Abstract: The present invention provides for an antisense oligonucleotide having the sequence 5?GCTCGGCGCCGCCATTTCCAG3?. The invention also provides for an antisense oligonucleotide having the sequence 5?GTCAGCGGCCATCAGCTT3?. The present invention further provides for a method for treating a neurodegenerative disorder in a subject which comprises administering to the subject a compound in an amount effective to inhibit neuronal cell death and thus treat the neurodegenerative disorder in the subject, which compound comprises the oligonucleotide 5?GCTCGGCGCCGCCATTTCCAG3? and a delivery agent. The present invention provides for a method of inhibiting trophic factor withdrawal mediated death of a cell which comprises contacting the cell with an amount of the oligonucleotide 5?GCTCGGCGCCGCCATTTCCAG3? effective to inhibit death of the cell.

Abstract: The present invention provides a chain-shortened polynucleotide wherein the proportion of a 2?-5? phosphodiester bond is up to 3% based on the whole phosphodiester bonds or a salt thereof and a pharmaceutical composition containing the same, and a method for producing the same.

Abstract: Truncated aggrecanase proteins and nucleotides sequences encoding them as well as processes for producing them are disclosed. Additionally, aggrecanases with amino acid mutations that lead to increased stability and expression levels in comparison with wild-type or native aggrecanases are also disclosed. Aggrecanases of the invention are especially useful for development of compositions for treatment of diseases such as osteoarthritis. Methods for developing inhibitors of the aggrecanase enzymes and antibodies to the enzymes for treatment of conditions characterized by the degradation of aggrecan are also disclosed.

Abstract: The present invention provides a method for easily producing an (R)-3-[4-(trifluoromethyl)phenylamino]-pentanoic acid amide derivative useful for an intermediate for pharmaceutical products, particularly an inhibitor of a cholesteryl ester transfer protein (CETP) from easily available raw materials. In the present invention, (S)-N-[4-(trifluoromethyl)phenyl]-3-hydroxypentanoic acid amide prepared from easily available raw materials leads a production of (R)-4-ethyl-1-[4-(trifluoromethyl)phenyl]-2-azetidinone to give (R)-3-[4-(trifluoromethyl)phenylamino]-pentanoic acid amide. Furthermore, (R)-4-ethyl-1-[4-(trifluoromethyl)phenyl]-2-azetidinone is reacted with a carbamic acid ester to give an (R)-3-[4-(trifluoromethyl)phenylamino]-pentanoic acid amide derivative.

Abstract: The invention relates to a process for the preparation of substituted 2-vinyl-2-arylmorpholine derivatives as described herein. This invention also relates to 2-vinyl-2-arylmorpholine derivatives as well as intermediates therefor.

Abstract: A process for preparing substituted 5-amino-pyrazolo[4,3-e]-1,2,4-triazolo-[1,5-c]pyrimidine compounds having an aminoalkyl substituent at the 7-position is disclosed, wherein the pyrimidine ring is cyclized using a cyanating agent.

Abstract: The present invention provides a process for producing the pyridine compound [d]: [wherein R3 and R4 are as defined below], which has an excellent herbicidal activity, by making a pyridine compound [a]: [wherein R1 represents a C1–C6 alkoxy group, R3 represents a halogen atom, cyano group or nitro group, and R4 ?????????? ? ???????? ???? ?? ??????? ????] ????? ???? ?? ?-diazoester compound [f]: N2CHCOR1[f] [wherein R1 is defined above] in the presence of an acid.

Abstract: The present invention relates an improved process for the preparation of tetrahydro-?-carboline derivative of formula (V) which is useful as an intermediate for the preparation of Tadalafil of formula (I).

Abstract: The inventors have purified the fluorescent product in the hydroethidine-based supeorxide detection assays and further identified the product as 2-hydroxyethidium. Methods for synthesizing 2-hydroxyethidium and for detecting and quantifying superoxide are provided.

Abstract: The present invention relates to novel chromogenic substrates which are used to detect aminopeptidase activity in microorganisms or to determine whether at least one bacterium belongs to the Gram-positive group or to the Gram-negative group according to the color thereof. The invention also relates to culture media containing such substrates, to the use of the substrates or media for the detection of aminopeptidase activities and/or the differentiation of Gram-positive bacteria from Gram-negative bacteria and to methods of use. The aforementioned novel substrates have the formula below: in which: R1 is nothing or an alkyl, allyl or aryl group, R2 consists of at least one amino acid, preferably alanine, R3, R4, R5 and R6 consist, independently of one another, of H— or —O-alkyl, preferably —O—CH3, R7 consists of H, O—CH3, alkyl or halogen, R8 consists of H or Cl, and n is an integer corresponding to 0 or 1. The invention is particularly suitable for use in the field of diagnostics.

Abstract: Compounds of the formula (I) provide pharmacological agents which are inhibitors of the P450 enzyme, aldosterone synthase, and thus may be employed for the treatment of aldosterone mediated conditions. Accordingly, the compounds of formula (I) may be employed for prevention, delay of progression, or treatment of hypokalemia, hypertension, congestive heart failure, renal failure, in particular, chronic renal failure, restenosis, atherosclerosis, syndrome X, obesity, nephropathy, post-myocardial infarction, coronary heart diseases, increased formation of collagen, fibrosis and remodeling following hypertension and endothelial dysfunction. Preferred are the compounds of formula (I) which are selective inhibitors of aldosterone synthase devoid of undesirable side effects due to general inhibition of cytochrome P450 enzymes.

Abstract: Diastereoselective and enantioselective synthetic routes for the preparation of compounds of formula (I): or derivatives thereof, wherein: R is C1-6alkyl, C3-7cycloalkyl, C1-6alkoxy, hydroxy, halo, C1-6alkenyl, C1-6alkynyl, amino, C1-6alkylamino, di(C1-6alkyl)amino, hydroxyC1-6alkyl, C1-6alkoxyC1-6alkyl, arylC1-6alkoxy, heteroarylC1-6alkoxy, aminoC1-6alkyl, (C1-6alkyl)aminoC1-6alkyl, di(C1-6alkyl)aminoC1-6alkyl, arylC1-6alkylamino, heteroarylC1-6alkyamino; R1 is hydrogen or R; R2 is hydroxy, C1-6alkoxy, amino, C1-6alkylamino, di(C1-6alkyl)amino; R3 and R4 are each independently selected from the list consisting of perhaloC1-6alkyl, hydrogen, halo, C1-6alkyl, C1-6alkoxy, hydroxy, amino, C1-6alkylamino, di(C1-6alkyl)amino, hydroxyC1-6alkyl, C1-6alkoxyC1-6alkyl, aminoC1-6alkyl,(C1-6alkyl)aminoC1-6alkyl, di(C1-6alkyl)aminoC1-6alkyl, aryl, and COX wherein X may be hydroxy, C1-6 alkoxy, C1-6alkyl, amino, C1-6alkylamino, or di(C1-6alkyl)amino; and wherein any alkyl group or the alkyl moiety of any group cont

Abstract: 2,3-Di-substituted N-heteroaromatic propionamides with said substitution at the 3-position being a substituted phenyl group and at the 2-position being a methyl cycloalkyl ring, said propionamides being glucokinase activators which increase insulin secretion in the treatment of type II diabetes.

Abstract: Methods for the preparation of N-arylated oxazolidinone compounds via a copper catalyzed cross coupling reaction are disclosed.

Abstract: The invention relates to a process for preparing substituted imidazole derivatives of formula (I) and acid addition salts thereof in which formula Y is —CH2— or —CO—, R1 is H, halo or hydroxy, R2 is H or halo and R3 is H or lower alkyl, starting from a compound of formula (II) wherein Y, R1, R2 and R3 are as defined above. The invention also relates to intermediates and their preparation.

Abstract: A process for the synthesis of perindopril of formula (I): and its pharmaceutically acceptable salts.

Abstract: A process for preparing an amine which comprises in preparing an amine by decarboxylating an ?-amino acid under heating in a high boiling liquid polymer having average molecular weight 200 to 6000, and directly recovering this amine by distillation in the same reaction system, namely in one pot.

Abstract: The present invention relates to bicyclic tetrahydrofuran lactone derivatives of Formula (1) and a preparation method thereof, and particularly it relates to a process of preparing compounds of Formula (1) by performing an intramolecular cyclization of tetrahydrofuran-allenic acid derivatives in the presence of a phenyl halide, a palladium catalyst and a base: wherein n is 1 or 2, and R is phenyl optionally substituted with C1–C6 alkyl, C1–C6 alkoxy, hydroxyl or C1–C6 hydroxyalkyl group.

Abstract: A process for the recovery of molybdenum catalyst from the epoxidation reaction product of olefins with organic hydroperoxides. The active form of the glycol-molybdate epoxidation catalyst is removed from the process stream with an anion ion exchange resin. The ion exchange resin can be either a weak base or strong base type. The preferred embodiment of the invention produces a concentrated epoxidation catalyst in the “ammonium” form that is suitable for recycle to the catalyst preparation vessel. The ammonia form is converted into the active form by evaporating the water and ammonia from the recovered catalyst in the presence of a glycol. The preferred configuration of the ion exchange process is a “Lead-Lag” system. Two vessels will be in service while the third is in the regeneration mode recovering the epoxidation catalyst. A fourth polishing vessel can also be included as a “guard bed” to prevent leakage of the molybdate catalyst into the process stream.

Abstract: The present invention relates to a method of separating an olefin from a gas stream, said gas stream comprising the olefin and at least one other component, said method comprising (i) compressing and cooling the gas stream; (ii) separating the olefin from the gas stream by absorbing the olefin in an absorbent; (iii) separating the olefin from the absorbent by desorption; wherein compressing or cooling or compressing and cooling in (i) is carried out at least twice.

Abstract: This invention provides novel antioxidants comprising hydroquinone substituted polyunsaturated fatty acids. Such fatty acids can be obtained from crude kombo butter and are suitable for preventing oxidation of various organic materials. In particular, the invention relates to the use of these fatty acids as antioxidants in the treatment of cancer, the inhibition of proliferation of cells, in lowering levels of cholesterol both in vivo and in vitro and in the treatment of cognitive disorders, including but not limited to Alzheimer's disease.

Abstract: A process for separating inorganic and organometallic by-products from a mixture comprising at least one organometallic transition metal compound as product and at least one organometallic by-product and at least one inorganic by-product as by-products comprises the steps A) admixing the mixture comprising the product, the organometallic by-product and the inorganic by-product with a mixture comprising at least one polar organic extractant and water and separating off the undissolved residue, B) washing the residue from step A) with a nonpolar organic extractant or a mixture comprising at least one nonpolar organic extractant and at least one aprotic polar organic solvent and C) drying the residue which has been washed in step B) and comprises the organometallic transition metal compound.

Abstract: One aspect of the present invention relates to ligands for transition metals. A second aspect of the present invention relates to the use of catalysts comprising these ligands in transition metal-catalyzed carbon-heteroatom and carbon-carbon bond-forming reactions. The subject methods provide improvements in many features of the transition metal-catalyzed reactions, including the range of suitable substrates, reaction conditions, and efficiency.

Abstract: The present invention provides a novel phosphorus-containing organosilicon compound furnished with performance of an oxaphosphorin compound, a method for producing therefore and a resin composition containing the same, particularly a polyester or polycarbonate resin composition and a coating composition containing the same, characterized by that said phosphorus-containing organosilicon compound has in the molecule a phosphorus-containing group (an X group) bonded to a silicon atom and represented by the following chemical formula (1)

Abstract: The present invention relates to an improved process for the preparation of novel antidiabetic compounds having formula (1) where R1 represents hydrogen or lower alkyl group and X represents hydrogen or halogen atom

Abstract: A process for a preparation of Compound (V), a pharmaceutically acceptable salt or a solvate thereof, said process comprising the steps represented by the following formula: wherein R1 and R2 are each independently C1–C8 alkyl.

Abstract: An improvement of the methanol carbonylation process for manufacturing acetic acid is disclosed. Specifically disclosed is a method for removing permanganate reducing compounds (“PRC's”) from the condensed light ends overhead stream, including (a) distilling at least a portion of the condensed light ends overhead to yield a PRC enriched second overhead stream; (b) extracting the second overhead stream with water and separating therefrom an aqueous stream containing PRC's; and (c) returning at least a portion of the extracted second overhead to the second distiller.

Abstract: A process by which high-quality crystals of methionine in the form of granules or thick plates having high bulk density can be stably produced. The process for production of methionine comprises the step of hydrolyzing 5-(2-methylmercaptoethyl)hydantoin into a metal salt of methionine by the use of at least one metal compound selected from the group consisting of metal hydroxides, metal carbonates, and metal bicarbonates, the step of neutralizing the metal salt of methionine under pressurizing with carbon dioxide to crystallize methionine, the step of separating the resulting mixture into methionine and a filtrate, and the step of recycling the filtrate to the step of hydrolysis of 5-(2-methylmercaptoethyl)-hydantoin, wherein the content of methionine polymers and/or salts thereof in the aqueous solution used in the crystallization step in terms of methionine polymers is adjusted to 8 wt % or below based on the amount of methionine to be formed.

Abstract: The present invention relates to a method for the purification of an ?-hydroxy acid on an industrial scale, in which an ?-hydroxy acid with a color (fresh) of not more than 10,000 APHA units is subjected to (a) a crystallization step followed by (b) a distillation step.

Abstract: An improvement of the methanol carbonylation process for manufacturing acetic acid is disclosed. Specifically disclosed is a method for reducing the formation of alkyl iodides and C3-8 carboxylic acids by removing permanganate reducing compounds (“PRC's”) from the light phase of the condensed light ends overhead stream, including (a) distilling the light phase to yield a PRC enriched overhead stream; and (b) extracting the third overhead stream with water in at least two consecutive stages and separating therefrom one or more aqueous streams containing PRC's.

Abstract: A multivalent cationic lipid having a positively-charged head group including two quaternary amine groups and a hydrophobic portion including four hydrocarbon chains, which may be the same or different and which are optionally substituted alkyl and alkenyl groups, two alkyl chains attached to each of the two quaternary amine groups can be used for the introduction of polyanionic materials such a nucleic acid polymers into cells. Specific cationic lipids are N,N,N?,N?-tetraoleyl-N-N?-dimethyl-1,3-propanediammonium chloride and N,N,N?,N?-tetraoleyl-N-N?-dimethyl-1,6-hexanediammonium chloride.

Abstract: Novel compounds and compositions including those compounds, as well as methods of using and making the compounds are herein described. The compounds are useful in therapeutic applications, including modulation of disease or disease symptoms in a subject (e.g., mammal, human, dog, cat, horse). The compounds are useful as modulators of the mu opioid receptor (MOR) through their binding affinity with that receptor.

Abstract: The present invention relates to an improved isocyanate reactive mixture containing at least one DMC-catalyzed polyol and about 0.25 to about 15 wt. %, based on the total weight of the isocyanate-reactive mixture, of at least one ethylene oxide (EO) containing water compatibilizer. The isocyanate reactive mixtures of the present invention may find use in the preparation of polyurethane foams, coatings, elastomers, sealants, adhesives and the like.

Abstract: The invention relates to a process for the production of an [18F]fluorohaloalkane which comprises treatment of a solid support-bound precursor of formula (I): SOLID SUPPORT-LINKER-SO2—O—(CH2)nX (I) wherein n is an integer of from (1) to (7) and X is chloro, bromo or iodo; with 18F? to produce the [18F]fluorohaloalkane of formula (II) 18F—(CH2)n—X (II) wherein n and X are as defined for the compound of formula (I), optionally followed by (i) removal of excess 18F?, for example by ion-exchange chromatography; and/or (ii) removal of organic solvent.

Abstract: Process for the separation of a mixture comprising at least one hydrofluoroalkane and hydrogen fluoride, according to which a hydrofluoroalkane/hydrogen fluoride mixture is reacted with at least one chlorinated or chlorofluorinated precursor of the hydrofluoroalkane. Process for the preparation of a hydrofluoroalkane comprising such a separation, in combination with a catalytic reaction stage. Azeotropic compositions.

Abstract: Linear 1-butene dimers and other linear alpha-olefin dimers are manufactured in high yield and with high selectivity by coupling of alpha-olefins. The coupling is accomplished by contacting alpha olefins with an iron-based catalyst activated with an aluminum-based co-catalyst. The catalyst is structured to preclude formation of multiple dimer products, and the byproducts of the olefin coupling consist almost exclusively of methyl branched olefin dimers. The dimers have potentially diverse use in areas stretching form pharmaceuticals to plastics. Linear 1-butene dimers may be particularly useful in the production of plasticizer alcohols which may in turn be used to manufacture high quality plastics with reduced leaching.

Abstract: A process for total hydrogenation of polyunsaturated compounds that have n nonsaturations that are contained in a hydrocarbon feedstock in the presence of a catalytic reactor with a hydrogen-selective membrane is described. This process comprises the introduction of said feedstock that is co-mixed with hydrogen into a reaction zone of said reactor, the contact of hydrogen with the face that is upstream from said membrane, which is inorganic and porous, then the catalytic reaction of said feedstock with hydrogen that has selectively traversed the membrane.

Abstract: An ethane or other hydrocarbon feedstock is steam cracked to produce an ethylene stream which is processed in an ethylene plant recovery section to separate an ethane recycle and a polymer grade or chemical grade ethylene product stream. A portion of the ethylene product stream may then be reacted by dimerization to produce a butene stream. These formed butenes and/or butenes recovered from other sources and another portion of the ethylene product stream are reacted by metathesis to produce a propylene stream which is deethanized and separated from heavier hydrocarbons to produce the propylene product. The butene product stream may also be deethanized and is separated from heavier hydrocarbons. The overhead from the metathesis section deethanizer may be recycled to the ethylene plant recovery section. The reflux for the metathesis section deethanizer may be generated from the overhead or may be a portion of the ethylene product stream.

Abstract: This invention provides processes for maintaining a desired particle size distribution in an oxygenate to olefin reaction system. In one embodiment, the invention comprises replacing lost catalyst fines with less active co-catalyst particles. By adding less active co-catalyst particles to the reaction system, desirable fluidization characteristics and hydrodynamics can be maintained without affecting the overall (or primary catalyst) performance and product selectivities. The invention is also directed to a population of catalyst particles having a desirable particle size distribution well-suited for realizing ideal fluidization and hydrodynamic characteristics.

Abstract: A process for the production of an olefin from a hydrocarbon by autothermal cracking, which process comprises: partially combusting the hydrocarbon and an oxygen-containing gas in the presence of a catalyst, wherein the stoichiometric ratio of hydrocarbon to oxygen is 5 to 16 times the stoichiometric ratio of hydrocarbon to oxygen required for complete combustion of the hydrocarbon to carbon dioxide and water, characterised in that the catalyst comprises palladium and at least one further metal being a Group IIIA, Group IVA, VA, a transition metal or a lanthanide.

Abstract: A process for the isomerization of a feedstream comprising C5–C6 hydrocarbons where the process involves charging hydrogen and a feedstream comprising at least normal C5–C6 hydrocarbons into an isomerization zone and contacting said hydrogen and feedstream with an isomerization catalyst at isomerization conditions to increase the branching of the feedstream hydrocarbons and produce an isomerization effluent stream comprising at least normal pentane, normal hexane, methylbutane, dimethylbutane, and methylpentane has been discovered. Without passing through a stabilizer, the isomerization effluent stream is passed to a deisohexanizer zone to generate at least a stream enriched in methylbutane and dimethylbutanes. The stream enriched in methylbutane and dimethylbutanes is passed to an isomerate striper column to remove butane and lighter hydrocarbons and gasses. The remainder containing the methylbutane and dimethylbutanes is collected for use in, for example, gasoline blending.

Abstract: A wound dressing including an absorbent core defining opposed proximal and distal surfaces and at least one receptacle formed therein. The at least one receptacle opening at the distal surface of the absorbent core and extending a distance into the thickness of the absorbent core. The at least one receptacle contains a discrete portion of absorbent material. The absorbent core may include a plurality of discrete hydrophilic particulates enmeshed therein. The wound dressing may include an elastomeric gel layer and a liquid impervious, vapor permeable backing layer connected to the absorbent core.

Abstract: The present invention provides a sanitary napkin that is thin (less than 5 mm in thickness), highly absorbent and has a lateral flexibility allowing for controlled deformation when in use, namely the assumption of a “W” pattern. This controlled deformation provides a good comfort potential and simultaneously reduces the likelihood of bunching due to compression forces exerted laterally against the napkin by the thighs of the wearer. In a specific example, the sanitary napkin is characterized by a pair of preferential bending zones extending along the longitudinal axis of the sanitary napkin and by a pair of longitudinal adhesive zones on the liquid-impervious barrier layer of the sanitary napkin, that register with the preferential bending zones. The longitudinal adhesive zones fasten the sanitary napkin to the undergarment at the areas at which the sanitary napkin is intended to fold when subjected to lateral compression.

Abstract: The subject invention relates to nematode responsive domains obtained from soybean promoters for phosphoribosylformylglycinamidine ribonucleotide (FGAM) synthase paralogs. The nematode responsive domains can be used in promoters that are linked to heterologous DNA. Such constructs can be expressed in transfected or transformed soybean and used in the control of nematode infection of soybean.

Abstract: The invention provides a method of producing a recombinant polypeptide having ?-glucosidase enzymatic activity, a polynucleotide encoding the polypeptide, nucleic acid constructs carrying the polynucleotide, transformed cells, such as yeast cells, and transgenic organisms expressing the polynucleotide. The invention provides various uses of the polypeptide, the polynucleotide, cells and/or organisms, including producing a recombinant polypeptide having ?-glucosidase enzymatic activity, increasing the level of aromatic compounds in alcoholic beverages, as well as other fermentation products of plant material, hydrolyzing cellobiose and thus increasing the level of fermentable glucose, increasing the production of alcohol; such as ethanol from plant material, increasing the aroma released from a plant, or a plant, product, and hydrolysis or transglycosylation of glycosides.

Abstract: A transgenic plant transformed by a protein kinase stress-related protein (PKSRP) coding nucleic acid, wherein expression of the nucleic acid sequence in the plant results in increased tolerance to environmental stress as compared to a wild type variety of the plant. Also provided are agricultural products, including seeds, produced by the transgenic plants. Also provided are isolated PKSRP, and isolated nucleic acid coding PKSRP, and vectors and host cells containing the latter. Further provided are methods of producing transgenic plants expressing PKSRP, and methods of identifying novel PKSRP and methods of modifying the expression of PKSRP in plants.

Abstract: Compositions and methods are provided for modifying a trait of a plant. Isolated polynucleotide and polypeptide sequences are provided, along with an expression vector comprising the isolated polynucleotide, a host cell comprising the isolated polynucleotide, and a transgenic plant comprising the isolated polynucleotide. Also provided is a method for producing a transgenic plant, a method for screening for a compound that may modify the trait and a method for identifying other homologous polynucleotide and polypeptide sequences.

Abstract: This invention relates to an isolated nucleic acid fragment encoding a vitamin E biosynthtetic enzyme. The invention also relates to the construction of a chimeric gene encoding all or a portion of the vitamin E biosynthtetic enzyme, in sense or antisense orientation, wherein expression of the chimeric gene results in production of altered levels of the vitamin E biosynthtetic enzyme in a transformed host cell.

Abstract: B-2-1-ctHGg cotton seeds and plants are provided. Such cotton seeds display genetically-controlled naturally-occurring glyphosate herbicide resistance. A method is provided for transferring the herbicide resistance to another cotton plant, as well as a method for controlling weeds in a field of such plants.

Abstract: The present invention provides cotton plants, cotton tissues, and cotton seeds that include the MON15985 event, which confers resistance to Lepidopteran insect damage. Also provided are assays for detecting the presence of the MON15985 event based on the DNA sequence of the recombinant construct inserted into the cotton genome that resulted in the MON15985 event and/or the genomic sequences flanking the insertion site.