Patents Assigned to L
  • Patent number: 8559299
    Abstract: Embodiments of the invention include a method for providing UE session resilience performed in a first PDN-GW that is coupled to a second PDN-GW, which are both in a PDN-GW pool. The method provides UE session resilience by allowing the first PDN-GW to provide connectivity for UE sessions previously serviced by the second PDN-GW after the second PDN-GW becomes non-operational. The first PDN-GW recognizes that the second PDN-GW failed and then activates a plurality of standby UE sessions. Each standby UE session is a backup UE session corresponding to a previously active UE session serviced on the second PDN-GW. Each standby UE session is associated with a UE device and a network resource identifier of an APN slice. The first PDN-GW transmits a message to a SGW that is servicing the UE sessions that indicates that the SGW should direct traffic previously bound for the second PDN-GW to the first PDN-GW.
    Type: Grant
    Filed: November 30, 2010
    Date of Patent: October 15, 2013
    Assignee: Telefonaktiebolaget L M Ericsson (Publ)
    Inventors: Staffan Bonnier, Hans-Åke Lund, Lars Gunnar Folke Ahlström
  • Patent number: 8560647
    Abstract: A network topology design system to determine placement of a set of controllers within a network with a split architecture, the placement of the set of controllers selected to minimize disruption of the split architecture network caused by a link failure, a switch failure or a connectivity loss between the set of controllers and the data plane components. The system performs a method including graphing a topology of the split architecture network, determining a set of clusters of nodes within the graph by applying an agglomerative clustering process or a partitive clustering process, determining, a centroid for each cluster in the set of clusters, assigning one of the set of controllers to each network element corresponding to a determined centroid in the graph, and assigning each controller to control a set of network elements corresponding to a cluster in the graph.
    Type: Grant
    Filed: July 19, 2011
    Date of Patent: October 15, 2013
    Assignee: Telefonaktiebolaget L M Ericsson (publ)
    Inventors: Ying Zhang, Neda Beheshti, Mallik Tatipamula
  • Patent number: 8557698
    Abstract: A method for producing a micromechanical and/or nanomechanical device includes partial etching of at least one sacrificial layer arranged between a first layer and a substrate, forming at least one cavity in which is arranged at least one portion of the sacrificial layer in contact with the first layer and/or the substrate. The method also includes chemical transformation of at least one wall of the first layer and/or the substrate in the cavity, delimiting at least one stop in the first layer and/or the substrate at the level of the portion of the sacrificial layer. The portion of the sacrificial layer and the chemically transformed wall of the first layer and/or the substrate is also eliminated.
    Type: Grant
    Filed: December 16, 2008
    Date of Patent: October 15, 2013
    Assignee: Commissariat a l'Energie Atomique
    Inventor: Stéphane Caplet
  • Patent number: 8560777
    Abstract: It presented a method comprising the steps of: determining, in a caching server of a telecommunication network, a user profile to analyze; obtaining, in the caching server, a group of user profiles; obtaining correlation measurements for each user profile in the group of user profiles in relation to the user profile to analyze; and calculating a content caching priority for at least one piece of content of a content history associated with the group of user profiles, taking the correlation measurement into account. A corresponding server, computer program and computer program product are also provided.
    Type: Grant
    Filed: December 16, 2009
    Date of Patent: October 15, 2013
    Assignee: Telefonaktiebolaget L M Ericsson (publ)
    Inventors: Catalin Meirosu, Andras Valkó
  • Patent number: 8559434
    Abstract: A method of providing packet routing information comprises: encoding routing information from a source node to one or more destination nodes into a compact representation of set membership; and putting the compact representation of sets into a header of a packet that is to be sent from the source node to the destination node(s). The compact representation may be obtained by: generating d representations of a set of identifiers; generating d candidate compact representations of set membership from the d representations of the identifiers; and selecting one of the candidate compact representation of set membership. The selection may be made on the basis of which of the candidate compact representations has the lowest rate of returning false positives.
    Type: Grant
    Filed: October 10, 2008
    Date of Patent: October 15, 2013
    Assignee: Telefonaktiebolaget L M Ericsson (publ)
    Inventors: Christian Esteve Rothenberg, Petri Jokela, Jimmy Kjällman, Pekka Nikander, Teemu Rinta-Aho, Jukka Ylitalo
  • Publication number: 20130264543
    Abstract: The present invention relates to a photodetector for detecting an infrared-light emission having a given wavelength (?) comprising a multilayer with: a layer (11) of a partially absorbent semiconductor; a spacer layer (12) made of a material that is transparent to said wavelength; and a structured metallic mirror (13), the distance (g) between the top of said mirror and said spacer layer being smaller than ? and said mirror comprising a network of holes defining an array of metallic reliefs with a pitch P of between 0.5 ?/nSC and 1.5 ?/nSC, where nSC is the real part of the refractive index of the semiconductor, a relief width L of between 9P/10 and P/2 and a hole depth h of between ?/100 and ?/15.
    Type: Application
    Filed: December 16, 2011
    Publication date: October 10, 2013
    Applicant: COMMISSARIAT A L'ENERGIE ATOMIQUE ET AUX ENERGIES ALTERNATIVES
    Inventors: Roch Espiau De Lamaestre, Christophe Largeron
  • Publication number: 20130263389
    Abstract: The present invention relates to a process for dyeing hair using at least one water-insoluble silicate, at least one compound of formula (I), in which Y represents a C1-C4 hydroxyalkyl group or a C1-C4 hydroxyalkyloxy radical, n denotes an integer ranging from 0 to 5, X, which may be identical or different, represents a C1-C4 alkyl radical or a halogen; and at least one hydroxylated aliphatic solvent comprising therein from 2 to 6 carbon atoms.
    Type: Application
    Filed: December 19, 2011
    Publication date: October 10, 2013
    Applicant: L'OREAL
    Inventors: Boris Lalleman, Françoise Albouy
  • Publication number: 20130265916
    Abstract: The invention relates to Coordinated Scheduling for a Time Division Duplex (TDD) network. In a method for User Equipment (UE) scheduling by a base station in a TDD network, the base station receives scheduling decision from at least one neighboring cell of the base station, and schedules a UE among a plurality of UEs in the serving cell of the base station based on the scheduling decision from the at least one neighboring cell and based on smart antenna information. The inter-cell interference is suppressed and therefore the network performance is improved.
    Type: Application
    Filed: December 22, 2010
    Publication date: October 10, 2013
    Applicant: TELEFONAKTIEBOLAGET L M ERICSSON (PUBL)
    Inventors: Huaisong Zhu, Jiansong Gan, Xinyu Gu
  • Publication number: 20130267239
    Abstract: Systems and methods provide for applying a clustering based assignment algorithm (CbAA) in a telecommunication system. A method includes: receiving strength information for transmission points belonging to an associated Coordinated Multi-Point (CoMP)-cell; determining the clustering subsets, wherein the step of determining the clustering subsets includes: applying a k-means algorithm to the strength information to form K clusters; identifying the cluster associated with each UE; associating a cluster to each transmission point in accordance to a pre-defined rule; and selecting the UEs to be serviced; and reporting the clustering formations.
    Type: Application
    Filed: May 29, 2012
    Publication date: October 10, 2013
    Applicant: TELEFONAKTIEBOLAGET L M ERICSSON (PUBL)
    Inventors: Elvis M. G. STANCANELLI, Tarcisio MACIEL, Yuri C. B. SILVA, Walter da RUZ FREITAS, JR., Francisco R. P. CAVALCANTI
  • Publication number: 20130264520
    Abstract: The invention relates to a catalyst comprising: a) a catalyst support made of a ceramic, the support comprising an arrangement of crystallites having the same size, the same isodiametric morphology and the same chemical composition or substantially the same size, the same isodiametric morphology and the same chemical composition, in which each crystallite makes point contact or almost point contact with the surrounding crystallites; and b) at least one active phase comprising metallic particles that interact chemically with said catalyst support made of a ceramic and that are mechanically anchored to said catalyst support in such a way that the coalescence and mobility of each particle are limited to a maximum volume corresponding to that of a crystallite of said catalyst support.
    Type: Application
    Filed: December 14, 2011
    Publication date: October 10, 2013
    Applicants: L'Air Liquide Societe Anonyme Pour L'Etide Et L'Exploitation Des Procedes Georges Claude, Centre National De La Recherche Scientifique- France, Universite De Limoges
    Inventors: Pascal Del-Gallo, Fabrice Rossignol, Thierry Chartier, Raphael Faure, Claire Bonhomme, Sebastien Goudalle
  • Publication number: 20130268664
    Abstract: In the embodiments of the present invention, a network node in an operator network is introduced. The network node is an analysis component configured to analyze the subscriber behavior based on the internet traffic data within the network. The network node is configured to provide a dynamic profile of the subscribers based on the current and past internet traffic. The dynamic profile may be used by other applications in the operator network or third parties. For example, a content provider can take a decision on what content to provide to a certain subscriber, based on dynamic subscriber profile information of this certain subscriber received from the network node according to the embodiments of the present invention. Another example is that an operator can use the dynamic subscriber profile when selecting commercial offers to his own subscribers e.g. when a subscriber has a new music mobile when visiting music sites.
    Type: Application
    Filed: December 15, 2010
    Publication date: October 10, 2013
    Applicant: TELEFONAKTIEBOLAGET L M ERICSSON (PUBL)
    Inventors: Mattias Lidström, Jonas Björk, Tor Kvernvik, Mona Matti
  • Publication number: 20130264820
    Abstract: The apparatus comprises a first sector wherethrough is introduced the biaxially oriented pipe and the gasket, a second sector, with diameter greater than that of the first sector, and a third sector, concentric to the second sector. The first sector is formed by at least three segments separated by isolating washers, so that at least two of said segments of the first sector, the second sector and the third sector are connected to means of heating and/or means of cooling regulated by a control unit which allows the selective and independent variation of the temperature of said segments and sectors and therefore of the pipe to favour the modelling of the socket with the integral gasket avoiding the disorientation of the pipe.
    Type: Application
    Filed: September 6, 2010
    Publication date: October 10, 2013
    Applicant: MOLECOR TECNOLOGIA, S. L.
    Inventor: Ignacio Muñoz De Juan
  • Publication number: 20130266802
    Abstract: The invention relates to a catalyst support made of a ceramic, the support comprising an arrangement of crystallites having the same size, the same isodiametric morphology and the same chemical composition or substantially the same size, the same isodiametric morphology and the same chemical composition, in which each crystallite makes point contact or almost point contact with the surrounding crystallites.
    Type: Application
    Filed: December 14, 2011
    Publication date: October 10, 2013
    Applicants: L'Air Liquide Societe Anonyme Pour L"Etude Et L"Exploitation Des Procedes Georges Claude
    Inventors: Pascal Del-Gallo, Fabrice Rossignol, Thierry Chartier, Claire Bonhomme, Raphael Faure, Sebastien Goudalle
  • Publication number: 20130267082
    Abstract: Disclosed are chalcogenide-containing precursors for use in the manufacture of semiconductor, photovoltaic, LCD-TFT1 or fiat panel type devices. Also disclosed a methods of synthesizing the chalcogenide-containing precursors and vapor deposition methods, preferably thermal ALD, using the chaicogenide-containing precursors to form chaicogenide-containing films.
    Type: Application
    Filed: December 29, 2010
    Publication date: October 10, 2013
    Applicant: L'Air Liquide, Societe Anonyme pour l'Etude et l'Exploitation des Procedes Georges Claude
    Inventors: Julien Gatineau, Mao Minoura, Hana Ishii
  • Publication number: 20130267240
    Abstract: Downlink interference alignment schemes are described which provide, among other things, channel state information (CSI) from the UEs using a constant amplitude codebook. By providing only phase information associated the UEs' channel states, instead of both amplitude and phase information, fewer bits can be used to inform the BSs of the UEs effective channels, thereby reducing the bandwidth requirements associated with the transmission of CSI by UEs for downlink interference alignment purposes. According to other embodiments, feedback information can be used to perform user selection scheduling and rate balancing.
    Type: Application
    Filed: April 4, 2012
    Publication date: October 10, 2013
    Applicant: Telefonaktiebolaget L M Ericsson (publ)
    Inventor: Yu FU
  • Publication number: 20130268215
    Abstract: A simplified tool is provided for simultaneous prediction of dent resistance and snap-through buckling resistance of roof panels including the effect of roof bow placement, curvatures of the roof panel, thickness of the roof, and steel grade. In one embodiment, a method of predicting snap-through buckling resistance of a sheet metal panel to an applied load under localized loading conditions is provided, wherein the sheet panel has certain defined geometries. The method includes the steps of: identifying first and second principal radii of curvature of the panel; identifying a thickness of the panel; identifying the distance of a portion of the panel between structural supports; creating a mathematical function to determine load deflection behavior for snap-through buckling; and determining the likelihood of the panel to display snap-through buckling characteristics under various localized applied loads by inputting the parameters.
    Type: Application
    Filed: April 9, 2012
    Publication date: October 10, 2013
    Applicant: ARCELORMITTAL INVESTIGACION Y DESARROLLO, S. L.
    Inventors: Sriram Sadagopan, Oscar Lanzi
  • Publication number: 20130268224
    Abstract: A method for measuring the coincidence count rate, using a time-to-digital conversion and an extendible dead time method with measurement of the live time. The count rate of coincident events between radiation detectors operating in parallel is measured, the time fluctuations of the coincident events are converted into digital form, and the extendible dead time method is used with measurement of the live time to eliminate all the other correlated events which may occur in a given detector. The time distributions of the time intervals separating the pulses are recorded, and the count rate of the coincident events is measured using recorded time distributions.
    Type: Application
    Filed: December 19, 2011
    Publication date: October 10, 2013
    Applicant: COMMISSARIAT A L'ENERGIE ATOMIQUE ET AUX ENERGIES ALTERNATIVES
    Inventor: Christophe Bobin
  • Publication number: 20130265124
    Abstract: Disclosed is a compact superconducting magnet device for generating an intense and homogeneous magnetic field component Bz along an axis Oz in a zone of interest ZI successively includes, starting from the axis Oz, at least three coaxial superconducting helical coils formed around circular cylinder sections of axis Oz delimited by end circles. The lateral ends of the helical coils are arranged, to within the thickness of the coils, in the vicinity of one same sphere of radius c whose centre O is placed on the axis Oz at the centre of the zone of interest ZI and which encompasses the magnetic device assembly. The azimuthal current densities j1, j2, j3 of the helical coils are alternately of opposite sign. The lengths of the helical coils are of decreasing length.
    Type: Application
    Filed: July 8, 2011
    Publication date: October 10, 2013
    Applicant: COMMISSARIAT A L'ENERGIE ATOMIQUE ET AUX ENERGIES ALTERNATIVES
    Inventor: Guy Aubert
  • Publication number: 20130265875
    Abstract: A load balancer in a communication network tracks active network flows using a Bloom filter and takes a snapshot of the Bloom filter at the time of a scaling event. The load balancer uses the Bloom filter snapshot to differentiate packets belonging to pre-existing network flows from packets belonging to new network flows. Packets belonging to pre-existing network flows continue to be distributed according to a mapping function in use prior to the scaling event. Packets belonging to new network flows are distributed according to a new mapping function.
    Type: Application
    Filed: April 4, 2012
    Publication date: October 10, 2013
    Applicant: Telefonaktiebolaget L M Ericsson (publ)
    Inventors: Eric Dyke, Geoffrey Lefebvre, Jon Maloy, Makan Pourzandi, Catherine Truchan
  • Publication number: 20130266515
    Abstract: The present invention relates to an aptamer which includes a nucleic acid including or made up of: the sequence GGAACGCAAGAACUGAGGCCAUGAGGCGCCUUCCCUUGCUCA GGACGC (SEQ ID NO: 1), or the sequence AGCUAGGCCGCAAGGUGCCUCAACGCCAUCUGAGUGCCGACC CGAUCGC (SEQ ID NO: 2), or a sequence including or made up of at least 25 consecutive nucleotides of a sequence that is at least 80% identical to SEQ ID NO: 1 or to SEQ ID NO: 2, with the condition that a nucleic acid made up of said sequence is bonded to annexin 2.
    Type: Application
    Filed: November 10, 2011
    Publication date: October 10, 2013
    Applicant: Commissariat A L'Energie Atomique ET AUX Energies Alternatives
    Inventors: Frédéric Duconge, Agnès Cibiel