Abstract: Systems and methods spectrally and radiometrically calibrate an optical spectrum detected with a color-image sensor of an optical spectrometer. When the color-image sensor includes a Bayer filter, the red-peaked, green-peaked, and blue-peaked spectral responses of the color filters forming the Bayer filter may be used to identify unique spectral signatures in the red, green, and blue color channels. These spectral signatures may be used to associate calibration wavelengths to the pixel locations of the color-image sensor where the spectral signatures are observed. A fitted model may then be used to associate a wavelength to each pixel location of the color-image sensor. These systems and methods account for translational shifts of the optical spectrum on the color-image sensor induced by optical image stabilization, and thus may aid optical spectrometry utilizing a digital camera in a smartphone or tablet computer.

Abstract: An interferometry system including a coherent light source operable to generate a beam of coherent light is provided. Separate waveguide pathways are optically associated between the coherent light source a photodetector. A transceiving segment can also be optically associated with each waveguide pathway at a location between the coherent light source and the photodetector. Each transceiving segment can be configured to emit an emitted beam of coherent light and positioned to receive a received portion of an emitted beam of coherent light emitted from a transceiving segment optically associated with a different waveguide pathway. The received portion of the emitted beam of coherent light can be combined with coherent light from the waveguide pathway receiving the received portion of the emitted beam of coherent light to form an optical interference signal. Accordingly, each waveguide pathway can be further configured to direct a separate optical interference signal toward a respective photodetector.

Abstract: Provided is a database management apparatus, having a processor, a memory, and a storage device, whereby a database which is stored in the storage device is managed, the database management apparatus further comprising: a query acceptance unit which accepts a query to the database; a query execution plan generating unit which generates a query execution plan which includes a database operation which is necessary for executing the accepted query; and a query execution unit which, in executing the accepted query on the basis of the generated query execution plan, dynamically generates a task for executing the database operation, and executes the dynamically generated task. The query execution unit acquires a resource usage state, and, when executing the next database operation, generates a new task on the basis of the resource usage state, and executes the new task in parallel with the task.

Abstract: A genetically modified vertebrate is provided that has an enhanced sense due to an over representation of a predetermined odorant receptor. The vertebrate is genetically modified by introduction of DNA that comprises at least four sequential repeats of a sequence whose primary structure is at least 90% homologous with ACATAACTTTTTAATGAGTCT (SEQ ID NO: 1). The DNA causes a nearby odorant receptor coding sequence to be over represented in a singular gene choice fashion relative to a corresponding vertebrate that lacks the DNA.

Abstract: Disclosed herein are nanostructured conducting films. The nanostructured conducting films can comprise a nanocrystal phase comprising a plurality of nanocrystals comprising a first metal chalcogenide, the nanocrystal phase being dispersed within a continuous phase comprising a second metal chalcogenide, and wherein the nanocrystal phase, the continuous phase, or a combination thereof further comprises a dopant. In some examples, the first metal chalcogenide and/or the second metal chalcogenide comprise a metal oxide. Also disclosed herein are transparent conducting oxide films having heterogeneous dopant distributions, the films having high mobility, good conductivity, or combinations thereof. Also described herein are methods of making and methods of use of the nanostructured conducing films described herein.

Abstract: The present invention discloses a grilling oven comprising an oven body and a grilling chamber encircled by the oven body; an electrical heating device, a grilling grid and a fat catching plate are provided in the grilling chamber; the electrical heating device is located at the top of the grilling chamber; the fat catching plate is located at the bottom of the grilling chamber; the grilling grid is located between the electrical heating device and the fat catching plate; the grilling grid and the fat catching plate both are horizontally placed. During a grilling process, the fat of grilled meat is prevented from dripping downwards onto a heat source of the grilling oven, so that no cancerogenic substance is produced thereby or condensed on the grilled meat, thus making the grilling process more environmental and healthy, and the grilled meat safe to eat.

Abstract: The present invention provides polynucleotide aptamers that selectively bind to and inhibit polymerization of sickle hemoglobin (HbS), pharmaceutical compositions comprising the same, methods of use for diagnostics and treatment of sickle cell disease, methods of use as capture reagents, and methods of rational drug design.

Abstract: The disclosure provides seed, tissue cultures, essential oil extracts, and plants of catnip hybrid ‘CR3’, as well as methods for producing a catnip plants by crossing ‘CR3’ plants with themselves or with another catnip plant, such as a plant of another genotype, variety, or cultivar. The disclosure further provides seed, tissue cultures, essential oil extracts, and plants produced by such crossing. Methods of using the plants and extracts as insect repellents and in pet toys, are also provided.

Abstract: The present invention provides a memory device in which lower electrodes, a buffer layer, a seed layer, a magnetic tunnel junction, a capping layer, synthetic exchange diamagnetic layers, and an upper electrode are formed on a substrate in a laminated manner. According to the present invention, the lower electrodes and the seed layer are formed of a polycrystalline conductive material, and the perpendicular magnetic anisotropy of the magnetic tunnel junction is maintained upon heat treatment at a high temperature of 400° C. or more.

Abstract: A liquid chromatograph comprising a column coupled to a microring resonator array and methods of using the same are disclosed. The microring resonator array measures the bulk refractive index of the mobile phase and any sample injected onto and separated in the column. While carrying out the methods, the composition of a mobile phase passing through the chromatography column may remain substantially constant (isocratic elution) or it may vary (gradient elution). One or more microrings may comprise a covering to act as a thermal control. In addition, the sensor surface may be modified with some type of capture agent that can interact with one or more components in the sample.

Abstract: A multilayered cathode for a lithium sulfur battery comprising at least one current collector working electrode having a surface comprising a carbon containing layer, two or more sulfur containing layers wherein at least one of the sulfur layers is located in juxtaposition to and in communication with the carbon containing layer, and at least one outermost layer comprising a positively charged polymer for forming interconnected layers of the sulfur containing layer, the carbon containing layer, and the polymer. Preferably, the cathode has layers that are alternatively arranged of two or more different sulfur containing layers. A lithium sulfur battery is provided and a method of making a multilayered cathode for a lithium sulfur battery is disclosed.

Abstract: Provided are electronic devices having a two-dimensional (2D) material layer. The electronic device includes an electrode layer that directly contacts an edge of the 2D material layer. The electrode layer may include a conductive material having a high work function or may have a structure in which an electrode layer includes a conductive material having a high work function and an electrode layer includes a conductive material having a low work function.

Abstract: A hydrothermal method of preparing uniform, monodisperse ceramic lanthanum hydroxyl carbonate (LaCO3OH) having cherry-blossom-like nanogears and/or nanocubes is described. The method produced a hexagonal crystal with a crystal lattice in which at least on lanthanum ion is substituted with calcium ion. The ceramic nanoparticles produced by the method are good catalyst for the reduction of nitrogen oxides with a hydrocarbon. A method of reducing exhaust gases is described.

Abstract: A superhydrophobic and self-cleaning surface including a substrate and a superhydrophobic layer. The superhydrophobic layer having a reacted form of octadecyltrichlorosilane. The octadecyltrichlorosilane is disposed on and crosslinked to a surface of the substrate via surface hydroxyl groups. The surface exhibits a rms roughness of 40 nm to 60 nm, a water contact angle of 155° to 180°, and a contact angle hysteresis of less than 15°. A method of preparing the substrate with a superhydrophobic and self-cleaning surface including treating a substrate with a plasma treatment, contacting the substrate with water or an alcohol to form an hydroxylated substrate, contacting the hydroxylated substrate with a solution of octadecyltrichlorosilane in an alkane solvent at a concentration in the range of 0.05 M to 0.3 M, and drying the solution on to the substrate under ambient air to form the superhydrophobic and self-cleaning surface on the substrate.

Abstract: A method detecting a floor obstacle using a laser range finder according to the present invention includes the following steps: (a) generating normal floor characteristic data with regard to a flat normal driving surface having no floor obstacle; (b) registering the normal floor characteristic data on a pre-registered one-class classification method; (c) obtaining sensing value of the laser range finder according to the driving of a mobile robot; (d) generating sensing value-floor characteristic data with respect to the sensing value; and (e) determining whether the sensing value indicates a normal driving surface or a floor obstacle by applying the sensing value-floor characteristic data to the one-class classification method. Therefore, an obstacle including a relatively small floor obstacle existing on the driving path of a mobile robot can be detected more effectively using a laser range finder, thereby providing more stably an area where the mobile robot can travel.

Abstract: Disclosed herein, in certain embodiments, are methods and kits for diagnosing a subject as having hepatocellular carcinoma (HCC) or lung cancer. In some instances, also described herein are methods of determining the prognosis of the subject having HCC or lung cancer. In additional instances, described herein are methods of determining the specific staging of HCC or lung cancer in a subject.

Abstract: The present invention provides bicyclic heteroaryl inhibitors of BMP signaling and compositions and methods for inhibiting BMP signaling. Exemplary compounds include those of Formula I: These compounds and compositions may be used to modulate cell growth, differentiation, proliferation, and apoptosis, and thus may be useful for treating diseases or conditions associated with BMP signaling, including inflammation, cardiovascular disease, hematological disease, cancer, and bone disorders, as well as for modulating cellular differentiation and/or proliferation. These compounds and compositions may also be used to reduce circulating levels of ApoB-100 or LDL and treat or prevent acquired or congenital hypercholesterolemia or hyperlipoproteinemia; diseases, disorders, or syndromes associated with defects in lipid absorption or metabolism; or diseases, disorders, or syndromes caused by hyperlipidemia.

Abstract: The present invention provides methods for improving microbial tolerance to alpha olefin compounds, host cells having increased tolerance to such compounds, and method of using the host cells to produce alpha olefin compounds.

Abstract: A method for treating autoimmune diseases or a disease associated with chronic inflammation can include administering to a subject in need thereof a therapeutically effective amount of a pharmaceutical composition comprising an Arid5a inhibitor and a pharmaceutically acceptable carrier. The Arid5a inhibitor can have the formula or a pharmaceutically acceptable salt thereof. The disease associate with chronic inflammation can be multiple sclerosis. A screening method can include identifying candidate Arid5a inhibitors through in silico predicted binding to Arid5a target domains and confirming Arid5a inhibition through in vitro binding assays.

Abstract: Disclosed is a data driven error model that is based on error patterns found at the morphemes level. A model is generated by error-correct patterns generator and is stored in an error-correct patterns database (ECPD). The ECPD is used in conjunction with a correction candidates' generator (CCG) to provide a list of correction candidates for a given error word. The error model can learn the types and forms of the language patterns from an annotated corpus. The error model can be used to analyze the type of error and can provide candidates corrections for wide ranges of Arabic spelling errors.