Abstract: A process for instabilizing viral quasi-species-distributions under avoidance of resistance phenomena by replication of the nucleic acids of the viruses present in the quasi-species-distribution by of a defective replication system, a) whereby the defective replication system has a rate of misincorporation for nucleotides above the rate of misincorporation of the viral wild-type-replication system and, whereby the viruses are replicated by the replication system having the higher rate of misincorporation at least as effectively as it is done by the replication system of the wild-type virus, b) and/or negative influence of the replication of the consensus-sequence (nucleic acid sequence of the wild-type virus) in relation to other replicatable nucleic acids.

Abstract: The invention relates to polynucleotides for HSV detection and the use of these polypeptides in kits and methods for HSV detection.

Abstract: The invention relates to polynucleotides for HSV detection and the use of these polypeptides in kits and methods for HSV detection.

Abstract: Methods and products for the evaluation of HIV treatment are provided. The methods are based on evaluating molecular events at the HIV integrase resulting in altered therapeutic efficacy of tho investigated compounds. The methods rely on providing an integrase gene and evaluating either through integrase gene genotyping or phenotyping.

Abstract: Highly infectious rubella virus cDNA clones derived from infectious cDNA clone having a low specific infectivity and methods of obtaining highly infectious rubella virus cDNA clones. Togavirus expression vectors of improved stability for the expression of live, attenuated togavirus and a foreign gene, based on the nucleic acid sequence of an infectious rubella virus clone and contain a togavirus non-structural protein open reading frame; an expression element for expression of a foreign gene; a foreign gene or a multiple cloning site for insertion of a foreign gene; an expression element for the expression of the live, attenuated togavirus; and a togavirus structural protein open reading frame. The expression element is either a subgenomic promoter or an internal ribosome entry site (IRES). Administration of the vector as an immunization agents is useful for the induction of immuity against the togavirus, the foreign gene, or both.

Abstract: The inventive method of producing a eukaryotic viral vector comprises contacting a eukaryotic cell, which comprises a unique enzyme that nicks or cleaves a DNA molecule, with a recombinant phage vector, or contacting a eukaryotic cell, which does not comprise a unique enzyme that nicks or cleaves a DNA molecule, simultaneously or sequentially, in either order, with (i) a unique enzyme that nicks or cleaves a DNA molecule, and (ii) a recombinant phage vector. The recombinant phage vector comprises the DNA molecule comprising (a) a eukaryotic viral vector genome comprising a coding sequence, (b) a phage packaging site that is not contained within the eukaryotic viral vector genome, and (c) a promoter that is operably linked to the coding sequence. Alternatively, the DNA molecule is not present within the recombinant phage vector. The eukaryotic cell is contacted with the first DNA molecule and a recombinant phage vector.

Abstract: Isolated recombinant polynucleotides comprising elements which promote encapsidation into AAV particles, packaging cells comprising the recombinant polynucleotides, and methods for their use are provided in the present invention. These isolated recombinant polynucleotides comprise a non-AAV ITR encapsidation element (such as the P1 sequence located within the AAV S1 integration site of human chromosome 19) operably linked to one or more heterologous genes to be encapsidated. The constructs may be either integrated into a mammalian cell genome, maintained episomally, or provided transiently.

Abstract: The invention relates to the use of geminin and/or Orc3N molecules for inhibiting viral replication. Use of the molecules and related molecules in the prevention and treatment of viral infections, such as papillomavirus infections, polyomavirus infections, and herpesvirus infections, such as Epstein-Barr virus (EBV) infections, are described.

Abstract: The present invention describes the production of a nodavirus-based DNA vector that drives abundant expression of foreign genes in a wide variety of cell types. The DNA plasmid is initially transcribed by a host-cell RNA polymerase to produce primary transcripts from which a nodaviral RNA-dependent RNA polymerase (RNA replicase) is translated. These primary transcripts are then amplified by the RNA replicase in an autonomous, cytoplasmic RNA replication. Such a vector is a useful addition to the current arsenal of expression vectors, and well suited to laboratory-scale and larger-scale expression of transcripts and/or proteins in eukaryotic cells.

Abstract: A method for determining whether a compound inhibits or disrupts an interaction between a first polypeptide comprising a transcriptional adaptor motif (TRAM) and a second polypeptide comprising a TRAM-interaction motif. The first polypeptide and/or second polypeptide may be Mdm-2, p53, TBP, E2F, YY1, CBP/p300 or TF11B, or a viral polypeptide such as a human papillomavirus (HPV) E6 polypeptide from HPV strain (16) or (18).

Abstract: Compositions and methods for enhancing the effect of vaccines in animals, such as domestic, sport, or pet species, and humans are disclosed. More particularly, vaccine compositions comprising ribavirin and an antigen, preferably an antigen that has an epitope present in Hepatitis C virus (HCV), are disclosed for use in treating and preventing disease, preferably HCV infection.

Abstract: By isolating a so far unknown novel hepatitis virus and determining the gene sequence thereof, genes, polynucleotides, polypeptides, methods for isolating virus particles, virus particles, and antiviral antibodies, which can be used for diagnosis and treatment, as well as methods for detecting viruses are provided. Disclosed is a non-B, non-C, non-G hepatitis virus gene having a nucleotide sequence from which a sequence having a length of from about 3500 nucleotides to about 4000 nucleotides can be amplified by PCR utilizing an oligonucleotide having the nucleotide sequence shown in SEQ ID NO: 57 and an oligonucleotide having the nucleotide sequence shown in SEQ ID NO: 60 as primers, or PCR utilizing an oligonucleotide having the nucleotide sequence shown in SEQ ID NO: 57 and an oligonucleotide having the nucleotide sequence shown in SEQ ID NO: 61 as primers. Based on the nucleotide sequence of the gene, polypeptides etc. are provided.

Abstract: The role of certain cellular kinases active during Human Cytomegalovirus infection is disclosed. These cellular kinases are useful to detect HCMV infection, and can be used to screen for cellular kinase inhibitors. Cellular kinases inhibitors, which effectively downregulate these key cellular components, serve as effective therapeutics against HCMV infection.

Abstract: The present invention discloses a method for detecting the presence of an enterovirus in a clinical sample. The invention additionally discloses a method for typing an enterovirus in a clinical sample. Both methods employ a set of primer oligonucleotides for reverse transcription and amplification that hybridize to conserved regions of the enterovirus genome, and that provide amplicons that include significant portions of the VP1 region that are characteristic of the various serotypes. In the typing method, the invention further provides a database consisting of nucleotide sequences from prototypical enteroviral serotypes, which is used to type the clinical sample by comparing the sequence of its amplicon with each prototypical sequence in the database. The invention additionally provides mixtures of primer oligonucleotides, and a kit for use in conducting the typing method that includes a mixture of the primer oligonucleotides.

Abstract: The present invention provides experimentally-generated cold-adapted equine influenza viruses, and reassortant influenza A viruses comprising at least one genome segment of such an equine influenza virus, wherein the equine influenza virus genome segment confers at least one identifying phenotype of the cold-adapted equine influenza virus, such as cold-adaptation, temperature sensitivity, dominant interference, or attenuation. Such viruses are formulated into therapeutic compositions to protect animals from diseases caused by influenza A viruses, and in particular, to protect horses from disease caused by equine influenza virus. The present invention also includes methods to protect animals from diseases caused by influenza A virus utilizing the claimed therapeutic compositions.

Abstract: A retroviral delivery system capable of transducing a target site is described. The retroviral delivery system comprises a first nucleotide sequence coding for at least a part of an envelope protein; and one or more other nucleotide sequences derivable from a retrovirus that ensure transduction of the target site by the retroviral delivery system; wherein the first nucleotide sequence is heterologous with respect to at least one of the other nucleotide sequences; and wherein the first nucleotide sequence codes for at least a part of a rabies G protein or a mutant, variant, derivative or fragment thereof that is capable or recognising the target site.

Abstract: The invention provides HSV antigens that are useful for the prevention and treatment of HSV infection. Disclosed herein are epitopes confirmed to be recognized by T-cells derived from herpetic lesions. T-cells having specificity for antigens of the invention have demonstrated cytotoxic activity against cells loaded with virally-encoded peptide epitopes, and in many cases, against cells infected with HSV. The identification of immunogenic antigens responsible for T-cell specificity provides improved anti-viral therapeutic and prophylactic strategies. Compositions containing antigens or polynucleotides encoding antigens of the invention provide effectively targeted vaccines for prevention and treatment of HSV infection.

Abstract: A method of assaying potential inhibitors of EBNA-1 is disclosed. In one aspect, this invention comprises the steps of (a) obtaining an EBV-positive cell line and an EBV-negative cell line; (b) exposing the cell lines to a test compound, and (c) observing the effect of the compound on induction of apoptosis in the cell lines, wherein significant apoptosis in the EBV-positive cell line and lack of significant apoptosis in the EBV-negative cell line indicates a compound that specifically inhibits EBNA-1.

Abstract: Double stranded DNAs, expression vectors and methods for their use are provided in which the intracellular expression of the double stranded DNAs is used to alter the phenotype of a target cell so that the function of a target nucleic acid that includes a nucleotide sequence encoding a motif of interest can be determined using a combinatorial ribozyme library. The members of the library are catalytic RNAs that disrupt the expression of the transcription product of the target nucleic acid. Disruption of transcription product expression results in an altered cell phenotype which is used to determine the function of the target nucleic acid. The specific phenotype or response may be associated with normal cellular processes, or it may contribute to the generation of pathogenesis involved in disease development. The compositions find use in high-throughput screens to assign gene functions.

Abstract: A papillomavirus polyprotein construct comprises at least two amino acid sequences fused directly or indirectly together, each of the sequences being the sequence of an early ORF protein of papillomavirus or an immunogenic variant or fragment thereof, and at least one of said sequences being other than the E6 or E7 protein sequence or an immunogenic variant or fragment thereof. Nucleic acid molecules encoding the polyprotein construct, prophylactic or therapeutic compositions comprising the polyprotein construct or the nucleic acid molecule, and methods for eliciting an immune response against papillomavirus in a host animal are also provided.

Abstract: The present invention is directed to a novel strain of feline immunodeficiency virus, designated herein as FIV-141, and to attenuated forms of the virus produced by mutating specific regions of the viral genome. The virus and mutated forms of the virus may be used to induce the production of antibodies to FIV-141, and in vaccines designed to protect cats from FIV.

Abstract: The present invention provides experimentally-generated cold-adapted equine influenza viruses, and reassortant influenza A viruses comprising at least one genome segment of such an equine influenza virus, wherein the equine influenza virus genome segment confers at least one identifying phenotype of the cold-adapted equine influenza virus, such as cold-adaptation, temperature sensitivity, dominant interference, or attenuation. Such viruses are formulated into therapeutic compositions to protect animals from diseases caused by influenza A viruses, and in particular, to protect horses from disease caused by equine influenza virus. The present invention also includes methods to protect animals from diseases caused by influenza A virus utilizing the claimed therapeutic compositions.

Abstract: The present invention is directed toward vector stage replication-defective flaviviruses that are replication-defective in mosquito vectors that transmit them to humans. Such mutant flaviviruses may be useful as vaccines. The replication-defective flaviviruses of the present invention demonstrate a limited ability to replicate in the vector organisms that transmit flaviviruses from one host to another. More specifically, the present invention is directed toward the construction and propagation of flaviviruses that possess 3′-noncoding regions altered in such a way as to prevent or severely limit viral reproduction in a vector organism. In one embodiment of the present invention, a replication-defective dengue virus that is replication-defective in arthropods is contemplated for use as a vaccine. In another embodiment, a replication-defective dengue virus that is replication-defective in mosquitoes is contemplated for use as a vaccine.

Abstract: A method of quantifying an HIV protease inhibitor in a biological sample includes combining HIV protease, a spectroscopic substrate for HIV protease, and a biological sample suspected of containing an HIV protease inhibitor to form an assay mixture. A spectroscopic property of the assay mixture may be measured and related to the concentration of the HIV protease inhibitor in the biological sample.

Abstract: The present invention relates to compositions and methods for enhancing the effect of vaccines in animals, such as domestic, sport, or pet species, and humans. More particularly, the use of Ribavirin as an adjuvant to a vaccine protocol and compositions having Ribavirin and an antigen are described.

Abstract: The present invention provides chimeric nucleic acids, preferably contained on an expression vector, that encode at least site III of a lyssavirus glycoprotein.

Abstract: Methods for treating cell proliferative disorders by administering virus to proliferating cells having an activated Ras-pathway are disclosed. The virus is administered so that it ultimately directly contacts proliferating cells having an activated Ras-pathway. Proliferative disorders include but are not limited to neoplasms. The virus is selected from modified adenovirus, modified HSV, modified vaccinia virus and modified parapoxvirus orf virus. Also disclosed are methods for treating cell proliferative disorders by further administering a immunosuppressive agent.

Abstract: The present invention relates to a method for analysing the phenotypic characteristics shown by certain virus strains, particularly human immunodeficiency viruses, involving the construction of a recombinant virus obtained by homologous recombination.

Abstract: The present invention provides compositions comprising recombinant avian IFN-&ggr; polypeptides and methods using said recombinant avian IFN-&ggr; polypeptides and compositions to enhance the immune responses of birds, and to enhance growth and/or prevent weight loss in birds. The present invention is particularly useful in the prophylactic and therapeutic treatment of birds against coccidiosis and the causative agent thereof.

Abstract: Viral material, in the isolated or purified state, in which the genome comprises a nucleotide sequence chosen from the group including sequences SEQ ID NO:46, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53 and SEQ ID NO:56, their complementary sequences and their equivalent sequences, in particular nucleotide sequences displaying, for any succession of 100 contiguous monomers, at least 50% and preferably at least 70% homology with the said sequences SEQ ID NO:46, SEQ ID NO:51, SEQ ID NO:52, SEQ ID NO:53 and SEQ ID NO:56, respectively, and their complementary sequences.

Abstract: An isolated nucleic acid, a recombinant protein encoded thereby and uses thereof. The isolated nucleic acid including (a) a polynucleotide at least 60% identical to SEQ ID NOs:1, 3, 5 or portions thereof as determined using the Bestfit procedure of the DNA sequence analysis software package developed by the Genetic Computer Group (GCG) at the university of Wisconsin (gap creation penalty—50, gap extension penalty—3); (b) a polynucleotide encoding a polypeptide being at least 60% homologous with SEQ ID NOs:2, 4, 6 or portions thereof as determined using the Bestfit procedure of the DNA sequence analysis software package developed by the Genetic Computer Group (GCG) at the university of Wisconsin (gap creation penalty—50, gap extension penalty—3); or (c) a polynucleotide hybridizable with SEQ ID NOs:1, 3, 5 or portions thereof at 68° C. in 6×SSC, 1% SDS, 5× Denharts, 10% dextran sulfate, 100 &mgr;g/ml salmon sperm DNA, and 32p labeled probe and wash at 68° C.

Abstract: The present invention relates to methods for detecting viral pathogens, particularly human herpes virus S (HHV6), preferably using polymerase chain reaction (PCR) techniques. Primer sequences useful in these methods are also described. In a first aspect, the invention provides an isolated nucleic add molecule complementary to and specific for human herpes virus 6 (HHV6) DNA including a sequence selected from 5′CTTCTGTTTTAAGTCGTACAGGAGT (SEQ ID NO: 1), 5′ACAATTGCCATTTCGGGGAAGTAC (SEQ ID NO: 2), and functionally equivalent sequences. A method for detecting HHV6 in a sample suspected of containing HHV6 is also provided.

Abstract: Nucleic acid sequences, oligonucleotides and a method for detection of SRSV, in particular, a virus which belongs to Genotype II (GII), in clinical examinations, public health examinations, food evaluations and food poisoning examinations are provided.

Abstract: The invention provides methods and compositions for inhibiting CMV infection and dissemination in an animal, as well as in vitro and in vivo assay systems for identifying such compositions.

Abstract: Polypeptide sequences for PERV-A receptors found on primate cells, including human, and the polynucleotides encoding those polypeptide receptor sequences are disclosed along with processes for using the PERV-A receptors in both in vitro and in vivo screening assays and models for agents that block viral infection. Also disclosed are processes for detecting the presence of PERV receptors in a tissue, blocking virus binding to receptors and protection of an animal, such as a human patient, from PERV infection. Antibodies that react with PERV receptors, vectors comprising the polynucleotides encoding such receptors and recombinant cells that express these receptors are also described.

Abstract: This invention relates to a novel protein having a lecithin-cholesterol acyltransferase-like activity, etc. or its salt, a precursor protein of the protein or its salt, a partial peptide of the protein or its salt; a DNA coding for the protein; a recombinant vector; a transformant; a method for producing the protein, a pharmaceutical composition comprising the protein, the partial peptide or its salt; and an antibody to the protein or the partial peptide. The protein, the partial peptide or its salt, and the DNA are useful as an agent for treating or preventing arteriosclerosis, atherosclerosis, hyperlipidemia, hypercalorism, obesity or hypertriglyceridemia. The antibody can be used in assay of the protein, the partial peptide or its salt. The protein, the partial peptide or its salt is useful as a reagent for the screening for candidate medical compounds.

Abstract: The present invention provides novel compositions comprising Epstein-Barr virus-specific oligonucleotides that are useful as primers to amplify particular regions of the genome during enzymatic nucleic acid amplification. The invention also provides a rapid, sensitive and specific method for the detection and quantitation of the virus which may be present in a clinical specimen, using the virus-specific primers and enzymatic nucleic acid amplification; hybridization of amplified target sequences, if present, with one or more Epstein-Barr virus-specific oligonucleotide probes which are labeled with a detectable moiety; and detection of the detectable moiety of labeled oligonucleotide probe hybridized to amplified target sequences of Epstein-Barr virus DNA.

Abstract: A chimeric, carboxy-terminal truncated hepatitis B virus nucleocapsid protein (HBc) is disclosed that contains an immunogen for inducing the production of antibodies to the influenza M2 protein. An immunogenic influenza epitope is preferably expressed at or near the N-terminus or in the HBc immunogenic loop sequence. The chimer preferably contains an influenza-specific T cell epitope and is preferably engineered for both enhanced stability of self-assembled particles and enhanced yield of those chimeric particles. Methods of making and using the chimers are also disclosed.

Abstract: The present invention provides methods directed to detecting antibodies that specifically bind to a varicella zoster polypeptide, detecting the presence of a varicella zoster virus in an animal, diagnosing a disease caused by varicella zoster virus, and detecting a varicella zoster virus having a single nucleotide polymorphism in ORF68. The present invention also provides a vaccine composition, a method for producing a modified attenuated varicella zoster virus, isolated polynucleotides, and isolated polypeptides, and viruses.

Abstract: Abstract The invention relates to the field of molecular genetics and medicine. In particular the present invention relates to the field of functional genomics. The present invention provides the methods and means for the identification of nucleic acids and the polypeptides encoded by these nucleic acids that have a function related to the E2F pathway, which were isolated in a high-throughput screening assay using the E2F transcription factor activity as a read-out. The identified compounds are suitable drug-targets to treat human diseases.

Abstract: This invention relates to an expression vector wherein said expression vector comprises a polynucleotide promoter sequence, a polynucleotide encoding a signal sequence, a polynucleotide encoding an antigen protein or peptide, a polynucleotide encoding a cell binding element, and a polynucleotide polyadenylation sequence all operatively linked. More particularly, it relates to the method of eliciting an immune response directed against an antigen in a mammal comprising the steps of introducing the expression vector into a cell, expressing the vector to produce an antigen under conditions wherein the antigen is secreted from the cell, endocytosing the secreted antigen into the cell, processing the antigen, and presenting fragments to a receptor to elicit a T-cell response. In addition, this invention relates to a vaccine and a method of use. The invention also relates to the method of identifying MHC-II restricted epitopes.

Abstract: The present invention provides a method for replicating virus to high titer in cultured mammalian cells by infecting the mammalian cells with the high titer virus strain to obtain infected cells, specifically, attenuated dengue virus strains of serotype 1, 2, 3, and 4. The resulting replicated virus is suitable for use in vaccines and vaccination methods which are also provided by the invention.

Abstract: The present invention relates to peptides derived from the superantigen (SAg) ENV protein of the human endogenous retrovirus HERV-K18, and to the use of the peptides in obtaining antibodies which inhibit the superantigen activity of HERV-K18 ENV. The invention also relates to vaccine compositions for treating and preventing disorders associated with the ENV gene product of HERV-K18, for example autoimmune diseases such as insulin-dependent diabetes mellitus (IDDM). A preferred peptide consists of a portion of an N- or C-terminal segment of the HERV-K18.1 ENV protein, as illustrated in FIG. 1A, said N-terminal segment extending from amino acids 22 to 62 of HERV-K18.1 ENV, and said C-terminal segment extending from amino acids 110 to 153 of HERV-K18.1 ENV, wherein the peptide has a length of 6 to 40 amino acids and is capable of giving rise to antibodies which inhibit superantigen activity associated with HERV-K18 envelope proteins.

Abstract: Retroviral strains of the non-M, non-O HIV-1 group, in particular a strain designated YBF30, its fragments and also its uses as a diagnostic reagent and as an immunogenic agent.

Abstract: The present invention provides a substance which inhibits the binding between E2/NS1 protein of hepatitis C virus and a cell infectious with hepatitis C virus, a cell expressing CD81, or CD81. The present invention can provide a novel medicament which has an anti-viral effects such as an inhibitory action against HCV infection.

Abstract: What is described is a recombinant poxvirus, such as vaccinia virus, fowlpox virus and canarypox virus, containing foreign DNA from herpesvirus. In one embodiment, the foreign DNA is expressed in a host by the production of a herpesvirus glycoprotein. In another embodiment, the foreign DNA is expressed in a host by the production of at least two, particularly two or three, herpesvirus glycoproteins. What is also described is a vaccine containing the recombinant poxvirus for inducing an immunological response in a host animal inoculated with the vaccine. By the present invention, the barrier of maternal immunity in a newborn offspring can be overcome or avoided.

Abstract: Disclosed is a measles virus mutant gene coding for a measles virus mutant H protein antigen, wherein said gene coding for a measles virus mutant H protein antigen is at least one member selected from the group consisting of the following genes (a) to (c): (a) a gene coding for an amino acid sequence of SEQ ID NO: 10; (b) a gene coding for an amino acid sequence of SEQ ID NO: 3 or SEQ ID NO: 11; and (c) a gene coding for an amino acid sequence of SEQ ID NO: 4 or SEQ ID NO: 12. By the use of the measles virus mutant gene of the present invention, it has become possible to provide efficiently and economically a gene vaccine which is adapted for an epidemic strain of measles virus, and a diagnostic reagent capable of accurately detecting infections with an epidemic strain of measles virus.

Abstract: The nucleic acid and the corresponding amino acid sequence for the attachment glycoprotein of Avian Metapneumovirus (Colorado) Type C strain is provided. The nucleotide sequence is 1,321 base pairs with only one substantial open reading frame encoding a glycoprotein of about 435 amino acids with a predicted Mr of about 48,483 and a net charge of about 23.15 at neutral pH.

Abstract: A unique HCV RNA molecule is provided having an enhanced efficiency of establishing cell culture replication. Novel adaptive mutations have been identified within the HCV non-structural region that improves the efficiency of establishing persistently replicating HCV RNA in cell culture. This self-replicating polynucleotide molecule contains, contrary to all previous reports, a 5′-NTR that can be either an A as an alternative to the G already disclosed and therefore provides an alternative to existing systems comprising a self-replicating HCV RNA molecule. The G->A mutation gives rise to HCV RNA molecules that, in conjunction with mutations in the HCV non-structural region, such as the G(2042)C/R mutations, possess greater efficiency of transduction and/or replication. These RNA molecules when transfected in a cell line are useful for evaluating potential inhibitors of HCV replication.

Abstract: The present invention relates to methods of preparing a DNA comprising steps, wherein (a) a DNA comprising a full length copy of the genomic RNA (gRNA) or an RNA virus; or (b) a DNA comprising one or several fragments of a gRNA of an RNA virus, which fragments code for an RNA dependent RNA polymerase and at least one structural or non-structural protein; or (c) a DNA having a homology of at least 60% to the sequences of (a) or (b); is cloned into a bacterial artificial chromosome (BAC). Additionally, DNAs are provided, which comprise sequences derived from the genomic RNA (gRNA) of a coronavirus which sequences have a homology of at least 60% to the natural sequence of the virus and code for an RNA dependent RNA polymerase and at least one structural or no-structural protein, wherein a fragment of said DNA is capable of being transcribed into RNA which RNA can he assembled to a virion.