POLYPEPTIDE AND USE THEREOF FOR IMPROVING STRESS TOLERANCE IN PLANTS
This disclosure provides a stress-responsive polypeptide sequence for fusion with a polypeptide to specifically induce stability of the fusion polypeptide under stress conditions, such as drought, high salt and high temperature, in plants. Also disclosed includes an expression vector for expressing a fusion polypeptide comprising the stress-responsive peptide in plants transformed therewith, and a method for generating a transgenic plant with enhanced tolerance to environmental stresses, comprising introducing into the transgenic plant a polynucleotide encoding a fusion polypeptide which comprises the stress-responsive peptide as disclosed and a plant anti-stress gene, such as the plant senescence-associated gene SSPP. A plant expressing the expression vector that have an enhanced stress tolerance, including Arabidopsis and soybean, is also provided.
Latest NANKAI UNIVERSITY Patents:
- Broadband balun structures and applications thereof
- METHOD FOR ENHANCING TRANSFERRIN RECEPTOR-BASED TRANSCYTOSIS ACROSS THE BLOOD BRAIN BARRIER
- SWITCHGEAR FAULT DIAGNOSIS METHOD AND APPARATUS BASED ON DEEP LEARNING
- METHOD FOR PREPARING META-(CHIRAL ALLYL)-SUBSTITUTED PYRIDINE COMPOUND
- Oxazoline compound, synthesis method therefor and application thereof
The present application is a continuation-in-part application of, and claims priority to, Patent Cooperation Treaty (PCT) application PCT/CN2016/070504 filed on Jan. 8, 2016, which is a continuation of, and claims priority to, Chinese Patent Application Nos. CN 201510010018.4 filed on Jan. 9, 2015 and CN 201510050322.1 filed on Feb. 2, 2015, whose disclosures are hereby incorporated by reference in their entirety.
BACKGROUNDWith the increasing growth of population, declining arable land, and tightening of other agriculture-related resources, supply of crop food in the whole world is facing a huge challenge. Therefore, it becomes highly needed to increase and sustain crop production and improve crop quality. However, a variety of environmental stresses, such as drought, flood, freezing, heat, and pathogens, have greatly impacted yield and quality of crops.
Plant genetic engineering utilizes recombinant DNA technologies to modify and recombine genes in order to confer new traits to transgenic plants and obtain new varieties with higher yields, improved quality and stress tolerance. R&D on plant genetic engineering has advanced rapidly ever since the transgenic tobacco and potato were obtained in 1983. As of 1997, a total of about 25,000 field trials on genetically modified (GM) crops have been carried out globally, which involved 10 countries, 60 crops and 10 traits (Cheng et al., 2014). To date, a large number of high-yield, high-quality new varieties of crops with herbicide tolerance, disease resistance, insect resistance, and stress tolerance have been bred and broadly applied in agricultural production (Hou et al., 2005).
A large number of genes with high potentials have been identified in recent years, which include Arabidopsis stress-induced transcription factors DREB1A (Kasuga et al., 1999) and CBFs (Hsieh et al., 2002a; Hsieh et al., 2002b), etc. Constitutive overexpression of these genes in transgenic plants could result in improved phenotypes such as better stress tolerance and delayed plant senescence, which are frequently accompanied, however, by unfavorable effects on the growth and development under normal growth conditions, such as shorter height, retarded growth, or reduced yield. It is expected that the practical values of these transgenes could get significantly boosted if they are up-regulated specifically at certain developmental stage or under stress conditions while remaining down-regulated under normal conditions. As such, tissue-specific promoters are conventionally employed to drive expression of target genes (Kasuga et al., 1999; Lee et al., 2003; Kovalchuk et al., 2013; Wang et al., 2013). However, this approach has limitations. Firstly, only a limited number of tissue-specific promoters have been identified and applied to date, which generally have low promoter activity and low tissue specificity. Low promoter activity may result in the expression of target genes below the level required for functioning. Secondly, transgenes with breeding potentials need to be transcribed and translated into proteins in order to regulate the growth and development of transgenic plants after their integration into the genomes, and it is common for most genes that both the post-transcriptional and post-translational regulations play important roles in modulating gene expression and functionalities. Thus the only use of specific promoters is far from ideal for this purpose, but this weakness can be compensated by protein-level regulation, which thus has great potentials.
Recently Jang et al. reported that ubiquitin-like domain 1 (UBA1) and 2 (UBA2) of the Arabidopsis RAD23a protein could serve as stabilizing signals to significantly increase the stability of HFR1 and PIF3, two short-lived transcription factors, leading to a more pronounced phenotype of the transgenic plants than that of the plants merely overexpressing these transgenes. The UBA domain of the Arabidopsis DDI1 protein could also extend the half-life of the short-lived protein JAZ0.1 that is implicated in the jasmonate signaling pathway. It was proposed that fusion of UBA domain with other short-lived proteins to increase their stability may benefit the fundamental research of these proteins and may be used for modification and improvement of crop traits (Jang et al., 2012). Thus fusion of a polypeptide sequence that specifically regulates gene expression on protein level with other target proteins may result in accumulation of the target proteins under certain developmental stages or under specific stress conditions while still remaining low expression under other conditions. It helps to conditionally control the expression of genes with breeding potentials, resulting in a better control of the development of transgenic plants and leading to increased yields and improved qualities. To date there have been only limited cases where such polypeptide sequences are identified and applied in real agricultural practices, yet it is expected that this approach will play a significant role in the improvement of crop traits and the breeding of new varieties.
Delay of senescence is closely associated with the increase of crop yield and quality. In food crops and major cash crops, the assimilation products in functional leaves and the accumulated nutrients in senescent leaves are continuously allocated to yield organs during their development. Premature senescence thus has a disadvantageous impact on crop yield and quality. For instance, premature leaf senescence and hypofunction during the late development stage of some hybrid rice varieties leads to low seed-setting rates, which severely limits the further realization of yield potentiality (Gan et al. 1997). Furthermore, leaf senescence in green-leaf crops not only has negative impact on overall yield and quality but also directly affects other factors such as harvest yield, postharvest quality, and shelf life. It was reported that the postharvest loss of vegetables in China reached 10% -50% (Zhang et al. 2009). Additionally, for flowering plants, the senescence of leaves and floral organs directly affects their ornamental values and selling prices. Thus delay of senescence can potentially affect the yield and quality of almost all major crops and commercial plants.
Senescence is the final stage of leaf development, and as an active physiological process, it involves increased expression of a large number of senescence-associated genes (SAGs), which are implicated in the control and regulation of the senescence process. During senescence, the metabolism process inside the plant cell is extremely active and a large amount of assimilation products accumulated in leaves, including degradable cellular components, are degraded and transformed in an efficient and ordered manner, and then transported to the newly formed organs, especially the seeds and fruits (Buchanan-Wollaston et al., 2005; Lim et al., 2007; Lin et al., 2004). Leaf senescence is cooperatively regulated by internal signals (leaf age-correlated signals and levels of endogenous hormones, etc.) and various external factors (temperature, light, stress, etc.). Endogenous hormones are one of the major factors influencing leaf senescence, and regulation of leaf senescence is closely correlated with cytokinins. Tang et al. (1998) found that exogenous application of phenylurea cytokinin (4-PU-30) had significant green-sustaining and senescence-delaying effects on the leaves of hybrid rice, and additionally improved the photosynthetic rates, facilitated grain-filling and dry matter accumulation, which ultimately led to an increase of grain weight and yield. Liu et al. (2001) reported that spraying of lawn grasses such as heaven grass and Manila grass with different concentrations of GA3, BA or PP333 all resulted in delay of senescence, prolonging of green period, and enhancement of cold tolerance. Leaf senescence is also a highly programmed process affected by external factors. Unfavorable conditions such as pathogen infection, shade, heat, drought and flood may all lead to premature senescence of the plants. It has been showed that during rice grain-filling, high temperature could cause accelerated senescence of rice leaves, which in turn led to accelerated grain filling, shortened effective grain-filling period, and reduced grain plumpness. Wen et al. (2000) found that droughts caused a decreasing area of sword leaves and reduction of chlorophylls, which in turn resulted in premature leaf senescence, lower grain weight, and reduced yields.
Many senescence-associated genes (SAGs) have been cloned (Quirino et al., 2000). Gan and Amasino et al. (1995) reported that specific expression of isopentyl transferase (IPI) gene, which is pivotally involved in the cytokinin synthesis pathway, significantly delayed senescence of the transgenic tobacco plants, and that tobacco plants containing the SAG12-IPT transgene had an increase of seed yield and dry weight by 50%. Yuan et al. (2002) found that after transformation of the SAG12-IPT fusion gene, the transgenic cabbages exhibited delayed senescence, increased harvest yields, and sustained freshness, offering a new vegetable breeding approach to increase the shelf life. Zhang et al. (2008) reported that the shotgun-transformed transgenic cool-season turfgrass tall fescue, which expressed the Leafy-ipt transgene, displayed significantly increased cold resistance and delayed senescence. Ding et al. (2007) found that rice transformed with the maize ppc transgene exhibited delayed senescence and significantly increased photosynthetic rate, especially under stress conditions.
Crop yield and quality are affected by a variety of environmental stresses, such as drought, flood, freezing, heat, and diseases. Among them, drought is one of the most prevalent and most frequent natural disasters, having the greatest negative impact on crop yields (Wang et al., 2007). Statistics from 1950 to 2007 showed that in China an average of 21,733,300 hm2 of agricultural lands had been stricken by drought every year, and an average annual loss of grain was up to 15.8 billion kilograms, which represented more than 60% of all grain losses caused by various natural disasters (Kuang et al., 2014). To alleviate the damages caused by drought, cultivating new drought-resistant crop varieties via plant genetic engineering has also become a powerful approach in addition to other integrated managements such as enhanced monitoring of environmental dynamics, improved risk assessment and improved water resource utilization.
Recent years many drought-related signal molecules, transcription factors and functional genes have been cloned, which include AREB1, AREB2, rd19, rd22, and transcription factors MYC, MYB, bZIP, etc. (Jiang et al., 2013; Umezawa et al., 2006). Taji et al. (2002) found that overexpression of galactinol synthase gene (AtGo1S2) in Arabidopsis increased the endogenous levels of galactinol and raffinose, reduced water evaporation in leaves and improved drought resistance. Haake et al. (2002) showed that transformation of Arabidopsis with the transcription factor CBF4 (which binds to CRT/DRE) transgene could result in enhanced activities of the TGGCCGAC element and its downstream genes, which in turn improved drought and cold tolerance in transgenic Arabidopsis. Pellegrineschi et al. (2002) transformed wheats with DREB1a, and found that under severe water stress, all control wheats withered and died while transgenic wheats survived. Capell et al. (1998) found that transforming rice with an oat arginine decarboxylase gene (Adc) could reduce loss of chlorophylls under drought stress and prevent transgenic rice from drought damage. Xu et al. (1996) transformed rice with barley HVA1 gene, which expresses a late embryogenesis abundant protein (LEA), and observed high expression levels of LEA in leaves of the transgenic rice, and found that both the drought and salt resistance of the second-generation transgenic rice were significantly improved. Under these stresses, the transgenic rice exhibited high growth rate, reduced stress-related symptoms, and faster post-stress recovery rate. Nelson et al. (2007) also demonstrated that transgenic maize overexpressing ZmNF-YB2, a homologous gene of the Arabidopsis transcription factor gene AtNF-YB2, had higher drought tolerance with significantly higher levels of chlorophylls, photosynthetic rate and stomatal conductance and significantly lower leaf temperature compared with control.
In summary, identification of genes related to delayed leaf senescence and increased stress tolerance together with subsequent manipulation of their expression by means of genetic engineering is an effective approach to obtain transgenic crops with delayed senescence and without increased growth cycle, which in turn may result in increased and sustained crop yields and improved crop quality, bringing about significant economic and social benefits.
SUMMARY OF THE INVENTIONThere are several problems with conventional plant genetic engineering techniques, including notably the issue of overexpression of exogenous genes in transgenic plants, which may result in a broken balance of metabolism due to constant accumulation of the foreign proteins during growth and development of the plants. Metabolisms regulated by certain proteins are not required for plant growth, and their persistent activation may result in a waste of nutrients and energy, an impediment of normal plant growth, and even death of transgenic plants.
This disclosure provides a polypeptide sequence which specifically regulates the stability of plant proteins under stress conditions. This polypeptide sequence is manually obtained from a segment of Arabidopsis 1-aminocyclopropane-1-carboxylic acid synthase 7 (ACS7) protein, and is termed WX01 throughout the disclosure, whose amino acid sequence is set forth in SEQ ID NO: 1. Functional study on different segments of this protein indicated that the first 14-amino-acid-residue segment of the polypeptide sequence comprises a protein degradation signal, which responds to developmental and environmental cues. This polypeptide sequence WX01 post-translationally regulates the stability of the target proteins that are fused with it, such that the target proteins are degraded in transgenic plants under normal growth under light, but are accumulated specifically under high salt, high temperature, dehydration, as well as under other stresses conditions that stimulate plant senescence.
Disclosed herein also includes a fusion polypeptide by fusing the polypeptide sequence WX01 with a target protein. The fusion polypeptide may comprise WX01 as an N-terminal stress-responsive peptide; a target protein as a C-terminal polypeptide; and optionally a linker sequence between the N-terminal stress-responsive peptide and the C-terminal polypeptide, said linker sequence having a length of 1-20 amino acid residues; wherein the N-terminal stress-responsive peptide is foreign to the C-terminal polypeptide; and the N-terminal stress-responsive peptide retains an ability to regulate stability of the fusion polypeptide such that the fusion polypeptide is capable of remaining at a low level in absence of, but accumulating at a high level in presence of, at least one environmental stress in the plant. The at least one environmental stress may comprise drought stress, high salt stress, high temperature stress, low temperature stress, water stress, or pathogen stress. In some embodiments, the N-terminal stress-responsive peptide may comprise an amino acid sequence slightly different from the amino acid sequence as set forth in SEQ ID NO: 1, for example, with at least 70% or 90% sequence identity, yet may still retain the similar capability as WX01 of functioning as a protein degradation signal in response to environmental cues such that the target proteins are degraded under normal growth conditions, but are accumulated specifically under stress conditions. The linker sequence is designed to connect the N-terminal stress-responsive peptide and the C-terminal polypeptide without substantially interfering with the functions of both the N-terminal stress-responsive peptide and the C-terminal polypeptide in plants. The linker sequence may be optional, and may have a length of 1-20 amino acid residues. In some embodiments, a tagging peptide sequence, such as a FLAG tag or an HA tag, may optionally be further disposed at the C-terminus of the C-terminal polypeptide to be conveniently used for identification and detection purposes.
Disclosed herein also includes an expression vector that expresses the fusion polypeptide as disclosed above. The expression vector may comprise a promoter operably linked to a polynucleotide, wherein the polynucleotide is constructed as a fusion gene “WX01-target gene” and encodes the fusion polypeptide as disclosed above. In some embodiments, the expression vector may be used to transform plants. The fusion gene comprising WX01 and the target gene is integrated into the genome of, and expresses in, the transgenic plants, where the target protein is accumulated specifically under various stress conditions, but its accumulation is inhibited during normal growth. In these embodiments, the promoter is a plant-compatible promoter, which can drive the expression of the fusion gene “WX01-target gene” in plant cells. In some embodiments, the plant-compatible promoter may be a constitutive plant promoter, such as a CaMV35S promoter, an opine promoter, a plant ubiquitin (Ubi) promoter, an actin 1 (Act-1) promoter, and an alcohol dehydrogenase 1 (Adh-1) promoter. Some of these promoters may be from other species of plants. Yet the plant-compatible promoter may be a tissue specific promoter in some embodiments, or may be a promoter of a plant gene, such as ACS7 gene, that can drive the expression of the “WX01-target gene”, in some other embodiments. Yet in some embodiments, the expression vector can be used to transform various other organisms for various purposes. The various other organisms may include, but are not limited to, bacteria, yeasts, algae, mammals, etc. In one such embodiment, the expression vector may be used to express the “WX01-target gene” in E. coli, wherein the promoter in the expression vector may be an E. coli-compatible promoter, and the expression vector may be used for biochemical analysis of fusion polypeptides in vitro.
Disclosed herein also includes a method of generating a transgenic plant with enhanced tolerance to at least one environmental stress, comprising substantially the step of introducing into the transgenic plant a polynucleotide, wherein the polynucleotide is constructed to encode, and express in the transgenic plant, a fusion polypeptide as disclosed above, and said transgenic plant exhibits enhanced tolerance to the at least one environmental stress compared to a plant of the same species not containing the polynucleotide. The at least one environmental stress may comprise drought stress, high salt stress, high temperature stress, low temperature stress, water stress, or pathogen stress. The plant can be a model plant, a food crop, a cash crop, a vegetable, a fruit, a grass or a flower, and specifically can be Arabidopsis, corn (maize), sorghum, wheat, sunflower, crucifer, pepper, potato, cotton, rice, soybean, sugarbeet, sugarcane, tobacco, barley, oilseed rape, Brassica sp., alfalfa, rye, millet, safflower, peanut, chestnut, sweet potato, cassava, coffee, coconut, pineapple, apple, orange, pear, watermelon, grape, peach, lemon, cherry, Chinese date, strawberry, blue berry, raspberry, blackberry, papaya, apricot, persimmon, pomegranate, jackfruit, areca nut, kiwi fruit, plum, loquat, cocoa, tea, banana, avocado, fig, guava, mango, olive, papaya, cashew, macadamia, almond, oat, onions, tomato, lettuce, green bean, lima bean, pea, eggplant, zucchini, luffa, mushroom, carrot, spinach, kale, broccoli, pumpkin, white gourd, lotus root, garlic, ginger, chive, yam, cucumber, cantaloupe, muskmelon, azalea, hydrangea, hibiscus, rose, tulip, daffodil, petunia, carnation, poinsettia, chrysanthemum, pulp tree, oil palm, and conifer.
In some embodiments of the method, the step of introducing into the transgenic plant a polynucleotide may comprise the step of transforming the transgenic plant with an expression vector as disclosed above, comprising substantially a plant-compatible promoter operably linked to the polynucleotide that encodes, and expresses in the transgenic plant, a fusion polypeptide as disclosed above. The plant-compatible promoter may be a constitutive plant promoter, a tissue specific promoter, or a promoter of a plant gene. Transformation of plants may be performed via an Agrobacterium-mediated floral-dip approach, an Agrobacterium-mediated cotyledonary node transformation approach, shotgun or a pollen tube approach. In some preferred embodiments, the expression vector comprises a CaMV35S promoter and is used to transform plants by an Agrobacterium-mediated floral-dip approach. In some embodiments of the method, the C-terminal polypeptide of the fusion polypeptide encoded by the polynucleotide that is introduced in the transgenic plant may be a polypeptide having a function of a plant anti-stress gene, such as AREB1, AREB2, rd19, rd22, MYC, MYB, bZIP, AtGolS2, CBF4, DREB1a, Adc, HVA1, ZmNF-YB2, IPT, PPC and SSPP. The C-terminal polypeptide does not necessarily have the full-length of, or have an identical amino acid sequence of part of, a plant anti-stress gene, but it substantially retains the function of counteracting the at least one environmental stress as disclosed above in plants. In some preferred embodiments, the C-terminal polypeptide of the fusion polypeptide has a function of plant senescence-associated gene SSPP, and may comprise an amino acid sequence at least 70%, at least 90%, or 100% identical to the sequence as set forth in SEQ ID NO: 2 (Arabidopsis SSPP amino acid sequence). In some preferred embodiments, the fusion polypeptide encoded by the polynucleotide comprises an amino acid sequence as set forth in SEQ ID NO: 3 (the amino acid sequence of the WX01-SSPP fusion polypeptide). In some preferred embodiments, the polynucleotide comprises a nucleotide sequence as set forth in SEQ ID NO: 4 (WX02), but may comprise a nucleotide sequence that is slightly different (e.g. at least 70% or 90% sequence identity) from WX02.
Disclosed herein also includes a plant with enhanced tolerance to at least one environmental stress, wherein the plant is transformed with, and expresses, the fusion polypeptide as disclosed above. The at least one environmental stress may comprise drought stress, high salt stress, high temperature stress, low temperature stress, water stress, or pathogen stress. The plant can be a model plant, a food crop, a cash crop, a vegetable, a fruit, a grass or a flower, and specifically can be the species as mentioned above. In some embodiments, the plant may contain in its genome a polynucleotide encoding the fusion polypeptide. In some preferred embodiments, the plant exhibits enhanced tolerance to the at least one environmental stress compared to a plant of the same species not containing the polynucleotide. In some embodiments, the plant may be obtained by transforming the plant with an expression vector as disclosed above, comprising substantially a plant-compatible promoter operably linked to the polynucleotide that encodes, and expresses in the transgenic plant, a fusion polypeptide as disclosed above. The plant-compatible promoter may be a constitutive plant promoter, a tissue specific promoter, or a promoter of a plant gene. The plant may be obtained by transformation via an Agrobacterium-mediated floral-dip approach, an Agrobacterium-mediated cotyledonary node transformation approach, shotgun, or a pollen tube approach. In some preferred embodiments, the plant can be obtained by transforming an expression vector comprising a CaMV35S promoter via an Agrobacterium-mediated floral-dip approach. In some embodiments of the plant, the C-terminal polypeptide of the fusion polypeptide encoded by the polynucleotide that is introduced in the plant may be a polypeptide having a function of a plant anti-stress gene, with examples disclosed above. In some preferred embodiments, the C-terminal polypeptide of the fusion polypeptide has a function of SSPP, and may comprise an amino acid sequence at least 70%, at least 90%, or 100% identical to the sequence as set forth in SEQ ID NO: 2. In some preferred embodiments, the fusion polypeptide encoded by the polynucleotide comprises an amino acid sequence as set forth in SEQ ID NO: 3. In some preferred embodiments, the polynucleotide comprises a nucleotide sequence, at least 70%, 90%, or 100% identical to the WX02 sequence as set forth in SEQ ID NO: 4.
This invention discloses a polypeptide sequence capable of regulating accumulation levels of target proteins, which, if fused with a target gene and transformed into a plant by genetic engineering, can specifically regulate the stability of target proteins, such that in the transgenic plants, the target protein is accumulated specifically under high salt, high temperature, dehydration, or other stresses that stimulate plant senescence and death while remains limited in expression during normal growth. This feature differentiates from the conventional approach of utilizing promoters to transcriptionally regulate the expression of target genes, which typically result in persistent overexpression of transgenes in the plants, leading to various adverse effects on the transgenic plants during normal plant growth. Thus by fusing with genes having potentials to increase stress tolerance and improve crop yield and quality, the polypeptide sequence can effectively reduce the adverse effects related to target gene overexpression during normal plant growth, yet still retain advantageous features such as increased crop yields and enhanced stress resistance. This approach thus has great values in plant genetic engineering in order to breed new crop varieties and to obtain plants with improved traits.
This disclosure provides a polypeptide sequence which specifically regulates the stability of plant proteins under stress conditions. This polypeptide sequence is manually obtained from a segment of Arabidopsis 1-aminocyclopropane-1-carboxylic acid synthase protein, encoded by ACS7 gene. Studies on indicated that a segment of the first 14 amino acid residues comprises a protein degradation signal, which responds to developmental and environmental cues. This 14 amino acid residue-polypeptide sequence is termed WX01, and its amino acid sequence is set forth in SEQ ID NO: 1.
As demonstrated in Embodiment 1 by examining the WX01-GUS fusion gene in Arabidopsis, this polypeptide sequence WX01 post-translationally regulates the stability of the target proteins that are fused with it, such that the target proteins are degraded in transgenic plants under normal growth, but are accumulated specifically under high salt, high temperature, dehydration, or other stresses conditions that stimulate senescence.
The poly-nucleotide sequence that encodes WX01, as set forth in SEQ ID NO: 18, is utilized to construct “WX01-target gene”, which is then used for plant transformation. The fusion gene comprising WX01 and the target gene is integrated into the genome of the transgenic plants. In the transgenic plants, the target protein is accumulated specifically under various stress conditions, but its accumulation is inhibited during normal growth. The target gene in the above-mentioned fusion gene may be any genes implicated in the basic research, transformational techniques, or required for the crop trait improvements. In this disclosure, the target gene may encode a polypeptide having a function of a plant anti-stress gene, such as AREB1, AREB2, rd19, rd22, MYC, MYB, bZIP, AtGolS2, CBF4, DREB1a, Adc, HVA1, ZmNF-YB2, IPT, PPC and SSPP.
In Embodiment 2, WX01 was fused with plant senescence-associated gene SSPP to obtain a fusion gene, termed WX02, which was then used to transform the model plant Arabidopsis thaliana. As the functional analysis of the transgenic Arabidopsis plants demonstrates, WX02 is capable of moderately delaying leaf senescence and improving stress tolerance in plants.
In Embodiment 3, the above mentioned fusion gene WX02 was further used to transform soybean plants, and results demonstrate that WX02 is capable of moderately delaying leaf senescence and improving stress tolerance in soybean plants.
Embodiment 1In this embodiment, this disclosure provides a method for constructing a fusion gene “WX01-GUS reporter gene” in expression vector pCAMBIA1301, and a method for analyzing the specific accumulation of the fusion protein “WX01-GUS” in transgenic plants.
A method for constructing the fusion gene “WX01-GUS reporter gene” comprises in expression vector pCAMBIA1301: 1) obtaining a DNA fragment of “WX01-GUS” fusion gene by PCR amplification of the GUS reporter gene, wherein the pCAMBIA 1301 plasmid (from CAMBIA™) is used as template, and an upstream primer incorporates a WX01-encoding nucleotide sequence; 2) purifying the PCR amplification product; 3) ligating the PCR amplification product and a pMD18-T vector (from Takara™) under the catalysis by a ligase; 4) transforming the E. coli DH5a competent cells with the ligation product; 5) selecting a positive TA clone by resistance screening; 6) digesting the TA clone plasmid comprising the “WX01-GUS” fusion gene by restriction enzymes Nco I and BstE II, and purifying the DNA fragment that comprises the “WX01-GUS” fusion gene; 7) digesting a binary expression vector plasmid by restriction enzymes Nco I and BstE II, and purifying the vector fragment; 8) mixing the DNA fragment comprising the “WX01-GUS” fusion gene obtained from sub-step 6) and the vector fragment obtained from sub-step 7) for ligation, and obtaining a construct of the binary expression vector that comprises the fusion gene and the pCAMBIA 130 lvector.
The PCR reactions for amplification of the “WX01-GUS” fusion gene are as follows: obtaining a first PCR amplification product by a first PCR reaction with the plasmid as template and with Upstream Primer No. 2 and Downstream Primer as primers; and obtaining the PCR amplification product of the “WX01-GUS” fusion gene by a second PCR reaction with the first PCR amplification product as a template, and Upstream Primer No. 1 and the Downstream Primer as primers, wherein the Upstream Primer No. 1 (SEQ ID NO: 5, CCATGGatgggtcttcctctaatgatggagagatcatcaaacaacaacATGG) comprises an Nco I restriction site (shown as underlined) and the WX01-encoding nucleotide sequence (shown in lower case), the Upstream Primer No. 2 (SEQ ID NO: 6, ggagagatcatcaaacaacaacATGGTAGATCTGAGGGTAA ATTTCTAG) comprises a partial WX01-encoding nucleotide sequence (shown in lower case), and the Downstream Primer (SEQ ID NO: 7, GGTCACCTCACACGTGGTGGTGGTGG) comprises a BstE II restriction site (shown as underlined).
The method for analyzing the specific accumulation of the fusion protein “WX01-GUS” in transgenic plants comprises the sub-steps of: transforming Arabidopsis with the binary expression vector that comprises the “WX01-GUS” fusion gene via an Agrobacterium-mediated floral-dip approach (Clough & Bent,1998); screening seeds for transgenic plants resistant to 30 mg/L of hygromycin; culturing resistant transgenic plants in soil; and detecting the specific accumulation of the fusion protein “WX01-GUS” in resistant transgenic Arabidopsis plants by histochemical staining (Blume & Grierson, 1997) and immunostaining (Bolt & Mahoney, 1997).
The following provides specific details of this embodiment.
Step 1: Fusion of the WX01-encoding nucleotide sequence with GUS reporter gene and construction of a pCAMBIA 1301-based binary expression vector that comprises the “WX01-GUS” fusion gene.
First, a 2108-bp DNA fragment of the “WX01-GUS” fusion gene was amplified by PCR using pCAMBIA 1301 plasmid as template, purified and cloned by a TA cloning approach.
(1) PCR amplification of target DNA fragment: specific primers were designed based on the sequence of the GUS reporter gene on the pCAMBIA 1301 vector plasmid, wherein the Upstream Primer No. 1 (SEQ ID NO: 5), the Upstream Primer No. 2 (SEQ ID NO: 6) and the Downstream Primer (SEQ ID NO: 7) are disclosed above. The pCAMBIA 1301 vector plasmid was purified by a plasmid extraction kit (from Axygen™) following the manufacturer's manual. PCR amplification of the “WX01-GUS” fusion gene is as follows: obtaining a first PCR amplification product by a first PCR reaction with the plasmid as template and with the Upstream Primer No. 2 and the Downstream Primer as primers; and obtaining the PCR amplification product of the “WX01-GUS” fusion gene (target DNA fragment) by a second PCR reaction with the first PCR amplification product as a template, and the Upstream Primer No. 1 and the Downstream Primer as primers. The following is the PCR reaction setup:
94° C. 3 min; 94° C. 30 sec; 56° C. 30 sec; 72° C. 2 min 10 sec, 25 cycles; 72° C. 10 min;
(2) Cloning of target DNA fragment and identification of positive clones:
{circle around (1)} Purification of target fragment: The PCR amplification product of the WX01-GUS fusion gene was purified using the PCR purification kit (from Axygen™).
{circle around (2)} Ligation: The reagents as shown below were mixed and incubated at 16° C. overnight for ligation of the target DNA fragment with the pMD18-T vector.
{circle around (3)} Transformation and identification of positive clones: The E. coli DH5α competent cells were prepared by the CaCl2-based approach, and then were transformed with 10 μL of the ligation products; the resulted mixture was plated onto the LB plates containing Ampicillin, and the LB plates were incubated upside down for 12-14 hours at 37° C.; the bacterial clones on the LB plates were picked for the conventional purification of plasmids; the plasmids were digested with restriction enzymes Nco I and BstE II to produce a 2.7 kb pMD18-T vector DNA fragment and a 2101-bp DNA fragment of the WX01-GUS fusion gene. A PCR reaction was performed using the plasmids as template and using the Upstream Primer No. 1 and the Downstream Primer in sub-step (1) as the primers, and under the same PCR reaction, and the PCR products underwent agarose gel electrophoresis for detection of the 2108-bp DNA fragment of the WX01-GUS fusion gene, whose presence indicates a positive clone.
{circle around (4)} Verification by sequencing: After identification, positive bacterial clones were sent to for DNA sequencing, and the nucleic acid sequence is set forth in SEQ ID NO: 17 (WX01-GUS).
Second, construction of binary expression vector comprising the WX01-GUS fusion gene.
(1) The binary expression vector plasmids were purified from E. coli and digested with restriction enzymes Nco I and BstE II; and the bigger vector fragment was purified;
(2) The plasmids from the TA clones obtained from first step were purified and digested using restriction enzymes Nco I and BstE II; and the DNA fragment of the WX01-GUS fusion gene was purified using an agarose gel purification kit (from Axygen™);
(3) The two DNA fragments as shown above were mixed and incubated at 16° C. overnight for ligation (see table below for reactions) for the construction of a pCAMBIA 1301-based binary expression vector that comprises the WX01-GUS fusion gene.
(4) The E. coli DH5α competent cells were transformed with the ligation mixture, using the same method as sub-step (2) in Step 1;
(5) The bacterial clones (Kanamycin-resistant) on the LB plates were picked for the conventional purification of the plasmids; the plasmids were digested using restriction enzymes Nco I and BstE II to produce two DNA fragments: the 10.2 kb binary expression vector fragment, and the 2101-bp DNA fragment of the WX01-GUS fusion gene.
(6) PCR was performed to detect the 2108-bp DNA fragment of the WX01-GUS fusion gene, using the plasmids as template and using the following primers: Upstream Primer No.1 (SEQ ID NO: 5) and Downstream Primer (SEQ ID NO: 7).
(7) After enzymatic digestion and PCR verification, positive clones were sent to biotechnology companies for DNA sequencing, and the results indicated that the nucleic acid sequence is identical to the sequence as set forth in SEQ ID NO: 17;
(8) Plasmids from the positive clones were purified and used to transform the Agrobacterium strain GV3101 to obtain engineered agrobacteria for plant transformation.
Step 2: Obtaining the Transgenic Arabidopsis Plants
(1) Wild-type Arabidopsis was transformed with a binary expression vector obtained from Step 1 that expresses the WX01-GUS fusion gene. An Agrobacterium-mediated floral-dip approach was applied for transformation, and offspring seeds were then screened for transgenic plants resistant to 30 mg/L of Hygromycin, and the resistant plants that showed normal growth were cultured in soil.
(2) PCR identification of the transgenic plants: the leaves of transgenic plants and wild-type plants were obtained and their genomic DNAs were respectively extracted by a previously reported method (Huang et al., 2002); PCR was performed under the same reaction setup as in Step 1: Upstream Primer No. 3 (SEQ ID NO: 8, TGGGTCTTCCTCTAATGATGGA) and Downstream Primer (SEQ ID NO: 7). The PCR products underwent agarose gel electrophoresis analysis. The 2101-bp DNA fragment of the WX01-GUS fusion gene was present in the transgenic plants but was absent in non-transformed plants, proving that the target DNA fragment was integrated into the genome of the transgenic plants (
(3) Seeds were harvested from each of the various strains of the transgenic Arabidopsis plant comprising the WX01-GUS fusion gene, and were screened by 30 mg/L hygromycin resistance selection; strains that displayed a resistance separation ratio of 3:1 were individually transferred to the soil for culturing, and the seeds harvested from individual plant underwent further 30 mg/L hygromycin resistance selection, wherein the strains whose seeds all had normal growth phenotype were homozygous;
Step 3: Detection of Specific Accumulation of the WX01-GUS Fusion Protein in Transgenic Arabidopsis Plants.
(1) Detection of accumulation levels of the WX01-GUS fusion protein in transgenic Arabidopsis plants at various developmental stages by GUS histochemical staining. The transgenic Arabidopsis plants after 11 days, 26 days and 28 days of culturing under light were analyzed by GUS staining, with transgenic Arabidopsis plants expressed GUS under the same promoter as control. Blue staining in the various organs or tissues of the transgenic plant indicated the histochemical staining of the GUS reporter gene, where a stronger staining indicates a higher expression level of the WX01-GUS fusion protein. Results were photographed and scanned after 6 hours of staining; Staining results were shown in
(2) Detection of accumulation levels of the WX01-GUS fusion protein in transgenic Arabidopsis plants under various abiotic stresses by GUS histochemical staining and immunostaining. The WX01-GUS transgenic Arabidopsis plants after 9 days of culturing were treated under the following conditions: 24 hour-treatment by 175 mM of NaC1 (high salt), 3 hour-treatment at 43° C. in darkness (high temperature), and 3 hour-treatment on dry filter paper in the air (dehydration), then the treated and untreated plants were compared by GUS histochemical staining and immunostaining analysis. GUS histochemical staining was indicated by the blue staining in transgenic plants, where a stronger staining indicates a higher accumulation level of the WX01-GUS fusion protein. Results were photographed and scanned after 6 hours of staining. In the immunostaining, β-actin was used as an internal loading reference, and a stronger detection signal by the specific anti-GUS antibody (darker bands) indicates a higher accumulation level of the WX01-GUS fusion protein in the transgenic plants. Staining results are shown in
These results indicate that the WX01 polypeptide, if fused with GUS at its N-terminus, could limit levels of GUS at normal growth, but could significantly increase the accumulation levels of GUS under stress conditions such as high salt, high temperature, dehydration, or others that induce senescence and death. Thus by specifically regulating the stability of a target protein with which it is fused, the WX01 polypeptide could drive accumulation of the target protein specifically at certain developmental stages or under stress conditions.
Embodiment 2The present disclosure provides a fusion gene of 1206 bp, termed WX02, obtained by manually splicing through molecular biology techniques. Its nucleotide sequence is set forth in SEQ ID NO: 4. Analysis showed that the fusion gene could moderately delay leaf senescence and enhance drought resistance.
This disclosure provides a method for obtaining the WX02 fusion gene constructed in a cloning vector, comprising: 1) obtaining a PCR amplification product of a full-length cDNA fragment of the WX02 fusion gene, comprising the sub-steps of: designing two pairs of specific primers, wherein the two pairs of specific primers comprise two upstream primers and two downstream primers, and at least one of the two upstream primers comprises an upstream fragment of the WX02 fusion gene; and amplifying a downstream fragment of the WX02 fusion gene by PCR amplification over the Arabidopsis cDNA template using the two pairs of specific primers; 2) purifying the PCR amplification product; 3) ligating the PCR amplification product into a pMD18-T cloning vector (from Takara™); 4) transforming the E. coli DH5α competent cells with the ligation product; and 5) selecting a positive TA clone by resistance screening to thereby obtain a WX02 fusion gene containing vector plasmid WX02/pMD18-T.
The PCR reactions performed to clone the WX02 fusion gene are as follows: PCR amplification was first done using Upstream Primer No. 5 (SEQ ID NO: 10, GAGAGATCATCAAACAACAACACTAGTATGGTTAAACCCTGTTGGAGAATAGG) and Downstream Primer No. 2 (SEQ ID NO: 12, AACATCGTATGGGTACTCGAGTGATGTTGAA TGCATCGGGTATC); and the resulted PCR fragments were used as template for the second amplification to ultimately obtain WX02 fusion gene using Upstream Primer No. 4 (SEQ ID NO: 9, TCTAGATGGGTCTTCCTCTAATGATGGAGAGATCATCAAACAACAACACTAGT) and Downstream Primer No. 1 (SEQ ID NO:11, GAGCTCTCAAGCGTAATCTGGAACATCGTA TGGGTAC), wherein Upstream Primer No. 4 comprises an Xba I restriction site (shown as underlined in the sequence), and Downstream Primer No. 1 comprises a Sac I restriction site (shown as underlined in the sequence).
This disclosure also provides a method for moderately delaying plant senescence and improving stress tolerance in a transgenic plant utilizing the WX02 fusion gene, comprising the sub-steps of: constructing a binary expression vector (CaMV 35S promoter: WX02) that expresses the WX02 fusion gene under the promoter of CaMV 35S; transforming the binary expression vector to a plant; obtaining a transgenic plant that contains the above-mentioned nucleotide sequence in the genome and constitutively expresses the WX02 fusion gene. Phenotypic analysis on the transgenic plant is then performed to evaluate phenotypes with regard to growth and development, leaf senescence and stress tolerance.
The application method comprising a process of constructing the binary expression vector “CaMV 35S promoter: WX02” is as follows: 6) digesting the WX02 fusion gene-cloning vector WX02/pMD18-T by restriction enzymes Xba I and Sac I, and purifying a DNA fragment that comprises the WX02 fusion gene; 7) digesting a pBI121 expression vector plasmid (from Clontech™) by restriction enzymes Xba I and Sac I, purifying a vector fragment that comprises a CaMV 35S promoter; 8) mixing the DNA fragment that comprises the WX02 fusion gene and the vector fragment obtained from sub-step 7) for ligation following manufacturer's instructions to obtain a construct of the binary expression vector “CaMV 35S promoter: WX02” based on the pBI121 vector.
The application method also comprises an expression and phenotypic analysis of the transgenic plant that expresses the binary expression vector “CaMV 35S promoter: WX02”, comprising: 9) transforming Arabidopsis with the binary expression vector “CaMV 35S promoter: WX02” via an Agrobacterium-mediated floral-dip approach, screening seeds for transgenic plants resistant to 25 mg/L Kanamycin, culturing resistant transgenic plants in soil, and detecting the integration and expression of WX02 in resistant transgenic plants by genomic PCR and semi-quantitative RT-PCR; 10) culturing the wild-type and transgenic (CaMV 35S promoter:WX02, or “35S: WX02” in short) Arabidopsis plants, comprising the sub-steps of: sterilizing seeds of the wild-type and transgenic Arabidopsis plants, plating the seeds on ½ MS medium, and incubating the seeds on vertical plates under a long light exposure condition (white light exposure for 16 hours followed by incubation in darkness for 8 hours) at 22° C. for 10 days; 11) transferring the wild-type and transgenic plants that are at similar growth and development stage to soil to grow under the long daily light exposure condition (white light exposure for 16 hours followed by incubation in darkness for 8 hours) at 22° C.; 12) continuously observing and recording phenotypes of the wild-type and transgenic plants, and comparing differences in rosette size and leaf senescence between the wild-type and transgenic plants; 13) transferring seedlings of the wild-type and transgenic plants that display similar growth and development stages after incubation on the ½ MS medium for 7 days to soil for culturing under the long daily light exposure condition (white light exposure for 16 hours followed by incubation in darkness for 8 hours) at 22° C. for 14 days, applying a drought stress by stopping watering the wild-type and transgenic plants for 21 days followed by resuming watering, and observing differences between the wild-type and transgenic plants in wilting responses under the drought stress and the recovery after resuming watering.
The following provides specific details of this embodiment.
Step 1: obtaining of WX02, a fusion gene for moderately delaying plant senescence and improving stress tolerance.
A 1206-bp DNA fragment of the WX02 fusion gene was amplified by PCR using wild-type Arabidopsis cDNA as template and purified and cloned by a TA cloning approach.
(1) PCR Amplification of Target DNA Fragment
Total RNA from Arabidopsis was extracted by a Trizol-based approach and then reverse-transcribed into cDNA; the full-length cDNA fragment of the WX02 fusion gene was obtained by PCR, wherein the PCR comprises the sub-steps of: designing two pairs of specific primers, wherein the two pairs of specific primers comprise two upstream primers and two downstream primers, and at least one of the two upstream primers comprises an upstream fragment of the WX02 fusion gene; and amplifying a downstream fragment of the WX02 fusion gene by PCR amplification using the two pairs of specific primers and the Arabidopsis cDNA as template;
The two upstream primers and two downstream primers designed to clone the WX02 fusion gene are as follows. PCR amplification was first done using Upstream Primer No. 5 (SEQ ID NO: 10) and Downstream Primer No. 2 (SEQ ID NO: 12); and the resulted PCR fragments were used as template for the second amplification to ultimately obtain WX02 fusion gene using Upstream Primer No. 4 (SEQ ID NO: 9) and Downstream Primer No. 1 (SEQ ID NO: 11).
94° C. 3 min; 94° C. 30 sec, 56° C. 30 sec, 72° C. 1 min 30 sec, 25 cycles; 72° C. 10 min;
(2) Cloning of Target DNA Fragment and Identification of Positive Clones:
{circle around (1)} Purification of target fragment: The PCR amplification product of the WX02 fusion gene was purified using the PCR purification kit (from Axygen™), following the manual of the commercial kit.
{circle around (2)} Ligation: The reagents as shown below were mixed and incubated at 16° C. overnight for ligation of the target fragment with the pMD18-T vector (obtained from Takara™).
{circle around (3)} Transformation and identification of positive clones: The E. coli DH5α competent cells were prepared by the CaCl2-based approach, and then transformed with 10 μL of the ligation products; the resulted mixture was plated onto the LB plates containing Ampicillin, and the LB plates were placed upside down for 12-14 hours at 37° C.; the bacterial clones on the LB plates were picked for the conventional purification of plasmids; the plasmids were digested with restriction enzymes Xba I and Sac I to produce a 2.7-kb pMD18-T vector DNA fragment and a 1204-bp DNA fragment of the WX02 fusion gene. A PCR reaction was performed under the same conditions as mentioned above using the plasmid as template and using Upstream Primer No. 4 and Downstream Primer No.1 in sub-step (1) as the primers, and the PCR products underwent agarose gel electrophoresis for the detection of the 1206-bp DNA fragment, whose presence indicates a positive clone containing the WX02 fusion gene.
{circle around (4)} Verification by sequencing: After identification, positive bacterial clones were sent for DNA sequencing, and the nucleic acid sequence is set forth in SEQ ID NO: 4.
Step 2: Utilizing the pBI121 vector to construct a binary expression vector that expresses the WX02 fusion gene under the promoter of CaMV 35S.
(1) The pBI121 plasmids were purified from E. coli (from Takara™ or Clontech™) and digested with restriction enzymes Xba I and Sac I; and the bigger vector fragment (which comprises the CaMV35S promoter) was purified.
(2) The plasmids of the TA clones obtained from Step 1 were purified and digested using restriction enzymes Xba I and Sac I; and the DNA fragment of the WX02 fusion gene was purified after agarose gel electrophoresis (similar to sub-step (2) in Step 1).
(3) The two DNA fragments as shown above were mixed and incubated at 16° C. overnight for ligation for the construction of the binary expression vector that expresses the WX02 fusion gene under the promoter of CaMV 35S on the pBI121 vector.
(4) The E. coli DH5a competent cells were transformed with the ligation mixture, using the same method as sub-step (2) in Step 1.
(5) The bacterial clones on the LB plates with kanamycin were picked for the conventional purification of the plasmids; the plasmid were digested using restriction enzymes Xba I and Sac I to produce two DNA fragments: the 13-kb pBI121 vector DNA fragment, and the 1204-bp DNA fragment of the WX02 fusion gene.
(6) PCR was performed using the plasmid as template, using Upstream Primer No. 4 and Downstream Primer No.1 in sub-step (1) of Step 1 as primers, and under the same PCR reaction setup, for detection of the 1206-bp DNA fragment of the WX02 fusion gene.
(7) After enzymatic digestion and PCR verification, positive clones were sent to biotechnology companies for DNA sequencing, and the nucleic acid sequence is identical to the sequence as set forth in SEQ ID NO: 4.
(8) Plasmids from the positive clones were purified and used to transform the Agrobacterium strain GV3101 to obtain engineered Agrobacteria for plant transformation.
Step 3: Obtaining the Transgenic Arabidopsis Plants
(1) Arabidopsis was transformed with the binary expression vector obtained in Step 2 that expresses the WX02 fusion gene under the promoter of CaMV 35S. An Agrobacteria-mediated floral-dip approach was applied for transformation, and offspring seeds were then screened for transgenic plants resistant to 25 mg/L of Kanamycin, and the resistant plants that showed normal growth were subsequently grown in soil;
(2) PCR identification of the transgenic plants: leaves of transgenic plants and wild-type plants were obtained and genomic DNAs were extracted via a previously reported method (Huang et al., 2002); PCR was performed using their genomic DNAs as templates, using Upstream Primer No. 4 and Downstream Primer No.1 as primers; the PCR products underwent agarose gel electrophoresis analysis. The 1206-bp DNA fragment of the WX02 fusion gene was found in transgenic plants but was absent in non-transformed plants, proving that the target DNA fragment was integrated into the genome of the transgenic plants (
(3) Overexpression detection of the WX02 fusion gene in transgenic plants: total RNA from light-exposed 9-d old seedlings of 35S: WX02 transgenic plants was extracted by a Trizol-based approach, and then a semi-quantitative PCR was performed following the method as disclosed in the thesis of Liu D. (2010), wherein TIP41-like was used as an internal reference. Specific primers were as follows: For amplification of the WX02 fusion gene: upstream primer (SEQ ID NO: 13, GGCCATGGAGGTCCAGAGGCT) and downstream primer (SEQ ID NO: 14, TCTTGTGGGCTAAGCCGCGT); for amplification of the TIP41-like gene: upstream primer (SEQ ID NO: 15, GAAATTCAGGAGCAAGCCGTCTCAG) and downstream primer (SEQ ID NO: 16, ATCAACTCTCAGCCAAAATCGCAAG). Results showed that a 572-bp DNA fragment of the WX02 fusion gene was observed in various transgenic plants with different brightness levels, indicating the WX02 fusion gene was effectively expressed in transgenic plants.
Step 4: Functional Analysis of the WX02 Fusion Gene in Transgenic Arabidopsis Plants
(1) Seeds were harvested from each of the various strains of the transgenic Arabidopsis plant as obtained in Step 3, and were screened by 25 mg/L kanamycin resistance selection; strains that displayed a resistance separation ratio of 3:1 were individually transferred to the soil for culturing, and the seeds harvested from individual plant underwent further 25 mg/L kanamycin resistance selection, wherein the strains whose seeds all had normal growth phenotype were homozygous strains;
(2) Seeds of the wild-type and homozygous 35S:WX02 transgenic Arabidopsis plants were plated on ½ MS medium after sterilization, and incubated on vertical plates under a long daily light exposure condition (white light exposure for 16 hours followed by incubation in darkness for 8 hours) at 22° C. for 10 days;
(3) The wild-type and transgenic plants that were at a similar growth and development stage were transferred to soil for culturing under the long daily light exposure condition (white light exposure for 16 hours followed by incubation in darkness for 8 hours) at 22° C.;
(4) Phenotypes of the wild-type and the transgenic Arabidopsis plants, including rosette sizes and leaf senescence, were continuously observed and recorded (see
Results showed that the 35S: WX02 transgenic Arabidopsis plants were capable of maintaining normal growth during fast growth period, and showed no significant difference in rosette sizes (
Step 5: Drought/High Salt Tolerance Analysis of the 35S:WX02 Transgenic Plants:
(1) Seeds of the wild-type and homozygous 35S:WX02 transgenic Arabidopsis plants were plated on ½ MS medium after sterilization, and incubated on vertical plates under a long daily light exposure condition (white light exposure for 16 hours followed by incubation in darkness for 8 hours) at 22° C. for 7 days;
(2) The wild-type and transgenic plants that were at a similar growth and development stage were transferred to soil for culturing under the long daily light exposure condition (white light exposure for 16 hours followed by incubation in darkness for 8 hours) at 22° C.;
(3) The wild-type and transgenic plants were cultured for 14 days, then the soil was completely soaked one night before the drought stress wherein in the drought stress the plants received no watering for the next 21 days; then the watering resumed;
(4) Phenotypes, such as the drought tolerance (
Results of the wild-type and transgenic Arabidopsis plants showed that: after 21-d drought stress and the subsequent 1-d re-watering, growth and development of the 35S:WX02 transgenic Arabidopsis plants were less affected compared with that of the wild-type plants; after 10-d high salt stress, growth and development of the 35 S:WX02 transgenic Arabidopsis plants were less affected compared with that of the wild-type plants and of the 35S:SSPP plants. These results indicate that the 35S:WX02 transgenic Arabidopsis plants have significantly improved drought and high salt tolerance compared with the wild-type.
Embodiment 3In this embodiment, the above mentioned fusion gene WX02 was further used to transform soybean, a major commercial crop. A variety of functional assays were then performed to evaluate the stress resistance phenotype of the transgenic soybean plants expressing the WX02 fusion gene.
First, a binary expression vector CaMV 35S promoter: WX02 that expresses the WX02 fusion gene was obtained. Differing from the binary expression vector employed for transforming and expressing WX02 fusion gene in the Arabidopsis plants in Embodiment 2, which was based on pBI121, the binary expression vector employed in this embodiment (i.e. Embodiment 3) was based on pCAMBIA3301.
Specifically, PCR was performed using a template of the binary expression vector CaMV 35S promoter:WX02/pBI21 as described above in Embodiment 2, and a pair of primers (Seq ID. NO: 19: ACGCGTTCTAGAATGGGTCTTCCTCTAATGATG and Seq ID NO: 20: GGTCACCAGCTCTCAAGCGTAATCTGGAACA); then the PCR product was digested with restriction enzymes Mlu I/BstE II, and the purified fragment was ligated into a fragment of the expression vector pCAMBIA3301 having ends for the restriction enzymes Mlu I/BstE II, to thereby obtain the binary expression vector capable of expressing the WX02 fusion gene in soybean plants (i.e. CaMV 35S promoter:WX02/pCAMBIA3301).
Second, 35S: WX02 transgenic soybean plants were obtained. Differing from the aforementioned processes of transforming the binary expression vector CaMV 35S promoter: WX02/pBI121 into the Arabidopsis plants in Embodiment 2, in which an Agrobacterium-mediated floral-dip approach was utilized, herein the binary expression vector CaMV 35S promoter:WX02/pCAMBIA3301 was transformed into the soybean plants via Agrobacterium-mediated soybean cotyledonary node transformation approach. The Agrobacterium-mediated soybean cotyledonary node transformation approach has been reported earlier (Paz et al., 2006), and the description thereof is skipped herein.
To evaluate whether the 35S: WX02 transgene was transformed into the transgenic soybean plants, a Southern blot analysis was performed over genomic DNAs from six 35S: WX02 transgenic soybean plants.
Specifically, genomic DNAs were extracted from the various different samples (including the non-transgenic soybean plant CK and six transgenic soybean plants WX02-1, WX02-2, WX02-3, WX02-4, WX02-5, and WX02-6), which were then respectively digested with EcoR I and EcoR V restriction enzymes, and the digestion products then underwent electrophoresis, film transfer, and probe hybridization (using the digoxin-labeled WX02 probe).
Specifically, the following is the process to obtain the digoxin-labeled WX02 probe. First, PCR was performed by using a template of the WX02 sequence and a pair of primers (Seq ID. NO: 21: AAGGCACATTTGTTGGAGTTT and Seq ID NO: 22: AGCTCTGGAATCTCCCGTGTTTG), then a 3′-end of purified PCR product was incubated with DIG-11-dUTP to thereby obtained the digoxin-labeled WX02 probe.
As shown in the
To further evaluate whether the 35S: WX02 transgene can express in the transgenic soybean plants, a semi-quantitative RT-PCR analysis of WX02 expression in the six 35S: WX02 transgenic soybean plants were carried out.
Specifically, total RNAs of the various different samples (including the non-transgenic plant CK and six transgenic plants WX02-1, WX02-2, WX02-3, WX02-4, WX02-5, and WX02-6) were extracted, reverse transcribed, and further underwent PCR analysis over the cDNA templates to detect the target gene SSPP (controlled using 18sRNA). The details for the semi-quantitative RT-PCR analysis can be referenced to the semi-quantitative RT-PCR analysis as described above in Embodiment 2, and will not be repeated herein.
As shown in
To evaluate the stresses of high salt and drought on the 35S: WX02 transgenic soybean plants, a series of drought/high salt tolerance analysis were performed.
Specifically for a high salt tolerance analysis, after germination, the non-transgenic (CK) and the 35S: WX02 transgenic soybean plants (WX02-6 for
As shown in
Experimentation with another three 35S: WX02 transgenic soybean plants (WX02-2, WX02-3, and WX02-4) also exhibited similar high salt tolerance. As shown in
Specifically for a drought tolerance analysis, after germination, the non-transgenic (CK) and the 35S: WX02 transgenic soybean plants (WX02-2, WX02-3 and WX02-4) were transferred to a same plate, treated with drought (i.e. with watering stopped) for a certain period of time, and followed by watering resumption.
As shown in
Taken the above results together, the WX02 transgene can result in a tolerance to high salt and/or drought after transformation into soybeans, one of the major commercial crops, which in turn may have increased and sustained crop yields.
Advantages of the invention as disclosed herein are as follows: a WX02 fusion gene that can moderately delay leaf senescence and enhance drought and high salt resistance is obtained by manually splicing through molecular biology techniques; a binary expression vector (CaMV35S promoter:WX02) that expresses the WX02 fusion gene under the promoter of CaMV35S is constructed and transformed into a model plant Arabidopsis; functional analysis indicates that when growing under same conditions as the wild type control, the transgenic Arabidopsis plants expressing the 35S: WX02 transgene exhibit significantly delayed leaf senescence and improved drought and high salt tolerance while still maintaining normal growth and development. This suggests that the WX02 fusion gene has a high commercial value for breeding.
REFERENCES
- Blume B and Grierson D. The Plant Journal, 1997, 12: 731-746.
- Bolt M W and Mahoney P A. Anal Biochem, 1997, 247: 185-192.
- Buchanan-Wollaston, et al. The Plant Journal, 2005, 42: 567-585.
- Capell T, et al. Theor Appl Genet, 1998, 97: 246-254.
- Cheng B Z and Yang J H. Plant genetic engineering in agriculture. Chinese Times, 2014, (3).
- Clough S J and Bent A F. The Plant Journal, 1998, 16: 735-743.
- Ding Z, et al. Acta Agronomica Sinia, 2007, 33(5):717-722.
- Gan S and Amasino R M. Science, 1995, 270: 1986-1988.
- Gan S and Amasino R M. Plant physiol, 1997, 113: 313-319.
- Haake V, et al. Plant Physiol, 2002, 130(2):639-48.
- Hsieh T H, et al. Plant Physiol, 2002a, 129(3):1086-1094.
- Hsieh T H, et al. Plant Physiol, 2002b, 130(2):618-626.
- Huang P, et al., Molecular Cloning: A Laboratory Manual (3rd version), Science press, 2002.
- Hou W, et al. Chinese Agricultural Science Bulletin, 2005, 21(1): 128-132.
- Jang I C, et al. Plant J, 2012, 72(2):345-354.
- Jiang Y F, et al. Chinese Agricultural Science Bulletin. 2013, 9(3): 1-5.
- Kasuga M, et al. Nat Biotechnol, 1999, 17(3): 287-291.
- Kovalchuk N, et al. Plant Biotechnol J, 2013, 11(6):659-670.
- Kuang L and Zhang H Q. Chinese Journal of Eco-Agriculture. 2014, 22(8): 928-937.
- Lee J T, et al. Plant Cell Environ, 2003, 26(7):1181-1190.
- Lim P O, et al. Annu. Rev. Plant Biol, 2007, 58: 115-136.
- Lin J F and Wu S H. The Plant Journal, 2004, 39: 612-628.
- Liu D. Studies of Arabidopsis agyl mutants and soybean GmATG8a gene. PhD Dissertation in Nankai University, 2010.
- Liu W, et al. Grassland Science, 2001, 18(5): 28-32.
- Nelson D E, et al. Proc Natl Acad Sci U S A, 2007, 104(42): 16450-5.
- Paz M M, et al., Plant Cell Rep, 2006, 25: 206-213.
- Pellegrineschi A, et al. Jircas Working Report, 2002, 55-60.
- Quirino B F, et al. Trends in plant science, 2000(5):278-282.
- Taji T, et al. The Plant Journal, 2002, 29(4): 417-426.
- Tang R S, et al. Acta Agronomica Sinica, 1998, 24 (2): 231-236.
- Umezawa T, et al. Current Opinion in Biotechnology, 2006, 17:113-122.
- Wang C, et al. Journal of Natural Disasters. 2007, 16(537):37-43.
- Wang J Y, et al. Biochem Biophys Res Commun, 2013, 432(2):262-267.
- Wen H and Nie F. Journal of Anhui Agricultural University. 2000, 27(2): 135-137.
- Xu D, et al. Plant Physiol, 1996, 110(1): 249-257.
- Yuan Z, et al. Journal of plant physiology and molecular biology. 2002, 28(5): 379-384.
- Zhang X, et al. Journal of Shanxi Agricultural Sciences. 2008, 36(9): 26-28.
- Zhang X J and Yan Y. Northern Horticulture. 2009 (9): 1-6.
Claims
1. A fusion polypeptide, comprising:
- an N-terminal stress-responsive peptide, comprising an amino acid sequence at least 70% identical to the sequence as set forth in SEQ ID NO: 1;
- a C-terminal polypeptide; and
- optionally a linker sequence between the N-terminal stress-responsive peptide and the C-terminal polypeptide, said linker sequence having a length of 1-20 amino acid residues;
- wherein: the N-terminal stress-responsive peptide is foreign to the C-terminal polypeptide; and the N-terminal stress-responsive peptide retains an ability to regulate stability of the fusion polypeptide such that the fusion polypeptide is capable of remaining at a low level in absence of, but accumulating at a high level in presence of, at least one environmental stress in the plant.
2. The fusion polypeptide according to claim 1, wherein the N-terminal stress-responsive peptide comprises an amino acid sequence at least 90% identical to the sequence as set forth in SEQ ID NO: 1.
3. The fusion polypeptide according to claim 2, wherein the N-terminal stress-responsive peptide comprises an amino acid sequence 100% identical to the sequence as set forth in SEQ ID NO: 1.
4. The fusion polypeptide according to claim 1, comprising an amino acid sequence as set forth in SEQ ID NO: 3.
5. An expression vector, comprising a promoter operably linked to a polynucleotide, wherein the polynucleotide encodes the fusion polypeptide according to claim 1.
6. The expression vector according to claim 5, wherein the promoter is a plant-compatible promoter, selected from a group consisting of a constitutive plant promoter, a tissue specific plant promoter, and a promoter of a plant gene.
7. The expression vector according to claim 6, wherein the promoter is a constitutive plant promoter, selected from the group consisting of a CaMV35S promoter, an opine promoter, a promoter of ubiquitin (Ubi) gene of a plant species, a promoter of actin 1 (Act-1) gene of a plant species, and a promoter of alcohol dehydrogenase 1 (Adh-1) gene of a plant species.
8. The expression vector according to claim 7, wherein the promoter is a CaMV35S promoter.
9. A plant transformed with a polynucleotide, wherein the polynucleotide encodes, and expresses in the plant, a fusion polypeptide, the fusion polypeptide comprising:
- a N-terminal stress-responsive peptide, comprising an amino acid sequence at least 70% identical to the sequence as set forth in SEQ ID NO: 1;
- a C-terminal polypeptide; and
- optionally a linker sequence between the N-terminal stress-responsive peptide and the C-terminal polypeptide, said linker sequence having a length of 1-20 amino acid residues;
- wherein: the N-terminal stress-responsive peptide is foreign to the C-terminal polypeptide; and the N-terminal stress-responsive peptide retains an ability to regulate stability of the fusion polypeptide such that the fusion polypeptide is capable of remaining at a low level in absence of, but accumulating at a high level in presence of, at least one environmental stress in the plant.
10. The plant according to claim 9, wherein the C-terminal polypeptide is a polypeptide having a function of a plant anti-stress gene, selected from a group consisting ofAREB1, AREB2, rd19, rd22, MYC, MYB, bZIP, AtGolS2, CBF4, DREBla, Adc, HVA1, ZmNF-YB2, IPT, PPC and SSPP.
11. The plant according to claim 10, wherein the C-terminal polypeptide is a polypeptide having a function of SSPP.
12. The plant according to claim 11, wherein the C-terminal polypeptide comprises an amino acid sequence at least 70% identical to the sequence as set forth in SEQ ID NO: 2.
13. The plant according to claim 12, wherein the C-terminal polypeptide comprises an amino acid sequence 100% identical to the sequence as set forth in SEQ ID NO: 2.
14. The plant according to claim 9, wherein the polynucleotide comprises a nucleotide sequence at least 70% identical to the sequence as set forth in SEQ ID NO: 4.
15. The plant according to claim 14, wherein the polynucleotide comprises a nucleotide sequence 100% identical to the sequence as set forth in SEQ ID NO: 4.
16. The plant according to claim 9, exhibiting enhanced tolerance to the at least one environmental stress compared to a plant of a same species not containing the polynucleotide, wherein:
- the at least one environmental stress comprises at least one of drought stress, high salt stress, high temperature stress, low temperature stress, water stress, or pathogen stress.
17. The plant according to claim 16, wherein the at least one environmental stress comprises at least one of drought stress and high salt stress.
18. The plant according to claim 9, wherein the plant is a model plant, a food crop, a cash crop, a vegetable, a fruit, a grass or a flower.
19. The plant according to claim 17, wherein the plant is selected from the group consisting of Arabidopsis, corn (maize), sorghum, wheat, sunflower, crucifer, pepper, potato, cotton, rice, soybean, sugarbeet, sugarcane, tobacco, barley, oilseed rape, Brassica sp., alfalfa, rye, millet, safflower, peanut, chestnut, sweet potato, cassava, coffee, coconut, pineapple, apple, orange, pear, watermelon, grape, peach, lemon, cherry, Chinese date, strawberry, blue berry, raspberry, blackberry, papaya, apricot, persimmon, pomegranate, jackfruit, areca nut, kiwi fruit, plum, loquat, cocoa, tea, banana, avocado, fig, guava, mango, olive, papaya, cashew, macadamia, almond, oat, onions, tomato, lettuce, green bean, lima bean, pea, eggplant, zucchini, luffa, mushroom, carrot, spinach, kale, broccoli, pumpkin, white gourd, lotus root, garlic, ginger, chive, yam, cucumber, cantaloupe, muskmelon, azalea, hydrangea, hibiscus, rose, tulip, daffodil, petunia, carnation, poinsettia, chrysanthemum, pulp tree, oil palm, and conifer.
20. The plant according to claim 18, wherein the plant is Arabidopsis or soybean.
Type: Application
Filed: Jul 8, 2017
Publication Date: Oct 26, 2017
Patent Grant number: 10760092
Applicant: NANKAI UNIVERSITY (Tianjin)
Inventors: NINGNING WANG (Tianjin), LI XIONG (Tianjin), JUANJUAN BI (Tianjin), SHENG LIU (Tianjin), WEI XU (Tianjin), LIFANG SUN (Tianjin), ZHAOXIA GUO (Tianjin), NASRULLAH (Tianjin), DAN WANG (Tianjin), YUANYUAN MEI (Tianjin)
Application Number: 15/644,779