ARTIFICIAL RIBOSWITCH FOR CONTROLLING PRE-MRNA SPLICING
The present invention relates to riboswitches that have been engineered to regulate pre-mRNA splicing. In particular, the insertion of a high affinity theophylline binding aptamer into the 3′ splice site region, 5′ splice site region, or branchpoint sequence (BPS) of a pre-mRNA modulates RNA splicing in the presence of theophylline. Accordingly, the aspects of the present invention include, but are not limited to, theophylline-dependent riboswitches which modulate RNA splicing, methods of modulating RNA splicing using theophylline and its corresponding riboswitches, methods of improving/identifying theophylline-dependent riboswitches, methods of treating diseases associated with or caused by abnormal RNA splicing.
The present application claims priority to U.S. Provisional Application No. 60/686,838, filed Jun. 1, 2005, the disclosure of which is incorporated by reference herein in its entirety.
GOVERNMENT INTERESTThis invention was made with government support in part by the Department of Defense, Grant Number BC023235. The government may have certain rights in this invention.
BACKGROUNDThe vast majority of structural genes in higher eukaryotes contain intervening sequences (introns) whose precise removal from the mRNA precursors (pre-mRNAs) is essential for proper gene expression. Excision of introns from nuclear pre-mRNAs is catalyzed by the spliceosome, perhaps the most complex ribonucleoprotein (RNP) assembly in the cell (Nilsen, 2003). A number of RNA-RNA and RNA-protein interactions involving five small nuclear RNAs (U1, U2, U4, U5 and U6) and many snRNP and non-snRNP proteins mediate the removal of introns and joining of exons (Kramer, 1996; Moore et al., 1993; Newman, 1994; Nilsen, 2003; Will and Luhrmann, 1997).
Pre-mRNAs are spliced in a two-step pathway involving two sequential transesterification reactions. In the first step, pre-mRNA is cleaved at the 5′ splice site simultaneously generating two splicing intermediates: a linear first exon RNA, and an intron-second exon RNA in a lariat configuration. In the second step, the 3′-hydroxyl group of the last nucleotide in the first exon makes a nucleophilic attack at the phosphodiester bond separating the intron and the second exon (3′ splice site) enabling the joining of two exons and the release of the intron as a lariat (Kramer, 1996; Moore et al., 1993; Newman, 1994; Nilsen, 2003; Will and Luhrmann, 1997).
In higher eukaryotes, three distinct sequences direct the splicing reaction: the 5′ splice site (/GURAGY), the branchpoint sequence (BPS) (YNYURAC), and the 3′ splice site (YAG/), where a slash (/) denotes a splice site, N denotes any nucleotide, R denotes purine, Y denotes pyrimidine, and underlining indicates the conserved nucleotide. During the early stages of the spliceosome assembly the 5′ and the 3′ end of the intron are recognized by intermolecular base pairing between U1 snRNA and the 5′ splice site (Seraphin et al., 1988; Siliciano and Guthrie, 1988; Zhuang and Weiner, 1986) and by the binding of U2AF to the poly(Y) tract/3′ ss AG (Merendino et al., 1999; Ruskin et al., 1988; Wu et al., 1999; Zamore et al., 1992; Zorio and Blumenthal, 1999), respectively. Later in the spliceosome assembly, U1 snRNA-5′ splice site base pairing is disrupted and the 5′ splice site is bound by U6 snRNA (Kandels-Lewis and Seraphin, 1993; Konforti et al., 1993; Lesser and Guthrie, 1993; Sawa and Abelson, 1992; Sawa and Shimura, 1992; Sontheimer and Steitz, 1993; Wassarman and Steitz, 1992). The branchpoint adenosine is selected in part by intermolecular base pairing between the BPS and U2 snRNA, and the RS domain of U2AF65 stabilizes this interaction (Gaur et al., 1995; Valcarcel et al., 1996). Recently, a one-step assembly of the spliceosome has also been reported (Malca et al., 2003; Stevens et al., 2002).
Pre-mRNAs can also undergo alternative splicing to generate variant mRNAs with diverse and often antagonistic functions (Black, 2003; Clayerie, 2001; Graveley, 2001; Smith and Valcarcel, 2000). Alternative splicing of pre-mRNA is now recognized as the most important source of protein diversity in vertebrates (Maniatis and Tasic, 2002; Mironov et al., 1999; Roberts and Smith, 2002; Thanaraj et al., 2004). It has been estimated that 35-60% of human genes generate transcripts that are alternatively spliced (Johnson et al., 2003; Mironov et al., 1999), and 70-90% of alternative splicing decisions result into the generation of proteins with diverse functions ranging from sex determination to apoptosis (Black, 2003; Kan et al., 2001; Modrek et al., 2001). Importantly, the defective regulation of splice variant expression has been identified as the cause of several genetic disorders (Dredge et al., 2001; Faustino and Cooper, 2003; Garcia-Blanco et al., 2004; Hull et al., 1993; Nissim-Rafinia and Kerem, 2002; Pagani and Baralle, 2004; Phillips and Cooper, 2000), and certain forms of cancer have been linked to unbalanced isoform expression from genes involved in cell cycle regulation or angiogenesis (Krajewska et al., 1996a; Krajewska et al., 1996b; Novak et al., 2001; Steinman et al., 2004; Venables, 2004; Xerri et al., 1996). Therefore, development of tools that could control pre-mRNA splicing may have far-reaching effects in biotechnology and medicine.
Initial efforts aimed at controlling pre-mRNA splicing exploited the intrinsic property of nucleic acids to bind specific complementary pre-mRNA sequence and inhibit/modulate splicing (Dominski and Kole, 1993). However, susceptibility of antisense oligonucleotides to nuclease digestion, off-target effects, and problems associated with the delivery and localization led to the realization that better methods are needed (Heidenreich et al., 1995). Bifunctional molecules that act like an antisense oligonucleotide, but carry the binding site for a known splicing factor have proved to be useful in reprogramming pre-mRNA splicing (Cartegni and Krainer, 2003; Eperon and Muntoni, 2003; Skordis et al., 2003; Villemaire et al., 2003). Although bifunctional molecules have overcome some of the problems associated with antisense-based approach, the need to include various chemical modifications limit their utility.
Notably, all of the above mentioned approaches function in a constitutive manner, i.e., an antisense oligonucleotide or a bifunctional molecule directed to inhibit the splicing will continue to do so as long as the oligonucleotide is available. Given that splicing of many pre-mRNAs is regulated in a tissue or development specific manner (Black, 2003; Lopez, 1998), to be able to switch off/on the splicing would be of broad application in gene-based therapy and functional genomics. Although a recently reported small molecule-based approach, which could activate splicing by simultaneously binding to a protein containing the splicing activation domain and a second protein bound to the pre-mRNA has the potential to act as a splicing switch, expression of heterologous proteins and maintaining small molecule-protein interplay makes this approach complicated (Graveley, 2005).
Accordingly, there is a need to develop novel approaches to regulate RNA splicing or alternative RNA splicing in a condition-specific manner.
SUMMARYOne aspect of the present invention relates to artificial riboswitches that specifically regulate the splicing of their cognate pre-mRNA in the presence of a condition that may affect or bind to the riboswitches. For example, one embodiment of the invention relates to artificial riboswitches that show affinity to, or are regulated by, theophylline (Jenison et al., 1994), wherein the theophylline-dependent or theophylline binding riboswitches regulate RNA splicing in the presence of theophylline.
Another aspect of the present invention relates to methods of regulating (e.g., inhibiting or inducing) the splicing of a pre-mRNA (e.g., AdML-Theo29AG, SEQ ID NO: 6) in a theophylline-dependent manner, wherein the 3′ splice site AG is embedded within the theophylline binding aptamer. In one embodiment, the BPS-to-3′ splice distance as well as the location of the 3′ splice site AG within the aptamer is designed such that it confers theophylline-dependent control of RNA splicing. In a preferred embodiment, the distance between BPS and 3′ splice site AG is between 21 to 39 nucleotides (e.g., 29) starting from the C of the BPS and ending with the G of the 3′ splice site. In another preferred embodiment, the pre-mRNA splicing can be regulated in vitro, in vivo, or ex vivo. It is noted that theophylline mediated control of pre-mRNA splicing is specific. First, theophylline specifically blocks the step II of the splicing. Second, a small molecule ligand similar in shape and size of theophylline has no effect on the splicing of pre-mRNAs modulated by theophylline. Third, theophylline fails to exert any influence on the splicing of a pre-mRNA that does not contain its binding site (aptamer). Finally, theophylline-dependent modulation of pre-mRNA splicing is functionally relevant.
Another aspect of the present invention relates to methods of optimizing the BPS-to-3′ splice distance so that theophylline can effectively modulate the pre-mRNA splicing. The method comprises the steps of generating riboswitches of various distance between the BPS and the 3′ splice (AG), measuring the effect of theophylline on RNA splicing in a pre-mRNA containing the riboswitches.
Another aspect of the present invention relates to methods of modifying theophylline-dependent aptamers so that the aptamers' affinity to theophylline can be modified (e.g., improved). The method comprises the steps of modifying nucleotides in a theophylline-dependent aptamer, designing pre-mRNA embedding the modified aptamer, and determining the level of RNA splicing.
Another aspect of the present invention relates to methods of identifying aptamers that bind to theophylline, preferably at physiological Mg2+ concentration. The method comprises the steps of designing an aptamer and testing the aptamer's affinity to theophylline.
Another aspect of the present invention relates to methods of developing theophylline-dependent bifunctional molecules which can regulate pre-mRNA splicing. The method comprises the steps of designing a bifunctional molecule, where the molecule comprises an antisense domain to an exonic splicing enhancer and a theophylline aptamer; wherein the binding of the antisense domain to the exonic splicing enhance reduces RNA splicing and the introduction of theophylline to a splicing reaction inhibits the binding of the antisense domain to the exonic splicing enhancer. In one embodiment, the stability of a bifunctional molecule may be improved by using phosphorothioate or 2′ modified nucleotides.
Another aspect of the present invention relates to bimolecular allosteric hammerhead molecules, which are able to regulate pre-mRNA splicing in a theophylline-dependent manner.
Another aspect of the present invention relates to methods of identifying theophylline-like compounds or test agents. In one embodiment, the method comprises the steps of providing a pre-mRNA containing a theophylline-dependent aptamer wherein the splicing of the pre-mRNA is regulated in the presence of theophylline; contacting a test agent with the pre-mRNA; and determining the level of pre-mRNA splicing in the presence of the agent relative to the absence of the agent. In another embodiment, the method comprises the steps of providing a cell or a subject containing a pre-mRNA comprising a theophylline-dependent aptamer wherein the splicing of the pre-mRNA is regulated in the presence of theophylline, contacting the cell or the subject with a test agent, and determining the level of pre-mRNA splicing in the presence of the agent relative to the absence of the agent.
Another aspect of the present invention relates to methods of modulating RNA splicing in a subject using theophylline and a theophylline-dependent riboswitch. The method comprises the steps of introducing into a subject a pre-mRNA containing a theophylline-dependent riboswitch, contact the subject with theophylline, examining the modulation of pre-mRNA splicing in the presence of theophylline.
Another aspect of the present invention relates to methods of placing or inserting a theophylline aptamer into the 5′ splice site and determining whether a theophylline-dependent riboswitch would modulate the 5′ splice site choice in the presence of theophylline. Another aspect of the present invention relates to methods of modulating RNA splicing comprising the steps of inserting a theophylline aptamer into the 5′ splice site and modulating pre-mRNA splicing in the presence of theophylline.
Another aspect of the present invention relates to methods of placing or inserting a theophylline aptamer into the BPS and determining whether a theophylline-dependent riboswitch would modulate pre-mRNA splicing in the presence of theophylline. Another aspect of the present invention relates to methods of modulating RNA splicing comprising the steps of inserting a theophylline aptamer into the BPS and modulating pre-mRNA splicing in the presence of theophylline.
Another aspect of the present invention relates to methods of treating a disease associated with abnormal RNA splicing or a fragment of mutated gene using a theophylline dependent aptamer. In one embodiment, a vector containing the complementary sequence of a theophylline dependent aptamer is introduced into a cell or a subject. The vector may be transcribed to a pre-mRNA and the splicing of the pre-mRNA is dependent on the presence of theophylline. Theophylline or a theophylline-like agent is contacted with or administered to the cell or subject and regulates the splicing of the pre-mRNA. Consequently, abnormal RNA splicing is corrected or inhibited in the presence of theophylline.
One aspect of the present invention relates to artificial riboswitches that specifically regulate the splicing of its cognate pre-mRNA in the presence of a condition (e.g., a ligand or a molecule) that triggers the modulation of RNA splicing.
The term “riboswitch” used herein refers to a fragment of nucleic acids inserted by or linked with an aptamer such that the binding of an aptamer-specific ligand or molecule to the aptamer would affect the activity of the fragment. One example of a riboswitch contains a sequence 3′ to the BPS, which comprises a poly pyrimidine sequence, the 3′ splice site, and an aptamer that is inserted or linked to the 3′ splice site region in a way that the pre-mRNA splicing is affected or modulated in the presence of a ligand or molecule specific to the aptamer. Another example of a riboswitch contains a sequence 5′ to the BPS, wherein the sequence comprises an aptamer that is associated with (e.g., inserted or linked to) to the 5′ splice site in a way that the pre-mRNA splicing is affected or modulated in the presence of a ligand or molecule specific to the aptamer. Yet another example of a riboswitch contains a modified BPS, wherein an aptamer is associated with (e.g., inserted or linked to) the BPS in such a way that pre-mRNA splicing is affected or modulated in the presence of a ligand or molecule specific to the aptamer.
The “aptamer” used herein refers to a fragment (or a domain) of nucleic acid sequence that selectively binds to a ligand or molecule. The introduction of a ligand to a ligand-specific aptamer causes conformational changes within the aptamer and influences nucleic acids adjacent to the aptamer.
In one embodiment of the present invention, a riboswitch contains a theophylline-dependent aptamer with a nucleic acid sequence of AUACCAGCCGAAAGGCCCUUGGCAG (SEQ ID NO: 10) and a ligand is theophylline (
A number of ligands such as tobramycin (Wang and Rando, 1995), neomycin (Wallis et al., 1995), ATP (Sassanfar and Szostak, 1993), FMN (Burgstaller and Famulok, 1994) and theophylline (Jenison et al., 1994) have been shown to bind RNAs that were evolved by in vitro selection (Joyce, 1994). All of these ligands meet some of the above mentioned criteria (e.g., the first three requirements). However, since both ATP and FMN are cellular components, and ATP is required for in vitro splicing, a system based on these two molecules might interfere with splicing regulation. To assess the suitability of ligands, the splicing of pre-mRNA not having ligand-dependent aptamer (e.g., AdML-21AG pre-mRNA (Chua and Reed, 2001)) is examined in the presence of these ligands. As a result, theophylline (
Accordingly, examples of riboswitches include but are not limited to, for instance:
7) AC(Y)nN1N2N3N4AUACCAGCCGAAAGGCCCUUGGCAGN′4N3N′2N′1, n ranges from 11 to 27, N1-N4 each denote any nucleotide, N′1-N′4 are complementary to N1-N4, respectively (SEQ ID NOs: 7);
8) AC(U)nNNNNAUACCAGCCGAAAGGCCCUUGGCAGN′N′N′N′, n ranges from 11 to 27, N is any nucleotide, N′ is complementary to N (SEQ ID NOs: 8);
9) AC(Y)nNNNNAUACCAGCCGAAAGGCCCUUGGCAGN′N′N′N′, n ranges from 19 to 23, N is any nucleotide, N′ is complementary to N (SEQ ID NOs: 9).
As shown below, theophylline mediated inhibition of AdML-Theo29AG (SEQ ID NO: 6) splicing is highly specific: First, theophylline inhibits the splicing of AdML-Theo29AG by blocking the step II of the splicing. Second, a molecule similar in shape and size to theophylline failed to elicit any effect on its splicing. Third, the splicing of a pre-mRNA that does not contain appropriately placed theophylline-binding aptamer remained unaffected in the presence of theophylline. Finally, insertion of theophylline aptamer 8 and 10 nucleotides downstream of the 3′ or 5′ splice site, respectively failed to elicit any effect on the splicing.
However, the introduction or insertion of theophylline-dependent aptamer at the 3′ splice site does not necessarily confer theophylline-dependent regulation of pre-mRNA splicing. Distance as well as the location of 3′ splice site AG plays an important role in conferring theophylline-dependent regulation of splicing. To investigate whether formation of RNA-theophylline complex affects pre-mRNA splicing, a derivative of AdML Par pre-mRNA (Gozani et al., 1994) designated AdML-Theo39AG, that has a theophylline aptamer sequence 3′ adjacent to the poly (Y) tract was used (
To analyze in vitro splicing, 32P-labeled RNAs were incubated in HeLa nuclear extract under standard conditions that support splicing (Gaur et al., 1995). After incubation, the splicing reaction was terminated and products were fractionated by electrophoresis on a 13% denaturing polyacrylamide gel. The wild type substrate, as expected, underwent both steps of the splicing reaction with normal kinetics, as evidenced by the presence of lariat containing RNAs and spliced mRNA (
To rule out the possibility that the observed step II splicing inhibition in AdML-Theo39AG might be due to a higher order structure formed by the presence of aptamer sequence, a derivative of human β-globin pre-mRNA (Hβ-Theo41AG) in which the 3′ splice site AG is engineered to be the part of the theophylline binding sequence was constructed. The in vitro splicing of Hβ-Theo41AG pre-mRNA also resulted in the inhibition of the step II of the splicing.
It has been previously shown that pre-mRNA derivatives bearing mutations of the splice sites (Aebi et al., 1986; Lamond et al., 1987; Newman et al., 1985; Ruskin and Green, 1985; Seraphin and Rosbash, 1990) or the branchpoint (Freyer et al., 1987; Gaur et al., 1997; Hornig et al., 1986; Query et al., 1994) can undergo the first step of the splicing, giving rise to a lariat-exon 2 intermediate that is blocked for the second step. To examine whether mutation of the splice sites or branch point might be the cause of step II splicing inhibition, AdML-Theo39AG substrate was subjected to reverse transcription and PCR. The amplified DNA was cloned into pCR2.1 vector using a TA cloning kit according to the instructions provided by the manufacturer (Invitrogen). Sequencing of 20 randomly selected clones revealed no mutations, suggesting that a mutation of the splice sites or the branchpoint is not the cause of step II splicing inhibition.
To further investigate why AdML-Theo39AG pre-mRNA failed to undergo the second step of the splicing, we examined the 3′ half of the intron. As illustrated in
To determine whether the aforementioned reasons could be the cause of step II splicing inhibition, an AdML derivative with BPS-to-AG distance of 29 nucleotides and the sequence between the poly(Y) tract and AG bearing the substitutions of cytidine for guanosine was synthesized (
Although lowering of BPS-to-AG distance from 39 to 29 nucleotides has relieved step II splicing inhibition in the absence of theophylline, yet compared to the parent substrate the efficiency of the second step of splicing of AdML-Theo-29AG remains low (
The in vitro splicing of AdML-Theo-27AG pre-mRNA demonstrates that lowering of BPS-to-AG distance by 2 nucleotides not only failed to improve the efficiency of the second step of splicing any further (
These results can be explained in terms of the location of the 3′ ss AG. In AdML-Theo-29AG, the AG proximal to the BPS is “buried” inside the theophylline-RNA complex, which makes its accessibility to the spliceosome as a 3′ acceptor site difficult. This interpretation is in general agreement with the NMR structure of theophylline in complex with its aptamer, which revealed that A28 (the adenine of 3′ ss AG) participates in multiple interactions involving G29 and G43 (
The selection and activation of AG as a 3′ splice site is a complex phenomenon in which several step II splicing factors make functionally important contacts near the 3′ end of the intron (Chiara et al., 1997; van Nues and Beggs, 2001 and references there in). The results presented in the previous section strongly suggest that sequestering of the AG within the theophylline-RNA complex prevent such protein-RNA contact(s). If that is true, then relocation of theophylline aptamer to a position that has no apparent contribution in the selection and activation of AG will have no effect on the splicing.
To test this hypothesis, we decided to synthesize an AdML pre-mRNA derivative, termed AdML-TheoExon 2, in which the theophylline-binding site was moved eight nucleotides downstream of the 3′ ss (
It has been previously shown that in vitro, spliceosome assembly on pre-mRNA can proceed through one-step assembly (Malca et al., 2003; Stevens et al., 2002), or via a coordinated assembly of complexes E→A→B→C with the catalytic steps of splicing occurring in the complex C (Reed and Palandjian, 1997). In addition, the efficiency of the spliceosome assembly and the intermediate steps can be monitored by native gel electrophoresis (Konarska and Sharp, 1986).
To investigate the effect of theophylline on spliceosome assembly, 32P-labeled AdML-Theo-29AG pre-mRNA was incubated under splicing conditions in the absence or presence of theophylline. Aliquots were removed at various time points, followed by the separation of complexes on native agarose gels according to the published protocol (Das and Reed, 1999). In the absence of theophylline, complex A was detected as early as 5 min and converted into B/C complex thereafter. Complex B/C appeared after 5 min and peaked between 15-30 min, and after 30 min declined steadily. In the presence of theophylline, the kinetics of complexes A and B/C formation is not very different; complex A appeared at 5 min and decreased thereafter. However, the amount of complexes B/C steadily accumulated (
It is noted that the theophylline-mediated control of pre-mRNA splicing is highly specific. The extraordinary ability with which the splicing regulators discriminate between a specific and a non-specific RNA target play a critical role in the precise regulation of pre-mRNA splicing. For example, both U2AF65 (Zamore et al., 1992) and Sxl (Sakamoto et al., 1992) are poly(Y) tract binding proteins and yet, they utilize different mechanisms (Banerjee et al., 2003; Singh et al., 2000; Singh et al., 1995) for recognizing polypyrimidine tracts and perform different functions; while U2AF65 is a splicing activator, Sxl is a repressor of splicing (Valcarcel et al., 1993). Thus, before theophylline could be employed as a splicing regulator its specificity must be established. First, theophylline should not affect the splicing of a substrate, which does not contain its binding site. Second, molecules that are similar in size and shape to theophylline should not inhibit the splicing of the pre-mRNA that contains theophylline-binding sequence.
To address the first issue, we examine the splicing of AdML-21AG (Chua and Reed, 2001), a pre-mRNA that does not contain the binding site for theophylline, but otherwise is identical to AdML-Theo-29AG (Compare
The second issue was addressed by examining the splicing of AdML-Theo-29AG in the presence of caffeine (
Alternative splicing plays an important role in the regulation of gene expression in higher eukaryotes. Alternative splicing is normally regulated by the regulatory proteins, which bind to the specific regions of pre-mRNA and enhance or repress the ability of the spliceosome to recognize the splice sites flanking the regulated exon (Black, 2003; Graveley, 2001). To demonstrate that RNA-small molecule interaction could also regulate alternative splicing, a model pre-mRNA in which two 3′ splice sites competing for a common 5′ splice site was generated following standard molecular biology techniques (
Similar experiments were run using pre-mRNA substrates wherein the 5′ ss rather than the 3′ ss was embedded within the theophylline binding aptamer. Plasmids encoding three 5′ ss embedded AdML pre-mRNA derivatives (AdMLTheo54Mut, AdMLTheo57Mut, AdMLTheo510Mut, and AdMLTheo513Mut) were constructed using a standard PCR based approach (
Controlling gene expression in living cells through theophylline-RNA interaction. In the in vitro splicing assay, theophylline-RNA interaction has been shown to regulate pre-mRNA splicing. To determine if such an approach could also regulate gene expression in living cells, a splicing reporter was constructed in which the cDNA of AdML-Theo29AG pre-mRNA was inserted into the 5′ UTR of green fluorescence protein (GFP) cDNA. It was contemplated that theophylline mediated inhibition of AdML-Theo29AG splicing will prevent the export of GFP mRNA which will be mirrored by the lack of GFP expression. The reporter plasmid was constructed by standard molecular cloning approach. In brief, a PCR amplified DNA fragment containing the entire AdML-Theo29AG sequence was cloned into the EcoRI/Sal I digested expression vector (pEGFP-N1, Invitrogen). The resulting reporter plasmid, pAdML-Theo29AG-EGFP, contains the cDNA of AdML-Theo29AG pre-mRNA fused 5′ to the GFP coding sequence.
To examine theophylline-mediated regulation of AdML-Theo29AG splicing, HEK293 cells were transfected with pAdML-Theo29AG-EGFP reporter using polyfectin following manufacturer's instructions (Qiagen). Cells were grown and maintained in a humidified atmosphere at 37° C. under 5% CO2 in Dulbecco's Modified Eagle Medium (Cellgro) supplemented with 10% fetal bovine serum and antibiotics (100 μg/ml streptomycin and 100 U/ml penicillin). For transfection, cells (3×104, per well) were seeded in a 24 well plate and incubated for 24 h (50-80% confluency) at which time pAdML-Theo29AG-EGFP or pEGFP-N1 was introduced. After 10 hours of incubation, cells were treated with buffer or theophylline (0 to 1M) and incubation was continued up to 48 hours. The GFP expression was visualized with a fluorescence microscope and cells were photographed with color CCD camera (Olympus). We observed that the cells, which were transfected with pAdML-Theo29AG-EGFP and treated with theophylline showed a dose dependent decrease in GFP expression (
An RT-PCR assay was performed to confirm that theophylline-mediated reduction of GFP expression is due to the inhibition of AdML-Theo29AG-EGFP splicing and not the result of mRNA degradation. Total RNA was isolated (from 3×104 cells) using trizol reagent. In a total volume of 20 μl, 5 μg of total RNA was reverse transcribed (RT) using vector specific reverse primer (GFPR, 5′-GTCGCCGTCCAGCTCGACCAGG-3′) according to manufacturer's instructions (Invitrogen Kit). Next, an aliquot (2 μl) of RT product was subjected to PCR amplification in a 50 μl reaction using 2.5 units of Taq polymerase, vector specific forward (GFPF, 5′-GCGCTACCGGACTCAGATCTCG-3′) and reverse primer (GFPR, 5′-GTCGCCGTCCAGCTCGACCAGG-3′). The amplified product was analyzed on a 2% agarose gel. As shown in
As mentioned above, another aspect of the present invention relates to the optimization of the BPS-to-3′ splice (AG) distance. It has been reported that the preferred distance for an AG to serve as the site for second transesterification step has been proposed to be 19 to 23 nucleotides downstream from the BPS (Chua and Reed, 2001). Thus, preferred pre-mRNA for theophylline-dependent splicing includes the one in which BPS-to-AG distance is 19 to 23 nucleotides and AG is located within the theophylline binding pocket. The sequences subject to the optimization include:
To test this, a series of pre-mRNAs will be synthesized in which the BPS-to-AG distance will be varied from 19 to 23 nt. Plasmids encoding these pre-mRNAs (
Another aspect of the present invention relates to the modification of theophylline-dependent aptamers to improve their affinity for theophylline, preferably in physiological relevant concentration of divalent metal ions (e.g., Mg2+). As described above, theophylline achieves partial modulation of RNA splicing (
To achieve high affinity theophylline-aptamer binding at physiological Mg2+ concentrations, the RNA affinity of theophylline will be increased by introducing modifications in the existing aptamer. A large body of evidence suggests that modified nucleotides stabilize RNA structures by affecting thermodynamic and kinetic parameters (Bevers et al., 1999; Proctor et al., 2004). As a parallel approach, we will employ in vitro selection to screen new aptamers that may bind to theophylline with high affinity and specificity at ˜3.0 mM Mg2+.
The NMR structure of theophylline-aptamer complex indicates that a number of stacking interactions make important contribution towards stabilization of the RNA-theophylline complex (Zimmermann et al., 1997). For example, a “base-zipper” which forms one side of the binding pocket and consists of residues U6, C22, A7, and C21 plays an important role in the stabilization of theophylline-RNA complex (
In addition, one embodiment of the invention relates to a systematic analysis of the effect of these modified nucleotides on the RNA affinity of theophylline. For example, a series of theophylline aptamers bearing the substitution of Ph-y for U6, U23 or U24 will be synthesized by in vitro transcription following the published protocol (Endo et al., 2004). Because Ph-y can be incorporated into the RNA only if the template contains an unnatural base (2-amino-6-(2-thienyl) purine) opposite the site of Ph-y incorporation, T7 transcription templates containing 2-amino-6-(2-thienyl) purine at predetermined site will be synthesized as described in the literature (Endo et al., 2004). The aptamers with A-4cPh modification at position A5, A7, A10 or A28 will be synthesized following standard RNA synthesis protocol by substituting A4cPh phosphoramidite for adenosine phosphoramidite (Zhao and Baranger, 2003). Since the phenyl groups in Ph-y and A4cPh do not occupy the positions, which have been proposed to be involved in the base-triple interactions (Zimmermann et al., 1997), these modifications may not interfere in the binding of theophylline. Once the RNA aptamers with the desired modifications are synthesized, our next goal will be to determine the binding affinity of theophylline for modified aptamers. We will use equilibrium filtration technique to estimate RNA affinity of theophylline (Jenison et al., 1994). Among the sets of Ph-y and A-4cPh modified aptamers that provide tight binding (better than the wild type aptamer) will be subjected to double substitution to determine if a further increase in the binding affinity can be achieved. In other words, if determined that from the sets of Ph-y and A4cPh modified aptamers U23 and A7 modifications, respectively resulted into improved binding of theophylline, then an aptamer bearing both U23 and A7 modifications will be synthesized and tested for its ability to bind theophylline. The aptamer with highest binding affinity will be used to construct AdML derivative following Moore and Sharp approach (Moore and Sharp, 1992). First, we will construct pre-mRNAs as shown in
Another embodiment of present invention relates to methods of designing/screening/isolating aptamers that bind to theophylline at physiological Mg2+ concentration. It has been reported that in vitro selection can be used to isolate RNA aptamers, which can specifically bind to a trans-activation-responsive (TAR) RNA at physiological magnesium condition (3.0 mM) (Duconge and Toulme, 1999). If an anti-TAR aptamer could bind to a polyanionic target with high affinity (Kd ˜30 nM) and specificity, it is conceivable that SELEX (Joyce, 1994) might also evolve an aptamer that would bind to theophylline with high affinity at physiological Mg2+ concentration. The isolation of aptamers will be carried out according to the published protocol (Jenison et al., 1994) except that selection will be performed in the buffer containing 3.0 mM Mg2+. Briefly, the RNA populations (pool of ˜1012 molecules) will be generated by in vitro transcription from a DNA template containing a random cassette of 30 nucleotides (
Prior to in vitro selection, 12-15 cycles of PCR will be performed with ˜0.2-0.4 μmol of gel purified DNA library with forward (primer 1, SEQ ID NO: 37) and reverse (primer 2, SEQ ID NO: 38) primers which will bind to the constant segments (
Once a class of high affinity theophylline aptamer is identified, we will determine the minimal sequence that may be sufficient for the binding of theophylline. To this end, sequence/motif that is common among the candidate aptamers will be identified, and mfold program will be used to generate the secondary structure (Zuker, 1989). With this information in hand, aptamers bearing the deletion of non-consensus sequences will be synthesized and evaluated for their affinity for theophylline. The aptamer(s) that bind to theophylline with high affinity (preferably in low nM range) at physiological Mg2+ will be used to generate AdML derivatives essentially as described above. The new anti-theophylline aptamer will not only be of direct use in the proposed studies, but also be of general interest for generating theophylline dependent allosteric ribozymes and in the construction of highly sensitive biosensor for monitoring theophylline in biological samples.
Another aspect of the present invention relates to method of developing theophylline-dependent bifunctional molecules which can regulate pre-mRNA splicing. It has been demonstrated that a system based on theophylline-RNA aptamer binding could be manipulated to regulate pre-mRNA splicing. However, such an approach may not be applicable for reprogramming the splicing of an endogenous gene. With the aim of developing a versatile approach, which not only modulates pre-mRNA splicing like an antisense RNA, but also has the mechanism to switch on/off the binding of antisense RNA, it is contemplated that if an antisense oligonucleotide directed to bind an exonic splicing enhancer (ESE) were part of theophylline aptamer then the resulting bifunctional molecule would be modular in nature: The binding of antisense domain to the ESE will repress the splicing of targeted pre-mRNA, whereas the addition of theophylline to the splicing reaction will induce a conformational rearrangement which will displace antisense RNA from its target. Thus, the bifunctional molecule will function like an allosteric enzyme whose activity can be controlled by an effector.
To test this, we designed a bifunctional theophylline aptamer in which the non-conserved portion of the aptamer is complementary to the ESE present in the alternative exon M2 of the mouse IgM gene (
It is noted that the bifunctional aptamer did not elicit a complete inhibition of splicing. Although increasing the concentration of bifunctional aptamer did improve splicing repression (
Another aspect of the present invention relates to methods of improving the stability of bifunctional theophylline aptamer against nucleases. The high affinity theophylline aptamer identified will serve as the starting molecule to generate nuclease resistant bifunctional aptamer. A number of chemical modifications have been shown to increase the stability of both DNA and RNA against nucleases (Kurreck, 2003). Modifications that have been shown to improve the stability of antisense RNAs will be tested to identify those that show maximum serum stability without compromising with the affinity for theophylline.
For example, a bifunctional aptamer may be modified to improve stability by using phosphorothioate. One of the most important chemical modifications that have been widely used in classical antisense approach is the replacement of the phosphodiester backbone with phosphorothioate (PS) linkage (Kurreck, 2003; Vortler and Eckstein, 2000). Excellent water solubility, reduced cleavage by nuclease, relative ease of synthesis, and improved bioavailability of P-S modified oligonucleotides make them an attractive tool for antisense research. The phosphorothioate substituted bifunctional aptamer will be synthesized by standard in vitro transcription except that NTPs will be replaced by NTPaS. The resulting bifunctional aptamer will be tested for nuclease sensitivity by incubating in HeLa nuclear extract. Splicing assay will be performed with IgM pre-mRNA.
Another example of improving the stability of a bifunctional aptamer is to use 2′-modified nucleotides. The presence of 2′ hydroxyl group in RNA makes it more susceptible to cleavage by nucleases (Eder et al., 1991; Shaw et al., 1991; Tsuji et al., 1992). Interestingly, modifications such as 2′-O-methyl (Monia et al., 1993), 2′-deoxy-2′-fluoropyrimidines (Kawasaki et al., 1993) and 2′-O-methoxyethyl (2′-OMOE) (Chen et al., 2002) have been shown to increase the stability of RNA. Among them, 2′-deoxy-2′-fluoropyrimidine has gained considerable attention. Compared to unmodified RNAs, 2′-fluoro, 2′-deoxy-substituted RNAs are significantly more stable (103-105-fold), and therefore more commonly used for the preparation of aptamers, ribozymes and antisense molecules for therapeutic application (Heidenreich et al., 1994; Kubik M F, 1997; Pieken et al., 1991). In addition to having resistance to nucleases, 2′-deoxy, 2′-fluoronucleosides prefer to adopt C3′-endo conformation, as in the case of ribonucleosides (Aurup et al., 1992; Guschlbauer, 1980). Furthermore, the commercial availability of 2′-deoxy, 2′-fluoronucleosides both as a 5′ triphosphate and phosphoramidite, allow the synthesis of 2′-fluoro substituted RNAs by chemical and enzymatic methods.
Pardi and coworkers (Zimmermann et al., 2000) have shown that all but one 2′ hydroxyl group (U24) of theophylline binding aptamer can be converted to the 2′-deoxy without having a noticeable effect on its affinity for theophylline. Thus, it is reasonable to assume that replacement of uridines (except U24) by 2′-deoxy, 2′-fluorouridine may not have any negative effect on RNA affinity of theophylline. Bifunctional aptamer will be synthesized in which the 2′-deoxy-2,-fluorouridine will be substituted for uridine (except U24), and the four terminal phosphodiester linkages will be replaced by P-S group; a report published by Eckstein and coworkers suggests that such a combination significantly improves the stability of hammerhead ribozymes (Heidenreich et al., 1994).
Another aspect of the present invention relates to a novel bimolecular allosteric hammerhead molecule, which should be able to regulate pre-mRNA splicing in theophylline-dependent manner. In other words, theophylline-dependent bimolecular hammerhead ribozymes may be engineered to regulate pre-mRNA splicing. It has been demonstrated that hammerhead ribozyme can be made to induce or suppress RNA cleavage in theophylline-dependent fashion by appending theophylline aptamer to a non-essential stem region (Soukup and Breaker, 1999a; Soukup and Breaker, 1999b; Soukup et al., 2000). It has also been shown that both hammerhead ribozyme (Kuwabara et al., 1998; Kuznetsova et al., 2004) and theophylline aptamer (Zimmermann et al., 1998; Zimmermann et al., 2000) could be assembled into their native conformations by using two RNA oligonucleotides. These properties of theophylline aptamer and hammerhead ribozyme will be exploited to generate an effector dependent hammerhead ribozyme, which will regulate the splicing of a target pre-mRNA without cleaving the pre-mRNA.
The theophylline-dependent bimolecular hammerhead ribozyme approach is outlined in
To test the utility of the proposed approach, the splicing of IgM pre-mRNA will be examined. 32P-labeled pre-mRNA and RNA A will be annealed. After 15-20 minutes, theophylline, RNA B, HeLa nuclear extract and other components of the splicing mix will be added followed by incubation at 30° C. for 2 hours. Control reactions without RNA B or theophylline will also be performed. Although ˜200 μM theophylline has been reported to be optimum for the assembly of active ribozyme, for the proposed assay the optimum concentration will be determined (0.1-1 mM will be tested). The products of the splicing reaction will be analyzed. It is expected that the splicing reaction performed in the presence of RNA A will not yield the spliced RNA. In contrast, the reaction carried out in the presence of RNA A, RNA B and theophylline will result into mRNA.
Another aspect of the present invention relates to methods of modulating RNA splicing in a subject using theophylline and theophylline-dependent riboswitch. The experiments described in the application demonstrate that the aptamer selected in vitro could retain its target recognition property in a cell free system or when expressed inside the living cells. If theophylline-RNA interaction could control a 3′ splice site switch in a model pre-mRNA (
In one embodiment, Drosophila cells are used for the test. Drosophila sexual differentiation involves a hierarchy of alternative splicing events, which are the best-characterized examples of alternative splicing regulation (Black, 2003; Cline and Meyer, 1996; Lopez, 1998). The Drosophila protein sex-lethal (Sxl), which is the master sex-switch in somatic cells and only expressed in female flies, regulates the alternative splicing of transformer (tra) pre-mRNA (Boggs et al., 1987; Granadino et al., 1997; Inoue et al., 1990; Sosnowski et al., 1989; Valcarcel et al., 1993). Experiments in transgenic flies and with nuclear extracts prepared from HeLa as well as Drosophila cells have demonstrated that Sxl protein blocks the binding of general splicing factor U2AF to NSS 3′ ss and thereby diverting it to activate the lower affinity female specific (FS) 3′ splice site (Inoue et al., 1990; Sosnowski et al., 1989; Valcarcel et al., 1993) (
To test theophylline-mediated modulation of tra splicing, a series of M-tra derivatives carrying the high affinity theophylline-binding site at various positions 5′ to the NSS 3′ splice site junction will be constructed (
As outlined in
To determine whether M-Theo-tra can recapitulate gender specific splicing of tra, 32P-labeled M-Theo-tra pre-mRNA will be incubated in HeLa nuclear extract in the presence of theophylline or caffeine as described in
It was further investigated whether theophylline could be used to regulate splicing of tra in a more physiological and biologically meaningful context, for example, in Drosophila Schneider cells (SL-2). Drosophila Schneider cells (SL-2), which are known to be male with respect to Sxl expression provides an excellent model system for studying the underlying mechanisms that control the sex determination pathway (Ryner and Baker, 1991). Before theophylline could be employed as a regulatory molecule it is important to determine whether theophylline has any adverse effect on the growth of Schneider cells. To this end, Schneider's cells (2×106, per well) were seeded in a six well plate in 3 ml Drosophila medium supplemented with 5% FCS and L-glutamine (Invitrogen). The cells were grown at 27° C. without CO2 in the absence or presence of theophylline. After 72 h, cell were harvested and resuspended in PBS containing trypan blue (0.05%). The cells were counted using hemocytometer. Dead cells were identified by uptake of the trypan blue; live cells by exclusion of the trypan blue marker. In
It is contemplated that the M-theo-tra derivative (
Schneider cells will be transiently transfected with pRM-theo-tra, pRM-mutTheo-tra or with empty vector (pRmHa-3). In brief, Schneider cells (2-3×106 cells/well) will be seeded in a six well plate in 3 ml Drosophila medium (Gibco) supplemented with 5% FCS, and 50 μg/ml gentamycin. The following day, cells will be washed with 2-3 ml of serum free medium, and transfected with 0.5-3.0 μg plasmid (the total amount of DNA will be kept constant by using empty vector) using CellFectin (Invitrogen) following manufacture's instructions. The amount of DNA and the transfection time will be standardized and the conditions that result in highest transfection efficiency will be used. After 18-24 h, the DNA-containing medium will be replaced by 3 ml of Drosophila medium and cells will be allowed to grow for another 24 h. At this stage theophylline or caffeine will be added and the transcription will be induced by CuSO4 (0.7-1.0 μg). After an incubation of 24 and 48 h, cells will be collected, washed with ice cold PBS, total RNA will be isolated with PARIS™ Kit (Ambion), and analyzed by RT-PCR. Since the timing of theophylline addition (after transfection), concentration of copper sulfate and induction time could affect the outcome of an experiment; each of these factors will separately optimized. Although every effort will be made to maintain Schneider cells under optimal culture conditions according to the published protocol (Bunch et al., 1988), cultured cells are known to change their properties with repeated passages. Therefore key findings obtained with Schneider cells will also be studied in other cell line such as Drosophila Kc cells.
It is contemplated that both pRM-Theo-tra and pRM-mutTheo-tra transfected cells, untreated or treated with caffeine, are expected to undergo male specific splicing, i.e., the NSS 3′ splice site will be activated, which would be confirmed by ˜383-bp PCR product. Upon theophylline treatment, pRM-theo-tra, but not pRM-mutTheo-tra transfected cells, is expected to generate female specific splicing (˜186-bp band in RT-PCR) 3. Finally, pRmHa-3 (vector only) transfected cells will be negative in terms of M-Theo-tra splicing.
Another aspect of the present invention relates to methods of placing or inserting a theophylline aptamer into the 5′ splice site and determining whether a theophylline-dependent riboswitch would modulate the 5′ splice site choice in the presence of theophylline. Another aspect of the present invention relates to methods of modulating RNA splicing comprising the steps of inserting a theophylline aptamer into the 5′ spice site and modulating pre-mRNA splicing in the presence of theophylline.
Another aspect of the present invention relates to methods of placing or inserting a theophylline aptamer into the BPS and determining whether a theophylline-dependent riboswitch would modulate pre-mRNA splicing in the presence of theophylline. Another aspect of the present invention relates to methods of modulating RNA splicing comprising the steps of inserting a theophylline aptamer into the BPS and modulating pre-mRNA splicing in the presence of theophylline.
In recent years tremendous efforts have been made in the development of tools that could manipulate gene expression at the level of transcription. For example, sequence specific DNA binding of pyrrole-imidazole polyamide oligomers has been exploited to control transcription (Gottesfeld et al., 1997). Likewise, principle of chemically induced proximity has been used for the development of small molecule-based approach for the regulation of transcription (Belshaw et al., 1996; Ho et al., 1996). Although controlling gene expression at the level of transcription is useful, to be able to control pre-mRNA splicing will have many applications in biology and medicine. For instance, a theophylline-dependent trans gene whose expression is turned on/off at a specific time in the development can be used to study the function of a developmentally regulated gene. Similarly, if a gene of interest encodes a transcription factor, a trans gene could be designed so that its alternative splicing modulated by theophylline would generate mRNAs encoding transcription activator and repressor molecules that bind to the same sequence of the promoter.
Another aspect of the present invention relates to riboswitch and a small molecule-based approach for controlling gene expression at the level of splicing. The approach is based on the principle of riboswitch in which the binding of a small molecule ligand to the specific RNA sequence leads to the formation of a stem loop structure that either terminates transcription prematurely or sequesters the Shine-Dalgarno sequence and inhibits translation initiation (Nudler and Mironov, 2004). Since aptamers can also bind small molecule ligands, it is interestingly found that insertion of an aptamer within the 3′ splice site region of a pre-mRNA generates an artificial riboswitch that may enable ligand specific control of pre-mRNA splicing.
A series of model pre-mRNAs in which the 3′ splice site AG was engineered to be the part of theophylline-binding aptamer were constructed and tested for their ability to undergo pre-mRNA splicing in the absence or presence of theophylline (
Experimental data included herein indicate that AdML-Theo29AG, AdML-Theo27AG and AdML-Theo-Stem21AG pre-mRNAs conferred theophylline dependent control of splicing, albeit with varying degree (
Unlike AdML-Theo29AG and AdML-Theo27AG substrates, the normal step II of the splicing of AdML-Theo-Stem21AG in the absence of theophylline (see accumulation of lariat-exon 2 in lanes 2-5,
Data disclosed herein indicate that even at the highest concentration of theophylline, 20-25% of the AdML-Theo29AG pre-mRNA underwent step II of splicing (
Several lines of evidence argue strongly that the observed theophylline dependent inhibition of step II of the splicing is specific. First, theophylline mediated decrease in the yield of the spliced product is directly proportional to the amount of the lariat product, suggesting that the inhibition of AdML-Theo-29AG splicing is not the result of mRNA degradation (see lariat and spliced product in
The formation of RNA secondary structure has been known to account for the regulation of splicing in a number of natural pre-mRNAs (Buratti et al., 2004). In addition, the effects of artificial stem-loop structures on the splicing of pre-mRNAs in yeast (Goguel and Rosbash, 1993; Goguel et al., 1993), mammals (Eperon et al., 1988; Liu et al., 1997; Solnick, 1985) and plants (Goodall and Filipowicz, 1991; Liu et al., 1995) have also been investigated. More recently, the analysis of human intronic sequences has revealed a strong correlation between alternative splicing and the prevalence of tandem nucleotide repeats that have the potential of forming secondary structure in introns that flank alternatively spliced exons (Lian and Garner, 2005). Given these facts, it would be interesting to test whether or not the RNA-theophylline system developed here could be used to influence a 3′ splice site switch of a pre-mRNA in which a common 5′ splice site pairs with two alternative 3′ splice site.
In conclusion, we have demonstrated that an artificial riboswitch, which exploits the high affinity binding of theophylline to an in vitro evolved aptamer, can regulate pre-mRNA splicing. Theophylline-dependent control of pre-mRNA splicing may have many advantages. First, theophylline is a well-known drug with favorable pharmacokinetic and cellular uptake properties. Second, theophylline is highly stable and possesses good water solubility. Third, theophylline is commercially available and is inexpensive. Finally, theophylline binds to its cognate sequence with high affinity and specificity, and the BLAST search of the human genome revealed no apparent match for theophylline aptamer sequence.
Since the choice of alternative splice sites is generally made at early stages of spliceosome assembly, it was next examined whether a theophylline riboswitch could be engineered to control splicing prior to the first step. A series of pre-mRNA substrates were constructed in which the branchpoint sequence (BPS) was inserted within the theophylline aptamer. In AdML pre-mRNA derivatives in which the branchpoint sequence is inserted within the upper stem of theophylline binding sequences, normal splicing was observed in the absence of theophylline, albeit with varying efficiency (
To investigate whether theophylline inhibits pre-mRNA splicing by blocking the step(s) in the assembly of the spliceosome or simply interferes with the chemical step(s) of splicing, splicing complex assembly was analyzed. Spliceosome assembly assays were performed in the presence or absence of 2 mM theophylline. Addition of theophylline significantly affected the kinetics of spliceosome assembly (
To determine whether theophylline-dependent splicing is specific, nucleotides that are necessary for theophylline binding (boxed residues in
Biochemical and structural studies showed that the lower theophylline aptamer stem is not critical for ligand binding (Zimmermann 1997), but apparently increases the stability of the RNA-theophylline complex. If true, then an increase in the length of the lower theophylline aptamer stem should further stabilize the RNA-theophylline complex, which may bring stronger splicing repression. To test this prediction, AdML-Theo15AG derivatives were constructed in which the size of the lower theophylline aptamer stem was varied from four to ten nucleotides (
The effect of BPS location on splicing repression was tested next. An AdML derivative in which the BPS was inserted in the lower theophylline aptamer stem was constructed (
Naturally-occurring RNA structure elements as well as artificial stem-loop structures are known to influence alternative splicing. To determine whether theophylline-induced secondary structure can likewise influence alternative splicing, a series of model splicing substrates were constructed consisting of three exons interrupted by two introns (
To determine whether theophylline-induced sequestering of branchpoint can control splicing in living cells, DNAs that encode ABT0-8M pre-mRNAs was inserted into the mammalian expression vector pcDNA3.1 to yield pcDNA-ABT0-8M. HeLa cells (70-90% confluence) were transiently transfected with these constructs or with empty vector, then treated with theophylline (1 mM) or buffer. After a 24 hour incubation, cells were harvested and total RNA was extracted using an RNeasy mini-kit (Qiagen). RT-PCR assays showed that theophylline can affect alternative splicing (
Alternative splicing is a precisely regulated process by which a single pre-mRNA can undergo differential joining of 5′ and 3′ splice sites to generate variant mRNAs with diverse, and often antagonistic functions (Black, 2003; Clayerie, 2001; Graveley, 2001). The defective regulation of splice variant expression has been identified as the cause of several genetic disorders (Dredge et al., 2001; Faustino and Cooper, 2003; Garcia-Blanco et al., 2004; Hull et al., 1993; Nissim-Rafinia and Kerem, 2002; Pagani and Baralle, 2004; Phillips and Cooper, 2000). Moreover, certain forms of cancer have been linked to unbalanced isoform expression from genes involved in cell cycle regulation or angiogenesis (Krajewska et al., 1996a; Krajewska et al., 1996b; Novak et al., 2001; Steinman et al., 2004; Venables, 2004; Xerri et al., 1996). Thus, a system based on a small drug like molecule (such as theophylline) that can influence a splicing decision may emerges as novel pharmacological tools with potential for therapeutic intervention.
For example, the theophylline-dependent riboswitches can be employed to target two genes that are linked to human diseases: the Bcl-x gene and the SMN1 gene. Alternative splicing of Bcl-x gene generates a long isoform, Bcl-xL and a short isoform, Bcl-xS. A proper balance between these two isoforms is essential for the normal cell function, such as maintaining breast epithelial cell homeostasis and mammary gland involution. In addition, overexpression of Bcl-xL has been associated with increased risk of breast cancer metastasis and resistance to chemotherapeutic agents. It has been suggested that Bcl-xL promotes cell survival by counteracting signals that lead to the expression of Bcl-xS, a pro-apoptotic protein. An ideal approach for breast cancer treatment would be a conditional splicing switch that regulates Bcl-x trans gene splicing in a dose-dependent manner according to individual patient need.
To investigate whether theophylline can affect alternative splicing of Bcl-x trans gene, a Bcl-x minigene (pBcl-x-Theo) was constructed in which the proximal 5′ ss is imbedded within TBS. Because the entire TBS is present in the intron, it was expected that the modified minigene would remain functional. Three derivatives of the Bcl-x minigene were prepared by in vitro transcription: BclxSHTheo57 (7 nucleotide stem), BclxSHTheo510 (10 nucleotide stem), and BclxSHTheo513 (13 nucleotide stem), and used for in vitro splicing assays (
Spinal muscular atrophy (SMA) is a hereditary neurodegenerative disorder, which is caused by mutation in the SMN1 gene (Cartegni et al., 2002; Garcia-Blanco et al., 2004; Khoo et al., 2003). Although SMN2 gene can compensate partially for the loss of SMN1, a translationally silent C-to-T substitution in exon 7 disrupts an SF2/ASF-dependent ESE, resulting into exclusion of exon 7 and production of defective protein. Thus, blocking the 3′ splice site (using theophylline aptamer system) of exon 8 may force the splicing machinery to include included exon 7 and therefore produce the functional protein.
EXAMPLES Example 1 Pre-mRNA SubstratesAdML Par and AdML21AG pre-mRNAs were generated by in vitro transcription using BamHI digested plasmids pAdML Par (Gozani et al., 1994) and pAdML21AG, respectively. AdML-Theo39AG pre-mRNA was synthesized from a PCR derived template, which was amplified from plasmid pAdMLΔAG (Gozani et al., 1994) using T7 primer (5′-TAATACGACTCACTATAG-3′; SEQ ID NO: 30) and oligonucleotide #17179 (5′-TCAACGTCGAGACGCTGCCAAGGGCCTTTCGGCTG GTATCGCCAGAGAGAGAGG-3′; SEQ ID NO: 31) as forward and reverse primers, respectively. Plasmids encoding AdML-Theo29AG, AdML-Theo27AG and AdML-Theo-Stem21AG pre-mRNAs are derivatives of pAdML (Gozani et al., 1994) and were constructed by PCR using T7 primer as the forward primer and oligonucleotide #17396 (5′-TTGACGTCGACCTCCTGCCAAGGGCCTTTCGGCTGGTATGAGGAA AAAAAAAGAAAAAAAGT-3′; SEQ ID NO: 32); oligonucleotide #17395 (5′-TTGACGTCGACCTGCCAAGGGCCTTTCGGCTGGTATGGAAAAAAAAAGAAAAA AAGT-3′; SEQ ID NO: 33); and oligonucleotide #22735 (5′-TTGACGTCGATCAGCT GCCAAGGGCCTTTCGGCTGGTATCTGAAAAAAAAAAGAAAAAGT-3′; SEQ ID NO: 34), respectively as reverse primer. AdML-TheoExon2 pre-mRNA was synthesized from PstI digested plasmid pAdML-TheoExon2, which was generated by PCR using oligonucleotides #30036 (5′-CCCTTGGCAGCGTCTGAGGACAAAC TCTTCGCGG-3′; SEQ ID NO: 35) and #30037 (5′-CCTTTCGGCTGGTATCGCCAC GTCGACCTGAAAAAAAAAG-3′; SEQ ID NO: 36) and pAdML21AG as the template, underline represents theophylline binding sequence. The PCR amplified DNA was circularized using T4 DNA ligase to yield the desired pAdML-TheoExon2.
Example 2 In Vitro Transcription AssayLinearized plasmid (1 νg) or PCR generated DNA (˜150-200 ng) was used as template for run-off transcription. A typical (10 μL) in vitro transcription reaction consisted of 40 mM Tris-HCl (pH 8.0), 2.0 mM spermidine, 10 mM DTT, 20 mM MgCl2, NTP mixture (0.4 mM CTP and ATP, and 0.1 mM GTP and UTP), 2.0 mM cap analog (NEB), ˜10 μCi [γ-32P]UTP, 10-20 units SP6 (NEB) or T7 polymerase (Ambion). After incubation at 37° C. for 2 hours, the reaction was terminated by adding 12.5 μL stop buffer and RNA was purified on a 10% denaturing polyacrylamide gel.
Example 3 In Vitro Splicing AssayNuclear extracts were prepared from HeLa cells (obtained from National Cell Culture), essentially as described by Dignam et al., (Dignam et al., 1983). To ensure that theophylline binds to its RNA target, a solution (5 μl) consisting of 32P-labeled pre-mRNA (5-10 fmol, ˜10,000 cpm per reaction), indicated concentration of theophylline, 0.5 μl BC300 (20 mM HEPES, pH 8.0, 20% glycerol, 300 mM KCl, 0.2 mM EDTA) and 0.25 μl 160 mM MgCl2 were heated to 65° C. for 5 minutes, followed by 20 minutes incubation at room temperature. Next, 0.5 mM ATP, 20 mM creatine phosphate, 0.4 units of RNasin (Promega), 1.0 mM DTT, 6.25 μl HeLa nuclear extract, and water up to 12.5 μl (all concentrations are final) was added and incubation continued at 30° C. for the indicated time. Where indicated, theophylline was substituted by caffeine or water. Splicing reaction was terminated by the addition of 125 μl stop buffer (100 mM Tris-HCl, pH 7.5, 10 mM EDTA, 1% SDS, 150 mM NaCl, 300 mM sodium acetate) followed by phenol-chloroform extraction and isolation of the RNA by ethanol precipitation. The RNA pallet was washed with 70% aqueous ethanol, dried and dissolved in 10 μl loading buffer. Splicing intermediates and products were analyzed by electrophoresis in 13% denaturing polyacrylamide gels. The fractionated RNAs were visualized by PhosphorImager (Molecular Dynamics) and RNA signals were quantified by ImageQuant version 4.2 software (Molecular Dynamics) or ImageJ version 1.36 software (Rasband, W. S., ImageJ, U.S. National Institutes of Health, Bethesda, Md., http://rsb.info.nih.gov/ij, 1997-2006).
Example 4 Spliceosome Assembly AssaySpliceosome assembly and separation of individual complexes were performed essentially as described earlier (Das and Reed, 1999). Briefly, pre-mRNA (˜5 ng) was incubated in HeLa nuclear extract in the absence or presence of theophylline (12.5 μl total volume) under the conditions that support in vitro splicing. After the incubation, 2.5 μl of 4 μg/μl heparin and 2.5 μl of 5× loading dye containing 1×TBE (89 mM Tris, 89 mM boric acid, 2.5 mM EDTA), 20% glycerol, 0.25% bromophenol blue, 0.25% xylene cyanol) was added and the 3 μl aliquots of each reaction mixture were loaded on a 2% horizontal low-melting agarose gels followed by the spliceosome complexes at 70 V for 3 h in Tris-glycine running buffer at room temperature (Konarska and Sharp, 1986). Gels were fixed in 10% acetic acid, 10% methanol for 30 min, and then dried under vacuum at 80° C.
As stated above, the foregoing is merely intended to illustrate various embodiments of the present invention. The specific modifications discussed above are not to be construed as limitations on the scope of the invention. It will be apparent to one skilled in the art that various equivalents, changes, and modifications may be made without departing from the scope of the invention, and it is understood that such equivalent embodiments are to be included herein. All references cited herein are expressly incorporated by reference herein in their entirety.
REFERENCES
- 1. Aebi, M., Hornig, H., Padgett, R. A., Reiser, J. and Weissmann, C. (1986) Sequence requirements for splicing of higher eukaryotic nuclear pre-mRNA. Cell, 47, 555-565.
- 2. Aurup, H., Williams, D. and Eckstein, F. (1992) 2′-Fluoro- and 2′-amino-2′-deoxynucleoside 5′-triphosphates as substrates for T7 RNA polymerase. Biochemistry, 31, 9636-9641.
- 3. Banerjee, H., Rahn, A., Davis, W. and Singh, R. (2003) Sex lethal and U2 small nuclear ribonucleoprotein auxiliary factor (U2AF65) recognize polypyrimidine tracts using multiple modes of binding. Rna, 9, 88-99.
- 4. Belshaw, P. J., Ho, S. N., Crabtree, G. R. and Schreiber, S. L. (1996) Controlling protein association and subcellular localization with a synthetic ligand that induces heterodimerization of proteins. Proc Natl Acad Sci USA, 93, 4604-4607.
- 5. Bevers, S., Ha, S. B. and McLaughlin, L. W. (1999) Critical nature of a specific uridine O2-carbonyl for cleavage by the hammerhead ribozyme. Biochemistry, 38, 7710-7718.
- 6. Black, D. L. (2003) Mechanisms of alternative pre-messenger RNA splicing. Annu Rev Biochem, 72, 291-336.
- 7. Boggs, R. T., Gregor, P., Idriss, S., Belote, J. M. and McKeown, M. (1987) Regulation of sexual differentiation in D. melanogaster via alternative splicing of RNA from the transformer gene. Cell, 50, 739-747.
- 8. Bunch, T. A., Grinblat, Y. and Goldstein, L. S. (1988) Characterization and use of the Drosophila metallothionein promoter in cultured Drosophila melanogaster cells. Nucleic Acids Res, 16, 1043-1061.
- 9. Buratti, E., Muro, A. F., Giombi, M., Gherbassi, D., Iaconcig, A. and Baralle, F. E. (2004) RNA folding affects the recruitment of SR proteins by mouse and human polypurinic enhancer elements in the fibronectin EDA exon. Mol Cell Biol, 24, 1387-1400.
- 10. Burgstaller, P. and Famulok, M. (1994) Isolation of RNA aptamers for biological cofactors by in vitro selection. Angew. Chem. Int. Ed. Engl., 33, 1084-1087.
- 11. Cartegni, L. and Krainer, A. R. (2003) Correction of disease-associated exon skipping by synthetic exon-specific activators. Nat Struct Biol, 10, 120-125.
- 12. Chen, Z., Monia, B. P. and Corey, D. R. (2002) Telomerase inhibition, telomere shortening, and decreased cell proliferation by cell permeable 2′-O-methoxyethyl oligonucleotides. J Med Chem, 45, 5423-5425.
- 13. Chiara, M. D., Palandjian, L., Feld Kramer, R. and Reed, R. (1997) Evidence that U5 snRNP recognizes the 3′ splice site for catalytic step II in mammals. Embo J, 16, 4746-4759.
- 14. Chua, K. and Reed, R. (2001) An upstream AG determines whether a downstream AG is selected during catalytic step II of splicing. Mol Cell Biol, 21, 1509-1514.
- 15. Clayerie, J. M. (2001) Gene number. What if there are only 30,000 human genes? Science, 291, 1255-1257.
- 16. Cline, T. W. and Meyer, B. J. (1996) Vive la difference: males vs females in flies vs worms. Annu Rev Genet, 30, 637-702.
- 17. Collins, C. A. and Guthrie, C. (1999) Allele-specific genetic interactions between Prp8 and RNA active site residues suggest a function for Prp8 at the catalytic core of the spliceosome. Genes Dev, 13, 1970-1982.
- 18. Collins, C. A. and Guthrie, C. (2001) Genetic interactions between the 5′ and 3′ splice site consensus sequences and U6 snRNA during the second catalytic step of pre-mRNA splicing. RNA, 7, 1845-1854.
- 19. Das, R. and Reed, R. (1999) Resolution of the mammalian E complex and the ATP-dependent spliceosomal complexes on native agarose mini-gels. Rna, 5, 1504-1508.
- 20. Deirdre, A., Scadden, J. and Smith, C. W. (1995) Interactions between the terminal bases of mammalian introns are retained in inosine-containing pre-mRNAs. Embo J, 14, 3236-3246.
- 21. Dignam, J. D., Lebovitz, R. M. and Roeder, R. G. (1983) Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei. Nucleic Acids Res., 11, 1475-1489.
- 22. Dominski, Z. and Kole, R. (1993) Restoration of correct splicing in thalassemic pre-mRNA by antisense oligonucleotides. Proc Natl Acad Sci USA, 90, 8673-8677.
- 23. Dredge, B. K., Polydorides, A. D. and Darnell, R. B. (2001) The splice of life: alternative splicing and neurological disease. Nat Rev Neurosci, 2, 43-50.
- 24. Duconge, F. and Toulme, J. J. (1999) In vitro selection identifies key determinants for loop-loop interactions: RNA aptamers selective for the TAR RNA element of HIV-1. Rna, 5, 1605-1614.
- 25. Eder, P. S., DeVine, R. J., Dagle, J. M. and Walder, J. A. (1991) Substrate specificity and kinetics of degradation of antisense oligonucleotides by a 3′ exonuclease in plasma. Antisense Res Dev, 1, 141-151.
- 26. Endo, M., Mitsui, T., Okuni, T., Kimoto, M., Hirao, I. and Yokoyama, S. (2004) Unnatural base pairs mediate the site-specific incorporation of an unnatural hydrophobic component into RNA transcripts. Bioorg Med Chem Lett, 14, 2593-2596.
- 27. Eperon, I. C. and Muntoni, F. (2003) Can a ‘patch’ in a skipped exon make the pre-mRNA splicing machine run better? Trends Mol Med, 9, 233-234.
- 28. Eperon, L. P., Graham, I. R., Griffiths, A. D. and Eperon, I. C. (1988) Effects of RNA secondary structure on alternative splicing of pre-mRNA: is folding limited to a region behind the transcribing RNA polymerase? Cell, 54, 393-401.
- 29. Faustino, N. A. and Cooper, T. A. (2003) Pre-mRNA splicing and human disease. Genes Dev, 17, 419-437.
- 30. Freyer, G. A., Arenas, J., Perkins, K. K., Furneaux, H. M., Pick, L., Young, B., Roberts, R. J. and Hurwitz, J. (1987) In vitro formation of a lariat structure containing a G2′-5′G linkage. J Biol Chem., 262, 4267-4273.
- 31. Garcia-Blanco, M. A., Baraniak, A. P. and Lasda, E. L. (2004) Alternative splicing in disease and therapy. Nat Biotechnol, 22, 535-546.
- 32. Gaur, R. K., McLaughlin, L. W. and Green, M. R. (1997) Functional group substitutions of the branchpoint adenosine in a nuclear pre-mRNA and a group II intron. Rna, 3, 861-869.
- 33. Gaur, R. K., Valcarcel, J. and Green, M. R. (1995) Sequential recognition of the pre-mRNA branch point by U2AF65 and a novel spliceosome-associated 28-kDa protein. RNA, 1, 407-417.
- 34. Goguel, V. and Rosbash, M. (1993) Splice site choice and splicing efficiency are positively influenced by pre-mRNA intramolecular base pairing in yeast. Cell, 72, 893-901.
- 35. Goguel, V., Wang, Y. and Rosbash, M. (1993) Short artificial hairpins sequester splicing signals and inhibit yeast pre-mRNA splicing. Mol. Cell. Biol., 13, 6841-6848.
- 36. Goodall, G. J. and Filipowicz, W. (1991) Different effects of intron nucleotide composition and secondary structure on pre-mRNA splicing in monocot and dicot plants. Embo J, 10, 2635-2644.
- 37. Gottesfeld, J. M., Neely, L., Trauger, J. W., Baird, E. E. and Dervan, P. B. (1997) Regulation of gene expression by small molecules. Nature, 387, 202-205.
- 38. Gozani, O., Patton, J. G. and Reed, R. (1994) A novel set of spliceosome-associated proteins and the essential splicing factor PSF bind stably to pre-mRNA prior to catalytic step II of the splicing reaction. Embo J, 13, 3356-3367.
- 39. Granadino, B., Penalva, L. O., Green, M. R., Valcarcel, J. and Sanchez, L. (1997) Distinct mechanisms of splicing regulation in vivo by the Drosophila protein Sex-lethal. Proc. Natl. Acad. Sci. USA, 94, 7343-7348.
- 40. Graveley, B. R. (2001) Alternative splicing: increasing diversity in the proteomic world. Trends Genet, 17, 100-107.
- 41. Graveley, B. R. (2005) Small molecule control of pre-mRNA splicing. Rna, 11, 355-358.
- 42. Guschlbauer, W. (1980) Conformational analysis of ribonucleosides from proton-proton coupling constants. Biochim Biophys Acta, 610, 47-55.
- 43. Heidenreich, O., Benseler, F., Fahrenholz, A. and Eckstein, F. (1994) High activity and stability of hammerhead ribozymes containing 2′-modified pyrimidine nucleosides and phosphorothioates. J Biol Chem, 269, 2131-2138.
- 44. Heidenreich, O., Kang, S. H., Xu, X. and Nerenberg, M. (1995) Application of antisense technology to therapeutics. Mol Med Today, 1, 128-133.
- 45. Ho, S. N., Biggar, S. R., Spencer, D. M., Schreiber, S. L. and Crabtree, G. R. (1996) Dimeric ligands define a role for transcriptional activation domains in reinitiation. Nature, 382, 822-826.
- 46. Hornig, H., Aebi, M. and Weissmann, C. (1986) Effect of mutations at the lariat branch acceptor site on beta-globin pre-mRNA splicing in vitro. Nature, 324, 589-591.
- 47. Huang, Z. and Szostak, J. W. (2003) Evolution of aptamers with a new specificity and new secondary structures from an ATP aptamer. Rna, 9, 1456-1463.
- 48. Hull, J., Shackleton, S. and Harris, A. (1993) Abnormal mRNA splicing resulting from three different mutations in the CFTR gene. Hum Mol Genet, 2, 689-692.
- 49. Inoue, K., Hoshijima, K., Sakamoto, H. and Shimura, Y. (1990) Binding of the Drosophila sex-lethal gene product to the alternative splice site of transformer primary transcript. Nature, 344, 461-463.
- 50. Jenison, R. D., Gill, S. C., Pardi, A. and Polisky, B. (1994) High-resolution molecular discrimination by RNA. Science, 263, 1425-1429.
- 51. Johnson, J. M., Castle, J., Garrett-Engele, P., Kan, Z., Loerch, P. M., Armour, C. D., Santos, R., Schadt, E. E., Stoughton, R. and Shoemaker, D. D. (2003) Genome-wide survey of human alternative pre-mRNA splicing with exon junction microarrays. Science, 302, 2141-2144.
- 52. Joyce, G. F. (1994) In vitro evolution of nucleic acids. Curr Opin Struct Biol, 4, 331-336.
- 53. Kan, Z., Rouchka, E. C., Gish, W. R. and States, D. J. (2001) Gene structure prediction and alternative splicing analysis using genomically aligned ESTs. Genome Res, 11, 889-900.
- 54. Kandels-Lewis, S, and Seraphin, B. (1993) Involvement of U6 snRNA in 5′ splice site selection. Science, 262, 2035-2039.
- 55. Kawasaki, A. M., Casper, M. D., Freier, S. M., Lesnik, E. A., Zounes, M. C., Cummins, L. L., Gonzalez, C. and Cook, P. D. (1993) Uniformly modified 2′-deoxy-2′-fluoro phosphorothioate oligonucleotides as nuclease-resistant antisense compounds with high affinity and specificity for RNA targets. J. Med. Chemistry, 36, 831-841.
- 56. Konarska, M. M. and Sharp, P. A. (1986) Electrophoretic separation of complexes involved in the splicing of precursors to mRNAs. Cell, 46, 845-855.
- 57. Konforti, B. B., Koziolkiewicz, M. J. and Konarska, M. M. (1993) Disruption of base pairing between the 5′ splice site and the 5′ end of U1 snRNA is required for spliceosome assembly. Cell, 75, 863-873.
- 58. Krainer, A. R., Maniatis, T., Ruskin, B. and Green, M. R. (1984) Normal and mutant human beta-globin pre-mRNAs are faithfully and efficiently spliced in vitro. Cell, 36, 993-1005.
- 59. Krajewska, M., Fenoglio-Preiser, C. M., Krajewski, S., Song, K., Macdonald, J. S., Stemmerman, G. and Reed, J. C. (1996a) Immunohistochemical analysis of Bcl-2 family proteins in adenocarcinomas of the stomach. Am J Pathol, 149, 1449-1457.
- 60. Krajewska, M., Krajewski, S., Epstein, J. I., Shabaik, A., Sauvageot, J., Song, K., Kitada, S, and Reed, J. C. (1996b) Immunohistochemical analysis of bcl-2, bax, bcl-X, and mcl-1 expression in prostate cancers. Am J Pathol, 148, 1567-1576.
- 61. Kramer, A. (1996) The structure and function of proteins involved in mammalian pre-mRNA splicing. Annu Rev Biochem, 65, 367-409.
- 62. Kubik M F, B. C., Fitzwater T, Watson S R, Tasset D M. (1997) Isolation and characterization of 2′-fluoro-, 2′-amino-, and 2′-fluoro-/amino-modified RNA ligands to human IFN-gamma that inhibit receptor binding. J Immunol, 159.
- 63. Kurreck, J. (2003) Antisense technologies. Improvement through novel chemical modifications. Eur J Biochem, 270, 1628-1644.
- 64. Kuwabara, T., Warashina, M., Tanabe, T., Tani, K., Asano, S, and Taira, K. (1998) A novel allosterically trans-activated ribozyme, the maxizyme, with exceptional specificity in vitro and in vivo. Mol Cell, 2, 617-627.
- 65. Kuznetsova, M., Novopashina, D., Repkova, M., Venyaminova, A. and Vlassov, V. (2004) Binary hammerhead ribozymes with high cleavage activity. Nucleosides Nucleotides Nucleic Acids, 23, 1037-1042.
- 66. Lamond, A. I., Konarska, M. M. and Sharp, P. A. (1987) A mutational analysis of spliceosome assembly: evidence for splice site collaboration during spliceosome formation. Genes Dev., 1, 532-543.
- 67. Lesser, C. and Guthrie, C. (1993) Mutations in U6 snRNA that alter splice site specificity: implications for the active site. Science, 262, 1982-1988.
- 68. Lian, Y. and Garner, H. R. (2005) Evidence for the regulation of alternative splicing via complementary DNA sequence repeats. Bioinformatics, 21, 1358-1364.
- 69. Liu, H.-K., Goodall, G. J., Kole, R. and Filipowicz, W. (1995) Effects of secondary structure on pre-mRNA splicing: hairpins sequestering the 5′ but not the 3′ splice site inhibit intron processing in Nicotiana plumbaginifolia. EMBO J., 14, 377-388.
- 70. Liu, Z. R., Laggerbauer, B., Luhrmann, R. and Smith, C. W. (1997) Crosslinking of the U5 snRNP-specific 116-kDa protein to RNA hairpins that block step 2 of splicing. Rna, 3, 1207-1219.
- 71. Lopez, A. J. (1998) Alternative splicing of pre-mRNA: developmental consequences and mechanisms of regulation. Annu Rev Genet, 32, 279-305.
- 72. Luukkonen, B. G. and Seraphin, B. (1997) The role of branchpoint-3′ splice site spacing and interaction between intron terminal nucleotides in 3′ splice site selection in Saccharomyces cerevisiae. Embo J, 16, 779-792.
- 73. Malca, H., Shomron, N. and Ast, G. (2003) The U1 snRNP base pairs with the 5′ splice site within a penta-snRNP complex. Mol Cell Biol, 23, 3442-3455.
- 74. Maniatis, T. and Tasic, B. (2002) Alternative pre-mRNA splicing and proteome expansion in metazoans. Nature, 418, 236-243.
- 75. Marshall, K. A. and Ellington, A. D. (2000) In vitro selection of RNA aptamers. Methods Enzymol, 318, 193-214.
- 76. Merendino, L., Guth, S., Bilbao, D., Martinez, C. and Valcarcel, J. (1999) Inhibition of msl-2 splicing by Sex-lethal reveals interaction between U2AF35 and the 3′ splice site AG. Nature, 402, 838-841.
- 77. Mironov, A. A., Fickett, J. W. and Gelfand, M. S. (1999) Frequent alternative splicing of human genes. Genome Res, 9, 1288-1293.
- 78. Modrek, B., Resch, A., Grasso, C. and Lee, C. (2001) Genome-wide detection of alternative splicing in expressed sequences of human genes. Nucleic Acids Res, 29, 2850-2859.
- 79. Monia, B. P., Lesnik, E. A., Gonzalez, C., Lima, W. F., McGee, D., Guinosso, C. J., Kawasaki, A. M., Cook, P. D. and Freier, S. M. (1993) Evaluation of 2′-modified oligonucleotides containing 2′-deoxy gaps as antisense inhibitors of gene expression. J Biol Chem, 268, 14514-14522.
- 80. Moore, J. J., Query, C. C. and Sharp, P. A. (1993) Splicing of precursors to mRNA by the spliceosome. In Gesteland, R. F. and Atkins, J. R. (eds.), In The RNA world. Cold Spring Harbor, N.Y.
- 81. Moore, M. J. and Sharp, P. A. (1992) Site-specific modification of pre-mRNA: the 2′-hydroxyl groups at the splice sites. Science, 256, 992-997.
- 82. Newman, A. (1994) Activity in the spliceosome. Curr. Biol., 4, 462-464.
- 83. Newman, A. J., Lin, R. J., Cheng, S. C. and Abelson, J. (1985) Molecular consequences of specific intron mutations on yeast mRNA splicing in vivo and in vitro. Cell, 42, 335-344.
- 84. Nilsen, T. W. (2003) The spliceosome: the most complex macromolecular machine in the cell? Bioessays, 25, 1147-1149.
- 85. Nissim-Rafinia, M. and Kerem, B. (2002) Splicing regulation as a potential genetic modifier. Trends Genet, 18, 123-127.
- 86. Novak, U., Grob, T. J., Baskaynak, G., Peters, U. R., Aebi, S., Zwahlen, D., Tschan, M. P., Kreuzer, K. A., Leibundgut, E. O., Cajot, J. F., Tobler, A. and Fey, M. F. (2001) Overexpression of the p73 gene is a novel finding in high-risk B-cell chronic lymphocytic leukemia. Ann Oncol, 12, 981-986.
- 87. Nudler, E. and Mironov, A. S. (2004) The riboswitch control of bacterial metabolism. Trends Biochem Sci, 29, 11-17.
- 88. Pagani, F. and Baralle, F. E. (2004) Genomic variants in exons and introns: identifying the splicing spoilers. Nat Rev Genet, 5, 389-396.
- 89. Parker, R. and Siliciano, P. G. (1993) Evidence for an essential non-Watson-Crick interaction between the first and last nucleotides of a nuclear pre-mRNA intron. Nature, 361, 660-662.
- 90. Patterson, B. and Guthrie, C. (1991) A U-rich tract enhances usage of an alternative 3′ splice site in yeast. Cell, 64, 181-187.
- 91. Phillips, A. and Cooper, T. (2000) RNA processing and human disease. Cell Mol Life Sci, 57, 235-249.
- 92. Pieken, W. A., Olsen, D. B., Benseler, F., Aurup, H. and Eckstein, F. (1991) Kinetic characterization of ribonuclease-resistant 2′-modified hammerhead ribozymes. Science, 253, 314-317.
- 93. Proctor, D. J., Ma, H., Kierzek, E., Kierzek, R., Gruebele, M. and Bevilacqua, P. C. (2004) Folding thermodynamics and kinetics of YNMG RNA hairpins: specific incorporation of 8-bromoguanosine leads to stabilization by enhancement of the folding rate. Biochemistry, 43, 14004-14014.
- 94. Query, C. C., Moore, M. J. and Sharp, P. A. (1994) Branch nucleophile selection in pre-mRNA splicing: evidence for the bulged duplex model. Genes & Dev., 8, 587-597.
- 95. Reed, R. and Palandjian, L. (1997) Spliceosome assembly. In Krainer, A. (ed.), Eukaryotic mRNA processing. IRL Press, Oxford, pp. 103-129.
- 96. Roberts, G. C. and Smith, C. W. (2002) Alternative splicing: combinatorial output from the genome. Curr Opin Chem Biol, 6, 375-383.
- 97. Ruskin, B. and Green, M. R. (1985) Role of the 3′ splice site consensus sequence in mammalian pre-mRNA splicing. Nature, 317, 732-734.
- 98. Ruskin, B., Zamore, P. D. and Green, M. R. (1988) A factor, U2AF, is required for U2 snRNP binding and splicing complex assembly. Cell, 52, 207-219. Ryner, L. C. and Baker, B. S. (1991) Regulation of doublesex pre-mRNA processing by 3′ splice site activation. Genes Dev., 5, 2071-2085.
- 99. Sakamoto, H., Inoue, K., Higuchi, I., Ono, Y. and Shimura, Y. (1992) Control of Drosophila Sex-lethal pre-mRNA splicing by its own female-specific product. Nucleic Acids Res, 20, 5533-5540.
- 100. Sambrook, J., and Russell, D. W. 2001. Molecular cloning: a laboratory manual, 3rd ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
- 101. Sassanfar, M. and Szostak, J. W. (1993) An RNA motif that binds ATP. Nature, 364, 550-553.
- 102. Sawa, H. and Abelson, J. (1992) Evidence for a base-pairing interaction between U6 small nuclear RNA and the 5′ splice site during the splicing reaction in yeast. Proc. Natl. Acad. Sci. USA, 89, 11269-11273.
- 103. Sawa, H. and Shimura, Y. (1992) Association of U6 snRNA with the 5′-splice site region of pre-mRNA in the spliceosome. Genes & Dev., 6, 244-254.
- 104. Seraphin, B., Kretzner, L. and Rosbash, M. (1988) A U1 snRNA:pre-mRNA base pairing interaction is required early in yeast spliceosome assembly but does not uniquely define the 5′ cleavage site. EMBO J., 7, 2533-2538.
- 105. Seraphin, B. and Rosbash, M. (1990) Exon mutations uncouple 5′ splice site selection from U1 snRNA pairing. Cell, 63, 619-629.
- 106. Shaw, J. P., Kent, K., Bird, J., Fishback, J. and Froehler, B. (1991) Modified deoxyoligonucleotides stable to exonuclease degradation in serum. Nucleic Acids Res, 19, 747-750.
- 107. Shomron, N. and Ast, G. (2003) Boric acid reversibly inhibits the second step of pre-mRNA splicing. FEBS Left, 552, 219-224.
- 108. Shomron, N., Malca, H., Vig, I. and Ast, G. (2002) Reversible inhibition of the second step of splicing suggests a possible role of zinc in the second step of splicing. Nucleic Acids Res, 30, 4127-4137.
- 109. Siliciano, P. G. and Guthrie, C. (1988) 5′ splice site selection in yeast: genetic alterations in base-pairing with U1 reveal additional requirements. Genes Dev., 2, 1258-1267.
- 110. Singh, R., Banerjee, H. and Green, M. R. (2000) Differential recognition of the polypyrimidine-tract by the general splicing factor U2AF65 and the splicing repressor sex-lethal. Rna, 6, 901-911.
- 111. Singh, R., Valcarcel, J. and Green, M. R. (1995) Distinct binding specificities and functions of higher eukaryotic polypyrimidine tract-binding proteins. Science, 268, 1173-1176.
- 112. Skordis, L. A., Dunckley, M. G., Yue, B., Eperon, I. C. and Muntoni, F. (2003) Bifunctional antisense oligonucleotides provide a trans-acting splicing enhancer that stimulates SMN2 gene expression in patient fibroblasts. Proc Natl Acad Sci USA, 100, 4114-4119.
- 113. Smith, C. W. and Valcarcel, J. (2000) Alternative pre-mRNA splicing: the logic of combinatorial control. Trends Biochem Sci, 25, 381-388.
- 114. Solnick, D. (1985) Alternative splicing caused by RNA secondary structure. Cell, 43, 667-676.
- 115. Sontheimer, E. and Steitz, J. A. (1993) The U5 and U6 small nuclear RNAs as active site components of the spliceosome. Science, 262, 1989-1996.
- 116. Sosnowski, B. A., Belote, J. M. and McKeown, M. (1989) Sex-specific alternative splicing of RNA from the transformer gene results from sequence-dependent splice site blockage. Cell, 58, 449-459.
- 117. Soukup, G. A. and Breaker, R. R. (1999a) Engineering precision RNA molecular switches. Proc Natl Acad Sci USA, 96, 3584-3589.
- 118. Soukup, G. A. and Breaker, R. R. (1999b) Nucleic acid molecular switches. Trends Biotechnol, 17, 469-476.
- 119. Soukup, G. A., Emilsson, G. A. and Breaker, R. R. (2000) Altering molecular recognition of RNA aptamers by allosteric selection. J Mol Biol, 298, 623-632.
- 120. Staley, J. P. and Guthrie, C. (1998) Mechanical devices of the spliceosome: motors, clocks, springs, and things. Cell, 92, 315-326.
- 121. Steinman, H. A., Burstein, E., Lengner, C., Gosselin, J., Pihan, G., Duckett, C. S. and Jones, S. N. (2004) An alternative splice form of Mdm2 induces p53-independent cell growth and tumorigenesis. J Biol Chem, 279, 4877-4886.
- 122. Stevens, S. W., Ryan, D. E., Ge, H. Y., Moore, R. E., Young, M. K., Lee, T. D. and Abelson, J. (2002) Composition and functional characterization of the yeast spliceosomal penta-snRNP. Mol Cell, 9, 31-44.
- 123. Tanaka, K., Watakabe, A. and Shimura, Y. (1994) Polypurine sequences within a downstream exon function as a splicing factor. Mol. Cell. Biol., 14, 1347-1354.
- 124. Thanaraj, T. A., Stamm, S., Clark, F., Riethoven, J. J., Le Texier, V. and Muilu, J. (2004) ASD: the Alternative Splicing Database. Nucleic Acids Res, 32 Database issue, D64-69.
- 125. Tsuji, H., Nomiyama, K., Murai, K., Akagi, K. and Fujishima, M. (1992) Comparison of the properties of ribonucleases in human liver tissue and serum. Eur J Clin Chem Clin Biochem, 30, 339-341.
- 126. Umen, J. G. and Guthrie, C. (1995) The second catalytic step of pre-mRNA splicing. RNA, 1, 869-885.
- 127. Valcarcel, J., Gaur, R. K., Singh, R. and Green, M. R. (1996) Interaction of U2AF65 RS region with pre-mRNA branch point and promotion of base pairing with U2 snRNA. Science, 273, 1706-1709.
- 128. Valcarcel, J., Singh, R., Zamore, P. D. and Green, M. R. (1993) The protein Sex-lethal antagonizes the splicing factor U2AF to regulate alternative splicing of transformer pre-mRNA. Nature, 362, 171-175.
- 129. van Nues, R. W. and Beggs, J. D. (2001) Functional contacts with a range of splicing proteins suggest a central role for Brr2p in the dynamic control of the order of events in spliceosomes of Saccharomyces cerevisiae. Genetics, 157, 1451-1467.
- 130. Venables, J. P. (2004) Aberrant and alternative splicing in cancer. Cancer Res, 64, 7647-7654.
- 131. Villemaire, J., Dion, I., Elela, S. A. and Chabot, B. (2003) Reprogramming alternative pre-messenger RNA splicing through the use of protein-binding antisense oligonucleotides. J Biol Chem, 278, 50031-50039.
- 132. Vortler, L. C. and Eckstein, F. (2000) Phosphorothioate modification of RNA for stereochemical and interference analyses. Methods Enzymol, 317, 74-91.
- 133. Wallis, M. G., von Ahsen, U., Schroeder, R. and Famulok, M. (1995) A novel RNA motif for neomycin recognition. Chem Biol, 2, 543-552.
- 134. Wang, Y. and Rando, R. R. (1995) Specific binding of aminoglycoside antibiotics to RNA. Chem Biol, 2, 281-290.
- 135. Wassarman, D. A. and Steitz, J. A. (1992) Interactions of small nuclear RNA's with precursor messenger RNA during in vitro splicing. Science, 257, 1918-1925.
- 136. Watakabe, A., Tanaka, K. and Shimura, Y. (1993) The role of exon sequences in splice site selection. Genes Dev., 7, 407-418.
- 137. Will, C. L. and Luhrmann, R. (1997) Protein functions in pre-mRNA splicing. Curr Opin Cell Biol, 9, 320-328.
- 138. Wu, S., Romfo, C. M., Nilsen, T. W. and Green, M. R. (1999) Functional recognition of the 3′ splice site AG by the splicing factor U2AF35. Nature, 402, 832-835.
- 139. Xerri, L., Parc, P., Brousset, P., Schlaifer, D., Hassoun, J., Reed, J. C., Krajewski, S, and Birnbaum, D. (1996) Predominant expression of the long isoform of Bcl-x (Bcl-xL) in human lymphomas. Br J Haematol, 92, 900-906.
- 140. Zamore, P. D., Patton, J. G. and Green, M. R. (1992) Cloning and domain structure of the mammalian splicing factor U2AF. Nature, 355, 609-614.
- 141. Zhao, Y. and Baranger, A. M. (2003) Design of an adenosine analogue that selectively improves the affinity of a mutant U1A protein for RNA. J Am Chem Soc, 125, 2480-2488.
- 142. Zhuang, Y. and Weiner, A. M. (1986) A compensatory base change in U1 snRNA suppresses a 5′ splice site mutation. Cell, 46, 827-835.
- 143. Zillmann, M., Zapp, M. L. and Berget, S. M. (1988) Gel electrophoretic isolation of splicing complexes containing U1 small nuclear ribonucleoprotein particles. Mol Cell Biol, 8, 814-821.
- 144. Zimmermann, G. R., Jenison, R. D., Wick, C. L., Simorre, J. P. and Pardi, A. (1997) Interlocking structural motifs mediate molecular discrimination by a theophylline-binding RNA. Nat Struct Biol, 4, 644-649.
- 145. Zimmermann, G. R., Shields, T. P., Jenison, R. D., Wick, C. L. and Pardi, A. (1998) A semiconserved residue inhibits complex formation by stabilizing interactions in the free state of a theophylline-binding RNA. Biochemistry, 37, 9186-9192.
- 146. Zimmermann, G. R., Wick, C. L., Shields, T. P., Jenison, R. D. and Pardi, A. (2000) Molecular interactions and metal binding in the theophylline-binding core of an RNA aptamer. Rna, 6, 659-667.
- 147. Zorio, D. A. and Blumenthal, T. (1999) Both subunits of U2AF recognize the 3′ splice site in Caenorhabditis elegans. Nature, 402, 835-838.
- 148. Zuker, M. (1989) Computer prediction of RNA structure. Methods Enzymol, 180, 262-288.
Claims
1. An artificial riboswitch comprising a nucleic acid sequence set forth as SEQ ID NO: 6.
2. A nucleic acid comprising the complementary sequence of the nucleic acid sequence in claim 1.
3. A vector comprising the nucleic acid of claim 2.
4. A cell comprising the artificial riboswitch of claim 1 or the nucleic acid of claim 1 or 2.
5. A method of modulating RNA splicing comprising the steps of:
- a) providing a nucleic acid containing a ligand dependent riboswitch, wherein the riboswitch comprises an aptamer having affinity to the ligand; and
- b) contacting the ligand with the nucleic acid, wherein the interaction of the ligand with the aptamer modulates the splicing of the nucleic acid, wherein RNA splicing is modulated.
6. The method of claim 5 wherein the ligand is theophylline.
7. The method of claim 5 wherein the aptamer is a theophylline dependent aptamer.
8. (canceled)
9. (canceled)
10. A method of optimizing the BPS-to-3′ spice distance comprising the steps of:
- a) synthesizing a pre-mRNA containing a theophylline-dependent riboswitch selected from SEQ ID NOs: 1, 2, 3, 7, 8, 9, 11, 12, 13, 14 and 15;
- b) contacting the pre-mRNA with or without theophylline; and
- c) determining the level of pre-mRNA splicing in the presence of theophylline relative to the absence thereof, so as to optimize the BPS-to-3′ splice distance.
11. A method of improving an aptamer affinity to theophylline comprising the steps of: wherein the aptamer affinity to theophylline is improved.
- a) modifying the aptamer with a nucleic acid sequence of SEQ ID NO: 10;
- b) contacting the aptamer with theophylline; and
- c) measuring the binding affinity of theophylline to the aptamer,
12. The method of claim 11 wherein the aptamer is contacted with theophylline at a physiological Mg2+ concentration.
13. A method of identifying an aptamer with affinity to theophylline comprising the steps of:
- a) generating a test aptamer;
- b) contacting the test aptamer with theophylline; and
- c) measuring the binding affinity of the test aptamer to theophylline.
14. A method of identifying an agent that modulates pre-mRNA splicing comprising the steps of:
- a) providing a pre-mRNA containing a theophylline dependent riboswitch;
- b) contacting a test agent with the pre-mRNA; and
- c) determining the level of pre-mRNA splicing in the presence of the agent relative to the absence of the agent.
15. A method of developing a theophylline-dependent bifunctional molecule comprising the steps of:
- a) providing a test nucleic acid molecule, wherein the molecule comprises a theophylline aptamer and an antisense domain complementary to an exonic splicing enhancer sequence of a pre-mRNA;
- b) contacting the test molecule with the pre-mRNA;
- c) contacting the test molecule and the pre-mRNA with or without theophylline;
- d) measuring the level of pre-mRNA splicing in the presence or absence of theophylline; and
- e) determining if the test molecule in absence of theophylline modulates the pre-mRNA splicing and the addition of theophylline reduces the splicing caused by the test molecule.
16. A method of modulating RNA splicing in a subject comprising the steps of:
- a) introducing into a subject a pre-mRNA containing a theophylline-dependent riboswitch;
- b) contacting the subject with theophylline; and
- c) measuring the modulation of pre-mRNA splicing in the presence of theophylline.
17. A ligand-dependent riboswitch comprising a ligand dependent aptamer, wherein the aptamer is associated with the branchpoint sequence-3′ splice region in a pre-mRNA and the presence of the ligand modulates pre-mRNA splicing.
18. The riboswitch of claim 17 wherein the ligand dependent aptamer is a theophylline dependent aptamer.
19. The riboswitch of claim 18 wherein the theophylline aptamer has a nucleic acid sequence of SEQ ID NO: 10.
20. A ligand-dependent riboswitch comprising a theophylline dependent aptamer, wherein the theophylline dependent aptamer is associated with the branchpoint sequence-3′ splice region in a pre-mRNA in a nucleic acid sequence set forth as SEQ ID NO: 6, and the presence of theophylline modulates pre-mRNA splicing.
21. A ligand-dependent riboswitch comprising a ligand dependent aptamer, wherein the aptamer is inserted into the 3′ splice site in a pre-mRNA and the presence of the ligand modulates pre-mRNA splicing.
22. The riboswitch of claim 21 wherein the ligand dependent aptamer is a theophylline dependent aptamer.
23. A ligand-dependent riboswitch comprising a ligand dependent aptamer, wherein the aptamer is inserted into the 5′ splice site in a pre-mRNA and the presence of the ligand modulates pre-mRNA splicing.
24. The riboswitch of claim 23 wherein the ligand dependent aptamer is a theophylline dependent aptamer.
25. A ligand-dependent riboswitch comprising a ligand dependent aptamer, wherein the aptamer is inserted into the branchpoint sequence (BPS) in a pre-mRNA and the presence of the ligand modulates pre-mRNA splicing.
26. The riboswitch of claim 25 wherein the ligand dependent aptamer is a theophylline dependent aptamer.
Type: Application
Filed: Jun 1, 2006
Publication Date: Jul 2, 2009
Inventor: Rajesh K. Gaur (Glendora, CA)
Application Number: 11/446,527
International Classification: A61K 31/7088 (20060101); C07H 21/04 (20060101); C12N 15/74 (20060101); C12N 5/00 (20060101); C07H 21/00 (20060101); G01N 33/566 (20060101); A61P 43/00 (20060101);