Abstract: The invention relates to a method and apparatus for separating a mixture containing carbon monoxide, nitrogen and hydrogen by cryogenic distillation in a separation system which includes a denitrification column and at least another column. The method can include separating the mixture in order to obtain a fluid enriched with carbon monoxide and containing nitrogen, separating the fluid in the denitrification column, pressurizing the carbon monoxide flow from the column in a compressor up to a high pressure, collecting a fraction of carbon monoxide flow to be used as a product, expanding an amount of the high-pressure carbon monoxide flow in a valve prior to supplying it to the denitrification column, and varying the flow expanded in the valve according to re-boiling needs of the denitrification column.

Abstract: An ink container usable with an image forming apparatus having a carriage to transport the ink container in a reciprocating motion across a substrate and an ink ejector to eject the ink onto the substrate is included. The ink container includes a chamber configured to supply ink to the ink ejector of the image forming apparatus. The ink container also includes a separation member disposed within the chamber configured to separate unwanted particles from the ink in response to the reciprocating motion of the carriage and gravity, and to direct the ink downstream to the ink ejector.

Abstract: A network topology design system to determine placement of a set of controllers within a network with a split architecture, the placement of the set of controllers selected to minimize disruption of the split architecture network caused by a link failure, a switch failure or a connectivity loss between the set of controllers and the data plane components. The system performs a method including graphing a topology of the split architecture network, determining a set of clusters of nodes within the graph by applying an agglomerative clustering process or a partitive clustering process, determining, a centroid for each cluster in the set of clusters, assigning one of the set of controllers to each network element corresponding to a determined centroid in the graph, and assigning each controller to control a set of network elements corresponding to a cluster in the graph.

Abstract: A method of providing packet routing information comprises: encoding routing information from a source node to one or more destination nodes into a compact representation of set membership; and putting the compact representation of sets into a header of a packet that is to be sent from the source node to the destination node(s). The compact representation may be obtained by: generating d representations of a set of identifiers; generating d candidate compact representations of set membership from the d representations of the identifiers; and selecting one of the candidate compact representation of set membership. The selection may be made on the basis of which of the candidate compact representations has the lowest rate of returning false positives.

Abstract: It presented a method comprising the steps of: determining, in a caching server of a telecommunication network, a user profile to analyze; obtaining, in the caching server, a group of user profiles; obtaining correlation measurements for each user profile in the group of user profiles in relation to the user profile to analyze; and calculating a content caching priority for at least one piece of content of a content history associated with the group of user profiles, taking the correlation measurement into account. A corresponding server, computer program and computer program product are also provided.

Abstract: In the embodiments of the present invention, a network node in an operator network is introduced. The network node is an analysis component configured to analyze the subscriber behavior based on the internet traffic data within the network. The network node is configured to provide a dynamic profile of the subscribers based on the current and past internet traffic. The dynamic profile may be used by other applications in the operator network or third parties. For example, a content provider can take a decision on what content to provide to a certain subscriber, based on dynamic subscriber profile information of this certain subscriber received from the network node according to the embodiments of the present invention. Another example is that an operator can use the dynamic subscriber profile when selecting commercial offers to his own subscribers e.g. when a subscriber has a new music mobile when visiting music sites.

Abstract: The present invention relates to a process for dyeing hair using at least one water-insoluble silicate, at least one compound of formula (I), in which Y represents a C1-C4 hydroxyalkyl group or a C1-C4 hydroxyalkyloxy radical, n denotes an integer ranging from 0 to 5, X, which may be identical or different, represents a C1-C4 alkyl radical or a halogen; and at least one hydroxylated aliphatic solvent comprising therein from 2 to 6 carbon atoms.

Abstract: The invention relates to a catalyst comprising: a) a catalyst support made of a ceramic, the support comprising an arrangement of crystallites having the same size, the same isodiametric morphology and the same chemical composition or substantially the same size, the same isodiametric morphology and the same chemical composition, in which each crystallite makes point contact or almost point contact with the surrounding crystallites; and b) at least one active phase comprising metallic particles that interact chemically with said catalyst support made of a ceramic and that are mechanically anchored to said catalyst support in such a way that the coalescence and mobility of each particle are limited to a maximum volume corresponding to that of a crystallite of said catalyst support.

Abstract: The present invention relates to a photodetector for detecting an infrared-light emission having a given wavelength (?) comprising a multilayer with: a layer (11) of a partially absorbent semiconductor; a spacer layer (12) made of a material that is transparent to said wavelength; and a structured metallic mirror (13), the distance (g) between the top of said mirror and said spacer layer being smaller than ? and said mirror comprising a network of holes defining an array of metallic reliefs with a pitch P of between 0.5 ?/nSC and 1.5 ?/nSC, where nSC is the real part of the refractive index of the semiconductor, a relief width L of between 9P/10 and P/2 and a hole depth h of between ?/100 and ?/15.

Abstract: The invention relates to a catalyst support made of a ceramic, the support comprising an arrangement of crystallites having the same size, the same isodiametric morphology and the same chemical composition or substantially the same size, the same isodiametric morphology and the same chemical composition, in which each crystallite makes point contact or almost point contact with the surrounding crystallites.

Abstract: The invention relates to Coordinated Scheduling for a Time Division Duplex (TDD) network. In a method for User Equipment (UE) scheduling by a base station in a TDD network, the base station receives scheduling decision from at least one neighboring cell of the base station, and schedules a UE among a plurality of UEs in the serving cell of the base station based on the scheduling decision from the at least one neighboring cell and based on smart antenna information. The inter-cell interference is suppressed and therefore the network performance is improved.

Abstract: Systems and methods provide for applying a clustering based assignment algorithm (CbAA) in a telecommunication system. A method includes: receiving strength information for transmission points belonging to an associated Coordinated Multi-Point (CoMP)-cell; determining the clustering subsets, wherein the step of determining the clustering subsets includes: applying a k-means algorithm to the strength information to form K clusters; identifying the cluster associated with each UE; associating a cluster to each transmission point in accordance to a pre-defined rule; and selecting the UEs to be serviced; and reporting the clustering formations.

Abstract: Downlink interference alignment schemes are described which provide, among other things, channel state information (CSI) from the UEs using a constant amplitude codebook. By providing only phase information associated the UEs' channel states, instead of both amplitude and phase information, fewer bits can be used to inform the BSs of the UEs effective channels, thereby reducing the bandwidth requirements associated with the transmission of CSI by UEs for downlink interference alignment purposes. According to other embodiments, feedback information can be used to perform user selection scheduling and rate balancing.

Abstract: The apparatus comprises a first sector wherethrough is introduced the biaxially oriented pipe and the gasket, a second sector, with diameter greater than that of the first sector, and a third sector, concentric to the second sector. The first sector is formed by at least three segments separated by isolating washers, so that at least two of said segments of the first sector, the second sector and the third sector are connected to means of heating and/or means of cooling regulated by a control unit which allows the selective and independent variation of the temperature of said segments and sectors and therefore of the pipe to favour the modelling of the socket with the integral gasket avoiding the disorientation of the pipe.

Abstract: Disclosed are chalcogenide-containing precursors for use in the manufacture of semiconductor, photovoltaic, LCD-TFT1 or fiat panel type devices. Also disclosed a methods of synthesizing the chalcogenide-containing precursors and vapor deposition methods, preferably thermal ALD, using the chaicogenide-containing precursors to form chaicogenide-containing films.

Abstract: It is presented a method for notifying at least a first condition in an industrial system by means of a monitoring system in order to draw the attention of an operator monitoring the industrial system to the at least one condition. The method comprises displaying (S1) the first condition in a first portion of a display screen of the monitoring system, determining (S2) by means of eye tracking an area where a user focuses on the display screen, the area where the user focuses differing from the first portion, and alerting (S3) the user of the first condition in order to allow the user to be notified of the first condition in the industrial system. A monitoring system is also presented herein.

Abstract: The present invention relates to an aptamer which includes a nucleic acid including or made up of: the sequence GGAACGCAAGAACUGAGGCCAUGAGGCGCCUUCCCUUGCUCA GGACGC (SEQ ID NO: 1), or the sequence AGCUAGGCCGCAAGGUGCCUCAACGCCAUCUGAGUGCCGACC CGAUCGC (SEQ ID NO: 2), or a sequence including or made up of at least 25 consecutive nucleotides of a sequence that is at least 80% identical to SEQ ID NO: 1 or to SEQ ID NO: 2, with the condition that a nucleic acid made up of said sequence is bonded to annexin 2.

Abstract: The invention relates to 4-aminoindole derivatives of formula (I), and the addition salts thereof, mesomers thereof, isomers thereof and solvates thereof: and to their use for the oxidation dyeing of keratin fibres, and in particular of human keratin fibres such as the hair. The present invention makes it possible to achieve dark shades, natural shades and dark natural shades. The present invention also makes it possible to obtain powerful, chromatic, aesthetic, sparingly selective coloration of keratin fibres in varied shades, which is resistant to the various attacking factors to which the hair may be subjected. In particular, when the 4-aminoindole derivatives are combined with one or more heterocyclic oxidation bases, they make it possible to obtain a wide range of colours and coloration of keratin fibres that shows good chromaticity and good selectivity.

Abstract: A load balancer in a communication network tracks active network flows using a Bloom filter and takes a snapshot of the Bloom filter at the time of a scaling event. The load balancer uses the Bloom filter snapshot to differentiate packets belonging to pre-existing network flows from packets belonging to new network flows. Packets belonging to pre-existing network flows continue to be distributed according to a mapping function in use prior to the scaling event. Packets belonging to new network flows are distributed according to a new mapping function.

Abstract: The present invention relates to an aptamer comprising a nucleic acid comprising, or consisting of: the sequence ACUGU CCCAG UAUGA CGCGA CUGCU UAGGU GGGAU GUUUC CCAUG CCUCG (SEQ ID NO: 1), or a sequence comprising, or consisting of, at least 25 consecutive nucleotides in a sequence having at least 80% identity with SEQ ID NO: 1, with the proviso that a nucleic acid consisting of this sequence binds to the LAR protein.