Abstract: Described herein are beta-glucosidase enzymes that have improved beta-glucosidase activity compared to a control beta-glucosidase enzyme. The improved beta-glucosidase enzymes are useful for converting a cellulosic biomass to fermentable sugars such as glucose. Also described are isolated polynucleotides that encode polypeptides having improved beta-glucosidase activity, expression cassettes for expressing the improved beta-glucosidase polypeptides, and cells, such as yeast cells, transformed with the expression cassettes.

Abstract: The present invention relates to methods for obtaining positive transformants of a filamentous fungal host cell, comprising: transforming a tandem construct into a population of cells of the filamentous fungal host a tandem construct and isolating a transformant of the filamentous fungal host cell comprising the tandem construct. The present invention also relates to such tandem constructs, filamentous fungal host cells comprising such tandem constructs, and methods of producing multiple recombinant proteins.

Abstract: The present invention relates to variants of factor IX (F.IX) or activated factor IX (F.IXa), wherein the variant is characterized in that it has clotting activity in absence of its cofactor. The present invention furthermore relates to variants of factor IX (F.IX) or activated factor IX (F.IXa), wherein the variant is characterized in that it has increased F.IX clotting activity compared to wildtype. The present invention furthermore relates to the use of these variants for the treatment and/or prophylaxis of bleeding disorders, in particular hemophilia A and/or hemophilia B or hemophilia caused or complicated by inhibitory antibodies to F.VIII. The present invention also relates to further variants of factor IX (F.IX) which have desired properties and can, thus be tailored for respective specific therapeutic applications.

Abstract: The present disclosure provides novel polypeptides with 3-buten-2-ol dehydratase activity, polypeptides with catalytic activity in the conversion of 3-methyl-3-buten-2-ol to isoprene, and crystal structure data for one of such polypeptides. Methods of making and using the polypeptides and their related crystal structure data are also provided.

Abstract: A psicose 3-epimerase, a polynucleotide encoding the enzyme, a recombinant vector carrying the polynucleotide, a recombinant cell harboring the recombinant vector, and use thereof are provided.

Abstract: Methods of preventing the transmission of a mitochondrial disease, disorder, or condition using mitochondria-targeted enzymes or mRNA encoding mitochondria-targeted enzymes. The methods as described herein can specifically eliminate mitochondrial DNA (mtDNA) mutations in the germline.

Abstract: A composition used in targeted mutagenesis is provided, which includes a first expression cassette comprising a nucleotide sequence which encodes a CAS9 endonuclease; a second expression cassette comprising a nucleotide sequence which encodes a guide RNA sequence, wherein the guide RNA sequence is complementary to a target genome nucleotide sequence in a cell; and a third expression cassette comprising a nucleotide sequence which encodes a Trex2 exonuclease (Trex2) gene. The first, second, and third expression cassettes may be a part or a portion of one or more expression vectors.

Abstract: The present disclosure relates to novel peptides and their uses including, proline-rich peptides that are useful for displaying a protein of interest at the surfaces of a host cell such as a yeast. Polynucleotides, proteins, vectors and host cells that comprise or encode the novel proline-rich peptides, including libraries comprising such polynucleotides, proteins, vectors and/or host cells that comprise or encode novel proline-rich peptides are provided. Methods and materials for display and expression of proteins of interest are provided. Methods and materials are also provided by the present disclosure for isolating peptides capable of displaying a protein of interest (e.g., a marker protein), for generating libraries to display and/or express proteins of interest (e.g., antibodies such as humanized antibodies), for generating secretion vectors for such proteins of interest, and for generating proteins of interest (e.g., antibodies).

Abstract: Methods and compositions are provided for rapidly identifying novel structure-switching aptamers.

Abstract: The invention relates to a method for selecting a glycopolypeptide that binds to a target protein, the method including the steps of providing a pool of glycopolypeptides fused via puromycin linker to an encoding mRNA-cDNA duplex; combining the pool with a target protein to form a mixture; incubating the mixture for a period of time sufficient to allow any target protein to bind to one or more of the glycopolypeptides, thereby forming glycopolypeptide-target protein complexes; and isolating from the mixture the glycopolypeptide-target protein complexes, thereby identifying a plurality of selected glycopolypeptides.

Abstract: Disclosed herein is an efficient method of generating a library of variants of a sequence of interest, such as may be used in directed evolution. In one embodiment, the method includes an amplification reaction, e.g., error-prone PCR, to generate double-stranded DNA (dsDNA) variants of a sequence of interest, after which one strand of the dsDNA variants may be selectively degraded to produce single-stranded DNA (ssDNA) variants. The ssDNA variants may be hybridized to ssDNA intermediaries, e.g., uracilated circular ssDNA intermediaries, to form heteroduplex DNA, which may be transformed into cells, such as E. coli cells, yielding a library of variants. This method eliminates the inefficient sub-cloning steps and the need for costly primer sets required by many prior methods.

Abstract: The present disclosure provides compositions, methods, systems, and devices for polynucleotide processing. Such polynucleotide processing may be useful for a variety of applications, including polynucleotide sequencing. In some cases, this disclosure provides methods for the generation of polynucleotide barcode libraries, and for the attachment of such polynucleotides to target polynucleotides.

Abstract: The invention, in some aspects, relates to methods, systems, and components of a high-content, single-cell resolution, spatial multiplex cell imaging system.

Abstract: An objective of the present invention is to provide target tissue-specific antigen-binding molecules, antigen-binding molecules whose antigen-binding activity varies depending on the concentration of an unnatural compound, libraries comprising a plurality of the antigen-binding molecules which are different from one another, pharmaceutical compositions comprising the antigen-binding molecules, methods of screening for the antigen-binding molecules, and methods for producing the antigen-binding molecules. The present inventors created antigen-binding domains whose antigen-binding activity varies depending on the concentration of a small molecule compound or antigen-binding molecules containing an antigen-binding domain, and libraries comprising a plurality of the antigen-binding domains which are different from one another or antigen-binding domains, and demonstrated that the above-noted objective could be achieved by using the libraries.

Abstract: The disclosure relates to novel compounds and compositions comprising a RNAi agent comprising a novel compound as a 3? end cap. The disclosure also relates to processes for making such compositions, and methods and uses of such compositions, e.g., to mediate RNA interference.

Abstract: The invention provides means and methods for alleviating one or more symptom(s) of Duchenne Muscular Dystrophy and/or Becker Muscular Dystrophy. Therapies using compounds for providing patients with functional muscle proteins are combined with at least one adjunct compound for reducing inflammation, preferably for reducing muscle tissue inflammation, and/or at least one adjunct compound for improving muscle fiber function, integrity and/or survival.

Abstract: The present inventions relates to isolated nucleic acid molecules comprising a nucleotide sequence coding for mi RNA-182 (uuuggcaaugguagaacucacacu or ugguucuagacuugccaacua), miRNA-96 (uuuggcacuagcacauuuuugcu or aaucaugugcagugccaauaug) and/or mi RNA-183 (uauggcacugguagaauucacu or gugaauuaccgaagggccauaa) for use in treating or ameliorating a ciliopathy and/or a photoreceptor dysfunction.

Abstract: The present invention is intended to provide a novel molecule that inhibits the expression of the periostin gene that is effective in treatment of diseases caused by the expression of periostin except for eye diseases. A drug for a disease caused by the expression of periostin except for an eye disease includes, as an expression inhibitory sequence for the periostin gene, a nucleic acid molecule including a nucleotide that has a base sequence represented by any one of SEQ ID NOs: 1 to 19. The drug for disease according to the present invention can inhibit the expression of the periostin gene. Thus, it can be used for treatment of diseases (except for eye diseases) caused by the expression of the periostin gene, specifically skin diseases, respiratory diseases, gastrointestinal diseases, and the like.

Abstract: The invention relates to si RNA molecules and their use in methods and pharmaceutical compositions for inhibiting the expression of the FLAP gene. The invention also relates to the use of said si RNAs molecules in the treatment and/or prevention of an eye condition characterised by increased expression and/or activity of FLAP gene, preferably said eye condition is conjunctivitis and/or an ocular allergy such as seasonal allergic conjunctivitis, perennial allergic conjunctivitis, vernal keratoconjunctivitis, atopic keratoconjunctivitis, and giant papillary conjunctivitis.

Abstract: The present invention provides asymmetrical duplex RNA molecules that are capable of effecting sequence-specific gene silencing. The RNA molecule comprises a first strand and a second strand. The first strand is longer than the second strand. The RNA molecule comprises a double-stranded region formed by the first strand and the second strand, and two ends independently selected from the group consisting of 5?-overhang, 3?-overhang, and blunt end. The RNA molecules of the present invention can be used as research tools and/or therapeutics.

Abstract: The invention relates to the use of microRNA 96 and precursors and mimics thereof for the inhibition of vascular cell proliferation and/or vascular remodelling, and for the treatment of associated medical conditions such as pulmonary arterial hypertension (PAH).

Abstract: This invention relates to compounds, compositions, and methods useful for reducing transthyretin (TTR) target RNA and protein levels via use of dsRNAs, e.g., Dicer substrate siRNA (DsiRNA) agents.

Abstract: Disclosed herein are compositions and methods for reducing expression of C9ORF72 mRNA and protein in an animal. Such methods are useful to treat, prevent, ameliorate, or slow progression of neurodegenerative diseases in an individual in need thereof.

Abstract: A method of controlling the number of cells in a population of cells having silenced transcription of a target nucleic acid as a function of time includes recruiting a chromatin regulator (CR) to a site proximal to a transcription initiation site of the target nucleic acid to form a fraction of silenced cells in the population of cells. The chromatin regulator may be EED, KRAB, DNMT3, HDAC4, EZH2, REST, or a combination thereof.

Abstract: Immunogenic modulators and compositions comprising oligonucleotide agents capable of inhibiting suppression of immune response by reducing expression of one or more gene involved with an immune suppression mechanism.

Abstract: The invention relates to an oligonucleotide including one or more modified nucleoside bases having the structure -B-L-A wherein for each of the modified nucleosides A is independently a monosaccharide or oligosaccharide, L is a linker molecule, and B is independently a pyrimidine or pyridine base linked to the sugar-phosphate backbone of the oligonucleotide; and wherein the oligonucleotide binds specifically to a carbohydrate-binding monoclonal antibody with an affinity of less than 100 nM. Immunogenic conjugates that include the oligonucleotide, and pharmaceutical compositions that include the oligonucleotide or the immunogenic conjugate are also disclosed. Various method of using the oligonucleotides, immunogenic conjugates, and pharmaceutical compositions are disclosed, including inducing an immune response, inhibiting viral or bacterial infection, treating a cancerous condition, and detecting a neutralizing antibody.

Abstract: The present invention relates to RNAi constructs with improved tissue and cellular uptake characteristics and methods of use of these compounds in dermal and fibrotic applications. Aspects of the invention provide nucleic acid molecules for the prophylactic treatment of wounding to reduce scarring. Herein, it is demonstrated that a specific nucleic acid molecule, RXI-109 (targeting connective tissue growth factor (CTGF)), given prophylactically, reduces scarring during wound healing.

Abstract: The invention relates to antisense oligonucleotidic sequences (ODN) against Smad7 suitably modified, and their uses in medical field as therapeutic biological agents, in particular in the treatment of chronic inflammatory bowel disease, such as Crohn's disease and ulcerative colitis.

Abstract: Provided herein are methods, compounds, and compositions for reducing expression of a DMPK mRNA and protein in an animal. Also provided herein are methods, compounds, and compositions for preferentially reducing CUGexp DMPK RNA, reducing myotonia or reducing spliceopathy in an animal. Such methods, compounds, and compositions are useful to treat, prevent, delay, or ameliorate type 1 myotonic dystrophy, or a symptom thereof.

Abstract: The present invention relates to an RNA interference-inducing nucleic acid and the use thereof, and more particularly to an RNA interference-inducing nucleic acid comprising at least one single strand of double strands, the at least one single strand comprising a modification substituted to a spacer, which is unable to form a base pair, in the 5? end or the 3? end region. The RNA interference-inducing nucleic acid of the present invention is a novel modified form of nucleotide provided to prevent off-target effects, offering a method to selectively repress target gene expression.

Abstract: The present disclosure relates to methods of treating a patient suffering from or at risk of developing an ocular disease, disorder or injury, and includes treatment regimens using a double-stranded RNA compound that down-regulates CASP2 expression, or a pharmaceutically acceptable salt thereof.

Abstract: The invention relates to si RNA molecules and their use in methods and pharmaceutical compositions for inhibiting the expression of the ORAI1 gene. The invention also relates to the use of said si RNAs molecules in the treatment and/or prevention of an eye condition characterised by increased expression and/or activity of ORAI1 gene, preferably said eye condition is conjunctivitis and/or an ocular allergy such as seasonal allergic conjunctivitis, perennial allergic conjunctivitis, vernal keratoconjunctivitis, atopic keratoconjunctivitis, and giant papillary conjunctivitis.

Abstract: The present invention relates to uses, methods and compositions for treating crescentic glomerulonephritis. More specifically, the present invention relates to a DDR1 antagonist or an inhibitor of DDR1 gene expression for the prevention or the treatment of said disease.

Abstract: The invention provides a method of propagating an adenoviral vector. The method comprises (a) providing a cell comprising a cellular genome comprising a nucleic acid sequence encoding a tetracycline operon repressor protein (tetR), and (b) contacting the cell with an adenoviral vector comprising a heterologous nucleic acid sequence encoding a toxic protein. The heterologous nucleic acid sequence is operably linked to a promoter and one or more tetracycline operon operator sequences (tetO), and expression of the heterologous nucleic acid sequence is inhibited in the presence of tetR, such that the adenoviral vector is propagated. The invention also provides a system comprising the aforementioned cell and adenoviral vector.

Abstract: The invention relates to an artificial nucleic acid molecule comprising at least one open reading frame and at least one 3?-untranslated region element (3?-UTR element) comprising a nucleic acid sequence which is derived from the 3?-UTR of a FIG4 gene or from a variant of the 3?-UTR of a FIG4 gene. The invention further relates to the use of such an artificial nucleic acid molecule in gene therapy and/or genetic vaccination. Furthermore, the invention relates to the use of a 3?-UTR element comprising a nucleic acid sequence which is derived from the 3?-UTR of a FIG4 gene or from a variant of the 3?-UTR of a FIG4 gene for the stabilization and/or prolongation of protein expression from a nucleic acid sequence comprising such 3?-UTR element.

Abstract: Described herein is the development of a multi-plasmid system (Compatible Antibiotic-free Multi-Plasmid System, CAMPS) for the expression of one or more nucleic acid sequences of interest in specially engineered host cells and grown in antibiotic-free medium. A panel of compatible plasmids was engineered in which each plasmid comprises an identical origin of replication (Ori) which only differs between plasmids in the loop sequence/s of the RNA I/II region of the Ori. Thus, these plasmids share the same replication mechanism but vary in copy numbers. In order to maintain these multiple plasmids without using antibiotics, multiple conditional essential genes (CEG) from the host genome were grafted into these plasmids. As a result, all of these co-existing plasmids carrying the CEG were maintained in a host where the corresponding CEGs were knocked out from the host's genome during fermentation. Said CAMPS system has broad utility in metabolic engineering and synthetic biology.

Abstract: The present invention concerns a method for genetically transforming a Bifidobacterium strain comprising a step of methylation of a shuttle vector in an E. coli or a Gram-positive bacterium strain by two type II DNA methyltransferases from a Bifidobacterium: a methyltransferase enzyme that methylates the adenine base at position 4 of the nucleotide sequence RTCAGG and a methyltransferase enzyme that methylates the cytosine base at position 4 of the nucleotide sequence GGWCC. The present invention also concerns genetic tools and culture media useful for carrying out said method.

Abstract: The present disclosure relates to compositions and methods for destabilizing biofilms, altering biofilm 3D structure, and dispersing biofilms, in order to enhance biofilm cell removal and/or sensitivity to other agents (e.g., environmental or co-applied treatments). In particular, the present disclosure relates to the use of L-arginine in the removal and/or sensitization (e.g., to antimicrobials) of microorganisms in medical, industrial, domestic, or environmental applications, as well as treatment of bacterial infections (e.g., in biofilms).

Abstract: The present invention relates to a female fertile variant strain of filamentous fungus derived from a female sterile parental strain which comprises at least one of the six female fertility specific gene alleles or derivatives thereof comprising the functional characteristics of these alleles (FS_4-9).

Abstract: The present disclosure relates to the identification of a QTL associated with high ethanol tolerance in Saccharomyces spp. More specifically, it relates to specific alleles of MKT1 and APJ1 possibly combined with a specific allele of SWS2 that are important in obtaining a high ethanol tolerance in Saccharomyces spp. It relates further to the use of such alleles in the construction of high ethanol tolerant strains, and the use of these alleles in screening for ethanol tolerance.

Abstract: Described herein is a process of genetic transformation in W. somnifera by Agrobacterium tumefaciens mediated transformation to overexpress squalene synthase gene (WsSQS) encoding WsSQS enzyme that catalyzes the synthesis of squalene from farnesyl pyrophosphate. Increased withanolide level including withaferin-A, withanolide A and B and withanone is attained in transformed plant tissues.

Abstract: Methods and compositions of improving plant yield by introducing into a plant the K-domain of a MADS box gene are disclosed. The expression of the K-domain provides plants with altered flower development, plant size and leaf development.

Abstract: The present invention provides recombinant DNA constructs, vectors and molecules comprising a polynucleotide sequence encoding a florigenic FT protein operably linked to a vegetative stage promoter, which may also be a meristem-preferred or meristem-specific promoter. Transgenic plants, plant cells and tissues, and plant parts are further provided comprising a polynucleotide sequence encoding a florigenic FT protein. Transgenic plants comprising a florigenic FT transgene may produce more bolls, siliques, fruits, nuts, or pods per node on the transgenic plant, particularly on the main stem of the plant, relative to a control or wild type plant. Methods are further provided for introducing a florigenic FT transgene into a plant, and planting transgenic FT plants in the field including at higher densities. Transgenic plants of the present invention may thus provide greater yield potential than wild type plants and may be planted at a higher density due to their altered plant architecture.

Abstract: The invention provides to improved methods for the modification of genes in plant cells, and plants and seeds derived therefrom. More specifically, the invention relates to the increased efficiency of targeted gene mutation by combining gene repair oligonucleotides with approaches that enhance the availability of components of the target cell gene repair mechanisms.

Abstract: The present invention relates to a method of genome engineering in microalgae using the Cas9/CRISPR system. In particular, the present invention relates to methods of delivering RNA guides via cell penetrating peptides in microalgae, preferably in stable integrated Cas9 microalgae. The present invention also relates to kits and isolated cells comprising Cas9, split Cas9 or guide RNA and Cas9-fused cell-penetrating peptides. The present invention also relates to isolated cells obtained by the methods of the invention.

Abstract: This disclosure concerns compositions and methods for promoting transcription of a nucleotide sequence in a plant or plant cell, employing a promoter from a Brachypodium distachyon metallothionein-like gene (mtl). Some embodiments relate to a promoter from a Brachypodium distachyon metallothionein-like gene (mtl) that functions in plants to promote transcription of operably linked nucleotide sequences.

Abstract: This disclosure concerns compositions and methods for promoting transcription of a nucleotide sequence in a plant or plant cell, employing a promoter from a Panicum virgatum metallothionein-like gene (mtl). Some embodiments relate to a promoter from a Panicum virgatum metallothionein-like gene (mtl) that functions in plants to promote transcription of operably linked nucleotide sequences.

Abstract: Mutant photosynthetic microorganisms having reduced chlorophyll and increased photosynthetic efficiency are provided. The mutant strains have mutated chloroplastic SRP54 genes and exhibit increased productivity with respect to wild type strains. Also provided are mutant algal strains having mutated cytosolic SRP54 genes. Provided herein are methods of producing biomass and other products such as lipids using strains having mutations in an SRP54 gene. Also included are constructs and methods for attenuating or disrupting SRP54 genes.

Abstract: The present disclosure relates to certain polypeptides derived from prokaryotic DGT enzymes, and nucleic acids useful in encoding the same.

Abstract: Compositions having pesticidal activity and methods for their use are provided. Compositions include isolated and recombinant polypeptides having pesticidal activity, recombinant and synthetic nucleic acid molecules encoding the polypeptides, DNA constructs and vectors comprising the nucleic acid molecules, host cells comprising the vectors, and antibodies to the polypeptides. Nucleotide sequences encoding the polypeptides can be used in DNA constructs or expression cassettes for transformation and expression in organisms of interest. The compositions and methods provided are useful for producing organisms with enhanced pest resistance or tolerance. Transgenic plants and seeds comprising a nucleotide sequence that encodes a pesticidal protein of the invention are also provided. Such plants are resistant to insects and other pests. Methods are provided for producing the various polypeptides disclosed herein, and for using those polypeptides for controlling or killing a pest.