba [subtype A4] and NCTC 2916 [subtype A(B)].
19. The method of claim 17 wherein the Clostridium botulinum type A strain is Loch Maree.
20. The method of claim 17 wherein the Clostridium botulinum type A strain is 657Ba.
Type: Application
Filed: Mar 13, 2013
Publication Date: Mar 6, 2014
Patent Grant number: 9453057
Applicant: WISCONSIN ALUMNI RESEARCH FOUNDATION (Madison, WI)
Inventor: WISCONSIN ALUMNI RESEARCH FOUNDATION
Application Number: 13/800,997
International Classification: C07K 14/33 (20060101);