Telomerase reverse transcriptase (TERT) genes
The present invention pertains, in general, to the identification, isolation and use of Telomerase Reverse Transcriptase (TERT) genes and the proteins encoded by such genes. In particular, the present invention pertains to the identification, isolation and use of TERT genes and TERT proteins from several genetically diverse and economically important organisms, including two human pathogens and an agronomic crop species.
Latest Montana State University Patents:
- Lactococcal expression of IL-35 for treatment of disease
- Process for establishing uniform liquid films on polar and non-polar substrates
- Fault-tolerant computer system with configurable coprocessor component and methods thereof
- CRISPR-BASED PROGRAMMABLE RNA EDITING
- Microscope lens with integrated wide-field camera and beam scanning device
[0001] The present invention pertains, in general, to the identification and use of Telomerase Reverse Transcriptase (TERT) genes and the proteins encoded by such genes. In particular, the present invention pertains to the identification and use of TERT genes and TERT proteins from several genetically diverse and economically important organisms, including two human pathogens and an agronomic crop species.
BACKGROUND OF THE INVENTION[0002] All publications and patent applications herein are incorporated by reference to the same extent as if each individual publication or patent application was specifically and individually indicated to be incorporated by reference.
[0003] TERT genes have been identified in mammals (mouse and human), yeasts (Saccharomyces cerevisiae, Schizosaccharomyces pombe) and ciliated protozoans (Tetrahymena thermophila, Oxytricha trifallax and Euplotes aediculatus) (Ligner, J. et al., 1997; Bryan, T. M. et al., 1998; Nakamura, T. M. at al., 1997; Greenberg, R. A. et al., 1999). Telomerase RNA has been cloned from bovine testis (Tsao et al., 1998) and from approximately twenty other organisms.
[0004] The protein encoded by the TERT gene, together with an RNA subunit, comprise telomerase, an enzyme required for the maintenance of telomeres. Telomeres, which are long stretches of short DNA sequence repeats located on the ends of linear chromosomes, are an essential component of the eukaryotic genome. They serve as “caps” on chromosomal termini, preventing loss of terminal sequence information and degradation of chromosomal DNA, as well as regulating expression of nearby genes. Telomerase has been shown to be responsible for maintenance of telomere length, as cells lacking this enzyme experience a shortening and, eventual loss of telomeric sequence. For a recent review, see Bryan and Cech, 1999.
[0005] Telomere length and telomerase activity have been implicated in studies of both aging and cancer. Telomeres are believed to function as a molecular clock, gradually shortening as a cell ages and signaling cell death when the telomeres decay down to a critical length. It has been observed that in many immortal cells, telomerase appears to be overactive, resulting in telomeres that are maintained indefinitely. These observations have led to great interest in research programs attempting to develop pharmaceuticals that either ameliorate or activate telomerase activity, as well as diagnostic tools to detect telomerase activity. For reviews, see Raymond, 1996 and Holt and Shay, 1999.
[0006] We have identified TERT genes from three economically important and genetically diverse organisms: Plasmodium falciparum, Candida albicans and Oryza sativa P. falciparum and C. albicans are the causative agents of serious medical conditions of humans while O. sativa is food staple of people throughout the world, especially those of third world countries. The discovery of these genes will have a profound effect on our ability to genetically manipulate and control the growth of these important organisms.
SUMMARY OF THE INVENTION[0007] This invention comprises compositions and methods for the identification and use of novel TERT genes. In particular, this invention provides comprises compositions and methods for the identification and use of TERT genes of Plasmodium falciparum, Candida albicans and Oryza sativa.
[0008] The present invention provides isolated nucleic acid molecules coding for TERT genes and TERT gene fragments wherein the isolated nucleic acid molecules include: (a) isolated nucleic acid molecules that encode the amino acid sequence of SEQ ID NO.2, SEQ ID NO.4, SEQ ID NO.6, SEQ ID NO.8 or SEQ ID NO.10; (b) isolated nucleic acid molecules that encode a fragment of at least 6 amino acids of SEQ ID NO.2, SEQ ID NO.4, SEQ ID NO.6, SEQ ID NO.8 or SEQ ID NO.10; (c) isolated nucleic acid molecules which hybridize to the complement of a nucleic acid molecule comprising SEQ ID NO.1, SEQ ID NO.3, SEQ ID NO.5, SEQ ID NO.7 or SEQ ID NO.9 under conditions of sufficient stringency to produce a clear signal; and (d) isolated nucleic acid molecules which hybridize to a nucleic acid molecule that encodes the amino acid sequence of SEQ ID NO.2, SEQ ID NO.4, SEQ ID NO.6, SEQ ID NO.8 or SEQ ID NO.10 under conditions of sufficient stringency to produce a clear signal. In particular, this invention provides nucleic acid molecules with the nucleic acid sequences of SEQ ID NO. 1, SEQ ID NO.3, SEQ ID NO.5, SEQ ID NO.7 and SEQ ID NO.9.
[0009] This invention also provides such isolated nucleic acid molecules coding for TERT genes or gene fragments operably linked to one or more expression control elements,
[0010] This invention also provides vectors comprising such isolated nucleic acid molecules coding for TERT genes and TERT gene fragments.
[0011] This invention also provides host cells, tissues, organs and organisms transformed to contain such nucleic acid molecules coding for TERT genes and TERT gene fragments. This invention further provides host cells, tissues, organs and organisms comprising vectors comprising such isolated nucleic acid molecules coding for TERT genes and TERT gene fragments.
[0012] This invention also provides methods for producing a polypeptide comprising the, step of culturing a host cell transformed with such nucleic acid molecules coding for TERT genes and gene fragments under conditions in which the protein encoded by these nucleic acid molecules are expressed. This invention further provides isolated polypeptides produced by such methods.
[0013] This invention also provides isolated TERT polypeptides and TERT polypeptide fragments wherein the polypeptides include: (a) those coded by the amino acid sequence of SEQ ID NO.2, SEQ ID NO.4, SEQ ID NO.6, SEQ ID NO.8 or SEQ ID NO.10; (b) those comprising a fragment of at least 6 amino acids of SEQ ID NO.2, SEQ ID NO.4, SEQ ID NO.6, SEQ ID NO.8 or SEQ ID NO.10; (c) conservative amino acid substitutions of SEQ ID NO.2, SEQ ID NO.4, SEQ ID NO.6, SEQ ID NO.8 or SEQ ID NO.10; and (d) naturally occurring amino acid sequence variants of SEQ ID NO.2, SEQ ID NO.4, SEQ ID NO.6, SEQ ID NO.8 or SEQ ID NO.10.
[0014] The invention also provides isolated antibodies that bind to such TERT polypeptides and TERT polypeptide fragments. The invention further provides such antibodies wherein the antibodies are monoclonal or polyclonal antibodies.
[0015] The invention also provides methods of identifying an agents which modulate the expression of a nucleic acid encoding the protein having the sequence of SEQ ID NO.2, SEQ ID NO.4, SEQ ID NO.6, SEQ ID NO.8 or SEQ ID NO.10 comprising the steps of:
[0016] exposing cells which express the nucleic acid to the agent; and
[0017] determining whether the agent modulates expression of said nucleic acid, thereby identifying an agent which modulates the expression of a nucleic acid encoding the protein having the sequence of SEQ ID NO.2, SEQ ID NO.4, SEQ ID NO.6, SEQ ID NO.8 or SEQ ID NO.10.
[0018] The invention also provides methods of identifying agents which modulate at least one activity of a protein comprising the sequence of SEQ ID NO.2, SEQ ID NO.4, SEQ ID NO.6, SEQ ID NO.8 or SEQ ID NO.10 comprising the steps of:
[0019] exposing cells which express the protein to the agent;
[0020] determining whether the agent modulates at least one activity of said protein, thereby identifying an agent which modulates at least one activity of a protein comprising the sequence of SEQ ID NO.2, SEQ ID NO.4, SEQ ID NO.6, SEQ ID NO.8 or SEQ ID NO.10.
[0021] The invention also provides methods of identifying binding partners for a protein comprising the sequence of SEQ ID NO.2, SEQ ID NO.4, SEQ ID NO.6, SEQ ID NO.8 or SEQ ID NO.10, comprising the steps of:
[0022] exposing said protein to a potential binding partner; and
[0023] determining if the potential binding partner binds to said protein, thereby identifying binding partners for a protein comprising the sequence of SEQ ID NO.2, SEQ ID NO.4, SEQ ID NO.6, SEQ ID NO.8 or SEQ ID NO.10.
[0024] The invention also provides methods of modulating the expression of a nucleic acid encoding the protein having the sequence of SEQ ID NO.2, SEQ ID NO.4, SEQ ID NO.6, SEQ ID NO.8 or SEQ ID NO.10 comprising the step of:
[0025] administering an effective amount of an agent which modulates the expression of a nucleic acid encoding the protein having the sequence of SEQ ID NO.2, SEQ ID NO.4, SEQ ID NO.6, SEQ ID NO.8 or SEQ ID NO.10.
[0026] This invention also provides methods of modulating at least one activity of a protein comprising the sequence of SEQ ID NO.2, SEQ ID NO.4, SEQ ID NO.6, SEQ ID NO.8 or SEQ ID NO.10 comprising the step of:
[0027] administering an effective amount of an agent which modulates at least one activity of a protein comprising the sequence of SEQ ID NO.2, SEQ ID NO.4, SEQ ID NO.6, SEQ ID NO.8 or SEQ ID NO.10.
[0028] This invention also provides methods for diagnosing Plasmodium falciparum infection in a patient comprising the steps of:
[0029] obtaining a cell sample from the patient;
[0030] determining whether the nucleic acid of SEQ ID NO.5 or SEQ ID NO.7 or the protein of SEQ ID NO.6 or SEQ ID NO.8 is present within the cell sample; and
[0031] correlating the presence of the nucleic acid of SEQ ID NO.5 or SEQ ID NO.7 or the protein of SEQ ID NO.6 or SEQ ID NO.8 with the presence of Plasmodium falciparum.
[0032] This invention also provides methods for diagnosing Candida albicans infection in a patient comprising the steps of:
[0033] obtaining a cell sample from the patient;
[0034] determining whether the nucleic acid of SEQ ID NO.1 or SEQ ID NO.3 or the protein of SEQ ID NO.2 or SEQ ID NO.4 is present within the cell sample; and
[0035] correlating the presence of the nucleic acid of SEQ ID NO.1 or SEQ ID NO.3 or the protein of SEQ ID NO.2 or SEQ ID NO.4 with the presence of Candida albicans.
[0036] One skilled in the art can easily make any necessary adjustments in accordance with the necessities of the particular situation.
[0037] Further objects and advantages of the present invention will be clear from the description that follows.
BRIEF DESCRIPTION OF THE DRAWINGS[0038] FIG. 1. Identification of the TERT gene for P. falciparum.
[0039] {circle over (1)} Sanger Centre chromosome 13 contig 41294.
[0040] {circle over (2)} Sanger Centre chromosome 13 contig 02431.
[0041] {circle over (3)} TIGR Database chromosome 14 contig 5560 (now #364).
[0042] {circle over (4)} P. falciparum Putative Telomerase Gene. Letters indicate motifs.
[0043] FIG. 2. Sequence alignment of the P. falciparum TERT gene and the TERT genes of other organisms. Organism codes are as follows:
[0044] h.=Human.
[0045] m.=Mouse.
[0046] o.=Oxytricha trifallax.
[0047] E.=Euplotes aediculatus.
[0048] T.=Tetrahymena thermophila.
[0049] Sp.=Schizosaccharomyces pombe.
[0050] Sc.=Saccharomyces cerevisiae.
[0051] Ca.=Candida albicans.
[0052] FIG. 3. TERT RT-PCR on Total RNA of P. falciparum. 1 M 1kb ladder (Promega ®). Lane 1 RT-PCR of 4 &mgr;g P. falciparum total RNA with primers pfRT and pfTELfor (45 min at 48 C. followed by 40 cycles of 1 min at 94 C., 1 min at 52 C., 4 min at 68 C.), followed by nested PCR of 3 &mgr;l product with primers pfBREV and pfTELfor (20 cycles of 1 min at 94 C., 1 min at 52 C., 4 min at 68 C.). 25 &mgr;l product electrophoresed on 0.8% agarose gel. Arrow indicates signal for TERT mRNA. Lane 2 No AMV-reverse transcriptase control. All other conditions same as Lane 1. Lane 3 No template control. All other conditions same as Lane 1. Lane 4. RT-PCR of 4 &mgr;g P. falciparum total RNA with pfRT2 and pf2160, followed by nested PCR with primers pfREV2 and pf2160. 10 &mgr;l product electrophoresed on 0.8% agarose gel. Lane 5 No AMV-reverse transcriptase control. All other conditions same as Lane 4. Lane 6 No template control. All other conditions same as Lane 4.
[0053] FIG. 4. TERT RT-PCR Gel on Total RNA of C. albicans. 2 Lane 1 RT PCR on 5 &mgr;g Candida albicans total RNA with primers CaFor2 and CaRT2 (45 min at 48C followed by 40 cycles of 1 min at 94C, 1 min at 52C, 2 min at 68C). Nested PCR of 3 &mgr;l product (20 cycles of 1 min at 94C, 1 min at 52C, 4 min at 68C) with primers CaFor2 and CaNest2. 1 &mgr;l sample loaded on 0.8% agarose gel. Lane 2 No AMV-reverse transcriptase control. All other conditions as in Lane 1. Lane 3 No template control. All other conditions as in Lane 1. Lane 4 RT PCR on 0.85 &mgr;g Candida albicans total RNA with primers CaRT3 and CaFor3 (45 min at 48C followed by 40 cycles of 1 min at 94C, 1 min at 52C, 2 min at 68C). 10 &mgr;l product electrophoresed on 0.8% agarose gel. Lane 5 No AMV-reverse transcriptase control. All other conditions as in Lane 4. Lane 6 No template control. All other conditions as in Lane 4.
[0054] FIG. 5. TERT RT-PCR Gel on Total RNA of C. albicans.
[0055] Product 1 (P1) was amplified with RT3 and FOR1; product 2 (P2) with RT 1 and FOR2; product 3 (P3) with RT2 and FOR2; and product 4 (P4) with RT3 and FOR3.
[0056] Products 2 and 4 were not visible on agarose gel after 40 cycles, and 3 &mgr;l PCR product was reamplified with NEST1 and FOR2 (P2) or NEST2 and FOR2 (P4) for another 12 cycles of PCR as described for FIG. 4.
[0057] FIG. 6. Sequence alignment of the O. sativa TERT gene and the Arabidopsis TERT genes.
DETAILED DESCRIPTION OF THE INVENTION[0058] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, the preferred methods and materials are described.
[0059] Definitions
[0060] “Allele” or “allelomorph” refers to any of the forms of the same gene that occur at the same locus on a homologous chromosome but differ in base sequence. Two or more alleles are said to be allelic or allelomorphic to each other, and if more than two alleles exist in a population, the locus is said to show multiple allelism.
[0061] “Apoptosis” refers to cell death that may occur by accident, cell necrosis, or by an intracellular controlled process characterized by a condensation and, subsequent, fragmentation of the cell nucleus during which the plasma membrane remains intact.
[0062] “Modulate” refers to the inhibition, induction, agonism and/or antagonism of the expression or function of a TERT gene or TERT gene product.
[0063] “Nucleic acid” includes DNA and RNA molecules and is used synonymously with the terms “nucleic acid sequence” and “polynucleotide.”
[0064] “Polypeptide” refers to an amino acid sequence including, but not limited to, proteins and protein fragments, naturally derived or synthetically produced.
[0065] “Senescence” refers to the process of growing old or aging.
[0066] “Telomerase” refers to a ribonucleoprotein, telomere specific reverse transcriptase, which contains some protein components and telomerase RNA components. Telomerase can synthesize the tandem repeat units of telomere to the 3′ end of telomeric primers without a template. The RNA component of the enzyme contains the complementary sequence of the telomeric repeats it synthesizes.
[0067] “Telomere-specific repeats” refers to simple DNA repeat sequences found at the ends of chromosomes. These sequences are sometimes referred to as “telomeric DNA” by those skilled in the art.
[0068] “Telomerase enzyme subunit” refers to any domain, or region or discrete part of a polypeptide sequence that can be equated with telomerase enzyme function.
[0069] “Telomere” refers to the specialized DNA sequence found at the end of the chromosome that provides stability to the chromosome, prevents fusion with other natural or broken ends, and allows replication without loss.
[0070] “TERT” refers to Telomerase Reverse Transcriptase. TERT, as it is used herein, can refer to either the gene encoding the enzyme or to the enzyme (i.e., protein) itself. TERT refers to the nucleoprotein, or enzyme, portion of telomerase. TERT genes have also been called “Ever Shorter Telomeres” or “EST” genes.
[0071] “Transcriptional factors” refers to a class of proteins that bind to a promoter or to a nearby sequence of DNA to facilitate or prevent transcription initiation.
[0072] “Transcriptional profiling” refers to any assay method or technique which is capable of analyzing, quantitatively and/or qualitatively, one or more mRNA species found in a cell or a nucleic acid sample. For example, such assays include, but are not limited to, RT-PCR, quantitative PCR (Q-PCR), RNase protection assays, subtractive hybridization, READS and Northern blots.
[0073] Overview of the Invention
[0074] The present invention is based in part on the identification of new TERT genes and the TERT proteins encoded by these genes found in three economically important organisms.
[0075] The newly identified TERT proteins can serve as targets for agents that can be used to modulate the expression or activity of the enzyme. For example, agents may be identified which modulate biological processes associated with telomerase, such as but not limited to: the maintenance of telomeres, replicative senescence, cell multiplication, mitotic clock functioning, aging, proliferative capacity, tumorigenesis, tumor progression, cellular immortilization, cellular senescence, apoptosis and cell death.
[0076] Agents identified by the methods of the present invention can inhibit or promote the growth of specific organisms by modulating the expression or activity of the TERT proteins specific to the organisms. Thus, agents can be identified which are useful in the prevention, treatment or eradication of infection by pathogens, including infection by parasitic protozoans and pathogenic yeasts. Agents may also be identified which modulate the biological processes associated with recovery from various types of cancer.
[0077] Agents identified by the methods of the present invention can modulate the biological processes of plants, thereby controlling plant growth ability and rate. The agents identified by the methods of the present invention can be used in various agricultural chemicals, including growth regulators, herbicides and fertilizers.
[0078] The present invention is further based on the development of methods for isolating binding partners that bind to the TERT proteins. Probes based on the proteins are used as capture probes to isolate potential binding partners, such as other proteins. Dominant negative proteins, DNAs encoding these proteins, antibodies to these proteins, peptide fragments of these proteins or mimics of these proteins may be introduced into cells to affect function. Additionally, these proteins provide a novel target for screening of synthetic small molecules and combinatorial or naturally occurring compound libraries to discover novel therapeutics to regulate various cellular processes or diseases such as cell cycle, cell death and tumor progression.
[0079] Plasmodium falciparum TERT Gene and TERT Protein
[0080] We have identified a TERT gene from the parasite Plasmodium falciparum and performed experiments that indicate that the TERT gene product is expressed in vivo. This is the first identification of this essential gene and protein in this important human pathogen.
[0081] P. falciparum is a protozoan which is the causative agent of malaria, Malaria is the world's most important tropical parasitic disease, presenting 300-500 million clinical cases per year and causing over 1 million deaths per year (WHO, 1998). Thus, identification of the TERT gene product from Plasmodium, which is a vital component of cell viability, is an important contribution to research towards eradication of this disease.
[0082] Our discovery of the TERT gene and TERT protein of Plasmodium falciparum makes possible avenues of research aimed at understanding the structure and function of the TERT gene and its effects on the Plasmodium life cycle and pathogenicity. Possible utility includes but is not limited to development of natural or artificial compounds that affect TERT activity, or screening procedures to aid in detection of this pathogen.
[0083] Candida albicans TERT Genes and TERT Proteins
[0084] We have identified TERT genes and TERT proteins from the yeast Candida albicans, and performed experiments that indicate that the TERT gene product is expressed in vivo. This is the first identification of these essential genes and proteins in this important human pathogen. The C. albicans proteins are the smallest TERT homologues discovered to date. Their compact size makes them an attractive target for gene analysis and for protein crystallization.
[0085] C. albicans is the cause of vaginal candidiasis (commonly known as yeast infections) in women. Additionally, Candida can cause severe, life threatening infections in the respiratory tract and major organs of immunocompromised patients, such as persons suffering from HIV disease, patients undergoing immunosuppresive therapy or the elderly (McCullough et al., 1996). Thus, identification of the TERT genes and TERT proteins from Candida, which is a vital component of cell viability, is an important contribution to research towards eradication of disease caused by this pathogen.
[0086] Our discovery of the TERT genes and TERT proteins of Candida albicans makes possible avenues of research aimed at understanding the structure and function of the TERT genes and its effects on the C. albicans life cycle and pathogenicity. Possible utility includes but is not limited to development of natural or artificial compounds that affect TERT activity, or screening procedures to aid in detection of this pathogen.
[0087] The National Institutes of Health is currently researching fungal virulence genes using a gene disruption approach. At least four C. albicans genes involved in human pathogenicity have been identified by this method to date (Kwon-Chun, 1998). The identification of the TERT genes thus makes possible studies to determine the effects of these genes on the pathogenicity of the organism. Similar studies of the function of the TERT gene/catalytic subunit of the TERT protein have been carried out in the ciliate Euplotes aediculatus and in the fission yeast Schizosaccharomyces pombe (Nakamura et al., 1997).
[0088] Oryza sativa TERT Gene Fragment and TERT Protein Fragment
[0089] We have identified a TERT gene fragment and TERT protein fragment from rice, Oryza sativa . This is the first identification of a fragment of this essential gene in an important crop plant.
[0090] Our discovery of the TERT gene fragment of O. sativa makes possible avenues of research aimed at understanding the structure and function of the TERT gene and its effects on the life cycle of the rice plant. Potential interest in this discovery include implications for plant cell proliferative capacity by, for example, by down-regulating telomerase expression (i.e., prevent growth of roots and flowers in weeds) or by up-regulating telomerase expression leading to a larger endosperm and thus improved grain yield.
[0091] Telomeres and Telomerase
[0092] Telomeres
[0093] A large fraction of the deoxyribonucleic acid (DNA) of most higher eukaryotes is made up of repeat sequences ranging from a few copies up to millions of copies. Repeat functional sequences occur at the telomeres and centromeres of eukaryotic chromosomes.
[0094] Telomeres are specialized DNA sequences found at the ends of the chromosomes of eukaryotes which function in chromosome protection, positioning, and replication. Telomeres protect linear chromosomes from degradation and fusion to other chromosomes, and are thought to be a site of attachment to the nuclear matrix at times during the cell cycle. As chromosome caps they reduce the formation of damaged and rearranged chromosomes which arise as a consequence of recombination-mediated chromosome fusion events.
[0095] Generally, telomeres consist of tens to thousands of tandem repeats of a telomere motif sequence and associated proteins. The telomeres from all species show the same pattern: a short DNA sequence, one strand G-rich and one C-rich, that is tandemly repeated many times. The repeating telomeric unit found in Tetrahymena is T2G4, in the ciliated protozoan Oxytricha it is T4G4, and in Saccharomyces cerevisiae it is T1-3G1-3. In humans and other mammals this motif is 5′-d(TTAGGG)-3′. Sequences specific to other species such as plants may be found in Greider et al. (1990).
[0096] Telomeres of all human chromosomes are composed of variable length arrays of the TTAGGG repeat units with the G-rich strand oriented 5′ to 3′ towards the telomere. Variant telomere repeat units such as TTGGGG and TGAGGG have been identified but tend to be located at the proximal ends of human telomeres. Methods for detecting and quantitating multiple copies of a repeat sequence, such as a telomere (or centromere) repeat sequence, are provided in WO 97/14026. Methods for characterizing variability in telomere DNA by Polymerase Chain Reaction (PCR) are provided in WO 96/12821.
[0097] Telomerase
[0098] The maintenance of telomeres is required for cells to avoid replicative senescence and to continue to multiply. Chromosomes lose about 50-200 nucleotides of telomeric sequence from their ends per cell division, and the shortening of telomeres may act as a mitotic clock shortening with age both in vitro and in vivo in a replication dependent manner (Harley, 1991). Telomeric sequences can be added back to the chromosome ends, by telomere terminal transferase, also known as telomerase enzyme or simply as telomerase. Methods and compositions for increasing telomere length in normal cells to increase the proliferative capacity of cells and to delay the onset of senescence are provided in U.S. Pat. No. 5,686,306.
[0099] Telomerase is a ribonucleoprotein enzyme that elongates the G-rich strand of chromosomal termini by adding telomeric repeats. This elongation occurs by reverse transcription of a part of the telomerase RNA component, which contains a sequence complementary to the telomere repeat. Following telomerase-catalyzed extension of the G-rich strand, the complementary DNA strand of the telomere is presumably replicated by more conventional means.
[0100] Telomerase is a reverse transcriptase composed of both ribonucleotide acid (RNA), and protein, wherein the RNA molecule functions as the template for the telomeric repeat. The RNA moiety of human telomerase contains the 5′-CCCTAA-3′ sequence that may act as the template for de novo synthesis. The enzyme also contains a region that recognizes the guanine rich single strands of a DNA substrate. Methods and compositions for the determination of telomere length and telomerase activity are provided in U.S. Pat. Nos. 5,489,508 and 5,707,795.
[0101] The RNA component of the telomerase enzymes of Saccharomyces cerevisiae , certain species of Tetrahymena, as well as that of other ciliates, such as Euplotes and Glaucoma, has been sequenced and reported in the scientific literature. See Singer and Gottschling, Oct. 21, 1994, Science 266:404-409; Lingner et al., 1994, Genes & Development 8:1984-1988; Greider and Blackburn, 1989, Nature 337:331-337; Romero and Blackburn, 1991, Cell 67:343-353; and Shippen-Lentz and Blackburn, 1990, Science 25 247:546-552; and U.S. Pat. No. 5,698,686, each of which is incorporated herein by reference.
[0102] The telomerase enzymes of these ciliates synthesize telomeric repeat units distinct from that in mammals. The nucleic acids comprising the RNA of a mammalian telomerase are provided in U.S. Pat. No. 5,583,016.
[0103] The functioning of telomerases seems to be activated in dividing embryonic cells and gametocytes. Telomerase activity has been identified in germ line cells and tumor cells but is repressed in differentiated somatic cells. It is now believed that the reactivation of telomerase is an essential step in tumor progression and in the immortalization of cells in culture. It is postulated that inhibition of telomerase in an immortalized cell line or in the malignant condition would cause senescence or cell death. The introduction of synthetic oligonucleotides which mimic telomere motifs has been shown to inhibit the proliferation of immortal cells or cells that express telomerase (U.S. Pat. No. 5,643,890). In fact, the single telomere motif TTAGGG exhibited greater cellular uptake and higher inhibition of proliferation than longer oligonucleotides. Methods for screening for agents which inhibit telomerase activity, including fungal telomerase activity, are provided in U.S. Pat. No. 5,645,986.
[0104] Comprehensive reviews of both telomeres and telomerase are provided in U.S. Pat. Nos. 5,643,890 and 5,707,795.
[0105] Telomere-Telomere Recombination
[0106] Telomere-telomere recombination provides an alternate pathway for telomere maintenance in at least some eukaryotes (Zakian, 1997). Wang et al. (1990) provided evidence for a telomere-telomere recombination process in yeast which involves a gene conversion event that requires little homology, occurs at or near the boundary of telomeric and non-telomeric DNA, and resembles the recombination process involved in bacteriophage T4 DNA replication.
[0107] Yeast cells which lack a functional est1 gene exhibit a continuous decline in the terminal (G1-3 T)n tract, a progressive increase in the frequency of chromosome loss, and a concomitant increase in the frequency of cell death (Lundblad et al., 1989). Although EST1 is not a catalytic component of telomerase (Cohn et al., 1995), the same phenotypes are produced by deleting the S. cerevisiae telomerase RNA gene, tlc1 (Singer and Gottschling, 1994). Although the majority of the cells in an EST1− culture die, late EST1− cultures give rise to derivatives that have survived the lethal consequences of the est1 mutation. By studying the survival of late cultures of S. cerevisiae cells, Lundblad et al. (1993) demonstrated that yeast cells have a RAD52-dependent bypass pathway by which cells can circumvent a defect in the EST1-mediated pathway for yeast telomere replication. Most of the surviving cells have very short telomeres but acquire long tandem arrays of subtelomeric repeats by gene conversion. The researchers concluded that “even when the primary pathway for telomer replication is defective, an alternative backup pathway exists that restores sufficient telomere function for continued cell viability.”
[0108] Although deletion of the telomerase RNA gene, ter1, in the yeast Kluyveromyces lactis also results in the gradual loss of telomeric repeats and progressively declining cell growth capability, some cells are able to continuing growing without telomerase. McEachern et al. (1996) proposed that shortened, terminal telomeric repeat tracts become uncapped, promoting recombinational repair between them to regenerate lengthened telomeres in survivors. They termed this process telomere cap-prevented recombination (CPR).
[0109] The TERT Proteins of the Present Invention
[0110] The present invention provides isolated proteins, allelic variants of the proteins, and conservative amino acid substitutions of the proteins. As used herein, the proteins or polypeptides refers to a protein that has the amino acid sequence depicted in SEQ ID NO.2, SEQ ID NO.4, SEQ ID NO.6, SEQ ID NO.8 or SEQ ID NO.10. The invention includes naturally occurring allelic variants and proteins that have a slightly different amino acid sequence than that specifically recited for SEQ ID NO.2, SEQ ID NO.4, SEQ ID NO.6, SEQ ID NO.8 or SEQ ID NO.10. Allelic variants, though possessing a slightly different amino acid sequence than those recited above, will still have the same or similar biological functions associated with the TERT proteins specifically identified herein.
[0111] As used herein, the family of proteins related to the TERT proteins of SEQ ID NO.2, SEQ ID NO.4, SEQ ID NO.6, SEQ ID NO.8 or SEQ ID NO.10 refer to proteins that have been isolated from organisms in addition to P. falciparum, C. albicans or O. sativa, wherein such proteins display unique features associated with the proteins of the present invention. The methods used to identify and isolate other members of protein families related to each of the TERT proteins of the present invention are described below.
[0112] The proteins of the present invention are preferably in isolated form. As used herein, a protein is said to be isolated when physical, mechanical or chemical methods are employed to remove the protein from cellular constituents that are normally associated with the protein. A skilled artisan can readily employ standard purification methods to obtain an isolated protein.
[0113] The proteins of the present invention further include conservative variants of the proteins herein described. As used herein, a conservative variant refers to alterations in the amino acid sequence that do not adversely affect the biological functions of the protein. A substitution, insertion or deletion is said to adversely affect the protein when the altered sequence prevents or disrupts a biological function associated with the protein. For example, the overall charge, structure or hydrophobic/hydrophilic properties of the protein can be altered without adversely affecting a biological activity. Accordingly, the amino acid sequence can be altered, for example to render the peptide more hydrophobic or hydrophilic, without adversely affecting the biological activities of the protein. Ordinarily, the allelic variants, the conservative substitution variants, and the members of the protein family will have an amino acid sequence having at least 30% amino acid sequence identity with the sequences set forth in SEQ ID NO.2, SEQ ID NO.4, SEQ ID NO.6, SEQ ID NO.8 or SEQ ID NO.10, or at least 35%, or at least 40%, or at least 45%, or at least 50%, or at least 55%, or at least 60%, or at least 65%, or at least 70%, or at least 75%, preferably at least 80%, or more preferably at least 85%, even more preferably at least 90%, and most preferably at least 95%. Identity or homology with respect to such sequences is defined herein as the percentage of amino acid residues in the candidate sequence that are identical with the known peptides, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent homology, and not considering any conservative substitutions as part of the sequence identity. In a related aspect, conservative substitution refers to a substitution of one amino acid for another with generally similar properties (size, hydrophobicity, charge, etc). N-terminal, C-terminal or internal extensions, deletions, or insertions into the peptide sequence shall not be construed as affecting homology.
[0114] Thus, the proteins of the present invention include molecules having the amino acid sequence disclosed in SEQ ID NO.2, SEQ ID NO.4, SEQ ID NO.6, SEQ ID NO.8 or SEQ ID NO. 10; fragments thereof having a consecutive sequence of at least about 3, 4, 5, 6, 10, 15, 20, 25, 30, 35 or more amino acid residues of the newly identified TERT proteins; amino acid sequence variants of such sequence wherein an amino acid residue has been inserted N- or C-terminal to, or within, the disclosed sequence; and amino acid sequence variants of the disclosed sequence, or their fragments as defined above, that have been substituted by another residue. Contemplated variants further include those containing predetermined mutations by, e.g., homologous recombination, site-directed or PCR mutagenesis, and the corresponding TERT proteins of other eukaryotic species, and the alleles or other naturally occurring variants of the families of TERT proteins; and derivatives wherein the TERT proteins have been covalently modified by substitution, chemical, enzymatic, or other appropriate means with a moiety other than a naturally occurring amino acid (for example a detectable moiety such as an enzyme or radioisotope).
[0115] As described below, members of the families of TERT proteins can be used: 1) to identify agents which modulate at least one activity of the TERT proteins; 2) in methods of identifying binding partners for the TERT proteins, 3) as antigens to raise polyclonal or monoclonal antibodies, and 4) as therapeutic agents.
[0116] TERT Nucleic Acid Molecules of the Present Invention
[0117] The present invention further provides nucleic acid molecules that encode the proteins having SEQ ID NO.2, SEQ ID NO.4, SEQ ID NO.6, SEQ ID NO.8 or SEQ ID NO.10 and the related proteins herein described, preferably in isolated form. As used herein, “nucleic acid” is defined as RNA or DNA that encodes a protein or peptide as defined above, or is complementary to nucleic acid sequence encoding such peptides, or hybridizes to such nucleic acids and remains stably bound to it under appropriate stringency conditions, or encodes polypeptides sharing at least 30% sequence identity, or at least 35%, or at least 40%, or at least 45%, or at least 50%, or at least 55%, or at least 60%, or at least 65%, or at least 70%, or at least 75%, preferably at least 80%, or more preferably at least 85%, even more preferably at least 90%, and most preferably at least 95%, with the TERT peptide sequences. Specifically contemplated are genomic DNA, cDNA, mRNA and antisense molecules, as well as nucleic acids based on alternative backbones or including alternative bases whether derived from natural sources or synthesized. Such hybridizing or complementary nucleic acids, however, are defined further as being novel and unobvious over any prior art nucleic acid including that which encodes, hybridizes under appropriate stringency conditions, or is complementary to nucleic acid encoding a protein according to the present invention.
[0118] Homology or identity is determined by BLAST (Basic Local Alignment Search Tool) analysis using the algorithm employed by the programs blastp, blastn, blastx, tblastn and tblastx (Karlin, et al., Proc Natl Acad Sci USA 87: 2264-2268, 1990 and Altschul, S. F., J Mol Evol 36: 290-300, 1993, fully incorporated by reference) which are tailored for sequence similarity searching. The approach used by the BLAST program is to first consider similar segments between a query sequence and a database sequence, then to evaluate the statistical significance of all matches that are identified and finally to summarize only those matches which satisfy a preselected threshold of significance. For a discussion of basic issues in similarity searching of sequence databases, see Altschul et al. (Nature Genetics 6: 119-129, 1994) which is fully incorporated by reference. The search parameters for histogram, descriptions, alignments, expect (i.e., the statistical significance threshold for reporting matches against database sequences), cutoff, matrix and filter are at the default settings. The default scoring matrix used by blastp, blastx, tblastn, and tblastx is the BLOSUM62 matrix (Henikoff, et al., Proc Natl Acad Sci USA 89: 10915-10919, 1992 fully incorporated by reference). For blastn, the scoring matrix is set by the ratios of M (i.e., the reward score for a pair of matching residues) to N (i.e., the penalty score for mismatching residues), wherein the default values for M and N are 5 and −4, respectively.
[0119] “Stringent conditions” are those hybridization conditions that work for Southern blots : hybridization with 32P nick translated probe is done in 6×SSC, 5×Denhardt's solution, 0.5% SDS, 10 mM EDTA pH8, 100 mcg/ml sheared, denatured salmon sperm DNA at 65 C. Washes are at room temperature for 2×30 min in 2×SSC, 0.1% SDS, followed by 2×30 min at 65 C. in 0.1×SSC, 0.1% SDS.
[0120] These conditions work, for example, for both of the Candida genes discovered by the present invention. For other Candida strains this process will still successfully work at 60 C.
[0121] A skilled artisan can readily determine and vary the stringency conditions appropriately to obtain a clear and detectable hybridization signal. For example, sufficient stringency conditions are contemplated such that target (e.g., SEQ ID NO.1, SEQ ID NO.3, SEQ ID NO.5, SEQ ID NO.7 or SEQ ID NO.9) and closely related sequences can be distinguished and isolated (see Sambrook et al., Molecular Cloning: A Laboratory Manual; 2nd ed pp. 9.47-9.58; 11.1-11.19 and 11.45-11-57, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989 and Methods in Enzymology, Vol.152, (Berger et al., eds), pp.399-407 and 620-622, Academic Press, Inc., New York 1987).
[0122] The present invention further provides synthetic polynucleotides which may be synthesized by well-known techniques as described in the technical literature. See, e.g., Carruthers et al., 1982, Cold Spring Harbor Symp. Quant. Biol. 47:411-418 and Adams et al., 1983, J. Am. Chem. Soc. 105:661. Double stranded DNA fragments may then be obtained either by synthesizing the complementary strand and annealing the strands together under appropriate conditions, or by adding the complementary strand using DNA, polymerase with an appropriate primer sequence.
[0123] As used herein, a nucleic acid molecule is said to be “isolated” when the nucleic acid molecule is substantially separated from contaminant nucleic acid encoding other polypeptides from the source of nucleic acid.
[0124] The present invention further provides fragments of the encoding nucleic acid molecules. As used herein, a fragment of an encoding nucleic acid molecule refers to a small portion of the entire protein encoding sequence. The size of the fragment will be determined by the intended use. For example, if the fragment is chosen so as to encode an active portion of the proteins, the fragment will need to be large enough to encode the functional region(s) of the proteins. If the fragment is to be used as a nucleic acid probe or PCR primer, then the fragment length is chosen so as to obtain a relatively small number of false positives during probing/priming.
[0125] Fragments of the encoding nucleic acid molecules of the present invention (i.e., synthetic oligonucleotides) that are used as probes or specific primers for the polymerase chain reaction (PCR), or to synthesize gene sequences encoding proteins of the invention can easily be synthesized by chemical techniques, for example, the phosphotriester method of Matteucci, et al., (J. Am. Chem. Soc. 103:3185-3191, 1981) or using automated synthesis methods. In addition, larger DNA segments can readily be prepared by well known methods, such as synthesis of a group of oligonucleotides that define various modular segments of the gene, followed by ligation of oligonucleotides to build the complete modified gene.
[0126] The encoding nucleic acid molecules of the present invention may further be modified so as to contain a detectable label for diagnostic and probe purposes. A variety of such labels are known in the art and can readily be employed with the encoding molecules herein described. Suitable labels include, but are not limited to, biotin, radiolabeled nucleotides and the like. A skilled artisan can employ any of the art known labels to obtain a labeled encoding nucleic acid molecule.
[0127] Modifications to the primary structures themselves by deletion, addition, or alteration of the amino acids incorporated into the protein sequences during translation can be made without destroying the activity of the TERT proteins. Such substitutions or other alterations result in proteins having an amino acid sequence encoded by a nucleic acid falling within the contemplated scope of the present invention.
[0128] Isolation of Other Related Nucleic Acid Molecules
[0129] As described above, the identification of the TERT nucleic acid molecules having SEQ ID NO.1, SEQ ID NO.3, SEQ ID NO.5, SEQ ID NO.7 or SEQ ID NO.9 allows a skilled artisan to isolate nucleic acid molecules that encode other members of the protein families of each organism in addition to the specific sequences herein described. Further, the presently disclosed nucleic acid molecules allow a skilled artisan to isolate nucleic acid molecules that encode other members of the families of proteins in addition to the amino acid protein having SEQ ID NO.2, SEQ ID NO. 4, SEQ ID NO.6, SEQ ID NO.8 or SEQ ID NO.10.
[0130] Essentially, a skilled artisan can readily use the amino acid sequence of SEQ ID NO.2, SEQ ID NO. 4, SEQ ID NO.6, SEQ ID NO.8 or SEQ ID NO.10 to generate antibody probes to screen expression libraries prepared from appropriate cells. Typically, polyclonal antiserum from mammals such as rabbits immunized with the purified proteins (as described below) or monoclonal antibodies can be used to probe a cDNA or genomic expression library, such as lambda gtll library, to obtain the appropriate coding sequence for other members of the protein families. The cloned cDNA sequence can be expressed as a fusion protein, expressed directly using its own control sequences, or expressed by constructions using control sequences appropriate to the particular host used for expression of the enzyme.
[0131] Alternatively, a portion of the coding sequences herein described can be synthesized and used as probes to retrieve DNA encoding a member of the protein families from any eukaryotic organism. Oligomers containing approximately 18-20 nucleotides (encoding about a 6-7 amino acid stretch) are prepared and used to screen genomic DNA or cDNA libraries to obtain hybridization under stringent conditions or conditions of sufficient stringency to eliminate an undue level of false positives.
[0132] Additionally, pairs of oligonucleotide primers can be prepared for use in a polymerase chain reaction (PCR) to selectively clone an encoding nucleic acid molecule. A PCR denature/anneal/extend cycle for using such PCR primers is well known in the art and can readily be adapted for use in isolating other encoding nucleic acid molecules.
[0133] Methods to Identify Pathogen Infection, Disease Progression and Success/Failure of Treatment
[0134] U.S. Pat. No. 5,489,508 sets forth general methods useful for determining the telomere length and telomere activity of a cell based on elongating oligonucleotide primers that can serve as a substrate for telomerase-mediated primer extension under conditions which minimize interference from other genomic sequences. U.S. Pat. No. 5,695,932 sets forth telomerase activity assays for diagnosing pathogenic infections, including those of Candida and P. falciparum . These methods are based on detecting the telomeric nucleic acids particular to a specific pathogen. The telomeric nucleic acids utilized by these methods are the specific telomeric repeats which a particular telomerase adds to the ends of the chromosomes. The methods set forth in these patents do not directly utilize a TERT gene or a TERT protein specific to a pathogen.
[0135] TERT expression has been suggested as a useful marker in diagnosing human gastric carcinomas and bladder cancer (Yasui et al., 1998; Ito et al., 1998).
[0136] Until the present invention, the TERT genes and TERT proteins of P. falciparum and C. albicans were not available for use in methods which can more directly detect these pathogens.
[0137] Thus, another embodiment of the present invention provides methods for detecting the presence or absence of a pathogen in a cell, tissue, organ or organism by analyzing the cell, tissue, organ or organism for the TERT mRNA, TERT DNA or TERT protein particular to the pathogen of interest. The present invention also provides methods for diagnosing the status of an infection in a cell, tissue, organ or organism by analyzing the cell, tissue, organ or organism for the TERT mRNA, TERT DNA or TERT protein particular to the pathogen of interest. The TERT mRNA, TERT DNA or TERT protein can be isolated or assayed by methods well known to one skilled in the art of isolating and assaying for nucleic acids and proteins. The genus or species of the organism which can be analyzed by the methods of the present invention includes, but are not limited to, any mammal.
[0138] The detection and diagnosis methods encompassed by the present invention include those using fragments, segments or portions of the specific TERT nucleic acids or TERT proteins of the present invention, where such fragments, segments or portions are indicative of the TERT mRNA, TERT DNA or TERT protein particular to the organism of interest.
[0139] Particular embodiments of the present invention include methods of detecting the presence or absence of C. albicans or P. falciparum in a mammalian cell, tissue, organ or organism. SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO.3 or SEQ ID NO.4 can be used in methods for the detection and diagnosis of C. albicans. SEQ ID NO. 5, SEQ ID NO.6, SEQ ID NO.7 or SEQ ID NO.8 can be used in methods for the detection and diagnosis of P. falciparum.
[0140] A further embodiment of the present invention provides methods for determining the presence or absence of a pathogen by measuring the level of telomerase activity of the pathogen within a cell, tissue, organ or organism. The level of the telomerase activity can be compared to that of normal cells in that tissue, organ or organism or compared to normal cells of organisms known not to be afflicted with the pathogen.
[0141] A still further embodiment of the present invention provides methods for determining the relative or actual amount of a pathogen in a cell, tissue, organ or organism by analyzing the cell, tissue organ or organism for TERT mRNA, TERT DNA or TERT protein of the pathogen. The methods encompassed by the present invention include using fragments, segments or portions of these nucleic acids or proteins in such detection methods, where such fragments, segments or portions are indicative of the pathogen. Particular embodiments of the present invention include methods of detecting the presence or absence of C. albicans or P. falciparum in a mammalian cell, tissue, organ or organism. SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO.3 or SEQ ID NO.4 can be used in methods for determining the relative or actual amounts of C. albicans in a sample. SEQ ID NO. 5, SEQ ID NO.6, SEQ ID NO.7 or SEQ ID NO.8 can be used in methods for determining the relative or actual amounts of P. falciparum in a sample.
[0142] Methods to Identify Binding Partners
[0143] Another embodiment of the present invention provides methods for use in isolating and identifying binding partners of proteins of the invention In detail, a TERT protein or TERT protein fragment of the invention is mixed with a potential binding partner or an extract or fraction of a cell under conditions that allow the association of potential binding partners with the protein of the invention. After mixing, peptides, polypeptides, proteins or other molecules that have become associated with a proteins of the invention are separated from the mixture. The binding partner that binds to the proteins of the invention can then be removed and further analyzed. To identify and isolate a binding partner, the entire proteins, for instance the entire amino acid protein of SEQ ID NO.2, SEQ ID NO. 4, SEQ ID NO.6, SEQ ID NO.8 or SEQ ID NO.10 can be used. Alternatively, a fragment of the proteins can be used. For example, the protein fragments encoded by SEQ ID NO.8 or SEQ ID NO. 10 can be utilized in the present invention.
[0144] As used herein, a cellular extract refers to a preparation or fraction which is made from a lysed or disrupted cell of the organism of interest. The preferred source of cellular extracts will be cells derived from yeast, protozoan, human or plant tissue. Cells of interest include neoplastic cells and normal cells. Alternatively, cellular extracts may be prepared from available cell lines or newly-created cell lines, particularly transformed and proliferating cells.
[0145] A variety of methods can be used to obtain an extract of a cell. Cells can be disrupted using either physical or chemical disruption methods. Examples of physical disruption methods include, but are not limited to, sonication and mechanical shearing. Examples of chemical lysis methods include, but are not limited to, detergent lysis and enzyme lysis. A skilled artisan can readily adapt methods for preparing cellular extracts in order to obtain extracts for use in the present methods.
[0146] Once an extract of a cell is prepared, the extract is mixed with the proteins of the invention under conditions in which association of the proteins with the binding partners can occur. A variety of conditions can be used, the most preferred being conditions that closely resemble conditions found in the cytoplasm of a yeast, protozoan, human or plant cell. Features such as osmolarity, pH, temperature, and the concentration of cellular extract used, can be varied to optimize the association of the proteins with the binding partners.
[0147] After mixing under appropriate conditions, the bound complex is separated from the mixture. A variety of techniques can be utilized to separate the mixture. For example, antibodies specific to a proteins of the invention can be used to immunoprecipitate the binding partner complex. Alternatively, standard chemical separation techniques such as chromatography and density/sediment centrifugation can be used.
[0148] After removal of non-associated cellular constituents found in the extract, the binding partner can be dissociated from the complex using conventional methods. For example, dissociation can be accomplished by altering the salt concentration or pH of the mixture. To aid in separating associated binding partner pairs from the mixed extract, the proteins of the invention can be immobilized on a solid support. For example, the proteins can be attached to a nitrocellulose matrix or acrylic beads. Attachment of the proteins to a solid support aids in separating peptide/binding partner pairs from other constituents found in the extract. The identified binding partners can be either a single protein or a complex made up of two or more proteins. Alternatively, binding partners may be identified using a Far-Western assay according to the procedures of Takayama et al., Methods Mol Biol 69:171-84, 1997 or Sauder et al., J GenVirol 77(5):991-6, 1996 or identified through the use of epitope tagged proteins or GST fusion proteins.
[0149] Alternatively, the nucleic acid molecules of the invention can be used in a yeast two-hybrid system. The yeast two-hybrid system has been used to identify other protein partner pairs and can readily be adapted to employ the nucleic acid molecules herein described.
[0150] Methods to Identify Agents that Modulate the Expression of a Nucleic Acid Encoding the TERT Proteins of the Present Invention
[0151] Methods of screening for agents which inhibit telomerase activity and more specifically methods of inhibiting human telomerase activity are set forth in U.S. Pat. No. 5,645,986. Such methods require combining a potential agent, an active telomerase, a substrate oligonucleotide for the telomerase and nucleotide triphosphates. These methods further require using an oligonucleotide probe which hybridizes to the specific telomere repeat sequences which are added. The telomeric nucleic acid probes utilized by these methods are specific for the telomeric repeats which a particular telomerase adds to the ends of the chromosomes. U.S. Pat. No. 5,830,644 sets forth methods of screening to identify an agent which increases telomerase activity in a cell by comparing the telomerase activity of treated and untreated cells. The methods set forth in these patents do not directly utilize a TERT gene or a TERT protein of a specific pathogen.
[0152] Until the present invention, the TERT genes and TERT proteins of P. falciparum and C. albicans were not available for use in methods of screening for agents which inhibit or promote the growth of these pathogens.
[0153] Thus, another embodiment of the present invention provides methods for identifying agents that modulate the expression of a nucleic acid encoding a protein of the invention such as a protein having the amino acid sequence of SEQ ID NO.2, SEQ ID NO.4, SEQ ID NO.6, SEQ ID NO.8 or SEQ ID NO.10. Such assays may utilize any available means of monitoring for changes in the expression level of the nucleic acids of the invention. As used herein, an agent is said to modulate the expression of a nucleic acid of the invention, for instance a nucleic acid encoding the protein having the sequence of SEQ ID NO.2, SEQ ID NO.4, SEQ ID NO.6, SEQ ID NO.8 or SEQ ID NO.10, if it is capable of up- or down-regulating expression of the nucleic acid in a cell.
[0154] In one assay format, cell lines that contain reporter gene fusions between the open reading frame defined by SEQ ID NO.1, SEQ ID NO.3, SEQ ID NO.5, SEQ ID NO.7 or SEQ ID NO.9 and any assayable fusion partner may be prepared. Numerous assayable fusion partners are known and readily available including the firefly luciferase gene and the gene encoding chloramphenicol acetyltransferase (Alam et al. (1990) Anal Biochem 188:245-254). Cell lines containing the reporter gene fusions are then exposed to the agent to be tested under appropriate conditions and time. Differential expression of the reporter gene between samples exposed to the agent and control samples identifies agents which modulate the expression of a nucleic acid encoding a protein having the sequence of SEQ ID NO.2, SEQ ID NO.4, SEQ ID NO.6, SEQ ID NO.8 or SEQ ID NO.10.
[0155] Additional assay formats may be used to monitor the ability of the agent to modulate the expression of a nucleic acid encoding a protein of the invention such as the protein having SEQ ID NO.2, SEQ ID NO.4, SEQ, ID NO.6, SEQ ID NO.8 or SEQ ID NO.10. For instance, mRNA expression may be monitored directly by hybridization to the nucleic acids of the invention. Cell lines are exposed to the agent to be tested under appropriate conditions and time and total RNA or mRNA is isolated by standard procedures such those disclosed in Sambrook et al. (Molecular Cloning: A Laboratory Manual, 2nd Ed. Cold Spring Harbor Laboratory Press, 1989).
[0156] In order to assay gene expression of the present invention in a physiologically relevant manner, tissues may be analyzed under conditions which model neoplastic or normal cell stages of proliferation and differentiation. Cells which express or fail to express a particular gene involved in the activation, inactivation or regulation of TERT transcription and expression may be particularly useful in the assays discussed herein. Such cells can exist naturally or be the result of genetic manipulation, such as specialized cells created via gene transformation or gene disruption. For example, cells with or without the MYC proto-oncogene may be of interest in methods used for identifying agents which modulate TERT gene expression. The MYC proto-oncogene encodes a ubiquitous transcription factor (c-MYC) involved in the control of cell proliferation and differentiation (Wu et al., 1999). TERT and c-MYC are expressed in normal and transformed proliferating cells, downregulated in quiescent and terminally differentiated cells, and can both induce immortalization when constitutively expressed in transfected cells. As another example, telomerase activity is suppressed during terminal differentiation of HL-60 promyelocytic leukaemic cells (Xu et al., 1999).
[0157] Probes to detect differences in RNA expression levels between cells exposed to the agent and control cells may be prepared from the nucleic acids of the invention. It is preferable, but not necessary, to design probes which hybridize only with target nucleic acids under conditions of high stringency. Only highly complementary nucleic acid hybrids form under conditions of high stringency. Accordingly, the stringency of the assay conditions determines the amount of complementarity which should exist between two nucleic acid strands in order to form a hybrid. Stringency should be chosen to maximize the difference in stability between the probe:target hybrid and potential probe:non-target hybrids.
[0158] Probes may be designed from the nucleic acids of the invention through methods known in the art. For instance, the G+C content of the probe and the probe length can affect probe binding to its target sequence. Methods to optimize probe specificity are commonly available in Sambrook et al. (Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, NY, 1989) or Ausubel et al. (Current Protocols in Molecular Biology, Greene Publishing Co., NY, 1995).
[0159] Hybridization conditions are modified using known methods, such as those described by Sambrook et al. and Ausubel et al. as required for each probe. Hybridization of total cellular RNA or RNA enriched for polyA RNA can be accomplished in any available format. For instance, total cellular RNA or RNA enriched for polyA RNA can be affixed to a solid support and the solid support exposed to at least one probe comprising at least one, or part of one of the sequences of the invention under conditions in which the probe will specifically hybridize. Alternatively, nucleic acid fragments comprising at least one, or part of one of the sequences of the invention can be affixed to a solid support, such as a porous glass wafer. The glass wafer can then be exposed to total cellular RNA or polyA RNA from a sample under conditions in which the affixed sequences will specifically hybridize. Such glass wafers and hybridization methods are widely available, for example, those disclosed by Beattie (WO 95/11755). By examining for the ability of a given probe to specifically hybridize to an RNA sample from an untreated cell population and from a cell population exposed to the agent, agents which up or down regulate the expression of a nucleic acid encoding the protein having the sequence of SEQ ID NO.2, SEQ ID NO.4, SEQ ID NO.6, SEQ ID NO.8 or SEQ ID NO.10 are identified.
[0160] Hybridization for qualitative and quantitative analysis of mRNAs may also be carried out by using a RNase Protection Assay (i.e., RPA, see Ma et al., Methods 10: 273-238, 1996). Briefly, an expression vehicle comprising cDNA encoding the gene product and a phage specific DNA dependent RNA polymerase promoter (e.g., T7, T3 or SP6 RNA polymerase) is linearized at the 3′ end of the cDNA molecule, downstream from the phage promoter, wherein such a linearized molecule is subsequently used as a template for synthesis of a labeled antisense transcript of the cDNA by in vitro transcription. The labeled transcript is then hybridized to a mixture of isolated RNA (i.e., total or fractionated mRNA) by incubation at 45° C. overnight in a buffer comprising 80% formamide, 40 mM Pipes, pH 6.4, 0.4 M NaCl and 1 mM EDTA. The resulting hybrids are then digested in a buffer comprising 40 &mgr;g/ml ribonuclease A and 2 &mgr;g/ml ribonuclease. After deactivation and extraction of extraneous proteins, the samples are loaded onto urea/polyacrylamide gels for analysis.
[0161] In another assay format, agents which effect the expression of the instant gene products, cells or cell lines would first be identified which express said gene products physiologically. Cell and/or cell lines so identified would be expected to comprise the necessary cellular machinery such that the fidelity of modulation of the transcriptional apparatus is maintained with regard to exogenous contact of agent with appropriate surface transduction mechanisms and/or the cytosolic cascades. Further, such cells or cell lines would be transduced or transfected with an expression vehicle (e.g., a plasmid or viral vector) construct comprising an operable non-translated 5′-promoter containing end of the structural gene encoding the instant gene products fused to one or more antigenic fragments, which are peculiar to the instant gene products, wherein said fragments are under the transcriptional control of said promoter and are expressed as polypeptides whose molecular weight can be distinguished from the naturally occurring polypeptides or may further comprise an immunologically distinct tag. Such a process is well known in the art (see Maniatis, 1982). Elements responsible for promoter activity of hTERT are known to be contained within a region extending from 330 bp upstream of the ATG to the second exon of the hTERT gene (Cong et al., 1999).
[0162] Cells or cell lines transduced or transfected as outlined above would then be contacted with agents under appropriate conditions; for example, the agent comprises a pharmaceutically acceptable excipient and is contacted with cells comprised in an aqueous physiological buffer such as phosphate buffered saline (PBS) at physiological pH, Eagles balanced salt solution (BSS) at physiological pH, PBS or BSS comprising serum or conditioned media comprising PBS or BSS and/or serum incubated at 37° C. Said conditions may be modulated as deemed necessary by one of skill in the art. Subsequent to contacting the cells with the agent, said cells will be disrupted and the polypeptides of the disruptate are fractionated such that a polypeptide fraction is pooled and contacted with an antibody to be further processed by immunological assay (e.g., ELISA, immunoprecipitation or Western blot). The pool of proteins isolated from the “agent contacted” sample will be compared with a control sample where only the excipient is contacted with the cells and an increase or decrease in the immunologically generated signal from the “agent contacted” sample compared to the control will be used to distinguish the effectiveness of the agent.
[0163] Methods to Identify Agents that Modulate at Least One Activity of the TERT Proteins
[0164] Another embodiment of the present invention provides methods for identifying agents that modulate at least one activity of a protein of the invention such as the protein having the amino acid sequence of SEQ ID NO.2, SEQ ID NO.4, SEQ ID NO.6, SEQ ID NO.8 or SEQ ID NO.10. Such methods or assays may utilize any means of monitoring or detecting the desired activity, such as the synthesis of telomeric DNA, cell immortalization, tumorigenesis or cell proliferation.
[0165] In one format, an assay may involve comparing the relative amounts of a protein of the present invention between a cell population that has been exposed to the agent to be tested to that of an unexposed control cell population. In this format, probes such as specific antibodies are used to monitor the differential expression of the protein in the different cell populations. Cell lines or populations are exposed to the agent to be tested under appropriate conditions and time. Cellular lysates may be prepared from the exposed cell line or population and a control, unexposed cell line or population. The cellular lysates are then analyzed with the probe.
[0166] Antibody probes are prepared by immunizing suitable mammalian hosts in appropriate immunization protocols using the peptides, polypeptides or proteins of the invention if they are of sufficient length, or, if desired, or if required to enhance immunogenicity, conjugated to suitable carriers. Methods for preparing immunogenic conjugates with carriers such as BSA, KLH, or other carrier proteins are well known in the art. In some circumstances, direct conjugation using, for example, carbodiimide reagents may be effective; in other instances linking reagents such as those supplied by Pierce Chemical Co., Rockford, Ill., may be desirable to provide accessibility to the hapten. The hapten peptides can be extended at either the amino or carboxy terminus with a Cys residue or interspersed with cysteine residues, for example, to facilitate linking to a carrier. Administration of the immunogens is conducted generally by injection over a suitable time period and with use of suitable adjuvants, as is generally understood in the art. During the immunization schedule, titers of antibodies are taken to determine adequacy of antibody formation.
[0167] While the polyclonal antisera produced in this way may be satisfactory for some applications, for pharmaceutical compositions, use of monoclonal preparations is preferred. Immortalized cell lines which secrete the desired monoclonal antibodies may be prepared using the standard method of Kohler and Milstein (Nature 256(5517):495-7, 1975; Eur J Immunol 6(7):511-9, 1976; and Biotechnology 24:524-6, 1992)or modifications which effect immortalization of lymphocytes or spleen cells, as is generally known. The immortalized cell lines secreting the desired antibodies are screened by immunoassay in which the antigen is the peptide hapten. polypeptide or protein. When the appropriate immortalized cell culture secreting the desired antibody is identified, the cells can be cultured either in vitro or by production in ascites fluid.
[0168] The desired monoclonal antibodies are then recovered from the culture supernatant or from the ascites supernatant. Fragments of the monoclonals or the polyclonal antisera which contain the immunologically significant portion can be used as antagonists, as well as the intact antibodies. Use of immunologically reactive fragments, such as the Fab, Fab′, of F(ab′)2 fragments is often preferable, especially in a therapeutic context, as these fragments are generally less immunogenic than the whole immunoglobulin.
[0169] The antibodies or fragments may also be produced, using current technology, by recombinant means. Antibody regions that bind specifically to the desired regions of the protein can also be produced in the context of chimeras with multiple species origin, for instance, humanized antibodies.
[0170] Agents that are assayed in the above method can be randomly selected or rationally selected or designed. As used herein, an agent is said to be randomly selected when the agent is chosen randomly without considering the specific sequences involved in the association of the a protein of the invention alone or with its associated substrates, binding partners, etc. An example of randomly selected agents is the use a chemical library or a peptide combinatorial library, or a growth broth of an organism.
[0171] As used herein, an agent is said to be rationally selected or designed when the agent is chosen on a nonrandom basis which takes into account the sequence of the target site and/or its conformation in connection with the agent's action. Agents can be rationally selected or rationally designed by utilizing the peptide sequences that make up these sites.
[0172] The agents of the present invention can be, as examples, peptides, small molecules, vitamin derivatives, as well as carbohydrates. A skilled artisan can readily recognize that there is no limit as to the structural nature of the agents of the present invention.
[0173] The peptide agents of the invention can be prepared using standard solid phase (or solution phase) peptide synthesis methods, as is known in the art. In addition, the DNA encoding these peptides may be synthesized using commercially available oligonucleotide synthesis instrumentation and produced recombinantly using standard recombinant production systems. The production using solid phase peptide synthesis is necessitated if non-gene-encoded amnino acids are to be included.
[0174] Another class of agents of the present invention are antibodies immunoreactive with critical positions of proteins of the invention. Antibody agents are obtained by immunization of suitable mammalian subjects with peptides, containing as antigenic regions, those portions of the protein intended to be targeted by the antibodies.
[0175] Uses for Agents that Modulate at Least One Activity of the TERT Proteins
[0176] Agents that modulate or down-regulate the expression of the protein or agents such as agonists or antagonists of at least one activity of the proteins may be used to modulate biological and pathologic processes associated with the protein's function and activity. As used herein, a subject can be any mammal, so long as the mammal is in need of modulation of a pathological or biological process mediated by a protein of the invention. The term “mammal” is meant to include an individual belonging to the class Mammalia. The invention is particularly useful in the treatment of human subjects with conditions or diseases such as cancer, such as stomach cancer, malaria or vaginal candidiasis.
[0177] Pathological processes refer to a category of biological processes which produce a deleterious effect. For example, expression of a protein of the invention may be associated with tumorigenesis, malaria or vaginal candidiasis. The pathological processes associated with malaria and a list of drugs currently used in the chemotherapy of protozoal infections are set forth in J. W. Tracy and L. T. Webster, Jr., 1996, Malaria, In Goodman & Gilman's The Pharmacological Basis of Therapeutics, Ninth Edition, Ch. 40:965-985.
[0178] As used herein, an agent is said to modulate a pathological process when the agent reduces the degree or severity of the process. For instance, malaria may be prevented or disease progression modulated by the administration of agents which reduce or modulate in some way the expression or at least one activity of a protein, a gene, or a gene product (RNA or DNA) of the invention.
[0179] The agents of the present invention can be provided alone, or in combination with other agents that modulate a particular pathological process. For example, an agent of the present invention can be administered in combination with other agents commonly used to treat cancers, protozoan infections and yeast infections. As used herein, two agents are said to be administered in combination when the two agents are administered simultaneously or are administered independently in a fashion such that the agents will act at the same time.
[0180] The agents of the present invention can be administered via parenteral, subcutaneous, intravenous, intramuscular, intraperitoneal, transdermal, or buccal routes. Alternatively, or concurrently, administration may be by the oral route. The dosage administered will be dependent upon the age, health, and weight of the recipient, kind of concurrent treatment, if any, frequency of treatment, and the nature of the effect desired.
[0181] The present invention further provides compositions containing one or more agents which modulate expression or at least one activity of a protein of the invention. While individual needs vary, determination of optimal ranges of effective amounts of each component is within the skill of the art. Typical dosages comprise 0.1 to 100 &mgr;g/kg body wt. The preferred dosages comprise 0.1 to 10 &mgr;g/kg body wt. The most preferred dosages comprise 0.1 to 1 &mgr;g/kg body wt.
[0182] In addition to the pharmacologically active agent, the compositions of the present invention may contain suitable pharmaceutically acceptable carriers comprising excipients and auxiliaries which facilitate processing of the active compounds into preparations which can be used pharmaceutically for delivery to the site of action. Suitable formulations for parenteral administration include aqueous solutions of the active compounds in water-soluble form, for example, water-soluble salts. In addition, suspensions of the active compounds as appropriate oily injection suspensions may be administered. Suitable lipophilic solvents or vehicles include fatty oils, for example, sesame oil, or synthetic fatty acid esters, for example, ethyl oleate or triglycerides. Aqueous injection suspensions may contain substances which increase the viscosity of the suspension include, for example, sodium carboxymethyl cellulose, sorbitol, and/or dextran. Optionally, the suspension may also contain stabilizers. Liposomes can also be used to encapsulate the agent for delivery into the cell.
[0183] The pharmaceutical formulation for systemic administration according to the invention may be formulated for enteral, parenteral or topical administration. Indeed, all three types of formulations may be used simultaneously to achieve systemic administration of the active ingredient.
[0184] Suitable formulations for oral administration include hard or soft gelatin capsules, pills, tablets, including coated tablets, elixirs, suspensions, syrups or inhalations and controlled release forms thereof.
[0185] In practicing the methods of this invention, the compounds of this invention may be used alone or in combination, or in combination with other therapeutic or diagnostic agents. In certain preferred embodiments, the compounds of this invention may be coadministered along with other compounds typically prescribed for these conditions according to generally accepted medical practice, such as anticoagulant agents, thrombolytic agents, or other antithrombotics, including platelet aggregation inhibitors, tissue plasminogen activators, urokinase, prourokinase, streptokinase, heparin, aspirin, or warfarin. The compounds of this invention can be utilized in vivo, ordinarily in mammals, such as humans, sheep, horses, cattle, pigs, dogs, cats, rats and mice, or in vitro.
[0186] rDNA molecules Containing a Nucleic Acid Molecule
[0187] The present invention fturer provides recombinant DNA molecules (rDNAs) that contain coding sequences. As used herein, a rDNA molecule is a DNA molecule that has been subjected to molecular manipulation in situ. Methods for generating rDNA molecules are well known in the art, for example, see Sambrook et al., Molecular Cloning (1989). In the preferred rDNA molecules, a coding DNA sequence is operably linked to expression control sequences and/or vector sequences.
[0188] The choice of vector and/or expression control sequences to which one of the protein family encoding sequences of the present invention is operably linked depends directly, as is well known in the art, on the functional properties desired, e.g., protein expression, and the host cell to be transformed. A vector contemplated by the present invention is at least capable of directing the replication or insertion into the host chromosome, and preferably also expression, of the structural gene included in the rDNA molecule.
[0189] Expression control elements that are used for regulating the expression of an operably linked proteins encoding sequence are known in the art and include, but are not limited to, inducible promoters, constitutive promoters, secretion signals, and other regulatory elements. Preferably, the inducible promoter is readily controlled, such as being responsive to a nutrient in the host cell's medium.
[0190] In one embodiment, the vector containing a coding nucleic acid molecule will include a prokaryotic replicon, i.e., a DNA sequence having the ability to direct autonomous replication and maintenance of the recombinant DNA molecule extrachromosomally in a prokaryotic host cell, such as a bacterial host cell, transformed therewith. Such replicons are well known in the art. In addition, vectors that include a prokaryotic replicon may also include a gene whose expression confers a detectable marker such as a drug resistance. Typical bacterial drug resistance genes are those that confer resistance to ampicillin or tetracycline.
[0191] Vectors that include a prokaryotic replicon can further include a prokaryotic or bacteriophage promoter capable of directing the expression (transcription and translation) of the coding gene sequences in a bacterial host cell, such as E. coli. A promoter is an expression control element formed by a DNA sequence that permits binding of RNA polymerase and transcription to occur. Promoter sequences compatible with bacterial hosts are typically provided in plasmid vectors containing convenient restriction sites for insertion of a DNA segment of the present invention. Typical of such vector plasmids are pUC8, pUC9, pBR322 and pBR329 available from Biorad Laboratories, (Richmond, Calif.), pPL and pKK223 available from Pharmacia, Piscataway, N.J.
[0192] Expression vectors compatible with eukaryotic cells can also be used to form a rDNA molecules that contains a coding sequence. Eukaryotic cell expression vectors are well known in the art and are available from several commercial sources. Typically, such vectors are provided containing convenient restriction sites for insertion of the desired DNA segment. Typical of such vectors are pSVL and pKSV-10 (Pharmacia), pBPV-1/pML2d (International Biotechnologies, Inc.), pTDT1 (ATCC, #31255), the vector pCDM8 described herein, and the like eukaryotic expression vectors.
[0193] Eukaryotic cell expression vectors used to construct the rDNA molecules of the present invention may further include a selectable marker that is effective in an eukaryotic cell, preferably a drug resistance selection marker. A preferred drug resistance marker is the gene whose expression results in neomycin resistance, i.e., the neomycin phosphotransferase (neo) gene. (Southern et al., J. Mol. Anal. Genet 1:327-341, 1982.) Alternatively, the selectable marker can be present on a separate plasmid, and the two vectors are introduced by co-transfection of the host cell, and selected by culturing in the appropriate drug for the selectable marker.
[0194] Host Cells Containing an Exogenously Supplied Coding Nucleic Acid Molecule
[0195] The present invention further provides host cells: transformed with nucleic acid molecules that encode the TERT proteins of the present invention. Eukaryotic cells useful for expression of a protein of the invention are not limited, so long as the cell line is compatible with cell culture methods and compatible with the propagation of the expression vector and expression of the gene product. Preferred eukaryotic host cells include, but are not limited to, yeast, protozoan, insect, plant and mammalian cells. Preferable vertebrate cells include those from a mouse, rat, monkey or human cell line. Preferred eukaryotic host cells include Chinese hamster ovary (CHO) cells available from the ATCC as CCL61, NIH Swiss mouse embryo cells NIH/3T3 available from the ATCC as CRL 1658, HL-60 promyelocytic cells, baby hamster kidney cells (BHK), and the like eukaryotic tissue culture cell lines. Various plant cells are also preferred hosts, including those of tomato, rice, wheat, corn, tobacco, Arabidopsis, soybean and alfalfa.
[0196] Any prokaryotic host can be used to express a rDNA molecule encoding a protein of the invention. The preferred prokaryotic host is E. coli.
[0197] Transformation of appropriate cell hosts with a rDNA molecule of the present invention is accomplished by well known methods that typically depend on the type of vector used and host system employed. With regard to transformation of prokaryotic host cells, electroporation and salt treatment methods are typically employed, see, for example, Cohen et al., Proc. Natl. Acad. Sci. USA 69:2110, 1972; and Maniatis et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. (1982). With regard to transformation of vertebrate cells with vectors containing rDNAs, electroporation, cationic lipid or salt treatment methods are typically employed, see, for example, Graham et al., Virol 52:456, 1973; Wigler et al., Proc Natl Acad Sci USA 76:1373-76, 1979.
[0198] Successfully transformed cells, i.e., cells that contain a rDNA molecule of the present invention, can be identified by well known techniques including the selection for a selectable marker. For example, cells resulting from the introduction of an rDNA of the present invention can be cloned to produce single colonies. Cells from those colonies can be harvested, lysed and their DNA content examined for the presence of the rDNA using a method such as that described by Southern, J Mol Biol 98:503, 1975, or Berent et al., Biotech. 3:208, 1985 or the proteins produced from the cell assayed via an immunological method.
[0199] Production of Recombinant Proteins using a rDNA Molecule
[0200] The present invention further provides methods for producing a TERT protein of the invention using nucleic acid molecules herein described. In general terms, the production of a recombinant form of a protein typically involves the following steps:
[0201] First, a nucleic acid molecule is obtained that encodes a protein of the invention, such as the nucleic acid molecules depicted in SEQ ID NO.1, SEQ ID NO.3, SEQ ID NO.5, SEQ ID NO.7 or SEQ ID NO.9, or fragments of such sequences which encode an active TERT protein. If the encoding sequences are uninterrupted by introns, it is directly suitable for expression in any host.
[0202] The nucleic acid molecules are then preferably placed in operable linkage with suitable control sequences, as described above, to form an expression units containing the open reading frame of the TERT proteins or protein fragments. The expression unit is used to transform a suitable host and the transformed host is cultured under conditions that allow the production of the recombinant proteins. Optionally the recombinant proteins are isolated from the medium or from the cells; recovery, and purification of the proteins may not be necessary in some instances where some impurities may be tolerated.
[0203] Each of the foregoing steps can be done in a variety of ways. For example, the desired coding sequences may be obtained from genomic fragments and used directly in appropriate hosts. The construction of expression vectors that are operable in a variety of hosts is accomplished using appropriate replicons and control sequences, as set forth herein. The control sequences, expression vectors, and transformation methods are dependent on the type of host cell used to express the gene and were discussed in detail herein. Suitable restriction sites can, if not normally available, be added to the ends of the coding sequence so as to provide an excisable gene to insert into these vectors. A skilled artisan can readily adapt any host/expression system known in the art for use with the nucleic acid molecules of the invention to produce recombinant proteins.
[0204] Genetic Transformation Methods
[0205] Production of Transgenic Protozoans
[0206] Transgenic protozoans, especially P. falciparum , clones containing recombinant genes corresponding to the DNA sequences of SEQ ID NO.1, SEQ ID NO.3, SEQ ID NO.5, SEQ ID NO.7 or SEQ ID NO.9 are a part of the invention.
[0207] Protozoans expressing heterologous genes can be produced by homologous recombination of circular plasmids into the corresponding chromosome loci. For a general discussion of the molecular biology of parasitic protozoans, see, D. F. Smith and M. Parsons, 1996, Molecular Biology of Parasitic Protozoa (Frontiers in Molecular Biology, 13).
[0208] Organisms such as P. falciparum (Yuda et al., 1999, J. Exp. Med., 189(12):1947-1952; Menard et al.,1997, Methods, 13(2):148-157), P. berghei (van Dijk et al., 1995, Science, 268(5215):1358-1362) and Toxoplasma gondii (Black et al., 1998, J. Biol. Chem., 273(7):3972-9) have been used.
[0209] Unlike yeast and bacterial recombinant systems, the purpose of which may be commercial production of heterologous proteins, these transformants usually are produced to provide a basis for studying the effects of gene alterations and knock-outs, as well as for studying the different stages in an organism's life cycle (Wu et al., 1996, PNAS, 93(3):1130-1134; Waters et al., 1997, Methods, 13(2):134-147).
[0210] Production of Transgenic Yeast
[0211] Transgenic yeast, especially C. albicans, clones containing recombinant genes corresponding to the DNA sequences of SEQ ID NO.1, SEQ ID NO.3, SEQ ID NO.5, SEQ ID NO.7 or SEQ ID NO.9 are a part of the invention.
[0212] For general discussion on producing transgenic yeasts, see, P. L. Bartel and S. Fields, 1997, The Yeast Two-Hybrid System (Advances in Molecular Biology), Oxford Univ. Press.; A. J. P. Brown et al., 1998, Yeast Gene Analysis; A. Adams et al., 1997, Methods in Yeast Genetics, 997: A Cold Spring Harbor Laboratory Course Manual/With 1999 Biosupplynet Source Book; H. Heslot and C. Gaillardin, 1991, Molecular Biology and Genetic Engineering of Yeasts.
[0213] The production of recombinant yeasts and their use in the subsequent production of secreted and non-secreted heterologous proteins are well known and well characterized in the art (Russo et al., 1995, J. Environ. Pathol. Toxicol. Oncol 14(3-4):133-157; Buckholz et al., 1991, Biotechnology, 9(11):1067-1072; Tekamp-Olson et al., 1990, Curr. Opinion Biotechnol. 1:28-35; Brake et al., 1984, PNAS 81:4642-4646; Bitter et al., 1984, PNAS 81:5330-5334; Singh et al., 1984, Nucl. Acid. Res. 12:8927.
[0214] C. albicans can be transformed by traditional (biochemical) means (Datta et al., 1989, Adv. Microb. Physiol. 30:53-88 and U.S. Pat. Nos. 5,871,987 and 5,885,815) or by electroporation (U.S. Pat. No. 5,908,753).
[0215] In addition to C. albicans and S. cerevisiae, other transgenic yeasts can be created by transforming, with suitable vectors and promoters, organisms such as: Pichia pastoris (U.S. Pat. No. 4,879,231); Kluyveromyces lactis (U.S. Pat. Nos. 4,806,472 and 5,633,146); Hansenula polymorpha (U.S. Pat. Nos. 5,240,838 and 5,741,674); Schizosaccharomyces pombe (U.S. Pat. No. 5,663,061), Schwanniomyces occidentalis (U.S. Pat. No. 5,100,794) and Yarrowia lipolytica (U.S. Pat. No. 4,880,741).
[0216] Recombinant proteins which have been successfully produced by yeast systems include, but are not limited to, alpha-interferon (U.S. Pat. No. 4,615,974); human growth hormone and human insulin (U.S. Pat. No. 4,775,622); platelet derived growth factor (U.S. Pat. No. 4,801,542); a herpes simplex virus gene (U.S. Pat. No. 5,059,538); epidermal growth factor (U.S. Pat. No. 5,102,789); desulphatohirudin, a protease inhibitor (U.S. Pat. No. 5,726,043); alpha, beta and gamma-globin (U.S. Pat. No. 5,827,693); and human serum albumin (U.S. Pat. No. 5,879,907).
[0217] Production of Transgenic Animals
[0218] Transgenic animals containing mutant, knock-out or modified genes corresponding to the DNA sequence of SEQ ID NO.1, SEQ ID NO.3, SEQ ID NO.5, SEQ ID NO.7 or SEQ ID NO.9 are also included in the invention.
[0219] Transgenic animals are genetically modified animals into which recombinant, exogenous or cloned genetic material has been experimentally transferred. Such genetic material is often referred to as a transgene. The nucleic acid sequence of the transgene, in this case an active form, fragment or segment of SEQ ID NO.1, SEQ ID NO.3, SEQ ID NO.5, SEQ ID NO.7 or SEQ ID NO.9, mnay be integrated either at a locus of a genome where that particular nucleic acid sequence is not otherwise normally found or at the normal locus for the transgene. The transgene may consist of nucleic acid sequences derived from the genome of the same species or of a different species, including non-animal species, than the species of the target animal.
[0220] The term “germ cell line transgenic animal” refers to a transgenic animal in which the genetic alteration or genetic information was introduced into a germ line cell, thereby conferring the ability of the transgenic animal to transfer the genetic information to offspring. If such offspring in fact possess some or all of that alteration or genetic information, then they too are transgenic animals.
[0221] The alteration or genetic information may be foreign to the species of animal to which the recipient belongs, foreign only to the particular individual recipient, or may be genetic information already possessed by the recipient. In the last case, the altered or introduced gene may be expressed differently than the native gene.
[0222] The development of transgenic technology allows investigators to create mammals of virtually any genotype and to assess the consequences of introducing specific exogenous nucleic acid sequences on the physiological and morphological characteristics of the transformed animals. The availability of transgenic animals permits cellular processes to be influenced and examined in a systematic and specific manner not achievable with most other test systems. For example, the development of transgenic animals provides biological and medical scientists with models that are useful in the study of disease. Such animals are also useful for the testing and development of new pharmaceutically active substances. Gene therapy can be used to ameliorate or cure the symptoms of genetically-based diseases.
[0223] Transgenic animals can be produced by a variety of different methods including transfection, electroporation, microinjection, biolistics (also called gene particle acceleration or microprojectile bombardment), gene targeting in embryonic stem cells and recombinant viral and retro viral infection (see, e.g., U.S. Pat. No. 4,736,866; U.S. Pat. No. 5,602,307; Mullins et al., Hypertension 22(4):630-633 (1993); Brenin et al., Surg. Oncol. 6(2)99-110 (1997); Tuan (ed.), Recombinant Gene Expression Protocols, Methods in Molecular Biology No. 62, Humana Press (1997)).
[0224] The term “knock-out” generally refers to mutant organisms which contain a null allele of a specific gene. The term “knock-in” generally refers to mutant organisms into which a gene has been inserted through homologous recombination. The knock-in gene may be a mutant form of a gene which replaces the endogenous, wild-type gene.
[0225] A number of recombinant rodents have been produced, including those which express an activated oncogene sequence (U.S. Pat. No. 4,736,866); express simian SV 40 T-antigen (U.S. Pat. No. 5,728,915); lack the expression of interferon regulatory factor 1 (IRF-1) (U.S. Pat. No. 5,731,490); exhibit dopaminergic dysfunction (U.S. Pat. No. 5,723,719); express at least one human gene which participates in blood pressure control (U.S. Pat. No. 5,731,489); display greater similarity to the conditions existing in naturally occurring Alzheimer's disease (U.S. Pat. No. 5,720,936); have a reduced capacity to mediate cellular adhesion (U.S. Pat. No. 5,602,307); possess an bovine growth hormone gene (Clutter et al., Genetics 143(4):1753-1760 (1996)); and are capable of generating a fully human antibody response (McCarthy, The Lancet 349(9049):405 (1997)).
[0226] While rodents, especially mice and rats, remain the animals of choice for most transgenic experimentation, in some instances it is preferable or even necessary to use alternative animal species. Transgenic procedures have been successfully utilized in a variety of non-murine animals, including sheep, goats, pigs, dogs, cats, monkeys, chimpanzees, hamsters, rabbits, cows and guinea pigs (see, e.g., Kim et al., Mol. Reprod. Dev. 46(4(:515-526 (1997); Houdebine, Reprod. Nutr. Dev. 35(6):609-617 (1995); Petters, Reprod. Fertil. Dev. 6(5):643-645 (1994); Schnieke et al., Science 278(5346):2130-2133 (1997); and Amoah, J. Animal Science 75(2):578-585 (1997)).
[0227] The method of introduction of nucleic acid fragments into recombination competent mammalian cells can be by any method which favors co-transformation of multiple nucleic acid molecules. Detailed procedures for producing transgenic animals are readily available to one skilled in the art, including the recitations in U.S. Pat. No. 5,489,743 and U.S. Pat. No. 5,602,307.
[0228] Production of Transgenic Plants
[0229] Transgenic plants can be produced by a variety of different transformation methods including, but not limited to, electroporation; microinjection; microprojectile bombardment, also known as particle acceleration or biolistic bombardment; viral-mediated transformation; and Agrobacterium-mediated transformation (sec, e.g., U.S. Pat. Nos. 5,405,765, 5,472,869, 5,538,877, 5,538,880, 5,550,318, 5,641,664, 5,736,369 and 5,736369; Watson et al., Recombinant DNA, Scientific American Books (1992); Hinchee et al., Bio/Tech. 6:915-922 (1988); McCabe et al., Bio/Tech. 6:923-926 (1988); Toriyama et al., Bio/Tech. 6:1072-1074 (1988); Fromm et al., Bio/Tech. 8:833-839 (1990); Mullins et al., Bio/Tech. 8:833-839 (1990); and Raineri et al., Bio/Tech. 8:33-38 (1990)).
[0230] Methods of producing transgenic rice plants are well known to those skilled in the art of plant transformation. See, e.g., Hiei et al., 1994, Plant J. 6:271-282; Christou et al., 1992, Trends in Biotechnology 10:239; Lee et al., Proc. Nat'l Acad. Sci. USA 88:6389, U.S. Pat. Nos. 5,859,326, 5,861,542, 5,952,485, and 5,952,553.
[0231] Genes successfully introduced into plants using recombinant DNA methodologies include, but are not limited to, those coding for the following traits: seed storage proteins, including modified 7S legume seed storage proteins (U.S. Pat. Nos. 5,508,468, 5,559,223 and 5,576,203); herbicide tolerance or resistance (U.S. Pat. Nos. 5,498,544 and 5,554,798; Powell et al., Science 232:738-743 (1986); Kaniewski et al., Bio/Tech. 8:750-754 (1990); Day et al., Proc. Natl. Acad. Sci. USA 88:6721-6725 (1991)); phytase (U.S. Pat. No. 5,593,963); resistance to bacterial, fungal, nematode and insect pests, including resistance to the lepidoptera insects conferred by the Bt gene (U.S. Pat. Nos. 5,597,945 and 5,597,946; Hilder et al., Nature 330:160-163; Johnson et al., Proc. Natl. Acad. Sci. USA, 86:9871-9875 (1989); Perlak et al., Bio/Tech. 8:939-943 (1990)); lectins (U.S. Pat. No. 5,276,269); and flower color (Meyer et al., Nature 330:677-678 (1987); Napoli et al., Plant Cell 2:279-289 (1990); van der Krol et al., Plant Cell 2:291-299 (1990)).
[0232] Homologous Recombination
[0233] Genes can be introduced in a site directed fashion using homologous recombination. This can be used in the creation of a transgenic animal, wherein the animal would be mutated, and the phenotype of the mutation could be studied for purposes of drug screening, investigating physiologic processes, developing new products and the like. Papers discussing homologous recombination are discussed in U.S. Pat. No. 5,413,923.
[0234] Homologous recombination permits site-specific modifications in endogenous genes and thus inherited or acquired mutations may be corrected, and/or novel alterations may be engineered into the genome. The application of homologous recombination to gene therapy depends on the ability to carry out homologous recombination or gene targeting in normal, somatic cells for transplantation.
[0235] To prepare cells for homologous recombination, embryonic stem cells or a stem cell line may be obtained. Cells other than embryonic stem cells can be utilized (e.g. hematopoietic stem cells etc.) (See U.S. Pat. No. 5,589,369 for more examples). The cells may be grown on an appropriate fibroblast fetal layer or grown in the presence of leukemia inhibiting factor (LIF) and then used. The embryonic stem cells may be injected into a blastocyst, that has been previously obtained, to provide a chimeric animal. The main advantage of the embryonic stem cell technique is that the cells transfected with the “transgene” can be tested prior to reimplantation into a female animal for gestation for integration and the effect of the transgenes. By subsequent cross-breeding experiments, animals can be bred which carry the transgene on both chromosomes. If mutations are incorporated into the transgenes which block expression of the normal gene production, the endogenous genes can be eliminated by this technique and functional studies can thus be performed.
[0236] Methods for intracellularly producing DNA segments by homologous recombination of smaller overlapping DNA fragments and transgenic mammalian cells and whole animals produced by such methods are disclosed in U.S. Pat. No. 5,612,205. Cell lines useful for analysis of human homologous interchromosomal recombination are provided in U.S. Patent Application No. 5,554,529.
[0237] Homologous recombination can also proceed extrachromasomally, which may be of benefit when handling large gene sequences (e.g., larger than 50 kb). Methods of performing extrachromosomal homologous recombination are described in U.S. Pat. No. 5,721,367.
[0238] Homologous recombination and site-directed integration in plants are discussed in U.S. Pat. Nos. 5,451,513, 5,501,967 and 5,527,695.
[0239] Artificial Chromosomes
[0240] Components of Artificial Chromosomes
[0241] Artificial chromosomes are man-made linear DNA molecules constructed from essential DNA sequence elements that are responsible for the proper replication and partitioning of natural chromosomes (Murray et al., 1983). The essential elements necessary to construct artificial chromosomes include:
[0242] 1) a centromere, which is the site of kinetochore assembly and is responsible for the proper distribution of replicated chromosomes at cell division (i.e., mitosis and meiosis);
[0243] 2) two telomeres, the structures at the ends of a chromosome, which are needed to prevent the chromosome from being nibbled away by exonucleases;
[0244] 3) an origin of replication, also known as Autonomous Replication Sequences (ARS), which are the positions along the chromosome at which DNA replication initiates.
[0245] The construction of functional artificial chromosomes provides an alternate method for transforming cells. Artificial chromosome vectors can be constructed to include gene sequences capable of producing specific polypeptides, wherein the gene sequences can include extremely long stretches of exogenous DNA. Of course, selectable marker genes can also be included in such artificial chromosomes to aid in the selection of transformed cells.
[0246] Use of artificial chromosome recombinant molecules as vectors solves many of the problems associated with alternative transformation technologies which are used to introduce new DNA into higher eukaryotic cells. Since artificial chromosomes are maintained in the cell nucleus as independently replicating DNA molecules, sequences introduced on such vectors are not subject to the variable expression due to integration position effects. In addition, the delivery of artificial chromosomes to the nucleus of a cell as intact, unbroken, double-stranded DNA molecules with telomeric ends ensures that the introduced DNA can be maintained stably in that form and that rearrangements should not occur. Furthermore, artificial chromosome vectors will be stably maintained in the nucleus through meiosis and will be available to participate in homology-dependent meiotic recombination. Exogenous DNA introduced via artificial chromosome vectors can be delivered to practically any cell without host range limitations, in contrast to some other transformation methods such as the Agrobacterium-mediated DNA transfer systems.
[0247] Yeast Artificial Chromosomes
[0248] Yeast artificial chromosomes (YACs) are genetically engineered chromosomes that contain the essential DNA sequence elements of Saccharomyces and segments of exogenous DNAs that are much larger than those accepted by conventional cloning vectors.
[0249] YACs are generated from synthetic minichromosomes that contain a yeast centromere, a replication origin, and fused telomeres. The circular chromosome also contains three marker genes (m1, m2, and m3), which when expressed, allow selection of the cells carrying the plasmid and two specific sites (Burke et al, 1987). These two sites allow specific restriction endonucleases to break the molecule. Cleavage at one site opens the ring, while cleavage at the second site generates centric and acentric fragments with ends that will accept exogenous DNA fragments. Once these ends are ligated, an artificial chromosome is generated with a short and a long arm, with the long arm containing the spliced segment of exogenous DNA to be cloned. Such artificial chromosomes are distributed normally during subsequent yeast divisions creating colonies containing the YACs. In cells possessing the insert, the m1 and m3 markers are expressed, but the damaged M2 is not, allowing religated YACs to be distinguished from unbroken plasmids. For further descriptions of this process, see T. A. Brown, Gene Cloning, Second Edition, Chapman & Hall (1990), U.S. Pat. No. 4,889,806 and U.S. Pat. No. 5,270,201.
[0250] Telomeric fragments of human DNA, including the sequence for the human telomere, ranging in size from 50 to 250 kilobases have been cloned into Saccharomyces cerevisiae using YAC vectors (see, e.g., Riethman et al., 1989; Guerrini et al., 1990).
[0251] YAC vectors can be constructed according to the methods detailed in U.S. Pat. Nos. 4,889,806 and 5,270,201.
[0252] Yeast ARSs have not been found to replicate in filamentous fungi (Fincham, 1989).
[0253] Mammalian Artificial Chromosome
[0254] The controlled construction of mammalian artificial chromosomes (MACs) has been difficult because, with the exception of telomeres, the corresponding essential elements in mammals have not been fully defined. Higher eukaryotes (e.g., mammals), in contrast to yeast, contain repetitive DNA sequences which form a boundary at both sides of the centromere. This highly repetitive DNA interacting with certain proteins, especially in animal chromosomes, creates a genetically inactive zone (heterochromatin) around the centromere. This pericentric heterochromatin keeps any selectable marker gene at a considerable distance, and thus repetitive DNA prevents the isolation of centromeric sequences by chromosome “walking.” Alpha-satellite (alphoid) DNA forms a family of repeated DNA sequences found in amounts varying from 500 kb to 5 mb at the centromeres of human chromosomes. Alphoid sequences consist of a repeated 171 bp monomer that exhibits chromosome-specific variation in nucleotide sequence and higher order repeat arrangement.
[0255] U.S. Pat. No. 5,288,625 reports that a cell line which contains a dicentric chromosome, one of the centromeres of which contains a segment of human DNA, can be treated so as to isolate the centromere which contains the human DNA on a chromosome away from other mammalian chromosomes. Using a mouse lung fibroblast cell which contains such a dicentric chromosome wherein the centromere is linked to a dominant selectable marker (e.g., aminoglycoside-3′ phosphotransferease-II), the inventor was able to isolate derivative cell lines which stably replicated a chromosome containing only centromeres comprising cloned human DNA.
[0256] Harrington et al. (1997) have constructed stable human artificial chromosomes by cotransfecting large synthetic arrays of alphoid repeats, telomere repeats, and random genomic DNA fragments into human cultured cells. In general, the resultant minichromosomes acquired host sequences by means of either a chromosome truncation event or rescue of an acentric fragment, but in one case minichromosome formation was by a de novo mechanism. The inclusion of uncharacterized genomic DNA in the transfection mixture raises the possibility that sequences other than the transfected alphoid and telomere DNA contributed to chromosome formation.
[0257] To construct YAC-based mammalian artificial chromosomes, Ikeno et al. (1998) introduced telomere repeats and selectable markers into a 100 kb YAC containing human centromeric DNA. The resultant YAC, which has regular repeat sequences of alpha-satellite DNA and centromere protein B (CENP-B) boxes, efficiently formed MACs that segregated accurately and bound CENP-B, CENP-C, and CENP-E. The MACs appear to be about 1-5 Mb in size and contain YAC multimers. It is not known whether the MACs are linear or circular. The data from structural analyses of the MACs by FISH and Southern blot hybridization suggest that the introduced YAC DNA itself must have been multimerized by recombination and/or amplification.
EXAMPLES Example 1 Identification of a TERT Gene in Plasmodium falciparum[0258] Three segments of DNA containing portions of the putative P. falciparum TERT gene were identified by searching the Unfinished Microbial Genomes database (at the National Center for Biotechnology Information) via the “BLAST” algorithm.
[0259] Initially, the search utilized the following segment of the Schizosaccharomyces pombe TERT protein sequence in the region identified as the “T motif”: FFYITESSDLRNRTVYFRKDIW (SEQ ID NO.11) (Linger et al., 1997).
[0260] Two matches were found (FIG. 1):
[0261] 1. P. falciparum 3D7 unfinished sequence from chromosome 13 contig ID 41294 (3201 bp) from the Sanger Centre sequencing project; and
[0262] 2. P. falciparum unfinished sequence from chromosome 14 contig 5560 (8833 bp) at The Institute for Genomic Research (TIGR).
[0263] A third match was found by searching the database using the following portion of the S. pombe C. motif: LLRVVDDFLFITVNKKDAKKFLNLSLR (SEQ ID NO.12). The third clone was a 4190 bp contig from the Sanger Centre (P. falciparum 3D7 unfinished sequence from chromosome 13 contig 56572 (mal31p—02341) (FIG. 1).
[0264] We discovered that the P. falciparum TERT gene was embedded in larger segments of chromosomal sequence which had not in any way been recognized or identified by the
[0265] sequencing projects that deposited the data The first two contigs (nos. 13-41294 and 14-5560) overlap to create ˜10600 bp sequence including the entire putative P. falciparum TERT gene. The nucleotide sequence and corresponding amino acid sequence of the P. falciparum gene are presented in SEQ ID NO.5. The TERT protein sequence is provided in SEQ ID NO.6. The third contig (no. 13-56572) is a gene fragment that represents a second TERT gene in P. falciparum. Similarly, its nucleotide sequence and corresponding amino acid sequence appear in SEQ ID NOS. 7 and 8.
[0266] Sequence alignment of this ORF to TERT protein sequences of other organisms using Clustal® identified multiple regions of sequence similarity, showing that this protein is the P. falciparum TERT homolog (FIG. 2).
[0267] The Plasmodium protein sequence contains the canonical reverse transcriptase motifs 1, 2, A, B′, C, D and E, as well as the T motif possessed by all TERT proteins identified to date. The T motif in combination with the reverse transcriptase motifs has not been observed in any other proteins.
[0268] Variability exists for the amino acid sequence of the P. falciparum TERT gene. For example, we have found that residue 330 of SEQ ID NO.6 can also be Ile (i.e., CTA=Leu in contig 5560 and ATA=Ile in contig 41294) Additionally, we have found that residue 335 can also be Gly (i.e., GAT=Asp in contig 5560 and CTT=Gly in contig 41294). Other variations of SEQ ID NO.6 are certainly likely based on our findings and this invention encompasses all such natural and artificial variations in amino acid sequences as discussed herein.
Example 2 Reverse Transcription-PCR for Identified P. falciparum TERT Gene[0269] Total RNA prepared from P. falciparum was analyzed using reverse transcription coupled with the polymerase chain reaction (RT-PCR). DNA primers specific to the identified Plasmodium TERT gene were used to amplify two separate portions of the putative TERT mRNA. Control reactions were performed where reverse transcriptase was left out of the reaction to ensure signal did not arise from amplification of contaminating genomic DNA. See FIG. 3 and accompanying text for electrophoresis methods and results.
[0270] P. falciparum RT-PCR primers are as follows: 3 PfRT 5′ GTC ATC AAT AAA TCG GAG TAT GAG TG; (SEQ ID NO.32) pfTELfor 5′ TTC TAA CCA AAT CTG AGC; (SEQ ID NO.33) pfBREV 5′ TGC ATA ATA TAG GGA GCA C; (SEQ ID NO.34) pfRT2 5′ CTTTTGCCATTCTCATATGAATATAC; (SEQ ID NO.35) pfREV2 5′ ATTATTATGACGTGTGATG; (SEQ ID NO.36) pf2160 5′ CATATAATTACATCGAGG. (SEQ ID NO.37)
[0271] The RT-PCR process was repeated with two different primer sets amplifying different parts of the TERT gene. Results show that the TERT gene is indeed functional and not a pseudogene, as most transcribed protein genes are also translated into functional proteins.
Example 3 Identification of a Gene Fragment for a P. falciparum TERT Gene[0272] In addition to the full length P. falciparum TERT gene of SEQ ID NO.5, we have identified a TERT gene fragment which represents a second TERT gene in P. falciparum (SEQ ID NO.7).
[0273] Protein translation of the second TERT gene (794 amino acids, corresponding to amino acids 1392 to 2184 of full length P. falciparum TERT) shows that there are 9 base changes as compared to the full length TERT sequence, resulting in 7 amino acid changes (amino acid numbers refer to the full length sequence):
[0274] 1398 Ser to Gly
[0275] 1399 Val to Ala
[0276] 1614 Phe to Ser
[0277] 1777 Ile to Asn
[0278] 1870 Ser to Thr
[0279] 1884 Leu to Val
[0280] 1928 His to Gln.
Example 4 Identification of TERT Genes in Candida albicans[0281] A segment of DNA containing a potential Candida albicans TERT gene was identified by searching the Unfinished Microbial Genomes database (at the National Center for Biotechnology Information) via the “BLAST” algorithm. The search utilized a segment of the S. pombe TERT protein sequence in the region identified as the “T motif” (Nakamura et al., 1997) [sequence WLYNS . . . CRPFIT, SEQ ID NO.11] compared to the eukaryotes database with the Expect parameter at 100.
[0282] The third match, with a match score of 34, was contig 3-3463 from the C. albicans sequencing project at the Stanford Sequencing and Technology Center. Contig 3-3463 is a 11961 base pair genomic fragment.
[0283] By taking the complement of the strand as obtained from the database, base pairs 144-2747 of the contig form an open reading frame (ORF) of 867 amino acids.
[0284] Additional work demonstrated that there were two different genes within a single C. albicans cell that both coded for TERT genes. This is the first such report of two TERT genes within a single cell or for two different TERT genes identified in a single organism. The existence of two TERT genes suggests that they different functions.
[0285] The two C. albicans TERT genes differ at 12 base pairs, 7 that are silent, and 5 that cause amino acid changes. Additionally, there are 7 residues in each gene (amino acid positions #114, 452, 487, 538, 634, 735, and 856) that are encoded by a CTG (CUG) codon that would normally be Leu, but are Ser in Candida. C. albicans is one of several Candida species that have an unusual tRNA that charges Ser onto the tRNA that reads CUG codons.
[0286] The nucleotide sequences and corresponding amino acid sequences of the two C. albicans genes are presented in SEQ ID NOs: 1 and 3. The corresponding TERT protein sequences are provided in SEQ ID NOs: 2 and 4, respectively.
[0287] Sequence alignment of this ORF to TERT protein sequences of other organisms using Clustal® identified multiple regions of sequence similarity, showing that this protein is the Candida TERT homolog (FIG. 2).
[0288] The Candida protein sequence contains the canonical reverse transcriptase motifs 1,2, A, B′, C, D and E, as well as the T motif possessed by all TERT proteins identified to date. Besides these motifs, many other regions of sequence similarity are present between this and other TERT genes. The T motif in combination with the reverse transcriptase motifs has not been observed in any other proteins.
Example 5 Reverse Transcription-PCR for Identified C. albicans TERT Genes[0289] Total RNA prepared from log phase C. albicans cells was analyzed using reverse transcription coupled with the polymerase chain reaction (RT-PCR). DNA primers specific to the identified Candida TERT genes were used to amplify four separate portions of the TERT mRNA.
[0290] The QIAGEN® Genomic Tip-100 Kit was used for the genomic DNA isolation procedure. The protocol for yeast was utilized as set forth in the QIAGEN® handbooks and protocols for the use of the kits (http://www/qiagen.com/literature/handbooks/index.html; QIAGEN® Genomic DNA Handbook 9/97 (PDF version, 224 KB)).
[0291] Briefly, C. albicans is inoculated into 50 ml GYEP media (glucose 2%, peptone 1%, yeast extract 0.3%) and grown overnight at 37 C. with shaking. Cells are washed with buffer Y1 (1M sorbitol, 0.1 M EDTA, pH 7.4) and incubated with buffer Y1 plus 0.1%beta mercaptoethanol, 50 units lyticase (zymolase) per 107 cells for 1 h at 30 C. to break down cell walls. Spheroplasts are harvested by centrifugation at 300×g. The spheroplasts are then lysed, and run over the DNA binding columns, and the genomic DNA is washed on the column and eluted according to the manufacturer's instructions using the buffers provided by the manufacturer. C. albicans RTPCR primers: 4 CaRT1 CAGGGGGTATTGAAGAGATAGAAGCAGCG; (SEQ ID NO.13) CaFor1 TCGTTGTTATTCACGCGTATCG; (SEQ ID NO.14) CaNEST1 GCGACAATTGAGAGATATCGAG; (SEQ ID NO.15) CaRT2 GCACTTGATCATAAATATTCGAATCGGGGCG; (SEQ ID NO.16) CaFOR2 TTATGGAAAGAGCTATACG; (SEQ ID NO.17) CaNEST2 TGAGAATCCCTGAAACACG; (SEQ ID NO.18) CaRT3 CAATTTATGTGAACGCGTCCAACTGAGCGTAG; (SEQ ID NO.19) CaFOR3 GATACGACATTCTATATGC; (SEQ ID NO.20) CaNEST3 TCAATACAGGTTGGCTGAG; (SEQ ID NO.21)
[0292] We also used custom primers for sequencing the internal regions of the gene. They include the RTPCR primers listed above as well as the following: 5 CaFor480 5′TATTTCTGTTACTCGGACCA; (SEQ ID NO.22) CaFor1620 5′AGAGACTCCTTGTTAACC; (SEQ ID NO.23) CaFor1980 5′CAGTTAAAGATGCACGAGG; (SEQ ID NO.24) CaFor2310 5′TGAATAACAACAGATCTAAGC; (SEQ ID NO.25) CaFor2630 5′CAGCGACTGGGATGGTGC; (SEQ ID NO.26) CaRev290 5′ATTCTTGTGGTCGAATCGC; (SEQ ID NO.27) CaRev630 5′TAAAGCACATTGAATTTGG; (SEQ ID NO.28) CaRev1030 5′TAAATCATCCATATGTATC; (SEQ ID NO.29) CaRev1380 5′TAACACGAAAGCTCGAGCG; (SEQ ID NO.30) CaRev2340 5′AAACTTATCAGACCGGAG. (SEQ ID NO.31)
[0293] Control reactions were performed where reverse transcriptase was left out of the reaction to ensure signal did not arise from amplification of contaminating genomic DNA. See FIG. 4 and accompanying text for electrophoresis methods and results.
[0294] A second RT-PCR was conducted using four C. albicans RT-PCR reactions, controls, and the same reactions done in genomic DNA described above. See FIG. 5 for overview of the procedures and the resultant gel.
[0295] Results show that the TERT gene is indeed functional and not a pseudogene, as most transcribed protein genes are also translated into functional proteins.
Example 6 Identification of Two TERT Genes in Strain 3153 of C. albicans[0296] Two overlapping PCR products, P1 and P2, representing the entire coding region of the TERT gene, were amplified from genomic DNA from C. albicans strain 3153 (serotype A). P1 was amplified using primers CaRTfor1 and CaRT3, and P2 was amplified using primers CaFor2 and CaRT. The reaction conditions were 40 cycles of 1 min. at 94 C., 1 min. at 52 C. and 3 min. at 68 C., followed by a final 6 min incubation at 68 C. The resulting PCR products were gel purified and sequenced on both strands using internal primers specific to C. albicans strain 3153 (serotype A).
[0297] RT-PCR was used to produce four overlapping PCR products, P1, P2, P3 and P4. These are the same four products described in the RT-PCR experiment used to determine if the TERT gene is transcribed (see above). RT-PCR was performed using the Access RT-PCR kit (Promega®). For all RT-PCR reactions, a negative control was done (no reverse transcriptase added) to ensure that products were indeed amplified from RNA and not potential contaminating genomic DNA. The resulting PCR products were gel purified and sequenced on both strands using internal primers specific to the Candida albicans TERT twelve sites on the gene where the data was ambiguous. At these locations, electropherogram data from both strands showed two overlapping peaks, making identification of the proper nucleotide at that position impossible. This did not appear to be an artifact of the sequencing reactions, as data on both sides of the nucleotide in question was of high quality and unambiguous, with data on both strands in agreement as to the nucleotide sequence. Additionally, the same sites were identified as ambiguous in sequencing the genomic DNA PCR products and the RT-PCR products derived from the RNA.
[0298] Comparison of the PCR products derived from the genomic DNA and the total cellular RNA also proves that there are no intron sequences in the Candida TERT gene. To prove that the overlapping peaks on the sequencing electropherograms were due to simultaneous amplification of multiple sequences, three RT-PCR products, P1, P2 and P5 (amplified with primers Ca480For and CaRT2) were cloned into the pGEM-T vector and individual clones were sequenced. The three overlapping pieces were utilized because the entire gene could not be amplified by PCR in one piece. The three pieces, however, overlap significantly. Of the 2601 base pairs that comprise the coding region, P1 spans bases 1-1659, P2 spans bases 1108-2601 and PS spans bases 335-2047. Since only one amplicon is ligated into each vector, individual amplicons could be sequenced. Five P1, six P2 and two P5 clones were sequenced. At sites that had showed two overlapping base peaks on the electropherograms when PCR products were sequenced, clones would have either one or the other of the two bases. In this manner, the clones sorted into two classes, which when overlapped, generate the entire coding sequence of two genes, CaTERT1 and CaTERT2. These two genes differ at twelve positions, resulting in seven silent changes (that is, the two triplet codons designate the same amino acid) and five amino acid differences between the two proteins.
Example 7 Identification of Two TERT Genes in Strain 3153 of C. albicans[0299] The TERT gene of another Candida albicans strain, 9938, was also amplified in two overlapping PCR products, P1 and P2, as was done with strain 3153(A). The PCR products were sequenced on both strands in the same manner as strain 3153(A). The sequence data clearly indicates that this strain also has two TERT genes, which are different from the two TERT genes found in strain 3153(A) (SEQ ID NOs.1 and 3, respectively).
[0300] Of the twelve differing sites in 3153(A), three are unambiguous in the sequencing data for strain 9938, while four sites that are identical in both genes of strain 3153(A) appear to differ in the two genes of strain 9938.
[0301] The sequences of strain 9938 match those of SEQ ID NOs.1 and 3 for C. strain 3153(A) except for the following changes as indicated below:
[0302] 1. Position 1131 is always C, thus always Ser for the amino acid (rather than C or T in 3153A);
[0303] 2. Position 2185 is always A, thus always Thr for the amino acid (rather than A or C in 3153A);
[0304] 3. Position 2209 is always T (rather than T or C in 3153A). amino acid is identical either way;
[0305] 4. Position 2445, is either T or C (rather than always T in 3153A). Amino acid is Val or Asp (rather than always Val in 3153A);
[0306] 5. Position 2485 is either T or C (only T in 3153A). amino acid is Phe either way;
[0307] 6. Position 1927 is either T or C (only C in 3153A), amino acid is identical; and
[0308] 7. Position 2036 is either A or G (only G (Val) in 3153A). Amino acid is thus either Ile or Val.
Example 8 Identification of a TERT Gene Fragment in Oryza sativa[0309] A segment of DNA containing a potential Oryza sativa TERT gene was identified by first searching the Arabidopsis thaliana database (at the Stanford University DNA Sequence and Technology Development Center home page, www-sequence.stanford.edu) via the “BLAST” algorithm. The search utilized a segment of the Arabidopsis TERT protein sequence in the region identified as the “C motif” (sequence WLYNS . . . CRPFIT) compared to the higher plant sequence database with the Expect parameter at 100.
[0310] The second match, with a match score of 74, was accession number AQ510589 from the O. sativa sequencing project at Clemson University. AQ510589 is a 531 base pair genomic fragment.
[0311] The BAC containing the sequence fragment of interest was obtained from Clemson University and resequenced. The sequences of the primers used for this process are (Note: K is G+T): 6 Rice ep-2for: 5′ CCT KAA TAT TTK TTA ATK AKK; (SEQ ID NO.38) Rice er-rev 5′ KTC ATA CCT CKT ATA ATC AKC. (SEQ ID NO.39)
[0312] These primers are degenerate because they can also be used for Arabidopsis.
[0313] The nucleotide sequence and corresponding amino acid sequence of the O. sativa gene is presented in SEQ ID NO.9. The TERT protein sequence is provided in SEQ ID NO.10.
[0314] Sequence alignment of this ORF to the TERT protein sequence of Arabidopsis thaliana identified multiple regions of sequence similarity, showing that this protein is the O sativa TERT homolog (FIG. 6). The O. sativa protein sequence contains the canonical reverse transcriptase motifs C, D and E.
Example 9 Reverse Transcription-PCR for Identified O. sativa TERT Gene. Fragment[0315] Total RNA prepared from O sativa was analyzed using reverse transcription coupled with the polymerase chain reaction (RT-PCR) using the methods described above. DNA primers specific to the identified Oryza TERT gene were used to amplify separate portions of the putative TERT mRNA. Control reactions were performed where reverse transcriptase was left out of the reaction to ensure signal did not arise from amplification of contaminating genomic DNA.
[0316] Results show that the TERT gene fragment is indeed functional and not a pseudogene, as most transcribed protein genes are also translated into functional proteins.
Example 10 Use of the O. sativa TERT Gene Fragment as a Probe to Isolate TERT Genes from Plants[0317] The isolation of O. sativa TERT genes, TERT genes from other plant species, and related genes, such as TERT promoters, may be accomplished by a number of techniques. For instance, oligonucleotide probes based on the sequences disclosed herein can be used to identify the desired gene in a cDNA or genomic DNA library. To construct genomic libraries, large segments of genomic DNA are generated by random fragmentation, e.g. using restriction endonucleases, and are ligated with vector DNA to form concatemers that can be packaged into the appropriate vector. cDNA may be prepared from mRNA extracted from any rice cells in which TERT genes or homologs are expressed.
[0318] The cDNA or genomic library can then be screened using a probe based upon the rice TERT gene fragment of SEQ ID NO.9. Such a probe may include the entire sequence of SEQ ID NO.9 or a portion or fragment of this sequence. The probe may be used to hybridize with genomic DNA or cDNA sequences to isolate homologous genes in the same or different plant species.
[0319] Alternatively, the nucleic acids of interest can be amplified from nucleic acid samples using amplification techniques. For instance, polymerase chain reaction (PCR) technology to amplify the sequences of the TERT gene and related genes directly from genomic DNA, from CDNA, from genomic libraries or cDNA libraries. PCR and other in vitro amplification methods may also be useful, for example, to clone nucleic acid sequences that code for proteins to be expressed, to make nucleic acids to use as probes for detecting the presence of the desired mRNA in samples, for nucleic acid sequencing, or for other purposes.
[0320] Appropriate primers and probes for identifying TERT sequences from plant tissues are generated from comparisons of the sequences provided herein for rice. For a general review of PCR see Gelfand et al., 1990, PCR Protocals: A Guide to Methods and Applications (Academic Press, San Diego).
[0321] The foregoing detailed description has been given for clearness of understanding only and no unnecessary limitations should be understood therefrom as modifications will be obvious to those skilled in the art.
[0322] While the invention has been described in connection with specific embodiments thereof, it will be understood that it is capable of further modifications and this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure as come within known or customary practice within the art to which the invention pertains and as may be applied to the essential features hereinbefore set forth and as follows in the scope of the appended claims.
REFERENCES[0323] All references, articles, texts and patents referred to above and below are hereby incorporated by reference in their entirety.
[0324] Aldous, W. K, et al. Sep. 15, 1998. Stage specific detection and inhibition studies of Plasmodium falciparum telomerase. (Madigan Army Medical Center, Tacoma Wash.). Mol. Biochem. Parasitol. 95(2):281-5.
[0325] Ausubel et al. 1995. Current Protocols in Molecular Biology, Greene Publishing Co., NY.
[0326] Benito, E. P., Campuzano, V., Lopez-Matas, M. A., De Vicente, J. I., and Eslava, A. P. 1995. Isolation, characterization and transformation, by autonomous replication, of Mucor circinelloides OMPdecase-deficient mutants. Mol. Gen. Genet. 248: 126-135.
[0327] Blackburn, E. H. 1995. Developmentally Programmed Healing of Chromosomes. In Telomeres (E. H. Blackburn and C. W. Greider, Eds.). Cold Spring Harbor Laboratory Press. Cold Spring Harbor, N.Y.
[0328] Broach, J. R, Li, Y.-Y., Feldman, J., Jayaram, M., Abraham, J., Nasmyth, K. A., and Hicks, J. B. 1982. Localization and sequence analysis of yeast origins of DNA replication. Cold Spring Harbor Symp. Quant. Biol. 47: 1165-1174.
[0329] Burke et al. 1987. Construction of Large Linear Plasmid Library From Higher Eucaryote Genomes. J. Cell Biochem. Suppl. 11B.
[0330] Bryan, T. M. et al.. Jul. 21, 1998. Telomerase reverse transcriptase genes identified in Tetrahymena thermophila and Oxytricha trifallax. Proc. Natl. Acad. Sci. USA 95(15): 8479-84.
[0331] Bryan, T. M. and Cech, T. R. Jun. 1999. Telomerase and the maintenance of chromosome ends. Curr. Opin. Cell Biol. 11(3):318-24.
[0332] Cohn, M. and E. H. Blackburn. 1995. Telomerase in yeast. Science. 269:396-400.
[0333] Cooke, H. 1995. Non-programmed and Engineered Chromosome Breakage. In Telomeres (E. H. Blackburn and C. W. Greider, Eds.). Cold Spring Harbor Laboratory Press. Cold Spring Harbor, N.Y.
[0334] Fang, G. and Cech, T. R 1995. Telomere Proteins. In Telomeres (E. H. Blackburn and C. W. Greider, Eds.). Cold Spring Harbor Laboratory Press. Cold Spring Harbor, N.Y.
[0335] Fincham, J. R. S. 1989. Transformation in fingi. Microbiol. Rev. 53:148-170.
[0336] Gall, J. G. 1995. Beginning of the End: Origins of the Telomere Concept. In Telomeres (E. H. Blackburn and C. W. Greider, Eds.). Cold Spring Harbor Laboratory Press. Cold Spring Harbor, N.Y.
[0337] Greenberg, R. A. et al. Feb. 4, 1999. Telomerase reverse transcriptase gene is direct target of c-Myc but is not functionally equivalent in cellular transformation. Oncogene 18(5):1219-26,
[0338] Greider et al. 1990. Telomeres Telomerase and Senescence. Bio. Assays. 12(8):363-369.
[0339] Guerrini A. M., F. Ascenzioni, G. Pisani, G. Rappazzo, G. Della Valle, and P. Donini. 1990. Cloning a fragment from the telomere of the long arm of human chromosome 9 in a YAC vector. Chromosoma. 99(2):138-142.
[0340] Harrington, J. J., G. Van Bokkelen, R. W. Mays, K. Gustashaw, and H. F. Willard. 1997. Formation of de novo centromeres and construction of first-generation human artificial microchromosomes. Nat. Genet. 4:345-355.
[0341] Harley. 1991. Mutation Research. 256:271.
[0342] Henderson, E. 1995. Telomere DNA Structure. In Telomeres (Blackburn, E. H. and Greider, C. W., Eds.). Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
[0343] Holt, S. E. and Shay, J. W. July 1999. Role of telomerase in cellular proliferation and cancer. J. Cell Physiol. 180(1): 10-18.
[0344] Ikeno, M. B. Grimes, T. Okazaki, M. Nakano, K. Saitoh, H. Hoshino, N. McGill, H. Cooke, and H. Masumoto. 1998. Construction of YAC-based mammalian artificial chromosomes. Nature Biotechnology. 16:431-439.
[0345] Isaac, S. 1992. Fungal-Plant Interactions. Chapman & Hall, London, UK.
[0346] Ito, H., S. Kyo, T. Kanaya, M. Takakura, K. Koshida, M. Namiki and M. Inoue. 1998. Detection of human telomerase reverse transcriptase messenger RNA in voided urine samples as a useful diagnostic tool for bladder cancer. Clin. Cancer Res. 4(11):2807-10.
[0347] Kim, N. W. et al. 1994. Specific association of human telomerase activity with immortal cells and cancer. Science. 266:2011.
[0348] Kwon-Chun, K. August 1998. Gene disruption to evaluate the role of fungal candidate virulence genes. Curr. Opin. Microbiol. 1(4): 381-9.
[0349] Ligner, J. et al.. Apr. 25, 1997. Reverse transcriptase motifs in the catalytic subunit of telomerase. Science 276(5312):561-7.
[0350] Lundblad et al. 1990. RNA-dependent polymerase motifs in EST1: tentative identification of a protein component of an essential yeast telomere. Cell. 60:529-530.
[0351] Lundblad et al. 1993. An alternative pathway for yeast telomere maintenance rescues est1− senescence. Cell. 73:347-360.
[0352] Maniatis et al. 1982. Molecular Cloning, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
[0353] McCullough, M. J. et al. Apr. 1996. Candida albicans: a review of its history, taxonomy, epidemiology, virulence attributes, and methods of strain differentiation. Int. J. Oral Maxillofac. Surg. 25(2): 136-44.
[0354] McEachern et al. 1996. Cap-prevented recombination between terminal telomeric repeat arrays (telomere CPR) maintains telomeres in Kluyveromyces lactis lacking telomeres. Genes & Development. 10:1822-1834.
[0355] Murray et al. 1983. Nature. 301:189-193.
[0356] Nag Raj, T. R. 1993. Coelomycetous Anamorphs with Appendage-bearing Conidia. pp. 618-671. Mycologue Publications, Waterloo, Ontario.
[0357] Nakamura, T. M. et al.. Aug. 15, 1997. Telomerase catalytic subunit homologs from fission yeast and human. Science 299(5328):955-9.
[0358] Raymond, E. et al. Dec. 1996. Agents that target telomerase and telomeres. Curr. Opin. Biotechnol. 7(6):583-91.
[0359] Riethman, H. C., R. K. Moyzis, J. Meyne, D. T. Burke, and M. V. Olson. 1989. Cloning human telomeric DNA fragments into Saccharomyces cerevisiae using a yeast-artificial-chromosome vector. Proc. Natl. Acad. Sci. 86(16):6240-6244.
[0360] Sambrook, J., Fritsch, E. F., and Maniatis, T. 1989. Molecular Cloning: a Laboratory Manual, 2nd ed. Cold Spring Harbor Laboratory Press. Cold Spring Harbor, N.Y.
[0361] Smith, T. L., Gaskell, J., Berka, R. M., Yang, M., Henner, D. J., and Cullen, D. 1990. The promoter of the glucoamylase-encoding gene of Aspergillus niger functions in Ustilago maydis. Gene 88: 259-262.
[0362] Tsao, D. A., C. W. Wu and Y. S. Lin. 1998. Molecular cloning of bovine telomerase RNA. Gene 221(1):51-8.
[0363] Wang et al. 1990. Telomere-telomere recombination provides an express pathway for telomere acquisition. Nature. 345:455-460.
[0364] Williamson, J. R., Raghuraman, M. K., and Cech, T. R. 1989. Monovalent cation-induced structure of telomeric DNA: The G-quartet model. Cell 59: 871-880.
[0365] Cong, Y. S., J. Wen and S. Bacchetti. 1999. The human telomerase catalytic subunit hTERT: organization of the gene and characterization of the promoter. Hum. Mol. Genet. 8(1):137-42.
[0366] Woods, J. P. and Goldman, W. E. 1992. In vivo generation of linear plasmids with addition of telomeric sequences by Histoplasma capsulatum. Mol. Microbiol. 6: 3603-3610.
[0367] Woods, J. P. and Goldman, W. E. 1993. Autonomous replication of foreign DNA in Histoplasma capsulatum: role of native telomeric sequences. J. Bacteriol. 175: 636-641.
[0368] World Health Organization. Revised October 1998. Fact Sheet No 94. Malaria.
[0369] Wu, K. J., C. Grandori, M. Amacker, N. Simon-Vermot, A. Polack, J. Lingner and R. Dalla-Favera. 1999. Direct activation of TERT transcription by c-MYC. Nat. Genet. 21(2):220-4.
[0370] Yasui, W., H. Tahara, E. Tahara, J. Fujimoto, J. Nakayama, F. Ishikawa, T. Ide and E. Tahara. 1998. Expression of telomerase catalytic component, telomerase reverse transcriptase, in
[0371] human gastric carcinomas. Jpn. J. Cancer Res. 89(11):1099-103.
[0372] Zakian, V. A. 1997. Life and cancer without telomerase. Cell. 91:1-3.
Claims
1. An isolated nucleic acid molecule selected from the group consisting of: (a) an isolated nucleic acid molecule that encodes the amino acid sequence of SEQ ID NO.2, SEQ ID NO.4, SEQ ID NO.6, SEQ ID NO.8 or SEQ ID NO.10; (b) an isolated nucleic acid molecule that encodes a fragment of at least 6 amino acids of SEQ ID NO.2, SEQ ID NO.4, SEQ ID NO.6, SEQ ID NO.8 or SEQ ID NO.10; (c) an isolated nucleic acid molecule which hybridizes to the complement of a nucleic acid molecule comprising SEQ ID NO.1, SEQ ID NO.3, SEQ ID NO.5, SEQ ID NO.7 or SEQ ID NO.9 under conditions of sufficient stringency to produce a clear signal; and (d) an isolated nucleic acid molecule which hybridizes to a nucleic acid molecule that encodes the amino acid sequence of SEQ ID NO.2, SEQ ID NO.4, SEQ ID NO.6, SEQ ID NO.8 or SEQ ID NO.10 under conditions of sufficient stringency to produce a clear signal.
2. The isolated nucleic acid molecule of claim 1, wherein the nucleic acid molecule comprises the sequence of SEQ ID NO.1, SEQ ID NO.3, SEQ ID NO.5, SEQ ID NO.7 or SEQ ID NO.9.
3. The isolated nucleic acid molecule of claim 2, wherein the nucleic acid molecule consists of the sequence of SEQ ID NO.1, SEQ ID NO.3, SEQ ID NO.5, SEQ ID NO.7 or SEQ ID NO.9.
4. The isolated nucleic acid molecule of any one of claims 1-3, wherein said nucleic acid molecule is operably linked to one or more expression control elements.
5. A vector comprising an isolated nucleic acid molecule of any one of claims 1-3.
6. A host cell transformed to contain the nucleic acid molecule of any one claims 1-3.
7. A host cell comprising a vector of claim 5.
8. A method for producing a polypeptide comprising the step of culturing a host cell transformed with the nucleic acid molecule of any one of claims 1-3 under conditions in which the protein encoded by said nucleic acid molecule is expressed.
9. An isolated polypeptide produced by the method of claim 8.
10. An isolated polypeptide selected from the group consisting of: (a) an isolated polypeptide comprising the amino acid sequence of SEQ ID NO.2, SEQ ID NO.4, SEQ ID NO.6, SEQ ID NO.8 or SEQ ID NO.10; (b) an isolated polypeptide comprising a fragment of at least 6 amino acids of SEQ ID NO.2, SEQ ID NO.4, SEQ ID NO.6, SEQ ID NO.8 or SEQ ID NO.10; (c) an isolated polypeptide comprising conservative amino acid substitutions of SEQ ID NO.2, SEQ ID NO.4, SEQ ID NO.6, SEQ ID NO.8 or SEQ ID NO.10; and (d) naturally occurring amino acid sequence variants of SEQ ID NO.2, SEQ ID) NO.4, SEQ ID NO.6, SEQ ID NO.8 or SEQ ID NO.10.
11. An isolated antibody that binds to a polypeptide of either claim 9 or 10.
12. The antibody of claim 11 wherein said antibody is a monoclonal or polyclonal antibody.
13. A method of identifying an agent which modulates the expression of a nucleic acid encoding the protein having the sequence of SEQ ID NO.2, SEQ ID NO.4, SEQ ID NO.6, SEQ ID NO.8 or SEQ ID NO.10 comprising the steps of:
- exposing cells which express the nucleic acid to the agent; and
- determining whether the agent modulates expression of said nucleic acid, thereby identifying an agent which modulates the expression of a nucleic acid encoding the protein having the sequence of SEQ ID NO.2, SEQ ID NO.4, SEQ ID NO.6, SEQ ID NO.8 or SEQ ID NO.10.
14. A method of identifying an agent which modulates at least one activity of a protein comprising the sequence of SEQ ID NO.2, SEQ ID NO.4, SEQ ID NO.6, SEQ ID NO.8 or SEQ ID NO.10 comprising the steps of:
- exposing cells which express the protein to the agent;
- determining whether the agent modulates at least one activity of said protein, thereby identifying an agent which modulates at least one activity of a protein comprising the sequence of SEQ ID NO.2, SEQ ID NO.4, SEQ ID NO.6, SEQ ID NO.8 or SEQ ID NO.10.
15. A method of identifying binding partners for a protein comprising the sequence of SEQ ID NO.2, SEQ ID NO.4, SEQ ID NO.6, SEQ ID NO.8 or SEQ ID NO.10, comprising the steps of:
- exposing said protein to a potential binding partner; and
- determining if the potential binding partner binds to said protein, thereby identifying binding partners for a protein comprising the sequence of SEQ ID NO.2, SEQ ID NO.4, SEQ ID NO.6, SEQ ID NO.8 or SEQ ID NO.10.
16. A method of modulating the expression of a nucleic acid encoding the protein having the sequence of SEQ ID NO.2, SEQ ID NO.4, SEQ ID NO.6, SEQ ID NO.8 or SEQ ID NO.10 comprising the step of:
- administering an effective amount of an agent which modulates the expression of a nucleic acid encoding the protein having the sequence of SEQ ID NO.2, SEQ ID NO.4, SEQ ID NO.6, SEQ ID NO.8 or SEQ ID NO.10.
17. A method of modulating at least one activity of a protein comprising the sequence of SEQ ID NO.2, SEQ ID NO.4, SEQ ID NO.6, SEQ ID NO.8 or SEQ ID NO.10 comprising the step of:
- administering an effective amount of an agent which modulates at least one activity of a protein comprising the sequence of SEQ ID NO.2, SEQ ID NO.4, SEQ ID NO.6, SEQ ID NO.8 or SEQ ID NO.10.
18. A method for diagnosing Plasmodium falciparum infection in a patient comprising the steps of:
- obtaining a cell sample from the patient;
- determining whether the nucleic acid of SEQ ID NO.5 or SEQ ID NO.7 or the protein of SEQ ID NO.6 or SEQ ID NO.8 is present within the cell sample; and
- correlating the presence of the nucleic acid of SEQ ID NO.5 or SEQ ID NO.7 or the protein of SEQ ID NO.6 or SEQ ID NO.8 with the presence of Plasmodium falciparum.
19. A method for diagnosing Candida albicans infection in a patient comprising the steps of:
- obtaining a cell sample from the patient;
- determining whether the nucleic acid of SEQ ID NO.1 or SEQ ID NO.3 or the protein of SEQ ID NO.2 or SEQ ID NO.4 is present within the cell sample; and
- correlating the presence of the nucleic acid of SEQ ID NO.1 or SEQ ID NO.3 or the protein of SEQ ID NO.2 or SEQ ID NO.4 with the presence of Candida albicans.
Type: Application
Filed: Nov 26, 2002
Publication Date: Jul 17, 2003
Applicant: Montana State University
Inventors: David M. Long (Livingston, MT), Anneke M. Metz (Bozeman, MT), Ruschelle A. Love (Bozeman, MT)
Application Number: 10304095
International Classification: C12Q001/70; C07H021/04; C12Q001/68; C12N009/22; C12P021/02; C12N005/06;