PLANT EXPRESSION CONSTRUCTS COMPRISING AND USES THEREOF
Methods of expressing a molecule of interest in a plant are disclosed. One method comprises contacting roots of the plant in a solution comprising at least one Geminivirus based expression construct so as to allow the at least one Geminivirus based expression construct to be absorbed by the roots, the expression construct comprising a polynucleotide encoding the molecule of interest, and further the expression construct being capable of systemic symptomless spread in a plant host, thereby expressing a molecule of interest in a plant. Expression constructs capable of systemic symptomless spread in a host plant are also disclosed.
Latest Yissum Research Development Company of the Hebrew University of Jerusalem Ltd. Patents:
- Liposomal formulations comprising AT1 receptor blockers and uses thereof
- Antibodies to NKP46 and constructs thereof for treatment of cancers and infections
- Solar energy and agroproduction structures and facilities
- Nanoscale optical biosensor based on material-associated single walled carbon nanotubes
- Pyrazole pyrimidine derivative and uses thereof
This application is a division of U.S. patent application Ser. No. 13/003,151 filed on Feb. 23, 2011, which is a National Phase of U.S. Patent Application No. PCT/IL2009/000682 having International filing date of Jul. 8, 2009, which claims the benefit of priority from U.S. Provisional Patent Application No. 61/129,596 filed on Jul. 8, 2008. The content of the above document is incorporated by reference as if fully set forth herein.
SEQUENCE LISTING STATEMENTThe ASCII file, entitled 59114SequenceListing.txt, created on May 1, 2014, comprising 61,103 bytes, submitted concurrently with the filing of this application is incorporated herein by reference.
FIELD AND BACKGROUND OF THE INVENTIONThe present invention, in some embodiments thereof, relates to Gemini-virus constructs capable of symptomless, systemic spread in plant hosts.
Plants may be genetically engineered for a variety of purposes including for the generation of plants with enhanced viral resistance, for the development of abiotic stress tolerant plants, for commercially improved plants and for the expression of heterologous polypeptides for pharmaceutical and industrial purposes.
Present techniques for DNA delivery into plants include direct as well as indirect methods. However, each of these delivery methods is not without limitations. The direct DNA delivery systems such as particle bombardment, silicon carbide whisker technology and electroporation tend to result in integration of multiple copies of transgenes and are considered to be limited, unpredictable and transient. Indirect approaches such as Agrobacterium oftentimes result in integration of multiple copies of the foreign DNA into the plant genome along with unwanted sequences from the vector ‘backbone’.
Integration of foreign DNA into the plant genome to become a heritable trait raises many risks. Traits beneficial to crops may, through horizontal gene transfer or hybridization through breeding with wild relatives, provide wild plants with unwanted competitive advantages. Also, Transformation with Agrobacterium is a complex process which requires elimination of false positives arising from the growth of Agrobacterium in host tissues, and selection of transformed plants. The use of antibiotic resistance as a marker in the development of transgenic crops has also raised concerns regarding the increase of antibiotic resistance in the environment through horizontal transfer of antibiotic resistance genes to soil micro-organisms. Scientists now have the means to remove marker genes before a crop plant is developed for commercial use, but these means involve further costs and tedious procedures. In addition, several species or varieties of plants are still difficult to transform.
Infection of plants with modified viruses is simpler and quicker than the regeneration of stably transformed plants, since plant viruses are small and easy to manipulate, have the inherent ability to enter the plant cell, and will multiply to produce a high copy number of the gene of interest. Viral vectors have been engineered for delivery of genetic material and expression of recombinant proteins in plants. Viral expression systems are considered transient expression systems since the viral vectors are not integrated into the genome of the host. However, viral vectors still hold many limitations. Plant viral vectors have the potential to cause disease in their plant hosts, they posses the ability to naturally spread between plants in the field, and in some cases, can be spread through pollen or seed to the next generation. Viral vectors are also limited in their systemic spread in the plant, in host ranges, expression stability, and in the size of insert which can be tolerated. Finally, like transgenic plants, modified viruses are classified as a Genetically Modified Organism (GMO) and thus are subject to regulatory and moral constraints.
Viruses belonging to the family Geminiviridae carry one or two circular single-stranded (ss) DNA genomes and are insect-transmissible. Begomoviruses, Curtoviruses, Mastreviruses and Topocuviruses are genera within this family which have been classified according to genome organization, insect transmissibility and host range. Begomoviruses can carry a monopartite or bipartite genome and are whitefly-transmissible. The association of satellite DNAs with monopartite begomoviruses is addressed further on.
Tomato yellow leaf curl virus (TYLCV) is a monopartite begomovirus. It carries six overlapping open reading frames (ORFs) transcribed bi-directionally from an intergenic region (IR; also termed “common region”), serving as the viral origin of replication and as a bi-directional promoter. The IR is about 300-bp long and carries the universal motif TAATATT/AC and a binding site for the replicase-associated protein (REP). Two ORFs are expressed in viral orientation (V1, V2) and four ORFs in the complementary orientation (C1 to C4). Each gene product appears to participate in more than one function. The viral ssDNA is transmitted to the plant and converted into double-stranded (ds) DNA (replicative form) by the host machinery. The dsDNA replicates and expresses viral mRNAs and proteins. Viral genes are not involved in this stage of replication (dsDNA to dsDNA). However, when rolling circle replication (RCR) is initiated by REP, RCR intermediates may serve as templates for dsDNA replication, dependent on host gene activity. At the next stage of replication, the numerous viral dsDNAs serve as templates for RCR, producing progeny ssDNA. ORF C1 (also termed rep) is essential for the initiation of RCR. The progeny ssDNA molecules are then encapsidated, transported to other tissues or transmitted to other plants. At least three viral gene products are implicated in viral movement within the plant: V2, the coat protein (CP) V1, and C4. The viral genes V1, V2, C4 and probably C2 are implicated in symptom appearance and disease severity. In summary, five of the viral ORFs have no direct role in viral DNA replication or expression (some have auxiliary roles), whereas the sixth ORF (rep) is involved only in the rolling-circle phase. Movement and pathogenicity, however, require the activity of viral gene products.
The association of viral satellites with RNA viruses is a well-documented phenomenon. Satellites, either encapsidated or in the form of naked nucleic acid, depend on a helper virus for their replication. A geminivirus-associated, 682-base-long DNA satellite was first reported by Dry et al. in 1997, Proc. Natl. Acad. Sci. USA 94, 7088-7093. This satellite was associated with an Australian type of TYLCV and did not share sequence homology with the helper virus. However, the satellite carried two motifs that also reside in the IR of the helper virus: the universal stem-loop motif and the REP-binding motif. Other gemini-associated satellites have been discovered since then (Briddon et al., 2001, Virology 285, 234-243; Mansoor et al., 1999, Virology 259, 190-199; Zhou et al., 2003, J. Gen. Virol. 84, 237-247. All of these satellite DNAs (generally referred to as DNAβ and DNA-1) are about half the size of the viral DNA, and carry, in addition to the aforementioned motifs, an ORF termed βC1. The role of the putative βC1 protein has not yet been conclusively determined but it is probably involved in movement, nuclear localization and silencing suppression (Cui et al., 2005, J. Virol. 79, 10764-10775). In many cases of geminiviral infection, the satellite determines symptom severity. Geminiviral satellites are encapsidated and replicated via factors provided by helper viruses. A satellite associated with a particular virus may be supported for replication by other geminiviruses as well.
International Patent Application WO2007/141790 teaches Gemini-virus based constructs wherein the inserted sequence to be expressed is flanked by a non-contiguous nucleic acid sequence encoding a Geminivirus replicase.
SUMMARY OF THE INVENTIONAccording to an aspect of some embodiments of the present invention there is provided a method of expressing a molecule of interest in a plant, the method comprising contacting roots of the plant in a solution comprising at least one Geminivirus based expression construct so as to allow the at least one Geminivirus based expression construct to be absorbed by the roots, the expression construct comprising a polynucleotide encoding the molecule of interest, and further the expression construct being capable of systemic symptomless spread in a plant host, thereby expressing a molecule of interest in a plant.
According to an aspect of some embodiments of the present invention there is provided a method of expressing a molecule of interest in a plant, the method comprising grafting a section of a first plant infected with at least one Geminivirus based expression construct onto a section of a second plant, the expression construct comprising a polynucleotide sequence which encodes the molecule of interest, and further the Geminivirus based expression construct being capable of systemic symptomless spread in a plant host, thereby expressing a molecule of interest in a plant.
According to some embodiments of the invention, the Geminivirus based expression construct is devoid of a polynucleotide sequence encoding a C2 and C3 coding sequence.
According to some embodiments of the invention, the Geminivirus based expression construct comprises a polynucleotide sequence encoding the molecule of interest, the polynucleotide sequence being flanked by a non-contiguous nucleic acid sequence encoding a Geminivirus replicase.
According to an aspect of some embodiments of the present invention there is provided a Geminivirus based expression construct, capable of systemic symptomless spread in a plant host, the expression construct being devoid of a polynucleotide sequence encoding a C2 and C3 coding sequence.
According to an aspect of some embodiments of the present invention there is provided a method of expressing a molecule of interest in a plant cell comprising introducing into the plant tissue the nucleic acid construct the present invention, the heterologous polypeptide being the molecule of interest, thereby expressing a molecule of interest in a plant cell.
According to some embodiments of the invention, the expression construct comprises:
(i) a polynucleotide sequence encoding a Geminivirus intergenic region (IR);
(ii) a polynucleotide sequence encoding a modified Geminivirus coat protein (CP); and
(iii) a polynucleotide sequence encoding a modified Geminivirus precoat protein (V2).
According to some embodiments of the invention, the expression construct further comprises a polynucletotide sequence encoding a modified replicase protein (C1).
According to some embodiments of the invention, the modified replicase protein is as set forth in SEQ ID NO: 36.
According to some embodiments of the invention, the expression construct further comprises a polynucletotide sequence encoding a modified C4 protein.
According to some embodiments of the invention, the expression construct is capable of replication in a prokaryotic cell.
According to some embodiments of the invention, the expression construct is incapable of plant to plant transmission by an insect vector.
According to some embodiments of the invention, the expression construct further comprises a heterologous polynucleotide sequence.
According to some embodiments of the invention, the heterologous polynucleotide is larger than 1 kb.
According to some embodiments of the invention, the heterologous polynucleotide is larger than 5 kb.
According to some embodiments of the invention, the heterologous polynucleotide comprises an operon.
According to some embodiments of the invention, the heterologous polynucleotide is adapted for gene silencing.
According to some embodiments of the invention, the expression construct comprises a bacterial polynucleotide sequence.
According to some embodiments of the invention, the modified Geminivirus V2 protein is as set forth in SEQ ID NO: 6.
According to some embodiments of the invention, the modified Geminivirus coat protein comprises an amino acid sequence as set forth in SEQ ID NO: 3.
According to some embodiments of the invention, the modified Geminivirus coat protein comprises a mutation or deletion in nucleotides encoding an N-terminal 100 amino acids.
According to some embodiments of the invention, the expression construct comprises a polynucleotide sequence as set forth in SEQ ID NO: 10 or 11.
According to some embodiments of the invention, the heterologous polynucleotide encodes a polypeptide selected from the group consisting of a reporter molecule, an antiviral molecule, a viral moiety, an antifungal molecule, an antibacterial molecule, an insect resistance molecule, a herbicide resistance molecule, a biotic or abiotic stress tolerance molecule, a pharmaceutical molecule, a growth inducing molecule, and a growth inhibiting molecule.
According to some embodiments of the invention, the Geminivirus is a begomovirus.
According to some embodiments of the invention, the Geminivirus is a Tomato yellow leaf curl virus (TYLCV).
According to some embodiments of the invention, the expression construct is adapted for expression in a plant host selected from the group consisting of Solanaceae, Cucurbitaceae, Umbelliferae, Liliacae, Gramineae (Poaceae), Rosaceae, Musaceae, Vitacea, and Cruciferae.
According to some embodiments of the invention, the molecule of interest is selected from the group consisting of a reporter molecule, an antiviral molecule, a viral moiety, an antifungal molecule, an antibacterial molecule, an insect resistance molecule, a herbicide resistance molecule, a biotic or abiotic stress tolerance molecule, a pharmaceutical molecule, a growth inducing molecule, a product of genes in a metabolic pathway and a growth inhibiting molecule.
According to some embodiments of the invention, the genes in the metabolic pathway are encoded by an operon.
According to some embodiments of the invention, the plant is selected from the group consisting of a Solanaceae, a Cucurbitaceae, an Umbelliferae, a Liliacae, a Gramineae (Poaceae), a Rosaceae Musaceae, Vitacea and a Cruciferae.
Unless otherwise defined, all technical and/or scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention pertains. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of embodiments of the invention, exemplary methods and/or materials are described below. In case of conflict, the patent specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and are not intended to be necessarily limiting.
Some embodiments of the invention are herein described, by way of example only, with reference to the accompanying drawings. With specific reference now to the drawings in detail, it is stressed that the particulars shown are by way of example and for purposes of illustrative discussion of embodiments of the invention. In this regard, the description taken with the drawings makes apparent to those skilled in the art how embodiments of the invention may be practiced.
In the drawings:
The present invention, in some embodiments thereof, relates to Gemini-virus constructs capable of symptomless, systemic spread in plant hosts and methods of expressing molecules of interest using same.
Before explaining at least one embodiment of the invention in detail, it is to be understood that the invention is not necessarily limited in its application to the details set forth in the following description or exemplified by the Examples. The invention is capable of other embodiments or of being practiced or carried out in various ways.
Tomato yellow leaf curl virus (TYLCV) is a monopartite begomovirus. It carries six overlapping open reading frames (ORFs) transcribed bi-directionally from an intergenic region (IR; also termed “common region”), serving as the viral origin of replication and as a bi-directional promoter. The IR is about 300-bp long and carries the universal motif TAATATT/AC [SEQ ID NO: 9] and a binding site for the replicase-associated protein (REP). Two ORFs are expressed in viral orientation (V/, V2) and four ORFs in the complementary orientation (C1 to C4).
Whilst analyzing the relevance of the genes of the TYLCV, the present inventors found that the virally oriented (sense) genes V1 and V2, together with the viral integration region (IR), were sufficient for the virus's dsDNA replication (dsDNA to dsDNA), its mobilization throughout the plant and the expression of its genes. This was particularly surprising in light of the fact that mutations in C4 were previously shown to result in lack of systemic spread and reduce levels of virus in tomato plants, and C4 was therefore considered to be associated with movement (Jupin et al. (1994) Virology 204, 82-90).
However, the present inventors found that a 1486-bp IR-V2-CP fragment, devoid of functional C1, C2, C3 and C4, was able to promote DNA replication and mobilization, but to exclude the rolling-circle phase of replication. Accordingly, this fragment prevented synthesis of single-stranded (ss) DNA. Consequently, replication, mobilization and expression occurred without causing disease symptoms.
Whilst reducing the present invention to practice, the present inventors showed that this construct could be used to express foreign DNA in a plant (
In addition, the present inventors discovered that geminivirus based expression vectors which are capable of systemic symptomless spread in a plant host are capable of being absorbed into a plant via its roots (
Thus, according to one aspect of the present invention there is provided a Geminivirus based expression construct, capable of systemic symptomless spread in a plant host, the expression construct being devoid of a polynucleotide sequence encoding a C2 and C3 coding sequence.
As used herein, the phrase “systemic symptomless spread” refers to the ability of the plant virus-based vector of the present invention to spread, for example, into leaves not serving as the site of infection without inducing the characteristic geminivirus symptoms such as leaf yellowing, leaf curling, stunting of plant growth, or development of flowers or fruit.
Examples of susceptible host species include Cynanchum acutum, Datura stramonium, Hyoscyamus desertorum, Lens culinaris, Lycopersicon esculentum, Lycopersicon pimpinellifolium, Malva nicaensis, Malva parviflora, Nicotiana benthamiana, Nicotiana glutinosa, Nicotiana tabacum, Phaseolus vulgaris and Sonchus oleraceus, as well as insusceptible host species such as Abelmoschus esculentus, Althaea rosea, Amaranthus retroflexus, Arachis hypogaea, Atriplex, Beta vulgaris, Calotropis aegyptia, Capparis aegyptia, Chenopodium amaranticolor, Cucumis sativus, Gomphrena globosa, Gossypium hirsutum, Hibiscus rosa-sinensis, Lavatera cretica, Lonicera, Lycium, Medicago sativa, Momordica balsamina, Nerium oleander, Nicotiana rustica, Ochradenus baccatus, Physalis floridana, Pisum sativum, Plumbago capensis, Polygonum equisetiforme, Portulaca oleracea, Prosopis farcta, Ricinus communis, Solanum incanum, Solanum villosum, Tamarix, Tribulus, Vicia faba, Withania somnifera, Xanthium strumarium and Zinnia elegans.
Additional susceptible and insusceptible hosts are listed in http://pheneDOTcpmcDOTcolumbiaDOTedu/ICTVdB/29030000.htm
Preferred Geminiviruses which can be used with the present invention include the tomato yellow leaf curl virus (TYLCV) as well as other Begomoviruses (see, pheneDOTcpmcDOTcolumbia.edu/ICTVdB/29030000.htm). It will be appreciated that although some of the terminology utilized herein refers to the genes encoded by TYLCV, one of ordinary skill in the art would be more than capable of identifying and utilizing the genetic orthologues of other geminivirus species and strains.
As mentioned, the nucleic acid constructs of the present invention are devoid of functional C1, C2, C3 and C4 coding sequences. According to one embodiment, the construct is devoid of C2 and C3 coding sequences.
According to one embodiment, the nucleic acid construct of the present invention comprises modifications in the C1 and C4 genes. These modifications may be conservative or non-conservative.
According to one embodiment of this aspect of the present invention, the modifications in the C1 and C4 genes are such that the proteins encoded by same are non-functioning. Thus, the modification may be a truncation, a point mutation, a frame shift mutation, a partial deletion or a full deletion.
Accordingly, the present invention contemplates a construct which comprises a truncated C1 sequence (SEQ ID NO: 36) and a truncated C4 sequence (SEQ ID NO: 38) and is devoid of C2 and C3 completely.
According to another embodiment of this aspect of the present invention, the nucleic acid construct of the present invention comprises modifications in the V1 gene (encoding the coat protein (CP)) and/or the V2 (encoding the precoat protein) gene.
For example, the part of the CP that is involved in viral movement and systemic spread in plants has been mapped to the C-terminal part of the CP (Noris. et. al.(1998) J. Virol. 72, 10050-10057). Accordingly, the present invention contemplates altering the N-terminal part of the CP in some cases. In an exemplary embodiment of the invention, 60 nucleotides (corresponding to positions 552-612) of the TYLCV may be deleted, causing the removal of 20 amino acids (positions 27 to 46) from the native viral CP. The resultant CP would still carry a bipartite nuclear-localization signal (NLS; amino acids 1-20), although a third part (KRR at position 41-43) of what may have been a tripartite NLS would be removed.
According to one embodiment, the sequence of the CP is as set forth in SEQ ID NO: 34.
Alternatively, or additionally, point mutations may be introduced by single-base deletion into the V2 gene. For example, a single-base deletion may be introduced at position 640 of the native TYLCV-DNA, causing a frameshift which may be corrected for—for example by adding a G to position 744 of the native viral DNA. Due to the resultant frameshift, a stretch of amino acids residing between positions 56 and 91 of the native CP would become different, with no apparent similarity to the corresponding stretch (positions 926 to 1031) of IR-V2-CP. Beyond that point, however, the CP sequences of TYLCV and IR-V2-CP would be almost identical. Due to the changes in amino acids 56 to 91, the conserved sequence GCEGPCKVQS (SEQ ID NO: 33), carried by all geminoviruses tested to date (Kirthi et al. (2003) Arch. Virol. 148, 2369-2380), would be missing from IR-V2-CP. In many viruses (but not TYLCV), this sequence is part of a zinc-finger motif required for attachment to single-stranded (ss) DNA (apparently for encapsidation), a property that is redundant for a vector. Deletion at the N terminus of the CP typically results in a deletion at the C terminus of the overlapping ORF V2 (“pre-coat”). Thus, for example, the present invention contemplates constructs comprising a V2 gene as set forth in SEQ ID NO: 37, encoding the polypeptide sequence as set forth in SEQ ID NO: 6.
It will be appreciated that in order for the expression construct of the present invention to be expressed, the expression construct typically comprises an IR region. This region serves, amongst other things as a bi-directional promoter.
The IR derived sequence can include for example, a nucleotide region defined by coordinates 1-314 or 62-314 of TYLCV (GenBank Accession number X15656). For example, the IR derived sequence may be set forth in SEQ ID NO: 35.
The present invention also contemplates modifications in the IR region. Typically, these modifications do not affect the promoter region or the ability of the IR to direct expression in a plant over an extended period of time in the plant (e.g. longer than one month, 3 months, 6 months 1 year or even over the entire lifetime of the plant).
One example of an IR region which can be targeted for modification is the replication-associated protein binding domain (Akbar Behjatnia et al. Nucleic Acids Research, 1998, Vol. 26, No. 4, 925-931).
The aforedescribed alterations are all consistent with a disarmed dsDNA construct which is capable of replicating (dsDNA to dsDNA) by attracting the host machinery to its origin of replication and retaining its mobility, but with no ability to produce progeny viral ssDNA.
An exemplary construct of the present invention is set forth in SEQ ID NO: 11, comprising an IR region, a V2 gene and a CP gene only (see
As is further detailed in the Examples section which follows, the above described construct can be carried out using molecular techniques such as PCR which are well known to the ordinary skilled artisan.
Preferably, the nucleic acid construct of the present invention carries one or more polynucleotide insertions so as to provide additional features to the nucleic acid construct of the present invention. Such an insertion can be several nucleotides, to several thousand nucleotides long. The insert can include a complete eukaryotic or prokaryotic expression vector a polylinker insert or a molecule having a biological activity. In any case, it should be noted that the nucleic acid construct of the present invention can carry inserts which increase the final geminivirus by 20-100% and as much as 200% beyond that of a wild type genome and yet, the nucleic acid construct of the present invention is capable of efficiently spreading throughout the host plant. The insert can encode alternative or additional functions including for example, bacterial replication, antibiotic resistance, affinity purification tags and the like.
One preferred use for the nucleic acid constructs of the present invention is plant expression of a polynucleotide or a polypeptide of interest. The polynucleotide which encodes the molecule of interest may be inserted into the expression construct described herein, wherein the IR region of the construct serves as a promoter therefore—see for example
Co-administration of the transactivatable expression vector together with the construct of the present invention would result in expression of the molecule of interest (see for example
One of ordinary skill in the art is familiar with nucleic acids or proteins whose expression, controlled by the expression vector of the present invention, is advantageous. Furthermore, the skilled artisan is familiar with genes whose repression or deletion, by means of expression of, for example, a suitable double-stranded RNA, or an antisense RNA, would lead to a desired effect.
Nucleic acid sequences whose expression under the control of the expression vector of the present invention has advantageous effects are exemplified below.
The expressed polynucleotide sequence can encode a molecule which would protect the plant from abiotic stress factors such as drought, heat or chill. Examples include antifreeze polypeptides from Myoxocephalus Scorpius (WO 00/00512), Myoxocephalus octodecemspinosus, the Arabidopsis thaliana transcription activator CBF1, glutamate dehydrogenases (WO 97/12983, WO 98/11240), calcium-dependent protein kinase genes (WO 98/26045), calcineurins (WO 99/05902), casein kinase from yeast (WO 02/052012), farnesyltransferases (WO 99/06580; Pei Z M et al. (1998) Science 282:287-290), ferritin (Deak M et al. (1999) Nature Biotechnology 17:192-196), oxalate oxidase (WO 99/04013; Dunwell J M (1998) Biotechn Genet Eng Rev 15:1-32), DREB1A factor (“dehydration response element B 1A”; Kasuga M et al. (1999) Nature Biotech 17:276-286), genes of mannitol or trehalose synthesis such as trehalose-phosphate synthase or trehalose-phosphate phosphatase (WO 97/42326) or by inhibiting genes such as trehalase (WO 97/50561).
The expressed polynucleotide sequence could be a metabolic enzyme for use in the food-and-feed sector. Examples include, phytases (GenBank Acc. No.: A19451) and cellulases.
The expressed polynucleotide sequence can confer resistance to viruses, fungi, insects, nematodes and diseases, by directly attacking the pathogen, turning on the host defenses or by leading to an accumulation of certain metabolites or proteins. Examples of include glucosinolates (defense against herbivores), chitinases or glucanases and other enzymes which destroy the cell wall of parasites, ribosome-inactivating proteins (RIPS) and other proteins of the plant resistance and stress reaction as are induced when plants are wounded or attacked by microbes, or chemically, by, for example, salicylic acid, jasmonic acid or ethylene, or lysozymes from nonplant sources such as, for example, T4-lysozyme or lysozyme from a variety of mammals, insecticidal proteins such as Bacillus thuringiensis endotoxin, α-amylase inhibitor or protease inhibitors (cowpea trypsin inhibitor), lectins such as wheatgerm agglutinin, siRNA, antisense RNA, RNAses or ribozymes. Further examples are nucleic acids which encode the Trichoderma harzianum chit42 endochitinase (GenBank Acc. No.: 578423) or the N-hydroxylating, multi-functional cytochrome P-450 (CYP79) protein from Sorghum bicolor (GenBank Acc. No.: U32624), or functional equivalents thereof.
Accumulation of glucosinolates as protection from pests (Rask L et al. (2000) Plant Mol Biol 42:93-113; Menard R et al. (1999) Phytochemistry 52:29-35), the expression of Bacillus thuringiensis endotoxins (Vaeck et al. (1987) Nature 328:33-37) or the protection against attack by fungi, by expression of chitinases, for example from beans (Broglie et al. (1991) Science 254:1194-1197), is advantageous. Resistance to pests such as, for example, the rice pest Nilaparvata lugens in rice plants can be achieved by expressing the snowdrop (Galanthus nivalis) lectin agglutinin (Rao et al. (1998) Plant J 15(4):469-77).
The expression of synthetic cryIA(b) and cryIA(c) genes, which encode lepidoptera-specific Bacillus thuringiensis delta-endotoxins can bring about a resistance to insect pests in various plants (Goyal R K et al. (2000) Crop Protection 19(5):307-312).
Additional genes which are suitable for pathogen defense comprise “polygalacturonase-inhibiting protein” (PGIP), thaumatine, invertase and antimicrobial peptides such as lactoferrin (Lee T J et al. (2002) J Amer Soc Horticult Sci 127(2):158-164).
The expressed polynucleotide sequence can bring about an accumulation of chemicals such as of tocopherols, tocotrienols or carotenoids. One example of such a polynucleotide is phytoene desaturase. Preferred are nucleic acids which encode the Narcissus pseudonarcissus photoene desaturase (GenBank Acc. No.: X78815) or functional equivalents thereof.
The expressed polynucleotide sequence can be used for production of nutraceuticals such as, for example, polyunsaturated fatty acids (arachidonic acid, eicosapentaenoic acid or docosahexaenoic acid) examples include, fatty acid elongases and/or desaturases, or for production of proteins with improved nutritional value such as, for example, with a high content of essential amino acids (for example the high-methionine 2S albumin gene of the brazil nut). Preferred are polynucleotide sequence which encode the Bertholletia excelsa high-methionine 2S albumin (GenBank Acc. No.: AB044391), the Physcomitrella patens delta6-acyl-lipid desaturase (GenBank Acc. No.: AJ222980; Girke et al. (1998) Plant J 15:39-48), the Mortierella alpina delta6-desaturase (Sakuradani et al. 1999 Gene 238:445-453), the Caenorhabditis elegans delta5-desaturase (Michaelson et al. 1998, FEBS Letters 439:215-218), the Caenorhabditis elegans A5-fatty acid desaturase (des-5) (GenBank Acc. No.: AF078796), the Mortierella alpina delta5-desaturase (Michaelson et al. JBC 273:19055-19059), the Caenorhabditis elegans delta6-elongase (Beaudoin et al. 2000, PNAS 97:6421-6426), the Physcomitrella patens delta6-elongase (Zank et al. 2000, Biochemical Society Transactions 28:654-657), or functional equivalents of these.
The expressed polynucleotide sequence can be used for production of high-quality proteins and enzymes for industrial purposes (for example enzymes, such as lipases) or as pharmaceuticals (such as, for example, antibodies, blood clotting factors, interferons, lymphokins, colony stimulation factor, plasminogen activators, hormones or vaccines, as described by Hood E E, Jilka J M (1999) Curr Opin Biotechnol 10(4):382-6; Ma J K, Vine N D (1999) Curr Top Microbiol Immunol 236:275-92). For example, it has been possible to produce recombinant avidin from chicken albumen and bacterial P-glucuronidase (GUS) on a large scale in transgenic maize plants (Hood et al. (1999) Adv Exp Med Biol 464:127-47. Review).
The expressed polynucleotide sequence can be used for obtaining an increased storability in cells which normally comprise fewer storage proteins or storage lipids, with the purpose of increasing the yield of these substances. Examples include, acetyl-CoA carboxylase. Preferred polynucleotide sequence are those which encode the Medicago sativa acetyl-CoA carboxylase (accase) (GenBank Acc. No.: L25042), or functional equivalents thereof.
Additional examples of expressible polynucleotides include Hepatitis B surface antigen [Kumar GBS et al., PLANTA 222 (3): 484-493, 2005], herbicide resistance [Duke, S O, Pest Management Science 61:211-218, 2005], interferon [Edelbaum, O. et al., J. Interferon Res. 12: 449-453, 1992], T7-RNA polymerase [Zeitoune et al., Plant Science 141:59-65., 1997].
Further examples of polynucleotide sequence which can be expressed by the expression vector of the present invention are mentioned for example in Dunwell J M, Transgenic approaches to crop improvement, J Exp Bot. 2000; 51 pages 487-96.
The expression vector of the present invention can also be employed for the reduction (suppression) of transcription and/or translation of target genes. Thus, the expression vector of the present invention can express nucleic acids which bring about PTGS (post transcriptional gene silencing) or TGS (transcriptional silencing) effects and thus a reduction of the expression of endogenous genes. Such reduction can be achieved for example by expression of an antisense RNA (EP-A1 0 458 367; EP-A1 0 140 308; van der Krol A R et al. (1988) BioTechniques 6(10):658-676; de Lange P et al. (1995) Curr Top Microbiol Immunol 197:57-75, inter alia) or of a double-stranded RNA, each of which has homology with the endogenous target gene to be suppressed. Also, the expression of a suitable sense RNA can bring about a reduction of the expression of endogenous genes, by means of what is known as co-suppression (EP-A1 0 465 572). Especially preferred is the expression of a double-stranded small interfering RNA (siRNA) for reducing the gene expression of a target gene via RNA interference (RNAi). WO 99/32619 and WO 99/53050 describe methods for inhibiting individual target genes using an RNA with double-stranded structure, where the target gene and the region of the RNA duplex have at least partial identity (see also: Montgomery M K et al. (1998) Proc Natl Acad Sci USA 95:15502-15507; Sharp P A (1999) Genes & Development 13(2):139-141; Fire A et al. (1998) Nature 391:806-11).
The following exemplifies applications where reduction of gene expression can be employed using the expression vector of the present invention.
Delayed fruit maturation or a modified maturation phenotype (prolonged maturation, later senescence) can be achieved for example by reducing the gene expression of genes selected from the group consisting of polygalacturonases, pectin esterases, beta.-(1,4)glucanases (cellulases), beta.-galactanases (.beta.-galactosidases), or genes of ethylene biosynthesis, such as 1-aminocyclopropane-1-carboxylate synthase, adenosylmethionine hydrolase (SAMase), aminocyclopropane-1-carb-oxylate deaminase, aminocyclopropane-1-carboxylate oxidase, genes of carotenoid biosynthesis such as, for example, genes of pre-phytoene biosynthesis or phytoene biosynthesis, for example phytoene desaturases, and O-methyltransferases, acyl carrier protein (ACP), elongation factor, auxin-induced gene, cysteine(thiol) proteinases, starch phosphorylases, pyruvate decarboxylases, chalcone reductases, protein kinases, auxin-related gene, sucrose transporters, meristem pattern gene. Further advantageous genes are described for example in WO 91/16440, WO 91/05865, WO 91/16426, WO 92/17596, WO 93/07275 or WO 92/04456. Especially preferred is the reduction of the expression of polygalacturonase for the prevention of cell degradation and mushiness of plants and fruits, for example tomatoes. Nucleic acid sequences such as that of the tomato polygalacturonase gene (GenBank Acc. No.: x14074) or its homologs are preferably used for this purpose.
Improved protection against abiotic stress factors (heat, chill, drought, elevated moisture, pollutants, UV radiation). It is preferred to reduce the expression of genes which are implicated in stress reactions.
The reduction of the gene expression of genes encoding storage proteins (hereinbelow SPs) has numerous advantages, such as, for example, the reduction of the allergenic potential or modification regarding composition or quantity of other metabolites, such as, for example, oil or starch content.
Resistance to plant pathogens such as arachnids, fungi, insects, nematodes, protozoans, viruses, bacteria and diseases can be achieved by reducing the gene expression of genes which are essential for the growth, survival, certain developmental stages (for example pupation) or the multiplication of a specific pathogen. Such a reduction can bring about a complete inhibition of the abovementioned steps, or else a delay of same. They can take the form of plant genes which for example make possible the penetration of the pathogen, but may also be homologous pathogen genes. The transgenically expressed nucleic acid sequence (for example the double-stranded RNA) is preferably directed against genes of the pathogen. The antipathogenic agent which acts may be, in this context, the transgenically expressed nucleic acid sequence itself (for example the double-stranded RNA), but also the transgenic expression cassettes or transgenic organisms. The plants themselves, in the form of a transgenic organism, may contain the agents and pass them on to the pathogens, for example in the form of a stomach poison. Various essential genes of a variety of pathogens are known to the skilled artisan (for example for nematode resistance WO 93/10251, WO 94/17194).
Virus resistance can be achieved for example by reducing the expression of a viral coat protein, a viral replicase, a viral protease and the like. A large number of plant viruses and suitable target genes are known to the skilled artisan.
Reduction of undesired, allergenic or toxic plant constituents such as, for example, glucosinolates or patatin. Suitable target genes are described (in WO 97/16559, inter alia). The target genes which are preferred for reduction of allergenic proteins are described for example by Tada Y et al. (1996) FEBS Lett 391(3):341-345 or Nakamura R (1996) Biosci Biotechnol Biochem 60(8):1215-1221.
Delayed signs of senescence. Suitable target genes are, inter alia, cinnamoyl-CoA:NADPH reductases or cinnamoyl-alcohol dehydrogenases. Further target genes are described (in WO 95/07993, inter alia).
Reduction of the susceptibility to bruising of, for example, potatoes by reducing for example polyphenol oxidase (WO 94/03607) and the like.
Increase of the methionine content by reducing threonine biosynthesis, for example by reducing the expression of threonine synthase (Zeh M et al. (2001) Plant Physiol 127(3):792-802).
It will be appreciated that the nucleic acid construct of the present invention can also express homologues of the above described molecules that exhibit the desired activity (i.e., the biological activity). Such homologues can be, for example, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%, identical to any of the expressed sequences described above as determined using the BestFit software of the Wisconsin sequence analysis package, utilizing the Smith and Waterman algorithm, where gap weight equals 50, length weight equals 3, average match equals 10, and average mismatch equals −9.
Thus, the present invention provides a geminivirus based nucleic acid construct which spreads systemically throughout the host plant and yet does not induce symptoms therein.
In summary, the nucleic acid construct of the present invention can be utilized for any purpose. Examples of uses include the following:
(i) plant expression of proteins (specific examples provided hereinabove) for various purposes including plant improvement, biopharming etc;
(ii) plant expression of nucleic acid molecules (e.g. siRNA, specific examples provided hereinabove);
(iii) produce indicator plants which detect viral infection—a plant carrying a construct including a reporter molecule (e.g. fluorophore) attached to the IR region would express the reporter in when infected by a geminivirus; and
(iv) produce infection-resistant plants—a plant carrying a construct including an anti-viral or anti-plant molecule attached, for example, to the IR region would express such a molecule when infected by a geminivirus; such “immunity” or suicide scheme would only be active when the plant is infected; since the nucleic acid constructs of the present invention are preferably transient and not stably integrated into a genome of the host plant, such a trait would not be inherited by the progeny of the plant nor would it persist in commercial products of the plant.
The nucleic acid construct of the present invention can be utilized to stably or preferably transiently transform plant cells. In stable transformation, the nucleic acid molecule of the present invention is integrated into the plant genome, and as such it represents a stable and inherited trait. In transient transformation, the nucleic acid molecule is expressed by the cell transformed but not integrated into the genome, and as such represents a transient trait.
There are various methods of introducing foreign genes into both monocotyledonous and dicotyledonous plants (Potrykus, I. (1991). Annu Rev Plant Physiol Plant Mol Biol 42, 205-225; Shimamoto, K. et al. (1989). Fertile transgenic rice plants regenerated from transformed protoplasts. Nature (1989) 338, 274-276).
The principal methods of the stable integration of exogenous DNA into plant genomic DNA includes two main approaches:
(i) Agrobacterium-mediated gene transfer. See: Klee, H. J. et al. (1987). Annu Rev Plant Physiol 38, 467-486; Klee, H. J. and Rogers, S. G. (1989). Cell Culture and Somatic Cell Genetics of Plants, Vol. 6, Molecular Biology of Plant Nuclear Genes, pp. 2-25, J. Schell and L. K. Vasil, eds., Academic Publishers, San Diego, Cal.; and Gatenby, A. A. (1989). Regulation and Expression of Plant Genes in Microorganisms, pp. 93-112, Plant Biotechnology, S. Kung and C. J. Arntzen, eds., Butterworth Publishers, Boston, Mass.
(ii) Direct DNA uptake. See, e.g.: Paszkowski, J. et al. (1989). Cell Culture and Somatic Cell Genetics of Plants, Vol. 6, Molecular Biology of Plant Nuclear Genes, pp. 52-68, J. Schell and L. K. Vasil, eds., Academic Publishers, San Diego, Cal.; and Toriyama, K. et al. (1988). Bio/Technol 6, 1072-1074 (methods for direct uptake of DNA into protoplasts). See also: Zhang et al. (1988). Plant Cell Rep 7, 379-384; and Fromm, M. E. et al. (1986). Stable transformation of maize after gene transfer by electroporation. Nature 319, 791-793 (DNA uptake induced by brief electric shock of plant cells). See also: Klein et al. (1988). Bio/Technology 6, 559-563; McCabe, D. E. et al. (1988). Stable transformation of soybean (Glycine max) by particle acceleration. Bio/Technology 6, 923-926; and Sanford, J. C. (1990). Biolistic plant transformation. Physiol Plant 79, 206-209 (DNA injection into plant cells or tissues by particle bombardment). See also: Neuhaus, J. M. et al. (1987). Theor Appl Genet. 75, 30-36; and Neuhaus, J. M. and Spangenberg, G. C. (1990). Physiol Plant 79, 213-217 (use of micropipette systems). See U.S. Pat. No. 5,464,765 (glass fibers or silicon carbide whisker transformation of cell cultures, embryos or callus tissue). See also: DeWet, J. M. J. et al. (1985). “Exogenous gene transfer in maize (Zea mays) using DNA-treated pollen,” Experimental Manipulation of Ovule Tissue, G. P. Chapman et al., eds., Longman, N.Y.-London, pp. 197-209; and Ohta, Y. (1986). High-Efficiency Genetic Transformation of Maize by a Mixture of Pollen and Exogenous DNA. Proc Natl Acad Sci USA 83, 715-719 (direct incubation of DNA with germinating pollen).
The Agrobacterium-mediated system includes the use of plasmid vectors that contain defined DNA segments which integrate into the plant genomic DNA. Methods of inoculation of the plant tissue vary depending upon the plant species and the Agrobacterium delivery system. A widely used approach is the leaf-disc procedure, which can be performed with any tissue explant that provides a good source for initiation of whole-plant differentiation (Horsch, R. B. et al. (1988). “Leaf disc transformation.” Plant Molecular Biology Manual A5, 1-9, Kluwer Academic Publishers, Dordrecht). A supplementary approach employs the Agrobacterium delivery system in combination with vacuum infiltration. The Agrobacterium system is especially useful for in the creation of transgenic dicotyledenous plants.
There are various methods of direct DNA transfer into plant cells. In electroporation, the protoplasts are briefly exposed to a strong electric field, opening up mini-pores to allow DNA to enter. In microinjection, the DNA is mechanically injected directly into the cells using micropipettes. In microparticle bombardment, the DNA is adsorbed on microprojectiles such as magnesium sulfate crystals or tungsten particles, and the microprojectiles are physically accelerated into cells or plant tissues. Additional direct DNA transfer techniques include glass or silicone carbide whiskers (see, for example, Dunwell, Methods Mol. Biol. 1999; 111:375-82).
Following stable transformation, plant propagation then occurs. The most common method of plant propagation is by seed. The disadvantage of regeneration by seed propagation, however, is the lack of uniformity in the crop due to heterozygosity, since seeds are produced by plants according to the genetic variances governed by Mendelian rules. In other words, each seed is genetically different and each will grow with its own specific traits. Therefore, it is preferred that the regeneration be effected such that the regenerated plant has identical traits and characteristics to those of the parent transgenic plant. The preferred method of regenerating a transformed plant is by micropropagation, which provides a rapid, consistent reproduction of the transformed plants.
Micropropagation is a process of growing second-generation plants from a single tissue sample excised from a selected parent plant or cultivar. This process permits the mass reproduction of plants having the preferred tissue and expressing a fusion protein. The newly generated plants are genetically identical to, and have all of the characteristics of, the original plant. Micropropagation allows for mass production of quality plant material in a short period of time and offers a rapid multiplication of selected cultivars with preservation of the characteristics of the original transgenic or transformed plant. The advantages of this method of plant cloning include the speed of plant multiplication and the quality and uniformity of the plants produced.
Micropropagation is a multi-stage procedure that requires alteration of culture medium or growth conditions between stages. The micropropagation process involves four basic stages: stage one, initial tissue culturing; stage two, tissue culture multiplication; stage three, differentiation and plant formation; and stage four, greenhouse culturing and hardening. During stage one, the tissue culture is established and certified contaminant-free. During stage two, the initial tissue culture is multiplied until a sufficient number of tissue samples are produced to meet production goals. During stage three, the newly grown tissue samples are divided and grown into individual plantlets. At stage four, the transformed plantlets are transferred to a greenhouse for hardening where the plants' tolerance to light is gradually increased so that they can continue to grow in the natural environment.
Transient transformation of, for example, leaf cells, meristematic cells, or the whole plant is also envisaged by the present invention.
Transient transformation can be effected by any of the direct DNA transfer methods described above or by mechanical or vector mediated viral infection using the plant viruses derived plasmid of the present invention.
As mentioned, the constructs of the present invention may also be transformed into a plant via grafting a section of one plant which comprises the construct onto a section of another plant. Alternatively, the constructs of the present invention may be transformed into a plant by soaking its roots into a solution comprising the construct.
Thus, according to another aspect of the present invention there is provided a method of expressing a molecule of interest in a plant, the method comprising contacting roots of the plant in a solution comprising at least one Geminivirus based expression construct so as to allow the at least one Geminivirus based expression construct to be absorbed by the roots, the expression construct comprising a polynucleotide encoding the molecule of interest, and further the expression construct being capable of systemic symptomless spread in a plant host, thereby expressing a molecule of interest in a plant.
According to yet another aspect of the present invention there is provided a method of expressing a molecule of interest in a plant, the method comprising grafting a section of a first plant infected with at least one Geminivirus based expression construct onto a section of a second plant, the expression construct comprising a polynucleotide sequence which encodes the molecule of interest, and further the Geminivirus based expression construct being capable of systemic symptomless spread in a plant host, thereby expressing a molecule of interest in a plant.
As used herein, the term “grafting” refers to the joining together of the parts of plants so that they bind together and the sap can flow, thus forming a new plant that can grow and develop. A graft therefore consists of two parts: (i) the lower part is the rootstock as referred to herein and essentially consists of the root system and a portion of the stem, and (ii) the upper part, the scion or graft, which gives rise to the aerial parts of the plant. It will be appreciated that a single graft can comprise two parts of the same plant of alternatively a single graft can comprise parts of two different plants.
Preferably, the first plant and the second plant are compatible for grafting. As used herein, the term “compatible” refers to the ability of the grafted rootstock and plant tissue to grow together and survive. It is well known that compatible rootstock and plant tissue grafts do not have to be from the same plant species. For example, tomato scions can be grafted onto eggplant rootstock. Transgenic rootstock can be prepared using standard methods.
Grafting can be accomplished using standard materials and methods known in the art. (See, for example, Black et al. (2003); Fernandez-Garcia et al. (2004); Edelstein et al. (2004); see Worldwide Website: wwwdotparamount-seedsdotcom/Paramountonline/graftingdothtm; see Worldwide Website: wwwdotagnetdotorg/library/article/eb480 dothtml).
Exemplary plants which can be grafted according to this aspect of the present invention include dicotyledonous plants, such as, for example, peas, alfalfa, tomato, tomatillo, melon, chickpea, chicory, clover, kale, lentil, soybean, tobacco, potato, sweet potato, radish, cabbage, rape, apple trees, grape, cotton, sunflower, citrus (including orange, mandarin, kumquat, lemon, lime, grapefruit, tangerine, tangelo, citron, and pomelo), pepper, bean, and lettuce. Plants within the scope of the present invention also include conifers.
Examples of tomato rootstock that can be used to prepare pathogen resistant transgenic rootstock includes, but is not limited to, “PG3” and “Beaufort.” Examples of tomato cultivars that can be used to provide scions for the present invention include, but are not limited to, “Monroe,” “Belle,” Summer Set,” “Match,” Trust,” “Better Boy,” “Celebrity,” “Grace,” “Heinz 1439,” “Roma,” “Rugers,” “Ultra Girl,” “2710,” “BHN 665,” “STM 0227,” “STM 5206,” “Boy oh Boy,” “Jubilation,” “Sunchief,” and “Fabulous.”
Contemplated geminivirus based expression constructs that may be grafted from one plant to another or soaked up by plant roots are those described herein above and further those described in International Patent Application WO2007/141790.
The terms “comprises”, “comprising”, “includes”, “including”, “having” and their conjugates mean “including but not limited to”.
The term “consisting of means “including and limited to”.
The term “consisting essentially of” means that the composition, method or structure may include additional ingredients, steps and/or parts, but only if the additional ingredients, steps and/or parts do not materially alter the basic and novel characteristics of the claimed composition, method or structure.
As used herein the term “method” refers to manners, means, techniques and procedures for accomplishing a given task including, but not limited to, those manners, means, techniques and procedures either known to, or readily developed from known manners, means, techniques and procedures by practitioners of the chemical, pharmacological, biological, biochemical and medical arts.
It is appreciated that certain features of the invention, which are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the invention, which are, for brevity, described in the context of a single embodiment, may also be provided separately or in any suitable sub-combination or as suitable in any other described embodiment of the invention. Certain features described in the context of various embodiments are not to be considered essential features of those embodiments, unless the embodiment is inoperative without those elements.
Various embodiments and aspects of the present invention as delineated hereinabove and as claimed in the claims section below find experimental support in the following examples.
EXAMPLESReference is now made to the following examples, which together with the above descriptions illustrate some embodiments of the invention in a non limiting fashion. Reference is now made to the following examples, which together with the above descriptions, illustrate the invention in a non limiting fashion.
Generally, the nomenclature used herein and the laboratory procedures utilized in the present invention include molecular, biochemical, microbiological and recombinant DNA techniques. Such techniques are thoroughly explained in the literature. See, for example, “Molecular Cloning: A laboratory Manual” Sambrook et al., (1989); “Current Protocols in Molecular Biology” Volumes I-III Ausubel, R. M., ed. (1994); Ausubel et al., “Current Protocols in Molecular Biology”, John Wiley and Sons, Baltimore, Md. (1989); Perbal, “A Practical Guide to Molecular Cloning”, John Wiley & Sons, New York (1988); Watson et al., “Recombinant DNA”, Scientific American Books, New York; Birren et al. (eds) “Genome Analysis: A Laboratory Manual Series”, Vols. 1-4, Cold Spring Harbor Laboratory Press, New York (1998); methodologies as set forth in U.S. Pat. Nos. 4,666,828; 4,683,202; 4,801,531; 5,192,659 and 5,272,057; “Cell Biology: A Laboratory Handbook”, Volumes I-III Cellis, J. E., ed. (1994); “Culture of Animal Cells—A Manual of Basic Technique” by Freshney, Wiley-Liss, N.Y. (1994), Third Edition; “Current Protocols in Immunology” Volumes I-III Coligan J. E., ed. (1994); Stites et al. (eds), “Basic and Clinical Immunology” (8th Edition), Appleton & Lange, Norwalk, Conn. (1994); Mishell and Shiigi (eds), “Selected Methods in Cellular Immunology”, W. H. Freeman and Co., New York (1980); available immunoassays are extensively described in the patent and scientific literature, see, for example, U.S. Pat. Nos. 3,791,932; 3,839,153; 3,850,752; 3,850,578; 3,853,987; 3,867,517; 3,879,262; 3,901,654; 3,935,074; 3,984,533; 3,996,345; 4,034,074; 4,098,876; 4,879,219; 5,011,771 and 5,281,521; “Oligonucleotide Synthesis” Gait, M. J., ed. (1984); “Nucleic Acid Hybridization” Hames, B. D., and Higgins S. J., eds. (1985); “Transcription and Translation” Hames, B. D., and Higgins S. J., eds. (1984); “Animal Cell Culture” Freshney, R. I., ed. (1986); “Immobilized Cells and Enzymes” IRL Press, (1986); “A Practical Guide to Molecular Cloning” Perbal, B., (1984) and “Methods in Enzymology” Vol. 1-317, Academic Press; “PCR Protocols: A Guide To Methods And Applications”, Academic Press, San Diego, Calif. (1990); Marshak et al., “Strategies for Protein Purification and Characterization—A Laboratory Course Manual” CSHL Press (1996); all of which are incorporated by reference as if fully set forth herein. Other general references are provided throughout this document. The procedures therein are believed to be well known in the art and are provided for the convenience of the reader. All the information contained therein is incorporated herein by reference.
Methods and MaterialsCloning of TYLCV—A full 2.8-genome-length clone of the Israeli strain of TYLCV (SEQ ID NO: 4 GenBank accession # X15656) was produced as described in Navot, N., et al [Virology 185, 151-161 (1991)].
Construction of IL-60—The IL-60 vector (SEQ ID NO: 2) of the present invention was constructed by making the following changes to the native TYLCV viral vector (SEQ ID NO: 4):
(i) a deletion of a stretch of 60 nucleotides (nos. 552 to 612 of SEQ ID NO: 1) encoding 20 amino acids near the N-terminus of the coat protein, TYLCV-CP (nos. 27 to 46 of SEQ ID NO: 5). Deletion was carried out by inverse PCR in accordance with Livneh, O. et al. [Euphytica 62:97-102 (1992)] using primers directed outward from the ends of the deleted segment [Inverse forward primer (unphosphorylated): OH-acaggcccatagaccgaaagccca; SEQ ID NO: 14, Inverse reverse (phosphorylated): P-tgggctgtcgaagttcagcct; SEQ ID NO: 15]. The self-ligated PCR product was cleaved with SacI to produced a single (linear) product, confirming that a circular form has been made (non-ligated, linear PCR products would have produced two fragments upon cleaving).
(ii) a PCR derived deletion of T in position 640 (of TYLCV) and addition of G at following position 744 thereby generating a frame shift in the TYLCV sequence (SEQ ID NO: 4) encoding positions 56-91 of native TYLCV-CP protein (SEQ ID NO: 5). Frame shift was achieved in 2 steps, first aimed at deleting the T and second at adding the G. The first step aimed at deleting the T at position 640 included two PCR steps, an initial and nested PCR. The initial PCR product was cut with TaqI, and a mutated (missing the T) nested PCR product, which was situated between 2 TaqI restriction sites, was ligated instead of the cut out piece. Initial PCR amplified a 439 bp product flanked with TaqI restriction sites, and possessing two middle TaqI restriction sites. [forward primer: ggctgaacttcgacagcccatacagcagccgtgctgctg (SEQ ID NO: 20), BcefI recognition site is emphasized in bold, TaqI restriction site is underlined; reverse primer: gcggtactgggctcattatatcgaacatatt (SEQ ID NO: 21), BmrI recognition site is emphasized in bold, TaqI restriction sites is underlined]. Nested PCR amplified a product flanked by the same TaqI restriction site at the forward end (using the same forward primer-SEQ ID NO: 20) and another middle TaqI restriction site at the reverse end. The reverse primer also possessed the missing respective T [nested reverse primer: ggcttcgatacattctgtat↑ttctg (SEQ ID NO: 22), TaqI recognition site is emphasized in bold, arrow represents the position of the deleted T]. The initial PCR product was cleaved with TaqI and run on a gel, to obtain 3 bands (from the 2 flanking and 2 middle TaqI restriction sites). The upstream piece, situated between the primers of the nested PCR, was removed. The remaining 2 bands were extracted from the gel and ligated to the mutated PCR product of the nested PCR to obtain the desired sequence (BcfI to TaqI with a missing T). The second step, aimed at adding the G at position 744, involved an initial PCR with primers holding BstDSI (forward) and MaeIII (reverse) restriction sites [forward primer: ctgatgttccccgtggatgtgaaggcccat (SEQ ID NO: 23), BstDSI recognition site is emphasized in bold; reverse primer: ccacgagtaacatcactaacaacCaacaatac (SEQ ID NO: 24), MaeIII recognition site is emphasized in bold, added G (C in the reverse complement) is also emphasized in bold], to obtain a PCR product holding the additional G. The PCR product, and the product of the first step (BcfI to TaqI with a missing T) were cleaved with BstDSI and MaeIII, and the cleavage product was replaced with the PCR product including the added G, by ligation. Finally, IL-60 was cleaved with BceFI and BmrI, a fragment was removed and replaced by the sequence obtained in the steps described above (BcfI to BmrI with a missing T and an added G). iii) a deletion of 45 amino acids at the C terminus of native TYLCV V2 (“pre-coat”-SEQ ID NO: 6), caused by the deletion of the TYLCV CP described hereinabove.
Construction of IL-60-BS—the IL-60-BS vector (SEQ ID NO: 1) of the present invention was constructed by ligating a linearized (Sac I) Bluescript II-KS+ plasmid (Stratagene, La Jolla, Calif., USA) into position 2443 of the IL-60 plasmid (SEQ ID NO: 2), interrupting the rep (rolling circle replication) protein (SEQ ID NO: 7) at position 93, within the N-terminus. The gene coding for C4 (symptom expression) was also interrupted by the BS insertion.
Construction of IR-GUS-pD—The IR-GUS-pD vector (SEQ ID NO: 13) was constructed by amplifying the IR region, pre-coat ORF and a part of the 5′ UTR of the coat protein ORF— (positions 61 to 473 of TYLCV; accession # X15656) using forward primer 933: atacttggacacctaatggc (SEQ ID NO: 29) and reverse primer 934: agtcacgggcccttacaa (SEQ ID NO: 30). This fragment was termed “IR-region”. IR region was T/A cloned into the plasmid pDRIVE, to produce a plasmid called IR-pD (SEQ ID NO: 12). The coding sequence of GUS (bases 1466 to 3274 of GenBank accession #M14641) (SEQ ID NO: 31) was cleaved out of a GUS-carrying plasmid with SacI and SalI and inserted into a SalI/SacI cleaved pDRIVE carrying the aforementioned IR region.
Construction of IR-PRN-pD—The IR-PRN-pD vector was constructed by placing the entire PRN operon (as a single piece carrying all 4 genes) of P. fluorescence (corresponding to bases 424-6165 of GenBank accession # U74493; SEQ ID NO: 32) in place of GUS in IR-GUS-pD.
Propagation of IR-V2-CP, IR-V2-CP-GFP, IL-60 and IR— GUS-pD, and their administration to plants—E. coli cells were transformed with the above described constructs and propagated under ampicillin selection; the construct was extracted using standard procedures. IR-V2-CP was administered directly into plants, without mediation by Agrobacterium. The stem, or leaf petiole, of the recipient plant was punctured by a hypodermic needle. A capillary tube was inserted into the resultant hole, and approximately 2 microgram of DNA (in 100 μl of 5 mM Tris-HCl; pH 8.5) were pipetted into the capillary tube until fully soaked by the plant.
RT-PCR analysis: RT-PCR analysis was carried out according to standard procedures (Sambrook and Russel, 2001). Primers used for analyzing expression of IR-V2-CP-GFP are set forth in Table 1.
Primers used in order to detect GUS were as follows:
Primers used in order to detect PRN was as follows:
Delivery of plasmids to plants by grafting—IL-60-BS and IR-GUS (or IR-PRN) were injected to tobacco and tomato plants as described herein above. Plants in which GUS (or PRN) have been replicated and spread (as indicated by PCR) were set aside for the following grafting experiments.
Scions of tobacco and tomato plants in which IR-GUS or IR-PRN were present, were grafted on untreated tobacco and tomato plants respectively (the rootstocks). The rootstocks were PCR analyzed for GUS and PRN one month following grafting. DNA was extracted from leaves remote from the point of grafting by at least 3 leaves.
Delivery of plasmids to plants by soaking—Roots of seedlings or young plantlets (tomato, tobacco, grapevines) were slightly trimmed. The roots were soaked in a 2-5 μg of each of IL-60-BS and IR-GUS dissolved in water. The plantlets were kept in the solution until all liquid was soaked up. Another volume of water was then added and after it has also been soaked up the plantlets were planted in pots. Replication and spread of GUS was tested periodically by PCR in upper leaves.
Example 1 IR and the Sense Viral Genes (V1 and V2) are Sufficient for Stabilization, Movement and Spread of Artificial Satellites in Plant TissuesIR-carrying satellites are activated to replicate, move and be expressed, either by a helper virus or by the mutated disarmed vector IL-60-BS (see WO2007/141790, incorporated herein by reference). The following example now shows that the sense-transcribed genes of TYLCV alone, under IR regulation, are sufficient for self-replication, movement and expression. This genomic segment can promote replication, movement and expression of IR-carrying satellites in trans as well.
GFP was fused to the 3′ end of CP in the IR-V2-CP construct (
PCR analysis indicated the presence of both TYLCV CP and GFP sequences, as well as TYLCV transcripts in treated plants (
The IR-V2-CP construct can induce replication and movement of another DNA in trans, providing the DNA carries an IR. As shown in
The results are illustrated in
Although the invention has been described in conjunction with specific embodiments thereof, it is evident that many alternatives, modifications and variations will be apparent to those skilled in the art. Accordingly, it is intended to embrace all such alternatives, modifications and variations that fall within the spirit and broad scope of the appended claims.
All publications, patents and patent applications mentioned in this specification are herein incorporated in their entirety by reference into the specification, to the same extent as if each individual publication, patent or patent application was specifically and individually indicated to be incorporated herein by reference. In addition, citation or identification of any reference in this application shall not be construed as an admission that such reference is available as prior art to the present invention. To the extent that section headings are used, they should not be construed as necessarily limiting.
Claims
1. A method of expressing a molecule of interest in a plant, the method comprising contacting roots of the plant in a solution comprising at least one Geminivirus based expression construct so as to allow said at least one Geminivirus based expression construct to be absorbed by said roots, said expression construct comprising a polynucleotide encoding the molecule of interest, and further said expression construct being capable of systemic symptomless spread in a plant host, thereby expressing a molecule of interest in a plant.
2. The method of claim 1, wherein said Geminivirus based expression construct is devoid of a polynucleotide sequence encoding a C2 and C3 coding sequence.
3. A method of expressing a molecule of interest in a plant, the method comprising grafting a section of a first plant infected with at least one Geminivirus based expression construct onto a section of a second plant, said expression construct comprising a polynucleotide sequence which encodes the molecule of interest, and further said Geminivirus based expression construct being capable of systemic symptomless spread in a plant host, thereby expressing a molecule of interest in a plant.
4. The method of claim 3, wherein said Geminivirus based expression construct is devoid of a polynucleotide sequence encoding a C2 and C3 coding sequence.
5. A Geminivirus based expression construct, capable of systemic symptomless spread in a plant host, the expression construct being devoid of a polynucleotide sequence encoding a functional C2 and C3 protein, the construct comprising:
- (i) a polynucleotide sequence encoding a Geminivirus intergenic region (IR);
- (ii) a polynucleotide sequence encoding a modification in a Geminivirus coat protein (CP), wherein said modification comprises a deletion in nucleotides encoding an N-terminal 100 amino acids, wherein a position of said modification results in a deletion in the C-terminal Geminivirus V2 protein.
6. The expression construct of claim 5, being completely devoid of the C2 and C3 coding sequence.
7. The expression construct of claim 5, further comprising a polynucletotide sequence encoding a truncated replicase protein (C1) which results in a reduced capability of rolling circle, single stranded DNA replication compared to an unmodified Geminivirus replicase, and further when said modification of said replicase results in a deletion in a C4 protein of said Geminivirus.
8. The expression construct of claim 7, wherein said modified replicase protein comprises the sequence as set forth in SEQ ID NO: 36.
9. The expression construct of claim 5, being capable of replication in a prokaryotic cell.
10. The expression construct of claim 5, being incapable of plant to plant transmission by an insect vector.
11. The expression construct of claim 5, further comprising a heterologous polynucleotide sequence.
12. The expression construct of claim 11, wherein said heterologous polynucleotide comprises an operon.
13. The expression construct of claim 11, wherein said heterologous polynucleotide encodes a dsRNA or an antisense RNA.
14. The expression construct of claim 5, further comprising a bacterial polynucleotide sequence.
15. The expression construct of claim 5, wherein said modified Geminivirus V2 protein comprises the sequence as set forth in SEQ ID NO: 6.
16. The expression construct of claim 5, wherein said modified Geminivirus coat protein comprises the amino acid sequence as set forth in SEQ ID NO: 3.
17. The expression construct of claim 5, comprising the polynucleotide sequence as set forth in SEQ ID NO: 10 or 11.
18. The expression construct of claim 5, wherein the Geminivirus is a begomovirus.
19. The expression construct of claim 5, wherein the Geminivirus is a Tomato yellow leaf curl virus (TYLCV).
20. The expression construct of claim 5, wherein the expression construct is adapted for expression in a plant host selected from the group consisting of Solanaceae, Cucurbitaceae, Umbelliferae, Liliacae, Gramineae (Poaceae), Rosaceae, Musaceae, Vitacea, and Cruciferae.
21. A method of expressing a molecule of interest in a plant cell comprising introducing into the plant cell the nucleic acid construct of claim 11, said heterologous polypeptide being the molecule of interest, thereby expressing a molecule of interest in a plant cell.
22. The method of claim 21, wherein the plant is selected from the group consisting of a Solanaceae, a Cucurbitaceae, an Umbelliferae, a Liliacae, a Gramineae (Poaceae), a Rosaceae Musaceae, Vitacea and a Cruciferae.
23. A construct system comprising:
- (i) the Geminivirus based expression construct of claim 5; and
- (ii) a construct comprising a Geminivirus IR polynucleotide sequence and a heterologous polynucleotide sequence which encodes a polypeptide or dsRNA.
24. The construct system of claim 23, wherein said Geminivirus IR is flanked on both sides by heterologous polynucleotide sequences which are capable of hybridizing to form said dsRNA.
25. The construct system of claim 23, wherein said heterologous polynucleotide sequence encodes a polypeptide.
Type: Application
Filed: May 12, 2014
Publication Date: Sep 4, 2014
Applicants: Yissum Research Development Company of the Hebrew University of Jerusalem Ltd. (Jerusalem), Morflora Israel Ltd. (Moshav Sharsheret)
Inventors: Ilan SELA (Ramot-HaShavim), Yuval Peretz (Rechovot), Rita Mozes-Koch (Yavne)
Application Number: 14/274,812
International Classification: C12N 15/82 (20060101); A01G 1/06 (20060101);